#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ZNF721	170960	genome.wustl.edu	37	4	420088	420088	+	IGR	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr4:420088G>A	ENST00000506646.1	-	0	935				ABCA11P_ENST00000451020.2_RNA			Q8TF20	ZN721_HUMAN	zinc finger protein 721						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						TGAACAGCTCGTCTAGAAGCA	0.527																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20			4.37:g.420088G>A			Q69YG7	RNA	SNP	-	NULL	ENST00000506646.1	37	NULL		4																																																																																			ABCA11P	-	-	ENSG00000251595		0.527	ZNF721-003	PUTATIVE	basic	protein_coding	ABCA11P	HGNC	protein_coding	OTTHUMT00000357869.2	46	0.00	0	G	NM_133474		420088	420088	-1	no_errors	ENST00000451020	ensembl	human	known	69_37n	rna	37	15.91	7	SNP	1.000	A
ABCF2	10061	genome.wustl.edu	37	7	150915925	150915925	+	Missense_Mutation	SNP	T	T	C	rs535093235		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:150915925T>C	ENST00000287844.2	-	9	1161	c.1052A>G	c.(1051-1053)aAg>aGg	p.K351R	ABCF2_ENST00000473874.1_5'UTR|ABCF2_ENST00000222388.2_Missense_Mutation_p.K351R	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	351					transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCGGGCCAGCTTGGCACTGCC	0.517													T|||	1	0.000199681	0.0	0.0	5008	,	,		16615	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													109.0	101.0	104.0					7																	150915925		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.1052A>G	7.37:g.150915925T>C	ENSP00000287844:p.Lys351Arg		O60864|Q75MJ0|Q75MJ1|Q96TE8	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.K351R	ENST00000287844.2	37	c.1052	CCDS5923.1	7	.	.	.	.	.	.	.	.	.	.	T	20.9	4.073279	0.76415	.	.	ENSG00000033050	ENST00000222388;ENST00000287844	D;D	0.92299	-2.95;-3.01	5.17	5.17	0.71159	.	0.207594	0.50627	D	0.000111	D	0.94364	0.8188	M	0.86420	2.815	0.58432	D	0.999998	B;B	0.25105	0.118;0.118	B;B	0.40038	0.317;0.317	D	0.93823	0.7120	10	0.72032	D	0.01	-22.3369	12.8395	0.57793	0.0:0.0:0.0:1.0	.	351;351	Q9UG63;Q75MJ1	ABCF2_HUMAN;.	R	351	ENSP00000222388:K351R;ENSP00000287844:K351R	ENSP00000222388:K351R	K	-	2	0	ABCF2	150546858	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.428000	0.80296	1.960000	0.56953	0.456000	0.33151	AAG	ABCF2	-	NULL	ENSG00000033050		0.517	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF2	HGNC	protein_coding	OTTHUMT00000336086.1	47	0.00	0	T	NM_005692		150915925	150915925	-1	no_errors	ENST00000222388	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	1.000	C
ACSM5	54988	genome.wustl.edu	37	16	20448431	20448431	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr16:20448431C>T	ENST00000331849.4	+	11	1513	c.1366C>T	c.(1366-1368)Cga>Tga	p.R456*		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	456					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.R456R(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						CACAGGGGACCGAGCTCGCAT	0.488																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											167.0	155.0	159.0					16																	20448431		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1366C>T	16.37:g.20448431C>T	ENSP00000327916:p.Arg456*		Q96AV1|Q96CX8|Q9NWV3	Nonsense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.R456*	ENST00000331849.4	37	c.1366	CCDS10585.1	16	.	.	.	.	.	.	.	.	.	.	C	37	6.534719	0.97646	.	.	ENSG00000183549	ENST00000331849	.	.	.	5.15	-0.734	0.11140	.	0.274583	0.25509	N	0.030197	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.7894	10.4015	0.44233	0.6407:0.2889:0.0:0.0703	.	.	.	.	X	456	.	ENSP00000327916:R456X	R	+	1	2	ACSM5	20355932	0.994000	0.37717	0.967000	0.41034	0.957000	0.61999	0.242000	0.18087	-0.022000	0.13986	0.650000	0.86243	CGA	ACSM5	-	pfam_AMP-dep_Synth/Lig	ENSG00000183549		0.488	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM5	HGNC	protein_coding	OTTHUMT00000254413.1	87	0.00	0	C	NM_017888		20448431	20448431	+1	no_errors	ENST00000331849	ensembl	human	known	69_37n	nonsense	59	10.61	7	SNP	0.981	T
ADAM8	101	genome.wustl.edu	37	10	135084508	135084508	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr10:135084508C>T	ENST00000445355.3	-	14	1491	c.1441G>A	c.(1441-1443)Ggc>Agc	p.G481S	ADAM8_ENST00000415217.3_Missense_Mutation_p.G481S|ADAM8_ENST00000559180.1_5'Flank|ADAM8_ENST00000485491.2_Missense_Mutation_p.G442S	NM_001109.4	NP_001100.3	P78325	ADAM8_HUMAN	ADAM metallopeptidase domain 8	481	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				activation of MAPK activity involved in innate immune response (GO:0035419)|angiogenesis (GO:0001525)|cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|leukocyte migration involved in inflammatory response (GO:0002523)|lymphocyte chemotaxis (GO:0048247)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell adhesion (GO:0045785)|positive regulation of eosinophil migration (GO:2000418)|positive regulation of fibronectin-dependent thymocyte migration (GO:2000415)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of neutrophil extravasation (GO:2000391)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein processing (GO:0010954)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000309)|regulation of cell-cell adhesion (GO:0022407)|single organismal cell-cell adhesion (GO:0016337)	alpha9-beta1 integrin-ADAM8 complex (GO:0071133)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dense core granule membrane (GO:0032127)|integral component of plasma membrane (GO:0005887)|phagolysosome (GO:0032010)|plasma membrane (GO:0005886)|podosome (GO:0002102)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein self-association (GO:0043621)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)	17		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;7.72e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.23e-06)|Epithelial(32;1.02e-05)		GGGTGCCGGCCGTCACAGAAC	0.652																																						dbGAP											0													48.0	54.0	52.0					10																	135084508		2202	4299	6501	-	-	-	SO:0001583	missense	0			D26579	CCDS31319.2, CCDS58102.1, CCDS58103.1	10q26.3	2014-03-20	2005-08-18		ENSG00000151651	ENSG00000151651		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	215	protein-coding gene	gene with protein product		602267	"""a disintegrin and metalloproteinase domain 8"""			9126482	Standard	NM_001109		Approved	CD156, MS2, CD156a	uc021qbe.1	P78325	OTTHUMG00000019309	ENST00000445355.3:c.1441G>A	10.37:g.135084508C>T	ENSP00000453302:p.Gly481Ser		B4DVM6|H0YL36|H0YLR0|H0YN39	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,pfam_ADAM_Cys-rich,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,prints_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.G481S	ENST00000445355.3	37	c.1441	CCDS31319.2	10																																																																																			ADAM8	-	pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,prints_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin	ENSG00000151651		0.652	ADAM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM8	HGNC	protein_coding	OTTHUMT00000051118.4	29	0.00	0	C	NM_001109		135084508	135084508	-1	no_errors	ENST00000445355	ensembl	human	known	69_37n	missense	13	23.53	4	SNP	1.000	T
ADCY5	111	genome.wustl.edu	37	3	123022988	123022988	+	Silent	SNP	G	G	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr3:123022988G>T	ENST00000462833.1	-	13	3697	c.2485C>A	c.(2485-2487)Cgg>Agg	p.R829R	ADCY5_ENST00000309879.5_Silent_p.R479R|ADCY5_ENST00000491190.1_Silent_p.R462R	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	829					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		ATCTTGGACCGCACGATCTTC	0.602																																						dbGAP											0													72.0	60.0	64.0					3																	123022988		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.2485C>A	3.37:g.123022988G>T			B7Z8A6|Q7RTV7|Q8NFM3	Silent	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.R829	ENST00000462833.1	37	c.2485	CCDS3022.1	3																																																																																			ADCY5	-	NULL	ENSG00000173175		0.602	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY5	HGNC	protein_coding	OTTHUMT00000355889.4	14	0.00	0	G	XM_171048		123022988	123022988	-1	no_errors	ENST00000462833	ensembl	human	known	69_37n	silent	13	23.53	4	SNP	1.000	T
ADD2	119	genome.wustl.edu	37	2	70905920	70905920	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:70905920C>A	ENST00000264436.4	-	11	1743	c.1299G>T	c.(1297-1299)tgG>tgT	p.W433C	ADD2_ENST00000430656.1_Missense_Mutation_p.W449C|ADD2_ENST00000355733.3_Missense_Mutation_p.W433C|ADD2_ENST00000407644.2_Missense_Mutation_p.W433C|ADD2_ENST00000413157.2_Missense_Mutation_p.W433C	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	433	Interaction with calmodulin. {ECO:0000255}.				actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						GCGTATTGAGCCAGCGGGTCT	0.647																																						dbGAP											0													131.0	133.0	133.0					2																	70905920		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.1299G>T	2.37:g.70905920C>A	ENSP00000264436:p.Trp433Cys		A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.W433C	ENST00000264436.4	37	c.1299	CCDS1906.1	2	.	.	.	.	.	.	.	.	.	.	C	25.0	4.589246	0.86851	.	.	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000355733;ENST00000356565;ENST00000413157;ENST00000430656	T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.51907	0.1702	M	0.85777	2.775	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;0.999	T	0.57625	-0.7779	10	0.87932	D	0	-9.609	16.343	0.83101	0.0:1.0:0.0:0.0	.	449;433;433;433	B4DM17;P35612-4;P35612;P35612-3	.;.;ADDB_HUMAN;.	C	433;433;433;433;433;449	ENSP00000264436:W433C;ENSP00000384677:W433C;ENSP00000347972:W433C;ENSP00000388072:W433C;ENSP00000398112:W449C	ENSP00000264436:W433C	W	-	3	0	ADD2	70759428	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.609000	0.82925	2.716000	0.92895	0.655000	0.94253	TGG	ADD2	-	NULL	ENSG00000075340		0.647	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADD2	HGNC	protein_coding	OTTHUMT00000251918.4	59	0.00	0	C	NM_001617		70905920	70905920	-1	no_errors	ENST00000264436	ensembl	human	known	69_37n	missense	27	18.18	6	SNP	1.000	A
ADD2	119	genome.wustl.edu	37	2	70906014	70906014	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:70906014G>A	ENST00000264436.4	-	11	1649	c.1205C>T	c.(1204-1206)gCc>gTc	p.A402V	ADD2_ENST00000430656.1_Missense_Mutation_p.A418V|ADD2_ENST00000355733.3_Missense_Mutation_p.A402V|ADD2_ENST00000407644.2_Missense_Mutation_p.A402V|ADD2_ENST00000413157.2_Missense_Mutation_p.A402V	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	402					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						TGTGACCGTGGCTGGAATCTC	0.532																																						dbGAP											0													163.0	159.0	161.0					2																	70906014		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.1205C>T	2.37:g.70906014G>A	ENSP00000264436:p.Ala402Val		A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.A402V	ENST00000264436.4	37	c.1205	CCDS1906.1	2	.	.	.	.	.	.	.	.	.	.	G	34	5.406971	0.96051	.	.	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000355733;ENST00000356565;ENST00000413157;ENST00000430656	T;T;T;T;T	0.22539	1.95;1.95;1.95;1.95;1.95	5.23	5.23	0.72850	.	0.054824	0.64402	D	0.000001	T	0.47728	0.1461	M	0.76574	2.34	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.76071	0.987;0.979;0.971;0.91	T	0.47169	-0.9138	10	0.87932	D	0	-29.7234	16.343	0.83101	0.0:0.0:1.0:0.0	.	418;402;402;402	B4DM17;P35612-4;P35612;P35612-3	.;.;ADDB_HUMAN;.	V	402;402;402;402;402;418	ENSP00000264436:A402V;ENSP00000384677:A402V;ENSP00000347972:A402V;ENSP00000388072:A402V;ENSP00000398112:A418V	ENSP00000264436:A402V	A	-	2	0	ADD2	70759522	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.601000	0.98297	2.716000	0.92895	0.655000	0.94253	GCC	ADD2	-	NULL	ENSG00000075340		0.532	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADD2	HGNC	protein_coding	OTTHUMT00000251918.4	91	0.00	0	G	NM_001617		70906014	70906014	-1	no_errors	ENST00000264436	ensembl	human	known	69_37n	missense	36	21.74	10	SNP	1.000	A
ADSL	158	genome.wustl.edu	37	22	40755272	40755272	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr22:40755272G>A	ENST00000216194.7	+	6	719	c.663G>A	c.(661-663)caG>caA	p.Q221Q	ADSL_ENST00000480775.1_3'UTR|ADSL_ENST00000342312.6_Silent_p.Q221Q|ADSL_ENST00000454266.2_Silent_p.Q235Q	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	221					'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						AGGTAGAGCAGCTTGACAAGA	0.438																																					Colon(4;65 130 1097 1516)	dbGAP											0													274.0	257.0	263.0					22																	40755272		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.663G>A	22.37:g.40755272G>A			B0QY76|O75495|Q5TI34	Silent	SNP	pfam_Lyase1_N,pfam_AdenyloSucc_lyase_C,superfamily_L-Aspartase-like,prints_Fumarate_lyase,prints_D_crystallin,tigrfam_Pur_lyase	p.Q235	ENST00000216194.7	37	c.705	CCDS14001.1	22																																																																																			ADSL	-	pfam_Lyase1_N,superfamily_L-Aspartase-like,tigrfam_Pur_lyase	ENSG00000239900		0.438	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADSL	HGNC	protein_coding	OTTHUMT00000321386.1	131	0.00	0	G	NM_000026		40755272	40755272	+1	no_errors	ENST00000454266	ensembl	human	known	69_37n	silent	56	22.22	16	SNP	0.999	A
AGMAT	79814	genome.wustl.edu	37	1	15906613	15906613	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:15906613G>A	ENST00000375826.3	-	3	642	c.500C>T	c.(499-501)cCc>cTc	p.P167L	DNAJC16_ENST00000483270.1_Intron	NM_024758.4	NP_079034.3	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase)	167					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|putrescine biosynthetic process from arginine (GO:0033388)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	agmatinase activity (GO:0008783)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(6)|lung(2)|skin(1)	12		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		TTGCAATATGGGATATGTGAT	0.373																																					NSCLC(126;1678 1780 25805 43508 49531)	dbGAP											0													144.0	140.0	141.0					1																	15906613		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY057097	CCDS160.1	1p36.13	2009-01-05			ENSG00000116771	ENSG00000116771			18407	protein-coding gene	gene with protein product						11804860, 14648699, 11914032	Standard	NM_024758		Approved	FLJ23384	uc001awv.2	Q9BSE5	OTTHUMG00000002357	ENST00000375826.3:c.500C>T	1.37:g.15906613G>A	ENSP00000364986:p.Pro167Leu		Q5TDH1|Q9H5J3	Missense_Mutation	SNP	pfam_Ureohydrolase,prints_Ureohydrolase,tigrfam_Agmatinase-rel	p.P167L	ENST00000375826.3	37	c.500	CCDS160.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.100664	0.94245	.	.	ENSG00000116771	ENST00000375826	D	0.86297	-2.1	5.44	5.44	0.79542	Ureohydrolase domain (1);	0.000000	0.85682	D	0.000000	D	0.96849	0.8971	H	0.99697	4.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98664	1.0685	10	0.87932	D	0	-21.1771	16.8113	0.85720	0.0:0.0:1.0:0.0	.	167	Q9BSE5	SPEB_HUMAN	L	167	ENSP00000364986:P167L	ENSP00000364986:P167L	P	-	2	0	AGMAT	15779200	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.884000	0.92432	2.572000	0.86782	0.555000	0.69702	CCC	AGMAT	-	pfam_Ureohydrolase,prints_Ureohydrolase,tigrfam_Agmatinase-rel	ENSG00000116771		0.373	AGMAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGMAT	HGNC	protein_coding	OTTHUMT00000006763.1	135	0.74	1	G	NM_024758		15906613	15906613	-1	no_errors	ENST00000375826	ensembl	human	known	69_37n	missense	69	11.54	9	SNP	1.000	A
ALDH3B2	222	genome.wustl.edu	37	11	67434057	67434057	+	Missense_Mutation	SNP	C	C	T	rs1140670		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr11:67434057C>T	ENST00000349015.3	-	4	577	c.139G>A	c.(139-141)Gcc>Acc	p.A47T	ALDH3B2_ENST00000531881.1_5'UTR|ALDH3B2_ENST00000530069.1_Missense_Mutation_p.A47T	NM_000695.3	NP_000686	P48448	AL3B2_HUMAN	aldehyde dehydrogenase 3 family, member B2	47				ALA -> TLP (in Ref. 1; AAA85441 and 2; no nucleotide entry). {ECO:0000305}.	alcohol metabolic process (GO:0006066)|ethanol catabolic process (GO:0006068)|lipid metabolic process (GO:0006629)		3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	18						GCGGCGAGGGCGCCCACCAGG	0.637													c|||	1	0.000199681	0.0	0.0	5008	,	,		17152	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													73.0	71.0	72.0					11																	67434057		2200	4294	6494	-	-	-	SO:0001583	missense	0			U37519	CCDS31622.1	11q13.2	2014-09-04			ENSG00000132746	ENSG00000132746	1.2.1.5	"""Aldehyde dehydrogenases"""	411	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase 8"", ""acetaldehyde dehydrogenase 8"""	601917		ALDH8		8890755, 9161417	Standard	NM_000695		Approved		uc001oms.3	P48448	OTTHUMG00000167284	ENST00000349015.3:c.139G>A	11.37:g.67434057C>T	ENSP00000255084:p.Ala47Thr		Q53Y98|Q8NAL5|Q96IB2	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.A47T	ENST00000349015.3	37	c.139	CCDS31622.1	11	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	21.4	4.148952	0.78001	.	.	ENSG00000132746	ENST00000530069;ENST00000349015;ENST00000525827;ENST00000528756	D;D;D;D	0.90732	-2.72;-2.72;-2.72;-2.72	4.07	4.07	0.47477	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.97269	0.9107	H	0.98487	4.245	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98997	1.0810	10	0.87932	D	0	.	16.3782	0.83418	0.0:1.0:0.0:0.0	rs1140670	47	P48448	AL3B2_HUMAN	T	47	ENSP00000431595:A47T;ENSP00000255084:A47T;ENSP00000433718:A47T;ENSP00000433466:A47T	ENSP00000255084:A47T	A	-	1	0	ALDH3B2	67190633	1.000000	0.71417	0.997000	0.53966	0.189000	0.23516	7.536000	0.82023	2.260000	0.74910	0.561000	0.74099	GCC	ALDH3B2	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000132746		0.637	ALDH3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH3B2	HGNC	protein_coding	OTTHUMT00000394004.1	42	0.00	0	C	NM_000695		67434057	67434057	-1	no_errors	ENST00000349015	ensembl	human	known	69_37n	missense	23	20.00	6	SNP	1.000	T
ALG10	84920	genome.wustl.edu	37	12	34179103	34179103	+	Silent	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:34179103A>G	ENST00000266483.2	+	3	994	c.675A>G	c.(673-675)ggA>ggG	p.G225G	RP11-847H18.2_ENST00000501954.2_RNA|ALG10_ENST00000538927.1_Intron|AC046130.1_ENST00000401300.2_RNA	NM_032834.3	NP_116223.3	Q5BKT4	AG10A_HUMAN	ALG10, alpha-1,2-glucosyltransferase	225					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)				CTATTAAAGGACCATTTGCAG	0.403																																						dbGAP											0													83.0	90.0	88.0					12																	34179103		2197	4294	6491	-	-	-	SO:0001819	synonymous_variant	0			AJ312278	CCDS41769.1	12p11.21	2013-03-04	2013-03-04		ENSG00000139133	ENSG00000139133	2.4.1.256		23162	protein-coding gene	gene with protein product	"""derepression of ITR1 expression 2 homolog (S. cerevisiae)"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""	603313	"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (yeast)"", ""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)"""				Standard	NM_032834		Approved	FLJ14751, DIE2, ALG10A	uc001rlm.3	Q5BKT4	OTTHUMG00000169285	ENST00000266483.2:c.675A>G	12.37:g.34179103A>G			Q6NS98|Q96DU0|Q96SM6	Silent	SNP	pfam_Glycosyltransferase_ALG10,pirsf_Alpha1_2_glucosyltferase_Alg10	p.G225	ENST00000266483.2	37	c.675	CCDS41769.1	12																																																																																			ALG10	-	pfam_Glycosyltransferase_ALG10,pirsf_Alpha1_2_glucosyltferase_Alg10	ENSG00000139133		0.403	ALG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG10	HGNC	protein_coding	OTTHUMT00000403309.1	100	0.00	0	A	NM_032834		34179103	34179103	+1	no_errors	ENST00000266483	ensembl	human	known	69_37n	silent	62	16.22	12	SNP	0.997	G
ALG14	199857	genome.wustl.edu	37	1	95492695	95492695	+	Missense_Mutation	SNP	T	T	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:95492695T>G	ENST00000370205.5	-	3	456	c.410A>C	c.(409-411)aAg>aCg	p.K137T		NM_144988.3	NP_659425.1	Q96F25	ALG14_HUMAN	ALG14, UDP-N-acetylglucosaminyltransferase subunit	137					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(2)|pancreas(1)	6		all_lung(203;0.0232)|Lung NSC(277;0.0739)		all cancers(265;0.0615)|Epithelial(280;0.139)		CAAATCTGGCTTCACCCTGTG	0.478																																						dbGAP											0													80.0	75.0	77.0					1																	95492695		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS752.1	1p21.3	2013-02-21	2013-02-21		ENSG00000172339	ENSG00000172339			28287	protein-coding gene	gene with protein product		612866	"""asparagine-linked glycosylation 14 homolog (yeast)"", ""asparagine-linked glycosylation 14 homolog (S. cerevisiae)"""			15615718	Standard	NM_144988		Approved	MGC19780	uc001dra.2	Q96F25	OTTHUMG00000010781	ENST00000370205.5:c.410A>C	1.37:g.95492695T>G	ENSP00000359224:p.Lys137Thr		A8K030	Missense_Mutation	SNP	pfam_Oligosacch_biosynth_Alg14	p.K137T	ENST00000370205.5	37	c.410	CCDS752.1	1	.	.	.	.	.	.	.	.	.	.	T	14.17	2.455960	0.43634	.	.	ENSG00000172339	ENST00000370205	T	0.79141	-1.24	5.49	4.36	0.52297	.	0.206599	0.49305	D	0.000145	T	0.76608	0.4011	M	0.77616	2.38	0.40708	D	0.982544	P	0.37276	0.589	P	0.48770	0.589	T	0.79184	-0.1908	10	0.66056	D	0.02	-10.1184	9.3649	0.38219	0.0:0.0831:0.0:0.9169	.	137	Q96F25	ALG14_HUMAN	T	137	ENSP00000359224:K137T	ENSP00000359224:K137T	K	-	2	0	ALG14	95265283	1.000000	0.71417	1.000000	0.80357	0.640000	0.38277	2.546000	0.45778	1.024000	0.39682	0.482000	0.46254	AAG	ALG14	-	pfam_Oligosacch_biosynth_Alg14	ENSG00000172339		0.478	ALG14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG14	HGNC	protein_coding	OTTHUMT00000029699.2	39	0.00	0	T	NM_144988		95492695	95492695	-1	no_errors	ENST00000370205	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	G
AMY2B	280	genome.wustl.edu	37	1	104117917	104117917	+	Silent	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:104117917A>G	ENST00000361355.4	+	8	1567	c.951A>G	c.(949-951)caA>caG	p.Q317Q	AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	317					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		ATGACAATCAACGAGGACATG	0.398																																						dbGAP											0													229.0	235.0	233.0					1																	104117917		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.951A>G	1.37:g.104117917A>G			B3KTI1|B3KXB7|D3DT76|Q9UBH3	Silent	SNP	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.Q317	ENST00000361355.4	37	c.951	CCDS782.1	1																																																																																			AMY2B	-	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,prints_Alpha_amylase	ENSG00000240038		0.398	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1	161	0.00	0	A	NM_020978		104117917	104117917	+1	no_errors	ENST00000361355	ensembl	human	known	69_37n	silent	84	13.40	13	SNP	1.000	G
ANPEP	290	genome.wustl.edu	37	15	90348325	90348325	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr15:90348325G>A	ENST00000300060.6	-	4	1194	c.881C>T	c.(880-882)gCa>gTa	p.A294V	ANPEP_ENST00000558177.1_5'Flank	NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	294	Interaction with HCoV-229E.|Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	ACCATTGGATGCCTGCTTCTC	0.567																																					NSCLC(30;827 977 2459 19669 26125)	dbGAP											0													228.0	189.0	203.0					15																	90348325		2200	4299	6499	-	-	-	SO:0001583	missense	0			M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.881C>T	15.37:g.90348325G>A	ENSP00000300060:p.Ala294Val		Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.A294V	ENST00000300060.6	37	c.881	CCDS10356.1	15	.	.	.	.	.	.	.	.	.	.	G	9.204	1.029323	0.19512	.	.	ENSG00000166825	ENST00000300060	T	0.02606	4.23	5.08	4.07	0.47477	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	1.329130	0.04709	N	0.417348	T	0.04137	0.0115	L	0.31926	0.97	0.09310	N	1	B	0.19200	0.034	B	0.19666	0.026	T	0.32955	-0.9887	10	0.34782	T	0.22	.	11.482	0.50331	0.0:0.0:0.8082:0.1918	.	294	P15144	AMPN_HUMAN	V	294	ENSP00000300060:A294V	ENSP00000300060:A294V	A	-	2	0	ANPEP	88149329	0.001000	0.12720	0.004000	0.12327	0.004000	0.04260	0.710000	0.25748	2.369000	0.80426	0.462000	0.41574	GCA	ANPEP	-	pfam_Peptidase_M1_N	ENSG00000166825		0.567	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANPEP	HGNC	protein_coding	OTTHUMT00000313425.1	64	0.00	0	G			90348325	90348325	-1	no_errors	ENST00000300060	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	0.000	A
AP2B1	163	genome.wustl.edu	37	17	33953640	33953640	+	Splice_Site	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:33953640C>T	ENST00000262325.7	+	7	1270	c.717C>T	c.(715-717)agC>agT	p.S239S	AP2B1_ENST00000537622.2_Splice_Site_p.S239S|AP2B1_ENST00000312678.8_Splice_Site_p.S239S|AP2B1_ENST00000592545.1_Splice_Site_p.S201S|AP2B1_ENST00000538556.1_Splice_Site_p.S182S|AP2B1_ENST00000589344.1_Splice_Site_p.S239S|AP2B1_ENST00000545922.2_3'UTR	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	239					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		CCACCCTCAGCATCTGTGAGC	0.388																																						dbGAP											0													60.0	63.0	62.0					17																	33953640		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.717-1C>T	17.37:g.33953640C>T			A6NJP3|P21851|Q7Z451|Q96J19	Silent	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_B-adaptin_app_sub_C,pfam_HEAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Armadillo,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP_complex_bsu	p.S239	ENST00000262325.7	37	c.717	CCDS32622.1	17																																																																																			AP2B1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP_complex_bsu	ENSG00000006125		0.388	AP2B1-001	KNOWN	basic|CCDS	protein_coding	AP2B1	HGNC	protein_coding	OTTHUMT00000448969.1	20	0.00	0	C		Silent	33953640	33953640	+1	no_errors	ENST00000312678	ensembl	human	known	69_37n	silent	26	21.21	7	SNP	1.000	T
AP5M1	55745	genome.wustl.edu	37	14	57749707	57749707	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr14:57749707C>T	ENST00000261558.3	+	5	1550	c.1144C>T	c.(1144-1146)Cga>Tga	p.R382*	AP5M1_ENST00000556723.1_3'UTR|AP5M1_ENST00000431972.2_Nonsense_Mutation_p.R396*	NM_018229.3	NP_060699.3	Q9H0R1	AP5M1_HUMAN	adaptor-related protein complex 5, mu 1 subunit	382	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytosol (GO:0005829)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)											TGAAGTATTTCGAGAGAAAAG	0.269																																						dbGAP											0													121.0	138.0	132.0					14																	57749707		2203	4298	6501	-	-	-	SO:0001587	stop_gained	0			AF094583	CCDS9729.1	14q22.2	2012-03-20	2012-03-20	2012-03-20	ENSG00000053770	ENSG00000053770			20192	protein-coding gene	gene with protein product	"""Mu-2 related death-inducing gene"""	614368	"""chromosome 14 open reading frame 108"", ""MU-2/AP1M2 domain containing, death-inducing"""	C14orf108, MUDENG		18395520	Standard	NM_018229		Approved	FLJ10813, MuD, mu5	uc001xcv.3	Q9H0R1	OTTHUMG00000140318	ENST00000261558.3:c.1144C>T	14.37:g.57749707C>T	ENSP00000261558:p.Arg382*		O95354|Q6ZMD7|Q96DX3|Q9NVC5	Nonsense_Mutation	SNP	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pfscan_Clathrin_mu_C	p.R382*	ENST00000261558.3	37	c.1144	CCDS9729.1	14	.	.	.	.	.	.	.	.	.	.	C	39	7.755171	0.98471	.	.	ENSG00000053770	ENST00000261558;ENST00000431972	.	.	.	6.06	5.17	0.71159	.	0.054427	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	14.0281	0.64597	0.3885:0.6115:0.0:0.0	.	.	.	.	X	382;396	.	ENSP00000261558:R382X	R	+	1	2	MUDENG	56819460	0.992000	0.36948	1.000000	0.80357	0.555000	0.35460	1.285000	0.33261	1.554000	0.49487	-0.169000	0.13324	CGA	AP5M1	-	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pfscan_Clathrin_mu_C	ENSG00000053770		0.269	AP5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP5M1	HGNC	protein_coding	OTTHUMT00000276922.1	121	0.00	0	C	NM_018229		57749707	57749707	+1	no_errors	ENST00000261558	ensembl	human	known	69_37n	nonsense	59	18.06	13	SNP	1.000	T
APBA2	321	genome.wustl.edu	37	15	29367161	29367161	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr15:29367161G>A	ENST00000558402.1	+	6	1588	c.989G>A	c.(988-990)cGc>cAc	p.R330H	APBA2_ENST00000411764.1_Missense_Mutation_p.R330H|APBA2_ENST00000558259.1_Missense_Mutation_p.R330H|APBA2_ENST00000558330.1_Missense_Mutation_p.R330H|APBA2_ENST00000561069.1_Missense_Mutation_p.R330H			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	330					in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		AAGCAGCAGCGCTCTGATCTC	0.428																																						dbGAP											0													93.0	86.0	88.0					15																	29367161		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.989G>A	15.37:g.29367161G>A	ENSP00000453293:p.Arg330His		E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_PDZ,superfamily_PDZ,smart_PTyr_interaction_dom,smart_PDZ,pfscan_PDZ,pfscan_PTyr_interaction_dom	p.R330H	ENST00000558402.1	37	c.989	CCDS10022.1	15	.	.	.	.	.	.	.	.	.	.	G	22.7	4.317929	0.81469	.	.	ENSG00000034053	ENST00000411764;ENST00000219865;ENST00000382938	T	0.06449	3.3	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.20536	0.0494	M	0.63843	1.955	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.80764	0.974;0.987;0.994;0.952	T	0.03060	-1.1077	10	0.19590	T	0.45	.	15.9522	0.79850	0.0:0.0:1.0:0.0	.	330;34;330;330	Q5XKC0;Q6ZVB1;E9PGI4;Q99767	.;.;.;APBA2_HUMAN	H	330;330;34	ENSP00000409312:R330H	ENSP00000219865:R330H	R	+	2	0	APBA2	27154453	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.790000	0.85794	2.350000	0.79820	0.655000	0.94253	CGC	APBA2	-	NULL	ENSG00000034053		0.428	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA2	HGNC	protein_coding	OTTHUMT00000251362.3	69	0.00	0	G	NM_005503		29367161	29367161	+1	no_errors	ENST00000558259	ensembl	human	known	69_37n	missense	45	11.76	6	SNP	1.000	A
APEX2	27301	genome.wustl.edu	37	X	55029489	55029489	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chrX:55029489C>T	ENST00000374987.3	+	4	583	c.517C>T	c.(517-519)Cgc>Tgc	p.R173C	APEX2_ENST00000471758.1_3'UTR	NM_014481.2	NP_055296.2	Q9UBZ4	APEX2_HUMAN	APEX nuclease (apurinic/apyrimidinic endonuclease) 2	173					base-excision repair (GO:0006284)|cell cycle (GO:0007049)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|large_intestine(4)|lung(6)|prostate(1)|urinary_tract(1)	21						CTTTAAGATGCGCTTCTATCG	0.577								Other BER factors																														dbGAP											0													71.0	57.0	62.0					X																	55029489		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB021260	CCDS14365.1	Xp11.23	2014-02-18			ENSG00000169188	ENSG00000169188	4.2.99.18		17889	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 2"""	300773				11376153	Standard	NM_014481		Approved	APEXL2, APE2, XTH2, ZGRF2	uc004dtz.4	Q9UBZ4	OTTHUMG00000021642	ENST00000374987.3:c.517C>T	X.37:g.55029489C>T	ENSP00000364126:p.Arg173Cys		Q9Y5X7	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_Znf_GRF,superfamily_Endo/exonuclease/phosphatase,tigrfam_ExoDNase_III	p.R173C	ENST00000374987.3	37	c.517	CCDS14365.1	X	.	.	.	.	.	.	.	.	.	.	c	22.2	4.261477	0.80358	.	.	ENSG00000169188	ENST00000374987	T	0.80393	-1.37	5.15	3.33	0.38152	Endonuclease/exonuclease/phosphatase (2);	0.288543	0.40640	N	0.001056	T	0.79076	0.4385	M	0.84773	2.715	0.51767	D	0.999938	B	0.34372	0.451	B	0.29716	0.106	T	0.76119	-0.3076	10	0.62326	D	0.03	-7.9571	8.4913	0.33102	0.1531:0.762:0.0:0.0849	.	173	Q9UBZ4	APEX2_HUMAN	C	173	ENSP00000364126:R173C	ENSP00000364126:R173C	R	+	1	0	APEX2	55046214	1.000000	0.71417	0.985000	0.45067	0.953000	0.61014	2.882000	0.48546	0.470000	0.27294	0.597000	0.82753	CGC	APEX2	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,tigrfam_ExoDNase_III	ENSG00000169188		0.577	APEX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APEX2	HGNC	protein_coding	OTTHUMT00000056845.1	59	0.00	0	C			55029489	55029489	+1	no_errors	ENST00000374987	ensembl	human	known	69_37n	missense	24	24.24	8	SNP	1.000	T
APITD1	378708	genome.wustl.edu	37	1	10502382	10502382	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:10502382C>A	ENST00000309048.3	+	5	412	c.337C>A	c.(337-339)Cag>Aag	p.Q113K	APITD1-CORT_ENST00000400900.2_Intron|APITD1_ENST00000602296.1_Intron|APITD1_ENST00000602787.1_Intron|APITD1-CORT_ENST00000470413.2_Intron|APITD1-CORT_ENST00000465026.1_Intron|APITD1_ENST00000462462.1_3'UTR	NM_001270517.1|NM_199294.2	NP_001257446.1|NP_954988.1	Q8N2Z9	CENPS_HUMAN	apoptosis-inducing, TAF9-like domain 1	113					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of protein ubiquitination (GO:0031398)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	cytosol (GO:0005829)|FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|kinetochore (GO:0000776)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			kidney(1)|lung(1)|ovary(1)|stomach(1)	4	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.31e-07)|COAD - Colon adenocarcinoma(227;7.32e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000297)|Kidney(185;0.000747)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		ACGAAAAGCACAGAAGAAAAA	0.393																																						dbGAP											0													71.0	75.0	74.0					1																	10502382		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC029430	CCDS114.1, CCDS115.1	1p36.22	2013-11-05			ENSG00000175279	ENSG00000175279			23163	protein-coding gene	gene with protein product	"""centromere protein S"""	609130				15328517, 16622420, 16622419	Standard	NR_036462		Approved	CENPS, CENP-S, MHF1, FAAP16		Q8N2Z9	OTTHUMG00000059085	ENST00000309048.3:c.337C>A	1.37:g.10502382C>A	ENSP00000308583:p.Gln113Lys		Q8NFE5|Q8NFG5	Missense_Mutation	SNP	pfam_TFIID-31,superfamily_Histone-fold	p.Q113K	ENST00000309048.3	37	c.337	CCDS115.1	1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.749742	0.00669	.	.	ENSG00000175279	ENST00000309048	.	.	.	5.45	3.08	0.35506	.	.	.	.	.	T	0.09468	0.0233	N	0.00044	-2.455	0.58432	D	0.999996	B	0.02656	0.0	B	0.01281	0.0	T	0.40270	-0.9572	8	0.02654	T	1	.	11.0943	0.48134	0.6529:0.3471:0.0:0.0	.	113	Q8N2Z9	CENPS_HUMAN	K	113	.	ENSP00000308583:Q113K	Q	+	1	0	APITD1	10424969	1.000000	0.71417	0.486000	0.27416	0.112000	0.19704	3.620000	0.54203	0.432000	0.26286	-0.309000	0.09137	CAG	APITD1	-	NULL	ENSG00000175279		0.393	APITD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APITD1	HGNC	protein_coding	OTTHUMT00000130797.2	49	0.00	0	C	NM_199294		10502382	10502382	+1	no_errors	ENST00000309048	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.776	A
APOB	338	genome.wustl.edu	37	2	21233643	21233643	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:21233643G>A	ENST00000233242.1	-	26	6224	c.6097C>T	c.(6097-6099)Ccc>Tcc	p.P2033S		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2033					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATATTGATGGGCTCACTGAGT	0.398																																						dbGAP											0													123.0	123.0	123.0					2																	21233643		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.6097C>T	2.37:g.21233643G>A	ENSP00000233242:p.Pro2033Ser		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.P2033S	ENST00000233242.1	37	c.6097	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	G	6.616	0.482060	0.12581	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00691	5.84	5.31	3.51	0.40186	.	0.647072	0.13769	N	0.364001	T	0.01029	0.0034	M	0.64997	1.995	0.20489	N	0.999896	B	0.21520	0.057	B	0.16289	0.015	T	0.49716	-0.8910	10	0.49607	T	0.09	.	1.9339	0.03333	0.2318:0.1348:0.4944:0.139	.	2033	P04114	APOB_HUMAN	S	2033	ENSP00000233242:P2033S	ENSP00000233242:P2033S	P	-	1	0	APOB	21087148	0.000000	0.05858	0.102000	0.21198	0.031000	0.12232	-0.289000	0.08365	0.619000	0.30197	-0.300000	0.09419	CCC	APOB	-	NULL	ENSG00000084674		0.398	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	74	0.00	0	G			21233643	21233643	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	missense	42	14.29	7	SNP	0.088	A
ARHGAP18	93663	genome.wustl.edu	37	6	130031253	130031253	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:130031253A>G	ENST00000368149.2	-	1	117	c.29T>C	c.(28-30)gTg>gCg	p.V10A		NM_033515.2	NP_277050.2			Rho GTPase activating protein 18											NS(2)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(3)	18				OV - Ovarian serous cystadenocarcinoma(136;0.0621)|GBM - Glioblastoma multiforme(226;0.0638)|all cancers(137;0.074)		TGTTAGTACCACTCCCTGGGA	0.582																																						dbGAP											0													98.0	77.0	85.0					6																	130031253		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB053293	CCDS34535.1	6q23.1	2011-06-29			ENSG00000146376	ENSG00000146376		"""Rho GTPase activating proteins"""	21035	protein-coding gene	gene with protein product		613351					Standard	NM_033515		Approved	MacGAP, bA307O14.2	uc003qbr.3	Q8N392	OTTHUMG00000015547	ENST00000368149.2:c.29T>C	6.37:g.130031253A>G	ENSP00000357131:p.Val10Ala			Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.V10A	ENST00000368149.2	37	c.29	CCDS34535.1	6	.	.	.	.	.	.	.	.	.	.	A	24.4	4.522444	0.85600	.	.	ENSG00000146376	ENST00000275189	.	.	.	5.88	5.88	0.94601	.	0.000000	0.49305	D	0.000144	T	0.45034	0.1322	N	0.19112	0.55	0.40244	D	0.977997	D;P	0.63880	0.993;0.524	D;B	0.70016	0.967;0.138	T	0.48340	-0.9044	8	.	.	.	.	12.6668	0.56846	1.0:0.0:0.0:0.0	.	10;10	A9UK01;Q8N392	.;RHG18_HUMAN	A	10	.	.	V	-	2	0	ARHGAP18	130072946	1.000000	0.71417	0.994000	0.49952	0.982000	0.71751	5.050000	0.64251	2.248000	0.74166	0.477000	0.44152	GTG	ARHGAP18	-	NULL	ENSG00000146376		0.582	ARHGAP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP18	HGNC	protein_coding	OTTHUMT00000042185.2	63	0.00	0	A	NM_033515		130031253	130031253	-1	no_errors	ENST00000275189	ensembl	human	known	69_37n	missense	33	12.82	5	SNP	0.999	G
ARHGAP33	115703	genome.wustl.edu	37	19	36278850	36278850	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr19:36278850T>C	ENST00000007510.4	+	21	3527	c.3383T>C	c.(3382-3384)cTc>cCc	p.L1128P	ARHGAP33_ENST00000314737.5_Missense_Mutation_p.L967P|AC002398.5_ENST00000433059.1_lincRNA|ARHGAP33_ENST00000378944.5_Missense_Mutation_p.L964P			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	1128					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						TCACCCCCACTCCACAGGTCC	0.672																																						dbGAP											0													19.0	22.0	21.0					19																	36278850		2203	4293	6496	-	-	-	SO:0001583	missense	0			AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.3383T>C	19.37:g.36278850T>C	ENSP00000007510:p.Leu1128Pro		O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Phox,smart_SH3_domain,smart_RhoGAP_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.L1128P	ENST00000007510.4	37	c.3383		19	.	.	.	.	.	.	.	.	.	.	t	9.733	1.162668	0.21538	.	.	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000378944	T;T;T	0.14144	2.98;2.53;2.91	3.76	1.68	0.24146	.	0.537877	0.14002	N	0.348048	T	0.07593	0.0191	N	0.14661	0.345	0.52501	D	0.999958	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.18085	-1.0348	10	0.54805	T	0.06	.	6.2133	0.20642	0.0:0.4283:0.0:0.5717	.	964;967	O14559-10;O14559-11	.;.	P	1128;967;964	ENSP00000007510:L1128P;ENSP00000320038:L967P;ENSP00000368227:L964P	ENSP00000007510:L1128P	L	+	2	0	ARHGAP33	40970690	0.001000	0.12720	0.998000	0.56505	0.810000	0.45777	0.939000	0.28978	0.318000	0.23185	0.375000	0.23000	CTC	ARHGAP33	-	NULL	ENSG00000004777		0.672	ARHGAP33-201	KNOWN	basic	protein_coding	ARHGAP33	HGNC	protein_coding		17	0.00	0	T	NM_052948		36278850	36278850	+1	no_errors	ENST00000007510	ensembl	human	known	69_37n	missense	9	30.77	4	SNP	1.000	C
ARHGAP39	80728	genome.wustl.edu	37	8	145830970	145830970	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr8:145830970C>T	ENST00000276826.5	-	1	231	c.30G>A	c.(28-30)agG>agA	p.R10R	ARHGAP39_ENST00000540274.1_Silent_p.R10R|ARHGAP39_ENST00000377307.2_Silent_p.R10R			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	10					axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						CATTATGGCTCCTGCACTCGT	0.632																																						dbGAP											0													105.0	86.0	92.0					8																	145830970		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.30G>A	8.37:g.145830970C>T			B4E1I1	Silent	SNP	pfam_RhoGAP_dom,pfam_MyTH4_dom,superfamily_Rho_GTPase_activation_prot,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_MyTH4_dom,smart_RhoGAP_dom,pfscan_MyTH4_dom,pfscan_WW_Rsp5_WWP,pfscan_RhoGAP_dom	p.R10	ENST00000276826.5	37	c.30		8																																																																																			ARHGAP39	-	NULL	ENSG00000147799		0.632	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	ARHGAP39	HGNC	protein_coding	OTTHUMT00000382509.1	39	0.00	0	C			145830970	145830970	-1	no_errors	ENST00000377307	ensembl	human	known	69_37n	silent	14	22.22	4	SNP	0.933	T
ARHGEF28	64283	genome.wustl.edu	37	5	73200210	73200210	+	Missense_Mutation	SNP	C	C	A	rs368877878		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:73200210C>A	ENST00000426542.2	+	32	4161	c.4141C>A	c.(4141-4143)Cgt>Agt	p.R1381S	ARHGEF28_ENST00000513042.2_Missense_Mutation_p.R1381S|ARHGEF28_ENST00000512883.1_Missense_Mutation_p.R301S|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.R1381S|ARHGEF28_ENST00000545377.1_Missense_Mutation_p.R1381S|ARHGEF28_ENST00000296799.4_Missense_Mutation_p.R1068S|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.R1381S|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.R1337S			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	1381	Mediates cytoplasmic retention and interaction with YWHAH. {ECO:0000250}.				central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										GAATTTAACCCGTCTCTTATA	0.338																																						dbGAP											0													137.0	125.0	129.0					5																	73200210		1823	4084	5907	-	-	-	SO:0001583	missense	0				CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.4141C>A	5.37:g.73200210C>A	ENSP00000412175:p.Arg1381Ser		B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.R1381S	ENST00000426542.2	37	c.4141	CCDS54870.1	5	.	.	.	.	.	.	.	.	.	.	C	21.1	4.092043	0.76756	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799;ENST00000512883	T;T;T;T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99;1.99;1.99;1.99	5.95	5.95	0.96441	.	0.000000	0.33610	U	0.004735	T	0.48223	0.1488	M	0.71581	2.175	0.46478	D	0.999065	D;D;P;D;D	0.71674	0.995;0.989;0.95;0.998;0.97	P;D;P;D;P	0.70016	0.904;0.926;0.737;0.967;0.865	T	0.18999	-1.0319	10	0.41790	T	0.15	.	20.3712	0.98891	0.0:1.0:0.0:0.0	.	1068;1381;1381;301;1381	B5MDA3;Q8N1W1;E9PC75;D6RGZ3;Q8N1W1-4	.;RGNEF_HUMAN;.;.;.	S	1381;1381;1381;1337;1381;1381;1068;301	ENSP00000296794:R1381S;ENSP00000441913:R1381S;ENSP00000441436:R1381S;ENSP00000287898:R1337S;ENSP00000411459:R1381S;ENSP00000412175:R1381S;ENSP00000296799:R1068S;ENSP00000421081:R301S	ENSP00000287898:R1337S	R	+	1	0	RP11-428C6.1	73235966	0.999000	0.42202	0.708000	0.30435	0.766000	0.43426	6.296000	0.72751	2.822000	0.97130	0.655000	0.94253	CGT	ARHGEF28	-	NULL	ENSG00000214944		0.338	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF28	HGNC	protein_coding	OTTHUMT00000368975.1	127	0.00	0	C			73200210	73200210	+1	no_errors	ENST00000545377	ensembl	human	known	69_37n	missense	73	12.05	10	SNP	0.994	A
ARMC2	84071	genome.wustl.edu	37	6	109190033	109190033	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:109190033A>G	ENST00000392644.4	+	4	466	c.298A>G	c.(298-300)Aaa>Gaa	p.K100E	ARMC2_ENST00000368972.3_5'UTR	NM_032131.4	NP_115507.4	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2	100										endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)	24		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)		CCAGAAACCGAAAGTTCCAGC	0.478																																						dbGAP											0													44.0	45.0	45.0					6																	109190033		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC030603	CCDS5069.2, CCDS69168.1	6q21	2013-02-14			ENSG00000118690	ENSG00000118690		"""Armadillo repeat containing"""	23045	protein-coding gene	gene with protein product							Standard	XM_005267154		Approved	DKFZp434P0714, bA787I22.1	uc003pss.4	Q8NEN0	OTTHUMG00000015335	ENST00000392644.4:c.298A>G	6.37:g.109190033A>G	ENSP00000376417:p.Lys100Glu		A8K8Y4|B4DGF5|G5E993|Q5VVY8|Q9H0K9	Missense_Mutation	SNP	superfamily_ARM-type_fold,smart_Armadillo	p.K100E	ENST00000392644.4	37	c.298	CCDS5069.2	6	.	.	.	.	.	.	.	.	.	.	A	16.18	3.049906	0.55218	.	.	ENSG00000118690	ENST00000392644;ENST00000237512	T;T	0.81330	0.98;-1.48	5.41	5.41	0.78517	.	0.172923	0.48767	D	0.000162	T	0.67021	0.2849	M	0.72118	2.19	0.80722	D	1	P	0.43094	0.799	B	0.33339	0.162	T	0.71735	-0.4503	10	0.36615	T	0.2	.	13.2623	0.60113	1.0:0.0:0.0:0.0	.	100	Q8NEN0	ARMC2_HUMAN	E	100	ENSP00000376417:K100E;ENSP00000237512:K100E	ENSP00000237512:K100E	K	+	1	0	ARMC2	109296726	0.999000	0.42202	0.941000	0.38009	0.708000	0.40852	5.783000	0.68982	2.172000	0.68678	0.533000	0.62120	AAA	ARMC2	-	NULL	ENSG00000118690		0.478	ARMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC2	HGNC	protein_coding	OTTHUMT00000041732.2	29	0.00	0	A	NM_032131		109190033	109190033	+1	no_errors	ENST00000392644	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	0.968	G
ARMC2	84071	genome.wustl.edu	37	6	109215690	109215690	+	Missense_Mutation	SNP	C	C	T	rs200206972	byFrequency	TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:109215690C>T	ENST00000392644.4	+	6	860	c.692C>T	c.(691-693)gCg>gTg	p.A231V	ARMC2_ENST00000368972.3_Missense_Mutation_p.A66V	NM_032131.4	NP_115507.4	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2	231										endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)	24		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)		AAGAGACATGCGAGGGCCTCA	0.483													C|||	2	0.000399361	0.0008	0.0	5008	,	,		15666	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													110.0	103.0	106.0					6																	109215690		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC030603	CCDS5069.2, CCDS69168.1	6q21	2013-02-14			ENSG00000118690	ENSG00000118690		"""Armadillo repeat containing"""	23045	protein-coding gene	gene with protein product							Standard	XM_005267154		Approved	DKFZp434P0714, bA787I22.1	uc003pss.4	Q8NEN0	OTTHUMG00000015335	ENST00000392644.4:c.692C>T	6.37:g.109215690C>T	ENSP00000376417:p.Ala231Val		A8K8Y4|B4DGF5|G5E993|Q5VVY8|Q9H0K9	Missense_Mutation	SNP	superfamily_ARM-type_fold,smart_Armadillo	p.A231V	ENST00000392644.4	37	c.692	CCDS5069.2	6	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	3.605	-0.080762	0.07141	.	.	ENSG00000118690	ENST00000368972;ENST00000392644	T;T	0.45276	0.9;0.9	5.25	-2.18	0.07037	.	1.180980	0.05898	N	0.629527	T	0.12347	0.0300	L	0.44542	1.39	0.09310	N	1	B	0.16802	0.019	B	0.09377	0.004	T	0.24404	-1.0161	10	0.27785	T	0.31	.	5.6016	0.17357	0.0:0.3043:0.3861:0.3096	.	231	Q8NEN0	ARMC2_HUMAN	V	66;231	ENSP00000357968:A66V;ENSP00000376417:A231V	ENSP00000357968:A66V	A	+	2	0	ARMC2	109322383	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.402000	0.07223	-0.571000	0.06014	-0.844000	0.03045	GCG	ARMC2	-	NULL	ENSG00000118690		0.483	ARMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC2	HGNC	protein_coding	OTTHUMT00000041732.2	30	0.00	0	C	NM_032131		109215690	109215690	+1	no_errors	ENST00000392644	ensembl	human	known	69_37n	missense	27	20.59	7	SNP	0.000	T
ASPRV1	151516	genome.wustl.edu	37	2	70188297	70188297	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:70188297G>A	ENST00000320256.4	-	1	1100	c.524C>T	c.(523-525)cCt>cTt	p.P175L	PCBP1-AS1_ENST00000419542.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000596259.1_RNA	NM_152792.2	NP_690005.2			aspartic peptidase, retroviral-like 1											endometrium(3)|large_intestine(4)|lung(6)|ovary(1)	14						GGCAGCCCCAGGGACCCCAAA	0.592																																						dbGAP											0													43.0	46.0	45.0					2																	70188297		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055994	CCDS1897.1	2p13.3	2008-02-20			ENSG00000244617	ENSG00000244617			26321	protein-coding gene	gene with protein product	"""Skin ASpartic Protease"""	611765				16098038, 16565508	Standard	NM_152792		Approved	Taps, SASPase, FLJ25084	uc002sfz.4	Q53RT3	OTTHUMG00000129647	ENST00000320256.4:c.524C>T	2.37:g.70188297G>A	ENSP00000315383:p.Pro175Leu			Missense_Mutation	SNP	pfam_Peptidase_aspartic_euk-pred,pfam_Pept_A2A_retrovirus_sg,superfamily_Peptidase_aspartic,pfscan_Peptidase_A2_cat	p.P175L	ENST00000320256.4	37	c.524	CCDS1897.1	2	.	.	.	.	.	.	.	.	.	.	G	8.154	0.788014	0.16258	.	.	ENSG00000244617	ENST00000320256	T	0.46063	0.88	5.25	4.36	0.52297	.	1.439210	0.05263	N	0.516079	T	0.33818	0.0876	N	0.24115	0.695	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.24190	-1.0167	10	0.44086	T	0.13	-2.0939	10.2002	0.43077	0.094:0.0:0.906:0.0	.	175	Q53RT3	APRV1_HUMAN	L	175	ENSP00000315383:P175L	ENSP00000315383:P175L	P	-	2	0	ASPRV1	70041801	0.111000	0.22076	0.001000	0.08648	0.256000	0.26092	3.429000	0.52800	1.167000	0.42706	0.561000	0.74099	CCT	ASPRV1	-	NULL	ENSG00000244617		0.592	ASPRV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPRV1	HGNC	protein_coding	OTTHUMT00000334161.1	32	0.00	0	G	NM_152792		70188297	70188297	-1	no_errors	ENST00000320256	ensembl	human	known	69_37n	missense	35	18.60	8	SNP	0.003	A
ASTE1	28990	genome.wustl.edu	37	3	130743497	130743498	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr3:130743497_130743498delAA	ENST00000264992.3	-	3	1094_1095	c.653_654delTT	c.(652-654)tttfs	p.F218fs	NEK11_ENST00000356918.4_5'Flank|ASTE1_ENST00000514044.1_Frame_Shift_Del_p.F218fs|NEK11_ENST00000510769.1_5'Flank|NEK11_ENST00000429253.2_5'Flank|NEK11_ENST00000383366.4_5'Flank|NEK11_ENST00000412440.2_5'Flank|NEK11_ENST00000510688.1_5'Flank|NEK11_ENST00000511262.1_5'Flank	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	218					DNA repair (GO:0006281)		nuclease activity (GO:0004518)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						ATAGCACCGCAAAGAGAGGTAG	0.426																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.653_654delTT	3.37:g.130743497_130743498delAA	ENSP00000264992:p.Phe218fs		B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Frame_Shift_Del	DEL	pfam_XPG_DNA_repair_N	p.F218fs	ENST00000264992.3	37	c.654_653	CCDS3068.1	3																																																																																			ASTE1	-	NULL	ENSG00000034533		0.426	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTE1	HGNC	protein_coding	OTTHUMT00000356659.1	30	0.00	0	AA	NM_014065		130743497	130743498	-1	no_errors	ENST00000264992	ensembl	human	known	69_37n	frame_shift_del	28	15.15	5	DEL	0.997:1.000	-
BAIAP2L1	55971	genome.wustl.edu	37	7	97939890	97939890	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:97939890G>A	ENST00000005260.8	-	9	1037	c.822C>T	c.(820-822)taC>taT	p.Y274Y	RP4-607J23.2_ENST00000609873.1_RNA|RP4-607J23.2_ENST00000608882.1_RNA|BAIAP2L1_ENST00000462558.1_5'UTR	NM_018842.4	NP_061330.2	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1	274					filopodium assembly (GO:0046847)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|response to bacterium (GO:0009617)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)	23	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			AAAGGGTGTCGTAATCTTTCC	0.408																																						dbGAP											0													86.0	92.0	90.0					7																	97939890		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF119666	CCDS34687.1	7q22.1	2012-10-04			ENSG00000006453	ENSG00000006453			21649	protein-coding gene	gene with protein product		611877					Standard	NM_018842		Approved	IRTKS	uc003upj.3	Q9UHR4	OTTHUMG00000165117	ENST00000005260.8:c.822C>T	7.37:g.97939890G>A			A4D268|Q75L21|Q75L22|Q96CV4|Q9H5F5|Q9Y2M8	Silent	SNP	pfam_IRSp53/MIM_homology_IMD,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.Y274	ENST00000005260.8	37	c.822	CCDS34687.1	7																																																																																			BAIAP2L1	-	NULL	ENSG00000006453		0.408	BAIAP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAIAP2L1	HGNC	protein_coding	OTTHUMT00000334681.1	76	0.00	0	G	NM_018842		97939890	97939890	-1	no_errors	ENST00000005260	ensembl	human	known	69_37n	silent	35	20.45	9	SNP	0.434	A
BCAS3	54828	genome.wustl.edu	37	17	58988000	58988000	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:58988000G>A	ENST00000390652.5	+	12	961	c.930G>A	c.(928-930)cgG>cgA	p.R310R	BCAS3_ENST00000588874.1_Silent_p.R81R|BCAS3_ENST00000588462.1_Silent_p.R310R|BCAS3_ENST00000585744.1_Silent_p.R81R|BCAS3_ENST00000407086.3_Silent_p.R310R|BCAS3_ENST00000408905.3_Silent_p.R310R|BCAS3_ENST00000589222.1_Silent_p.R310R	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			GTAATTCACGGCGGAGTCCTT	0.502																																						dbGAP											0													137.0	133.0	135.0					17																	58988000		2057	4199	6256	-	-	-	SO:0001819	synonymous_variant	0			AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.930G>A	17.37:g.58988000G>A				Silent	SNP	pfam_BCAS3,pfam_WD40_repeat	p.R310	ENST00000390652.5	37	c.930	CCDS45749.1	17																																																																																			BCAS3	-	NULL	ENSG00000141376		0.502	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAS3	HGNC	protein_coding	OTTHUMT00000449578.1	42	0.00	0	G	NM_017679		58988000	58988000	+1	no_errors	ENST00000390652	ensembl	human	known	69_37n	silent	45	11.54	6	SNP	0.549	A
BPIFB4	149954	genome.wustl.edu	37	20	31671634	31671634	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr20:31671634G>A	ENST00000375483.3	+	3	631	c.631G>A	c.(631-633)Gtg>Atg	p.V211M		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	211	Gly-rich.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.V172M(1)									TGTCCTGGGCGTGCTCGGCGA	0.647																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											36.0	42.0	40.0					20																	31671634		2198	4292	6490	-	-	-	SO:0001583	missense	0			AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.631G>A	20.37:g.31671634G>A	ENSP00000364632:p.Val211Met		Q5TDX6	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.V211M	ENST00000375483.3	37	c.631	CCDS13213.2	20	.	.	.	.	.	.	.	.	.	.	G	15.63	2.888927	0.52014	.	.	ENSG00000186191	ENST00000375483	T	0.06608	3.28	3.21	2.25	0.28309	.	0.134612	0.32518	N	0.005994	T	0.10423	0.0255	N	0.22421	0.69	0.23210	N	0.998119	D	0.76494	0.999	D	0.79784	0.993	T	0.07214	-1.0784	10	0.56958	D	0.05	-10.8136	6.1977	0.20559	0.1459:0.0:0.8541:0.0	.	211	P59827	BPIB4_HUMAN	M	211	ENSP00000364632:V211M	ENSP00000364632:V211M	V	+	1	0	BPIFB4	31135295	0.690000	0.27699	0.847000	0.33407	0.988000	0.76386	0.718000	0.25866	0.677000	0.31305	0.407000	0.27541	GTG	BPIFB4	-	pfam_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_N	ENSG00000186191		0.647	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB4	HGNC	protein_coding	OTTHUMT00000078655.5	33	0.00	0	G	NM_182519		31671634	31671634	+1	no_errors	ENST00000375483	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	0.722	A
BRD8	10902	genome.wustl.edu	37	5	137476347	137476347	+	Intron	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:137476347G>A	ENST00000254900.5	-	26	3987				NME5_ENST00000265191.2_5'Flank	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8						cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TCTCATAGGCGTTCTGAAATC	0.433																																						dbGAP											0													77.0	77.0	77.0					5																	137476347		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.3615+46C>T	5.37:g.137476347G>A			O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.T327M	ENST00000254900.5	37	c.980	CCDS4198.1	5	.	.	.	.	.	.	.	.	.	.	G	12.35	1.910480	0.33721	.	.	ENSG00000112983	ENST00000427976	T	0.28666	1.6	4.7	-2.5	0.06384	.	.	.	.	.	T	0.27241	0.0668	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38564	-0.9655	6	0.56958	D	0.05	.	6.2148	0.20649	0.265:0.0:0.4637:0.2712	.	.	.	.	M	327	ENSP00000392646:T327M	ENSP00000392646:T327M	T	-	2	0	BRD8	137504246	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.194000	0.09559	-0.224000	0.09928	-3.486000	0.00034	ACG	BRD8	-	NULL	ENSG00000112983		0.433	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD8	HGNC	protein_coding	OTTHUMT00000251282.3	35	0.00	0	G	NM_006696		137476347	137476347	-1	no_start_codon	ENST00000427976	ensembl	human	putative	69_37n	missense	27	25.00	9	SNP	0.000	A
BROX	148362	genome.wustl.edu	37	1	222906001	222906001	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:222906001C>A	ENST00000340934.5	+	13	1587	c.1181C>A	c.(1180-1182)cCt>cAt	p.P394H	BROX_ENST00000539697.1_Missense_Mutation_p.P362H|BROX_ENST00000537020.1_3'UTR	NM_144695.2	NP_653296.2	Q5VW32	BROX_HUMAN	BRO1 domain and CAAX motif containing	394	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|stomach(1)	14						GAAGTGAAACCTGTGAAAGAA	0.348																																						dbGAP											0													75.0	72.0	73.0					1																	222906001		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1534.1, CCDS73036.1, CCDS73037.1	1q41	2010-11-30	2010-11-30	2010-11-30	ENSG00000162819	ENSG00000162819			26512	protein-coding gene	gene with protein product	"""BRO1 domain containing protein"""		"""chromosome 1 open reading frame 58"""	C1orf58		18190528	Standard	XM_005273065		Approved	FLJ32421	uc001hnq.1	Q5VW32	OTTHUMG00000037650	ENST00000340934.5:c.1181C>A	1.37:g.222906001C>A	ENSP00000343742:p.Pro394His		B7Z9G5|Q96MG1	Missense_Mutation	SNP	pfam_BRO1_dom,pfscan_BRO1_dom	p.P394H	ENST00000340934.5	37	c.1181	CCDS1534.1	1	.	.	.	.	.	.	.	.	.	.	c	21.3	4.130924	0.77549	.	.	ENSG00000162819	ENST00000340934;ENST00000539697	.	.	.	6.17	6.17	0.99709	BRO1 domain (1);	0.045613	0.85682	D	0.000000	T	0.72104	0.3419	M	0.78637	2.42	0.80722	D	1	D;B	0.59767	0.986;0.272	P;B	0.49752	0.621;0.141	T	0.67616	-0.5625	9	0.21540	T	0.41	-9.9273	20.4745	0.99168	0.0:1.0:0.0:0.0	.	362;394	B7Z9G5;Q5VW32	.;BROX_HUMAN	H	394;362	.	ENSP00000343742:P394H	P	+	2	0	BROX	220972624	1.000000	0.71417	0.994000	0.49952	0.973000	0.67179	7.269000	0.78482	2.941000	0.99782	0.655000	0.94253	CCT	BROX	-	pfscan_BRO1_dom	ENSG00000162819		0.348	BROX-001	NOVEL	basic|appris_principal|CCDS	protein_coding	BROX	HGNC	protein_coding	OTTHUMT00000091815.2	50	0.00	0	C	NM_144695		222906001	222906001	+1	no_errors	ENST00000340934	ensembl	human	known	69_37n	missense	51	22.73	15	SNP	1.000	A
BRWD1	54014	genome.wustl.edu	37	21	40570950	40570950	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr21:40570950A>T	ENST00000333229.2	-	40	5719	c.5392T>A	c.(5392-5394)Tct>Act	p.S1798T	BRWD1_ENST00000380800.3_Missense_Mutation_p.S1798T|BRWD1_ENST00000342449.3_Missense_Mutation_p.S1798T	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1798					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				CTACCACCAGATCTTCCTGGT	0.418																																					Melanoma(170;988 1986 4794 16843 39731)	dbGAP											0													120.0	121.0	120.0					21																	40570950		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.5392T>A	21.37:g.40570950A>T	ENSP00000330753:p.Ser1798Thr		C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_WD40_repeat_dom,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S1798T	ENST00000333229.2	37	c.5392	CCDS13662.1	21	.	.	.	.	.	.	.	.	.	.	A	4.282	0.051437	0.08291	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.54071	0.59;0.62;0.69	4.47	2.02	0.26589	.	1.186920	0.05967	N	0.641720	T	0.37544	0.1007	N	0.24115	0.695	0.09310	N	0.999999	B;B	0.11235	0.0;0.004	B;B	0.10450	0.0;0.005	T	0.23691	-1.0181	10	0.22109	T	0.4	4.032	6.817	0.23837	0.7983:0.0:0.2017:0.0	.	1798;1798	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	T	1798	ENSP00000330753:S1798T;ENSP00000344333:S1798T;ENSP00000370178:S1798T	ENSP00000330753:S1798T	S	-	1	0	BRWD1	39492820	0.000000	0.05858	0.001000	0.08648	0.496000	0.33645	0.088000	0.14979	0.124000	0.18369	0.533000	0.62120	TCT	BRWD1	-	NULL	ENSG00000185658		0.418	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	HGNC	protein_coding	OTTHUMT00000141398.3	58	0.00	0	A	NM_033656		40570950	40570950	-1	no_errors	ENST00000333229	ensembl	human	known	69_37n	missense	55	12.70	8	SNP	0.004	T
C1orf123	54987	genome.wustl.edu	37	1	53681666	53681668	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	CTC	CTC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:53681666_53681668delCTC	ENST00000294360.4	-	7	441_443	c.400_402delGAG	c.(400-402)gagdel	p.E134del	RP5-1024G6.2_ENST00000452466.1_RNA|C1orf123_ENST00000470385.1_5'UTR	NM_017887.1	NP_060357.1	Q9NWV4	CA123_HUMAN	chromosome 1 open reading frame 123	134						extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|pancreas(2)|skin(1)	6						CTCATACCTTCTCCTGCAGATTA	0.498																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			BC010908	CCDS576.1	1p32.3	2011-02-18			ENSG00000162384	ENSG00000162384			26059	protein-coding gene	gene with protein product						12477932	Standard	NM_017887		Approved	FLJ20580	uc001cvd.3	Q9NWV4	OTTHUMG00000008940	ENST00000294360.4:c.400_402delGAG	1.37:g.53681666_53681668delCTC	ENSP00000294360:p.Glu134del			In_Frame_Del	DEL	pfam_DUF866_euk	p.E134in_frame_del	ENST00000294360.4	37	c.402_400	CCDS576.1	1																																																																																			C1orf123	-	pfam_DUF866_euk	ENSG00000162384		0.498	C1orf123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf123	HGNC	protein_coding	OTTHUMT00000024751.1	83	0.00	0	CTC	NM_017887		53681666	53681668	-1	no_errors	ENST00000294360	ensembl	human	known	69_37n	in_frame_del	44	12.00	6	DEL	0.991:1.000:1.000	-
C2orf76	130355	genome.wustl.edu	37	2	120060116	120060116	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:120060116T>C	ENST00000409466.2	-	7	834	c.313A>G	c.(313-315)Act>Gct	p.T105A	C2orf76_ENST00000334816.7_Missense_Mutation_p.T105A|C2orf76_ENST00000409523.1_Missense_Mutation_p.T105A|C2orf76_ENST00000409877.1_Missense_Mutation_p.T105A			Q3KRA6	CB076_HUMAN	chromosome 2 open reading frame 76	105										large_intestine(1)|lung(3)|pancreas(1)	5						GCAATTTCAGTTTCACTGGCT	0.313																																						dbGAP											0													78.0	74.0	75.0					2																	120060116		1811	4073	5884	-	-	-	SO:0001583	missense	0				CCDS42739.1	2q14.2	2011-05-09			ENSG00000186132	ENSG00000186132			27017	protein-coding gene	gene with protein product						12477932	Standard	NM_001017927		Approved	MGC104437, LOC130355, AIM29	uc002tls.2	Q3KRA6	OTTHUMG00000153298	ENST00000409466.2:c.313A>G	2.37:g.120060116T>C	ENSP00000386302:p.Thr105Ala		B7ZLS8|Q4VC35	Missense_Mutation	SNP	pfam_UPF0538	p.T105A	ENST00000409466.2	37	c.313	CCDS42739.1	2	.	.	.	.	.	.	.	.	.	.	T	18.47	3.630007	0.67015	.	.	ENSG00000186132	ENST00000409466;ENST00000334816;ENST00000409877;ENST00000409523	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.68897	0.3051	M	0.85859	2.78	0.49798	D	0.999824	D	0.67145	0.996	P	0.60345	0.873	T	0.74432	-0.3667	10	0.72032	D	0.01	-1.0955	14.547	0.68038	0.0:0.0:0.0:1.0	.	105	Q3KRA6	CB076_HUMAN	A	105	ENSP00000386302:T105A;ENSP00000335041:T105A;ENSP00000387234:T105A;ENSP00000386714:T105A	ENSP00000335041:T105A	T	-	1	0	C2orf76	119776586	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.207000	0.65197	2.367000	0.80283	0.528000	0.53228	ACT	C2orf76	-	pfam_UPF0538	ENSG00000186132		0.313	C2orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf76	HGNC	protein_coding	OTTHUMT00000330582.2	67	0.00	0	T	NM_001017927		120060116	120060116	-1	no_errors	ENST00000334816	ensembl	human	known	69_37n	missense	57	12.31	8	SNP	1.000	C
C8G	733	genome.wustl.edu	37	9	139840387	139840387	+	Silent	SNP	G	G	T	rs532377363		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr9:139840387G>T	ENST00000224181.3	+	3	342	c.282G>T	c.(280-282)ggG>ggT	p.G94G	FBXW5_ENST00000325285.3_5'Flank|FBXW5_ENST00000483559.1_5'Flank	NM_000606.2	NP_000597.2	P07360	CO8G_HUMAN	complement component 8, gamma polypeptide	94					complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	retinol binding (GO:0019841)			NS(1)|prostate(1)|skin(1)	3	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.88e-06)|Epithelial(140;0.000107)		CCAGGGATGGGATCTGCTGGC	0.682																																						dbGAP											0													12.0	13.0	13.0					9																	139840387		2171	4268	6439	-	-	-	SO:0001819	synonymous_variant	0			X06465	CCDS7017.1	9q	2011-11-15			ENSG00000176919	ENSG00000176919		"""Complement system"", ""Lipocalins"""	1354	protein-coding gene	gene with protein product		120930					Standard	NM_000606		Approved		uc004cka.2	P07360	OTTHUMG00000020955	ENST00000224181.3:c.282G>T	9.37:g.139840387G>T			Q14CT8|Q14CU0|Q5SQ07	Silent	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_A1-microglobln,prints_Lipocalin	p.G94	ENST00000224181.3	37	c.282	CCDS7017.1	9																																																																																			C8G	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like	ENSG00000176919		0.682	C8G-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C8G	HGNC	protein_coding	OTTHUMT00000055178.1	26	0.00	0	G			139840387	139840387	+1	no_errors	ENST00000224181	ensembl	human	known	69_37n	silent	17	26.09	6	SNP	1.000	T
CABYR	26256	genome.wustl.edu	37	18	21735866	21735866	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr18:21735866C>T	ENST00000399496.3	+	4	566	c.401C>T	c.(400-402)aCg>aTg	p.T134M	CABYR_ENST00000415309.2_Missense_Mutation_p.T134M|CABYR_ENST00000399481.2_Missense_Mutation_p.T36M|CABYR_ENST00000399499.1_Missense_Mutation_p.T134M|CABYR_ENST00000327201.6_Missense_Mutation_p.T36M|CABYR_ENST00000581397.1_Missense_Mutation_p.T134M	NM_012189.2|NM_153769.1	NP_036321.2|NP_722453.1	O75952	CABYR_HUMAN	calcium binding tyrosine-(Y)-phosphorylation regulated	134					epithelial cilium movement (GO:0003351)|sperm capacitation (GO:0048240)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|protein heterodimerization activity (GO:0046982)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)	11	all_cancers(21;9.13e-05)|all_epithelial(16;5.49e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0305)|Ovarian(20;0.17)					ACTGAGCAAACGGAAGCAGTT	0.488																																						dbGAP											0													137.0	107.0	117.0					18																	21735866		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF088868	CCDS11881.1, CCDS11882.1, CCDS11883.1, CCDS42420.1, CCDS45840.1	18q11.2	2009-08-06	2007-11-22		ENSG00000154040	ENSG00000154040			15569	protein-coding gene	gene with protein product	"""fibrousheathin 2"", ""cancer/testis antigen 88"""	612135				11820818, 17317841, 16139264	Standard	NM_012189		Approved	FSP-2, CBP86, CT88	uc002kux.3	O75952	OTTHUMG00000037365	ENST00000399496.3:c.401C>T	18.37:g.21735866C>T	ENSP00000382419:p.Thr134Met		B2R857|Q8WXW5|Q9HAY3|Q9HAY4|Q9HAY5|Q9HCY9	Missense_Mutation	SNP	pfam_cAMP_dep_PK_reg_su_I/II_a/b,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,smart_cAMP_dep_PK_reg_su_I/II_a/b	p.T134M	ENST00000399496.3	37	c.401	CCDS42420.1	18	.	.	.	.	.	.	.	.	.	.	C	9.832	1.188590	0.21954	.	.	ENSG00000154040	ENST00000399496;ENST00000415309;ENST00000399481;ENST00000327201;ENST00000399499	T;T;T;T	0.49432	0.78;1.39;1.65;0.78	5.95	-1.14	0.09741	.	3.638620	0.00541	N	0.000223	T	0.43389	0.1245	L	0.43152	1.355	0.09310	N	1	P;B;D;D	0.64830	0.593;0.333;0.994;0.99	B;B;P;P	0.47744	0.055;0.032;0.556;0.469	T	0.35525	-0.9785	10	0.66056	D	0.02	.	1.2337	0.01949	0.1267:0.2659:0.2493:0.3581	.	116;134;134;134	O75952-2;O75952-4;O75952-3;O75952	.;.;.;CABYR_HUMAN	M	134;134;36;36;134	ENSP00000382419:T134M;ENSP00000399973:T134M;ENSP00000382404:T36M;ENSP00000382421:T134M	ENSP00000317095:T36M	T	+	2	0	CABYR	19989864	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.319000	0.02702	0.042000	0.15717	-0.214000	0.12660	ACG	CABYR	-	NULL	ENSG00000154040		0.488	CABYR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CABYR	HGNC	protein_coding	OTTHUMT00000090926.2	31	0.00	0	C	NM_153770		21735866	21735866	+1	no_errors	ENST00000463087	ensembl	human	known	69_37n	missense	29	19.44	7	SNP	0.000	T
CACNA1E	777	genome.wustl.edu	37	1	181690990	181690990	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:181690990G>A	ENST00000367573.2	+	16	2053	c.2053G>A	c.(2053-2055)Gtg>Atg	p.V685M	CACNA1E_ENST00000367570.1_Missense_Mutation_p.V685M|CACNA1E_ENST00000360108.3_Missense_Mutation_p.V685M|CACNA1E_ENST00000357570.5_Missense_Mutation_p.V636M|CACNA1E_ENST00000358338.5_Missense_Mutation_p.V636M|CACNA1E_ENST00000367567.4_Missense_Mutation_p.V292M|CACNA1E_ENST00000526775.1_Missense_Mutation_p.V685M	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	685					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CTACTTCATTGTGCTCACCTT	0.537																																						dbGAP											0													197.0	200.0	199.0					1																	181690990		2094	4236	6330	-	-	-	SO:0001583	missense	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.2053G>A	1.37:g.181690990G>A	ENSP00000356545:p.Val685Met		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.V685M	ENST00000367573.2	37	c.2053	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.759517	0.89932	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98701	-5.08;-5.08;-5.08;-5.08;-5.08;-5.08;-5.08	5.05	5.05	0.67936	.	0.061993	0.64402	D	0.000004	D	0.98741	0.9577	L	0.50333	1.59	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	D	0.99922	1.1262	10	0.87932	D	0	.	18.0194	0.89251	0.0:0.0:1.0:0.0	.	685;685	Q15878-2;Q15878-3	.;.	M	685;685;636;636;292;685;685	ENSP00000356542:V685M;ENSP00000434814:V685M;ENSP00000350183:V636M;ENSP00000351101:V636M;ENSP00000356539:V292M;ENSP00000353222:V685M;ENSP00000356545:V685M	ENSP00000350183:V636M	V	+	1	0	CACNA1E	179957613	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.730000	0.62015	2.323000	0.78572	0.563000	0.77884	GTG	CACNA1E	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000198216		0.537	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	70	0.00	0	G	NM_000721		181690990	181690990	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	1.000	A
CACNA1H	8912	genome.wustl.edu	37	16	1248638	1248638	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr16:1248638C>G	ENST00000348261.5	+	6	915	c.667C>G	c.(667-669)Ctg>Gtg	p.L223V	CACNA1H_ENST00000565831.1_Missense_Mutation_p.L223V|CACNA1H_ENST00000358590.4_Missense_Mutation_p.L223V	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	223					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	ggtcactctgctgctggatac	0.632																																						dbGAP											0													132.0	148.0	143.0					16																	1248638		2187	4280	6467	-	-	-	SO:0001583	missense	0			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.667C>G	16.37:g.1248638C>G	ENSP00000334198:p.Leu223Val		B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_PKD_2	p.L223V	ENST00000348261.5	37	c.667	CCDS45375.1	16	.	.	.	.	.	.	.	.	.	.	C	12.80	2.047734	0.36085	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.99070	-5.39;-5.39	3.62	2.62	0.31277	Ion transport (1);	0.279854	0.29932	N	0.010822	D	0.98921	0.9634	M	0.74546	2.27	0.29840	N	0.82931	P;D	0.76494	0.911;0.999	P;D	0.85130	0.515;0.997	D	0.95634	0.8692	10	0.54805	T	0.06	.	10.2481	0.43354	0.0:0.8958:0.0:0.1042	.	223;223	O95180-2;O95180	.;CAC1H_HUMAN	V	223	ENSP00000334198:L223V;ENSP00000351401:L223V	ENSP00000334198:L223V	L	+	1	2	CACNA1H	1188639	1.000000	0.71417	1.000000	0.80357	0.278000	0.26855	6.847000	0.75404	1.884000	0.54569	0.538000	0.68166	CTG	CACNA1H	-	pfam_Ion_trans_dom	ENSG00000196557		0.632	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CACNA1H	HGNC	protein_coding	OTTHUMT00000421601.1	43	0.00	0	C	NM_001005407		1248638	1248638	+1	no_errors	ENST00000348261	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	1.000	G
CACNB2	783	genome.wustl.edu	37	10	18827198	18827198	+	Silent	SNP	C	C	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr10:18827198C>A	ENST00000324631.7	+	13	1452	c.1392C>A	c.(1390-1392)acC>acA	p.T464T	CACNB2_ENST00000377328.1_Silent_p.T214T|CACNB2_ENST00000352115.6_Silent_p.T440T|RP11-499P20.2_ENST00000425669.1_RNA|CACNB2_ENST00000377331.2_Silent_p.T412T|CACNB2_ENST00000377319.3_Silent_p.T371T|CACNB2_ENST00000396576.2_Silent_p.T409T|CACNB2_ENST00000282343.8_Silent_p.T436T|CACNB2_ENST00000377329.4_Silent_p.T410T|CACNB2_ENST00000377315.4_Silent_p.T416T	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit	464					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GGAAGGCCACCCATCCTCCCA	0.552																																						dbGAP											0													199.0	184.0	189.0					10																	18827198		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764	ENST00000324631.7:c.1392C>A	10.37:g.18827198C>A			A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Silent	SNP	pfam_Guanylate_kin,pfam_VDCC_L_bsu,superfamily_SH3_domain,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_SH3_domain,prints_VDCC_L_bsu,prints_VDCC_L_b2su	p.T464	ENST00000324631.7	37	c.1392	CCDS7125.1	10																																																																																			CACNB2	-	NULL	ENSG00000165995		0.552	CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CACNB2	HGNC	protein_coding	OTTHUMT00000047072.2	69	0.00	0	C	NM_000724		18827198	18827198	+1	no_errors	ENST00000324631	ensembl	human	known	69_37n	silent	50	12.28	7	SNP	0.851	A
CAPN2	824	genome.wustl.edu	37	1	223934727	223934727	+	Frame_Shift_Del	DEL	G	G	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:223934727delG	ENST00000295006.5	+	5	898	c.589delG	c.(589-591)gggfs	p.G198fs	CAPN2_ENST00000433674.2_Frame_Shift_Del_p.G120fs	NM_001748.4	NP_001739	P17655	CAN2_HUMAN	calpain 2, (m/II) large subunit	198	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				blastocyst development (GO:0001824)|cellular response to amino acid stimulus (GO:0071230)|myoblast fusion (GO:0007520)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of cytoskeleton organization (GO:0051493)|response to hypoxia (GO:0001666)	chromatin (GO:0000785)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|cytoskeletal protein binding (GO:0008092)			breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|stomach(3)	29				GBM - Glioblastoma multiforme(131;0.109)		AGCGCTATCAGGGGGTGCCAC	0.527																																						dbGAP											0													112.0	107.0	109.0					1																	223934727		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			J04700	CCDS31035.1, CCDS53478.1	1q41-q42	2013-01-10			ENSG00000162909	ENSG00000162909	3.4.22.52	"""EF-hand domain containing"""	1479	protein-coding gene	gene with protein product		114230				2852952, 2539381	Standard	NM_001748		Approved	mCANP, CANPml, CANPL2	uc001hob.4	P17655	OTTHUMG00000037376	ENST00000295006.5:c.589delG	1.37:g.223934727delG	ENSP00000295006:p.Gly198fs		A6NDG7|B7ZA96|E7ES58|Q16738|Q6PJT3|Q8WU26|Q9HBB1	Frame_Shift_Del	DEL	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,prints_Calpain_cysteine_protease,pfscan_EF_HAND_2,pfscan_Peptidase_C2_calpain_cat	p.G198fs	ENST00000295006.5	37	c.589	CCDS31035.1	1																																																																																			CAPN2	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease,pfscan_Peptidase_C2_calpain_cat	ENSG00000162909		0.527	CAPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN2	HGNC	protein_coding	OTTHUMT00000090973.1	51	0.00	0	G	NM_001748		223934727	223934727	+1	no_errors	ENST00000295006	ensembl	human	known	69_37n	frame_shift_del	20	23.08	6	DEL	1.000	-
CAPRIN2	65981	genome.wustl.edu	37	12	30904069	30904069	+	Splice_Site	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:30904069T>C	ENST00000395805.2	-	2	968		c.e2-2		CAPRIN2_ENST00000308433.5_Splice_Site|CAPRIN2_ENST00000251071.5_Splice_Site|CAPRIN2_ENST00000417045.1_Splice_Site|CAPRIN2_ENST00000298892.5_Splice_Site	NM_001206856.1	NP_001193785.1			caprin family member 2											breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					CAGTTTGAGCTACAAAAGAGA	0.378																																						dbGAP											0													102.0	97.0	99.0					12																	30904069		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000395805.2:c.421-2A>G	12.37:g.30904069T>C				Splice_Site	SNP	-	e2-2	ENST00000395805.2	37	c.421-2	CCDS55816.1	12	.	.	.	.	.	.	.	.	.	.	T	17.16	3.318286	0.60524	.	.	ENSG00000110888	ENST00000298892;ENST00000395805;ENST00000251071;ENST00000417045;ENST00000537108;ENST00000542550;ENST00000540436;ENST00000540584	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0726	0.72049	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CAPRIN2	30795336	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.254000	0.65457	1.963000	0.57068	0.379000	0.24179	.	CAPRIN2	-	-	ENSG00000110888		0.378	CAPRIN2-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	CAPRIN2	HGNC	protein_coding	OTTHUMT00000403322.2	46	0.00	0	T	NM_023925	Intron	30904069	30904069	-1	no_errors	ENST00000251071	ensembl	human	known	69_37n	splice_site	43	17.31	9	SNP	1.000	C
CBWD1	55871	genome.wustl.edu	37	9	163985	163985	+	Silent	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr9:163985A>G	ENST00000356521.4	-	5	571	c.483T>C	c.(481-483)taT>taC	p.Y161Y	CBWD1_ENST00000377447.3_Silent_p.Y161Y|CBWD1_ENST00000377400.4_Silent_p.Y161Y|CBWD1_ENST00000382447.4_Silent_p.Y161Y|CBWD1_ENST00000314367.10_Silent_p.Y125Y|CBWD1_ENST00000431099.2_Silent_p.Y125Y	NM_018491.3	NP_060961.3	Q9BRT8	CBWD1_HUMAN	COBW domain containing 1	161							ATP binding (GO:0005524)			kidney(1)|lung(2)|ovary(1)|skin(1)	5	all_lung(41;0.218)	all_cancers(5;3.04e-16)|all_epithelial(5;4.68e-12)|all_lung(10;1.94e-10)|Lung NSC(10;3.61e-10)|Acute lymphoblastic leukemia(5;0.00439)|Breast(48;0.0148)|all_hematologic(5;0.024)|Prostate(43;0.122)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		TACCATCAAGATAAATATCAC	0.323																																						dbGAP											0													52.0	80.0	70.0					9																	163985		1501	2702	4203	-	-	-	SO:0001819	synonymous_variant	0			AY343911	CCDS6438.1, CCDS47947.1, CCDS47948.1	9p24.3	2008-02-05			ENSG00000172785	ENSG00000172785			17134	protein-coding gene	gene with protein product		611078				15233989, 12421752	Standard	NM_018491		Approved		uc003zga.4	Q9BRT8	OTTHUMG00000019425	ENST00000356521.4:c.483T>C	9.37:g.163985A>G			A2RU55|A8K3N3|B0AZR4|Q49AJ1|Q5VVK2|Q6VBU6|Q7Z5Z0|Q7Z652|Q9BY38|Q9NYD0	Silent	SNP	pfam_Cbl_biosynth_CobW-like,pfam_Cbl_biosynth_CobW-like_C,superfamily_Cbl_biosynth_CobW-like_C	p.Y161	ENST00000356521.4	37	c.483	CCDS6438.1	9																																																																																			CBWD1	-	pfam_Cbl_biosynth_CobW-like	ENSG00000172785		0.323	CBWD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	CBWD1	HGNC	protein_coding	OTTHUMT00000051463.1	122	0.81	1	A	NM_018491		163985	163985	-1	no_errors	ENST00000356521	ensembl	human	known	69_37n	silent	80	13.98	13	SNP	0.999	G
CCDC110	256309	genome.wustl.edu	37	4	186382306	186382306	+	Missense_Mutation	SNP	G	G	A	rs146969771		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr4:186382306G>A	ENST00000307588.3	-	5	320	c.245C>T	c.(244-246)tCg>tTg	p.S82L	CCDC110_ENST00000507501.1_5'UTR|CCDC110_ENST00000510617.1_Missense_Mutation_p.S82L|CCDC110_ENST00000393540.3_Intron	NM_152775.3	NP_689988.1	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110	82						nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(9)	30		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		ACTGATTTCCGACTGTACCTT	0.289													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16616	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													86.0	86.0	86.0					4																	186382306		2203	4296	6499	-	-	-	SO:0001583	missense	0			AB080722	CCDS3843.1, CCDS47170.1	4q35.1	2010-12-24			ENSG00000168491	ENSG00000168491			28504	protein-coding gene	gene with protein product	"""cancer/testis antigen 52"""	609488				18160854	Standard	NM_152775		Approved	KM-HN-1, MGC33607, CT52	uc003ixu.4	Q8TBZ0	OTTHUMG00000160415	ENST00000307588.3:c.245C>T	4.37:g.186382306G>A	ENSP00000306776:p.Ser82Leu		Q86YI9|Q8N7W0	Missense_Mutation	SNP	superfamily_4_helix_cytokine-like_core	p.S82L	ENST00000307588.3	37	c.245	CCDS3843.1	4	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	16.20	3.056064	0.55325	.	.	ENSG00000168491	ENST00000307588;ENST00000510617;ENST00000506876	T;T;T	0.63580	2.76;2.77;-0.05	5.95	5.95	0.96441	.	0.000000	0.56097	D	0.000039	T	0.61986	0.2391	M	0.66939	2.045	0.35906	D	0.830775	B;B	0.14012	0.009;0.009	B;B	0.11329	0.006;0.006	T	0.65109	-0.6248	10	0.52906	T	0.07	-11.9567	14.6347	0.68680	0.0:0.1451:0.8549:0.0	.	82;82	B4DZA2;Q8TBZ0	.;CC110_HUMAN	L	82	ENSP00000306776:S82L;ENSP00000427246:S82L;ENSP00000425276:S82L	ENSP00000306776:S82L	S	-	2	0	CCDC110	186619300	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.953000	0.49105	2.824000	0.97209	0.655000	0.94253	TCG	CCDC110	-	NULL	ENSG00000168491		0.289	CCDC110-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC110	HGNC	protein_coding	OTTHUMT00000360519.2	88	0.00	0	G	NM_152775		186382306	186382306	-1	no_errors	ENST00000307588	ensembl	human	known	69_37n	missense	57	17.39	12	SNP	1.000	A
CCDC138	165055	genome.wustl.edu	37	2	109432417	109432417	+	Silent	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:109432417T>C	ENST00000295124.4	+	10	1122	c.1062T>C	c.(1060-1062)gtT>gtC	p.V354V	CCDC138_ENST00000412964.2_Silent_p.V354V	NM_144978.1	NP_659415.1	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	354										endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	14						ATGGGCAAGTTTATGAACTTT	0.313																																						dbGAP											0													89.0	92.0	91.0					2																	109432417		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK057307	CCDS2080.1	2q13	2008-02-05			ENSG00000163006	ENSG00000163006			26531	protein-coding gene	gene with protein product						12477932	Standard	NM_144978		Approved	FLJ32745	uc002ten.1	Q96M89	OTTHUMG00000130980	ENST00000295124.4:c.1062T>C	2.37:g.109432417T>C			Q05DF1|Q4ZG07|Q53TE1|Q6ZUY5|Q86VL7	Missense_Mutation	SNP	NULL	p.F251S	ENST00000295124.4	37	c.752	CCDS2080.1	2	.	.	.	.	.	.	.	.	.	.	T	9.744	1.165631	0.21538	.	.	ENSG00000163006	ENST00000456512	.	.	.	6.07	2.02	0.26589	.	.	.	.	.	T	0.42404	0.1201	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28902	-1.0029	4	.	.	.	-0.5188	0.9356	0.01344	0.3189:0.1159:0.139:0.4262	.	.	.	.	S	251	.	.	F	+	2	0	CCDC138	108798849	0.995000	0.38212	1.000000	0.80357	0.992000	0.81027	0.043000	0.13971	0.524000	0.28502	0.533000	0.62120	TTT	CCDC138	-	NULL	ENSG00000163006		0.313	CCDC138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC138	HGNC	protein_coding	OTTHUMT00000253593.1	64	0.00	0	T	NM_144978		109432417	109432417	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000456512	ensembl	human	novel	69_37n	missense	46	17.86	10	SNP	0.998	C
CCDC168	643677	genome.wustl.edu	37	13	103382857	103382857	+	Silent	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr13:103382857T>C	ENST00000322527.2	-	1	6302	c.6303A>G	c.(6301-6303)aaA>aaG	p.K2101K		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	2101																	CATGATATTGTTTGTTTTTTT	0.403																																						dbGAP											0													70.0	59.0	62.0					13																	103382857		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.6303A>G	13.37:g.103382857T>C			Q8N800	Silent	SNP	NULL	p.K2101	ENST00000322527.2	37	c.6303		13																																																																																			CCDC168	-	NULL	ENSG00000175820		0.403	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		59	0.00	0	T	NM_001146197		103382857	103382857	-1	no_errors	ENST00000322527	ensembl	human	known	69_37n	silent	43	12.24	6	SNP	0.000	C
CCDC24	149473	genome.wustl.edu	37	1	44461500	44461500	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:44461500G>A	ENST00000372318.3	+	8	844	c.673G>A	c.(673-675)Ggg>Agg	p.G225R	CCDC24_ENST00000479055.1_3'UTR|SLC6A9_ENST00000372306.3_Intron|SLC6A9_ENST00000372307.3_Intron	NM_152499.1	NP_689712.1	Q8N4L8	CCD24_HUMAN	coiled-coil domain containing 24	225										endometrium(3)|large_intestine(2)|lung(3)|stomach(1)	9	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				GGCATCTGTGGGGCCTTCTTG	0.537																																						dbGAP											0													114.0	115.0	115.0					1																	44461500		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS507.1	1p34.1	2008-02-05			ENSG00000159214	ENSG00000159214			28688	protein-coding gene	gene with protein product						12477932	Standard	NM_152499		Approved	MGC45441	uc001clj.3	Q8N4L8	OTTHUMG00000008299	ENST00000372318.3:c.673G>A	1.37:g.44461500G>A	ENSP00000361392:p.Gly225Arg		Q6RWT2	Missense_Mutation	SNP	NULL	p.G225R	ENST00000372318.3	37	c.673	CCDS507.1	1	.	.	.	.	.	.	.	.	.	.	G	10.03	1.238194	0.22711	.	.	ENSG00000159214	ENST00000372318	.	.	.	5.03	-2.38	0.06622	.	2.017810	0.02550	N	0.095608	T	0.15652	0.0377	N	0.04508	-0.205	0.09310	N	1	B;B	0.11235	0.0;0.004	B;B	0.14578	0.002;0.011	T	0.15321	-1.0441	9	0.10902	T	0.67	-44.4115	5.5611	0.17144	0.2996:0.4136:0.2868:0.0	.	189;225	Q8N4L8-2;Q8N4L8	.;CCD24_HUMAN	R	225	.	ENSP00000361392:G225R	G	+	1	0	CCDC24	44234087	0.000000	0.05858	0.000000	0.03702	0.822000	0.46500	-0.598000	0.05706	-0.374000	0.07967	0.514000	0.50259	GGG	CCDC24	-	NULL	ENSG00000159214		0.537	CCDC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC24	HGNC	protein_coding	OTTHUMT00000022865.1	43	0.00	0	G	NM_152499		44461500	44461500	+1	no_errors	ENST00000372318	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	0.000	A
CDC6	990	genome.wustl.edu	37	17	38449856	38449857	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	AT	AT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:38449856_38449857delAT	ENST00000209728.4	+	5	1280_1281	c.809_810delAT	c.(808-810)catfs	p.H270fs		NM_001254.3	NP_001245.1	Q99741	CDC6_HUMAN	cell division cycle 6	270					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|positive regulation of chromosome segregation (GO:0051984)|positive regulation of cytokinesis (GO:0032467)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|traversing start control point of mitotic cell cycle (GO:0007089)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|kinase binding (GO:0019900)|nucleotide binding (GO:0000166)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	21						TTGGAAAAACATATGACTGCAG	0.45																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U77949	CCDS11365.1	17q21.3	2013-01-17	2013-01-17		ENSG00000094804	ENSG00000094804			1744	protein-coding gene	gene with protein product		602627	"""CDC6 (cell division cycle 6, S. cerevisiae) homolog"", ""CDC6 cell division cycle 6 homolog (S. cerevisiae)"", ""cell division cycle 6 homolog (S. cerevisiae)"""	CDC18L		8990175, 9566895	Standard	NM_001254		Approved		uc002huj.1	Q99741	OTTHUMG00000133324	ENST00000209728.4:c.809_810delAT	17.37:g.38449858_38449859delAT	ENSP00000209728:p.His270fs		Q8TB30	Frame_Shift_Del	DEL	pfam_ATPase_AAA_core,pfam_Cdc6_C_dom,smart_AAA+_ATPase,pirsf_Cell_div_Cdc6	p.M271fs	ENST00000209728.4	37	c.809_810	CCDS11365.1	17																																																																																			CDC6	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase,pirsf_Cell_div_Cdc6	ENSG00000094804		0.450	CDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC6	HGNC	protein_coding	OTTHUMT00000257129.1	45	0.00	0	AT			38449856	38449857	+1	no_errors	ENST00000209728	ensembl	human	known	69_37n	frame_shift_del	31	13.89	5	DEL	0.453:0.405	-
CDK11B	984	genome.wustl.edu	37	1	1573880	1573880	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:1573880C>T	ENST00000407249.3	-	13	1332	c.1333G>A	c.(1333-1335)Gca>Aca	p.A445T	CDK11B_ENST00000341832.6_Missense_Mutation_p.A398T|CDK11B_ENST00000340677.5_Missense_Mutation_p.A432T|CDK11B_ENST00000317673.7_Missense_Mutation_p.A443T			P21127	CD11B_HUMAN	cyclin-dependent kinase 11B	455	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(3)|lung(4)|skin(1)|stomach(2)	12						TTGTCTTTTGCTCTGTAGACC	0.632																																						dbGAP											0													25.0	24.0	24.0					1																	1573880		1788	3996	5784	-	-	-	SO:0001583	missense	0			AK000081	CCDS72682.1, CCDS72683.1, CCDS72684.1	1p36.33	2013-09-24	2009-12-16	2009-12-16	ENSG00000248333	ENSG00000248333		"""Cyclin-dependent kinases"""	1729	protein-coding gene	gene with protein product		176873	"""cell division cycle 2-like 1 (PITSLRE proteins)"""	CDC2L1		1774066, 14511641, 19884882	Standard	XM_006711061		Approved	CDK11-p110, CDK11-p58, CDK11-p46	uc001agv.1	P21127	OTTHUMG00000078638	ENST00000407249.3:c.1333G>A	1.37:g.1573880C>T	ENSP00000464036:p.Ala445Thr		O95265|Q12817|Q12818|Q12819|Q12820|Q12822|Q8N530|Q9NZS5|Q9UBJ0|Q9UBQ1|Q9UBR0|Q9UNY2|Q9UP57|Q9UP58|Q9UP59	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A445T	ENST00000407249.3	37	c.1333		1																																																																																			CDK11B	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000248333		0.632	CDK11B-204	KNOWN	basic|appris_candidate_longest	protein_coding	CDK11B	HGNC	protein_coding		142	0.00	0	C	NM_001787		1573880	1573880	-1	no_errors	ENST00000407249	ensembl	human	known	69_37n	missense	45	13.46	7	SNP	1.000	T
CDK5RAP2	55755	genome.wustl.edu	37	9	123220813	123220813	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr9:123220813C>T	ENST00000349780.4	-	20	2469	c.2290G>A	c.(2290-2292)Gca>Aca	p.A764T	CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.A764T|CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.A732T|CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.A764T	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	764					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						CAGCCAGGTGCGTGGGCCCCA	0.458																																						dbGAP											0													102.0	98.0	100.0					9																	123220813		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.2290G>A	9.37:g.123220813C>T	ENSP00000343818:p.Ala764Thr		Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	pfam_Spindle_assoc	p.A764T	ENST00000349780.4	37	c.2290	CCDS6823.1	9	.	.	.	.	.	.	.	.	.	.	C	8.578	0.881712	0.17467	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000416449	T;T;T;T;T	0.16897	3.99;3.88;3.94;3.85;2.31	5.63	-1.49	0.08718	.	0.965702	0.08582	N	0.924460	T	0.04588	0.0125	N	0.01576	-0.805	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.0;0.0	T	0.42616	-0.9441	10	0.06625	T	0.88	.	6.9116	0.24338	0.0:0.2518:0.12:0.6283	.	533;764;764;158	Q6MZT4;Q96SN8-4;Q96SN8;B1AMJ5	.;.;CK5P2_HUMAN;.	T	732;764;764;764;158	ENSP00000354065:A732T;ENSP00000352258:A764T;ENSP00000343818:A764T;ENSP00000353317:A764T;ENSP00000400395:A158T	ENSP00000343818:A764T	A	-	1	0	CDK5RAP2	122260634	0.001000	0.12720	0.000000	0.03702	0.089000	0.18198	0.696000	0.25541	-0.123000	0.11745	-1.044000	0.02363	GCA	CDK5RAP2	-	NULL	ENSG00000136861		0.458	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK5RAP2	HGNC	protein_coding	OTTHUMT00000055535.1	61	0.00	0	C	NM_018249		123220813	123220813	-1	no_errors	ENST00000349780	ensembl	human	known	69_37n	missense	45	18.18	10	SNP	0.000	T
CDYL	9425	genome.wustl.edu	37	6	4943948	4943948	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:4943948C>T	ENST00000328908.5	+	7	1583	c.1452C>T	c.(1450-1452)ggC>ggT	p.G484G	CDYL_ENST00000472453.1_3'UTR|CDYL_ENST00000397588.3_Silent_p.G430G|CDYL_ENST00000449732.2_Silent_p.G298G|CDYL_ENST00000343762.5_Silent_p.G298G			Q9Y232	CDYL1_HUMAN	chromodomain protein, Y-like	484					regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(2)|large_intestine(9)|lung(13)|skin(1)|stomach(2)|urinary_tract(1)	30	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		GTCCAGATGGCTGTTCTACCG	0.403																																						dbGAP											0													120.0	123.0	122.0					6																	4943948		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF081258	CCDS4491.2, CCDS47364.1	6p25.1	2010-05-04	2003-09-12		ENSG00000153046	ENSG00000153046			1811	protein-coding gene	gene with protein product	"""CDY-like, autosomal"", ""testis-specific chromodomain Y-like protein"""	603778	"""chromodomain protein, Y chromosome-like"""			10192397	Standard	NM_001143970		Approved	DKFZP586C1622, CDYL1	uc003mwj.3	Q9Y232	OTTHUMG00000014170	ENST00000328908.5:c.1452C>T	6.37:g.4943948C>T			A8K6D6|B4DLG4|Q0VDG7|Q32NC5|Q5VX99|Q6P7T5|Q9BWZ2|Q9Y424	Silent	SNP	pfam_Crotonase_core,pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.G484	ENST00000328908.5	37	c.1452		6																																																																																			CDYL	-	pfam_Crotonase_core	ENSG00000153046		0.403	CDYL-001	KNOWN	basic	protein_coding	CDYL	HGNC	protein_coding	OTTHUMT00000039736.1	73	0.00	0	C	NM_004824		4943948	4943948	+1	no_errors	ENST00000328908	ensembl	human	known	69_37n	silent	34	10.53	4	SNP	1.000	T
CELA3B	23436	genome.wustl.edu	37	1	22310304	22310304	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:22310304C>T	ENST00000337107.6	+	5	499	c.480C>T	c.(478-480)acC>acT	p.T160T		NM_007352.2	NP_031378.1	P08861	CEL3B_HUMAN	chymotrypsin-like elastase family, member 3B	160	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cholesterol metabolic process (GO:0008203)|proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			breast(2)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						GCTACATCACCGGCTGGGGCC	0.622																																						dbGAP											0													96.0	79.0	85.0					1																	22310304		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M18692	CCDS219.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000219073	ENSG00000219073	3.4.21.70		15945	protein-coding gene	gene with protein product	"""proteinase E"", ""elastase 1"", ""cholesterol-binding pancreatic protease"", ""pancreatic endopeptidase E"""		"""elastase 3B, pancreatic"""	ELA3B		2826474, 2460440	Standard	NM_007352		Approved	CBPP	uc001bfk.3	P08861	OTTHUMG00000002758	ENST00000337107.6:c.480C>T	1.37:g.22310304C>T			B2RE44|P11423|Q5VU28|Q5VU29|Q5VU30	Silent	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.T160	ENST00000337107.6	37	c.480	CCDS219.1	1																																																																																			CELA3B	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000219073		0.622	CELA3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELA3B	HGNC	protein_coding	OTTHUMT00000007797.1	29	0.00	0	C	NM_007352		22310304	22310304	+1	no_errors	ENST00000337107	ensembl	human	known	69_37n	silent	22	21.43	6	SNP	0.237	T
CEP350	9857	genome.wustl.edu	37	1	179959671	179959671	+	Silent	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:179959671A>G	ENST00000367607.3	+	4	568	c.150A>G	c.(148-150)gtA>gtG	p.V50V		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	50					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						AATTAGAAGTAGCCCCTACAA	0.338																																						dbGAP											0													48.0	47.0	47.0					1																	179959671		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.150A>G	1.37:g.179959671A>G			O75068|Q8TDK3|Q8WY20	Silent	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.V50	ENST00000367607.3	37	c.150	CCDS1336.1	1																																																																																			CEP350	-	NULL	ENSG00000135837		0.338	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	40	0.00	0	A	NM_014810		179959671	179959671	+1	no_errors	ENST00000367607	ensembl	human	known	69_37n	silent	43	10.42	5	SNP	0.998	G
CENPF	1063	genome.wustl.edu	37	1	214814654	214814654	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:214814654G>A	ENST00000366955.3	+	12	3141	c.2973G>A	c.(2971-2973)atG>atA	p.M991I		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AAGAGAAGATGAACTTAATCC	0.333																																					Colon(80;575 1284 11000 14801 43496)	dbGAP											0													73.0	82.0	79.0					1																	214814654		2190	4294	6484	-	-	-	SO:0001583	missense	0			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.2973G>A	1.37:g.214814654G>A	ENSP00000355922:p.Met991Ile		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_Centromere_CenpF_Rb-prot-bd	p.M991I	ENST00000366955.3	37	c.2973	CCDS31023.1	1	.	.	.	.	.	.	.	.	.	.	G	0.044	-1.274376	0.01421	.	.	ENSG00000117724	ENST00000366955	T	0.02974	4.09	5.16	-0.588	0.11687	.	0.642969	0.13790	N	0.362582	T	0.01627	0.0052	.	.	.	0.09310	N	0.999999	B	0.18013	0.025	B	0.12837	0.008	T	0.46775	-0.9167	9	0.31617	T	0.26	.	0.2943	0.00263	0.3653:0.1434:0.201:0.2903	.	991	P49454	CENPF_HUMAN	I	991	ENSP00000355922:M991I	ENSP00000355922:M991I	M	+	3	0	CENPF	212881277	0.047000	0.20315	0.072000	0.20136	0.756000	0.42949	0.570000	0.23653	-0.082000	0.12640	0.609000	0.83330	ATG	CENPF	-	NULL	ENSG00000117724		0.333	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1	23	0.00	0	G	NM_016343		214814654	214814654	+1	no_errors	ENST00000366955	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	0.130	A
CHST11	50515	genome.wustl.edu	37	12	105151273	105151273	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:105151273C>T	ENST00000303694.5	+	3	1190	c.751C>T	c.(751-753)Cgg>Tgg	p.R251W	CHST11_ENST00000549260.1_Missense_Mutation_p.R246W	NM_018413.5	NP_060883.1	Q9NPF2	CHSTB_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 11	251					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondrocyte development (GO:0002063)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|developmental growth (GO:0048589)|embryonic digit morphogenesis (GO:0042733)|embryonic viscerocranium morphogenesis (GO:0048703)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|polysaccharide localization (GO:0033037)|post-anal tail morphogenesis (GO:0036342)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)	18						ACACACCCAGCGGGAGGAGCC	0.572																																						dbGAP											0													144.0	115.0	125.0					12																	105151273		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB042326	CCDS9099.1, CCDS55878.1	12q23.3	2008-02-05				ENSG00000171310	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17422	protein-coding gene	gene with protein product		610128				10781601	Standard	NM_018413		Approved	C4ST1, C4St-1, C4ST, HSA269537	uc001tkz.3	Q9NPF2	OTTHUMG00000169803	ENST00000303694.5:c.751C>T	12.37:g.105151273C>T	ENSP00000305725:p.Arg251Trp		A8K4F8|Q9NXY6|Q9NY36	Missense_Mutation	SNP	pfam_Sulfotransferase	p.R251W	ENST00000303694.5	37	c.751	CCDS9099.1	12	.	.	.	.	.	.	.	.	.	.	C	17.75	3.467423	0.63625	.	.	ENSG00000171310	ENST00000549260;ENST00000303694	T;T	0.75367	-0.93;-0.93	5.38	4.41	0.53225	.	0.097447	0.64402	D	0.000004	D	0.84660	0.5521	M	0.82630	2.6	0.80722	D	1	D;D	0.69078	0.996;0.997	P;D	0.68039	0.889;0.955	D	0.86154	0.1589	10	0.72032	D	0.01	-8.7504	10.8378	0.46698	0.4237:0.5763:0.0:0.0	.	246;251	Q9NPF2-2;Q9NPF2	.;CHSTB_HUMAN	W	246;251	ENSP00000450004:R246W;ENSP00000305725:R251W	ENSP00000305725:R251W	R	+	1	2	CHST11	103675403	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.842000	0.39250	2.531000	0.85337	0.561000	0.74099	CGG	CHST11	-	pfam_Sulfotransferase	ENSG00000171310		0.572	CHST11-001	KNOWN	basic|CCDS	protein_coding	CHST11	HGNC	protein_coding	OTTHUMT00000405960.2	60	0.00	0	C	NM_018413		105151273	105151273	+1	no_errors	ENST00000303694	ensembl	human	known	69_37n	missense	27	17.65	6	SNP	1.000	T
CITED1	4435	genome.wustl.edu	37	X	71521829	71521829	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chrX:71521829G>A	ENST00000246139.5	-	3	901	c.326C>T	c.(325-327)gCt>gTt	p.A109V	CITED1_ENST00000445983.1_Missense_Mutation_p.A109V|CITED1_ENST00000373619.3_Missense_Mutation_p.A109V|CITED1_ENST00000431381.1_Missense_Mutation_p.A135V	NM_004143.3	NP_004134.2	Q99966	CITE1_HUMAN	Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1	109					apoptotic process (GO:0006915)|brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell proliferation (GO:0008283)|embryonic axis specification (GO:0000578)|labyrinthine layer development (GO:0060711)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|mesenchymal to epithelial transition (GO:0060231)|metanephros development (GO:0001656)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|pigmentation (GO:0043473)|placenta development (GO:0001890)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to estrogen (GO:0043627)|response to insulin (GO:0032868)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|response to interleukin-11 (GO:0071105)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-6 (GO:0070741)|response to interleukin-9 (GO:0071104)|response to lipopolysaccharide (GO:0032496)|response to parathyroid hormone (GO:0071107)|response to transforming growth factor beta (GO:0071559)|SMAD protein signal transduction (GO:0060395)|spongiotrophoblast layer development (GO:0060712)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|LBD domain binding (GO:0050693)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			skin(1)	1	Renal(35;0.156)					TGGAGTGGCAGCAGCCATCCC	0.612																																						dbGAP											0													20.0	21.0	20.0					X																	71521829		2203	4298	6501	-	-	-	SO:0001583	missense	0			U65092	CCDS14419.1, CCDS48136.1	Xq13.1	2008-02-05			ENSG00000125931	ENSG00000125931			1986	protein-coding gene	gene with protein product		300149		MSG1		8901575, 9721210	Standard	NM_004143		Approved		uc011mqc.2	Q99966	OTTHUMG00000021812	ENST00000246139.5:c.326C>T	X.37:g.71521829G>A	ENSP00000246139:p.Ala109Val		B5BU50|B5BUI2	Missense_Mutation	SNP	pfam_CITED	p.A135V	ENST00000246139.5	37	c.404	CCDS14419.1	X	.	.	.	.	.	.	.	.	.	.	G	4.880	0.163648	0.09287	.	.	ENSG00000125931	ENST00000453707;ENST00000431381;ENST00000445983;ENST00000373619;ENST00000246139;ENST00000417400;ENST00000427412	T;T;T;T;T;T;T	0.64991	-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.13	5.64	0.648	0.17801	.	0.414190	0.23319	N	0.049475	T	0.44435	0.1293	L	0.50333	1.59	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.003	T	0.11397	-1.0589	10	0.23891	T	0.37	-1.7609	0.7635	0.01011	0.1918:0.1543:0.3324:0.3216	.	135;109	Q99966-2;Q99966	.;CITE1_HUMAN	V	135;135;109;109;109;109;135	ENSP00000401764:A135V;ENSP00000388548:A135V;ENSP00000403274:A109V;ENSP00000362721:A109V;ENSP00000246139:A109V;ENSP00000414781:A109V;ENSP00000391407:A135V	ENSP00000246139:A109V	A	-	2	0	CITED1	71438554	0.061000	0.20836	0.006000	0.13384	0.177000	0.22998	0.228000	0.17814	0.552000	0.29026	-0.205000	0.12727	GCT	CITED1	-	pfam_CITED	ENSG00000125931		0.612	CITED1-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	CITED1	HGNC	protein_coding	OTTHUMT00000057181.1	47	0.00	0	G	NM_004143		71521829	71521829	-1	no_errors	ENST00000431381	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.003	A
CLCN2	1181	genome.wustl.edu	37	3	184072690	184072690	+	Splice_Site	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr3:184072690A>G	ENST00000265593.4	-	13	1568		c.e13+1		CLCN2_ENST00000434054.2_Splice_Site|CLCN2_ENST00000475279.1_5'Flank|CLCN2_ENST00000344937.7_Splice_Site|CLCN2_ENST00000457512.1_Splice_Site|EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000423355.2_Intron	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2						cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	CTGAGAACTCACCAATGACAA	0.612																																						dbGAP											0													80.0	80.0	80.0					3																	184072690		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.1396+1T>C	3.37:g.184072690A>G			B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Splice_Site	SNP	-	e13+2	ENST00000265593.4	37	c.1396+2	CCDS3263.1	3	.	.	.	.	.	.	.	.	.	.	A	19.68	3.873606	0.72180	.	.	ENSG00000114859	ENST00000265593;ENST00000344937;ENST00000434054;ENST00000457512	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0111	0.71550	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CLCN2	185555384	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	9.339000	0.96797	2.042000	0.60477	0.379000	0.24179	.	CLCN2	-	-	ENSG00000114859		0.612	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLCN2	HGNC	protein_coding	OTTHUMT00000345571.1	27	0	0	A		Intron	184072690	184072690	-1	no_errors	ENST00000265593	ensembl	human	known	69_37n	splice_site	16	30.43	7	SNP	1.000	G
CLRN3	119467	genome.wustl.edu	37	10	129676623	129676623	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr10:129676623G>A	ENST00000368671.3	-	3	633	c.471C>T	c.(469-471)tcC>tcT	p.S157S		NM_152311.3	NP_689524.1	Q8NCR9	CLRN3_HUMAN	clarin 3	157						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.S157S(1)		endometrium(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6		all_epithelial(44;0.00168)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)|Colorectal(57;0.235)				ACAACTCTTCGGAGAGTTGGT	0.468																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											166.0	132.0	143.0					10																	129676623		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC029478	CCDS7656.1	10q26.2	2006-11-24	2006-11-23	2006-11-23	ENSG00000180745	ENSG00000180745			20795	protein-coding gene	gene with protein product			"""transmembrane protein 12"""	TMEM12		12145752, 12080385	Standard	NM_152311		Approved	MGC32871, USH3AL1	uc001lka.1	Q8NCR9	OTTHUMG00000019253	ENST00000368671.3:c.471C>T	10.37:g.129676623G>A			Q6MZX8	Silent	SNP	NULL	p.S157	ENST00000368671.3	37	c.471	CCDS7656.1	10																																																																																			CLRN3	-	NULL	ENSG00000180745		0.468	CLRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLRN3	HGNC	protein_coding	OTTHUMT00000050987.1	36	0.00	0	G	NM_152311		129676623	129676623	-1	no_errors	ENST00000368671	ensembl	human	known	69_37n	silent	29	23.68	9	SNP	0.000	A
CNIH3	149111	genome.wustl.edu	37	1	224872505	224872505	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:224872505G>A	ENST00000272133.3	+	3	1040	c.158G>A	c.(157-159)cGg>cAg	p.R53Q		NM_152495.1	NP_689708.1	Q8TBE1	CNIH3_HUMAN	cornichon family AMPA receptor auxiliary protein 3	53					intracellular signal transduction (GO:0035556)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of membrane potential (GO:0042391)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|postsynaptic membrane (GO:0045211)	channel regulator activity (GO:0016247)	p.R53P(1)		large_intestine(5)|lung(4)	9	Breast(184;0.218)			GBM - Glioblastoma multiforme(131;0.073)		TAGAGGGAACGGTTGAGGAAC	0.542																																						dbGAP											1	Substitution - Missense(1)	lung(1)											187.0	154.0	165.0					1																	224872505		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF070524	CCDS1544.1	1q42.12	2013-08-28	2013-08-28		ENSG00000143786	ENSG00000143786			26802	protein-coding gene	gene with protein product			"""cornichon homolog 3 (Drosophila)"""			8619474, 9110174	Standard	NM_152495		Approved	FLJ38993, CNIH-3	uc001hos.1	Q8TBE1	OTTHUMG00000037634	ENST00000272133.3:c.158G>A	1.37:g.224872505G>A	ENSP00000272133:p.Arg53Gln			Missense_Mutation	SNP	pfam_Cornichon	p.R53Q	ENST00000272133.3	37	c.158	CCDS1544.1	1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.204962	0.79127	.	.	ENSG00000143786	ENST00000272133	.	.	.	4.49	4.49	0.54785	.	0.000000	0.85682	U	0.000000	T	0.63010	0.2475	N	0.22421	0.69	0.54753	D	0.999989	D	0.89917	1.0	D	0.87578	0.998	T	0.62599	-0.6820	9	0.32370	T	0.25	-14.8808	15.9805	0.80105	0.0:0.0:1.0:0.0	.	53	Q8TBE1	CNIH3_HUMAN	Q	53	.	ENSP00000272133:R53Q	R	+	2	0	CNIH3	222939128	0.998000	0.40836	1.000000	0.80357	0.889000	0.51656	6.605000	0.74155	2.063000	0.61619	0.551000	0.68910	CGG	CNIH3	-	NULL	ENSG00000143786		0.542	CNIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNIH3	HGNC	protein_coding	OTTHUMT00000091752.2	125	0.00	0	G	NM_152495		224872505	224872505	+1	no_errors	ENST00000272133	ensembl	human	known	69_37n	missense	44	16.98	9	SNP	1.000	A
CPEB1	64506	genome.wustl.edu	37	15	83240148	83240148	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr15:83240148G>A	ENST00000562019.1	-	3	641	c.325C>T	c.(325-327)Cga>Tga	p.R109*	CPEB1_ENST00000450751.2_Nonsense_Mutation_p.R34*|CPEB1_ENST00000398591.2_Nonsense_Mutation_p.R34*|CPEB1_ENST00000568757.1_Nonsense_Mutation_p.R34*|CPEB1_ENST00000563800.1_Nonsense_Mutation_p.R136*|CPEB1_ENST00000423133.2_Nonsense_Mutation_p.R34*|CPEB1_ENST00000398592.2_5'UTR|CPEB1_ENST00000564522.1_Nonsense_Mutation_p.R34*|CPEB1_ENST00000261723.6_Nonsense_Mutation_p.R112*|CPEB1_ENST00000568128.1_Nonsense_Mutation_p.R109*			Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding protein 1	109					cellular response to amino acid stimulus (GO:0071230)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|mRNA processing (GO:0006397)|negative regulation of cytoplasmic translation (GO:2000766)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(1)|skin(1)	28			BRCA - Breast invasive adenocarcinoma(143;0.229)			CTCCAGGGTCGGTCCCAGCCT	0.592																																						dbGAP											0													97.0	100.0	99.0					15																	83240148		1990	4178	6168	-	-	-	SO:0001587	stop_gained	0			AF329402	CCDS42072.1, CCDS45329.1, CCDS45330.1, CCDS42072.2, CCDS45329.2, CCDS45330.2	15q25.1	2008-02-05				ENSG00000214575			21744	protein-coding gene	gene with protein product		607342				11223249	Standard	NM_001079533		Approved	FLJ13203, CPEB	uc002biv.3	Q9BZB8		ENST00000562019.1:c.325C>T	15.37:g.83240148G>A	ENSP00000457836:p.Arg109*		B7Z6C6|Q86W46|Q8IV41|Q9BZB7|Q9H8V5	Nonsense_Mutation	SNP	pfscan_RRM_dom	p.R109*	ENST00000562019.1	37	c.325		15	.	.	.	.	.	.	.	.	.	.	G	26.7	4.759001	0.89843	.	.	ENSG00000214575	ENST00000450751;ENST00000398593;ENST00000423133;ENST00000398591;ENST00000261723	.	.	.	5.71	2.45	0.29901	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.2381	14.2622	0.66092	0.0:0.0:0.4614:0.5386	.	.	.	.	X	109;109;34;34;112	.	ENSP00000261723:R112X	R	-	1	2	CPEB1	81037203	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.442000	0.35046	0.718000	0.32166	0.557000	0.71058	CGA	CPEB1	-	NULL	ENSG00000214575		0.592	CPEB1-006	KNOWN	basic|appris_candidate_longest	protein_coding	CPEB1	HGNC	protein_coding	OTTHUMT00000421102.1	70	0.00	0	G	NM_030594		83240148	83240148	-1	no_errors	ENST00000562019	ensembl	human	known	69_37n	nonsense	25	19.35	6	SNP	1.000	A
CREB5	9586	genome.wustl.edu	37	7	28610052	28610052	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:28610052C>T	ENST00000357727.2	+	5	751	c.361C>T	c.(361-363)Cgg>Tgg	p.R121W	CREB5_ENST00000396300.2_Missense_Mutation_p.R114W|CREB5_ENST00000409603.1_Missense_Mutation_p.R88W|CREB5_ENST00000396299.2_Missense_Mutation_p.R88W	NM_182898.2	NP_878901.2	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	121					adipose tissue development (GO:0060612)|fat cell differentiation (GO:0045444)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(13)|prostate(1)|skin(3)	32						TAGCAGCGCTCGGCTGCCCAA	0.577																																						dbGAP											0													103.0	92.0	96.0					7																	28610052		2203	4300	6503	-	-	-	SO:0001583	missense	0			L05515	CCDS5417.1, CCDS5418.1, CCDS43562.1, CCDS43563.1	7p15	2013-01-10			ENSG00000146592	ENSG00000146592		"""basic leucine zipper proteins"""	16844	protein-coding gene	gene with protein product	"""cAMP response element binding protein CRE-Bpa"""					8378084, 8440710	Standard	XM_005249906		Approved	H_GS165L15.1, CRE-BPA	uc003szr.3	Q02930	OTTHUMG00000097081	ENST00000357727.2:c.361C>T	7.37:g.28610052C>T	ENSP00000350359:p.Arg121Trp		A8KA51|B4DU13|B5BUH3|C9JK47|Q05886|Q06246|Q75N02|Q86UJ9	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,smart_bZIP,pirsf_TF_cAMP-dep,pfscan_Znf_C2H2,pfscan_bZIP	p.R121W	ENST00000357727.2	37	c.361	CCDS5417.1	7	.	.	.	.	.	.	.	.	.	.	C	15.05	2.717622	0.48622	.	.	ENSG00000146592	ENST00000396299;ENST00000424599;ENST00000357727;ENST00000396300;ENST00000409603	T;T;T;T	0.64803	-0.12;-0.11;-0.11;-0.12	5.46	2.35	0.29111	.	0.057209	0.64402	D	0.000002	T	0.70552	0.3237	L	0.47716	1.5	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.70659	-0.4811	10	0.37606	T	0.19	-22.6494	14.4641	0.67472	0.3905:0.6095:0.0:0.0	.	121	Q02930	CREB5_HUMAN	W	88;114;121;114;88	ENSP00000379593:R88W;ENSP00000350359:R121W;ENSP00000379594:R114W;ENSP00000387197:R88W	ENSP00000350359:R121W	R	+	1	2	CREB5	28576577	0.744000	0.28250	0.893000	0.35052	0.768000	0.43524	1.351000	0.34022	1.307000	0.44944	0.655000	0.94253	CGG	CREB5	-	pirsf_TF_cAMP-dep	ENSG00000146592		0.577	CREB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CREB5	HGNC	protein_coding	OTTHUMT00000214204.4	42	0.00	0	C	NM_004904		28610052	28610052	+1	no_errors	ENST00000357727	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	0.984	T
CWC22	57703	genome.wustl.edu	37	2	180809917	180809917	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:180809917G>A	ENST00000410053.3	-	20	2965	c.2666C>T	c.(2665-2667)tCc>tTc	p.S889F	CWC22_ENST00000295749.6_Missense_Mutation_p.S889F	NM_020943.2	NP_065994.1	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein	889					mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(8)|stomach(1)	30						TGATTCTCTGGATTGTTCAGA	0.373																																						dbGAP											0													117.0	102.0	107.0					2																	180809917		1822	4080	5902	-	-	-	SO:0001583	missense	0				CCDS46465.1	2q31.3	2014-07-03	2014-07-03		ENSG00000163510	ENSG00000163510			29322	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein b"""	615186	"""CWC22 spliceosome-associated protein homolog (S. cerevisiae)"""			9136012, 23236153	Standard	NM_020943		Approved	KIAA1604, EIF4GL, fSAPb, NCM	uc010frh.1	Q9HCG8	OTTHUMG00000154244	ENST00000410053.3:c.2666C>T	2.37:g.180809917G>A	ENSP00000387006:p.Ser889Phe		Q05DC2|Q4G135|Q52LF0|Q6PEX2|Q7Z6I0|Q9H5L3|Q9H6Q6	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI	p.S889F	ENST00000410053.3	37	c.2666	CCDS46465.1	2	.	.	.	.	.	.	.	.	.	.	G	17.00	3.277025	0.59758	.	.	ENSG00000163510	ENST00000410053;ENST00000295749	T;T	0.24538	1.85;1.85	5.02	5.02	0.67125	.	0.637896	0.16850	N	0.196964	T	0.38134	0.1029	L	0.47716	1.5	0.31812	N	0.627069	D	0.61697	0.99	D	0.71656	0.974	T	0.09796	-1.0658	10	0.10636	T	0.68	-12.4339	11.5101	0.50488	0.0:0.0:0.8086:0.1914	.	889	Q9HCG8	CWC22_HUMAN	F	889	ENSP00000387006:S889F;ENSP00000295749:S889F	ENSP00000295749:S889F	S	-	2	0	CWC22	180518162	1.000000	0.71417	0.993000	0.49108	0.941000	0.58515	2.094000	0.41719	2.496000	0.84212	0.655000	0.94253	TCC	CWC22	-	NULL	ENSG00000163510		0.373	CWC22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CWC22	HGNC	protein_coding	OTTHUMT00000334537.1	108	0.00	0	G	NM_020943		180809917	180809917	-1	no_errors	ENST00000295749	ensembl	human	known	69_37n	missense	59	18.06	13	SNP	0.980	A
CWF19L1	55280	genome.wustl.edu	37	10	102006652	102006652	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr10:102006652T>C	ENST00000354105.4	-	8	835	c.749A>G	c.(748-750)gAt>gGt	p.D250G	CWF19L1_ENST00000478047.1_Intron|CWF19L1_ENST00000370379.1_Missense_Mutation_p.D5G	NM_018294.4	NP_060764.3	Q69YN2	C19L1_HUMAN	CWF19-like 1, cell cycle control (S. pombe)	250							catalytic activity (GO:0003824)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|stomach(2)	17		Colorectal(252;0.117)		Epithelial(162;3.78e-10)|all cancers(201;3.1e-08)		TTCTGCTGCATCCATTAGCTT	0.408																																						dbGAP											0													94.0	84.0	87.0					10																	102006652		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001860	CCDS7489.1	10q24.31	2008-11-24			ENSG00000095485	ENSG00000095485			25613	protein-coding gene	gene with protein product						14702039	Standard	NM_018294		Approved	FLJ10998	uc001kqq.1	Q69YN2	OTTHUMG00000018901	ENST00000354105.4:c.749A>G	10.37:g.102006652T>C	ENSP00000326411:p.Asp250Gly		B4DHX1|D3DR66|Q5W0I3|Q96HC3|Q9H865|Q9NV13	Missense_Mutation	SNP	pfam_Cwf19-like_C_dom-1,pfam_Cwf19-like_C_dom-2,superfamily_HIT-like	p.D250G	ENST00000354105.4	37	c.749	CCDS7489.1	10	.	.	.	.	.	.	.	.	.	.	T	12.46	1.943292	0.34283	.	.	ENSG00000095485	ENST00000354105;ENST00000370379	T;T	0.34859	1.34;1.34	5.56	0.545	0.17190	.	0.180296	0.64402	N	0.000014	T	0.24661	0.0598	L	0.53249	1.67	0.44268	D	0.997126	B;B	0.31949	0.348;0.001	B;B	0.26310	0.068;0.004	T	0.04203	-1.0969	10	0.25106	T	0.35	-1.6519	5.393	0.16253	0.0:0.2326:0.1435:0.6239	.	113;250	Q69YN2-3;Q69YN2	.;C19L1_HUMAN	G	250;5	ENSP00000326411:D250G;ENSP00000359405:D5G	ENSP00000326411:D250G	D	-	2	0	CWF19L1	101996642	1.000000	0.71417	0.826000	0.32828	0.923000	0.55619	3.006000	0.49529	-0.139000	0.11414	-1.328000	0.01277	GAT	CWF19L1	-	NULL	ENSG00000095485		0.408	CWF19L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CWF19L1	HGNC	protein_coding		79	0.00	0	T	NM_018294		102006652	102006652	-1	no_errors	ENST00000354105	ensembl	human	known	69_37n	missense	42	14.29	7	SNP	0.927	C
FNDC9	408263	genome.wustl.edu	37	5	156766240	156766240	+	IGR	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:156766240A>G	ENST00000312349.4	-	0	2125				CYFIP2_ENST00000541131.1_Missense_Mutation_p.Y779C|CYFIP2_ENST00000521420.1_Missense_Mutation_p.Y828C|CYFIP2_ENST00000435847.2_Missense_Mutation_p.Y553C|CYFIP2_ENST00000522463.1_Missense_Mutation_p.Y658C|CYFIP2_ENST00000442283.2_Missense_Mutation_p.Y139C|CYFIP2_ENST00000377576.3_Missense_Mutation_p.Y854C|CYFIP2_ENST00000318218.6_Missense_Mutation_p.Y879C|CYFIP2_ENST00000347377.6_Missense_Mutation_p.Y854C	NM_001001343.3	NP_001001343.2	Q8TBE3	FNDC9_HUMAN	fibronectin type III domain containing 9							integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	9						CTCCCCAACTACTGCTACAAT	0.587																																						dbGAP											0													101.0	104.0	103.0					5																	156766240		2096	4226	6322	-	-	-	SO:0001628	intergenic_variant	0			BC022570	CCDS4337.1	5q33.3	2013-02-11	2011-01-25	2011-01-25	ENSG00000172568	ENSG00000172568		"""Fibronectin type III domain containing"""	33547	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 40"""	C5orf40			Standard	NM_001001343		Approved	MGC27121	uc003lwu.2	Q8TBE3	OTTHUMG00000130248		5.37:g.156766240A>G			A8K0Y6	Missense_Mutation	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.Y879C	ENST00000312349.4	37	c.2636	CCDS4337.1	5	.	.	.	.	.	.	.	.	.	.	A	23.7	4.441998	0.83993	.	.	ENSG00000055163	ENST00000318218;ENST00000442283;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576;ENST00000541131;ENST00000435847	T;T;T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56;1.56;1.56	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.61223	0.2330	M	0.86953	2.85	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.973	D;D;D;D;D;D	0.91635	0.99;0.997;0.999;0.989;0.997;0.985	T	0.69446	-0.5143	10	0.87932	D	0	-26.7012	14.9903	0.71381	1.0:0.0:0.0:0.0	.	718;658;828;854;854;879	A8MUM2;E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;.;CYFP2_HUMAN	C	879;139;658;828;854;854;779;553	ENSP00000325817:Y879C;ENSP00000390948:Y139C;ENSP00000428009:Y658C;ENSP00000430904:Y828C;ENSP00000313567:Y854C;ENSP00000366799:Y854C;ENSP00000444645:Y779C;ENSP00000403793:Y553C	ENSP00000325817:Y879C	Y	+	2	0	CYFIP2	156698818	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.288000	0.96055	1.956000	0.56807	0.477000	0.44152	TAC	CYFIP2	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub	ENSG00000055163		0.587	FNDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYFIP2	HGNC	protein_coding	OTTHUMT00000252573.2	54	0.00	0	A	NM_001001343		156766240	156766240	+1	no_errors	ENST00000318218	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	1.000	G
DALRD3	55152	genome.wustl.edu	37	3	49055971	49055971	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr3:49055971C>T	ENST00000341949.4	-	1	33	c.27G>A	c.(25-27)ggG>ggA	p.G9G	MIR191_ENST00000384873.1_RNA|NDUFAF3_ENST00000326925.6_5'Flank|DALRD3_ENST00000441576.2_Silent_p.G9G|NDUFAF3_ENST00000395458.2_5'Flank|DALRD3_ENST00000496568.1_Intron|NDUFAF3_ENST00000326912.4_5'Flank|DALRD3_ENST00000440857.1_5'UTR|MIR425_ENST00000362162.1_RNA|DALRD3_ENST00000313778.5_Intron|DALRD3_ENST00000395462.4_5'UTR	NM_001009996.1	NP_001009996.1	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	9					arginyl-tRNA aminoacylation (GO:0006420)		arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)			breast(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CCAGCGTCTCCCCGACCCCAA	0.647																																						dbGAP											0													8.0	11.0	10.0					3																	49055971		2156	4253	6409	-	-	-	SO:0001819	synonymous_variant	0			BC014099	CCDS2783.1, CCDS33754.1, CCDS63632.1	3p21.31	2005-01-10			ENSG00000178149	ENSG00000178149			25536	protein-coding gene	gene with protein product						12477932	Standard	NM_001009996		Approved	FLJ10496	uc003cvk.2	Q5D0E6	OTTHUMG00000156748	ENST00000341949.4:c.27G>A	3.37:g.49055971C>T			Q7Z5S7|Q86WY1|Q8N105|Q8NA89|Q9NVU8	Silent	SNP	pfam_DALR_anticod-bd,superfamily_tRNAsynth_1a_anticodon-bd,smart_DALR_anticod-bd	p.G9	ENST00000341949.4	37	c.27	CCDS33754.1	3																																																																																			DALRD3	-	NULL	ENSG00000178149		0.647	DALRD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DALRD3	HGNC	protein_coding	OTTHUMT00000345581.1	12	0.00	0	C	NM_018114		49055971	49055971	-1	no_errors	ENST00000341949	ensembl	human	known	69_37n	silent	8	38.46	5	SNP	1.000	T
DBR1	51163	genome.wustl.edu	37	3	137880738	137880739	+	In_Frame_Ins	INS	-	-	CAT	rs371659375		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr3:137880738_137880739insCAT	ENST00000260803.4	-	8	1780_1781	c.1627_1628insATG	c.(1627-1629)gca>gATGca	p.542_543insD	DBR1_ENST00000505015.2_In_Frame_Ins_p.308_309insD	NM_016216.3	NP_057300.2	Q9UK59	DBR1_HUMAN	debranching RNA lariats 1	542					mRNA splicing, via spliceosome (GO:0000398)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA lariat debranching enzyme activity (GO:0008419)			NS(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						ATCTTAAGCTGCATCGTCATCA	0.386																																						dbGAP											0										1,4265		0,1,2132						-3.0	0.0			178	3,8251		0,3,4124	no	coding	DBR1	NM_016216.3		0,4,6256	A1A1,A1R,RR		0.0363,0.0234,0.0319				4,12516				-	-	-	SO:0001652	inframe_insertion	0			AF180919	CCDS33863.1	3q22.3	2013-05-01	2013-05-01		ENSG00000138231	ENSG00000138231			15594	protein-coding gene	gene with protein product		607024	"""debranching enzyme (S. Cerevisiae) homolog 1"", ""debranching enzyme homolog 1 (S. cerevisiae)"""			10982890	Standard	NM_016216		Approved		uc003erv.3	Q9UK59	OTTHUMG00000159824	ENST00000260803.4:c.1625_1627dupATG	3.37:g.137880739_137880741dupCAT	ENSP00000260803:p.Asp542_Asp542dup		Q96GH0|Q9NXQ6	In_Frame_Ins	INS	pfam_DBR1_C,pfam_Metallo_PEstase_dom	p.543in_frame_insD	ENST00000260803.4	37	c.1628_1627	CCDS33863.1	3																																																																																			DBR1	-	NULL	ENSG00000138231		0.386	DBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBR1	HGNC	protein_coding	OTTHUMT00000357585.1	117	0.00	0	-			137880738	137880739	-1	no_errors	ENST00000260803	ensembl	human	known	69_37n	in_frame_ins	44	13.73	7	INS	0.000:0.038	CAT
DCHS1	8642	genome.wustl.edu	37	11	6653279	6653279	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr11:6653279C>T	ENST00000299441.3	-	6	3875	c.3464G>A	c.(3463-3465)cGc>cAc	p.R1155H	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1155	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGGTGGATGCGGAAGGCCTT	0.587																																						dbGAP											0													81.0	82.0	82.0					11																	6653279		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.3464G>A	11.37:g.6653279C>T	ENSP00000299441:p.Arg1155His		O15098	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R1155H	ENST00000299441.3	37	c.3464	CCDS7771.1	11	.	.	.	.	.	.	.	.	.	.	C	14.44	2.535971	0.45176	.	.	ENSG00000166341	ENST00000299441	T	0.55413	0.52	4.66	2.77	0.32553	Cadherin (4);Cadherin-like (1);	0.618938	0.14429	N	0.320101	T	0.49304	0.1549	N	0.16862	0.45	0.37968	D	0.933205	D	0.89917	1.0	D	0.83275	0.996	T	0.52510	-0.8566	10	0.37606	T	0.19	.	3.2089	0.06676	0.2064:0.5154:0.0:0.2782	.	1155	Q96JQ0	PCD16_HUMAN	H	1155	ENSP00000299441:R1155H	ENSP00000299441:R1155H	R	-	2	0	DCHS1	6609855	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.004000	0.49513	1.311000	0.45024	0.561000	0.74099	CGC	DCHS1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000166341		0.587	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1	102	0.97	1	C	NM_003737		6653279	6653279	-1	no_errors	ENST00000299441	ensembl	human	known	69_37n	missense	40	16.67	8	SNP	1.000	T
DCLK1	9201	genome.wustl.edu	37	13	36445388	36445388	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr13:36445388T>C	ENST00000360631.3	-	5	1124	c.913A>G	c.(913-915)Agc>Ggc	p.S305G	DCLK1_ENST00000255448.4_Missense_Mutation_p.S305G|DCLK1_ENST00000379892.4_Missense_Mutation_p.S305G			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	305	Pro/Ser-rich.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		GGGGACTTGCTACGCCTGGAC	0.532																																						dbGAP											0													205.0	193.0	197.0					13																	36445388		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.913A>G	13.37:g.36445388T>C	ENSP00000353846:p.Ser305Gly		B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Doublecortin_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Doublecortin_dom,pfscan_Prot_kinase_cat_dom	p.S305G	ENST00000360631.3	37	c.913		13	.	.	.	.	.	.	.	.	.	.	T	20.3	3.971938	0.74246	.	.	ENSG00000133083	ENST00000255448;ENST00000360631;ENST00000539451;ENST00000379892	T;T;T	0.69435	-0.4;-0.4;1.67	5.28	5.28	0.74379	.	0.044520	0.85682	D	0.000000	T	0.73885	0.3644	M	0.74881	2.28	0.49915	D	0.999833	P	0.50528	0.936	P	0.52217	0.693	T	0.71906	-0.4451	10	0.18710	T	0.47	.	15.5029	0.75713	0.0:0.0:0.0:1.0	.	305	O15075-2	.	G	305	ENSP00000255448:S305G;ENSP00000353846:S305G;ENSP00000369222:S305G	ENSP00000255448:S305G	S	-	1	0	DCLK1	35343388	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.611000	0.67674	2.115000	0.64714	0.533000	0.62120	AGC	DCLK1	-	NULL	ENSG00000133083		0.532	DCLK1-010	KNOWN	basic	protein_coding	DCLK1	HGNC	protein_coding	OTTHUMT00000044487.1	94	0.00	0	T	NM_004734		36445388	36445388	-1	no_errors	ENST00000360631	ensembl	human	known	69_37n	missense	50	10.71	6	SNP	1.000	C
DCSTAMP	81501	genome.wustl.edu	37	8	105367367	105367367	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr8:105367367A>G	ENST00000297581.2	+	3	1341	c.1292A>G	c.(1291-1293)cAg>cGg	p.Q431R	DCSTAMP_ENST00000517991.1_Intron|DPYS_ENST00000521601.1_Intron|DCSTAMP_ENST00000520080.1_3'UTR	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	431					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											AGATCAAAGCAGCCGCTGGGA	0.463																																						dbGAP											0													62.0	65.0	64.0					8																	105367367		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.1292A>G	8.37:g.105367367A>G	ENSP00000297581:p.Gln431Arg		B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	SNP	pfam_DC_STAMP-like,superfamily_ABC_transptrTM_dom_typ1	p.Q431R	ENST00000297581.2	37	c.1292	CCDS6301.1	8	.	.	.	.	.	.	.	.	.	.	A	1.894	-0.454783	0.04540	.	.	ENSG00000164935	ENST00000297581	T	0.30182	1.54	5.2	1.34	0.21922	.	0.746779	0.12714	N	0.445311	T	0.18759	0.0450	L	0.41824	1.3	0.29048	N	0.884701	B	0.06786	0.001	B	0.04013	0.001	T	0.25745	-1.0123	10	0.24483	T	0.36	-5.4613	1.1327	0.01749	0.5328:0.1254:0.1628:0.179	.	431	Q9H295	TM7S4_HUMAN	R	431	ENSP00000297581:Q431R	ENSP00000297581:Q431R	Q	+	2	0	TM7SF4	105436543	0.228000	0.23718	0.516000	0.27786	0.676000	0.39594	0.548000	0.23314	0.051000	0.15978	0.533000	0.62120	CAG	DCSTAMP	-	superfamily_ABC_transptrTM_dom_typ1	ENSG00000164935		0.463	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCSTAMP	HGNC	protein_coding	OTTHUMT00000380810.1	44	0.00	0	A	NM_030788		105367367	105367367	+1	no_errors	ENST00000297581	ensembl	human	known	69_37n	missense	34	19.05	8	SNP	0.056	G
DDX27	55661	genome.wustl.edu	37	20	47858504	47858504	+	Frame_Shift_Del	DEL	A	A	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr20:47858504delA	ENST00000371764.4	+	17	2074	c.2065delA	c.(2065-2067)aaafs	p.K691fs	ZNFX1_ENST00000371754.4_Intron|DDX27_ENST00000484427.1_3'UTR|ZNFX1_ENST00000469991.1_Intron	NM_017895.7	NP_060365.7	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	691						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.K691fs*4(3)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	45			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GAAGGATGCCAAAAAAAAGGG	0.488																																						dbGAP											3	Deletion - Frameshift(3)	large_intestine(2)|ovary(1)											67.0	72.0	70.0					20																	47858504		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AL049766	CCDS13416.1	20q13.13	2010-07-06	2003-06-13		ENSG00000124228	ENSG00000124228		"""DEAD-boxes"""	15837	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 27"""				Standard	NM_017895		Approved	dJ686N3.1, DRS1	uc002xuh.3	Q96GQ7	OTTHUMG00000033072	ENST00000371764.4:c.2065delA	20.37:g.47858504delA	ENSP00000360828:p.Lys691fs		A0AVB6|B7ZLY1|Q5VXM7|Q8WYG4|Q969N7|Q96F57|Q96L97|Q9BWY9|Q9BXF0|Q9H990|Q9NWU3|Q9P0C2|Q9UGD6	Frame_Shift_Del	DEL	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.K691fs	ENST00000371764.4	37	c.2065	CCDS13416.1	20																																																																																			DDX27	-	NULL	ENSG00000124228		0.488	DDX27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX27	HGNC	protein_coding	OTTHUMT00000080485.1	48	0.00	0	A			47858504	47858504	+1	no_errors	ENST00000371764	ensembl	human	known	69_37n	frame_shift_del	31	22.50	9	DEL	1.000	-
DEFB136	613210	genome.wustl.edu	37	8	11831477	11831477	+	Missense_Mutation	SNP	G	G	A	rs199745025		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr8:11831477G>A	ENST00000382209.2	-	2	205	c.206C>T	c.(205-207)cCc>cTc	p.P69L		NM_001033018.2	NP_001028190.2	Q30KP8	DB136_HUMAN	defensin, beta 136	69					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				endometrium(2)|large_intestine(1)|lung(4)	7			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.163)		GGCTTGCGGGGGTTGAAAACG	0.448																																						dbGAP											0													196.0	191.0	193.0					8																	11831477		1913	4127	6040	-	-	-	SO:0001583	missense	0			DQ012026	CCDS43709.1	8p23.1	2011-07-19			ENSG00000205884	ENSG00000205884		"""Defensins, beta"""	34433	protein-coding gene	gene with protein product						16033865	Standard	NM_001033018		Approved	DEFB137	uc011kxm.2	Q30KP8	OTTHUMG00000158720	ENST00000382209.2:c.206C>T	8.37:g.11831477G>A	ENSP00000371644:p.Pro69Leu		Q4QY36	Missense_Mutation	SNP	NULL	p.P69L	ENST00000382209.2	37	c.206	CCDS43709.1	8	.	.	.	.	.	.	.	.	.	.	G	0.042	-1.281094	0.01398	.	.	ENSG00000205884	ENST00000382209	.	.	.	4.06	2.27	0.28462	.	0.783895	0.11270	N	0.581675	T	0.13072	0.0317	.	.	.	0.09310	N	1	P	0.40731	0.728	B	0.39904	0.313	T	0.08371	-1.0725	8	0.02654	T	1	0.791	6.231	0.20734	0.2256:0.0:0.7744:0.0	.	69	Q30KP8	DB136_HUMAN	L	69	.	ENSP00000371644:P69L	P	-	2	0	DEFB136	11868886	0.001000	0.12720	0.003000	0.11579	0.001000	0.01503	0.214000	0.17541	0.672000	0.31204	-0.266000	0.10368	CCC	DEFB136	-	NULL	ENSG00000205884		0.448	DEFB136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB136	HGNC	protein_coding	OTTHUMT00000351889.1	51	0.00	0	G	NM_001033018		11831477	11831477	-1	no_errors	ENST00000382209	ensembl	human	known	69_37n	missense	43	15.69	8	SNP	0.003	A
DGKB	1607	genome.wustl.edu	37	7	14758165	14758165	+	Splice_Site	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:14758165A>G	ENST00000403951.2	-	6	886		c.e6+1		DGKB_ENST00000407950.1_Splice_Site|DGKB_ENST00000258767.5_Splice_Site|DGKB_ENST00000403963.1_Splice_Site|DGKB_ENST00000399322.3_Splice_Site|DGKB_ENST00000402815.1_Splice_Site|DGKB_ENST00000444700.2_Splice_Site|DGKB_ENST00000406247.3_Splice_Site			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						AGAAACACATACACTCAAGCT	0.378																																						dbGAP											0													87.0	82.0	83.0					7																	14758165		1895	4122	6017	-	-	-	SO:0001630	splice_region_variant	0			AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.466+1T>C	7.37:g.14758165A>G			A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Splice_Site	SNP	-	e5+2	ENST00000403951.2	37	c.466+2	CCDS47547.1	7	.	.	.	.	.	.	.	.	.	.	A	15.56	2.869108	0.51588	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.896	0.63773	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DGKB	14724690	1.000000	0.71417	0.988000	0.46212	0.677000	0.39632	7.246000	0.78247	1.913000	0.55393	0.533000	0.62120	.	DGKB	-	-	ENSG00000136267		0.378	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKB	HGNC	protein_coding	OTTHUMT00000326356.2	57	0	0	A	NM_004080	Intron	14758165	14758165	-1	no_errors	ENST00000258767	ensembl	human	known	69_37n	splice_site	45	15.09	8	SNP	0.999	G
DHDDS	79947	genome.wustl.edu	37	1	26764736	26764736	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:26764736G>A	ENST00000236342.7	+	3	234	c.141G>A	c.(139-141)cgG>cgA	p.R47R	DHDDS_ENST00000525682.2_Silent_p.R47R|DHDDS_ENST00000360009.2_Silent_p.R47R|DHDDS_ENST00000526219.1_Silent_p.R47R|DHDDS_ENST00000374185.3_Silent_p.R47R|DHDDS_ENST00000427245.2_Silent_p.R47R|DHDDS_ENST00000531955.1_3'UTR			Q86SQ9	DHDDS_HUMAN	dehydrodolichyl diphosphate synthase	47					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	transferase activity, transferring alkyl or aryl (other than methyl) groups (GO:0016765)			breast(5)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)|urinary_tract(1)	15		all_cancers(24;2.04e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.0161)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.166)|LUSC - Lung squamous cell carcinoma(448;0.239)		AGGTGGAGCGGCAGGAAGGCC	0.517																																						dbGAP											0													102.0	92.0	95.0					1																	26764736		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK023164	CCDS281.1, CCDS282.1, CCDS57984.1, CCDS57983.1	1p35.3	2014-01-28			ENSG00000117682	ENSG00000117682			20603	protein-coding gene	gene with protein product		608172				12591616	Standard	NM_024887		Approved	HDS, FLJ13102, DS, RP59	uc001bmk.3	Q86SQ9	OTTHUMG00000003554	ENST00000236342.7:c.141G>A	1.37:g.26764736G>A			B7Z4B9|B7ZB20|D3DPK7|D3DPK8|D3DPK9|E9KL43|Q5T0A4|Q8NE90|Q9BTG5|Q9BTK3|Q9H905	Silent	SNP	pfam_UPP_synth-like,superfamily_UPP_synth-like,tigrfam_UPP_synth-like	p.R47	ENST00000236342.7	37	c.141	CCDS282.1	1																																																																																			DHDDS	-	pfam_UPP_synth-like,superfamily_UPP_synth-like,tigrfam_UPP_synth-like	ENSG00000117682		0.517	DHDDS-011	KNOWN	basic|appris_candidate|CCDS	protein_coding	DHDDS	HGNC	protein_coding	OTTHUMT00000392504.1	67	0.00	0	G	NM_024887		26764736	26764736	+1	no_errors	ENST00000360009	ensembl	human	known	69_37n	silent	44	10.20	5	SNP	0.863	A
DMKN	93099	genome.wustl.edu	37	19	35994348	35994348	+	Intron	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr19:35994348T>C	ENST00000339686.3	-	10	1311				DMKN_ENST00000419602.1_Intron|DMKN_ENST00000447113.2_Splice_Site_p.D429G|DMKN_ENST00000462126.1_Intron|DMKN_ENST00000472252.2_Intron|DMKN_ENST00000474928.1_Splice_Site_p.D26G|DMKN_ENST00000480502.1_Intron|DMKN_ENST00000467637.1_Intron|DMKN_ENST00000436012.1_Intron|DMKN_ENST00000458071.1_Splice_Site_p.D124G|DMKN_ENST00000402589.2_Intron|DMKN_ENST00000418261.1_Splice_Site_p.D379G|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000451297.2_Splice_Site_p.D362G|DMKN_ENST00000488892.1_Splice_Site_p.D75G|DMKN_ENST00000461300.1_Splice_Site_p.D26G|DMKN_ENST00000602781.1_Intron|DMKN_ENST00000440396.1_Splice_Site_p.D409G|DMKN_ENST00000392206.2_Splice_Site_p.D92G|DMKN_ENST00000408915.2_5'Flank|DMKN_ENST00000492341.2_Intron|DMKN_ENST00000424570.2_Splice_Site_p.D391G|DMKN_ENST00000443640.1_Intron|DMKN_ENST00000414866.2_Intron	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GCTTCTCTGGTCCTGGGCAAA	0.498																																						dbGAP											0													124.0	105.0	111.0					19																	35994348		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.1135-560A>G	19.37:g.35994348T>C			A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	NULL	p.D409G	ENST00000339686.3	37	c.1226	CCDS12463.1	19	.	.	.	.	.	.	.	.	.	.	T	0.616	-0.822958	0.02755	.	.	ENSG00000161249	ENST00000447113;ENST00000392206;ENST00000440396;ENST00000458071;ENST00000418261;ENST00000424570;ENST00000451297;ENST00000450261	T;T;T;T;T;T;T;T	0.19938	2.11;2.11;2.11;2.11;2.11;2.11;2.11;2.11	5.27	3.19	0.36642	.	.	.	.	.	T	0.11750	0.0286	.	.	.	0.21020	N	0.999804	B;B;B;B	0.24920	0.114;0.106;0.106;0.092	B;B;B;B	0.33620	0.167;0.06;0.06;0.126	T	0.43212	-0.9405	8	0.07482	T	0.82	.	6.8508	0.24014	0.0:0.1857:0.0:0.8143	.	409;362;379;391	E7EUS0;Q6E0U4-7;Q6E0U4-3;Q6E0U4-5	.;.;.;.	G	429;92;409;124;379;391;362;112	ENSP00000394908:D429G;ENSP00000376042:D92G;ENSP00000415277:D409G;ENSP00000403957:D124G;ENSP00000414743:D379G;ENSP00000388404:D391G;ENSP00000409513:D362G;ENSP00000397005:D112G	ENSP00000376042:D92G	D	-	2	0	DMKN	40686188	0.998000	0.40836	0.991000	0.47740	0.636000	0.38137	1.203000	0.32284	0.337000	0.23665	-0.326000	0.08463	GAC	DMKN	-	NULL	ENSG00000161249		0.498	DMKN-001	KNOWN	basic|CCDS	protein_coding	DMKN	HGNC	protein_coding	OTTHUMT00000109461.2	96	0.00	0	T	NM_033317		35994348	35994348	-1	no_errors	ENST00000440396	ensembl	human	known	69_37n	missense	48	20.00	12	SNP	0.998	C
DHX34	9704	genome.wustl.edu	37	19	47884112	47884112	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr19:47884112C>T	ENST00000328771.4	+	15	3371	c.3022C>T	c.(3022-3024)Cag>Tag	p.Q1008*		NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	1008					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		GCTAGAAGTCCAGAACATGTA	0.597																																						dbGAP											0													100.0	95.0	97.0					19																	47884112		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.3022C>T	19.37:g.47884112C>T	ENSP00000331907:p.Gln1008*		B4DMY8	Nonsense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q1008*	ENST00000328771.4	37	c.3022	CCDS12700.1	19	.	.	.	.	.	.	.	.	.	.	C	40	8.342328	0.98769	.	.	ENSG00000134815	ENST00000328771	.	.	.	4.76	4.76	0.60689	.	0.000000	0.53938	D	0.000051	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-34.2058	16.6911	0.85322	0.0:1.0:0.0:0.0	.	.	.	.	X	1008	.	ENSP00000331907:Q1008X	Q	+	1	0	DHX34	52575943	1.000000	0.71417	0.991000	0.47740	0.115000	0.19883	4.699000	0.61796	2.474000	0.83562	0.462000	0.41574	CAG	DHX34	-	NULL	ENSG00000134815		0.597	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX34	HGNC	protein_coding	OTTHUMT00000314313.3	60	0.00	0	C	NM_014681		47884112	47884112	+1	no_errors	ENST00000328771	ensembl	human	known	69_37n	nonsense	29	14.71	5	SNP	0.997	T
DNAH9	1770	genome.wustl.edu	37	17	11584201	11584201	+	Silent	SNP	G	G	A	rs192673174	byFrequency	TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:11584201G>A	ENST00000262442.4	+	19	3806	c.3738G>A	c.(3736-3738)ccG>ccA	p.P1246P	DNAH9_ENST00000454412.2_Silent_p.P1246P	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1246	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AAGAAGCCCCGTTCAGGTATG	0.522													G|||	2	0.000399361	0.0	0.0	5008	,	,		18522	0.001		0.0	False		,,,				2504	0.001					dbGAP											0													56.0	47.0	50.0					17																	11584201		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.3738G>A	17.37:g.11584201G>A			A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.P1246	ENST00000262442.4	37	c.3738	CCDS11160.1	17																																																																																			DNAH9	-	NULL	ENSG00000007174		0.522	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	41	0.00	0	G	NM_001372		11584201	11584201	+1	no_errors	ENST00000262442	ensembl	human	known	69_37n	silent	25	16.67	5	SNP	0.830	A
DNAJC7	7266	genome.wustl.edu	37	17	40141457	40141457	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:40141457C>T	ENST00000457167.4	-	7	954	c.718G>A	c.(718-720)Gct>Act	p.A240T	DNAJC7_ENST00000316603.7_Missense_Mutation_p.A184T|DNAJC7_ENST00000426588.3_Missense_Mutation_p.A184T	NM_003315.3	NP_003306.3	Q99615	DNJC7_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 7	240					chaperone cofactor-dependent protein refolding (GO:0070389)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	heat shock protein binding (GO:0031072)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9		all_cancers(22;0.00273)|Breast(137;0.00104)|all_epithelial(22;0.0305)				TGGTCAGGAGCCATCCTGAGA	0.468																																					Colon(63;618 1117 8600 10857 19751)	dbGAP											0													137.0	130.0	133.0					17																	40141457		1912	4129	6041	-	-	-	SO:0001583	missense	0			U46571	CCDS45677.1, CCDS45678.1	17q11.2	2013-01-10				ENSG00000168259		"""Heat shock proteins / DNAJ (HSP40)"", ""Tetratricopeptide (TTC) repeat domain containing"""	12392	protein-coding gene	gene with protein product		601964		TTC2		8836031, 11147971	Standard	NR_029431		Approved	TPR2	uc002hyo.3	Q99615		ENST00000457167.4:c.718G>A	17.37:g.40141457C>T	ENSP00000406463:p.Ala240Thr		Q7Z784	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,pfam_DnaJ_N,superfamily_DnaJ_N,smart_TPR_repeat,smart_DnaJ_N,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.A240T	ENST00000457167.4	37	c.718	CCDS45677.1	17	.	.	.	.	.	.	.	.	.	.	C	28.9	4.961556	0.92791	.	.	ENSG00000168259	ENST00000457167;ENST00000426588;ENST00000316603	T;T;T	0.64438	-0.1;-0.1;-0.1	5.57	5.57	0.84162	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.70456	0.3226	L	0.60455	1.87	0.80722	D	1	B;P;P	0.42337	0.293;0.661;0.776	B;P;P	0.48982	0.315;0.597;0.515	T	0.70813	-0.4770	10	0.52906	T	0.07	-20.2107	19.5532	0.95330	0.0:1.0:0.0:0.0	.	229;184;240	Q59EH7;Q7Z784;Q99615	.;.;DNJC7_HUMAN	T	240;184;184	ENSP00000406463:A240T;ENSP00000394327:A184T;ENSP00000313311:A184T	ENSP00000313311:A184T	A	-	1	0	DNAJC7	37394983	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.487000	0.81328	2.642000	0.89623	0.462000	0.41574	GCT	DNAJC7	-	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000168259		0.468	DNAJC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC7	HGNC	protein_coding	OTTHUMT00000453366.2	33	0.00	0	C			40141457	40141457	-1	no_errors	ENST00000457167	ensembl	human	known	69_37n	missense	40	16.67	8	SNP	1.000	T
DNALI1	7802	genome.wustl.edu	37	1	38023344	38023344	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:38023344C>T	ENST00000541606.1	+	2	211	c.14C>T	c.(13-15)cCc>cTc	p.P5L	DNALI1_ENST00000296218.7_Silent_p.P96P			O14645	IDLC_HUMAN	dynein, axonemal, light intermediate chain 1	0					cellular component movement (GO:0006928)|metabolic process (GO:0008152)|single fertilization (GO:0007338)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|filopodium (GO:0030175)	microtubule motor activity (GO:0003777)			breast(1)|kidney(1)|large_intestine(2)|ovary(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCATACTACCCCCAAGGTAAG	0.547																																						dbGAP											0													142.0	139.0	140.0					1																	38023344		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF006386	CCDS420.1	1p35.1	2008-07-18	2006-09-04		ENSG00000163879	ENSG00000163879		"""Axonemal dyneins"""	14353	protein-coding gene	gene with protein product	"""inner dynein arm, homolog of clamydomonas"", ""dJ423B22.5 (axonemal dynein light chain (hp28))"""	602135	"""dynein, axonemal, light intermediate polypeptide 1"""			9284741	Standard	NM_003462		Approved	P28, hp28, dJ423B22.5	uc001cbj.3	O14645	OTTHUMG00000004222	ENST00000541606.1:c.14C>T	1.37:g.38023344C>T	ENSP00000438962:p.Pro5Leu		A8K387|B4DHN6|Q05BL9|Q5HYE2|Q5TGH0|Q7L0I5	Missense_Mutation	SNP	pfam_Axonemal_dynein_light_chain	p.P5L	ENST00000541606.1	37	c.14		1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.341144	0.60963	.	.	ENSG00000163879	ENST00000541606	.	.	.	5.49	0.249	0.15531	.	0.000000	0.85682	D	0.000000	T	0.37320	0.0999	.	.	.	0.30660	N	0.754456	.	.	.	.	.	.	T	0.40117	-0.9580	6	0.87932	D	0	-8.0907	3.4702	0.07565	0.2771:0.3937:0.0:0.3291	.	.	.	.	L	5	.	ENSP00000438962:P5L	P	+	2	0	DNALI1	37795931	0.965000	0.33210	0.998000	0.56505	0.759000	0.43091	-0.141000	0.10327	0.017000	0.15025	-0.229000	0.12294	CCC	DNALI1	-	NULL	ENSG00000163879		0.547	DNALI1-201	KNOWN	basic	protein_coding	DNALI1	HGNC	protein_coding		46	0.00	0	C	NM_003462		38023344	38023344	+1	no_errors	ENST00000541606	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	0.986	T
DOT1L	84444	genome.wustl.edu	37	19	2185914	2185914	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr19:2185914C>A	ENST00000398665.3	+	3	222	c.186C>A	c.(184-186)gaC>gaA	p.D62E		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	62	DOT1. {ECO:0000255|PROSITE- ProRule:PRU00902}.				histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTTTAATTGACTATGACACCA	0.502																																						dbGAP											0													244.0	248.0	247.0					19																	2185914		1899	4126	6025	-	-	-	SO:0001583	missense	0			AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.186C>A	19.37:g.2185914C>A	ENSP00000381657:p.Asp62Glu		O60379|Q96JL1	Missense_Mutation	SNP	pfam_DOT1,pirsf_Histone_H3-K79_MeTrfase_met	p.D62E	ENST00000398665.3	37	c.186	CCDS42460.1	19	.	.	.	.	.	.	.	.	.	.	C	12.91	2.080453	0.36662	.	.	ENSG00000104885	ENST00000398665;ENST00000221482;ENST00000452696	T;T	0.21932	1.98;1.98	4.68	2.53	0.30540	.	0.057647	0.64402	N	0.000003	T	0.24851	0.0603	L	0.39245	1.2	0.45118	D	0.998133	D	0.54397	0.966	P	0.52881	0.712	T	0.01532	-1.1331	10	0.87932	D	0	-32.4715	8.5458	0.33421	0.1524:0.767:0.0:0.0806	.	62	Q8TEK3-2	.	E	62	ENSP00000381657:D62E;ENSP00000404284:D62E	ENSP00000221482:D62E	D	+	3	2	DOT1L	2136914	1.000000	0.71417	0.996000	0.52242	0.415000	0.31203	5.198000	0.65147	0.576000	0.29452	-0.253000	0.11424	GAC	DOT1L	-	pirsf_Histone_H3-K79_MeTrfase_met	ENSG00000104885		0.502	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOT1L	HGNC	protein_coding	OTTHUMT00000318066.1	76	0.00	0	C	NM_032482		2185914	2185914	+1	no_errors	ENST00000398665	ensembl	human	known	69_37n	missense	51	11.86	7	SNP	1.000	A
ECHDC2	55268	genome.wustl.edu	37	1	53362256	53362256	+	Missense_Mutation	SNP	C	C	T	rs536501241		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:53362256C>T	ENST00000371522.4	-	10	908	c.815G>A	c.(814-816)cGg>cAg	p.R272Q	ECHDC2_ENST00000358358.5_Missense_Mutation_p.R241Q|ECHDC2_ENST00000536120.1_Missense_Mutation_p.R226Q	NM_001198961.1	NP_001185890.1	Q86YB7	ECHD2_HUMAN	enoyl CoA hydratase domain containing 2	272					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	lyase activity (GO:0016829)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	12						TAGCCGGTCCCGGGTTGGAAT	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		19474	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													49.0	53.0	51.0					1																	53362256		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF258590	CCDS571.1, CCDS55600.1, CCDS72794.1	1p32.3	2010-04-30	2010-04-30		ENSG00000121310	ENSG00000121310			23408	protein-coding gene	gene with protein product			"""enoyl Coenzyme A hydratase domain containing 2"""				Standard	NM_018281		Approved	FLJ10948	uc001cup.4	Q86YB7	OTTHUMG00000008927	ENST00000371522.4:c.815G>A	1.37:g.53362256C>T	ENSP00000360577:p.Arg272Gln		D3DQ36|Q9NV38	Missense_Mutation	SNP	pfam_Crotonase_core	p.R272Q	ENST00000371522.4	37	c.815	CCDS55600.1	1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.564711	0.27915	.	.	ENSG00000121310	ENST00000371522;ENST00000358358;ENST00000536120	T;T;T	0.76186	-1.0;-1.0;-1.0	5.26	-1.51	0.08664	Crontonase, C-terminal (1);	0.572834	0.18651	N	0.134982	T	0.49966	0.1588	N	0.04805	-0.155	0.47994	D	0.999561	B;B	0.20780	0.048;0.038	B;B	0.21708	0.036;0.021	T	0.12400	-1.0549	10	0.29301	T	0.29	.	11.9353	0.52870	0.0:0.2606:0.0:0.7394	.	272;241	Q86YB7;Q86YB7-2	ECHD2_HUMAN;.	Q	272;241;226	ENSP00000360577:R272Q;ENSP00000351125:R241Q;ENSP00000439264:R226Q	ENSP00000351125:R241Q	R	-	2	0	ECHDC2	53134844	0.002000	0.14202	0.973000	0.42090	0.772000	0.43724	-0.206000	0.09398	-0.515000	0.06479	-0.140000	0.14226	CGG	ECHDC2	-	NULL	ENSG00000121310		0.512	ECHDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ECHDC2	HGNC	protein_coding	OTTHUMT00000024712.3	51	0.00	0	C	NM_018281		53362256	53362256	-1	no_errors	ENST00000371522	ensembl	human	known	69_37n	missense	24	29.41	10	SNP	0.691	T
EIF4A3	9775	genome.wustl.edu	37	17	78109862	78109862	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:78109862C>T	ENST00000269349.3	-	11	1381	c.1160G>A	c.(1159-1161)cGc>cAc	p.R387H		NM_014740.3	NP_055555.1	P38919	IF4A3_HUMAN	eukaryotic translation initiation factor 4A3	387	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cytokine-mediated signaling pathway (GO:0019221)|embryonic cranial skeleton morphogenesis (GO:0048701)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|mRNA binding (GO:0003729)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)			TCTGAGGATGCGGATGTCGTC	0.428																																						dbGAP											0													128.0	120.0	123.0					17																	78109862		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004386	CCDS11767.1	17q25.3	2010-02-10	2010-02-10	2006-11-27		ENSG00000141543		"""DEAD-boxes"""	18683	protein-coding gene	gene with protein product		608546	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 48"", ""eukaryotic translation initiation factor 4A, isoform 3"""	DDX48		10623621, 14730019	Standard	NM_014740		Approved	KIAA0111, EIF4AIII	uc002jxs.3	P38919		ENST00000269349.3:c.1160G>A	17.37:g.78109862C>T	ENSP00000269349:p.Arg387His		Q15033|Q6IBQ2|Q96A18	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R387H	ENST00000269349.3	37	c.1160	CCDS11767.1	17	.	.	.	.	.	.	.	.	.	.	C	14.01	2.406573	0.42715	.	.	ENSG00000141543	ENST00000269349	T	0.04917	3.53	4.18	4.18	0.49190	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.06554	0.0168	L	0.31157	0.91	0.80722	D	1	B	0.14012	0.009	B	0.10450	0.005	T	0.22591	-1.0212	10	0.87932	D	0	-18.3621	14.0211	0.64555	0.0:1.0:0.0:0.0	.	387	P38919	IF4A3_HUMAN	H	387	ENSP00000269349:R387H	ENSP00000269349:R387H	R	-	2	0	EIF4A3	75724457	1.000000	0.71417	0.776000	0.31678	0.162000	0.22319	7.212000	0.77941	2.185000	0.69588	0.555000	0.69702	CGC	EIF4A3	-	pfscan_Helicase_C	ENSG00000141543		0.428	EIF4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4A3	HGNC	protein_coding	OTTHUMT00000437446.1	75	0.00	0	C	NM_014740		78109862	78109862	-1	no_errors	ENST00000269349	ensembl	human	known	69_37n	missense	46	22.03	13	SNP	0.998	T
ELOVL4	6785	genome.wustl.edu	37	6	80656915	80656915	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:80656915A>G	ENST00000369816.4	-	1	382	c.82T>C	c.(82-84)Tgg>Cgg	p.W28R		NM_022726.3	NP_073563.1	Q9GZR5	ELOV4_HUMAN	ELOVL fatty acid elongase 4	28					cellular lipid metabolic process (GO:0044255)|detection of visible light (GO:0009584)|fatty acid biosynthetic process (GO:0006633)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)	G-protein coupled photoreceptor activity (GO:0008020)|transferase activity (GO:0016740)			central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)	GACCAGGTCCAGCGGTAGAAC	0.687																																						dbGAP											0													84.0	68.0	74.0					6																	80656915		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF277094	CCDS4992.1	6q14	2013-01-08	2011-05-25		ENSG00000118402	ENSG00000118402			14415	protein-coding gene	gene with protein product	"""cancer/testis antigen 118"""	605512	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4"""	STGD2, STGD3		11138005	Standard	NM_022726		Approved	CT118	uc003pja.4	Q9GZR5	OTTHUMG00000015087	ENST00000369816.4:c.82T>C	6.37:g.80656915A>G	ENSP00000358831:p.Trp28Arg		B2R6B5|Q5TCS2|Q86YJ1|Q9H139	Missense_Mutation	SNP	pfam_GNS1_SUR4	p.W28R	ENST00000369816.4	37	c.82	CCDS4992.1	6	.	.	.	.	.	.	.	.	.	.	A	17.45	3.393390	0.62066	.	.	ENSG00000118402	ENST00000369816	T	0.16897	2.31	4.25	3.06	0.35304	.	0.000000	0.85682	D	0.000000	T	0.08537	0.0212	L	0.55990	1.75	0.43874	D	0.99648	D	0.55385	0.971	P	0.47645	0.553	T	0.19943	-1.0290	10	0.21014	T	0.42	-4.6091	6.818	0.23841	0.793:0.0:0.0:0.207	.	28	Q9GZR5	ELOV4_HUMAN	R	28	ENSP00000358831:W28R	ENSP00000358831:W28R	W	-	1	0	ELOVL4	80713634	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.913000	0.48790	0.649000	0.30751	0.379000	0.24179	TGG	ELOVL4	-	NULL	ENSG00000118402		0.687	ELOVL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELOVL4	HGNC	protein_coding	OTTHUMT00000041315.1	38	0.00	0	A			80656915	80656915	-1	no_errors	ENST00000369816	ensembl	human	known	69_37n	missense	19	26.92	7	SNP	1.000	G
ERCC6L2	375748	genome.wustl.edu	37	9	98703810	98703810	+	Missense_Mutation	SNP	A	A	G	rs200972525		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr9:98703810A>G	ENST00000288985.7	+	12	2164	c.1859A>G	c.(1858-1860)aAt>aGt	p.N620S	ERCC6L2_ENST00000466840.1_3'UTR|ERCC6L2_ENST00000437817.1_Missense_Mutation_p.N431S	NM_001010895.2	NP_001010895.1	Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2	620	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)										AATCCAGCCAATGATCTTCAA	0.353																																						dbGAP											0													100.0	85.0	90.0					9																	98703810		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000288985.7:c.1859A>G	9.37:g.98703810A>G	ENSP00000288985:p.Asn620Ser		A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.N431S	ENST00000288985.7	37	c.1292	CCDS35072.1	9	.	.	.	.	.	.	.	.	.	.	A	12.52	1.963031	0.34659	.	.	ENSG00000182150	ENST00000405401;ENST00000288985;ENST00000437817	T;T	0.73575	-0.76;-0.76	4.87	3.74	0.42951	Helicase, C-terminal (3);	0.000000	0.56097	D	0.000040	T	0.64789	0.2630	L	0.52573	1.65	0.80722	D	1	B;P;B	0.43024	0.025;0.798;0.23	B;B;B	0.38921	0.028;0.285;0.125	T	0.60571	-0.7237	10	0.30854	T	0.27	-13.4002	9.3208	0.37964	0.9142:0.0:0.0858:0.0	.	431;302;620	Q5T890-2;F2Z2R4;Q5T890	.;.;RAD26_HUMAN	S	302;620;431	ENSP00000288985:N620S;ENSP00000416286:N431S	ENSP00000288985:N620S	N	+	2	0	C9orf102	97743631	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.274000	0.65569	0.897000	0.36392	0.402000	0.26972	AAT	ERCC6L2	-	pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,smart_Helicase_C,pfscan_Helicase_C	ENSG00000182150		0.353	ERCC6L2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ERCC6L2	HGNC	protein_coding	OTTHUMT00000053247.2	76	0.00	0	A	NM_001010895		98703810	98703810	+1	no_errors	ENST00000437817	ensembl	human	known	69_37n	missense	49	14.04	8	SNP	1.000	G
EVC	2121	genome.wustl.edu	37	4	5721019	5721019	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr4:5721019G>A	ENST00000264956.6	+	2	403	c.219G>A	c.(217-219)gcG>gcA	p.A73A	EVC_ENST00000509451.1_Silent_p.A73A|EVC_ENST00000382674.2_Silent_p.A73A	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	73					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A73A(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				AGTCTAATGCGCAGACCCCCT	0.483																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											196.0	196.0	196.0					4																	5721019		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.219G>A	4.37:g.5721019G>A				Silent	SNP	NULL	p.A73	ENST00000264956.6	37	c.219	CCDS3383.1	4																																																																																			EVC	-	NULL	ENSG00000072840		0.483	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVC	HGNC	protein_coding	OTTHUMT00000206859.1	82	0.00	0	G			5721019	5721019	+1	no_errors	ENST00000264956	ensembl	human	known	69_37n	silent	48	20.00	12	SNP	0.000	A
EVC	2121	genome.wustl.edu	37	4	5795342	5795342	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr4:5795342T>C	ENST00000264956.6	+	13	1968	c.1784T>C	c.(1783-1785)aTg>aCg	p.M595T	EVC_ENST00000515113.1_3'UTR|EVC_ENST00000382674.2_Missense_Mutation_p.M595T	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	595					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				CAGGTGTGGATGGAGGAGTGT	0.577																																						dbGAP											0													34.0	27.0	30.0					4																	5795342		2144	4155	6299	-	-	-	SO:0001583	missense	0			AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.1784T>C	4.37:g.5795342T>C	ENSP00000264956:p.Met595Thr			Missense_Mutation	SNP	NULL	p.M595T	ENST00000264956.6	37	c.1784	CCDS3383.1	4	.	.	.	.	.	.	.	.	.	.	T	3.291	-0.145035	0.06627	.	.	ENSG00000072840	ENST00000264956;ENST00000382674	T;T	0.51071	0.72;0.72	5.21	4.0	0.46444	.	0.492536	0.22962	N	0.053525	T	0.37972	0.1023	L	0.56769	1.78	0.80722	D	1	B	0.32160	0.358	B	0.32762	0.152	T	0.11324	-1.0592	10	0.14656	T	0.56	.	6.7488	0.23475	0.0:0.1764:0.0:0.8236	.	595	P57679	EVC_HUMAN	T	595	ENSP00000264956:M595T;ENSP00000372120:M595T	ENSP00000264956:M595T	M	+	2	0	EVC	5846243	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	0.973000	0.29422	2.189000	0.69895	0.533000	0.62120	ATG	EVC	-	NULL	ENSG00000072840		0.577	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVC	HGNC	protein_coding	OTTHUMT00000206859.1	26	0.00	0	T			5795342	5795342	+1	no_errors	ENST00000264956	ensembl	human	known	69_37n	missense	16	23.81	5	SNP	1.000	C
EZH2	2146	genome.wustl.edu	37	7	148525902	148525902	+	Silent	SNP	G	G	A	rs555589547		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:148525902G>A	ENST00000460911.1	-	6	643	c.555C>T	c.(553-555)gaC>gaT	p.D185D	EZH2_ENST00000320356.2_Silent_p.D185D|EZH2_ENST00000541220.1_Silent_p.D176D|EZH2_ENST00000476773.1_Silent_p.D176D|EZH2_ENST00000478654.1_Silent_p.D176D|EZH2_ENST00000350995.2_Silent_p.D146D|EZH2_ENST00000536783.1_Silent_p.D76D|EZH2_ENST00000483967.1_Silent_p.D176D			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit	185	Interaction with DNMT1, DNMT3A and DNMT3B.		D -> H (in dbSNP:rs2302427).		cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			catcatcatcgtcatcatcat	0.393			Mis		DLBCL								G|||	1	0.000199681	0.0	0.0	5008	,	,		19074	0.0		0.0	False		,,,				2504	0.001					dbGAP		Rec?	yes		7	7q35-q36	2146	enhancer of zeste homolog 2		L	0													180.0	148.0	159.0					7																	148525902		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.555C>T	7.37:g.148525902G>A			B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Silent	SNP	pfam_SET_dom,pfam_EZH2_WD-Binding,superfamily_Homeodomain-like,smart_SANT/Myb,smart_SET_dom,pfscan_SET_dom	p.D185	ENST00000460911.1	37	c.555	CCDS56516.1	7																																																																																			EZH2	-	smart_SANT/Myb	ENSG00000106462		0.393	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	EZH2	HGNC	protein_coding	OTTHUMT00000352744.1	110	0.00	0	G	NM_004456		148525902	148525902	-1	no_errors	ENST00000320356	ensembl	human	known	69_37n	silent	59	21.33	16	SNP	0.201	A
F2R	2149	genome.wustl.edu	37	5	76028893	76028893	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:76028893G>A	ENST00000319211.4	+	2	1108	c.843G>A	c.(841-843)gtG>gtA	p.V281V		NM_001992.3	NP_001983.2	P25116	PAR1_HUMAN	coagulation factor II (thrombin) receptor	281					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPKK activity (GO:0000186)|anatomical structure morphogenesis (GO:0009653)|blood coagulation (GO:0007596)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|G-protein coupled receptor signaling pathway (GO:0007186)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of renin secretion into blood stream (GO:1900134)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of blood coagulation (GO:0030194)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood coagulation (GO:0030193)|regulation of interleukin-1 beta production (GO:0032651)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|STAT protein import into nucleus (GO:0007262)|tyrosine phosphorylation of STAT protein (GO:0007260)	caveola (GO:0005901)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|platelet dense tubular network (GO:0031094)|postsynaptic membrane (GO:0045211)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)			NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(7)|ovary(3)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	TCTTTTTTGTGCCGCTGATCA	0.488																																						dbGAP											0													139.0	144.0	142.0					5																	76028893		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M62424	CCDS4032.1	5q13	2012-08-08			ENSG00000181104	ENSG00000181104		"""GPCR / Class A : Protease activated receptors"""	3537	protein-coding gene	gene with protein product		187930				8395910	Standard	NM_001992		Approved	TR, CF2R, PAR1, PAR-1	uc003ken.4	P25116	OTTHUMG00000131299	ENST00000319211.4:c.843G>A	5.37:g.76028893G>A			Q53XV0|Q96RF7|Q9BUN4	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Thrmbn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Protea_act_rcpt,prints_P2_purnocptor,pfscan_GPCR_Rhodpsn_supfam	p.V281	ENST00000319211.4	37	c.843	CCDS4032.1	5																																																																																			F2R	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,prints_Protea_act_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181104		0.488	F2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2R	HGNC	protein_coding	OTTHUMT00000254068.2	98	0.00	0	G			76028893	76028893	+1	no_errors	ENST00000319211	ensembl	human	known	69_37n	silent	44	16.98	9	SNP	1.000	A
FAM120C	54954	genome.wustl.edu	37	X	54112279	54112279	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chrX:54112279G>A	ENST00000375180.2	-	13	2764	c.2708C>T	c.(2707-2709)cCg>cTg	p.P903L	FAM120C_ENST00000328235.4_Intron	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	903							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						AGCAGAAGGCGGTGGATGATT	0.488																																						dbGAP											0													184.0	147.0	160.0					X																	54112279		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.2708C>T	X.37:g.54112279G>A	ENSP00000364324:p.Pro903Leu		B2RMT7	Missense_Mutation	SNP	NULL	p.P903L	ENST00000375180.2	37	c.2708	CCDS14356.1	X	.	.	.	.	.	.	.	.	.	.	g	13.25	2.180533	0.38511	.	.	ENSG00000184083	ENST00000375180	T	0.23754	1.89	4.67	0.75	0.18387	.	0.394451	0.24429	N	0.038602	T	0.20455	0.0492	L	0.50333	1.59	0.80722	D	1	B	0.14805	0.011	B	0.10450	0.005	T	0.07139	-1.0788	10	0.26408	T	0.33	0.7834	9.5478	0.39291	0.3478:0.0:0.6522:0.0	.	903	Q9NX05	F120C_HUMAN	L	903	ENSP00000364324:P903L	ENSP00000364324:P903L	P	-	2	0	FAM120C	54129004	0.993000	0.37304	0.800000	0.32199	0.962000	0.63368	1.135000	0.31454	0.041000	0.15688	-0.196000	0.12772	CCG	FAM120C	-	NULL	ENSG00000184083		0.488	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM120C	HGNC	protein_coding	OTTHUMT00000056795.2	69	0.00	0	G	NM_017848		54112279	54112279	-1	no_errors	ENST00000375180	ensembl	human	known	69_37n	missense	32	30.43	14	SNP	0.948	A
FAM162B	221303	genome.wustl.edu	37	6	117083229	117083229	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:117083229C>T	ENST00000368557.4	-	3	447	c.301G>A	c.(301-303)Gca>Aca	p.A101T		NM_001085480.2	NP_001078949.1	Q5T6X4	F162B_HUMAN	family with sequence similarity 162, member B	101						integral component of membrane (GO:0016021)				large_intestine(2)|lung(4)	6						TTGTTTCTTGCGGTGTCTATC	0.368																																						dbGAP											0													191.0	178.0	182.0					6																	117083229		1864	4108	5972	-	-	-	SO:0001583	missense	0			BC038997	CCDS43497.1	6q22.31	2014-01-28	2008-06-05	2008-06-05	ENSG00000183807	ENSG00000183807			21549	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 189"""	C6orf189			Standard	NM_001085480		Approved	bA86F4.2	uc003pxi.2	Q5T6X4	OTTHUMG00000015446	ENST00000368557.4:c.301G>A	6.37:g.117083229C>T	ENSP00000357545:p.Ala101Thr		Q8IXW8	Missense_Mutation	SNP	pfam_DUF1075	p.A101T	ENST00000368557.4	37	c.301	CCDS43497.1	6	.	.	.	.	.	.	.	.	.	.	C	16.69	3.192998	0.58017	.	.	ENSG00000183807	ENST00000368557	T	0.37752	1.18	4.49	2.61	0.31194	.	0.066079	0.64402	D	0.000012	T	0.27169	0.0666	M	0.82056	2.57	0.36786	D	0.884578	P	0.47302	0.893	B	0.42851	0.4	T	0.23190	-1.0195	10	0.87932	D	0	-4.1626	8.4138	0.32659	0.1587:0.7526:0.0:0.0887	.	101	Q5T6X4	F162B_HUMAN	T	101	ENSP00000357545:A101T	ENSP00000357545:A101T	A	-	1	0	FAM162B	117189922	1.000000	0.71417	1.000000	0.80357	0.484000	0.33280	2.644000	0.46613	1.178000	0.42870	0.655000	0.94253	GCA	FAM162B	-	pfam_DUF1075	ENSG00000183807		0.368	FAM162B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM162B	HGNC	protein_coding	OTTHUMT00000041965.1	102	0.00	0	C	XM_927381		117083229	117083229	-1	no_errors	ENST00000368557	ensembl	human	known	69_37n	missense	70	16.67	14	SNP	1.000	T
FAM170B	170370	genome.wustl.edu	37	10	50340002	50340002	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr10:50340002T>C	ENST00000311787.5	-	2	597	c.508A>G	c.(508-510)Aag>Gag	p.K170E	FAM170B-AS1_ENST00000442525.1_RNA|FAM170B-AS1_ENST00000443389.1_RNA|FAM170B-AS1_ENST00000435809.1_RNA	NM_001164484.1	NP_001157956.1	A6NMN3	F170B_HUMAN	family with sequence similarity 170, member B	170										central_nervous_system(1)|endometrium(1)|skin(1)	3						CAGTTGCTCTTGCAGGCTTCC	0.622																																						dbGAP											0													43.0	43.0	43.0					10																	50340002		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS53536.1	10q11.23	2008-11-06	2008-06-12	2008-06-12	ENSG00000172538	ENSG00000172538			19736	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 73"""	C10orf73			Standard	NM_001164484		Approved	Em:AC084727.4	uc001jhj.3	A6NMN3	OTTHUMG00000018187	ENST00000311787.5:c.508A>G	10.37:g.50340002T>C	ENSP00000308292:p.Lys170Glu		Q86WY6|Q8N6K8	Missense_Mutation	SNP	NULL	p.K170E	ENST00000311787.5	37	c.508	CCDS53536.1	10	.	.	.	.	.	.	.	.	.	.	T	0.359	-0.940739	0.02322	.	.	ENSG00000172538	ENST00000311787	T	0.26373	1.74	5.63	1.6	0.23607	.	0.743246	0.12229	N	0.487643	T	0.13500	0.0327	L	0.35414	1.06	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.38178	-0.9673	10	0.02654	T	1	-38.0361	4.7218	0.12922	0.0:0.1984:0.185:0.6167	.	170	A6NMN3	F170B_HUMAN	E	170	ENSP00000308292:K170E	ENSP00000308292:K170E	K	-	1	0	FAM170B	50010008	0.000000	0.05858	0.527000	0.27925	0.123000	0.20343	0.152000	0.16302	0.428000	0.26173	0.529000	0.55759	AAG	FAM170B	-	NULL	ENSG00000172538		0.622	FAM170B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM170B	HGNC	protein_coding	OTTHUMT00000047974.1	25	0.00	0	T	XM_096317		50340002	50340002	-1	no_errors	ENST00000311787	ensembl	human	known	69_37n	missense	23	23.33	7	SNP	0.026	C
FAM181A	90050	genome.wustl.edu	37	14	94391640	94391641	+	Frame_Shift_Ins	INS	-	-	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr14:94391640_94391641insT	ENST00000267594.5	+	2	330_331	c.23_24insT	c.(22-27)tcttctfs	p.S9fs	FAM181A_ENST00000556222.1_5'Flank|FAM181A_ENST00000557719.1_Intron|FAM181A_ENST00000557000.2_5'Flank|FAM181A-AS1_ENST00000554742.1_RNA	NM_001207073.1|NM_001207074.1|NM_138344.4	NP_001194002.1|NP_001194003.1|NP_612353.3	Q8N9Y4	F181A_HUMAN	family with sequence similarity 181, member A	9										cervix(1)|endometrium(2)|large_intestine(8)|lung(4)|prostate(1)|skin(2)	18						GAGAGAAGATCTTCTGGAGAGA	0.545																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC009073	CCDS9914.1, CCDS55939.1	14q32.12	2011-11-30	2008-07-22	2008-07-22	ENSG00000140067	ENSG00000140067			20491	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 152"""	C14orf152			Standard	NM_138344		Approved		uc021saz.1	Q8N9Y4	OTTHUMG00000171297	ENST00000267594.5:c.25dupT	14.37:g.94391642_94391642dupT	ENSP00000267594:p.Ser9fs		B2RD39|Q96GY1	Frame_Shift_Ins	INS	NULL	p.S9fs	ENST00000267594.5	37	c.23_24	CCDS9914.1	14																																																																																			FAM181A	-	NULL	ENSG00000140067		0.545	FAM181A-001	KNOWN	basic|CCDS	protein_coding	FAM181A	HGNC	protein_coding	OTTHUMT00000412840.1	44	0.00	0	-	NM_138344		94391640	94391641	+1	no_errors	ENST00000267594	ensembl	human	known	69_37n	frame_shift_ins	23	17.86	5	INS	0.000:0.000	T
FAM200B	285550	genome.wustl.edu	37	4	15689207	15689207	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr4:15689207C>T	ENST00000422728.2	+	2	1445	c.607C>T	c.(607-609)Cga>Tga	p.R203*	FAM200B_ENST00000504137.1_Intron	NM_001145191.1	NP_001138663.1	P0CF97	F200B_HUMAN	family with sequence similarity 200, member B	203							nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						agtatctcttcgaatttgtac	0.318																																						dbGAP											0													60.0	50.0	53.0					4																	15689207		692	1590	2282	-	-	-	SO:0001587	stop_gained	0			BC048993	CCDS47028.1	4p15.32	2014-04-02			ENSG00000237765	ENSG00000237765			27740	protein-coding gene	gene with protein product	"""chromosome 4 open reading frame 53"""						Standard	NM_001145191		Approved	C4orf53	uc003gof.4	P0CF97	OTTHUMG00000160279	ENST00000422728.2:c.607C>T	4.37:g.15689207C>T	ENSP00000393017:p.Arg203*			Nonsense_Mutation	SNP	superfamily_RNaseH-like_dom,superfamily_PAH	p.R203*	ENST00000422728.2	37	c.607	CCDS47028.1	4	.	.	.	.	.	.	.	.	.	.	C	41	8.870150	0.98984	.	.	ENSG00000237765	ENST00000422728	.	.	.	3.11	2.27	0.28462	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.1761	0.20444	0.0:0.8584:0.0:0.1416	.	.	.	.	X	203	.	.	R	+	1	2	FAM200B	15298305	0.003000	0.15002	0.834000	0.33040	0.923000	0.55619	-0.279000	0.08479	0.878000	0.35920	0.650000	0.86243	CGA	FAM200B	-	NULL	ENSG00000237765		0.318	FAM200B-005	PUTATIVE	basic|appris_principal|CCDS	protein_coding	FAM200B	HGNC	protein_coding	OTTHUMT00000360100.1	35	0.00	0	C	NM_001145191		15689207	15689207	+1	no_errors	ENST00000422728	ensembl	human	putative	69_37n	nonsense	23	23.33	7	SNP	0.940	T
FAM219A	203259	genome.wustl.edu	37	9	34402458	34402458	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr9:34402458C>T	ENST00000445726.1	-	4	577	c.271G>A	c.(271-273)Gtc>Atc	p.V91I	FAM219A_ENST00000297620.4_Missense_Mutation_p.V74I|FAM219A_ENST00000379081.1_Missense_Mutation_p.V62I|FAM219A_ENST00000379089.1_Missense_Mutation_p.V90I|FAM219A_ENST00000379087.1_Missense_Mutation_p.V73I|FAM219A_ENST00000379080.1_Missense_Mutation_p.V79I|FAM219A_ENST00000379084.1_Missense_Mutation_p.V73I|FAM219A_ENST00000379078.1_Missense_Mutation_p.V90I	NM_001184940.1|NM_001184941.1	NP_001171869.1|NP_001171870.1	Q8IW50	F219A_HUMAN	family with sequence similarity 219, member A	91																	TTATTGGGGACGACCAGCCTA	0.567																																						dbGAP											0													137.0	133.0	134.0					9																	34402458		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096350	CCDS6556.1, CCDS55304.1	9p11.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164970	ENSG00000164970			19920	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 25"""	C9orf25		9110174, 8619474	Standard	NM_147202		Approved	bA573M23.5, FLJ39031	uc011lok.2	Q8IW50	OTTHUMG00000019822	ENST00000445726.1:c.271G>A	9.37:g.34402458C>T	ENSP00000392452:p.Val91Ile		A2A364|B4DFE1|B4DSR8|Q5T590|Q5T591|Q5T592|Q5T594|Q5T595|Q8TAZ8	Missense_Mutation	SNP	NULL	p.V91I	ENST00000445726.1	37	c.271	CCDS55304.1	9	.	.	.	.	.	.	.	.	.	.	C	7.632	0.678994	0.14841	.	.	ENSG00000164970	ENST00000379089;ENST00000379087;ENST00000379084;ENST00000379081;ENST00000379080;ENST00000445726;ENST00000297620;ENST00000422409;ENST00000379078	.	.	.	4.6	4.6	0.57074	.	0.057569	0.64402	D	0.000002	T	0.55940	0.1952	L	0.53249	1.67	0.58432	D	0.999998	B;B;B;B;B	0.17038	0.02;0.007;0.017;0.007;0.003	B;B;B;B;B	0.13407	0.009;0.003;0.007;0.004;0.001	T	0.53165	-0.8477	9	0.12103	T	0.63	-7.6803	16.5698	0.84608	0.0:1.0:0.0:0.0	.	80;91;63;63;74	Q8IW50-4;Q8IW50;Q8IW50-3;Q8IW50-2;Q8IW50-6	.;CI025_HUMAN;.;.;.	I	90;73;73;62;79;91;74;90;90	.	ENSP00000297620:V74I	V	-	1	0	C9orf25	34392458	1.000000	0.71417	0.998000	0.56505	0.285000	0.27093	7.614000	0.82996	2.369000	0.80426	0.511000	0.50034	GTC	FAM219A	-	NULL	ENSG00000164970		0.567	FAM219A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM219A	HGNC	protein_coding		68	0.00	0	C	NM_001184940		34402458	34402458	-1	no_errors	ENST00000445726	ensembl	human	known	69_37n	missense	44	27.87	17	SNP	1.000	T
FANCC	2176	genome.wustl.edu	37	9	97873907	97873907	+	Silent	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr9:97873907A>G	ENST00000289081.3	-	13	1421	c.1167T>C	c.(1165-1167)ggT>ggC	p.G389G	RP11-80I15.4_ENST00000423075.1_RNA|FANCC_ENST00000375305.1_Silent_p.G389G|FANCC_ENST00000464653.1_5'Flank	NM_000136.2	NP_000127.2	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C	389					DNA repair (GO:0006281)|germ cell development (GO:0007281)|myeloid cell homeostasis (GO:0002262)|nucleotide-excision repair (GO:0006289)|protein complex assembly (GO:0006461)|removal of superoxide radicals (GO:0019430)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				kidney(1)|skin(1)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(62;0.138)				TCTCAAAGGGACCTCCGCAGG	0.522			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia C	9	9q22.3	2176	"""Fanconi anemia, complementation group C"""		L	0													99.0	95.0	96.0					9																	97873907		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC006303	CCDS35071.1, CCDS75861.1	9q22.3	2014-09-17			ENSG00000158169	ENSG00000158169		"""Fanconi anemia, complementation groups"""	3584	protein-coding gene	gene with protein product		613899		FACC		1303234	Standard	NM_001243743		Approved	FAC, FA3	uc004avh.3	Q00597	OTTHUMG00000020279	ENST00000289081.3:c.1167T>C	9.37:g.97873907A>G			B1ALR8	Silent	SNP	pfam_Fanconi,pirsf_Fanconi,prints_Fanconi	p.G389	ENST00000289081.3	37	c.1167	CCDS35071.1	9																																																																																			FANCC	-	pfam_Fanconi,pirsf_Fanconi	ENSG00000158169		0.522	FANCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCC	HGNC	protein_coding	OTTHUMT00000053219.1	41	0.00	0	A	NM_000136		97873907	97873907	-1	no_errors	ENST00000289081	ensembl	human	known	69_37n	silent	34	20.93	9	SNP	0.000	G
FBXO17	115290	genome.wustl.edu	37	19	39433304	39433305	+	Frame_Shift_Ins	INS	-	-	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr19:39433304_39433305insC	ENST00000292852.4	-	6	1121_1122	c.780_781insG	c.(778-783)gggcacfs	p.H261fs	FBXO17_ENST00000595329.1_Frame_Shift_Ins_p.H261fs|SARS2_ENST00000448145.2_Intron|CTC-360G5.8_ENST00000599996.1_Intron	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	261	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GCGCCATAGTGCCCCACCCAGG	0.584																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.781dupG	19.37:g.39433308_39433308dupC	ENSP00000292852:p.His261fs		Q96LQ4	Frame_Shift_Ins	INS	pfam_F-box-assoc_dom,pfam_F-box_dom_cyclin-like,superfamily_Galactose-bd-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like,pfscan_F-box-assoc_dom	p.H260fs	ENST00000292852.4	37	c.781_780	CCDS12526.1	19																																																																																			FBXO17	-	pfam_F-box-assoc_dom,superfamily_Galactose-bd-like,pfscan_F-box-assoc_dom	ENSG00000104835		0.584	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO17	HGNC	protein_coding	OTTHUMT00000463273.1	26	0.00	0	-	NM_024907		39433304	39433305	-1	no_errors	ENST00000292852	ensembl	human	known	69_37n	frame_shift_ins	13	13.33	2	INS	0.984:0.958	C
FGD5	152273	genome.wustl.edu	37	3	14964007	14964007	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr3:14964007C>T	ENST00000285046.5	+	15	3869	c.3759C>T	c.(3757-3759)tgC>tgT	p.C1253C	FGD5-AS1_ENST00000430166.1_RNA|FGD5_ENST00000543601.1_Silent_p.C1012C|FGD5_ENST00000476851.1_3'UTR	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1253					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						ACTGCGGCTGCGACTTCTCCC	0.627																																						dbGAP											0													36.0	42.0	40.0					3																	14964007		2134	4233	6367	-	-	-	SO:0001819	synonymous_variant	0			AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.3759C>T	3.37:g.14964007C>T			B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.C1253	ENST00000285046.5	37	c.3759	CCDS46767.1	3																																																																																			FGD5	-	pfam_Znf_FYVE,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	ENSG00000154783		0.627	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD5	HGNC	protein_coding	OTTHUMT00000340628.1	31	0.00	0	C	NM_152536		14964007	14964007	+1	no_errors	ENST00000285046	ensembl	human	known	69_37n	silent	8	38.46	5	SNP	0.853	T
FLNC	2318	genome.wustl.edu	37	7	128478072	128478072	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:128478072G>A	ENST00000325888.8	+	6	1262	c.1001G>A	c.(1000-1002)cGc>cAc	p.R334H	FLNC_ENST00000346177.6_Missense_Mutation_p.R334H	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	334					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GACAAGGATCGCACCTATGCT	0.542																																						dbGAP											0													134.0	145.0	142.0					7																	128478072		2096	4218	6314	-	-	-	SO:0001583	missense	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.1001G>A	7.37:g.128478072G>A	ENSP00000327145:p.Arg334His		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.R334H	ENST00000325888.8	37	c.1001	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	G	23.2	4.383845	0.82792	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	T;T	0.63096	-0.02;-0.02	5.64	5.64	0.86602	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.057271	0.64402	D	0.000006	T	0.73900	0.3646	L	0.61218	1.895	0.41718	D	0.989499	D;D	0.76494	0.999;0.997	D;D	0.66497	0.944;0.938	T	0.76027	-0.3109	10	0.66056	D	0.02	.	11.9853	0.53145	0.0875:0.0:0.9125:0.0	.	334;334	Q14315-2;Q14315	.;FLNC_HUMAN	H	334	ENSP00000327145:R334H;ENSP00000344002:R334H	ENSP00000327145:R334H	R	+	2	0	FLNC	128265308	0.827000	0.29292	0.998000	0.56505	0.749000	0.42624	3.226000	0.51254	2.651000	0.90000	0.655000	0.94253	CGC	FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.542	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	55	0.00	0	G			128478072	128478072	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	missense	46	11.54	6	SNP	1.000	A
FOXP4	116113	genome.wustl.edu	37	6	41557781	41557781	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:41557781delC	ENST00000307972.4	+	10	1242	c.1230delC	c.(1228-1230)cacfs	p.H410fs	FOXP4_ENST00000373060.1_Frame_Shift_Del_p.H410fs|FOXP4_ENST00000409208.1_Frame_Shift_Del_p.H398fs|FOXP4_ENST00000373057.3_Frame_Shift_Del_p.H408fs|FOXP4_ENST00000373063.3_Frame_Shift_Del_p.H397fs			Q8IVH2	FOXP4_HUMAN	forkhead box P4	410					embryonic foregut morphogenesis (GO:0048617)|heart development (GO:0007507)|lung secretory cell differentiation (GO:0061140)|negative regulation of lung goblet cell differentiation (GO:1901250)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					GTCTCGTGCACCCCCCGACCT	0.682																																						dbGAP											0													40.0	42.0	41.0					6																	41557781		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB080747	CCDS4856.1, CCDS34447.1, CCDS34448.1	6p21.1	2008-02-05			ENSG00000137166	ENSG00000137166		"""Forkhead boxes"""	20842	protein-coding gene	gene with protein product		608924					Standard	XM_006714991		Approved	FLJ40908	uc003oql.3	Q8IVH2	OTTHUMG00000014679	ENST00000307972.4:c.1230delC	6.37:g.41557781delC	ENSP00000309823:p.His410fs		Q5W098|Q7Z7F8|Q8IW55|Q96E19	Frame_Shift_Del	DEL	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.P412fs	ENST00000307972.4	37	c.1230	CCDS34447.1	6																																																																																			FOXP4	-	NULL	ENSG00000137166		0.682	FOXP4-002	KNOWN	basic|CCDS	protein_coding	FOXP4	HGNC	protein_coding	OTTHUMT00000106767.1	25	0.00	0	C	NM_138457		41557781	41557781	+1	no_errors	ENST00000307972	ensembl	human	known	69_37n	frame_shift_del	13	27.78	5	DEL	0.964	-
FRZB	2487	genome.wustl.edu	37	2	183703303	183703303	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:183703303G>A	ENST00000295113.4	-	4	1240	c.631C>T	c.(631-633)Cat>Tat	p.H211Y		NM_001463.3	NP_001454.2	Q92765	SFRP3_HUMAN	frizzled-related protein	211	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				brain development (GO:0007420)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell development (GO:0010721)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of hepatocyte differentiation (GO:0070367)|negative regulation of Wnt signaling pathway (GO:0030178)|neural crest cell differentiation (GO:0014033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fat cell differentiation (GO:0045600)|skeletal system development (GO:0001501)|somite development (GO:0061053)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(117;0.109)|Epithelial(96;0.231)			GTCACATCATGGCACTTAGTC	0.418																																						dbGAP											0													132.0	126.0	128.0					2																	183703303		2203	4300	6503	-	-	-	SO:0001583	missense	0			U24163	CCDS2286.1	2q32.1	2013-09-19			ENSG00000162998	ENSG00000162998		"""Secreted frizzled-related proteins"""	3959	protein-coding gene	gene with protein product		605083				8824257, 9118218	Standard	NM_001463		Approved	FRZB-PEN, FRZB1, SRFP3, FRP-3, SFRP3, FRE, FRITZ, FRZB-1, FZRB, hFIZ	uc002upa.2	Q92765	OTTHUMG00000132597	ENST00000295113.4:c.631C>T	2.37:g.183703303G>A	ENSP00000295113:p.His211Tyr		O00181|Q99686	Missense_Mutation	SNP	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.H211Y	ENST00000295113.4	37	c.631	CCDS2286.1	2	.	.	.	.	.	.	.	.	.	.	G	22.5	4.295368	0.81025	.	.	ENSG00000162998	ENST00000295113	T	0.29655	1.56	5.15	5.15	0.70609	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);	0.055821	0.64402	D	0.000001	T	0.44477	0.1295	L	0.40543	1.245	0.53688	D	0.999976	D	0.54047	0.964	P	0.60068	0.868	T	0.13415	-1.0510	10	0.31617	T	0.26	.	18.6599	0.91469	0.0:0.0:1.0:0.0	.	211	Q92765	SFRP3_HUMAN	Y	211	ENSP00000295113:H211Y	ENSP00000295113:H211Y	H	-	1	0	FRZB	183411548	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.783000	0.85696	2.406000	0.81754	0.557000	0.71058	CAT	FRZB	-	pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,smart_Netrin_module_non-TIMP,pfscan_Netrin_domain	ENSG00000162998		0.418	FRZB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRZB	HGNC	protein_coding	OTTHUMT00000255808.1	46	0.00	0	G	NM_001463		183703303	183703303	-1	no_errors	ENST00000295113	ensembl	human	known	69_37n	missense	43	15.69	8	SNP	1.000	A
FUT5	2527	genome.wustl.edu	37	19	5867314	5867314	+	Missense_Mutation	SNP	C	C	A	rs61731655	byFrequency	TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr19:5867314C>A	ENST00000588525.1	-	2	510	c.423G>T	c.(421-423)caG>caT	p.Q141H	FUT5_ENST00000252675.5_Missense_Mutation_p.Q141H	NM_002034.2	NP_002025.2	Q11128	FUT5_HUMAN	fucosyltransferase 5 (alpha (1,3) fucosyltransferase)	141					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12						AGCGCTGCCCCTGCGGCCTGG	0.632																																						dbGAP											0													47.0	44.0	45.0					19																	5867314		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12154.1	19p13.3	2013-02-26				ENSG00000130383	2.4.1.65	"""Fucosyltransferases"""	4016	protein-coding gene	gene with protein product		136835				1740457	Standard	NM_002034		Approved	FUC-TV	uc002mdo.4	Q11128	OTTHUMG00000180616	ENST00000588525.1:c.423G>T	19.37:g.5867314C>A	ENSP00000466880:p.Gln141His		A8K4X2	Missense_Mutation	SNP	pfam_Glyco_trans_10	p.Q141H	ENST00000588525.1	37	c.423	CCDS12154.1	19	.	.	.	.	.	.	.	.	.	.	C	4.852	0.158432	0.09236	.	.	ENSG00000130383	ENST00000252675	T	0.25912	1.77	2.17	-4.35	0.03656	.	0.639484	0.13831	U	0.359741	T	0.11324	0.0276	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.16041	-1.0416	10	0.49607	T	0.09	.	0.3969	0.00419	0.4021:0.1895:0.1351:0.2733	.	141	Q11128	FUT5_HUMAN	H	141	ENSP00000252675:Q141H	ENSP00000252675:Q141H	Q	-	3	2	FUT5	5818314	0.000000	0.05858	0.027000	0.17364	0.147000	0.21601	-6.052000	0.00083	-1.727000	0.01368	0.407000	0.27541	CAG	FUT5	-	pfam_Glyco_trans_10	ENSG00000130383		0.632	FUT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT5	HGNC	protein_coding	OTTHUMT00000452213.1	36	0.00	0	C	NM_002034		5867314	5867314	-1	no_errors	ENST00000252675	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	0.002	A
GALNT8	26290	genome.wustl.edu	37	12	4870281	4870281	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:4870281T>C	ENST00000252318.2	+	7	1668	c.1331T>C	c.(1330-1332)gTc>gCc	p.V444A		NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	444					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						AAACACATGGTCTACTTGGCC	0.537																																					Colon(108;631 1558 7270 20097 39846)	dbGAP											0													131.0	109.0	116.0					12																	4870281		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.1331T>C	12.37:g.4870281T>C	ENSP00000252318:p.Val444Ala		B2RU02	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.V444A	ENST00000252318.2	37	c.1331	CCDS8533.1	12	.	.	.	.	.	.	.	.	.	.	T	19.37	3.814859	0.70912	.	.	ENSG00000130035	ENST00000252318	T	0.28069	1.63	3.09	3.09	0.35607	.	0.178076	0.35291	N	0.003314	T	0.50446	0.1616	M	0.76727	2.345	0.35681	D	0.814085	D	0.89917	1.0	D	0.71414	0.973	T	0.63488	-0.6626	10	0.87932	D	0	.	9.3442	0.38098	0.0:0.0:0.0:1.0	.	444	Q9NY28	GALT8_HUMAN	A	444	ENSP00000252318:V444A	ENSP00000252318:V444A	V	+	2	0	GALNT8	4740542	1.000000	0.71417	0.998000	0.56505	0.880000	0.50808	7.359000	0.79477	1.303000	0.44873	0.374000	0.22700	GTC	GALNT8	-	NULL	ENSG00000130035		0.537	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	GALNT8	HGNC	protein_coding	OTTHUMT00000388277.2	40	0.00	0	T	NM_017417		4870281	4870281	+1	no_errors	ENST00000252318	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	1.000	C
GBA3	57733	genome.wustl.edu	37	4	22749085	22749085	+	RNA	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr4:22749085T>C	ENST00000503442.1	+	0	377				GBA3_ENST00000508166.1_RNA|GBA3_ENST00000511446.2_RNA	NM_001128432.2	NP_001121904.1	Q9H227	GBA3_HUMAN	glucosidase, beta, acid 3 (gene/pseudogene)						carbohydrate metabolic process (GO:0005975)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	beta-galactosidase activity (GO:0004565)|beta-glucosidase activity (GO:0008422)|glycosylceramidase activity (GO:0017042)			breast(1)|kidney(2)|large_intestine(4)|lung(20)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TTTGCTTCAGTACCTTTGGGG	0.423																																						dbGAP											0													168.0	166.0	167.0					4																	22749085		1899	4122	6021	-	-	-			0			AB017913		4p15.2	2013-05-09	2013-05-09		ENSG00000249948	ENSG00000249948	3.2.1.21		19069	protein-coding gene	gene with protein product	"""klotho-related protein"""	606619	"""glucosidase, beta, acid 3 (cytosolic)"""			11389701	Standard	NM_020973		Approved	GLUC, KLrP	uc031sdv.1	Q9H227	OTTHUMG00000160448		4.37:g.22749085T>C			Q32LY7|Q3MIH4|Q53GG8|Q6NSF4|Q8NHT8|Q9H3T4|Q9H4C6	Silent	SNP	NULL	p.S151	ENST00000503442.1	37	c.453		4																																																																																			GBA3	-	NULL	ENSG00000249948		0.423	GBA3-003	KNOWN	basic	polymorphic_pseudogene	GBA3	HGNC	polymorphic_pseudogene	OTTHUMT00000360620.2	72	0.00	0	T			22749085	22749085	+1	pseudogene	ENST00000508166	ensembl	human	known	69_37n	silent	37	13.95	6	SNP	0.000	C
GNLY	10578	genome.wustl.edu	37	2	85922455	85922455	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:85922455C>T	ENST00000263863.4	+	2	193	c.65C>T	c.(64-66)tCt>tTt	p.S22F	GNLY_ENST00000533041.1_3'UTR|GNLY_ENST00000409696.3_Missense_Mutation_p.S7F|GNLY_ENST00000524600.1_Missense_Mutation_p.S49F	NM_006433.3	NP_006424.2	P22749	GNLY_HUMAN	granulysin	22					cellular defense response (GO:0006968)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|killing of cells of other organism (GO:0031640)	extracellular space (GO:0005615)				endometrium(4)|kidney(10)|large_intestine(1)|lung(1)|skin(2)|upper_aerodigestive_tract(1)	19						CTGGTCTTCTCTCGTCTGAGC	0.622																																						dbGAP											0													86.0	69.0	75.0					2																	85922455		2203	4300	6503	-	-	-	SO:0001583	missense	0			X54101	CCDS1984.1, CCDS46354.1	2p12-q11	2008-02-05			ENSG00000115523	ENSG00000115523			4414	protein-coding gene	gene with protein product	"""T-lymphocyte activation gene 519"""	188855		LAG2		2212946, 2434598	Standard	NM_012483		Approved	NKG5, LAG-2, D2S69E, TLA519	uc002sql.4	P22749	OTTHUMG00000130179	ENST00000263863.4:c.65C>T	2.37:g.85922455C>T	ENSP00000263863:p.Ser22Phe		P09325|Q6GU08	Missense_Mutation	SNP	pfam_SapB_2,superfamily_Saposin-like,smart_SaposinB,pfscan_SaposinB	p.S22F	ENST00000263863.4	37	c.65	CCDS1984.1	2	.	.	.	.	.	.	.	.	.	.	C	14.39	2.521766	0.44866	.	.	ENSG00000115523	ENST00000263863;ENST00000524600;ENST00000409696	T;T;T	0.56776	0.44;0.45;0.47	1.64	0.705	0.18127	.	0.162638	0.26586	U	0.023556	T	0.47432	0.1445	L	0.34521	1.04	0.09310	N	1	D;D	0.69078	0.992;0.997	P;P	0.54590	0.657;0.756	T	0.36286	-0.9754	10	0.87932	D	0	.	5.8522	0.18699	0.0:0.6641:0.3359:0.0	.	49;22	B4E3H9;P22749	.;GNLY_HUMAN	F	22;49;7	ENSP00000263863:S22F;ENSP00000436423:S49F;ENSP00000387116:S7F	ENSP00000263863:S22F	S	+	2	0	GNLY	85775966	0.441000	0.25626	0.289000	0.24876	0.372000	0.29890	1.467000	0.35321	0.277000	0.22141	0.306000	0.20318	TCT	GNLY	-	NULL	ENSG00000115523		0.622	GNLY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNLY	HGNC	protein_coding	OTTHUMT00000252497.1	56	0.00	0	C	NM_006433		85922455	85922455	+1	no_errors	ENST00000263863	ensembl	human	known	69_37n	missense	29	14.71	5	SNP	0.288	T
GPM6B	2824	genome.wustl.edu	37	X	13835019	13835019	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chrX:13835019T>C	ENST00000356942.5	-	1	446	c.5A>G	c.(4-6)aAg>aGg	p.K2R	GPM6B_ENST00000454189.2_Intron|GPM6B_ENST00000493677.1_5'UTR|GPM6B_ENST00000316715.4_Missense_Mutation_p.K2R|GPM6B_ENST00000355135.2_Missense_Mutation_p.K2R|GPM6B_ENST00000398361.3_Intron	NM_005278.3	NP_005269.1	Q13491	GPM6B_HUMAN	glycoprotein M6B	2					cell differentiation (GO:0030154)|extracellular matrix assembly (GO:0085029)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of serotonin uptake (GO:0051612)|nervous system development (GO:0007399)|ossification (GO:0001503)|positive regulation of bone mineralization (GO:0030501)|protein transport (GO:0015031)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of focal adhesion assembly (GO:0051893)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|ovary(1)|pancreas(1)	6						CATGGCTGGCTTCATACCATC	0.468																																						dbGAP											0													236.0	205.0	216.0					X																	13835019		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14158.1, CCDS35206.1, CCDS35207.1, CCDS48084.1	Xp22.2	2010-08-03			ENSG00000046653	ENSG00000046653			4461	protein-coding gene	gene with protein product		300051				8661015	Standard	NM_001001995		Approved	M6B, MGC17150, MGC54284	uc004cvw.3	Q13491	OTTHUMG00000021162	ENST00000356942.5:c.5A>G	X.37:g.13835019T>C	ENSP00000349420:p.Lys2Arg		O76077|Q86X43|Q8N956	Missense_Mutation	SNP	pfam_Myelin_PLP,smart_Myelin_PLP,prints_Myelin_PLP	p.K2R	ENST00000356942.5	37	c.5	CCDS14158.1	X	.	.	.	.	.	.	.	.	.	.	T	16.46	3.128587	0.56721	.	.	ENSG00000046653	ENST00000316715;ENST00000355135;ENST00000356942;ENST00000475307	D;D;D;D	0.99519	-6.07;-6.05;-5.73;-4.87	5.08	5.08	0.68730	.	0.000000	0.52532	D	0.000064	D	0.98510	0.9503	N	0.08118	0	0.80722	D	1	B;B;D	0.69078	0.048;0.058;0.997	B;B;D	0.73380	0.026;0.022;0.98	D	0.99851	1.1072	10	0.49607	T	0.09	0.2017	14.0677	0.64841	0.0:0.0:0.0:1.0	.	2;2;2	Q13491;Q13491-3;Q8N956	GPM6B_HUMAN;.;.	R	2	ENSP00000316861:K2R;ENSP00000347258:K2R;ENSP00000349420:K2R;ENSP00000418594:K2R	ENSP00000316861:K2R	K	-	2	0	GPM6B	13744940	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.468000	0.66743	1.897000	0.54924	0.481000	0.45027	AAG	GPM6B	-	NULL	ENSG00000046653		0.468	GPM6B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GPM6B	HGNC	protein_coding	OTTHUMT00000055822.1	173	0.00	0	T	NM_001001995		13835019	13835019	-1	no_errors	ENST00000316715	ensembl	human	known	69_37n	missense	78	13.33	12	SNP	1.000	C
GPR112	139378	genome.wustl.edu	37	X	135441601	135441601	+	Silent	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chrX:135441601A>G	ENST00000394143.1	+	11	7422	c.7131A>G	c.(7129-7131)gcA>gcG	p.A2377A	GPR112_ENST00000370652.1_Silent_p.A2377A|GPR112_ENST00000287534.4_Intron|GPR112_ENST00000394141.1_Silent_p.A2172A|GPR112_ENST00000412101.1_Silent_p.A2172A	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2377					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					AACACGTTGCAGTGAAAAAAC	0.323																																						dbGAP											0													91.0	80.0	84.0					X																	135441601		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.7131A>G	X.37:g.135441601A>G			A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.A2377	ENST00000394143.1	37	c.7131	CCDS35409.1	X																																																																																			GPR112	-	NULL	ENSG00000156920		0.323	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	51	0.00	0	A			135441601	135441601	+1	no_errors	ENST00000370652	ensembl	human	known	69_37n	silent	40	20.00	10	SNP	0.569	G
GPR84	53831	genome.wustl.edu	37	12	54757017	54757017	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:54757017G>A	ENST00000551809.1	-	1	1254	c.619C>T	c.(619-621)Cga>Tga	p.R207*	RP11-753H16.3_ENST00000550474.1_RNA|GPR84_ENST00000267015.3_Nonsense_Mutation_p.R207*|RP11-753H16.5_ENST00000552785.1_RNA			Q9NQS5	GPR84_HUMAN	G protein-coupled receptor 84	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|kidney(2)|large_intestine(6)|lung(5)|skin(1)|urinary_tract(1)	18						TGTGCTGCTCGTTTGACCTGG	0.567																																						dbGAP											0													170.0	147.0	155.0					12																	54757017		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF237762	CCDS8878.1	12q13.13	2012-08-20						"""GPCR / Class A : Fatty acid receptors"""	4535	protein-coding gene	gene with protein product		606383				11273702	Standard	NM_020370		Approved	EX33	uc001sfu.3	Q9NQS5		ENST00000551809.1:c.619C>T	12.37:g.54757017G>A	ENSP00000450310:p.Arg207*		B6V9G7	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.R207*	ENST00000551809.1	37	c.619	CCDS8878.1	12	.	.	.	.	.	.	.	.	.	.	G	40	8.370960	0.98781	.	.	ENSG00000139572	ENST00000267015;ENST00000551809	.	.	.	5.03	1.94	0.25998	.	0.588693	0.15161	N	0.277141	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.1028	1.7894	0.03048	0.1794:0.1628:0.4897:0.1681	.	.	.	.	X	207	.	ENSP00000267015:R207X	R	-	1	2	GPR84	53043284	0.000000	0.05858	0.994000	0.49952	0.992000	0.81027	0.689000	0.25437	0.619000	0.30197	0.561000	0.74099	CGA	GPR84	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000139572		0.567	GPR84-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPR84	HGNC	protein_coding	OTTHUMT00000406156.1	107	0.00	0	G			54757017	54757017	-1	no_errors	ENST00000267015	ensembl	human	known	69_37n	nonsense	44	10.00	5	SNP	0.014	A
GPR98	84059	genome.wustl.edu	37	5	90151694	90151694	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:90151694A>G	ENST00000405460.2	+	82	17827	c.17731A>G	c.(17731-17733)Act>Gct	p.T5911A	GPR98_ENST00000425867.2_Missense_Mutation_p.T1572A	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5911					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AGCCTTCTTCACTTCTGGATT	0.363																																						dbGAP											0													181.0	168.0	172.0					5																	90151694		1902	4115	6017	-	-	-	SO:0001583	missense	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.17731A>G	5.37:g.90151694A>G	ENSP00000384582:p.Thr5911Ala		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.T5911A	ENST00000405460.2	37	c.17731	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	A	10.04	1.240770	0.22711	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.33216	1.47;1.42	5.49	4.31	0.51392	GPCR, family 2-like (1);	0.151016	0.64402	D	0.000010	T	0.08537	0.0212	N	0.00436	-1.5	0.24917	N	0.992009	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.01281	0.0;0.0;0.0	T	0.26326	-1.0106	9	.	.	.	.	12.1145	0.53858	0.1303:0.0:0.0:0.8697	.	1572;5911;1572	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	A	5911;5911;1572	ENSP00000384582:T5911A;ENSP00000392618:T1572A	.	T	+	1	0	GPR98	90187450	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	3.862000	0.56009	1.010000	0.39314	-0.429000	0.05907	ACT	GPR98	-	pfscan_GPCR_2-like	ENSG00000164199		0.363	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	97	0.00	0	A	NM_032119		90151694	90151694	+1	no_errors	ENST00000405460	ensembl	human	known	69_37n	missense	46	22.03	13	SNP	1.000	G
HEATR2	54919	genome.wustl.edu	37	7	819661	819661	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:819661C>G	ENST00000297440.6	+	12	2331	c.2311C>G	c.(2311-2313)Ctg>Gtg	p.L771V	HEATR2_ENST00000403952.3_Missense_Mutation_p.L196V|HEATR2_ENST00000313147.5_Missense_Mutation_p.L771V	NM_017802.3	NP_060272.3	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	771						cytoplasm (GO:0005737)				breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(4)|skin(1)	22		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		GGTCACCTGGCTGCAGTGTGT	0.552																																						dbGAP											0													133.0	108.0	116.0					7																	819661		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832914, AK000404, NM_017802, AK056233	CCDS34580.1	7p22.3	2014-05-06	2006-05-19		ENSG00000164818	ENSG00000164818			26013	protein-coding gene	gene with protein product		614864				23040496	Standard	NM_017802		Approved	FLJ20397, FLJ31671, FLJ39381, FLJ25564, CILD18	uc010krz.1	Q86Y56	OTTHUMG00000151416	ENST00000297440.6:c.2311C>G	7.37:g.819661C>G	ENSP00000297440:p.Leu771Val		Q69YL1|Q96FI9|Q9NX75	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.L771V	ENST00000297440.6	37	c.2311	CCDS34580.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.35|12.35	1.910195|1.910195	0.33721|0.33721	.|.	.|.	ENSG00000164818|ENSG00000164818	ENST00000440747|ENST00000297440;ENST00000313147;ENST00000537862;ENST00000403952	.|T;T;T	.|0.67865	.|-0.29;-0.29;-0.29	4.24|4.24	4.24|4.24	0.50183|0.50183	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.218650	.|0.39615	.|N	.|0.001315	T|T	0.73806|0.73806	0.3634|0.3634	M|M	0.68952|0.68952	2.095|2.095	0.29730|0.29730	N|N	0.837977|0.837977	.|D;D;D	.|0.61080	.|0.984;0.989;0.962	.|P;P;P	.|0.62435	.|0.902;0.9;0.677	T|T	0.71210|0.71210	-0.4660|-0.4660	5|10	.|0.66056	.|D	.|0.02	-16.0125|-16.0125	6.2692|6.2692	0.20945|0.20945	0.0:0.7436:0.0:0.2564|0.0:0.7436:0.0:0.2564	.|.	.|771;196;517	.|Q86Y56;E9PGY2;F5H8D4	.|HEAT2_HUMAN;.;.	G|V	572|771;771;517;196	.|ENSP00000297440:L771V;ENSP00000321451:L771V;ENSP00000384884:L196V	.|ENSP00000297440:L771V	A|L	+|+	2|1	0|2	HEATR2|HEATR2	786187|786187	1.000000|1.000000	0.71417|0.71417	0.958000|0.958000	0.39756|0.39756	0.088000|0.088000	0.18126|0.18126	2.648000|2.648000	0.46647|0.46647	2.053000|2.053000	0.61076|0.61076	0.555000|0.555000	0.69702|0.69702	GCT|CTG	HEATR2	-	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	ENSG00000164818		0.552	HEATR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR2	HGNC	protein_coding	OTTHUMT00000322542.1	41	0.00	0	C	NM_017802		819661	819661	+1	no_errors	ENST00000297440	ensembl	human	known	69_37n	missense	38	13.64	6	SNP	1.000	G
HGF	3082	genome.wustl.edu	37	7	81339534	81339534	+	Silent	SNP	C	C	T	rs372075114		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:81339534C>T	ENST00000222390.5	-	13	1696	c.1470G>A	c.(1468-1470)acG>acA	p.T490T	HGF_ENST00000457544.2_Silent_p.T485T	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	490					activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)	p.T490T(2)		NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						GCAATTGTTTCGTTTTGGCAC	0.328																																						dbGAP											2	Substitution - coding silent(2)	skin(2)											143.0	127.0	132.0					7																	81339534		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.1470G>A	7.37:g.81339534C>T			A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Silent	SNP	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.T490	ENST00000222390.5	37	c.1470	CCDS5597.1	7																																																																																			HGF	-	superfamily_Pept_cys/ser_Trypsin-like	ENSG00000019991		0.328	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGF	HGNC	protein_coding	OTTHUMT00000253315.2	69	0.00	0	C	NM_000601		81339534	81339534	-1	no_errors	ENST00000222390	ensembl	human	known	69_37n	silent	58	20.55	15	SNP	1.000	T
HGFAC	3083	genome.wustl.edu	37	4	3445881	3445881	+	Silent	SNP	C	C	T	rs373167210		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr4:3445881C>T	ENST00000382774.3	+	5	706	c.591C>T	c.(589-591)tgC>tgT	p.C197C	HGFAC_ENST00000511533.1_Silent_p.C197C	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	197	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		GCAAGGACTGCGGCACAGGTG	0.697																																						dbGAP											0													12.0	13.0	13.0					4																	3445881		2187	4289	6476	-	-	-	SO:0001819	synonymous_variant	0			D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.591C>T	4.37:g.3445881C>T			Q14726|Q2M1W7|Q53X47	Silent	SNP	pirsf_Coagulation_fac_XIIa/HGFA,pfam_Peptidase_S1_S6,pfam_Kringle,pfam_FN_type2_col-bd,pfam_Fibronectin_type1,pfam_EGF-like_dom,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_FN_type2_col-bd,smart_EGF-like,smart_Fibronectin_type1,smart_Kringle,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_EG-like_dom,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.C197	ENST00000382774.3	37	c.591	CCDS3369.1	4																																																																																			HGFAC	-	pirsf_Coagulation_fac_XIIa/HGFA,smart_EGF-like,pfscan_EG-like_dom	ENSG00000109758		0.697	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGFAC	HGNC	protein_coding	OTTHUMT00000206607.3	9	0.00	0	C			3445881	3445881	+1	no_errors	ENST00000382774	ensembl	human	known	69_37n	silent	9	35.71	5	SNP	0.007	T
HIST1H2BB	3018	genome.wustl.edu	37	6	26043595	26043595	+	Silent	SNP	C	C	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:26043595C>A	ENST00000357905.2	-	1	290	c.291G>T	c.(289-291)acG>acT	p.T97T	HIST1H3C_ENST00000540144.1_5'Flank	NM_021062.2	NP_066406.1	P33778	H2B1B_HUMAN	histone cluster 1, H2bb	97					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7						GGCGCACAGCCGTCTGAATCT	0.557																																						dbGAP											0													59.0	59.0	59.0					6																	26043595		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF531285	CCDS4575.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196226			"""Histones / Replication-dependent"""	4751	protein-coding gene	gene with protein product		602803	"""H2B histone family, member F"", ""histone 1, H2bb"""	H2BFF		8227173, 12408966	Standard	NM_021062		Approved	H2B/f	uc003nfu.3	P33778	OTTHUMG00000014421	ENST00000357905.2:c.291G>T	6.37:g.26043595C>A			Q4KN36	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.T97	ENST00000357905.2	37	c.291	CCDS4575.1	6																																																																																			HIST1H2BB	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000196226		0.557	HIST1H2BB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BB	HGNC	protein_coding	OTTHUMT00000040083.1	42	0.00	0	C	NM_021062		26043595	26043595	-1	no_errors	ENST00000357905	ensembl	human	known	69_37n	silent	26	13.33	4	SNP	0.996	A
HIST3H3	8290	genome.wustl.edu	37	1	228612752	228612752	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:228612752G>A	ENST00000366696.1	-	1	274	c.275C>T	c.(274-276)gCg>gTg	p.A92V		NM_003493.2	NP_003484.1	Q16695	H31T_HUMAN	histone cluster 3, H3	92					telomere maintenance (GO:0000723)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(1)|lung(2)|prostate(2)|skin(1)	6		Prostate(94;0.0724)				CTCCTGCAGCGCCATCACGGC	0.587																																						dbGAP											0													93.0	87.0	89.0					1																	228612752		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z49861	CCDS1572.1	1q42.13	2012-09-19	2006-10-11	2003-02-21	ENSG00000168148	ENSG00000168148		"""Histones / Replication-dependent"""	4778	protein-coding gene	gene with protein product		602820	"""H3 histone family, member T"", ""histone 3, H3"""	H3FT		8834248, 12408966	Standard	NM_003493		Approved	H3t, H3/g, H3.4	uc001hsx.1	Q16695	OTTHUMG00000040044	ENST00000366696.1:c.275C>T	1.37:g.228612752G>A	ENSP00000355657:p.Ala92Val		B2R5K3|Q6FGU4	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.A92V	ENST00000366696.1	37	c.275	CCDS1572.1	1	.	.	.	.	.	.	.	.	.	.	g	11.44	1.640054	0.29157	.	.	ENSG00000168148	ENST00000366696	T	0.70516	-0.49	3.89	3.89	0.44902	Histone-fold (2);Histone core (1);	0.000000	0.39407	N	0.001374	T	0.74481	0.3722	H	0.94423	3.535	0.48901	D	0.99972	P	0.37330	0.59	B	0.24269	0.052	T	0.82810	-0.0273	10	0.66056	D	0.02	.	14.213	0.65776	0.0:0.0:1.0:0.0	.	92	Q16695	H31T_HUMAN	V	92	ENSP00000355657:A92V	ENSP00000355657:A92V	A	-	2	0	HIST3H3	226679375	1.000000	0.71417	0.985000	0.45067	0.011000	0.07611	7.210000	0.77924	2.438000	0.82558	0.645000	0.84053	GCG	HIST3H3	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000168148		0.587	HIST3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST3H3	HGNC	protein_coding	OTTHUMT00000096595.2	46	0.00	0	G	NM_003493		228612752	228612752	-1	no_errors	ENST00000366696	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	1.000	A
HNF1A	6927	genome.wustl.edu	37	12	121432116	121432117	+	Frame_Shift_Ins	INS	-	-	C	rs56348580	byFrequency	TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:121432116_121432117insC	ENST00000257555.6	+	4	1089_1090	c.863_864insC	c.(862-867)gggcccfs	p.P289fs	HNF1A_ENST00000543427.1_Frame_Shift_Ins_p.P172fs|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000544413.1_Frame_Shift_Ins_p.P289fs|HNF1A_ENST00000402929.1_Frame_Shift_Ins_p.P289fs|HNF1A_ENST00000400024.2_Frame_Shift_Ins_p.P289fs|HNF1A_ENST00000541395.1_Frame_Shift_Ins_p.P289fs			P20823	HNF1A_HUMAN	HNF1 homeobox A	289					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ACGTACAGCGGGCCCCCCCCAG	0.668									Hepatic Adenoma, Familial Clustering of																													dbGAP											0			GRCh37	CI064741|CM067044	HNF1A	I|M	rs56348580																																			-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	Exception_encountered	12.37:g.121432116_121432117insC	ENSP00000257555:p.Pro289fs		A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Frame_Shift_Ins	INS	pfam_HNF1b_C,pfam_HNF-1_N,pfam_HNF1a_C,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_HNF1_dimer_dom,smart_Homeodomain,pfscan_Homeodomain	p.P289fs	ENST00000257555.6	37	c.863_864	CCDS9209.1	12																																																																																			HNF1A	-	pfam_HNF1b_C,superfamily_Homeodomain-like	ENSG00000135100		0.668	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1A	HGNC	protein_coding	OTTHUMT00000320957.5	16	0.00	0	-	NM_000545		121432116	121432117	+1	no_errors	ENST00000257555	ensembl	human	known	69_37n	frame_shift_ins	11	26.67	4	INS	0.997:0.998	C
HOOK3	84376	genome.wustl.edu	37	8	42868496	42868497	+	Frame_Shift_Ins	INS	-	-	AG			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr8:42868496_42868497insAG	ENST00000307602.4	+	21	2169_2170	c.1969_1970insAG	c.(1969-1971)cagfs	p.Q657fs		NM_032410.3	NP_115786.1	Q86VS8	HOOK3_HUMAN	hook microtubule-tethering protein 3	657	Required for association with Golgi.|Required for interaction with MSR1.				cytoplasmic microtubule organization (GO:0031122)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|Golgi localization (GO:0051645)|interkinetic nuclear migration (GO:0022027)|lysosome organization (GO:0007040)|microtubule anchoring at centrosome (GO:0034454)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|protein localization to centrosome (GO:0071539)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|FHF complex (GO:0070695)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|pericentriolar material (GO:0000242)	identical protein binding (GO:0042802)|microtubule binding (GO:0008017)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	31	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			AACAAAGAGTCAGAGAGAGATG	0.243			T	RET	papillary thyroid																																	dbGAP		Dom	yes		8	8p11.21	84376	hook homolog 3		E	0																																										-	-	-	SO:0001589	frameshift_variant	0			AK090540	CCDS6139.1	8p11.21	2013-08-21	2013-08-21		ENSG00000168172	ENSG00000168172			23576	protein-coding gene	gene with protein product		607825	"""hook homolog 3 (Drosophila)"""			9927460	Standard	NM_032410		Approved	HK3	uc003xpr.3	Q86VS8	OTTHUMG00000165278	ENST00000307602.4:c.1976_1977dupAG	8.37:g.42868503_42868504dupAG	ENSP00000305699:p.Gln657fs		D3DSY8|Q8NBH0|Q9BY13	Frame_Shift_Ins	INS	pfam_HOOK,superfamily_t-SNARE	p.M660fs	ENST00000307602.4	37	c.1969_1970	CCDS6139.1	8																																																																																			HOOK3	-	pfam_HOOK	ENSG00000168172		0.243	HOOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK3	HGNC	protein_coding	OTTHUMT00000383172.2	54	0.00	0	-	NM_032410		42868496	42868497	+1	no_errors	ENST00000307602	ensembl	human	known	69_37n	frame_shift_ins	37	13.95	6	INS	1.000:1.000	AG
HOXD8	3234	genome.wustl.edu	37	2	176996277	176996277	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:176996277C>T	ENST00000313173.4	+	2	1437	c.810C>T	c.(808-810)gaC>gaT	p.D270D	HOXD8_ENST00000544999.1_Silent_p.D269D|HOXD8_ENST00000450510.2_Silent_p.D269D|HOXD8_ENST00000429017.1_Silent_p.D86D|HOXD-AS2_ENST00000440016.2_RNA|HOXD8_ENST00000548663.1_Silent_p.D166D	NM_001199746.1|NM_019558.3	NP_001186675.1|NP_062458.1	P13378	HXD8_HUMAN	homeobox D8	270					anterior/posterior axis specification, embryo (GO:0008595)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(5)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		AGGTGAAGGACGGGGAAACGA	0.438																																						dbGAP											0													58.0	70.0	66.0					2																	176996277		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2268.1, CCDS56148.1, CCDS56149.1	2q31.1	2011-06-20	2005-12-22		ENSG00000175879	ENSG00000175879		"""Homeoboxes / ANTP class : HOXL subclass"""	5139	protein-coding gene	gene with protein product		142985	"""homeo box D8"""	HOX4, HOX4E		1973146, 1358459	Standard	NM_001199747		Approved		uc002uko.3	P13378	OTTHUMG00000132513	ENST00000313173.4:c.810C>T	2.37:g.176996277C>T			F8WBG7|Q5BL00|Q8IXZ1	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.D270	ENST00000313173.4	37	c.810	CCDS2268.1	2																																																																																			HOXD8	-	NULL	ENSG00000175879		0.438	HOXD8-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	HOXD8	HGNC	protein_coding	OTTHUMT00000255694.1	34	0.00	0	C			176996277	176996277	+1	no_errors	ENST00000313173	ensembl	human	known	69_37n	silent	23	23.33	7	SNP	0.972	T
HSPA12A	259217	genome.wustl.edu	37	10	118458152	118458152	+	Silent	SNP	C	C	T	rs545779576		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr10:118458152C>T	ENST00000369209.3	-	5	644	c.540G>A	c.(538-540)gcG>gcA	p.A180A		NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	180						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		CTACCTTCAGCGCCTGCTCCT	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		18726	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													90.0	90.0	90.0					10																	118458152		1996	4173	6169	-	-	-	SO:0001819	synonymous_variant	0			AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.540G>A	10.37:g.118458152C>T				Silent	SNP	NULL	p.A180	ENST00000369209.3	37	c.540	CCDS41569.1	10																																																																																			HSPA12A	-	NULL	ENSG00000165868		0.572	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA12A	HGNC	protein_coding	OTTHUMT00000050530.1	57	0.00	0	C	NM_025015		118458152	118458152	-1	no_errors	ENST00000369209	ensembl	human	known	69_37n	silent	31	22.50	9	SNP	0.031	T
HTR1A	3350	genome.wustl.edu	37	5	63256897	63256897	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:63256897C>T	ENST00000323865.3	-	1	883	c.650G>A	c.(649-651)cGc>cAc	p.R217H	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	217					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	TCGGAATATGCGCCCATAGAG	0.587																																						dbGAP											0													92.0	103.0	99.0					5																	63256897		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.650G>A	5.37:g.63256897C>T	ENSP00000316244:p.Arg217His		Q6LAE7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_5HT1A_rcpt,prints_7TM_GPCR_Rhodpsn,prints_5HT_rcpt,prints_NPY_rcpt	p.R217H	ENST00000323865.3	37	c.650	CCDS34168.1	5	.	.	.	.	.	.	.	.	.	.	C	22.8	4.336965	0.81801	.	.	ENSG00000178394	ENST00000323865	T	0.39056	1.1	5.7	5.7	0.88788	GPCR, rhodopsin-like superfamily (1);	0.197923	0.43919	D	0.000519	T	0.64427	0.2597	M	0.81614	2.55	0.58432	D	0.999999	D	0.89917	1.0	D	0.69824	0.966	T	0.68236	-0.5462	10	0.87932	D	0	.	12.1821	0.54218	0.0:0.9226:0.0:0.0774	.	217	P08908	5HT1A_HUMAN	H	217	ENSP00000316244:R217H	ENSP00000316244:R217H	R	-	2	0	HTR1A	63292653	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.091000	0.71406	2.692000	0.91855	0.655000	0.94253	CGC	HTR1A	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000178394		0.587	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1A	HGNC	protein_coding	OTTHUMT00000368397.1	14	0.00	0	C	NM_000524		63256897	63256897	-1	no_errors	ENST00000323865	ensembl	human	known	69_37n	missense	15	25.00	5	SNP	1.000	T
HTR1A	3350	genome.wustl.edu	37	5	63257403	63257403	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:63257403G>A	ENST00000323865.3	-	1	377	c.144C>T	c.(142-144)ttC>ttT	p.F48F	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	48					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GCACCGCGCAGAAGATGAGCG	0.607																																						dbGAP											0													84.0	83.0	83.0					5																	63257403		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.144C>T	5.37:g.63257403G>A			Q6LAE7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_5HT1A_rcpt,prints_7TM_GPCR_Rhodpsn,prints_5HT_rcpt,prints_NPY_rcpt	p.F48	ENST00000323865.3	37	c.144	CCDS34168.1	5																																																																																			HTR1A	-	pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_7TM_GPCR_Rhodpsn	ENSG00000178394		0.607	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1A	HGNC	protein_coding	OTTHUMT00000368397.1	33	0.00	0	G	NM_000524		63257403	63257403	-1	no_errors	ENST00000323865	ensembl	human	known	69_37n	silent	25	19.35	6	SNP	1.000	A
HUWE1	10075	genome.wustl.edu	37	X	53589093	53589093	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chrX:53589093C>T	ENST00000342160.3	-	53	7774	c.7317G>A	c.(7315-7317)gaG>gaA	p.E2439E	HUWE1_ENST00000262854.6_Silent_p.E2439E			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2439	Asp-rich.|Glu-rich.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						cctcatcttcctcctcctcct	0.532																																						dbGAP											0													178.0	108.0	132.0					X																	53589093		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.7317G>A	X.37:g.53589093C>T			O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_HECT,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.G1473R	ENST00000342160.3	37	c.4417	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	C	3.250	-0.153524	0.06585	.	.	ENSG00000086758	ENST00000427052	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	T	0.71888	0.3393	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71692	-0.4516	4	.	.	.	.	16.1977	0.82042	0.0:1.0:0.0:0.0	.	.	.	.	R	1473	.	.	G	-	1	0	HUWE1	53605818	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.392000	0.44433	2.164000	0.68074	0.513000	0.50165	GGA	HUWE1	-	NULL	ENSG00000086758		0.532	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	72	0.00	0	C	XM_497119		53589093	53589093	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000427052	ensembl	human	known	69_37n	missense	36	16.28	7	SNP	1.000	T
IGKV1D-16	28901	genome.wustl.edu	37	2	90139529	90139529	+	RNA	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:90139529G>A	ENST00000492446.1	+	0	327									immunoglobulin kappa variable 1D-16																		TCAGCAGCCTGCAGCCTGAAG	0.488																																						dbGAP											0													45.0	48.0	47.0					2																	90139529		1795	4031	5826	-	-	-			0			K01323		2p11.2	2012-02-08			ENSG00000241244	ENSG00000241244		"""Immunoglobulins / IGK locus"""	5748	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000151569		2.37:g.90139529G>A				Silent	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L100	ENST00000492446.1	37	c.300		2																																																																																			IGKV1D-16	-	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000241244		0.488	IGKV1D-16-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV1D-16	HGNC	IG_V_gene	OTTHUMT00000323144.2	111	0.00	0	G	NG_000833		90139529	90139529	+1	no_stop_codon	ENST00000492446	ensembl	human	known	69_37n	silent	42	20.75	11	SNP	0.041	A
IFIH1	64135	genome.wustl.edu	37	2	163130328	163130328	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:163130328T>C	ENST00000263642.2	-	12	2826	c.2431A>G	c.(2431-2433)Acc>Gcc	p.T811A		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	811	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						ATTTCATTGGTGACGAGACCA	0.338																																						dbGAP											0													165.0	154.0	158.0					2																	163130328		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.2431A>G	2.37:g.163130328T>C	ENSP00000263642:p.Thr811Ala		Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	pfam_RIG-I_C-RD,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_CARD,superfamily_DEATH-like,superfamily_ARM-type_fold,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.T811A	ENST00000263642.2	37	c.2431	CCDS2217.1	2	.	.	.	.	.	.	.	.	.	.	T	20.5	4.007166	0.75046	.	.	ENSG00000115267	ENST00000263642;ENST00000543192	T	0.04603	3.59	5.71	5.71	0.89125	Helicase, C-terminal (3);	0.089857	0.85682	D	0.000000	T	0.12135	0.0295	L	0.31804	0.96	0.51012	D	0.999909	D	0.63880	0.993	D	0.65573	0.936	T	0.16958	-1.0385	10	0.34782	T	0.22	-19.8459	16.2778	0.82654	0.0:0.0:0.0:1.0	.	811	Q9BYX4	IFIH1_HUMAN	A	811	ENSP00000263642:T811A	ENSP00000263642:T811A	T	-	1	0	IFIH1	162838574	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.222000	0.72249	2.306000	0.77630	0.533000	0.62120	ACC	IFIH1	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000115267		0.338	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIH1	HGNC	protein_coding	OTTHUMT00000255078.2	108	0.00	0	T	NM_022168		163130328	163130328	-1	no_errors	ENST00000263642	ensembl	human	known	69_37n	missense	68	13.58	11	SNP	1.000	C
IGLV1-51	28820	genome.wustl.edu	37	22	22677326	22677327	+	RNA	DEL	CA	CA	-	rs113820913		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr22:22677326_22677327delCA	ENST00000390290.2	+	0	390_391				BMS1P20_ENST00000426066.1_RNA					immunoglobulin lambda variable 1-51																		TGAGTGCTGGCACAGTGCTCCA	0.614																																						dbGAP											0																																										-	-	-			0			Z73661		22q11.2	2012-02-08			ENSG00000211644	ENSG00000211644		"""Immunoglobulins / IGL locus"""	5882	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000151035		22.37:g.22677328_22677329delCA				Frame_Shift_Del	DEL	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.T119fs	ENST00000390290.2	37	c.354_355		22																																																																																			IGLV1-51	-	smart_Ig_sub	ENSG00000211644		0.614	IGLV1-51-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV1-51	HGNC	IG_V_gene	OTTHUMT00000321094.1	26	0.00	0	CA	NG_000002		22677326	22677327	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390290	ensembl	human	known	69_37n	frame_shift_del	12	33.33	6	DEL	0.993:1.000	-
IL15	3600	genome.wustl.edu	37	4	142651103	142651103	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr4:142651103T>A	ENST00000296545.7	+	7	1188	c.344T>A	c.(343-345)aTc>aAc	p.I115N	IL15_ENST00000514653.1_Missense_Mutation_p.I88N|IL15_ENST00000529613.1_Missense_Mutation_p.I115N|IL15_ENST00000320650.4_Missense_Mutation_p.I115N|IL15_ENST00000477265.1_Missense_Mutation_p.I88N|IL15_ENST00000394159.1_Missense_Mutation_p.I88N			P40933	IL15_HUMAN	interleukin 15	115					aging (GO:0007568)|cell maturation (GO:0048469)|cell-cell signaling (GO:0007267)|cellular response to vitamin D (GO:0071305)|extrathymic T cell selection (GO:0045062)|hyaluronan metabolic process (GO:0030212)|immune response (GO:0006955)|inflammatory response (GO:0006954)|lymph node development (GO:0048535)|natural killer cell differentiation (GO:0001779)|negative regulation of smooth muscle cell proliferation (GO:0048662)|NK T cell proliferation (GO:0001866)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immune response (GO:0050778)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of defense response to virus by host (GO:0050691)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)				kidney(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_hematologic(180;0.158)					GAAAATCTGATCATCCTAGCA	0.388																																					Pancreas(10;184 986 25902)	dbGAP											0													122.0	122.0	122.0					4																	142651103		2203	4299	6502	-	-	-	SO:0001583	missense	0			U14407	CCDS3755.1, CCDS3756.1	4q31	2011-07-14			ENSG00000164136	ENSG00000164136		"""Interleukins and interleukin receptors"""	5977	protein-coding gene	gene with protein product		600554				8178155	Standard	NM_000585		Approved	IL-15, MGC9721	uc003iis.3	P40933	OTTHUMG00000133418	ENST00000296545.7:c.344T>A	4.37:g.142651103T>A	ENSP00000296545:p.Ile115Asn		D3DNZ2|O00440|O43512|Q495Z8|Q6FGX7|Q93058|Q9UBA3	Missense_Mutation	SNP	pfam_Interleukin_15-like,prints_Interleukin-15_mammal,prints_Interleukin-15	p.I115N	ENST00000296545.7	37	c.344	CCDS3755.1	4	.	.	.	.	.	.	.	.	.	.	T	10.79	1.448822	0.26074	.	.	ENSG00000164136	ENST00000320650;ENST00000296545;ENST00000514653;ENST00000529613;ENST00000477265;ENST00000394159	.	.	.	5.49	4.31	0.51392	.	0.408921	0.25161	N	0.032674	T	0.58104	0.2099	M	0.73598	2.24	0.29912	N	0.823518	D	0.54397	0.966	P	0.55222	0.771	T	0.59847	-0.7377	9	0.46703	T	0.11	-1.9394	8.4456	0.32841	0.0:0.0892:0.0:0.9108	.	115	P40933	IL15_HUMAN	N	115;115;88;115;88;88	.	ENSP00000296545:I115N	I	+	2	0	IL15	142870553	0.050000	0.20438	0.484000	0.27391	0.030000	0.12068	2.209000	0.42806	1.028000	0.39785	0.528000	0.53228	ATC	IL15	-	pfam_Interleukin_15-like	ENSG00000164136		0.388	IL15-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IL15	HGNC	protein_coding	OTTHUMT00000257278.2	69	0.00	0	T	NM_172175		142651103	142651103	+1	no_errors	ENST00000296545	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	0.899	A
IL17RA	23765	genome.wustl.edu	37	22	17583062	17583062	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr22:17583062C>T	ENST00000319363.6	+	7	765	c.632C>T	c.(631-633)aCc>aTc	p.T211I		NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	211					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)			endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		ACCGTGGAGACCCTGGAGGCC	0.587																																						dbGAP											0													129.0	112.0	118.0					22																	17583062		2203	4300	6503	-	-	-	SO:0001583	missense	0			U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.632C>T	22.37:g.17583062C>T	ENSP00000320936:p.Thr211Ile		O43844|Q20WK1	Missense_Mutation	SNP	pfam_SEFIR	p.T211I	ENST00000319363.6	37	c.632	CCDS13739.1	22	.	.	.	.	.	.	.	.	.	.	C	8.088	0.773881	0.16051	.	.	ENSG00000177663	ENST00000425985;ENST00000319363	T	0.06528	3.29	5.23	-7.9	0.01169	.	1.462200	0.04289	N	0.345095	T	0.04724	0.0128	M	0.68317	2.08	0.09310	N	1	P;P	0.38827	0.512;0.649	B;B	0.30105	0.111;0.083	T	0.40175	-0.9577	10	0.23302	T	0.38	-2.086	1.1239	0.01731	0.1969:0.188:0.173:0.4421	.	211;211	D3YTB4;Q96F46	.;I17RA_HUMAN	I	211	ENSP00000320936:T211I	ENSP00000320936:T211I	T	+	2	0	IL17RA	15963062	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.268000	0.08607	-1.007000	0.03408	-0.379000	0.06801	ACC	IL17RA	-	NULL	ENSG00000177663		0.587	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17RA	HGNC	protein_coding	OTTHUMT00000315820.1	56	0.00	0	C	NM_014339		17583062	17583062	+1	no_errors	ENST00000319363	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	0.000	T
JMJD1C	221037	genome.wustl.edu	37	10	64974383	64974383	+	Missense_Mutation	SNP	T	T	G	rs61758117	byFrequency	TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr10:64974383T>G	ENST00000399262.2	-	8	1762	c.1544A>C	c.(1543-1545)gAc>gCc	p.D515A	JMJD1C_ENST00000489372.2_5'Flank|JMJD1C_ENST00000402544.1_Missense_Mutation_p.D296A|JMJD1C_ENST00000542921.1_Missense_Mutation_p.D333A|JMJD1C_ENST00000399251.1_Missense_Mutation_p.D296A	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	515					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					TAAATTAGTGTCATTTGTAAT	0.363																																						dbGAP											0													143.0	135.0	138.0					10																	64974383		1841	4079	5920	-	-	-	SO:0001583	missense	0			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.1544A>C	10.37:g.64974383T>G	ENSP00000382204:p.Asp515Ala		A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.D515A	ENST00000399262.2	37	c.1544	CCDS41532.1	10	.	.	.	.	.	.	.	.	.	.	T	15.50	2.853434	0.51270	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	T;T;T;T	0.57273	0.76;0.41;2.16;0.76	6.03	6.03	0.97812	.	0.316094	0.36374	N	0.002621	T	0.40645	0.1125	L	0.29908	0.895	0.44937	D	0.997951	P;P	0.39665	0.495;0.682	B;B	0.30401	0.113;0.115	T	0.44251	-0.9340	10	0.66056	D	0.02	-12.1482	16.5655	0.84588	0.0:0.0:0.0:1.0	.	515;333	Q15652;A0T124	JHD2C_HUMAN;.	A	515;296;296;333	ENSP00000382204:D515A;ENSP00000384990:D296A;ENSP00000382195:D296A;ENSP00000444682:D333A	ENSP00000382195:D296A	D	-	2	0	JMJD1C	64644389	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.396000	0.73234	2.302000	0.77476	0.533000	0.62120	GAC	JMJD1C	-	NULL	ENSG00000171988		0.363	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JMJD1C	HGNC	protein_coding	OTTHUMT00000048249.2	51	0.00	0	T	NM_004241		64974383	64974383	-1	no_errors	ENST00000399262	ensembl	human	known	69_37n	missense	54	11.48	7	SNP	1.000	G
KBTBD12	166348	genome.wustl.edu	37	3	127642256	127642257	+	Frame_Shift_Ins	INS	-	-	GT	rs370191114		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr3:127642256_127642257insGT	ENST00000405109.1	+	2	819_820	c.352_353insGT	c.(352-354)agtfs	p.S118fs	KBTBD12_ENST00000407609.3_Intron|KBTBD12_ENST00000405256.1_Frame_Shift_Ins_p.S118fs|KBTBD12_ENST00000343941.4_5'UTR			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	118								p.S118T(2)		endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						AGAAGTCTTCAGTGTGTGTCAA	0.371																																						dbGAP											2	Substitution - Missense(2)	lung(2)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.359_360dupGT	3.37:g.127642263_127642264dupGT	ENSP00000385957:p.Ser118fs		B5MCC6|Q6ZRK1	Frame_Shift_Ins	INS	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.Q121fs	ENST00000405109.1	37	c.352_353	CCDS33848.2	3																																																																																			KBTBD12	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin	ENSG00000187715		0.371	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD12	HGNC	protein_coding	OTTHUMT00000318682.1	19	0.00	0	-	NM_207335		127642256	127642257	+1	no_errors	ENST00000405109	ensembl	human	known	69_37n	frame_shift_ins	22	21.43	6	INS	0.000:0.000	GT
KCNH2	3757	genome.wustl.edu	37	7	150654410	150654410	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:150654410C>T	ENST00000262186.5	-	5	1498	c.1097G>A	c.(1096-1098)cGa>cAa	p.R366Q	KCNH2_ENST00000430723.3_Missense_Mutation_p.R366Q|KCNH2_ENST00000392968.2_Missense_Mutation_p.R270Q|KCNH2_ENST00000330883.4_5'Flank	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	366					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	ATTGTGGGTTCGCTCCTTTAT	0.587																																					GBM(137;110 1844 13671 20123 45161)	dbGAP											0													119.0	92.0	101.0					7																	150654410		2203	4299	6502	-	-	-	SO:0001583	missense	0			U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.1097G>A	7.37:g.150654410C>T	ENSP00000262186:p.Arg366Gln		A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Ion_trans_2,pfam_cNMP-bd_dom,pfam_PAS_fold,pfam_PAS_fold_3,superfamily_cNMP-bd-like,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.R366Q	ENST00000262186.5	37	c.1097	CCDS5910.1	7	.	.	.	.	.	.	.	.	.	.	C	34	5.307560	0.95629	.	.	ENSG00000055118	ENST00000392968;ENST00000262186;ENST00000430723	D;D;D	0.94280	-3.39;-3.39;-3.39	4.83	4.83	0.62350	.	0.268811	0.25857	N	0.027845	D	0.97040	0.9033	M	0.88031	2.925	0.38682	D	0.952568	D;D;D	0.89917	0.997;1.0;0.988	D;D;P	0.97110	0.968;1.0;0.556	D	0.98512	1.0619	10	0.59425	D	0.04	.	15.7766	0.78224	0.0:1.0:0.0:0.0	.	270;366;366	C4PFH9;G5E9I0;Q12809	.;.;KCNH2_HUMAN	Q	270;366;366	ENSP00000376695:R270Q;ENSP00000262186:R366Q;ENSP00000387657:R366Q	ENSP00000262186:R366Q	R	-	2	0	KCNH2	150285343	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	6.005000	0.70716	2.383000	0.81215	0.561000	0.74099	CGA	KCNH2	-	NULL	ENSG00000055118		0.587	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH2	HGNC	protein_coding	OTTHUMT00000350741.2	71	0.00	0	C	NM_000238		150654410	150654410	-1	no_errors	ENST00000262186	ensembl	human	known	69_37n	missense	22	24.14	7	SNP	1.000	T
KCNK2	3776	genome.wustl.edu	37	1	215342695	215342695	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:215342695C>T	ENST00000444842.2	+	4	779	c.629C>T	c.(628-630)aCg>aTg	p.T210M	KCNK2_ENST00000391894.2_Missense_Mutation_p.T195M|KCNK2_ENST00000391895.2_Missense_Mutation_p.T206M	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	210					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	gtggaAGATACGTTTATTGTG	0.333																																						dbGAP											0													92.0	90.0	91.0					1																	215342695		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.629C>T	1.37:g.215342695C>T	ENSP00000394033:p.Thr210Met		A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	pfam_Ion_trans_2,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TASK	p.T210M	ENST00000444842.2	37	c.629	CCDS41467.1	1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.316927	0.40996	.	.	ENSG00000082482	ENST00000391895;ENST00000391894;ENST00000444842	T;T;T	0.19938	2.11;2.12;2.11	6.16	6.16	0.99307	.	0.065059	0.56097	U	0.000033	T	0.07413	0.0187	N	0.00621	-1.32	0.43183	D	0.995002	B;B;B	0.10296	0.001;0.003;0.0	B;B;B	0.09377	0.004;0.003;0.003	T	0.39781	-0.9597	10	0.30078	T	0.28	.	13.9788	0.64291	0.0:0.9314:0.0:0.0686	.	195;210;206	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	M	206;195;210	ENSP00000375765:T206M;ENSP00000375764:T195M;ENSP00000394033:T210M	ENSP00000375764:T195M	T	+	2	0	KCNK2	213409318	1.000000	0.71417	0.936000	0.37596	0.967000	0.64934	5.592000	0.67543	2.937000	0.99478	0.650000	0.86243	ACG	KCNK2	-	prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl_TRAAK	ENSG00000082482		0.333	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK2	HGNC	protein_coding	OTTHUMT00000089856.2	80	0.00	0	C	NM_014217		215342695	215342695	+1	no_errors	ENST00000444842	ensembl	human	known	69_37n	missense	48	22.58	14	SNP	0.997	T
KCNMB1	3779	genome.wustl.edu	37	5	169805721	169805721	+	Missense_Mutation	SNP	G	G	A	rs200312354		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:169805721G>A	ENST00000274629.4	-	4	1005	c.563C>T	c.(562-564)gCg>gTg	p.A188V	KCNIP1_ENST00000377360.4_Intron|KCNIP1_ENST00000518527.1_Intron	NM_004137.3	NP_004128.1	Q16558	KCMB1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 1	188					blood coagulation (GO:0007596)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to calcium ion (GO:0051592)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			endometrium(1)|large_intestine(1)|lung(7)|ovary(2)	11	Renal(175;0.000159)|Lung NSC(126;0.0165)|all_lung(126;0.026)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.175)	Miconazole(DB01110)|Procaine(DB00721)	CTTCTGGGCCGCCAGGATGGA	0.617																																						dbGAP											0													93.0	95.0	94.0					5																	169805721		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035046	CCDS4373.1	5q34	2012-02-23			ENSG00000145936	ENSG00000145936		"""Potassium channels"""	6285	protein-coding gene	gene with protein product	"""BK channel beta subunit"""	603951				8799178, 9888999	Standard	NM_004137		Approved	hslo-beta	uc003maq.2	Q16558	OTTHUMG00000130439	ENST00000274629.4:c.563C>T	5.37:g.169805721G>A	ENSP00000274629:p.Ala188Val		O00707|O00708|P78475|Q53YR0|Q8TAX3|Q93005	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_bsu,prints_K_chnl_Ca-activ_BK_bsu	p.A188V	ENST00000274629.4	37	c.563	CCDS4373.1	5	.	.	.	.	.	.	.	.	.	.	G	16.61	3.171206	0.57584	.	.	ENSG00000145936	ENST00000274629	T	0.12147	2.71	5.31	4.44	0.53790	.	0.263939	0.37577	N	0.002035	T	0.07007	0.0178	N	0.22421	0.69	0.80722	D	1	P	0.40731	0.728	B	0.30495	0.116	T	0.32613	-0.9900	9	.	.	.	.	8.9092	0.35543	0.0996:0.0:0.9004:0.0	.	188	Q16558	KCMB1_HUMAN	V	188	ENSP00000274629:A188V	.	A	-	2	0	KCNMB1	169738299	1.000000	0.71417	0.995000	0.50966	0.915000	0.54546	4.403000	0.59729	2.461000	0.83175	0.591000	0.81541	GCG	KCNMB1	-	pfam_K_chnl_Ca-activ_BK_bsu	ENSG00000145936		0.617	KCNMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNMB1	HGNC	protein_coding	OTTHUMT00000252830.3	37	0.00	0	G			169805721	169805721	-1	no_errors	ENST00000274629	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	0.980	A
CLUH	23277	genome.wustl.edu	37	17	2597292	2597292	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:2597292T>C	ENST00000570628.2	-	19	3121	c.3016A>G	c.(3016-3018)Aac>Gac	p.N1006D	CLUH_ENST00000538975.1_Missense_Mutation_p.N1006D|CLUH_ENST00000435359.1_Missense_Mutation_p.N1006D			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	1006					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											TTAAACAGGTTCAGGGCCTCA	0.642																																						dbGAP											0													55.0	71.0	66.0					17																	2597292		2132	4219	6351	-	-	-	SO:0001583	missense	0			AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.3016A>G	17.37:g.2597292T>C	ENSP00000458986:p.Asn1006Asp		Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	superfamily_GSKIP/TIF31_domain	p.N1006D	ENST00000570628.2	37	c.3016	CCDS45572.1	17	.	.	.	.	.	.	.	.	.	.	t	34	5.408622	0.96072	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	T;T	0.61627	0.09;0.09	5.66	5.66	0.87406	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.72716	0.3495	M	0.80616	2.505	0.80722	D	1	P;P	0.52316	0.902;0.952	P;P	0.55713	0.722;0.782	T	0.77284	-0.2645	10	0.72032	D	0.01	.	15.0732	0.72056	0.0:0.0:0.0:1.0	.	1006;1007	O75153;C9J6D7	K0664_HUMAN;.	D	1006;1007;1006	ENSP00000388872:N1006D;ENSP00000439628:N1006D	ENSP00000320468:N1007D	N	-	1	0	KIAA0664	2544042	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.961000	0.70356	2.166000	0.68216	0.454000	0.30748	AAC	KIAA0664	-	NULL	ENSG00000132361		0.642	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0664	HGNC	protein_coding	OTTHUMT00000437807.2	36	0.00	0	T	NM_015229		2597292	2597292	-1	no_errors	ENST00000435359	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	C
KIAA0825	285600	genome.wustl.edu	37	5	93727356	93727358	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	CTC	CTC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:93727356_93727358delCTC	ENST00000513200.3	-	17	3410_3412	c.3338_3340delGAG	c.(3337-3342)ggagat>gat	p.G1113del	KIAA0825_ENST00000427991.2_In_Frame_Del_p.G1113del	NM_001145678.1	NP_001139150.1	Q8IV33	K0825_HUMAN	KIAA0825	1113										breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						AGAGCAACATCTCCTTCTTGTAA	0.399																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000513200.3:c.3338_3340delGAG	5.37:g.93727356_93727358delCTC	ENSP00000424618:p.Gly1113del		O94914|Q6ZNN2	In_Frame_Del	DEL	NULL	p.G1113in_frame_del	ENST00000513200.3	37	c.3340_3338		5																																																																																			KIAA0825	-	NULL	ENSG00000185261		0.399	KIAA0825-001	KNOWN	not_organism_supported|basic	protein_coding	KIAA0825	HGNC	protein_coding	OTTHUMT00000254102.5	79	0.00	0	CTC	NM_173665		93727356	93727358	-1	no_errors	ENST00000427991	ensembl	human	known	69_37n	in_frame_del	61	14.08	10	DEL	0.997:1.000:1.000	-
KIAA1211L	343990	genome.wustl.edu	37	2	99449325	99449325	+	Splice_Site	SNP	C	C	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:99449325C>A	ENST00000397899.2	-	4	706	c.375G>T	c.(373-375)caG>caT	p.Q125H	KIAA1211L_ENST00000462314.1_Intron	NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	125																	AAACATTTACCTGCAGAGCTT	0.428																																						dbGAP											0													255.0	263.0	260.0					2																	99449325		1910	4141	6051	-	-	-	SO:0001630	splice_region_variant	0			BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.375+1G>T	2.37:g.99449325C>A				Missense_Mutation	SNP	NULL	p.Q125H	ENST00000397899.2	37	c.375	CCDS42720.1	2	.	.	.	.	.	.	.	.	.	.	C	21.9	4.211946	0.79240	.	.	ENSG00000196872	ENST00000397899;ENST00000423771;ENST00000428096;ENST00000415261	T	0.61627	0.09	4.96	4.96	0.65561	.	0.000000	0.46758	D	0.000262	T	0.75117	0.3806	M	0.72118	2.19	0.44129	D	0.996918	D	0.89917	1.0	D	0.91635	0.999	T	0.75337	-0.3353	9	.	.	.	-17.4992	17.3797	0.87401	0.0:1.0:0.0:0.0	.	125	Q6NV74	CB055_HUMAN	H	125;153;139;139	ENSP00000380996:Q125H	.	Q	-	3	2	C2orf55	98815757	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	5.508000	0.67006	2.556000	0.86216	0.655000	0.94253	CAG	KIAA1211L	-	NULL	ENSG00000196872		0.428	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211L	HGNC	protein_coding	OTTHUMT00000329933.1	53	0.00	0	C	NM_207362	Missense_Mutation	99449325	99449325	-1	no_errors	ENST00000397899	ensembl	human	known	69_37n	missense	53	17.19	11	SNP	1.000	A
KIAA1522	57648	genome.wustl.edu	37	1	33233495	33233495	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:33233495delC	ENST00000373480.1	+	2	269	c.166delC	c.(166-168)cccfs	p.P57fs	KIAA1522_ENST00000294521.3_Frame_Shift_Del_p.P57fs|KIAA1522_ENST00000373481.3_Frame_Shift_Del_p.P68fs|KIAA1522_ENST00000401073.2_Frame_Shift_Del_p.P116fs	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	57			P -> S (in dbSNP:rs11803515).							breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CAGTGGGCGACCCCCCCACCT	0.612																																						dbGAP											0													60.0	67.0	65.0					1																	33233495		1985	4150	6135	-	-	-	SO:0001589	frameshift_variant	0			AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.166delC	1.37:g.33233495delC	ENSP00000362579:p.Pro57fs		B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Frame_Shift_Del	DEL	NULL	p.H117fs	ENST00000373480.1	37	c.343	CCDS55588.1	1																																																																																			KIAA1522	-	NULL	ENSG00000162522		0.612	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1522	HGNC	protein_coding	OTTHUMT00000022130.1	26	0.00	0	C			33233495	33233495	+1	no_errors	ENST00000401073	ensembl	human	known	69_37n	frame_shift_del	16	20.00	4	DEL	0.980	-
KIAA1731	85459	genome.wustl.edu	37	11	93431088	93431088	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr11:93431088T>A	ENST00000325212.6	+	15	3172	c.3010T>A	c.(3010-3012)Ttt>Att	p.F1004I	KIAA1731_ENST00000344196.4_5'UTR|KIAA1731_ENST00000411936.1_Missense_Mutation_p.F1004I|KIAA1731_ENST00000531700.1_Intron			Q9C0D2	K1731_HUMAN	KIAA1731	1004						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TCAGCATACATTTACTTCACT	0.413																																						dbGAP											0													67.0	57.0	60.0					11																	93431088		692	1591	2283	-	-	-	SO:0001583	missense	0			AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.3010T>A	11.37:g.93431088T>A	ENSP00000316681:p.Phe1004Ile		C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	NULL	p.F1004I	ENST00000325212.6	37	c.3010	CCDS44708.1	11	.	.	.	.	.	.	.	.	.	.	T	11.26	1.584859	0.28268	.	.	ENSG00000166004	ENST00000325212;ENST00000411936	T;T	0.24151	1.87;1.87	4.68	2.41	0.29592	.	0.840987	0.10213	N	0.701882	T	0.26919	0.0659	M	0.61703	1.905	0.09310	N	0.999992	P	0.36909	0.573	B	0.39217	0.294	T	0.21381	-1.0247	10	0.48119	T	0.1	-2.4027	5.5268	0.16962	0.0:0.2162:0.0:0.7838	.	1004	Q9C0D2	K1731_HUMAN	I	1004	ENSP00000316681:F1004I;ENSP00000406505:F1004I	ENSP00000316681:F1004I	F	+	1	0	KIAA1731	93070736	0.003000	0.15002	0.002000	0.10522	0.380000	0.30137	0.378000	0.20569	0.901000	0.36495	0.459000	0.35465	TTT	KIAA1731	-	NULL	ENSG00000166004		0.413	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1731	HGNC	protein_coding	OTTHUMT00000394640.1	22	0.00	0	T	NM_033395		93431088	93431088	+1	no_errors	ENST00000411936	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	0.002	A
KLF11	8462	genome.wustl.edu	37	2	10188309	10188309	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:10188309C>T	ENST00000305883.1	+	3	1007	c.845C>T	c.(844-846)gCt>gTt	p.A282V	KLF11_ENST00000540845.1_Missense_Mutation_p.A265V|KLF11_ENST00000535335.1_Missense_Mutation_p.A265V	NM_003597.4	NP_003588.1	O14901	KLF11_HUMAN	Kruppel-like factor 11	282					apoptotic process (GO:0006915)|cellular response to peptide (GO:1901653)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		TCTGTCCCTGCTCCCCCTGTC	0.527																																					Melanoma(56;431 1507 23687 50789)	dbGAP											0													144.0	144.0	144.0					2																	10188309		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF028008	CCDS1668.1, CCDS54333.1	2p25	2013-01-08	2004-11-29	2004-12-01	ENSG00000172059	ENSG00000172059		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11811	protein-coding gene	gene with protein product		603301	"""TGFB inducible early growth response 2"""	TIEG2		9748269, 11087666	Standard	NM_001177716		Approved	Tieg3, MODY7	uc002raf.1	O14901	OTTHUMG00000119004	ENST00000305883.1:c.845C>T	2.37:g.10188309C>T	ENSP00000307023:p.Ala282Val		B4DZE7|Q9EPF4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A282V	ENST00000305883.1	37	c.845	CCDS1668.1	2	.	.	.	.	.	.	.	.	.	.	C	8.986	0.976582	0.18736	.	.	ENSG00000172059	ENST00000305883;ENST00000540845;ENST00000535335	T;T;T	0.14022	2.56;2.54;2.54	5.07	2.02	0.26589	.	0.398326	0.33144	N	0.005237	T	0.06005	0.0156	N	0.08118	0	0.22896	N	0.998598	B	0.31125	0.309	B	0.24701	0.055	T	0.38993	-0.9635	9	.	.	.	.	11.5395	0.50659	0.073:0.2566:0.6704:0.0	.	282	O14901	KLF11_HUMAN	V	282;265;265	ENSP00000307023:A282V;ENSP00000444690:A265V;ENSP00000442722:A265V	.	A	+	2	0	KLF11	10105760	0.003000	0.15002	0.013000	0.15412	0.357000	0.29423	0.227000	0.17795	0.524000	0.28502	-0.693000	0.03709	GCT	KLF11	-	NULL	ENSG00000172059		0.527	KLF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KLF11	HGNC	protein_coding	OTTHUMT00000239202.3	124	0.00	0	C	NM_003597		10188309	10188309	+1	no_errors	ENST00000305883	ensembl	human	known	69_37n	missense	46	11.54	6	SNP	0.820	T
KLHL14	57565	genome.wustl.edu	37	18	30267118	30267118	+	Splice_Site	SNP	C	C	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr18:30267118C>A	ENST00000359358.4	-	5	1676	c.1238G>T	c.(1237-1239)aGa>aTa	p.R413I		NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	413						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						AAACACTTACCTTTCCTGCAT	0.403																																						dbGAP											0													156.0	139.0	144.0					18																	30267118		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.1238+1G>T	18.37:g.30267118C>A			A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.R413I	ENST00000359358.4	37	c.1238	CCDS32813.1	18	.	.	.	.	.	.	.	.	.	.	C	35	5.466600	0.96257	.	.	ENSG00000197705	ENST00000359358	T	0.67171	-0.25	5.43	5.43	0.79202	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.85008	0.5599	M	0.88979	2.995	0.80722	D	1	D	0.67145	0.996	D	0.75020	0.985	D	0.86941	0.2079	9	.	.	.	.	19.2272	0.93822	0.0:1.0:0.0:0.0	.	413	Q9P2G3	KLH14_HUMAN	I	413	ENSP00000352314:R413I	.	R	-	2	0	KLHL14	28521116	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.487000	0.81328	2.535000	0.85469	0.557000	0.71058	AGA	KLHL14	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000197705		0.403	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL14	HGNC	protein_coding	OTTHUMT00000448376.1	60	0.00	0	C		Missense_Mutation	30267118	30267118	-1	no_errors	ENST00000359358	ensembl	human	known	69_37n	missense	42	14.29	7	SNP	1.000	A
KRT40	125115	genome.wustl.edu	37	17	39137136	39137136	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:39137136C>T	ENST00000398486.2	-	7	1036	c.876G>A	c.(874-876)ctG>ctA	p.L292L	KRT40_ENST00000377755.4_Silent_p.L292L	NM_182497.3	NP_872303.2	Q6A162	K1C40_HUMAN	keratin 40	292	Coil 2.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Breast(137;0.00043)				CCGCGCTGGACAGTTGCTGCT	0.493																																						dbGAP											0													96.0	98.0	97.0					17																	39137136		1995	4190	6185	-	-	-	SO:0001819	synonymous_variant	0			AK093919	CCDS42320.1	17q21.2	2013-01-16			ENSG00000204889	ENSG00000204889		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	26707	protein-coding gene	gene with protein product						16831889	Standard	NM_182497		Approved	FLJ36600, KA36	uc010cxh.1	Q6A162	OTTHUMG00000133596	ENST00000398486.2:c.876G>A	17.37:g.39137136C>T			Q6IFU5	Silent	SNP	pfam_F,prints_Keratin_I	p.L292	ENST00000398486.2	37	c.876	CCDS42320.1	17																																																																																			KRT40	-	pfam_F	ENSG00000204889		0.493	KRT40-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT40	HGNC	protein_coding	OTTHUMT00000257701.3	66	0.00	0	C	NM_182497		39137136	39137136	-1	no_errors	ENST00000377755	ensembl	human	known	69_37n	silent	40	16.67	8	SNP	0.054	T
KRT33B	3884	genome.wustl.edu	37	17	39525757	39525757	+	Silent	SNP	C	C	T	rs201559637		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:39525757C>T	ENST00000251646.3	-	1	295	c.246G>A	c.(244-246)gcG>gcA	p.A82A		NM_002279.4	NP_002270.1	Q14525	KT33B_HUMAN	keratin 33B	82	Coil 1A.|Rod.				aging (GO:0007568)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.A82A(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(6)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000496)				TCTCCAGCTCCGCGTTGTCCC	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		18591	0.001		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	lung(1)											63.0	62.0	63.0					17																	39525757		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			X82634	CCDS11389.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131738	ENSG00000131738		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6451	protein-coding gene	gene with protein product	"""hard keratin type I 3II"""	602762	"""keratin, hair, acidic, 3B"""	KRTHA3B		7565656, 16831889	Standard	NM_002279		Approved	Ha-3II	uc002hwl.4	Q14525	OTTHUMG00000133429	ENST00000251646.3:c.246G>A	17.37:g.39525757C>T			O76010	Silent	SNP	pfam_F,prints_Keratin_I	p.A82	ENST00000251646.3	37	c.246	CCDS11389.1	17																																																																																			KRT33B	-	pfam_F	ENSG00000131738		0.607	KRT33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT33B	HGNC	protein_coding	OTTHUMT00000257292.1	80	0.00	0	C	NM_002279		39525757	39525757	-1	no_errors	ENST00000251646	ensembl	human	known	69_37n	silent	31	13.89	5	SNP	0.741	T
LARP1	23367	genome.wustl.edu	37	5	154170243	154170243	+	Silent	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:154170243T>C	ENST00000336314.4	+	3	330	c.306T>C	c.(304-306)ccT>ccC	p.P102P		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	179					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GGCCCACACCTGGAGAGATAG	0.507																																						dbGAP											0													109.0	96.0	100.0					5																	154170243		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.306T>C	5.37:g.154170243T>C			O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	NULL	p.W41R	ENST00000336314.4	37	c.121	CCDS4328.1	5																																																																																			LARP1	-	NULL	ENSG00000155506		0.507	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP1	HGNC	protein_coding	OTTHUMT00000252509.1	55	0.00	0	T	NM_033551		154170243	154170243	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000521577	ensembl	human	known	69_37n	missense	33	13.16	5	SNP	1.000	C
LDB2	9079	genome.wustl.edu	37	4	16899985	16899985	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr4:16899985G>A	ENST00000304523.5	-	1	447	c.124C>T	c.(124-126)Cgc>Tgc	p.R42C	LDB2_ENST00000502640.1_Missense_Mutation_p.R42C|LDB2_ENST00000515064.1_Missense_Mutation_p.R42C|LDB2_ENST00000441778.2_Missense_Mutation_p.R42C	NM_001290.3	NP_001281.1	O43679	LDB2_HUMAN	LIM domain binding 2	42					epithelial structure maintenance (GO:0010669)|hair follicle development (GO:0001942)|positive regulation of cellular component biogenesis (GO:0044089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell maintenance (GO:0035019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	LIM domain binding (GO:0030274)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(23)|urinary_tract(1)	33						ACCTCTGTGCGAGACTGCAGT	0.433																																						dbGAP											0													189.0	169.0	176.0					4																	16899985		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF068651	CCDS3420.1, CCDS47031.1	4p16	2008-08-01			ENSG00000169744	ENSG00000169744			6533	protein-coding gene	gene with protein product		603450				9853615, 9880598, 10861853	Standard	NM_001290		Approved	CLIM1, LDB1	uc003goz.3	O43679	OTTHUMG00000048212	ENST00000304523.5:c.124C>T	4.37:g.16899985G>A	ENSP00000306772:p.Arg42Cys		O60619|O75480	Missense_Mutation	SNP	NULL	p.R42C	ENST00000304523.5	37	c.124	CCDS3420.1	4	.	.	.	.	.	.	.	.	.	.	G	20.6	4.013830	0.75161	.	.	ENSG00000169744	ENST00000515064;ENST00000441778;ENST00000304523;ENST00000502640;ENST00000506732	.	.	.	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.79621	0.4477	M	0.79475	2.455	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;0.999;1.0;0.999	D;D;D;D;D	0.79784	0.993;0.977;0.921;0.947;0.93	T	0.81208	-0.1037	9	0.51188	T	0.08	-9.2387	17.3951	0.87443	0.0:0.0:1.0:0.0	.	8;42;42;42;42	B7Z6D0;E9PFI4;G5E9Y7;O43679-2;O43679	.;.;.;.;LDB2_HUMAN	C	42;42;42;42;18	.	ENSP00000306772:R42C	R	-	1	0	LDB2	16509083	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.292000	0.96076	2.325000	0.78763	0.460000	0.39030	CGC	LDB2	-	NULL	ENSG00000169744		0.433	LDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDB2	HGNC	protein_coding	OTTHUMT00000250321.2	44	0.00	0	G			16899985	16899985	-1	no_errors	ENST00000304523	ensembl	human	known	69_37n	missense	35	14.63	6	SNP	1.000	A
LEPRE1	64175	genome.wustl.edu	37	1	43215952	43215952	+	Missense_Mutation	SNP	G	G	A	rs201236270		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:43215952G>A	ENST00000296388.5	-	11	1676	c.1625C>T	c.(1624-1626)aCg>aTg	p.T542M	LEPRE1_ENST00000397054.3_Missense_Mutation_p.T542M|LEPRE1_ENST00000236040.4_Missense_Mutation_p.T542M|LEPRE1_ENST00000462474.1_5'Flank			Q32P28	P3H1_HUMAN	leucine proline-enriched proteoglycan (leprecan) 1	542					bone development (GO:0060348)|cell growth (GO:0016049)|chaperone-mediated protein folding (GO:0061077)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein hydroxylation (GO:0018126)|protein stabilization (GO:0050821)|regulation of ossification (GO:0030278)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)|protein complex binding (GO:0032403)			large_intestine(2)|lung(15)|ovary(5)|prostate(1)|urinary_tract(3)	26	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CACCTTCTCCGTCACGTTGTA	0.572													G|||	1	0.000199681	0.0	0.0014	5008	,	,		16310	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													130.0	104.0	113.0					1																	43215952		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027648	CCDS472.2, CCDS53307.1, CCDS57986.1	1p34.1	2014-09-17			ENSG00000117385	ENSG00000117385			19316	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 1"", ""growth suppressor 1"""	610339				10951563	Standard	NM_022356		Approved	GROS1, P3H1, LEPRECAN, MGC117314	uc001chx.4	Q32P28	OTTHUMG00000007525	ENST00000296388.5:c.1625C>T	1.37:g.43215952G>A	ENSP00000296388:p.Thr542Met		Q7KZR4|Q96BR8|Q96SK8|Q96SL5|Q96SN3|Q9H6K3|Q9HC86|Q9HC87	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.T542M	ENST00000296388.5	37	c.1625	CCDS472.2	1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.304459	0.81136	.	.	ENSG00000117385	ENST00000397054;ENST00000236040;ENST00000296388;ENST00000540027	T;T;T	0.42900	0.96;0.96;0.96	5.13	5.13	0.70059	Prolyl 4-hydroxylase, alpha subunit (1);	0.273865	0.41396	D	0.000887	T	0.57242	0.2040	L	0.50333	1.59	0.35689	D	0.814699	D;D;D	0.89917	0.998;0.999;1.0	D;P;P	0.63703	0.917;0.732;0.732	T	0.68236	-0.5462	10	0.87932	D	0	-18.1282	16.0708	0.80928	0.0:0.0:1.0:0.0	.	542;407;542	Q32P28-3;B4DNM8;Q32P28	.;.;P3H1_HUMAN	M	542;542;542;407	ENSP00000380245:T542M;ENSP00000236040:T542M;ENSP00000296388:T542M	ENSP00000236040:T542M	T	-	2	0	LEPRE1	42988539	1.000000	0.71417	0.941000	0.38009	0.919000	0.55068	5.660000	0.68018	2.396000	0.81511	0.467000	0.42956	ACG	LEPRE1	-	smart_Pro_4_hyd_alph	ENSG00000117385		0.572	LEPRE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LEPRE1	HGNC	protein_coding	OTTHUMT00000019790.2	47	0.00	0	G	NM_022356		43215952	43215952	-1	no_errors	ENST00000236040	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	0.996	A
LGI1	9211	genome.wustl.edu	37	10	95557468	95557468	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr10:95557468G>A	ENST00000371418.4	+	8	1842	c.1582G>A	c.(1582-1584)Gtg>Atg	p.V528M	LGI1_ENST00000542308.1_Missense_Mutation_p.V480M|LGI1_ENST00000371413.3_Intron	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	528					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				ATTCACACATGTGTCCATTAA	0.353																																						dbGAP											0													74.0	76.0	76.0					10																	95557468		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.1582G>A	10.37:g.95557468G>A	ENSP00000360472:p.Val528Met		A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Missense_Mutation	SNP	pfam_EPTP,pfam_Leu-rich_rpt,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_EAR	p.V528M	ENST00000371418.4	37	c.1582	CCDS7431.1	10	.	.	.	.	.	.	.	.	.	.	G	15.68	2.905286	0.52333	.	.	ENSG00000108231	ENST00000542308;ENST00000371418	T;T	0.81163	-1.46;-1.46	5.65	5.65	0.86999	.	0.173688	0.49916	D	0.000121	D	0.85898	0.5804	L	0.58428	1.81	0.58432	D	0.999996	D;P	0.55172	0.97;0.904	P;P	0.56042	0.79;0.588	D	0.83400	0.0022	10	0.36615	T	0.2	-6.688	19.9142	0.97043	0.0:0.0:1.0:0.0	.	480;528	O95970-3;O95970	.;LGI1_HUMAN	M	480;528	ENSP00000440763:V480M;ENSP00000360472:V528M	ENSP00000360472:V528M	V	+	1	0	LGI1	95547458	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.055000	0.71103	2.941000	0.99782	0.655000	0.94253	GTG	LGI1	-	pfam_EPTP,superfamily_WD40_repeat_dom,pfscan_EAR	ENSG00000108231		0.353	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGI1	HGNC	protein_coding	OTTHUMT00000049445.1	29	0.00	0	G	NM_005097		95557468	95557468	+1	no_errors	ENST00000371418	ensembl	human	known	69_37n	missense	27	18.18	6	SNP	1.000	A
LIN54	132660	genome.wustl.edu	37	4	83891570	83891570	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr4:83891570T>C	ENST00000340417.3	-	4	1238	c.861A>G	c.(859-861)atA>atG	p.I287M	LIN54_ENST00000395283.2_Intron|LIN54_ENST00000505397.1_Missense_Mutation_p.I287M|LIN54_ENST00000446851.2_Missense_Mutation_p.I66M|LIN54_ENST00000510557.1_Missense_Mutation_p.I66M|LIN54_ENST00000442461.2_Missense_Mutation_p.I66M|LIN54_ENST00000395282.2_3'UTR|LIN54_ENST00000506560.1_Intron	NM_194282.2	NP_919258.2	Q6MZP7	LIN54_HUMAN	lin-54 DREAM MuvB core complex component	287					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(5)	14		Hepatocellular(203;0.114)				CACTTTCAGATATTGTTATGG	0.358																																						dbGAP											0													169.0	163.0	165.0					4																	83891570		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX537919	CCDS3599.1, CCDS47089.1, CCDS75157.1	4q21.22	2014-07-17	2014-07-17		ENSG00000189308	ENSG00000189308			25397	protein-coding gene	gene with protein product	"""CXC domain containing 1"""	613367	"""lin-54 homolog (C. elegans)"""			21498570	Standard	XM_005262749		Approved	MIP120, DKFZp686L1814, JC8.6, CXCDC1	uc003hnx.3	Q6MZP7	OTTHUMG00000130287	ENST00000340417.3:c.861A>G	4.37:g.83891570T>C	ENSP00000341947:p.Ile287Met		Q32M68|Q32M69|Q6N071|Q76B60	Missense_Mutation	SNP	pfam_TCR	p.I287M	ENST00000340417.3	37	c.861	CCDS3599.1	4	.	.	.	.	.	.	.	.	.	.	T	14.47	2.544780	0.45280	.	.	ENSG00000189308	ENST00000340417;ENST00000442461;ENST00000446851;ENST00000510557;ENST00000505397	.	.	.	5.81	-0.351	0.12602	.	0.049144	0.85682	D	0.000000	T	0.50051	0.1593	N	0.24115	0.695	0.80722	D	1	B;D	0.65815	0.028;0.995	B;D	0.72982	0.004;0.979	T	0.43589	-0.9382	9	0.39692	T	0.17	-20.3066	7.1585	0.25651	0.2739:0.0:0.4107:0.3154	.	159;287	Q7Z3G2;Q6MZP7	.;LIN54_HUMAN	M	287;66;66;66;287	.	ENSP00000341947:I287M	I	-	3	3	LIN54	84110594	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.619000	0.24388	0.411000	0.25702	0.528000	0.53228	ATA	LIN54	-	NULL	ENSG00000189308		0.358	LIN54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN54	HGNC	protein_coding	OTTHUMT00000252626.2	94	0.00	0	T	NM_194282		83891570	83891570	-1	no_errors	ENST00000340417	ensembl	human	known	69_37n	missense	79	15.05	14	SNP	0.994	C
LOXL2	4017	genome.wustl.edu	37	8	23198633	23198633	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr8:23198633G>A	ENST00000389131.3	-	4	984	c.615C>T	c.(613-615)taC>taT	p.Y205Y	RP11-177H13.2_ENST00000519692.1_RNA	NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	205	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		TCACCTCCACGTAGCCCTCCA	0.582																																						dbGAP											0													173.0	136.0	149.0					8																	23198633		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.615C>T	8.37:g.23198633G>A			B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Silent	SNP	pfam_Lysyl_oxidase,pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Lysyl_oxidase,prints_Srcr_rcpt	p.Y205	ENST00000389131.3	37	c.615	CCDS34864.1	8																																																																																			LOXL2	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000134013		0.582	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL2	HGNC	protein_coding	OTTHUMT00000375603.1	40	0.00	0	G			23198633	23198633	-1	no_errors	ENST00000389131	ensembl	human	known	69_37n	silent	24	17.24	5	SNP	1.000	A
LPA	4018	genome.wustl.edu	37	6	161071369	161071369	+	Splice_Site	SNP	C	C	T	rs533200556	byFrequency	TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:161071369C>T	ENST00000316300.5	-	2	254		c.e2+1		LPA_ENST00000447678.1_Splice_Site			P08519	APOA_HUMAN	lipoprotein, Lp(a)						blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TAATGACATACGCATTTGGGT	0.403																																						dbGAP											0													204.0	218.0	213.0					6																	161071369		2183	4295	6478	-	-	-	SO:0001630	splice_region_variant	0			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.209+1G>A	6.37:g.161071369C>T			Q5VTD7|Q9UD88	Splice_Site	SNP	-	e2+1	ENST00000316300.5	37	c.209+1	CCDS43523.1	6	.	.	.	.	.	.	.	.	.	.	C	5.837	0.338662	0.11069	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	.	.	.	2.57	2.57	0.30868	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.71	0.34378	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LPA	160991359	1.000000	0.71417	1.000000	0.80357	0.064000	0.16182	2.199000	0.42715	1.433000	0.47394	0.505000	0.49811	.	LPA	-	-	ENSG00000198670		0.403	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPA	HGNC	protein_coding	OTTHUMT00000042957.1	106	0.00	0	C	NM_005577	Intron	161071369	161071369	-1	no_errors	ENST00000316300	ensembl	human	known	69_37n	splice_site	42	23.64	13	SNP	1.000	T
LPIN2	9663	genome.wustl.edu	37	18	2929124	2929124	+	Missense_Mutation	SNP	C	C	T	rs201325845	byFrequency	TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr18:2929124C>T	ENST00000261596.4	-	10	1727	c.1489G>A	c.(1489-1491)Gaa>Aaa	p.E497K		NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	497					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		TCTGCAAATTCGTGATAAGTA	0.289													C|||	4	0.000798722	0.0	0.0	5008	,	,		17295	0.001		0.0	False		,,,				2504	0.0031					dbGAP											0													124.0	136.0	132.0					18																	2929124		2203	4297	6500	-	-	-	SO:0001583	missense	0			D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.1489G>A	18.37:g.2929124C>T	ENSP00000261596:p.Glu497Lys		A7MD25|D3DUH3	Missense_Mutation	SNP	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,smart_LNS2	p.E497K	ENST00000261596.4	37	c.1489	CCDS11829.1	18	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	26.2	4.709925	0.89018	.	.	ENSG00000101577	ENST00000261596	T	0.80214	-1.35	6.02	6.02	0.97574	.	0.043776	0.85682	D	0.000000	T	0.81432	0.4821	M	0.69358	2.11	0.80722	D	1	D	0.61080	0.989	P	0.48270	0.572	T	0.77461	-0.2579	10	0.13470	T	0.59	-32.9414	15.9556	0.79886	0.0:0.866:0.134:0.0	.	497	Q92539	LPIN2_HUMAN	K	497	ENSP00000261596:E497K	ENSP00000261596:E497K	E	-	1	0	LPIN2	2919124	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	4.503000	0.60407	2.857000	0.98124	0.650000	0.86243	GAA	LPIN2	-	NULL	ENSG00000101577		0.289	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPIN2	HGNC	protein_coding	OTTHUMT00000254363.2	95	0.00	0	C	NM_014646		2929124	2929124	-1	no_errors	ENST00000261596	ensembl	human	known	69_37n	missense	61	17.57	13	SNP	1.000	T
LRP1B	53353	genome.wustl.edu	37	2	141607771	141607771	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:141607771G>A	ENST00000389484.3	-	29	5810	c.4839C>T	c.(4837-4839)ttC>ttT	p.F1613F		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1613					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAGATGCATCGAAGTCTATCA	0.373										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	dbGAP											0													180.0	174.0	176.0					2																	141607771		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4839C>T	2.37:g.141607771G>A			Q8WY29|Q8WY30|Q8WY31	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_dom,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.F1613	ENST00000389484.3	37	c.4839	CCDS2182.1	2																																																																																			LRP1B	-	smart_LDLR_classB_rpt	ENSG00000168702		0.373	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	106	0.00	0	G	NM_018557		141607771	141607771	-1	no_errors	ENST00000389484	ensembl	human	known	69_37n	silent	63	19.23	15	SNP	0.570	A
LRRN1	57633	genome.wustl.edu	37	3	3886447	3886447	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr3:3886447G>A	ENST00000319331.3	+	2	883	c.122G>A	c.(121-123)cGt>cAt	p.R41H	SUMF1_ENST00000534863.1_Intron	NM_020873.5	NP_065924.3	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1	41	LRRNT.					integral component of membrane (GO:0016021)		p.R41H(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	26				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		TGTGAAATTCGTCCCTGGTTT	0.458																																						dbGAP											1	Substitution - Missense(1)	lung(1)											139.0	127.0	131.0					3																	3886447		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040930	CCDS33685.1	3p26.2	2013-01-11			ENSG00000175928	ENSG00000175928		"""Immunoglobulin superfamily / I-set domain containing"""	20980	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 3"""					10819331	Standard	NM_020873		Approved	FIGLER3	uc003bpt.4	Q6UXK5	OTTHUMG00000154934	ENST00000319331.3:c.122G>A	3.37:g.3886447G>A	ENSP00000314901:p.Arg41His		Q3LID5|Q8IYV5|Q9H8V1|Q9P231	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R41H	ENST00000319331.3	37	c.122	CCDS33685.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.154674	0.94686	.	.	ENSG00000175928	ENST00000319331	T	0.26373	1.74	5.76	5.76	0.90799	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.56108	0.1963	M	0.78456	2.415	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.58160	-0.7685	10	0.87932	D	0	.	19.9759	0.97304	0.0:0.0:1.0:0.0	.	41	Q6UXK5	LRRN1_HUMAN	H	41	ENSP00000314901:R41H	ENSP00000314901:R41H	R	+	2	0	LRRN1	3861447	1.000000	0.71417	0.944000	0.38274	0.997000	0.91878	9.787000	0.99055	2.713000	0.92767	0.655000	0.94253	CGT	LRRN1	-	NULL	ENSG00000175928		0.458	LRRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRN1	HGNC	protein_coding	OTTHUMT00000337704.2	45	0.00	0	G	NM_020873		3886447	3886447	+1	no_errors	ENST00000319331	ensembl	human	known	69_37n	missense	38	15.56	7	SNP	1.000	A
LYZL1	84569	genome.wustl.edu	37	10	29580826	29580826	+	Silent	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr10:29580826T>C	ENST00000375500.3	+	2	225	c.168T>C	c.(166-168)atT>atC	p.I56I		NM_032517.4	NP_115906.3	Q6UWQ5	LYZL1_HUMAN	lysozyme-like 1	10					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			central_nervous_system(1)|cervix(2)|large_intestine(2)|lung(5)|skin(1)	11		Breast(68;0.203)				TGACCCTCATTGGCTGCCTGG	0.552																																						dbGAP											0													35.0	29.0	31.0					10																	29580826		2198	4265	6463	-	-	-	SO:0001819	synonymous_variant	0				CCDS31174.1	10p12.1	2004-08-02			ENSG00000120563	ENSG00000120563	3.2.1.1		30502	protein-coding gene	gene with protein product						12477932	Standard	XM_005252627		Approved	MGC33408, LYC2	uc001iul.3	Q6UWQ5	OTTHUMG00000017880	ENST00000375500.3:c.168T>C	10.37:g.29580826T>C			Q5T921|Q8WW16	Silent	SNP	pfam_Glyco_hydro_22,superfamily_Lysozyme-like_dom,smart_Glyco_hydro_22,prints_Glyco_hydro_22,prints_Glyco_hydro_22_lys	p.I56	ENST00000375500.3	37	c.168	CCDS31174.1	10																																																																																			LYZL1	-	NULL	ENSG00000120563		0.552	LYZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYZL1	HGNC	protein_coding	OTTHUMT00000047381.1	43	0.00	0	T	NM_032517		29580826	29580826	+1	no_errors	ENST00000375500	ensembl	human	known	69_37n	silent	14	22.22	4	SNP	0.230	C
MAN2A2	4122	genome.wustl.edu	37	15	91456857	91456857	+	Missense_Mutation	SNP	G	G	A	rs549071659		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr15:91456857G>A	ENST00000559717.1	+	19	3191	c.2732G>A	c.(2731-2733)cGg>cAg	p.R911Q	MAN2A2_ENST00000360468.3_Missense_Mutation_p.R911Q|MAN2A2_ENST00000431652.2_Missense_Mutation_p.R419Q|MAN2A2_ENST00000430376.2_Missense_Mutation_p.R101Q			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	911					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			CAGCCCCGACGGTATCTGAAG	0.632													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17501	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													40.0	36.0	37.0					15																	91456857		2198	4298	6496	-	-	-	SO:0001583	missense	0			L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.2732G>A	15.37:g.91456857G>A	ENSP00000452948:p.Arg911Gln		A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	pfam_Glyco_hydro_38_core,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Glyco_hydro-type_carb-bd,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.R911Q	ENST00000559717.1	37	c.2732	CCDS32332.1	15	.	.	.	.	.	.	.	.	.	.	G	13.44	2.236958	0.39498	.	.	ENSG00000196547	ENST00000360468;ENST00000431652;ENST00000430376	T;T;T	0.78707	-1.2;-1.2;-1.2	4.97	3.09	0.35607	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.066712	0.64402	N	0.000010	T	0.61850	0.2380	N	0.25957	0.775	0.49915	D	0.999833	B;B;B	0.21225	0.053;0.03;0.003	B;B;B	0.19391	0.025;0.023;0.023	T	0.50668	-0.8801	10	0.20519	T	0.43	-23.9122	8.8364	0.35115	0.2507:0.0:0.7493:0.0	.	419;539;911	B4DEU9;B4DIK4;P49641	.;.;MA2A2_HUMAN	Q	911;419;101	ENSP00000353655:R911Q;ENSP00000388221:R419Q;ENSP00000394372:R101Q	ENSP00000353655:R911Q	R	+	2	0	MAN2A2	89257861	1.000000	0.71417	0.994000	0.49952	0.405000	0.30901	3.300000	0.51834	0.682000	0.31407	0.555000	0.69702	CGG	MAN2A2	-	pfam_Glyco_hydro_38_C,superfamily_Glyco_hydro-type_carb-bd	ENSG00000196547		0.632	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2A2	HGNC	protein_coding	OTTHUMT00000418246.5	18	0.00	0	G	NM_006122		91456857	91456857	+1	no_errors	ENST00000360468	ensembl	human	known	69_37n	missense	15	25.00	5	SNP	0.998	A
MANEAL	149175	genome.wustl.edu	37	1	38265584	38265584	+	Silent	SNP	C	C	T	rs550657013	byFrequency	TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:38265584C>T	ENST00000373045.6	+	4	1464	c.1083C>T	c.(1081-1083)ggC>ggT	p.G361G	RP11-109P14.9_ENST00000433474.1_RNA|MANEAL_ENST00000329006.5_Silent_p.G139G|MANEAL_ENST00000525897.1_Silent_p.G167G|MANEAL_ENST00000397631.3_3'UTR	NM_001113482.1	NP_001106954.1	Q5VSG8	MANEL_HUMAN	mannosidase, endo-alpha-like	361						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|liver(1)|lung(1)|prostate(3)	7	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TGGGGCCTGGCTACATAGACA	0.527													C|||	2	0.000399361	0.0	0.0	5008	,	,		19928	0.0		0.0	False		,,,				2504	0.002					dbGAP											0													86.0	88.0	87.0					1																	38265584		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055996	CCDS426.1, CCDS44110.1, CCDS44111.1	1p34.3	2008-02-05			ENSG00000185090	ENSG00000185090			26452	protein-coding gene	gene with protein product							Standard	NM_152496		Approved	FLJ31434	uc001cby.2	Q5VSG8	OTTHUMG00000004317	ENST00000373045.6:c.1083C>T	1.37:g.38265584C>T			Q6DD86|Q6P497|Q8N5P8|Q96G55|Q96N42	Silent	SNP	NULL	p.G361	ENST00000373045.6	37	c.1083	CCDS44110.1	1																																																																																			MANEAL	-	NULL	ENSG00000185090		0.527	MANEAL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MANEAL	HGNC	protein_coding	OTTHUMT00000012469.2	35	0.00	0	C	NM_152496		38265584	38265584	+1	no_errors	ENST00000373045	ensembl	human	known	69_37n	silent	33	21.43	9	SNP	1.000	T
MASTL	84930	genome.wustl.edu	37	10	27447506	27447506	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr10:27447506A>G	ENST00000375940.4	+	2	272	c.215A>G	c.(214-216)aAa>aGa	p.K72R	MASTL_ENST00000375946.4_Missense_Mutation_p.K72R|MASTL_ENST00000342386.6_Missense_Mutation_p.K72R			Q96GX5	GWL_HUMAN	microtubule associated serine/threonine kinase-like	72	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of protein phosphatase type 2A activity (GO:0034048)|regulation of cell cycle (GO:0051726)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein phosphatase 2A binding (GO:0051721)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ATGATCAACAAAAATATGACT	0.363																																						dbGAP											0													126.0	123.0	124.0					10																	27447506		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC009107	CCDS7153.1, CCDS53502.1, CCDS53503.1	10p12.1	2005-11-03			ENSG00000120539	ENSG00000120539			19042	protein-coding gene	gene with protein product		608221					Standard	NM_001172303		Approved	FLJ14813, THC2	uc001itm.3	Q96GX5	OTTHUMG00000017855	ENST00000375940.4:c.215A>G	10.37:g.27447506A>G	ENSP00000365107:p.Lys72Arg		Q5T8D5|Q5T8D7|Q8NCD6|Q96SJ5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.K72R	ENST00000375940.4	37	c.215	CCDS53502.1	10	.	.	.	.	.	.	.	.	.	.	A	28.1	4.893619	0.91889	.	.	ENSG00000120539	ENST00000375946;ENST00000342386;ENST00000375940	T;T;T	0.66638	-0.22;-0.22;-0.22	5.61	5.61	0.85477	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.72153	0.3425	N	0.25957	0.775	0.80722	D	1	P;P;D	0.89917	0.829;0.82;1.0	P;P;D	0.87578	0.708;0.899;0.998	T	0.71817	-0.4478	10	0.35671	T	0.21	-27.5747	15.8063	0.78513	1.0:0.0:0.0:0.0	.	72;72;72	Q96GX5-2;Q96GX5;Q96GX5-3	.;GWL_HUMAN;.	R	72	ENSP00000365113:K72R;ENSP00000343446:K72R;ENSP00000365107:K72R	ENSP00000343446:K72R	K	+	2	0	MASTL	27487512	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.524000	0.90579	2.135000	0.66039	0.528000	0.53228	AAA	MASTL	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000120539		0.363	MASTL-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MASTL	HGNC	protein_coding	OTTHUMT00000047320.1	73	0.00	0	A	NM_032844		27447506	27447506	+1	no_errors	ENST00000375940	ensembl	human	known	69_37n	missense	52	23.53	16	SNP	1.000	G
MBD1	4152	genome.wustl.edu	37	18	47800631	47800631	+	Silent	SNP	G	G	A	rs115570375		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr18:47800631G>A	ENST00000591416.1	-	11	1502	c.1071C>T	c.(1069-1071)tgC>tgT	p.C357C	MBD1_ENST00000436910.1_Silent_p.C334C|MBD1_ENST00000382948.5_Silent_p.C357C|MBD1_ENST00000457839.2_Silent_p.C382C|MBD1_ENST00000349085.2_Intron|MBD1_ENST00000269471.5_Silent_p.C334C|MBD1_ENST00000585595.1_Silent_p.C382C|MBD1_ENST00000269468.5_Silent_p.C357C|MBD1_ENST00000590208.1_Silent_p.C357C|MBD1_ENST00000347968.3_Intron|MBD1_ENST00000588937.1_Silent_p.C334C|MBD1_ENST00000585672.1_Silent_p.C307C|MBD1_ENST00000398488.1_Intron|MBD1_ENST00000591535.1_Silent_p.C334C|MBD1_ENST00000398495.2_Intron|MBD1_ENST00000424334.2_Silent_p.C408C|MBD1_ENST00000587605.1_Intron|MBD1_ENST00000398493.1_Intron|MBD1_ENST00000339998.6_Silent_p.C357C|MBD1_ENST00000353909.3_Silent_p.C308C			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	357					negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						TGGGCTTGTCGCAGCAGAAGT	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		17203	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													52.0	50.0	51.0					18																	47800631		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.1071C>T	18.37:g.47800631G>A			A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Silent	SNP	pfam_Znf_CXXC,pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_CXXC	p.C408	ENST00000591416.1	37	c.1224	CCDS11943.1	18																																																																																			MBD1	-	pfam_Znf_CXXC,pfscan_Znf_CXXC	ENSG00000141644		0.652	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	MBD1	HGNC	protein_coding	OTTHUMT00000255926.3	23	0.00	0	G	NM_015846		47800631	47800631	-1	no_errors	ENST00000424334	ensembl	human	known	69_37n	silent	17	26.09	6	SNP	0.854	A
MBD4	8930	genome.wustl.edu	37	3	129158619	129158619	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr3:129158619C>T	ENST00000249910.1	-	1	233	c.58G>A	c.(58-60)Gtc>Atc	p.V20I	IFT122_ENST00000431818.2_5'Flank|IFT122_ENST00000349441.2_5'Flank|IFT122_ENST00000440957.2_5'Flank|IFT122_ENST00000504021.1_5'Flank|IFT122_ENST00000347300.2_5'Flank|IFT122_ENST00000296266.3_5'Flank|IFT122_ENST00000348417.2_5'Flank|IFT122_ENST00000507564.1_5'Flank|MBD4_ENST00000503197.1_Missense_Mutation_p.V20I|MBD4_ENST00000429544.2_Missense_Mutation_p.V20I|MBD4_ENST00000509587.1_5'UTR|MBD4_ENST00000393278.2_Missense_Mutation_p.V20I|MBD4_ENST00000507208.1_Missense_Mutation_p.V20I	NM_003925.1	NP_003916.1	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4	20					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)	22						CTAGAGGTGACGGTGGGGGCA	0.632								Base excision repair (BER), DNA glycosylases																														dbGAP											0													42.0	39.0	40.0					3																	129158619		2200	4296	6496	-	-	-	SO:0001583	missense	0			AF072250	CCDS3058.1, CCDS63766.1, CCDS63767.1, CCDS63768.1, CCDS63769.1	3q21.3	2004-03-02			ENSG00000129071	ENSG00000129071			6919	protein-coding gene	gene with protein product		603574				9774669, 10097147	Standard	NM_003925		Approved	MED1	uc003emh.2	O95243	OTTHUMG00000159463	ENST00000249910.1:c.58G>A	3.37:g.129158619C>T	ENSP00000249910:p.Val20Ile		B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	pfam_Methyl_CpG_DNA-bd,pfam_HhH-GPD_domain,superfamily_DNA-bd_integrase-typ,superfamily_DNA_glycosylase,smart_Methyl_CpG_DNA-bd,pirsf_Me_CpG-bd_MBD4,pfscan_Methyl_CpG_DNA-bd	p.V20I	ENST00000249910.1	37	c.58	CCDS3058.1	3	.	.	.	.	.	.	.	.	.	.	C	5.669	0.308033	0.10733	.	.	ENSG00000129071	ENST00000429544;ENST00000249910;ENST00000503197;ENST00000393278;ENST00000507208	T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61	3.88	-3.96	0.04106	.	1.886220	0.02737	N	0.115861	T	0.30324	0.0761	N	0.20986	0.625	0.09310	N	1	B;B;B;B;B	0.10296	0.0;0.003;0.001;0.001;0.0	B;B;B;B;B	0.04013	0.0;0.001;0.001;0.001;0.0	T	0.11494	-1.0585	10	0.42905	T	0.14	0.5056	3.8192	0.08828	0.2806:0.2683:0.0:0.4511	.	20;20;20;20;20	E9PEE4;Q2MD36;O95243-2;O95243-3;O95243	.;.;.;.;MBD4_HUMAN	I	20	ENSP00000394080:V20I;ENSP00000249910:V20I;ENSP00000424873:V20I;ENSP00000376959:V20I;ENSP00000422327:V20I	ENSP00000249910:V20I	V	-	1	0	MBD4	130641309	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.376000	0.07465	-0.978000	0.03533	-0.748000	0.03510	GTC	MBD4	-	pirsf_Me_CpG-bd_MBD4	ENSG00000129071		0.632	MBD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MBD4	HGNC	protein_coding	OTTHUMT00000355529.1	23	0.00	0	C	NM_003925		129158619	129158619	-1	no_errors	ENST00000249910	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	0.000	T
MBOAT1	154141	genome.wustl.edu	37	6	20152948	20152948	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:20152948C>T	ENST00000324607.7	-	2	316	c.152G>A	c.(151-153)cGc>cAc	p.R51H	MBOAT1_ENST00000536798.1_Missense_Mutation_p.R51H|MBOAT1_ENST00000541730.1_5'UTR	NM_001080480.1	NP_001073949.1	Q6ZNC8	MBOA1_HUMAN	membrane bound O-acyltransferase domain containing 1	51					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(5)	20	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)			TAAGTAGATGCGAAACCAGAA	0.448																																						dbGAP											0													95.0	92.0	93.0					6																	20152948		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093994	CCDS34346.1	6p22.3	2013-10-11	2006-06-29	2006-06-29	ENSG00000172197	ENSG00000172197			21579	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 1"""	611732	"""O-acyltransferase (membrane bound) domain containing 1"""	OACT1		18287005	Standard	NM_001080480		Approved	MGC44669, dJ434O11.1, LPEAT1	uc003ncx.2	Q6ZNC8	OTTHUMG00000014334	ENST00000324607.7:c.152G>A	6.37:g.20152948C>T	ENSP00000324944:p.Arg51His		A9EDQ5|B4DL59|B4E3J4|Q86XC2|Q8N9R5	Missense_Mutation	SNP	pfam_MBOAT_fam	p.R51H	ENST00000324607.7	37	c.152	CCDS34346.1	6	.	.	.	.	.	.	.	.	.	.	C	32	5.176541	0.94846	.	.	ENSG00000172197	ENST00000324607;ENST00000536798	T;T	0.27256	2.51;1.68	5.37	5.37	0.77165	.	0.052061	0.64402	D	0.000001	T	0.53012	0.1770	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.60042	-0.7340	10	0.59425	D	0.04	-9.0307	18.2467	0.89988	0.0:1.0:0.0:0.0	.	51	Q6ZNC8	MBOA1_HUMAN	H	51	ENSP00000324944:R51H;ENSP00000439814:R51H	ENSP00000324944:R51H	R	-	2	0	MBOAT1	20260927	1.000000	0.71417	0.978000	0.43139	0.908000	0.53690	7.426000	0.80270	2.677000	0.91161	0.655000	0.94253	CGC	MBOAT1	-	NULL	ENSG00000172197		0.448	MBOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBOAT1	HGNC	protein_coding	OTTHUMT00000039980.1	75	0.00	0	C			20152948	20152948	-1	no_errors	ENST00000324607	ensembl	human	known	69_37n	missense	35	12.50	5	SNP	1.000	T
MBTPS1	8720	genome.wustl.edu	37	16	84088175	84088175	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr16:84088175A>G	ENST00000343411.3	-	23	3533	c.3038T>C	c.(3037-3039)gTc>gCc	p.V1013A		NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	1013					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GAAGGCCAGGACCACCATGGC	0.597																																						dbGAP											0													82.0	70.0	74.0					16																	84088175		2200	4300	6500	-	-	-	SO:0001583	missense	0			D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.3038T>C	16.37:g.84088175A>G	ENSP00000344223:p.Val1013Ala		A8K6V8|Q24JQ2|Q9UF67	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53,prints_Peptidase_S8_subtilisin-rel	p.V1013A	ENST00000343411.3	37	c.3038	CCDS10941.1	16	.	.	.	.	.	.	.	.	.	.	A	14.90	2.673036	0.47781	.	.	ENSG00000140943	ENST00000343411;ENST00000347334	T	0.37235	1.21	5.8	4.71	0.59529	.	0.132901	0.49916	N	0.000129	T	0.40247	0.1109	N	0.26042	0.785	0.58432	D	0.999999	P	0.49447	0.924	P	0.62298	0.9	T	0.11084	-1.0602	10	0.17369	T	0.5	-20.627	11.0132	0.47675	0.9266:0.0:0.0734:0.0	.	1013	Q14703	MBTP1_HUMAN	A	1013;458	ENSP00000344223:V1013A	ENSP00000344223:V1013A	V	-	2	0	MBTPS1	82645676	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.291000	0.78721	1.035000	0.39972	0.533000	0.62120	GTC	MBTPS1	-	NULL	ENSG00000140943		0.597	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTPS1	HGNC	protein_coding	OTTHUMT00000269080.2	36	0.00	0	A	NM_003791		84088175	84088175	-1	no_errors	ENST00000343411	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	G
MDN1	23195	genome.wustl.edu	37	6	90461233	90461233	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:90461233C>A	ENST00000369393.3	-	23	3259	c.3144G>T	c.(3142-3144)aaG>aaT	p.K1048N	MDN1_ENST00000428876.1_Missense_Mutation_p.K1048N			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1048					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TTGTAGGCTCCTTGTCTCCCA	0.478																																						dbGAP											0													156.0	134.0	141.0					6																	90461233		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.3144G>T	6.37:g.90461233C>A	ENSP00000358400:p.Lys1048Asn		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.K1048N	ENST00000369393.3	37	c.3144	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	C	15.22	2.767757	0.49574	.	.	ENSG00000112159	ENST00000369393;ENST00000428876;ENST00000439638	T;T;T	0.39592	1.07;1.07;1.07	5.71	-1.88	0.07713	.	0.162096	0.53938	N	0.000057	T	0.12433	0.0302	L	0.50333	1.59	0.45194	D	0.998202	B;B	0.27068	0.167;0.019	B;B	0.23716	0.048;0.048	T	0.16041	-1.0416	10	0.21014	T	0.42	.	5.7397	0.18087	0.2334:0.2226:0.0:0.544	.	975;1048	Q5T795;Q9NU22	.;MDN1_HUMAN	N	1048;1048;975	ENSP00000358400:K1048N;ENSP00000413970:K1048N;ENSP00000409664:K975N	ENSP00000358400:K1048N	K	-	3	2	MDN1	90517954	0.961000	0.32948	0.921000	0.36526	0.982000	0.71751	0.103000	0.15292	-0.801000	0.04427	-0.345000	0.07892	AAG	MDN1	-	pirsf_Midasin	ENSG00000112159		0.478	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	83	0.00	0	C			90461233	90461233	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	missense	41	28.07	16	SNP	0.984	A
MED12L	116931	genome.wustl.edu	37	3	151095876	151095876	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr3:151095876C>T	ENST00000474524.1	+	29	4326	c.4288C>T	c.(4288-4290)Ctg>Ttg	p.L1430L	MED12L_ENST00000273432.4_Silent_p.L1290L|P2RY12_ENST00000302632.3_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1430						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGGAAGAGTGCTGAAAGCCGC	0.517																																						dbGAP											0													85.0	81.0	82.0					3																	151095876		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.4288C>T	3.37:g.151095876C>T			Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.L1430	ENST00000474524.1	37	c.4288	CCDS33876.1	3																																																																																			MED12L	-	NULL	ENSG00000144893		0.517	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2	52	0.00	0	C	NM_053002		151095876	151095876	+1	no_errors	ENST00000474524	ensembl	human	known	69_37n	silent	30	16.67	6	SNP	0.415	T
MED12L	116931	genome.wustl.edu	37	3	151100490	151100490	+	Missense_Mutation	SNP	C	C	T	rs200563860		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr3:151100490C>T	ENST00000474524.1	+	31	4570	c.4532C>T	c.(4531-4533)gCg>gTg	p.A1511V	MED12L_ENST00000273432.4_Missense_Mutation_p.A1371V|P2RY12_ENST00000302632.3_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1511						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GACATAAAAGCGCGGCAGATG	0.353																																						dbGAP											0													66.0	64.0	65.0					3																	151100490		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.4532C>T	3.37:g.151100490C>T	ENSP00000417235:p.Ala1511Val		Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.A1511V	ENST00000474524.1	37	c.4532	CCDS33876.1	3	.	.	.	.	.	.	.	.	.	.	C	29.1	4.981642	0.93044	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.61392	0.33;0.11	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.69753	0.3146	L	0.38175	1.15	0.80722	D	1	D;D;D	0.76494	0.987;0.999;0.999	P;D;D	0.78314	0.658;0.991;0.98	T	0.68588	-0.5369	10	0.51188	T	0.08	-19.6398	19.8545	0.96752	0.0:1.0:0.0:0.0	.	1371;1510;1511	F8WAE6;Q86YW9-4;Q86YW9	.;.;MD12L_HUMAN	V	1511;1371	ENSP00000417235:A1511V;ENSP00000273432:A1371V	ENSP00000273432:A1371V	A	+	2	0	MED12L	152583180	1.000000	0.71417	0.382000	0.26119	0.629000	0.37895	7.572000	0.82409	2.784000	0.95788	0.644000	0.83932	GCG	MED12L	-	NULL	ENSG00000144893		0.353	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2	57	0.00	0	C	NM_053002		151100490	151100490	+1	no_errors	ENST00000474524	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	1.000	T
MEF2D	4209	genome.wustl.edu	37	1	156446980	156446980	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:156446980T>C	ENST00000348159.4	-	7	1159	c.679A>G	c.(679-681)Agt>Ggt	p.S227G	MEF2D_ENST00000353795.3_Missense_Mutation_p.S181G|MEF2D_ENST00000360595.3_Missense_Mutation_p.S227G|MEF2D_ENST00000464356.2_Missense_Mutation_p.S226G|MEF2D_ENST00000340875.5_Missense_Mutation_p.S226G|MEF2D_ENST00000368240.2_Missense_Mutation_p.S227G	NM_005920.2	NP_005911.1	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D	227					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|chondrocyte differentiation (GO:0002062)|endochondral ossification (GO:0001958)|muscle organ development (GO:0007517)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|histone deacetylase binding (GO:0042826)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	15	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GCCCGAGCACTGACGTAGCCA	0.547																																						dbGAP											0													58.0	54.0	55.0					1																	156446980		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC054520	CCDS1143.1, CCDS60304.1	1q12-q23	2008-02-05	2007-04-24		ENSG00000116604	ENSG00000116604		"""Myocyte enhancer factors"""	6997	protein-coding gene	gene with protein product		600663				8269842	Standard	NM_005920		Approved		uc001fpb.4	Q14814	OTTHUMG00000033095	ENST00000348159.4:c.679A>G	1.37:g.156446980T>C	ENSP00000271555:p.Ser227Gly		D3DVC0|Q14815|Q5T9U5|Q5T9U6	Missense_Mutation	SNP	pfam_TF_MADSbox,pfam_HJURP_C,superfamily_TF_MADSbox,smart_TF_MADSbox,pfscan_TF_MADSbox,prints_TF_MADSbox	p.S227G	ENST00000348159.4	37	c.679	CCDS1143.1	1	.	.	.	.	.	.	.	.	.	.	T	18.84	3.710109	0.68730	.	.	ENSG00000116604	ENST00000348159;ENST00000340875;ENST00000368240;ENST00000353795;ENST00000360595;ENST00000454816	T;T;T;T;T;T	0.61274	0.12;0.12;0.18;0.51;0.18;0.18	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.46405	0.1391	M	0.72118	2.19	0.58432	D	0.999998	P;B;B	0.36768	0.569;0.002;0.0	B;B;B	0.37144	0.242;0.003;0.005	T	0.53767	-0.8392	10	0.44086	T	0.13	-7.1278	14.287	0.66251	0.0:0.0:0.0:1.0	.	232;227;227	Q4LE66;Q14814;Q14814-4	.;MEF2D_HUMAN;.	G	227;226;227;181;227;226	ENSP00000271555:S227G;ENSP00000343159:S226G;ENSP00000357223:S227G;ENSP00000344705:S181G;ENSP00000353803:S227G;ENSP00000388505:S226G	ENSP00000343159:S226G	S	-	1	0	MEF2D	154713604	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.502000	0.81614	2.057000	0.61298	0.533000	0.62120	AGT	MEF2D	-	NULL	ENSG00000116604		0.547	MEF2D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MEF2D	HGNC	protein_coding	OTTHUMT00000080562.2	41	0.00	0	T	NM_005920		156446980	156446980	-1	no_errors	ENST00000348159	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	1.000	C
MEGF8	1954	genome.wustl.edu	37	19	42853706	42853706	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr19:42853706G>A	ENST00000251268.6	+	14	2354	c.2354G>A	c.(2353-2355)cGc>cAc	p.R785H	MEGF8_ENST00000334370.4_Missense_Mutation_p.R718H	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	785					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CGGCTGCAGCGCCCTGGGTCT	0.667																																						dbGAP											0													31.0	37.0	35.0					19																	42853706		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.2354G>A	19.37:g.42853706G>A	ENSP00000251268:p.Arg785His		A8KAY0|O75097	Missense_Mutation	SNP	pfam_CUB,pfam_EGF_laminin,pfam_Plexin_repeat,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_CUB,superfamily_Plexin-like_fold,smart_CUB,smart_EGF-like,smart_Plexin-like,smart_EGF-like_Ca-bd,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin	p.R785H	ENST00000251268.6	37	c.2354		19	.	.	.	.	.	.	.	.	.	.	G	22.3	4.266511	0.80358	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.25414	1.8;1.97	4.48	4.48	0.54585	.	0.287190	0.25402	N	0.030925	T	0.24198	0.0586	N	0.08118	0	0.80722	D	1	D;D	0.76494	0.996;0.999	P;P	0.60286	0.656;0.872	T	0.07195	-1.0785	10	0.13470	T	0.59	.	14.634	0.68676	0.0:0.0:1.0:0.0	.	785;718	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	H	718;785	ENSP00000334219:R718H;ENSP00000251268:R785H	ENSP00000251268:R785H	R	+	2	0	MEGF8	47545546	1.000000	0.71417	0.938000	0.37757	0.605000	0.37080	7.543000	0.82106	2.062000	0.61559	0.491000	0.48974	CGC	MEGF8	-	NULL	ENSG00000105429		0.667	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	HGNC	protein_coding	OTTHUMT00000463854.1	31	0.00	0	G	NM_001410		42853706	42853706	+1	no_errors	ENST00000251268	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.996	A
METAP1D	254042	genome.wustl.edu	37	2	172930997	172930997	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:172930997C>A	ENST00000315796.4	+	5	890	c.503C>A	c.(502-504)cCt>cAt	p.P168H	METAP1D_ENST00000488581.1_3'UTR	NM_199227.1	NP_954697.1	Q6UB28	MAP12_HUMAN	methionyl aminopeptidase type 1D (mitochondrial)	168					N-terminal protein amino acid modification (GO:0031365)|peptidyl-methionine modification (GO:0018206)|protein initiator methionine removal (GO:0070084)	mitochondrion (GO:0005739)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metalloaminopeptidase activity (GO:0070006)|metalloexopeptidase activity (GO:0008235)			NS(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)	8						TTTAGTCGACCTCTTCAGGAT	0.318																																						dbGAP											0													109.0	102.0	104.0					2																	172930997		2202	4300	6502	-	-	-	SO:0001583	missense	0			AY374142, BC029123	CCDS2246.1	2q31.1	2010-09-21			ENSG00000172878	ENSG00000172878			32583	protein-coding gene	gene with protein product	"""methionine aminopeptidase 1D"""	610267				14532271, 16568094	Standard	NM_199227		Approved	MAP1D, Metap1l	uc002uhk.3	Q6UB28	OTTHUMG00000132283	ENST00000315796.4:c.503C>A	2.37:g.172930997C>A	ENSP00000315152:p.Pro168His		Q1WNX3	Missense_Mutation	SNP	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain,prints_Pept_M24_MAP,tigrfam_Pept_M24A_MAP1	p.P168H	ENST00000315796.4	37	c.503	CCDS2246.1	2	.	.	.	.	.	.	.	.	.	.	C	16.88	3.244777	0.59103	.	.	ENSG00000172878	ENST00000315796	T	0.77098	-1.07	6.04	6.04	0.98038	Peptidase M24, structural domain (3);	0.157808	0.64402	D	0.000020	D	0.89312	0.6679	M	0.83953	2.67	0.54753	D	0.999988	D	0.69078	0.997	D	0.69479	0.964	D	0.88579	0.3135	10	0.52906	T	0.07	-6.4978	20.5948	0.99439	0.0:1.0:0.0:0.0	.	168	Q6UB28	AMP1D_HUMAN	H	168	ENSP00000315152:P168H	ENSP00000315152:P168H	P	+	2	0	METAP1D	172639243	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	4.010000	0.57117	2.873000	0.98535	0.563000	0.77884	CCT	METAP1D	-	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain,tigrfam_Pept_M24A_MAP1	ENSG00000172878		0.318	METAP1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METAP1D	HGNC	protein_coding	OTTHUMT00000255378.2	107	0.00	0	C	NM_199227		172930997	172930997	+1	no_errors	ENST00000315796	ensembl	human	known	69_37n	missense	73	12.05	10	SNP	1.000	A
MIPEP	4285	genome.wustl.edu	37	13	24460601	24460601	+	Silent	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr13:24460601A>G	ENST00000382172.3	-	2	332	c.234T>C	c.(232-234)caT>caC	p.H78H	C1QTNF9B-AS1_ENST00000382133.4_RNA|MIPEP_ENST00000469167.1_5'UTR|C1QTNF9B-AS1_ENST00000435039.2_RNA	NM_005932.3	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase	78					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(12)|prostate(2)|skin(1)	27		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		CTTGTGCAATATGAAATCCTT	0.443																																						dbGAP											0													77.0	76.0	76.0					13																	24460601		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9303.1	13q12	2011-01-17			ENSG00000027001	ENSG00000027001	3.4.24.59		7104	protein-coding gene	gene with protein product		602241				9073519	Standard	NM_005932		Approved	MIP	uc001uox.4	Q99797	OTTHUMG00000016573	ENST00000382172.3:c.234T>C	13.37:g.24460601A>G			Q5JV15|Q5T9Q9|Q96G65	Silent	SNP	pfam_Pept_M3A_M3B	p.H78	ENST00000382172.3	37	c.234	CCDS9303.1	13																																																																																			MIPEP	-	NULL	ENSG00000027001		0.443	MIPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIPEP	HGNC	protein_coding	OTTHUMT00000044169.1	35	0.00	0	A			24460601	24460601	-1	no_errors	ENST00000382172	ensembl	human	known	69_37n	silent	35	16.67	7	SNP	0.000	G
MOCS2	4338	genome.wustl.edu	37	5	52402960	52402960	+	Missense_Mutation	SNP	C	C	T	rs201182814		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:52402960C>T	ENST00000361377.4	-	3	273	c.232G>A	c.(232-234)Gaa>Aaa	p.E78K	MOCS2_ENST00000396954.3_Silent_p.T15T|MOCS2_ENST00000510818.2_Missense_Mutation_p.E78K|MOCS2_ENST00000584946.1_Missense_Mutation_p.E78K|MOCS2_ENST00000582677.1_Missense_Mutation_p.E78K|CTD-2366F13.1_ENST00000512301.1_RNA|MOCS2_ENST00000450852.3_Missense_Mutation_p.E78K|CTD-2366F13.1_ENST00000502171.2_RNA|CTD-2366F13.1_ENST00000499459.2_RNA|MOCS2_ENST00000527216.1_Missense_Mutation_p.E73K|MOCS2_ENST00000508922.1_Missense_Mutation_p.E78K					molybdenum cofactor synthesis 2											endometrium(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	5		Lung NSC(810;3.08e-05)|Breast(144;0.0848)				ACGGCAATTTCGTCTCCAGGC	0.443																																						dbGAP											0													97.0	86.0	90.0					5																	52402960		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117815	CCDS3958.1, CCDS47205.1	5q11	2008-02-05			ENSG00000164172	ENSG00000164172			7193	protein-coding gene	gene with protein product		603708				10053004, 9889283	Standard	NM_004531		Approved	MOCO1	uc003joz.3	O96007	OTTHUMG00000096981	ENST00000361377.4:c.232G>A	5.37:g.52402960C>T	ENSP00000355160:p.Glu78Lys			Missense_Mutation	SNP	pfam_ThiS/MoaD,superfamily_Mopterin_synth/thiamin_S_b,tigrfam_Mopterin_su_1	p.E78K	ENST00000361377.4	37	c.232	CCDS47205.1	5	.	.	.	.	.	.	.	.	.	.	C	15.85	2.954489	0.53293	.	.	ENSG00000164172	ENST00000361377;ENST00000510818;ENST00000450852;ENST00000508922	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	5.75	4.88	0.63580	Molybdopterin synthase/thiamin biosynthesis sulphur carrier, beta-grasp (1);Beta-grasp fold, ferredoxin-type (1);	.	.	.	.	T	0.71896	0.3394	.	.	.	0.26570	N	0.973584	D	0.63046	0.992	P	0.49887	0.625	T	0.67027	-0.5774	8	0.52906	T	0.07	-2.2682	16.9264	0.86177	0.0:0.8722:0.1278:0.0	.	78	O96033	MOC2A_HUMAN	K	78	ENSP00000355160:E78K;ENSP00000424267:E78K;ENSP00000411022:E78K;ENSP00000426274:E78K	ENSP00000355160:E78K	E	-	1	0	MOCS2	52438717	1.000000	0.71417	0.732000	0.30844	0.747000	0.42532	6.198000	0.72106	1.424000	0.47217	0.655000	0.94253	GAA	MOCS2	-	pfam_ThiS/MoaD,superfamily_Mopterin_synth/thiamin_S_b,tigrfam_Mopterin_su_1	ENSG00000164172		0.443	MOCS2-004	KNOWN	alternative_3_UTR|NMD_exception|basic|exp_conf|CCDS	protein_coding	MOCS2	HGNC	protein_coding	OTTHUMT00000367796.3	37	0.00	0	C	NM_183418		52402960	52402960	-1	no_errors	ENST00000361377	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	0.998	T
CDC20B	166979	genome.wustl.edu	37	5	54466481	54466481	+	Intron	SNP	T	T	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:54466481T>A	ENST00000381375.2	-	2	272				CDC20B_ENST00000322374.6_Intron|CDC20B_ENST00000334206.5_Intron|MIR449C_ENST00000516047.1_RNA|MIR449B_ENST00000384995.1_RNA|CDC20B_ENST00000331730.3_Intron|CDC20B_ENST00000296733.1_Intron|MIR449A_ENST00000362113.1_RNA			Q86Y33	CD20B_HUMAN	cell division cycle 20B											kidney(1)|large_intestine(5)|lung(7)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	19		Lung NSC(810;0.000744)|Breast(144;0.159)|Prostate(74;0.194)	LUSC - Lung squamous cell carcinoma(15;0.225)			ACAAGAAGAATTTATCCAGAA	0.473																																						dbGAP											0													102.0	87.0	92.0					5																	54466481		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			AB086378	CCDS3966.1, CCDS47207.1, CCDS54852.1	5q11.2	2013-01-17	2013-01-17		ENSG00000164287	ENSG00000164287		"""WD repeat domain containing"""	24222	protein-coding gene	gene with protein product			"""CDC20 cell division cycle 20 homolog B (S. cerevisiae)"", ""cell division cycle 20 homolog B (S. cerevisiae)"""				Standard	NM_152623		Approved	FLJ37927	uc003jpo.2	Q86Y33	OTTHUMG00000131185	ENST00000381375.2:c.126+1934A>T	5.37:g.54466481T>A			B7WNV8|B9EGL8|C9J6X8|C9JHE9|C9JKL5|Q86Y31|Q86Y32|Q8IUZ8|Q8N1S1|Q8NG56	RNA	SNP	-	NULL	ENST00000381375.2	37	NULL	CCDS54852.1	5																																																																																			MIR449B	-	-	ENSG00000207728		0.473	CDC20B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MIR449B	HGNC	protein_coding	OTTHUMT00000369715.1	41	0.00	0	T	NM_152623		54466481	54466481	-1	no_errors	ENST00000384995	ensembl	human	known	69_37n	rna	27	20.59	7	SNP	0.000	A
MOV10L1	54456	genome.wustl.edu	37	22	50584153	50584153	+	Silent	SNP	C	C	T	rs202216740		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr22:50584153C>T	ENST00000262794.5	+	19	2624	c.2541C>T	c.(2539-2541)gaC>gaT	p.D847D	MOV10L1_ENST00000545383.1_Silent_p.D847D|MOV10L1_ENST00000540615.1_Silent_p.D827D|MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000395852.1_5'Flank|MOV10L1_ENST00000395858.3_Silent_p.D847D	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	847					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		ATTGCAGAGACGGAGAAGACA	0.493													c|||	1	0.000199681	0.0	0.0	5008	,	,		18229	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													125.0	120.0	122.0					22																	50584153		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.2541C>T	22.37:g.50584153C>T			A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Silent	SNP	superfamily_NA-bd_OB-fold-like	p.D847	ENST00000262794.5	37	c.2541	CCDS14084.1	22																																																																																			MOV10L1	-	NULL	ENSG00000073146		0.493	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MOV10L1	HGNC	protein_coding	OTTHUMT00000075009.2	50	0.00	0	C	NM_018995		50584153	50584153	+1	no_errors	ENST00000262794	ensembl	human	known	69_37n	silent	26	16.13	5	SNP	0.077	T
MPP1	4354	genome.wustl.edu	37	X	154007615	154007615	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chrX:154007615T>C	ENST00000369534.3	-	12	1385	c.1238A>G	c.(1237-1239)cAg>cGg	p.Q413R	MPP1_ENST00000413259.3_Missense_Mutation_p.Q383R|MPP1_ENST00000393531.1_Missense_Mutation_p.Q393R	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	413	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.|Interaction with MPP5.				nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CTGCAGCTGCTGCAGGGCTTC	0.493																																						dbGAP											0													54.0	48.0	50.0					X																	154007615		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.1238A>G	X.37:g.154007615T>C	ENSP00000358547:p.Gln413Arg		B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.Q413R	ENST00000369534.3	37	c.1238	CCDS14762.1	X	.	.	.	.	.	.	.	.	.	.	T	14.59	2.580942	0.46006	.	.	ENSG00000130830	ENST00000369534;ENST00000413259;ENST00000393531	T;T;T	0.40756	1.02;1.02;1.02	5.86	5.86	0.93980	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.000000	0.85682	D	0.000000	T	0.32585	0.0834	L	0.28504	0.86	0.80722	D	1	B;B;B;B	0.18741	0.03;0.011;0.009;0.011	B;B;B;B	0.19946	0.022;0.027;0.016;0.027	T	0.09400	-1.0676	10	0.24483	T	0.36	.	13.9241	0.63952	0.0:0.0:0.0:1.0	.	396;383;393;413	B4E325;B4DZV5;G3XAI1;Q00013	.;.;.;EM55_HUMAN	R	413;383;393	ENSP00000358547:Q413R;ENSP00000400155:Q383R;ENSP00000377165:Q393R	ENSP00000358547:Q413R	Q	-	2	0	MPP1	153660809	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.619000	0.61218	1.969000	0.57287	0.486000	0.48141	CAG	MPP1	-	pfam_Guanylate_kin,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_Guanylate_kin	ENSG00000130830		0.493	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP1	HGNC	protein_coding	OTTHUMT00000061191.3	27	0.00	0	T	NM_002436		154007615	154007615	-1	no_errors	ENST00000369534	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	1.000	C
MTMR12	54545	genome.wustl.edu	37	5	32230235	32230235	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:32230235G>A	ENST00000382142.3	-	16	2063	c.1893C>T	c.(1891-1893)atC>atT	p.I631I	MTMR12_ENST00000510216.1_5'UTR|MTMR12_ENST00000264934.5_Silent_p.I521I|MTMR12_ENST00000280285.5_Silent_p.I577I	NM_001040446.1	NP_001035536.1	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	631	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					cytoplasm (GO:0005737)	phosphatase activity (GO:0016791)			breast(3)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						CGGGCCCCTCGATATGCGGTA	0.493																																						dbGAP											0													96.0	96.0	96.0					5																	32230235		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB051469	CCDS34138.1, CCDS75230.1	5p15.33	2011-06-09	2005-04-07	2005-04-07	ENSG00000150712	ENSG00000150712		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	18191	protein-coding gene	gene with protein product		606501	"""phosphatidylinositol-3-phosphate associated protein"""	PIP3AP		11504939, 12495846	Standard	XM_005248313		Approved	3-PAP, FLJ20476, KIAA1682, 3PAP	uc003jhq.3	Q9C0I1	OTTHUMG00000161978	ENST00000382142.3:c.1893C>T	5.37:g.32230235G>A			Q69YJ4|Q6PFW3|Q96QU2|Q9NX27	Silent	SNP	pfam_Myotubularin_assoc	p.I631	ENST00000382142.3	37	c.1893	CCDS34138.1	5																																																																																			MTMR12	-	pfam_Myotubularin_assoc	ENSG00000150712		0.493	MTMR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR12	HGNC	protein_coding	OTTHUMT00000366579.1	35	0.00	0	G	NM_019061		32230235	32230235	-1	no_errors	ENST00000382142	ensembl	human	known	69_37n	silent	33	10.81	4	SNP	0.033	A
MTUS2	23281	genome.wustl.edu	37	13	29600608	29600608	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr13:29600608C>T	ENST00000431530.3	+	1	1861	c.1803C>T	c.(1801-1803)aaC>aaT	p.N601N		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	591						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CTGACAAGAACACTTGCCCCA	0.537																																						dbGAP											0													57.0	61.0	60.0					13																	29600608		1961	4139	6100	-	-	-	SO:0001819	synonymous_variant	0			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.1803C>T	13.37:g.29600608C>T			A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Silent	SNP	NULL	p.N601	ENST00000431530.3	37	c.1803	CCDS45022.1	13																																																																																			MTUS2	-	NULL	ENSG00000132938		0.537	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044336.3	28	0.00	0	C	XM_166270		29600608	29600608	+1	no_errors	ENST00000431530	ensembl	human	known	69_37n	silent	20	25.93	7	SNP	0.014	T
MUC12	10071	genome.wustl.edu	37	7	100647332	100647333	+	Frame_Shift_Ins	INS	-	-	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:100647332_100647333insA	ENST00000379442.3	+	5	13917_13918	c.13917_13918insA	c.(13918-13920)caafs	p.Q4640fs	MUC12_ENST00000536621.1_Frame_Shift_Ins_p.Q4497fs			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4640	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CCCACAGCAGCCAAGACGCAAC	0.55																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	Exception_encountered	7.37:g.100647332_100647333insA	ENSP00000368755:p.Gln4640fs		A6ND38|F5GWV9|Q9UKN0	Frame_Shift_Ins	INS	pfam_SEA	p.Q4639fs	ENST00000379442.3	37	c.13917_13918		7																																																																																			MUC12	-	NULL	ENSG00000205277		0.550	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	42	0.00	0	-	XM_379904		100647332	100647333	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	frame_shift_ins	8	20.00	2	INS	0.426:0.340	A
MYCBP2	23077	genome.wustl.edu	37	13	77669522	77669522	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr13:77669522C>T	ENST00000544440.2	-	58	10073	c.10056G>A	c.(10054-10056)atG>atA	p.M3352I	MYCBP2_ENST00000407578.2_Missense_Mutation_p.M3390I|MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2_ENST00000482517.1_5'Flank|MYCBP2_ENST00000357337.6_Missense_Mutation_p.M3352I					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AGAGACAAGGCATTTTCACAG	0.398																																						dbGAP											0													91.0	86.0	88.0					13																	77669522		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.10056G>A	13.37:g.77669522C>T	ENSP00000444596:p.Met3352Ile			Missense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,prints_Reg_chr_condens,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens	p.M3390I	ENST00000544440.2	37	c.10170		13	.	.	.	.	.	.	.	.	.	.	C	14.88	2.666561	0.47677	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.27402	1.67;1.67;1.67	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.22513	0.0543	N	0.22421	0.69	0.80722	D	1	B	0.29627	0.252	B	0.21546	0.035	T	0.03818	-1.1001	10	0.22109	T	0.4	.	18.4033	0.90525	0.0:1.0:0.0:0.0	.	3352	O75592	MYCB2_HUMAN	I	3352;3390;3352	ENSP00000349892:M3352I;ENSP00000384288:M3390I;ENSP00000444596:M3352I	ENSP00000349892:M3352I	M	-	3	0	MYCBP2	76567523	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.727000	0.61993	2.789000	0.95967	0.655000	0.94253	ATG	MYCBP2	-	superfamily_ARM-type_fold	ENSG00000005810		0.398	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	69	0.00	0	C	NM_015057		77669522	77669522	-1	no_errors	ENST00000407578	ensembl	human	known	69_37n	missense	39	13.33	6	SNP	1.000	T
MYF6	4618	genome.wustl.edu	37	12	81102372	81102372	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:81102372C>T	ENST00000228641.3	+	2	811	c.589C>T	c.(589-591)Ctc>Ttc	p.L197F		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	197					muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26						TTCCAGGGGGCTCGTGATAAC	0.577																																						dbGAP											0													63.0	68.0	66.0					12																	81102372		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9019.1	12q21	2013-05-21				ENSG00000111046		"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991				8978788	Standard	NM_002469		Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.589C>T	12.37:g.81102372C>T	ENSP00000228641:p.Leu197Phe		B2R898|Q53X80|Q6FHI9	Missense_Mutation	SNP	pfam_Basic,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_Basic,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.L197F	ENST00000228641.3	37	c.589	CCDS9019.1	12	.	.	.	.	.	.	.	.	.	.	C	11.15	1.553244	0.27739	.	.	ENSG00000111046	ENST00000228641	D	0.96168	-3.93	5.23	5.23	0.72850	.	0.288450	0.35179	N	0.003400	D	0.91549	0.7331	L	0.51422	1.61	0.44956	D	0.997971	P	0.41265	0.744	B	0.33521	0.165	D	0.90394	0.4397	10	0.09843	T	0.71	-38.5293	15.8899	0.79291	0.0:1.0:0.0:0.0	.	197	P23409	MYF6_HUMAN	F	197	ENSP00000228641:L197F	ENSP00000228641:L197F	L	+	1	0	MYF6	79626503	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.794000	0.62482	2.583000	0.87209	0.563000	0.77884	CTC	MYF6	-	NULL	ENSG00000111046		0.577	MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYF6	HGNC	protein_coding	OTTHUMT00000407756.1	28	0.00	0	C	NM_002469		81102372	81102372	+1	no_errors	ENST00000228641	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	1.000	T
MYH3	4621	genome.wustl.edu	37	17	10549037	10549037	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:10549037C>T	ENST00000583535.1	-	12	1215	c.1128G>A	c.(1126-1128)ccG>ccA	p.P376P	MYH3_ENST00000226209.7_Silent_p.P376P	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	376	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						CTGTGCCATCCGGCTCGGCCT	0.532																																						dbGAP											0													110.0	96.0	101.0					17																	10549037		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.1128G>A	17.37:g.10549037C>T			Q15492	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.P376	ENST00000583535.1	37	c.1128	CCDS11157.1	17																																																																																			MYH3	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000109063		0.532	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	HGNC	protein_coding	OTTHUMT00000252734.2	83	0.00	0	C	NM_002470		10549037	10549037	-1	no_errors	ENST00000226209	ensembl	human	known	69_37n	silent	28	22.22	8	SNP	0.001	T
MYO9A	4649	genome.wustl.edu	37	15	72119094	72119094	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr15:72119094T>C	ENST00000356056.5	-	42	7946	c.7474A>G	c.(7474-7476)Acc>Gcc	p.T2492A	MYO9A_ENST00000424560.1_Missense_Mutation_p.T2563A|MYO9A_ENST00000444904.1_Missense_Mutation_p.T2473A|MYO9A_ENST00000564571.1_3'UTR	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	2492	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GGGTTGAAGGTTCCTCTGCTG	0.498																																						dbGAP											0													159.0	161.0	160.0					15																	72119094		2199	4297	6496	-	-	-	SO:0001583	missense	0			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.7474A>G	15.37:g.72119094T>C	ENSP00000348349:p.Thr2492Ala		B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.T2563A	ENST00000356056.5	37	c.7687	CCDS10239.1	15	.	.	.	.	.	.	.	.	.	.	T	15.20	2.763795	0.49574	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	D;D;D	0.86769	-2.15;-2.17;-2.15	5.31	5.31	0.75309	.	.	.	.	.	D	0.89491	0.6730	L	0.34521	1.04	0.58432	D	0.999994	D;D	0.71674	0.997;0.998	D;D	0.80764	0.985;0.994	D	0.89068	0.3467	9	0.38643	T	0.18	.	15.2488	0.73526	0.0:0.0:0.0:1.0	.	2492;2256	B2RTY4;B2RTY4-5	MYO9A_HUMAN;.	A	2492;2563;2473	ENSP00000348349:T2492A;ENSP00000399162:T2563A;ENSP00000398250:T2473A	ENSP00000348349:T2492A	T	-	1	0	MYO9A	69906148	1.000000	0.71417	1.000000	0.80357	0.154000	0.21943	7.567000	0.82357	2.005000	0.58758	0.460000	0.39030	ACC	MYO9A	-	NULL	ENSG00000066933		0.498	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO9A	HGNC	protein_coding	OTTHUMT00000257308.1	136	0.00	0	T	NM_006901		72119094	72119094	-1	no_errors	ENST00000424560	ensembl	human	known	69_37n	missense	76	17.39	16	SNP	1.000	C
NCOA2	10499	genome.wustl.edu	37	8	71126143	71126143	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr8:71126143T>A	ENST00000452400.2	-	4	435	c.254A>T	c.(253-255)gAa>gTa	p.E85V		NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	85					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			CTTACCTTGTTCTTTGATCTG	0.328			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																	dbGAP		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	0													85.0	73.0	77.0					8																	71126143		1802	4075	5877	-	-	-	SO:0001583	missense	0			X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.254A>T	8.37:g.71126143T>A	ENSP00000399968:p.Glu85Val		Q14CD2	Missense_Mutation	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_Nuc_rcpt_coact,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_HLH_DNA-bd	p.E85V	ENST00000452400.2	37	c.254	CCDS47872.1	8	.	.	.	.	.	.	.	.	.	.	T	20.9	4.060502	0.76074	.	.	ENSG00000140396	ENST00000452400	T	0.01918	4.56	5.53	5.53	0.82687	Helix-loop-helix DNA-binding (3);	0.000000	0.85682	D	0.000000	T	0.12433	0.0302	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00533	-1.1685	10	0.49607	T	0.09	.	15.6678	0.77247	0.0:0.0:0.0:1.0	.	85	Q15596	NCOA2_HUMAN	V	85	ENSP00000399968:E85V	ENSP00000399968:E85V	E	-	2	0	NCOA2	71288697	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.289000	0.72696	2.108000	0.64289	0.533000	0.62120	GAA	NCOA2	-	superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pirsf_Nuclear_rcpt_coactivator	ENSG00000140396		0.328	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA2	HGNC	protein_coding	OTTHUMT00000379696.1	83	0.00	0	T			71126143	71126143	-1	no_errors	ENST00000452400	ensembl	human	known	69_37n	missense	89	16.04	17	SNP	1.000	A
NCOR1	9611	genome.wustl.edu	37	17	15995175	15995175	+	Splice_Site	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:15995175A>G	ENST00000268712.3	-	22	3274		c.e22+1		NCOR1_ENST00000395851.1_Splice_Site|NCOR1_ENST00000395848.1_Silent_p.G913G	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1						CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		CTATCTACCTACCTTCCCACT	0.443																																						dbGAP											0													152.0	142.0	146.0					17																	15995175		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.3016+1T>C	17.37:g.15995175A>G			B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Splice_Site	SNP	-	e21+2	ENST00000268712.3	37	c.3016+2	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	A	18.51	3.640380	0.67244	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000436068	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2232	0.65841	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NCOR1	15935900	1.000000	0.71417	0.994000	0.49952	0.946000	0.59487	7.109000	0.77062	2.011000	0.59026	0.528000	0.53228	.	NCOR1	-	-	ENSG00000141027		0.443	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	70	0	0	A	NM_006311	Intron	15995175	15995175	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	splice_site	46	13.21	7	SNP	1.000	G
NCOR1	9611	genome.wustl.edu	37	17	15995175	15995175	+	Splice_Site	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:15995175A>G	ENST00000268712.3	-	22	3274		c.e22+1		NCOR1_ENST00000395851.1_Splice_Site|NCOR1_ENST00000395848.1_Silent_p.G913G	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1						CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		CTATCTACCTACCTTCCCACT	0.443																																						dbGAP											0													152.0	142.0	146.0					17																	15995175		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.3016+1T>C	17.37:g.15995175A>G			B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Splice_Site	SNP	-	e21+2	ENST00000268712.3	37	c.3016+2	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	A	18.51	3.640380	0.67244	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000436068	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2232	0.65841	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NCOR1	15935900	1.000000	0.71417	0.994000	0.49952	0.946000	0.59487	7.109000	0.77062	2.011000	0.59026	0.528000	0.53228	.	NCOR1	-	-	ENSG00000141027		0.443	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	70	0.00	0	A	NM_006311	Intron	15995175	15995175	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	splice_site	46	13.21	7	SNP	1.000	G
NEBL	10529	genome.wustl.edu	37	10	21097452	21097452	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr10:21097452C>T	ENST00000377122.4	-	26	3144	c.2748G>A	c.(2746-2748)ccG>ccA	p.P916P	NEBL_ENST00000377159.4_Intron|NEBL_ENST00000417816.2_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	916	Linker.				cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						CTTCATCAGACGGTCTTGTTA	0.413																																						dbGAP											0													106.0	99.0	102.0					10																	21097452		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.2748G>A	10.37:g.21097452C>T			B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Silent	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_SH3_domain	p.P916	ENST00000377122.4	37	c.2748	CCDS7134.1	10																																																																																			NEBL	-	NULL	ENSG00000078114		0.413	NEBL-004	KNOWN	basic|CCDS	protein_coding	NEBL	HGNC	protein_coding	OTTHUMT00000047113.1	39	0.00	0	C	NM_006393		21097452	21097452	-1	no_errors	ENST00000377122	ensembl	human	known	69_37n	silent	27	18.18	6	SNP	0.649	T
NEK9	91754	genome.wustl.edu	37	14	75572697	75572697	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr14:75572697G>A	ENST00000238616.5	-	13	1689	c.1531C>T	c.(1531-1533)Cga>Tga	p.R511*		NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	511					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		AAACCCAGTCGTCCTGAAACA	0.393																																						dbGAP											0													123.0	121.0	122.0					14																	75572697		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.1531C>T	14.37:g.75572697G>A	ENSP00000238616:p.Arg511*		Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Reg_chr_condens,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Reg_chr_condens,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R511*	ENST00000238616.5	37	c.1531	CCDS9839.1	14	.	.	.	.	.	.	.	.	.	.	G	38	7.195465	0.98129	.	.	ENSG00000119638	ENST00000238616	.	.	.	5.08	4.18	0.49190	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.5042	0.55972	0.0:0.0:0.8332:0.1668	.	.	.	.	X	511	.	ENSP00000238616:R511X	R	-	1	2	NEK9	74642450	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.543000	0.60684	1.117000	0.41842	0.591000	0.81541	CGA	NEK9	-	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens	ENSG00000119638		0.393	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK9	HGNC	protein_coding	OTTHUMT00000415021.1	96	0.00	0	G	NM_033116		75572697	75572697	-1	no_errors	ENST00000238616	ensembl	human	known	69_37n	nonsense	50	29.58	21	SNP	1.000	A
NFRKB	4798	genome.wustl.edu	37	11	129739508	129739508	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr11:129739508C>T	ENST00000446488.3	-	23	3515	c.3412G>A	c.(3412-3414)Gtg>Atg	p.V1138M	NFRKB_ENST00000304521.5_Missense_Mutation_p.V1138M|NFRKB_ENST00000524746.1_Missense_Mutation_p.V1138M|NFRKB_ENST00000524794.1_Missense_Mutation_p.V1163M	NM_001143835.1	NP_001137307.1	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	1138					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protease binding (GO:0002020)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(13)|ovary(4)|skin(3)|urinary_tract(1)	32	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		GTCTTGGACACAGCAGCATTC	0.612																																						dbGAP											0													73.0	71.0	72.0					11																	129739508		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS8483.1, CCDS44770.1	11q24-q25	2011-07-06			ENSG00000170322	ENSG00000170322		"""INO80 complex subunits"""	7802	protein-coding gene	gene with protein product	"""nuclear factor related to kappa B binding protein"", ""DNA-binding protein R kappa B"", ""INO80 complex subunit G"""	164013				1427843	Standard	NM_006165		Approved	DKFZp547B2013, INO80G	uc001qfg.3	Q6P4R8	OTTHUMG00000165761	ENST00000446488.3:c.3412G>A	11.37:g.129739508C>T	ENSP00000400476:p.Val1138Met		Q12869|Q15312|Q9H048	Missense_Mutation	SNP	NULL	p.V1163M	ENST00000446488.3	37	c.3487	CCDS44770.1	11	.	.	.	.	.	.	.	.	.	.	C	18.71	3.681905	0.68042	.	.	ENSG00000170322	ENST00000304521;ENST00000446488;ENST00000524794;ENST00000524746	.	.	.	5.31	3.44	0.39384	.	0.333232	0.31415	N	0.007696	T	0.38612	0.1047	N	0.24115	0.695	0.35772	D	0.820991	B;B;B	0.26744	0.158;0.003;0.057	B;B;B	0.26864	0.074;0.007;0.022	T	0.44787	-0.9305	9	0.56958	D	0.05	-3.473	12.0214	0.53346	0.0:0.8783:0.0:0.1217	.	1138;1137;1163	Q6P4R8;Q6P4R8-3;Q6P4R8-2	NFRKB_HUMAN;.;.	M	1138;1138;1163;1138	.	ENSP00000303800:V1138M	V	-	1	0	NFRKB	129244718	0.992000	0.36948	0.516000	0.27786	0.989000	0.77384	4.699000	0.61796	0.619000	0.30197	0.655000	0.94253	GTG	NFRKB	-	NULL	ENSG00000170322		0.612	NFRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFRKB	HGNC	protein_coding	OTTHUMT00000386063.2	21	0.00	0	C	NM_006165		129739508	129739508	-1	no_errors	ENST00000524794	ensembl	human	known	69_37n	missense	15	25.00	5	SNP	0.985	T
NFX1	4799	genome.wustl.edu	37	9	33294960	33294960	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr9:33294960T>C	ENST00000379540.3	+	2	630	c.568T>C	c.(568-570)Tgt>Cgt	p.C190R	NFX1_ENST00000379521.4_Missense_Mutation_p.C190R|NFX1_ENST00000318524.6_Missense_Mutation_p.C190R	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	190					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		GAAACTCAAATGTGAATGGAG	0.493																																						dbGAP											0													94.0	96.0	95.0					9																	33294960		2203	4300	6503	-	-	-	SO:0001583	missense	0			U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.568T>C	9.37:g.33294960T>C	ENSP00000368856:p.Cys190Arg		A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Missense_Mutation	SNP	pfam_Znf_NFX1,pfam_R3H_ss-bd,smart_Znf_RING,smart_Znf_NFX1,smart_R3H_ss-bd,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_R3H_ss-bd	p.C190R	ENST00000379540.3	37	c.568	CCDS6538.1	9	.	.	.	.	.	.	.	.	.	.	T	6.397	0.441324	0.12164	.	.	ENSG00000086102	ENST00000379540;ENST00000379521;ENST00000536210;ENST00000318524	T;T;T	0.20881	2.37;2.04;2.04	5.48	-5.94	0.02247	.	0.797101	0.12220	N	0.488477	T	0.06508	0.0167	N	0.08118	0	0.29069	N	0.883394	B;B;B;B;B	0.23806	0.027;0.023;0.055;0.039;0.091	B;B;B;B;B	0.20955	0.019;0.008;0.014;0.032;0.032	T	0.27536	-1.0071	10	0.25106	T	0.35	.	2.4387	0.04489	0.4625:0.0693:0.2123:0.2559	.	190;74;190;190;190	F5GXD0;A0JLR2;Q12986;Q12986-2;Q12986-3	.;.;NFX1_HUMAN;.;.	R	190	ENSP00000368856:C190R;ENSP00000368836:C190R;ENSP00000317695:C190R	ENSP00000317695:C190R	C	+	1	0	NFX1	33284960	0.011000	0.17503	0.903000	0.35520	0.724000	0.41520	-0.089000	0.11180	-1.120000	0.02953	-0.457000	0.05445	TGT	NFX1	-	NULL	ENSG00000086102		0.493	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFX1	HGNC	protein_coding	OTTHUMT00000052069.1	41	0.00	0	T			33294960	33294960	+1	no_errors	ENST00000379540	ensembl	human	known	69_37n	missense	23	23.33	7	SNP	0.604	C
NIPBL	25836	genome.wustl.edu	37	5	36985782	36985782	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:36985782C>T	ENST00000282516.8	+	10	2999	c.2500C>T	c.(2500-2502)Cga>Tga	p.R834*	NIPBL_ENST00000504430.1_3'UTR|NIPBL_ENST00000448238.2_Nonsense_Mutation_p.R834*	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	834					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.R834*(2)		autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			AGAGCGACATCGAGGGGATCA	0.408																																						dbGAP											2	Substitution - Nonsense(2)	large_intestine(2)	GRCh37	CM062926	NIPBL	M							67.0	65.0	66.0					5																	36985782		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.2500C>T	5.37:g.36985782C>T	ENSP00000282516:p.Arg834*		Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.R834*	ENST00000282516.8	37	c.2500	CCDS3920.1	5	.	.	.	.	.	.	.	.	.	.	C	42	9.361687	0.99148	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	.	.	.	5.99	4.1	0.47936	.	0.062210	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-7.278	12.9252	0.58257	0.5024:0.4976:0.0:0.0	.	.	.	.	X	834	.	ENSP00000282516:R834X	R	+	1	2	NIPBL	37021539	1.000000	0.71417	0.997000	0.53966	0.936000	0.57629	3.501000	0.53325	1.515000	0.48885	0.655000	0.94253	CGA	NIPBL	-	NULL	ENSG00000164190		0.408	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1	33	0.00	0	C	NM_015384		36985782	36985782	+1	no_errors	ENST00000282516	ensembl	human	known	69_37n	nonsense	39	13.04	6	SNP	0.999	T
NKAPL	222698	genome.wustl.edu	37	6	28227370	28227370	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:28227370G>A	ENST00000343684.3	+	1	273	c.221G>A	c.(220-222)cGg>cAg	p.R74Q	ZKSCAN4_ENST00000423974.2_5'Flank	NM_001007531.1	NP_001007532.1	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	74										breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31						TCGCGAGGGCGGCTCCCAAGA	0.612																																						dbGAP											0													52.0	55.0	54.0					6																	28227370		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC038240	CCDS34353.1	6p21.33	2008-02-05	2007-08-16	2007-08-16	ENSG00000189134	ENSG00000189134			21584	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 194"""	C6orf194			Standard	NM_001007531		Approved	bA424I5.1	uc003nkt.4	Q5M9Q1	OTTHUMG00000014517	ENST00000343684.3:c.221G>A	6.37:g.28227370G>A	ENSP00000345716:p.Arg74Gln		Q3MIV1|Q9H4Q7	Missense_Mutation	SNP	pfam_DUF926	p.R74Q	ENST00000343684.3	37	c.221	CCDS34353.1	6	.	.	.	.	.	.	.	.	.	.	G	11.84	1.759751	0.31137	.	.	ENSG00000189134	ENST00000343684	T	0.14640	2.49	4.77	-4.52	0.03472	.	1.558050	0.04148	N	0.320887	T	0.04227	0.0117	M	0.70275	2.135	0.09310	N	1	B	0.12630	0.006	B	0.04013	0.001	T	0.35101	-0.9802	10	0.49607	T	0.09	0.0535	1.5457	0.02564	0.2029:0.3045:0.2979:0.1948	.	74	Q5M9Q1	NKAPL_HUMAN	Q	74	ENSP00000345716:R74Q	ENSP00000345716:R74Q	R	+	2	0	NKAPL	28335349	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.375000	0.07475	-1.667000	0.01473	-2.943000	0.00086	CGG	NKAPL	-	NULL	ENSG00000189134		0.612	NKAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAPL	HGNC	protein_coding	OTTHUMT00000040185.1	19	0.00	0	G			28227370	28227370	+1	no_errors	ENST00000343684	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	0.000	A
NOS1	4842	genome.wustl.edu	37	12	117680511	117680511	+	Splice_Site	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:117680511C>T	ENST00000338101.4	-	20	3069		c.e20-1		NOS1_ENST00000317775.6_Splice_Site|NOS1_ENST00000344089.3_Splice_Site			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)						cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		TTGGATAGACCTGTGGGGAGA	0.507																																					Esophageal Squamous(162;1748 2599 51982 52956)	dbGAP											0													105.0	103.0	104.0					12																	117680511		1892	4108	6000	-	-	-	SO:0001630	splice_region_variant	0				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.3065-1G>A	12.37:g.117680511C>T				Splice_Site	SNP	-	e19-1	ENST00000338101.4	37	c.2963-1	CCDS55890.1	12	.	.	.	.	.	.	.	.	.	.	C	23.2	4.386601	0.82902	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	.	.	.	4.36	4.36	0.52297	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0693	0.86569	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOS1	116164894	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	7.036000	0.76524	2.230000	0.72887	0.460000	0.39030	.	NOS1	-	-	ENSG00000089250		0.507	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	HGNC	protein_coding	OTTHUMT00000268053.1	68	0.00	0	C		Intron	117680511	117680511	-1	no_errors	ENST00000317775	ensembl	human	known	69_37n	splice_site	46	16.36	9	SNP	1.000	T
NPHP4	261734	genome.wustl.edu	37	1	5925191	5925191	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:5925191C>T	ENST00000378156.4	-	27	4052	c.3787G>A	c.(3787-3789)Gct>Act	p.A1263T	NPHP4_ENST00000478423.2_5'UTR|MIR4689_ENST00000582517.1_RNA	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	1263					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		GAGGTGAAAGCTCTCACTTTC	0.637																																						dbGAP											0													45.0	54.0	51.0					1																	5925191		2045	4192	6237	-	-	-	SO:0001583	missense	0			AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.3787G>A	1.37:g.5925191C>T	ENSP00000367398:p.Ala1263Thr		Q8IWC0	Missense_Mutation	SNP	NULL	p.A1263T	ENST00000378156.4	37	c.3787	CCDS44052.1	1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.784579	0.90282	.	.	ENSG00000131697	ENST00000378156	T	0.74002	-0.8	5.06	5.06	0.68205	.	0.172475	0.40469	N	0.001083	T	0.80607	0.4655	M	0.68952	2.095	0.38667	D	0.95221	D	0.56968	0.978	P	0.56514	0.8	T	0.82774	-0.0291	10	0.48119	T	0.1	.	12.5209	0.56058	0.1666:0.8334:0.0:0.0	.	1263	O75161	NPHP4_HUMAN	T	1263	ENSP00000367398:A1263T	ENSP00000367398:A1263T	A	-	1	0	NPHP4	5847778	1.000000	0.71417	0.997000	0.53966	0.974000	0.67602	5.539000	0.67199	2.347000	0.79759	0.655000	0.94253	GCT	NPHP4	-	NULL	ENSG00000131697		0.637	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	NPHP4	HGNC	protein_coding	OTTHUMT00000001715.2	18	0.00	0	C			5925191	5925191	-1	no_errors	ENST00000378156	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	0.994	T
NRG3	10718	genome.wustl.edu	37	10	83637750	83637750	+	Intron	SNP	G	G	A	rs572733630		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr10:83637750G>A	ENST00000404547.1	+	1	823				NRG3_ENST00000556918.1_Missense_Mutation_p.V12I|NRG3_ENST00000372141.2_Intron|NRG3_ENST00000404576.2_Missense_Mutation_p.V12I|NRG3_ENST00000372142.2_Missense_Mutation_p.V12I			P56975	NRG3_HUMAN	neuregulin 3						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		CCTTGTATGCGTTGGGAGAGG	0.433													G|||	1	0.000199681	0.0	0.0	5008	,	,		18728	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													217.0	224.0	222.0					10																	83637750		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.823+1831G>A	10.37:g.83637750G>A			A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	pfam_Neuregulin_1_C,pfscan_EG-like_dom	p.V12I	ENST00000404547.1	37	c.34	CCDS31233.1	10	.	.	.	.	.	.	.	.	.	.	G	6.753	0.507798	0.12883	.	.	ENSG00000185737	ENST00000372142;ENST00000404576;ENST00000556918	T;T;T	0.48522	1.45;0.81;1.37	4.03	-0.0239	0.13941	.	.	.	.	.	T	0.26304	0.0642	N	0.14661	0.345	0.18873	N	0.999985	B	0.10296	0.003	B	0.08055	0.003	T	0.19451	-1.0305	9	0.66056	D	0.02	.	3.9778	0.09481	0.31:0.1768:0.5132:0.0	.	12	P56975-3	.	I	12	ENSP00000361215:V12I;ENSP00000385804:V12I;ENSP00000451376:V12I	ENSP00000385804:V12I	V	+	1	0	NRG3	83627730	0.071000	0.21146	0.095000	0.20976	0.004000	0.04260	0.488000	0.22371	-0.102000	0.12197	-0.244000	0.11960	GTT	NRG3	-	NULL	ENSG00000185737		0.433	NRG3-005	KNOWN	basic|CCDS	protein_coding	NRG3	HGNC	protein_coding	OTTHUMT00000412262.1	122	0.00	0	G	XM_166086		83637750	83637750	+1	no_errors	ENST00000372142	ensembl	human	known	69_37n	missense	63	20.25	16	SNP	0.035	A
NXT2	55916	genome.wustl.edu	37	X	108780219	108780219	+	5'UTR	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chrX:108780219C>T	ENST00000372106.1	+	0	115				NXT2_ENST00000372107.1_5'UTR|NXT2_ENST00000218004.1_Missense_Mutation_p.T50I|NXT2_ENST00000372103.1_5'Flank	NM_001242617.1	NP_001229546.1	Q9NPJ8	NXT2_HUMAN	nuclear transport factor 2-like export factor 2						mRNA transport (GO:0051028)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|large_intestine(1)|lung(1)|ovary(1)	6						CCAGAACACACTGCTACAAGG	0.627																																						dbGAP											0													71.0	49.0	56.0					X																	108780219		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF246127	CCDS14546.1, CCDS56605.1, CCDS56606.1	Xq22.3	2008-02-05			ENSG00000101888	ENSG00000101888			18151	protein-coding gene	gene with protein product		300320				11073998	Standard	NM_018698		Approved	P15-2	uc004eoe.2	Q9NPJ8	OTTHUMG00000022185	ENST00000372106.1:c.-17C>T	X.37:g.108780219C>T			D3DUY1|Q0VAN8|Q5JYV5|Q5JYV6|Q5JYV7|Q9H8U0|Q9NQ64|Q9NRL7|Q9Y3M4|Q9Y3M5	Missense_Mutation	SNP	pfam_NTF2,pfscan_Nuclear_transport_factor_2_euk	p.T50I	ENST00000372106.1	37	c.149	CCDS56605.1	X	.	.	.	.	.	.	.	.	.	.	C	8.799	0.932487	0.18131	.	.	ENSG00000101888	ENST00000218004	.	.	.	4.43	-3.54	0.04653	.	2.279210	0.01714	N	0.027872	T	0.26846	0.0657	.	.	.	0.09310	N	0.999994	B	0.02656	0.0	B	0.01281	0.0	T	0.08534	-1.0717	8	0.46703	T	0.11	.	1.9015	0.03268	0.1293:0.2335:0.3773:0.2599	.	50	Q9NPJ8-3	.	I	50	.	ENSP00000218004:T50I	T	+	2	0	NXT2	108666875	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.303000	0.01135	-1.035000	0.03291	-0.190000	0.12839	ACT	NXT2	-	NULL	ENSG00000101888		0.627	NXT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NXT2	HGNC	protein_coding	OTTHUMT00000057886.1	46	0.00	0	C	NM_018698		108780219	108780219	+1	no_errors	ENST00000218004	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	0.000	T
OCM2	4951	genome.wustl.edu	37	7	97616394	97616394	+	Missense_Mutation	SNP	G	G	A	rs200557951	byFrequency	TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:97616394G>A	ENST00000257627.4	-	3	360	c.269C>T	c.(268-270)gCg>gTg	p.A90V	OCM2_ENST00000473987.2_5'UTR	NM_006188.3	NP_006179.2	P0CE71	OCM2_HUMAN	oncomodulin 2	90	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			lung(4)	4						ATCATTATCCGCCGCAGCCAT	0.498													.|||	2	0.000399361	0.0	0.0	5008	,	,		21012	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													83.0	74.0	77.0					7																	97616394		2202	4280	6482	-	-	-	SO:0001583	missense	0			BC156841	CCDS5653.1	7q21.2	2014-04-01			ENSG00000135175	ENSG00000135175		"""EF-hand domain containing"""	34396	protein-coding gene	gene with protein product							Standard	NM_006188		Approved		uc003upc.3	P0CE71	OTTHUMG00000154162	ENST00000257627.4:c.269C>T	7.37:g.97616394G>A	ENSP00000257627:p.Ala90Val		P32930|Q6ISI5|Q75MW0	Missense_Mutation	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Parvalbumin	p.A90V	ENST00000257627.4	37	c.269	CCDS5653.1	7	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	g	10.21	1.288358	0.23478	.	.	ENSG00000135175	ENST00000257627	T	0.70986	-0.53	3.8	3.8	0.43715	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.47303	0.1438	N	0.20401	0.57	0.23023	N	0.998417	D	0.55800	0.973	B	0.35039	0.194	T	0.50600	-0.8809	10	0.49607	T	0.09	-0.0783	8.8746	0.35337	0.107:0.0:0.893:0.0	.	90	P0CE71	OCM2_HUMAN	V	90	ENSP00000257627:A90V	ENSP00000257627:A90V	A	-	2	0	OCM2	97454330	0.986000	0.35501	0.161000	0.22692	0.303000	0.27691	2.578000	0.46051	2.154000	0.67381	0.465000	0.42564	GCG	OCM2	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Parvalbumin	ENSG00000135175		0.498	OCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCM2	HGNC	protein_coding	OTTHUMT00000334188.1	129	0.00	0	G	NM_006188		97616394	97616394	-1	no_errors	ENST00000257627	ensembl	human	known	69_37n	missense	54	16.92	11	SNP	0.234	A
ODF1	4956	genome.wustl.edu	37	8	103572819	103572819	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr8:103572819C>T	ENST00000285402.3	+	2	616	c.460C>T	c.(460-462)Cgg>Tgg	p.R154W	ODF1_ENST00000518835.1_Intron	NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	154					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			GTCGGCTGAGCGGGAGAACAG	0.473																																						dbGAP											0													166.0	142.0	150.0					8																	103572819		2203	4300	6503	-	-	-	SO:0001583	missense	0			M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.460C>T	8.37:g.103572819C>T	ENSP00000285402:p.Arg154Trp		Q3SX72	Missense_Mutation	SNP	pfam_Hsp20,superfamily_HSP20-like_chaperone,pfscan_Hsp20	p.R154W	ENST00000285402.3	37	c.460	CCDS6293.1	8	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752558	0.69533	.	.	ENSG00000155087	ENST00000285402	D	0.93019	-3.15	5.27	3.38	0.38709	Heat shock protein Hsp20 (2);	0.000000	0.49916	D	0.000124	D	0.93559	0.7944	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.92608	0.6097	10	0.72032	D	0.01	-16.4235	10.4145	0.44314	0.3694:0.6306:0.0:0.0	.	154	Q14990	ODFP1_HUMAN	W	154	ENSP00000285402:R154W	ENSP00000285402:R154W	R	+	1	2	ODF1	103641995	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.703000	0.37846	0.542000	0.28846	0.555000	0.69702	CGG	ODF1	-	pfam_Hsp20,superfamily_HSP20-like_chaperone,pfscan_Hsp20	ENSG00000155087		0.473	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODF1	HGNC	protein_coding	OTTHUMT00000379884.1	76	0.00	0	C			103572819	103572819	+1	no_errors	ENST00000285402	ensembl	human	known	69_37n	missense	36	16.28	7	SNP	1.000	T
TENM3	55714	genome.wustl.edu	37	4	183676017	183676017	+	Silent	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr4:183676017A>G	ENST00000511685.1	+	22	4620	c.4497A>G	c.(4495-4497)tcA>tcG	p.S1499S	TENM3_ENST00000502950.1_3'UTR|TENM3_ENST00000406950.2_Silent_p.S1499S			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1499					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GGGCTGTGTCAAAGAATAAGC	0.443																																						dbGAP											0													86.0	84.0	85.0					4																	183676017		1905	4114	6019	-	-	-	SO:0001819	synonymous_variant	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.4497A>G	4.37:g.183676017A>G			Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c_dom,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.S1499	ENST00000511685.1	37	c.4497	CCDS47165.1	4																																																																																			ODZ3	-	NULL	ENSG00000218336		0.443	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ3	HGNC	protein_coding	OTTHUMT00000361734.1	46	0.00	0	A			183676017	183676017	+1	no_errors	ENST00000406950	ensembl	human	known	69_37n	silent	32	13.51	5	SNP	0.007	G
OPHN1	4983	genome.wustl.edu	37	X	67273542	67273542	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chrX:67273542G>T	ENST00000355520.5	-	22	2910	c.2269C>A	c.(2269-2271)Cca>Aca	p.P757T	OPHN1_ENST00000540071.1_Missense_Mutation_p.P649T	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	757	Pro-rich.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						TTTGGTTCTGGCTTTTGGGGA	0.547																																						dbGAP											0													101.0	75.0	84.0					X																	67273542		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.2269C>A	X.37:g.67273542G>T	ENSP00000347710:p.Pro757Thr		B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.P757T	ENST00000355520.5	37	c.2269	CCDS14388.1	X	.	.	.	.	.	.	.	.	.	.	G	9.850	1.193473	0.22037	.	.	ENSG00000079482	ENST00000355520;ENST00000540071	T;T	0.47528	0.84;0.84	4.82	1.05	0.20165	.	0.446155	0.23863	N	0.043826	T	0.41096	0.1144	N	0.14661	0.345	0.09310	N	1	D;B	0.71674	0.998;0.002	D;B	0.75484	0.986;0.003	T	0.20107	-1.0285	10	0.37606	T	0.19	.	2.2794	0.04111	0.182:0.1477:0.5154:0.1549	.	649;757	F5H2E3;O60890	.;OPHN1_HUMAN	T	757;649	ENSP00000347710:P757T;ENSP00000438617:P649T	ENSP00000347710:P757T	P	-	1	0	OPHN1	67190267	1.000000	0.71417	0.308000	0.25141	0.890000	0.51754	2.579000	0.46059	-0.114000	0.11936	0.600000	0.82982	CCA	OPHN1	-	NULL	ENSG00000079482		0.547	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPHN1	HGNC	protein_coding	OTTHUMT00000057011.1	98	0.00	0	G	NM_002547		67273542	67273542	-1	no_errors	ENST00000355520	ensembl	human	known	69_37n	missense	38	22.45	11	SNP	0.974	T
OR10AG1	282770	genome.wustl.edu	37	11	55735641	55735641	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr11:55735641C>T	ENST00000312345.2	-	1	349	c.299G>A	c.(298-300)gGc>gAc	p.G100D		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					ACACTCCGTGCCTCCAAGCAT	0.418																																						dbGAP											0													87.0	88.0	87.0					11																	55735641		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.299G>A	11.37:g.55735641C>T	ENSP00000311477:p.Gly100Asp		B2RNH4|Q6IEU3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G100D	ENST00000312345.2	37	c.299	CCDS31514.1	11	.	.	.	.	.	.	.	.	.	.	C	6.371	0.436538	0.12104	.	.	ENSG00000174970	ENST00000312345	T	0.01347	4.99	5.47	1.17	0.20885	GPCR, rhodopsin-like superfamily (1);	0.817470	0.10809	N	0.631815	T	0.02193	0.0068	L	0.52573	1.65	0.09310	N	1	B	0.17268	0.021	B	0.17979	0.02	T	0.38650	-0.9651	10	0.72032	D	0.01	.	10.9228	0.47174	0.1339:0.4759:0.3902:0.0	.	100	Q8NH19	O10AG_HUMAN	D	100	ENSP00000311477:G100D	ENSP00000311477:G100D	G	-	2	0	OR10AG1	55492217	0.000000	0.05858	0.002000	0.10522	0.019000	0.09904	-1.429000	0.02437	0.288000	0.22398	0.477000	0.44152	GGC	OR10AG1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000174970		0.418	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10AG1	HGNC	protein_coding	OTTHUMT00000391531.1	43	0.00	0	C	NM_001005491		55735641	55735641	-1	no_errors	ENST00000312345	ensembl	human	known	69_37n	missense	40	25.93	14	SNP	0.000	T
OR2T11	127077	genome.wustl.edu	37	1	248790131	248790131	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:248790131A>G	ENST00000330803.2	-	1	360	c.299T>C	c.(298-300)cTc>cCc	p.L100P		NM_001001964.1	NP_001001964.1	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T, member 11 (gene/pseudogene)	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(5)|lung(20)|skin(2)	28	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGTCAGGTAGAGGAAGATCTG	0.498																																						dbGAP											0													68.0	65.0	66.0					1																	248790131		2052	4234	6286	-	-	-	SO:0001583	missense	0			BK004476	CCDS31122.1	1q44	2013-10-10	2013-10-10		ENSG00000183130	ENSG00000183130		"""GPCR / Class A : Olfactory receptors"""	19574	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 11"""				Standard	NM_001001964		Approved	OR2T11Q	uc001ier.1	Q8NH01	OTTHUMG00000040384	ENST00000330803.2:c.299T>C	1.37:g.248790131A>G	ENSP00000328934:p.Leu100Pro		Q6IEY6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L100P	ENST00000330803.2	37	c.299	CCDS31122.1	1	.	.	.	.	.	.	.	.	.	.	.	11.32	1.603367	0.28534	.	.	ENSG00000183130	ENST00000330803	T	0.01313	5.02	4.62	3.5	0.40072	GPCR, rhodopsin-like superfamily (1);	0.192807	0.25543	N	0.029945	T	0.09335	0.0230	M	0.90082	3.085	0.09310	N	1	D	0.60575	0.988	D	0.63113	0.911	T	0.04635	-1.0937	10	0.87932	D	0	.	12.7258	0.57170	0.8616:0.1383:0.0:0.0	.	100	Q8NH01	O2T11_HUMAN	P	100	ENSP00000328934:L100P	ENSP00000328934:L100P	L	-	2	0	OR2T11	246856754	0.000000	0.05858	0.872000	0.34217	0.586000	0.36452	1.101000	0.31037	0.268000	0.21939	-1.256000	0.01477	CTC	OR2T11	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000183130		0.498	OR2T11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T11	HGNC	protein_coding	OTTHUMT00000097134.1	24	0.00	0	A	NM_001001964		248790131	248790131	-1	no_errors	ENST00000330803	ensembl	human	known	69_37n	missense	15	37.50	9	SNP	0.015	G
OR4X1	390113	genome.wustl.edu	37	11	48285598	48285598	+	Missense_Mutation	SNP	C	C	A	rs199551246		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr11:48285598C>A	ENST00000320048.1	+	1	186	c.186C>A	c.(184-186)agC>agA	p.S62R		NM_001004726.1	NP_001004726.1	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X, member 1 (gene/pseudogene)	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	28						TCTTTCTCAGCTACTTATCCT	0.488													C|||	1	0.000199681	0.0	0.0	5008	,	,		20797	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													150.0	137.0	141.0					11																	48285598		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB065544	CCDS31487.1	11p11.2	2013-10-10	2013-10-10		ENSG00000176567	ENSG00000176567		"""GPCR / Class A : Olfactory receptors"""	14854	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily X, member 1"""				Standard	NM_001004726		Approved		uc010rht.2	Q8NH49	OTTHUMG00000165301	ENST00000320048.1:c.186C>A	11.37:g.48285598C>A	ENSP00000321506:p.Ser62Arg		Q6IF74	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S62R	ENST00000320048.1	37	c.186	CCDS31487.1	11	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	14.09	2.431881	0.43122	.	.	ENSG00000176567	ENST00000320048	T	0.00402	7.56	4.29	3.38	0.38709	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00580	0.0019	L	0.43554	1.36	0.23936	N	0.996413	D	0.56746	0.977	P	0.60682	0.878	T	0.56786	-0.7921	9	0.72032	D	0.01	.	5.5662	0.17173	0.1944:0.7028:0.0:0.1028	.	62	Q8NH49	OR4X1_HUMAN	R	62	ENSP00000321506:S62R	ENSP00000321506:S62R	S	+	3	2	OR4X1	48242174	0.000000	0.05858	0.998000	0.56505	0.314000	0.28054	-2.261000	0.01176	1.140000	0.42260	0.563000	0.77884	AGC	OR4X1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176567		0.488	OR4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4X1	HGNC	protein_coding	OTTHUMT00000383373.1	94	0.00	0	C	NM_001004726		48285598	48285598	+1	no_errors	ENST00000320048	ensembl	human	known	69_37n	missense	61	12.86	9	SNP	0.996	A
OR6X1	390260	genome.wustl.edu	37	11	123624868	123624868	+	Missense_Mutation	SNP	C	C	T	rs535569258		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr11:123624868C>T	ENST00000327930.2	-	1	385	c.359G>A	c.(358-360)cGc>cAc	p.R120H		NM_001005188.1	NP_001005188.1	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X, member 1	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)	23		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GGTGAGGTAGCGGTCAAAAGA	0.552																																						dbGAP											0													163.0	160.0	161.0					11																	123624868		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB065510	CCDS31695.1	11q24.1	2012-08-09			ENSG00000221931	ENSG00000221931		"""GPCR / Class A : Olfactory receptors"""	14737	protein-coding gene	gene with protein product							Standard	NM_001005188		Approved		uc010rzy.2	Q8NH79	OTTHUMG00000166011	ENST00000327930.2:c.359G>A	11.37:g.123624868C>T	ENSP00000333724:p.Arg120His		B9EGW9|Q6IFA0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R120H	ENST00000327930.2	37	c.359	CCDS31695.1	11	.	.	.	.	.	.	.	.	.	.	C	16.31	3.087610	0.55968	.	.	ENSG00000221931	ENST00000327930	T	0.77489	-1.1	4.34	2.46	0.29980	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.74989	0.3789	M	0.88570	2.965	0.35544	D	0.803295	P	0.38788	0.647	B	0.26517	0.07	T	0.78666	-0.2115	9	0.72032	D	0.01	-4.1276	8.6195	0.33853	0.0:0.8102:0.0:0.1898	.	120	Q8NH79	OR6X1_HUMAN	H	120	ENSP00000333724:R120H	ENSP00000333724:R120H	R	-	2	0	OR6X1	123130078	0.998000	0.40836	0.976000	0.42696	0.993000	0.82548	3.738000	0.55067	0.475000	0.27415	0.650000	0.86243	CGC	OR6X1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000221931		0.552	OR6X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6X1	HGNC	protein_coding	OTTHUMT00000387436.1	72	0.00	0	C	NM_001005188		123624868	123624868	-1	no_errors	ENST00000327930	ensembl	human	known	69_37n	missense	39	17.02	8	SNP	1.000	T
ORMDL1	94101	genome.wustl.edu	37	2	190647159	190647159	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:190647159T>C	ENST00000325795.3	-	1	949	c.163A>G	c.(163-165)Ata>Gta	p.I55V	PMS1_ENST00000432292.3_5'Flank|ORMDL1_ENST00000392350.3_Missense_Mutation_p.I55V|ORMDL1_ENST00000392349.4_Missense_Mutation_p.I55V|PMS1_ENST00000418224.3_5'Flank|ORMDL1_ENST00000409519.1_Missense_Mutation_p.I55V|PMS1_ENST00000447232.2_5'Flank|PMS1_ENST00000441310.2_5'Flank|PMS1_ENST00000374826.4_5'Flank|PMS1_ENST00000409823.3_5'Flank|PMS1_ENST00000409985.1_5'Flank			Q9P0S3	ORML1_HUMAN	ORMDL sphingolipid biosynthesis regulator 1	55					ceramide metabolic process (GO:0006672)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(1)|urinary_tract(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00177)|Epithelial(96;0.0317)|all cancers(119;0.0889)			AGATTATGTATAATATTTGTT	0.358																																						dbGAP											0													56.0	52.0	53.0					2																	190647159		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2301.1	2q32	2014-06-16	2014-06-16		ENSG00000128699	ENSG00000128699			16036	protein-coding gene	gene with protein product		610073	"""ORM1 (S. cerevisiae)-like 1"", ""ORM1-like 1 (S. cerevisiae)"""			12093374, 23066021	Standard	NM_016467		Approved		uc002ure.4	Q9P0S3	OTTHUMG00000132661	ENST00000325795.3:c.163A>G	2.37:g.190647159T>C	ENSP00000326869:p.Ile55Val		B2R8W3|D3DPH9	Missense_Mutation	SNP	pfam_ORMDL,pirsf_ORMDL	p.I55V	ENST00000325795.3	37	c.163	CCDS2301.1	2	.	.	.	.	.	.	.	.	.	.	T	8.780	0.927958	0.18056	.	.	ENSG00000128699	ENST00000392350;ENST00000325795;ENST00000392349;ENST00000409519;ENST00000442547;ENST00000458355	.	.	.	4.65	3.43	0.39272	.	0.000000	0.85682	D	0.000000	T	0.49575	0.1565	N	0.21583	0.68	0.53688	D	0.99997	P	0.45348	0.856	P	0.60949	0.881	T	0.34527	-0.9825	9	0.08599	T	0.76	-31.5877	10.78	0.46371	0.1411:0.0:0.0:0.8589	.	55	Q9P0S3	ORML1_HUMAN	V	55	.	ENSP00000326869:I55V	I	-	1	0	ORMDL1	190355404	1.000000	0.71417	1.000000	0.80357	0.127000	0.20565	4.863000	0.62983	1.966000	0.57179	0.528000	0.53228	ATA	ORMDL1	-	pfam_ORMDL,pirsf_ORMDL	ENSG00000128699		0.358	ORMDL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ORMDL1	HGNC	protein_coding	OTTHUMT00000335275.1	36	0.00	0	T	NM_016467		190647159	190647159	-1	no_errors	ENST00000325795	ensembl	human	known	69_37n	missense	24	22.58	7	SNP	1.000	C
OSMR	9180	genome.wustl.edu	37	5	38886285	38886285	+	Silent	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:38886285T>C	ENST00000274276.3	+	7	1386	c.984T>C	c.(982-984)acT>acC	p.T328T	OSMR_ENST00000502536.1_Silent_p.T328T	NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	328					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					TTAACCTGACTCATCGAGGTG	0.408																																						dbGAP											0													121.0	113.0	116.0					5																	38886285		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.984T>C	5.37:g.38886285T>C			Q6P4E8|Q96QJ6	Silent	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.T328	ENST00000274276.3	37	c.984	CCDS3928.1	5																																																																																			OSMR	-	superfamily_Fibronectin_type3	ENSG00000145623		0.408	OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	OSMR	HGNC	protein_coding	OTTHUMT00000207609.2	53	0.00	0	T	NM_003999		38886285	38886285	+1	no_errors	ENST00000274276	ensembl	human	known	69_37n	silent	30	11.76	4	SNP	0.214	C
PCDHB2	56133	genome.wustl.edu	37	5	140475245	140475245	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:140475245C>T	ENST00000194155.4	+	1	1019	c.871C>T	c.(871-873)Cgc>Tgc	p.R291C		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	291	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGAAGACATTCGCAAAACGTT	0.428																																						dbGAP											0													80.0	82.0	82.0					5																	140475245		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.871C>T	5.37:g.140475245C>T	ENSP00000194155:p.Arg291Cys		Q4KMU1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R291C	ENST00000194155.4	37	c.871	CCDS4244.1	5	.	.	.	.	.	.	.	.	.	.	C	12.02	1.812318	0.32053	.	.	ENSG00000112852	ENST00000194155	T	0.52983	0.64	5.42	4.55	0.56014	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.49490	0.1560	M	0.80028	2.48	0.46586	D	0.999118	B	0.30889	0.299	B	0.24269	0.052	T	0.53429	-0.8440	9	0.46703	T	0.11	.	14.173	0.65522	0.0:0.9268:0.0:0.0732	.	291	Q9Y5E7	PCDB2_HUMAN	C	291	ENSP00000194155:R291C	ENSP00000194155:R291C	R	+	1	0	PCDHB2	140455429	0.601000	0.26907	1.000000	0.80357	0.929000	0.56500	-0.229000	0.09098	1.424000	0.47217	0.655000	0.94253	CGC	PCDHB2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000112852		0.428	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2	30	0.00	0	C	NM_018936		140475245	140475245	+1	no_errors	ENST00000194155	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	0.989	T
PCDHB18	54660	genome.wustl.edu	37	5	140615597	140615597	+	RNA	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:140615597C>T	ENST00000526308.1	+	0	1660					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						CTACTCGCTGCTGCCGCCCCA	0.652																																						dbGAP											0																																										-	-	-			0			AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140615597C>T			B3KTF8	RNA	SNP	-	NULL	ENST00000526308.1	37	NULL		5																																																																																			PCDHB18	-	-	ENSG00000146001		0.652	PCDHB18-002	KNOWN	basic	processed_transcript	PCDHB18	HGNC	pseudogene	OTTHUMT00000394776.1	37	0.00	0	C			140615597	140615597	+1	no_errors	ENST00000526308	ensembl	human	known	69_37n	rna	20	16.67	4	SNP	1.000	T
PCDHGA6	56109	genome.wustl.edu	37	5	140753950	140753950	+	Silent	SNP	G	G	A	rs192911480	byFrequency	TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:140753950G>A	ENST00000517434.1	+	1	300	c.300G>A	c.(298-300)ccG>ccA	p.P100P	PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	100	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCAGAGCCCGCGGTGTCTGG	0.507													.|||	2	0.000399361	0.0015	0.0	5008	,	,		19383	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													50.0	56.0	54.0					5																	140753950		2154	4284	6438	-	-	-	SO:0001819	synonymous_variant	0			AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.300G>A	5.37:g.140753950G>A			A6H8K7|B2RN55|Q9Y5D1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P100	ENST00000517434.1	37	c.300	CCDS54926.1	5																																																																																			PCDHGA6	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253731		0.507	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA6	HGNC	protein_coding	OTTHUMT00000374743.1	37	0.00	0	G	NM_018919		140753950	140753950	+1	no_errors	ENST00000517434	ensembl	human	known	69_37n	silent	23	23.33	7	SNP	0.000	A
PCDHGB2	56103	genome.wustl.edu	37	5	140741848	140741848	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:140741848C>T	ENST00000522605.1	+	1	2146	c.2146C>T	c.(2146-2148)Cga>Tga	p.R716*	PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	716					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGCGCCTGCGACTCTCTTC	0.557																																						dbGAP											0													95.0	100.0	98.0					5																	140741848		2027	4182	6209	-	-	-	SO:0001587	stop_gained	0			AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.2146C>T	5.37:g.140741848C>T	ENSP00000429018:p.Arg716*		Q3MIJ3|Q9UN65	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R716*	ENST00000522605.1	37	c.2146	CCDS54924.1	5	.	.	.	.	.	.	.	.	.	.	.	21.8	4.201209	0.79015	.	.	ENSG00000253910	ENST00000522605	.	.	.	5.18	-2.91	0.05631	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.885	0.46962	0.5239:0.2903:0.1859:0.0	.	.	.	.	X	716	.	ENSP00000429018:R716X	R	+	1	2	PCDHGB2	140722032	0.000000	0.05858	0.049000	0.19019	0.214000	0.24535	-1.544000	0.02192	-0.377000	0.07930	0.461000	0.40582	CGA	PCDHGB2	-	NULL	ENSG00000253910		0.557	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB2	HGNC	protein_coding	OTTHUMT00000374741.1	48	0.00	0	C	NM_018923		140741848	140741848	+1	no_errors	ENST00000522605	ensembl	human	known	69_37n	nonsense	29	12.12	4	SNP	0.005	T
PCDHGA9	56107	genome.wustl.edu	37	5	140783157	140783157	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:140783157C>T	ENST00000573521.1	+	1	638	c.638C>T	c.(637-639)aCg>aTg	p.T213M	PCDHGA4_ENST00000571252.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	213	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGTCCTCACGGCCTCGGAT	0.597																																						dbGAP											0													30.0	35.0	33.0					5																	140783157		2048	4181	6229	-	-	-	SO:0001583	missense	0			AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.638C>T	5.37:g.140783157C>T	ENSP00000460274:p.Thr213Met		A2RU65|Q9Y5C9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T213M	ENST00000573521.1	37	c.638	CCDS58981.1	5																																																																																			PCDHGA9	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000261934		0.597	PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA9	HGNC	protein_coding	OTTHUMT00000437105.1	29	0.00	0	C	NM_018921		140783157	140783157	+1	no_errors	ENST00000573521	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	0.962	T
PCDHGC5	56097	genome.wustl.edu	37	5	140869817	140869817	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:140869817A>G	ENST00000252087.1	+	1	1010	c.1010A>G	c.(1009-1011)cAa>cGa	p.Q337R	PCDHGA12_ENST00000252085.3_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGC3_ENST00000308177.3_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	337	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTGTGATTCAAGTGGATGTG	0.547																																						dbGAP											0													79.0	78.0	79.0					5																	140869817		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.1010A>G	5.37:g.140869817A>G	ENSP00000252087:p.Gln337Arg		Q9Y5C2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q337R	ENST00000252087.1	37	c.1010	CCDS4263.1	5	.	.	.	.	.	.	.	.	.	.	A	5.532	0.283002	0.10458	.	.	ENSG00000240764	ENST00000252087	T	0.01705	4.68	5.95	5.95	0.96441	Cadherin (4);Cadherin-like (1);	0.000000	0.52532	D	0.000066	T	0.02083	0.0065	L	0.33624	1.015	0.27574	N	0.9498	B;B	0.30482	0.281;0.048	B;B	0.30943	0.122;0.079	T	0.45731	-0.9241	10	0.34782	T	0.22	.	11.4349	0.50062	0.9283:0.0:0.0717:0.0	.	337;337	Q9Y5F6-2;Q9Y5F6	.;PCDGM_HUMAN	R	337	ENSP00000252087:Q337R	ENSP00000252087:Q337R	Q	+	2	0	PCDHGC5	140850001	0.210000	0.23517	0.997000	0.53966	0.937000	0.57800	1.278000	0.33179	2.276000	0.75962	0.460000	0.39030	CAA	PCDHGC5	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000240764		0.547	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGC5	HGNC	protein_coding	OTTHUMT00000251819.1	40	0.00	0	A	NM_018929		140869817	140869817	+1	no_errors	ENST00000252087	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	0.735	G
PCLO	27445	genome.wustl.edu	37	7	82763887	82763887	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:82763887A>C	ENST00000333891.9	-	3	3316	c.2979T>G	c.(2977-2979)agT>agG	p.S993R	PCLO_ENST00000423517.2_Missense_Mutation_p.S993R	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCACAGGTATACTTTTTGCAG	0.483																																						dbGAP											0													65.0	63.0	64.0					7																	82763887		1891	4109	6000	-	-	-	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.2979T>G	7.37:g.82763887A>C	ENSP00000334319:p.Ser993Arg			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.S993R	ENST00000333891.9	37	c.2979	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	A	1.555	-0.538209	0.04082	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.16897	2.31;2.31	5.54	-4.1	0.03940	.	.	.	.	.	T	0.07773	0.0195	N	0.14661	0.345	0.09310	N	1	B;B	0.23806	0.091;0.091	B;B	0.15870	0.014;0.014	T	0.33292	-0.9874	9	0.87932	D	0	.	4.2266	0.10584	0.4063:0.1042:0.3913:0.0982	.	993;993	Q9Y6V0-5;Q9Y6V0-6	.;.	R	939;993;993	ENSP00000334319:S993R;ENSP00000388393:S993R	ENSP00000334319:S993R	S	-	3	2	PCLO	82601823	0.000000	0.05858	0.000000	0.03702	0.093000	0.18481	-0.911000	0.04050	-0.606000	0.05746	0.533000	0.62120	AGT	PCLO	-	NULL	ENSG00000186472		0.483	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	100	0.00	0	A	NM_014510		82763887	82763887	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	missense	34	15.00	6	SNP	0.000	C
PCNT	5116	genome.wustl.edu	37	21	47863767	47863768	+	Frame_Shift_Ins	INS	-	-	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr21:47863767_47863768insC	ENST00000359568.5	+	45	9852_9853	c.9745_9746insC	c.(9745-9747)tccfs	p.S3249fs	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	3249					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.T3252fs*84(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					AACCAGAGAGTCCCCCCCAACC	0.579																																						dbGAP											1	Insertion - Frameshift(1)	lung(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.9752dupC	21.37:g.47863774_47863774dupC	ENSP00000352572:p.Ser3249fs		O43152|Q7Z7C9	Frame_Shift_Ins	INS	pfam_PACT_domain	p.T3252fs	ENST00000359568.5	37	c.9745_9746	CCDS33592.1	21																																																																																			PCNT	-	NULL	ENSG00000160299		0.579	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1	21	0.00	0	-	NM_006031		47863767	47863768	+1	no_errors	ENST00000359568	ensembl	human	known	69_37n	frame_shift_ins	11	21.43	3	INS	0.021:0.023	C
PDZK1IP1	10158	genome.wustl.edu	37	1	47650716	47650716	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:47650716A>G	ENST00000294338.2	-	3	352	c.230T>C	c.(229-231)gTg>gCg	p.V77A	PDZK1IP1_ENST00000371885.1_Missense_Mutation_p.V77A|PDZK1IP1_ENST00000491793.1_5'UTR	NM_005764.3	NP_005755.1	Q13113	PDZ1I_HUMAN	PDZK1 interacting protein 1	77						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|lung(1)|prostate(1)	3						ATCTGTTCCCACCAGGACTCC	0.612																																						dbGAP											0													194.0	148.0	163.0					1																	47650716		2203	4300	6503	-	-	-	SO:0001583	missense	0			U21049	CCDS546.1	1p33	2008-02-05			ENSG00000162366	ENSG00000162366			16887	protein-coding gene	gene with protein product		607178				9815914, 8701988, 12754212, 12837682	Standard	NM_005764		Approved	DD96, MAP17, SPAP	uc001cqw.3	Q13113	OTTHUMG00000007852	ENST00000294338.2:c.230T>C	1.37:g.47650716A>G	ENSP00000294338:p.Val77Ala		Q6ICT9|Q96EI1	Missense_Mutation	SNP	NULL	p.V77A	ENST00000294338.2	37	c.230	CCDS546.1	1	.	.	.	.	.	.	.	.	.	.	A	0.025	-1.377031	0.01214	.	.	ENSG00000162366	ENST00000294338;ENST00000371885	.	.	.	3.51	-3.45	0.04781	.	0.914652	0.08950	N	0.870331	T	0.16727	0.0402	L	0.31294	0.92	0.19300	N	0.99998	B	0.02656	0.0	B	0.01281	0.0	T	0.34054	-0.9844	9	0.05959	T	0.93	-0.7371	2.5939	0.04849	0.2257:0.1619:0.4538:0.1586	.	77	Q13113	PDZ1I_HUMAN	A	77	.	ENSP00000294338:V77A	V	-	2	0	PDZK1IP1	47423303	0.000000	0.05858	0.591000	0.28745	0.584000	0.36387	-0.223000	0.09177	-0.666000	0.05310	-0.609000	0.04063	GTG	PDZK1IP1	-	NULL	ENSG00000162366		0.612	PDZK1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZK1IP1	HGNC	protein_coding	OTTHUMT00000021655.1	64	0.00	0	A	NM_005764		47650716	47650716	-1	no_errors	ENST00000294338	ensembl	human	known	69_37n	missense	25	21.21	7	SNP	0.155	G
PFKFB3	5209	genome.wustl.edu	37	10	6245267	6245267	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr10:6245267T>C	ENST00000379775.4	+	1	374	c.44T>C	c.(43-45)gTg>gCg	p.V15A	RP11-414H17.5_ENST00000427630.1_RNA|PFKFB3_ENST00000317350.4_Missense_Mutation_p.V15A|PFKFB3_ENST00000540253.1_Intron|PFKFB3_ENST00000536985.1_Intron|PFKFB3_ENST00000360521.2_Missense_Mutation_p.V15A|PFKFB3_ENST00000379785.1_Missense_Mutation_p.V15A|PFKFB3_ENST00000379782.3_Missense_Mutation_p.V15A|PFKFB3_ENST00000379789.4_Intron	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	15	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						AAGATCTGGGTGCCCGTGGAC	0.726																																						dbGAP											0													35.0	33.0	34.0					10																	6245267		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.44T>C	10.37:g.6245267T>C	ENSP00000369100:p.Val15Ala		B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Missense_Mutation	SNP	pfam_6Phosfructo_kin,pfam_His_Pase_superF_clade-1,pfam_Chromatin_KTI12,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	p.V15A	ENST00000379775.4	37	c.44	CCDS7078.1	10	.	.	.	.	.	.	.	.	.	.	T	19.19	3.778954	0.70107	.	.	ENSG00000170525	ENST00000317350;ENST00000379785;ENST00000379782;ENST00000360521;ENST00000379775;ENST00000358499	.	.	.	4.75	4.75	0.60458	.	0.421173	0.23598	N	0.046461	T	0.27765	0.0683	N	0.08118	0	0.31186	N	0.701454	B;B	0.18166	0.001;0.026	B;B	0.17722	0.007;0.019	T	0.21143	-1.0254	9	0.34782	T	0.22	-1.9143	11.6236	0.51132	0.0:0.0:0.0:1.0	.	15;15	Q16875-2;Q16875	.;F263_HUMAN	A	15	.	ENSP00000369105:V15A	V	+	2	0	PFKFB3	6285273	1.000000	0.71417	0.998000	0.56505	0.948000	0.59901	2.219000	0.42899	1.768000	0.52137	0.260000	0.18958	GTG	PFKFB3	-	pirsf_Bifunct_6PFK/fruc_bisP_Ptase	ENSG00000170525		0.726	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PFKFB3	HGNC	protein_coding	OTTHUMT00000046647.1	12	0.00	0	T			6245267	6245267	+1	no_errors	ENST00000379782	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	1.000	C
PGM5	5239	genome.wustl.edu	37	9	71144508	71144508	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr9:71144508T>C	ENST00000396396.1	+	11	1869	c.1640T>C	c.(1639-1641)aTc>aCc	p.I547T		NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	547					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)			endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						CTCATAGCCATCGCACTGAAA	0.478																																						dbGAP											0													60.0	52.0	55.0					9																	71144508		2203	4300	6503	-	-	-	SO:0001583	missense	0			L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.1640T>C	9.37:g.71144508T>C	ENSP00000379678:p.Ile547Thr		B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Missense_Mutation	SNP	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-III,pfam_A-D-PHexomutase_a/b/a-II,superfamily_A-D-PHexomutase_a/b/a-I/II/III,prints_Alpha-D-phosphohexomutase_SF	p.I547T	ENST00000396396.1	37	c.1640	CCDS6622.2	9	.	.	.	.	.	.	.	.	.	.	T	20.6	4.020347	0.75275	.	.	ENSG00000154330	ENST00000396396	T	0.45668	0.89	5.66	5.66	0.87406	.	0.098719	0.64402	D	0.000002	T	0.59649	0.2209	L	0.55017	1.72	0.80722	D	1	D	0.53885	0.963	D	0.71870	0.975	T	0.60250	-0.7300	10	0.54805	T	0.06	.	14.8687	0.70437	0.0:0.0:0.0:1.0	.	547	Q15124	PGM5_HUMAN	T	547	ENSP00000379678:I547T	ENSP00000379678:I547T	I	+	2	0	PGM5	70334328	1.000000	0.71417	0.926000	0.36857	0.987000	0.75469	6.906000	0.75719	2.160000	0.67779	0.533000	0.62120	ATC	PGM5	-	NULL	ENSG00000154330		0.478	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PGM5	HGNC	protein_coding	OTTHUMT00000052548.2	47	0.00	0	T	NM_021965		71144508	71144508	+1	no_errors	ENST00000396396	ensembl	human	known	69_37n	missense	26	25.71	9	SNP	0.997	C
PHF12	57649	genome.wustl.edu	37	17	27239621	27239621	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:27239621A>T	ENST00000332830.4	-	9	2778	c.1968T>A	c.(1966-1968)gaT>gaA	p.D656E	PHF12_ENST00000577226.1_Missense_Mutation_p.D656E|PHF12_ENST00000268756.3_Missense_Mutation_p.D656E|PHF12_ENST00000582655.1_5'UTR	NM_001033561.1	NP_001028733.1			PHD finger protein 12											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			GTGGCCTTGAATCTGTCAACG	0.567																																						dbGAP											0													83.0	88.0	86.0					17																	27239621		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040956	CCDS11247.1, CCDS32598.1	17q11.2	2013-01-28			ENSG00000109118	ENSG00000109118		"""Zinc fingers, PHD-type"""	20816	protein-coding gene	gene with protein product						11390640	Standard	XM_005258015		Approved	PF1, KIAA1523	uc002hdg.1	Q96QT6	OTTHUMG00000132676	ENST00000332830.4:c.1968T>A	17.37:g.27239621A>T	ENSP00000329933:p.Asp656Glu			Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,superfamily_SMAD_FHA_domain,smart_Znf_PHD,pfscan_FHA_dom,pfscan_Znf_PHD-finger	p.D656E	ENST00000332830.4	37	c.1968	CCDS32598.1	17	.	.	.	.	.	.	.	.	.	.	A	9.390	1.075359	0.20227	.	.	ENSG00000109118	ENST00000332830;ENST00000378879;ENST00000268756	D;D;D	0.94330	-3.32;-3.4;-3.39	5.65	-1.35	0.09114	.	0.477415	0.24879	N	0.034864	T	0.81735	0.4885	N	0.24115	0.695	0.33655	D	0.608984	B;B;B;B;B	0.09022	0.001;0.0;0.0;0.002;0.002	B;B;B;B;B	0.09377	0.003;0.003;0.002;0.004;0.003	T	0.66228	-0.5976	10	0.16420	T	0.52	-0.7403	1.8483	0.03163	0.267:0.3913:0.2068:0.1349	.	638;656;656;656;656	B4DFE2;Q96QT6-2;Q2TAK2;C9J9G2;Q96QT6	.;.;.;.;PHF12_HUMAN	E	656	ENSP00000329933:D656E;ENSP00000368157:D656E;ENSP00000268756:D656E	ENSP00000268756:D656E	D	-	3	2	PHF12	24263747	0.176000	0.23096	0.996000	0.52242	0.997000	0.91878	-0.669000	0.05262	-0.204000	0.10235	0.482000	0.46254	GAT	PHF12	-	NULL	ENSG00000109118		0.567	PHF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF12	HGNC	protein_coding	OTTHUMT00000255941.1	43	0.00	0	A	NM_020889		27239621	27239621	-1	no_errors	ENST00000332830	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	0.987	T
PIGG	54872	genome.wustl.edu	37	4	515734	515734	+	Intron	SNP	C	C	T	rs377462432		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr4:515734C>T	ENST00000453061.2	+	8	1720				PIGG_ENST00000536264.1_3'UTR|PIGG_ENST00000310340.5_Intron|PIGG_ENST00000503111.1_3'UTR|PIGG_ENST00000509768.1_Missense_Mutation_p.R451C|PIGG_ENST00000296306.7_Intron|PIGG_ENST00000383028.4_Intron|PIGG_ENST00000504346.1_Intron	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						AAGGAAGGTACGTACGGCTGG	0.562																																						dbGAP											0													81.0	67.0	72.0					4																	515734		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.1614+4C>T	4.37:g.515734C>T			B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.R451C	ENST00000453061.2	37	c.1351	CCDS46992.1	4	.	.	.	.	.	.	.	.	.	.	C	6.301	0.423690	0.11928	.	.	ENSG00000174227	ENST00000509768	T	0.32023	1.47	0.235	-0.47	0.12131	.	.	.	.	.	T	0.14313	0.0346	.	.	.	0.33355	D	0.571529	P	0.49783	0.928	B	0.31495	0.131	T	0.30504	-0.9976	7	0.38643	T	0.18	.	.	.	.	.	451	D6RFE8	.	C	451	ENSP00000421550:R451C	ENSP00000421550:R451C	R	+	1	0	PIGG	505734	0.959000	0.32827	0.382000	0.26119	0.028000	0.11728	-0.661000	0.05311	-0.671000	0.05274	-0.657000	0.03884	CGT	PIGG	-	NULL	ENSG00000174227		0.562	PIGG-001	KNOWN	basic|CCDS	protein_coding	PIGG	HGNC	protein_coding	OTTHUMT00000357494.1	66	0.00	0	C	NM_017733		515734	515734	+1	no_errors	ENST00000509768	ensembl	human	novel	69_37n	missense	25	16.67	5	SNP	0.489	T
PIGS	94005	genome.wustl.edu	37	17	26881988	26881988	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:26881988G>A	ENST00000308360.7	-	11	1648	c.1273C>T	c.(1273-1275)Cgg>Tgg	p.R425W	PIGS_ENST00000543734.1_Missense_Mutation_p.R364W|PIGS_ENST00000395346.2_Missense_Mutation_p.R417W|UNC119_ENST00000301032.4_5'Flank|UNC119_ENST00000335765.4_5'Flank	NM_033198.3	NP_149975.1	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class S	425					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					CAGAGCAGCCGGTCTAGCTCC	0.572																																						dbGAP											0													77.0	64.0	68.0					17																	26881988		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11235.1	17p13.2	2013-02-26	2006-06-28		ENSG00000087111	ENSG00000087111		"""Phosphatidylinositol glycan anchor biosynthesis"""	14937	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610271	"""phosphatidylinositol glycan, class S"""				Standard	NM_033198		Approved		uc002hbo.2	Q96S52	OTTHUMG00000132604	ENST00000308360.7:c.1273C>T	17.37:g.26881988G>A	ENSP00000309430:p.Arg425Trp		Q6UVX6	Missense_Mutation	SNP	pfam_PtdIno-glycan_biosynth_class_S	p.R425W	ENST00000308360.7	37	c.1273	CCDS11235.1	17	.	.	.	.	.	.	.	.	.	.	G	21.3	4.134039	0.77662	.	.	ENSG00000087111	ENST00000395346;ENST00000308360;ENST00000543734	T;T;T	0.47177	0.85;0.85;0.85	5.42	4.37	0.52481	.	0.171581	0.51477	D	0.000093	T	0.61451	0.2348	M	0.65975	2.015	0.52501	D	0.999957	D;D	0.67145	0.996;0.995	P;P	0.59761	0.863;0.785	T	0.60974	-0.7156	10	0.38643	T	0.18	-8.4558	14.9945	0.71421	0.0:0.0:0.7645:0.2355	.	425;417	Q96S52;Q96S52-2	PIGS_HUMAN;.	W	417;425;364	ENSP00000378755:R417W;ENSP00000309430:R425W;ENSP00000438447:R364W	ENSP00000309430:R425W	R	-	1	2	PIGS	23906115	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.322000	0.59215	2.538000	0.85594	0.462000	0.41574	CGG	PIGS	-	pfam_PtdIno-glycan_biosynth_class_S	ENSG00000087111		0.572	PIGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGS	HGNC	protein_coding	OTTHUMT00000255833.3	40	0.00	0	G	NM_033198		26881988	26881988	-1	no_errors	ENST00000308360	ensembl	human	known	69_37n	missense	42	10.42	5	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178938775	178938775	+	Splice_Site	SNP	T	T	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr3:178938775T>A	ENST00000263967.3	+	14	2174	c.2017T>A	c.(2017-2019)Tct>Act	p.S673T		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	673	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TTCTTTTAGATCTGAGATGCA	0.328		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	0													51.0	42.0	45.0					3																	178938775		1814	4069	5883	-	-	-	SO:0001630	splice_region_variant	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2016-1T>A	3.37:g.178938775T>A			Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.S673T	ENST00000263967.3	37	c.2017	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	T	25.2	4.618101	0.87359	.	.	ENSG00000121879	ENST00000263967	T	0.68331	-0.32	5.41	5.41	0.78517	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.117098	0.64402	D	0.000009	T	0.79975	0.4539	M	0.70903	2.155	0.80722	D	1	D	0.64830	0.994	D	0.66351	0.943	T	0.82255	-0.0548	10	0.66056	D	0.02	0.6693	15.4463	0.75232	0.0:0.0:0.0:1.0	.	673	P42336	PK3CA_HUMAN	T	673	ENSP00000263967:S673T	ENSP00000263967:S673T	S	+	1	0	PIK3CA	180421469	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.698000	0.84413	2.052000	0.61016	0.528000	0.53228	TCT	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.328	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	66	0.00	0	T		Missense_Mutation	178938775	178938775	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	51	15.00	9	SNP	1.000	A
GSAP	54103	genome.wustl.edu	37	7	76984734	76984734	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:76984734C>T	ENST00000257626.7	-	16	1212	c.1134G>A	c.(1132-1134)atG>atA	p.M378I		NM_017439.3	NP_059135.2	A4D1B5	GSAP_HUMAN	gamma-secretase activating protein	378					positive regulation of beta-amyloid formation (GO:1902004)|regulation of proteolysis (GO:0030162)	trans-Golgi network (GO:0005802)	beta-amyloid binding (GO:0001540)										GCATATCAATCATTTCATTAT	0.373																																						dbGAP											0													65.0	71.0	69.0					7																	76984734		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34672.2	7q11.23	2013-04-05	2013-04-05	2013-04-05	ENSG00000186088	ENSG00000186088			28042	protein-coding gene	gene with protein product		613552	"""pigeon homolog (Drosophila)"""	PION		20811458	Standard	NM_017439		Approved	LOC54103	uc003ugf.3	A4D1B5	OTTHUMG00000150504	ENST00000257626.7:c.1134G>A	7.37:g.76984734C>T	ENSP00000257626:p.Met378Ile		A4D1B6|Q3MJC0|Q8ND73|Q9UMH3|Q9Y4L9	Missense_Mutation	SNP	NULL	p.M378I	ENST00000257626.7	37	c.1134	CCDS34672.2	7	.	.	.	.	.	.	.	.	.	.	C	9.400	1.077794	0.20227	.	.	ENSG00000186088	ENST00000257626	T	0.16597	2.33	5.76	0.71	0.18157	.	2.006720	0.02549	N	0.095466	T	0.05547	0.0146	N	0.01048	-1.04	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.31364	-0.9946	10	0.11794	T	0.64	.	5.1894	0.15201	0.1296:0.5081:0.0:0.3623	.	378;378	A4D1B5-3;A4D1B5	.;GSAP_HUMAN	I	378	ENSP00000257626:M378I	ENSP00000257626:M378I	M	-	3	0	PION	76822670	0.001000	0.12720	0.001000	0.08648	0.988000	0.76386	0.060000	0.14342	0.066000	0.16515	0.655000	0.94253	ATG	PION	-	NULL	ENSG00000186088		0.373	GSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PION	HGNC	protein_coding	OTTHUMT00000318672.2	52	0.00	0	C	NM_017439		76984734	76984734	-1	no_errors	ENST00000257626	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	0.000	T
PITPNM2	57605	genome.wustl.edu	37	12	123519107	123519107	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:123519107G>A	ENST00000542749.1	-	1	94	c.31C>T	c.(31-33)Cca>Tca	p.P11S	PITPNM2_ENST00000392428.1_Missense_Mutation_p.P11S|PITPNM2_ENST00000280562.5_Missense_Mutation_p.P11S|PITPNM2_ENST00000451868.2_5'UTR|PITPNM2_ENST00000320201.4_Missense_Mutation_p.P11S|PITPNM2_ENST00000546049.1_Missense_Mutation_p.P11S			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	11					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		ACGGTCATTGGCAGAGGAATC	0.552																																						dbGAP											0													134.0	111.0	119.0					12																	123519107		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.31C>T	12.37:g.123519107G>A	ENSP00000437611:p.Pro11Ser		Q9P271	Missense_Mutation	SNP	pfam_PI_transfer,pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD,prints_PI_transfer	p.P11S	ENST00000542749.1	37	c.31	CCDS9242.1	12	.	.	.	.	.	.	.	.	.	.	G	26.0	4.699020	0.88830	.	.	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000392428;ENST00000542749;ENST00000542210;ENST00000541244	T;T;T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91;-0.91;-0.91	5.19	4.28	0.50868	START-like domain (1);	0.057246	0.64402	D	0.000001	D	0.90960	0.7158	H	0.97240	3.965	0.32657	N	0.518578	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.999;1.0	D	0.95256	0.8364	10	0.87932	D	0	-31.8354	15.7722	0.78180	0.0:0.1366:0.8634:0.0	.	11;11;11	A5D8U3;Q9BZ72-2;Q9BZ72	.;.;PITM2_HUMAN	S	11	ENSP00000280562:P11S;ENSP00000322218:P11S;ENSP00000376223:P11S;ENSP00000437611:P11S;ENSP00000437869:P11S;ENSP00000445399:P11S	ENSP00000280562:P11S	P	-	1	0	PITPNM2	122085060	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.378000	0.90144	1.374000	0.46228	0.655000	0.94253	CCA	PITPNM2	-	pfam_PI_transfer	ENSG00000090975		0.552	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PITPNM2	HGNC	protein_coding	OTTHUMT00000401342.1	40	0.00	0	G	NM_020845		123519107	123519107	-1	no_errors	ENST00000320201	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	1.000	A
PKHD1L1	93035	genome.wustl.edu	37	8	110424608	110424608	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr8:110424608C>T	ENST00000378402.5	+	20	2304	c.2200C>T	c.(2200-2202)Cca>Tca	p.P734S		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	734					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AAACAGACGACCATATGGAGA	0.363										HNSCC(38;0.096)																												dbGAP											0													98.0	88.0	91.0					8																	110424608		1830	4080	5910	-	-	-	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.2200C>T	8.37:g.110424608C>T	ENSP00000367655:p.Pro734Ser		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.P734S	ENST00000378402.5	37	c.2200	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	C	8.933	0.964009	0.18583	.	.	ENSG00000205038	ENST00000378402	D	0.85013	-1.93	4.96	4.08	0.47627	.	0.219172	0.39083	N	0.001474	T	0.78052	0.4223	L	0.60455	1.87	0.24607	N	0.993749	B	0.18610	0.029	B	0.15484	0.013	T	0.59064	-0.7524	10	0.06236	T	0.91	.	9.7471	0.40453	0.0:0.903:0.0:0.097	.	734	Q86WI1	PKHL1_HUMAN	S	734	ENSP00000367655:P734S	ENSP00000367655:P734S	P	+	1	0	PKHD1L1	110493784	0.909000	0.30893	0.979000	0.43373	0.834000	0.47266	1.166000	0.31834	1.219000	0.43474	0.485000	0.47835	CCA	PKHD1L1	-	NULL	ENSG00000205038		0.363	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	66	0.00	0	C	NM_177531		110424608	110424608	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	missense	52	14.75	9	SNP	0.977	T
PLBD2	196463	genome.wustl.edu	37	12	113826338	113826338	+	Silent	SNP	G	G	A	rs200472635	byFrequency	TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:113826338G>A	ENST00000280800.3	+	12	1708	c.1677G>A	c.(1675-1677)ccG>ccA	p.P559P	PLBD2_ENST00000545182.2_Silent_p.P527P	NM_173542.3	NP_775813.2	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2	559					lipid catabolic process (GO:0016042)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						AGGTGCCCCCGTTCCAGTGGA	0.657													g|||	2	0.000399361	0.0	0.0	5008	,	,		15981	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													53.0	48.0	50.0					12																	113826338		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC030618	CCDS9168.1, CCDS53834.1	12q24.13	2013-10-11				ENSG00000151176			27283	protein-coding gene	gene with protein product	"""PLB homolog 2 (Dictyostelium)"", ""mannose-6-phosphate protein associated protein p76"""					17105447, 15193148, 19019078	Standard	NM_001159727		Approved	p76	uc001tve.2	Q8NHP8	OTTHUMG00000169567	ENST00000280800.3:c.1677G>A	12.37:g.113826338G>A			F5H5E2	Silent	SNP	pfam_PLipase_B-like	p.P559	ENST00000280800.3	37	c.1677	CCDS9168.1	12																																																																																			PLBD2	-	pfam_PLipase_B-like	ENSG00000151176		0.657	PLBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLBD2	HGNC	protein_coding	OTTHUMT00000404835.1	31	0.00	0	G	NM_173542		113826338	113826338	+1	no_errors	ENST00000280800	ensembl	human	known	69_37n	silent	11	26.67	4	SNP	0.258	A
PLOD1	5351	genome.wustl.edu	37	1	12030842	12030842	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:12030842C>T	ENST00000196061.4	+	17	1898	c.1871C>T	c.(1870-1872)aCg>aTg	p.T624M	PLOD1_ENST00000376369.3_Missense_Mutation_p.T671M	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	624					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	GCGCCCATGACGGAGAAGCTC	0.597																																						dbGAP											0													81.0	69.0	73.0					1																	12030842		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.1871C>T	1.37:g.12030842C>T	ENSP00000196061:p.Thr624Met		B4DR87|Q96AV9|Q9H132	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.T671M	ENST00000196061.4	37	c.2012	CCDS142.1	1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.634648	0.87660	.	.	ENSG00000083444	ENST00000414311;ENST00000376369;ENST00000196061	T;T	0.65364	-0.15;-0.15	5.94	5.94	0.96194	Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	T	0.72755	0.3500	M	0.82923	2.615	0.80722	D	1	D;D	0.62365	0.991;0.991	B;P	0.46885	0.429;0.53	T	0.77882	-0.2422	10	0.72032	D	0.01	.	19.3514	0.94389	0.0:1.0:0.0:0.0	.	671;624	B4DR87;Q02809	.;PLOD1_HUMAN	M	288;671;624	ENSP00000365548:T671M;ENSP00000196061:T624M	ENSP00000196061:T624M	T	+	2	0	PLOD1	11953429	1.000000	0.71417	0.989000	0.46669	0.936000	0.57629	7.810000	0.86072	2.826000	0.97356	0.561000	0.74099	ACG	PLOD1	-	smart_Pro_4_hyd_alph	ENSG00000083444		0.597	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD1	HGNC	protein_coding	OTTHUMT00000006865.1	36	0.00	0	C	NM_000302		12030842	12030842	+1	no_errors	ENST00000376369	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	1.000	T
PNPLA7	375775	genome.wustl.edu	37	9	140361796	140361796	+	Missense_Mutation	SNP	C	C	T	rs566258336		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr9:140361796C>T	ENST00000277531.4	-	25	3123	c.2937G>A	c.(2935-2937)atG>atA	p.M979I	PNPLA7_ENST00000406427.1_Missense_Mutation_p.M1004I|PNPLA7_ENST00000492278.1_5'UTR|PNPLA7_ENST00000371457.1_Missense_Mutation_p.M585I	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	979	Patatin.				lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		CCCGGATCCGCATCTGGCTGT	0.677																																						dbGAP											0													108.0	78.0	88.0					9																	140361796		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.2937G>A	9.37:g.140361796C>T	ENSP00000277531:p.Met979Ile		B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Missense_Mutation	SNP	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.M1004I	ENST00000277531.4	37	c.3012	CCDS7045.1	9	.	.	.	.	.	.	.	.	.	.	C	11.53	1.665445	0.29604	.	.	ENSG00000130653	ENST00000371457;ENST00000371446;ENST00000277531;ENST00000406427;ENST00000371451;ENST00000434090	T;T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99;-0.99	5.41	-5.13	0.02884	Acyl transferase/acyl hydrolase/lysophospholipase (1);Patatin/Phospholipase A2-related (1);	0.348277	0.36268	N	0.002687	T	0.52224	0.1721	L	0.33093	0.98	0.33711	D	0.615787	B;B;B;B	0.11235	0.004;0.002;0.001;0.001	B;B;B;B	0.15484	0.012;0.009;0.013;0.005	T	0.32745	-0.9895	10	0.17832	T	0.49	-1.6809	7.2029	0.25891	0.0:0.3824:0.2835:0.3341	.	387;1004;979;245	E2QRF8;Q6ZV29-5;Q6ZV29;B3KXH5	.;.;PLPL7_HUMAN;.	I	585;387;979;1004;979;970	ENSP00000360512:M585I;ENSP00000360501:M387I;ENSP00000277531:M979I;ENSP00000384610:M1004I;ENSP00000400582:M970I	ENSP00000277531:M979I	M	-	3	0	PNPLA7	139481617	0.441000	0.25626	0.117000	0.21633	0.598000	0.36846	-0.095000	0.11077	-0.951000	0.03654	0.561000	0.74099	ATG	PNPLA7	-	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	ENSG00000130653		0.677	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	PNPLA7	HGNC	protein_coding	OTTHUMT00000254787.1	33	0.00	0	C	NM_152286		140361796	140361796	-1	no_errors	ENST00000406427	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	0.982	T
PPARG	5468	genome.wustl.edu	37	3	12421355	12421355	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr3:12421355G>A	ENST00000287820.6	+	2	356	c.235G>A	c.(235-237)Gaa>Aaa	p.E79K	PPARG_ENST00000397026.2_Missense_Mutation_p.E57K|PPARG_ENST00000397000.1_Missense_Mutation_p.E51K|PPARG_ENST00000397012.2_Missense_Mutation_p.E51K|PPARG_ENST00000397015.2_Missense_Mutation_p.E51K|PPARG_ENST00000309576.6_Missense_Mutation_p.E51K|PPARG_ENST00000539812.1_Missense_Mutation_p.E49K|PPARG_ENST00000397010.2_Missense_Mutation_p.E51K	NM_015869.4	NP_056953.2	P37231	PPARG_HUMAN	peroxisome proliferator-activated receptor gamma	79					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|brown fat cell differentiation (GO:0050873)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|cellular response to lithium ion (GO:0071285)|epithelial cell differentiation (GO:0030855)|fatty acid oxidation (GO:0019395)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|innate immune response (GO:0045087)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|lipoprotein transport (GO:0042953)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle receptor biosynthetic process (GO:0045713)|monocyte differentiation (GO:0030224)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of cell growth (GO:0030308)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ regeneration (GO:0031100)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|placenta development (GO:0001890)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood pressure (GO:0008217)|regulation of cholesterol transporter activity (GO:0060694)|regulation of transcription involved in cell fate commitment (GO:0060850)|response to caffeine (GO:0031000)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to lipid (GO:0033993)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|arachidonic acid binding (GO:0050544)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|prostaglandin receptor activity (GO:0004955)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		PAX8/PPARG(117)	breast(2)|endometrium(4)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20					Balsalazide(DB01014)|Bezafibrate(DB01393)|Glipizide(DB01067)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Mesalazine(DB00244)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rosiglitazone(DB00412)|Sulfasalazine(DB00795)|Telmisartan(DB00966)	TCCACATTACGAAGACATTCC	0.418			T	PAX8	follicular thyroid		"""Insulin resistance ; lipodystrophy, familial partial L;diabetes mellitus, insulin-resistantI, with acanthosis nigricans and hypertension"""																															dbGAP		Dom	yes		3	3p25	5468	"""peroxisome proliferative activated receptor, gamma"""	yes	E	0													164.0	153.0	157.0					3																	12421355		2203	4300	6503	-	-	-	SO:0001583	missense	0			X90563	CCDS2609.1, CCDS2610.2	3p25	2013-01-16	2006-10-17		ENSG00000132170	ENSG00000132170		"""Nuclear hormone receptors"""	9236	protein-coding gene	gene with protein product		601487	"""peroxisome proliferative activated receptor, gamma"""			7862171, 9750197	Standard	NM_005037		Approved	PPARG1, PPARG2, NR1C3, PPARgamma	uc003bwx.3	P37231	OTTHUMG00000129764	ENST00000287820.6:c.235G>A	3.37:g.12421355G>A	ENSP00000287820:p.Glu79Lys		A8K3G6|B5BUA1|O00684|O00710|O14515|Q0QJH8|Q15178|Q15179|Q15180|Q15832|Q86U60|Q96J12	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_PPARgamma_N,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_1Cnucl_rcpt,prints_1Cnucl_rcpt_G,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.E79K	ENST00000287820.6	37	c.235	CCDS2609.1	3	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308326	0.60305	.	.	ENSG00000132170	ENST00000397010;ENST00000397029;ENST00000309576;ENST00000397015;ENST00000397012;ENST00000397026;ENST00000438682;ENST00000397000;ENST00000539812;ENST00000287820	T;T;T;T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63	5.8	5.8	0.92144	Peroxisome proliferator-activated receptor gamma, N-terminal (1);	0.288157	0.35970	N	0.002872	T	0.61426	0.2346	L	0.43152	1.355	0.46631	D	0.999137	B;D;B	0.89917	0.12;1.0;0.198	B;D;B	0.81914	0.039;0.995;0.064	T	0.50056	-0.8872	10	0.15499	T	0.54	.	20.0716	0.97726	0.0:0.0:1.0:0.0	.	79;65;51	P37231;Q4W4C7;E9PFX5	PPARG_HUMAN;.;.	K	51;51;51;51;51;57;51;51;49;79	ENSP00000380205:E51K;ENSP00000380224:E51K;ENSP00000312472:E51K;ENSP00000380210:E51K;ENSP00000380207:E51K;ENSP00000380221:E57K;ENSP00000392285:E51K;ENSP00000380196:E51K;ENSP00000438940:E49K;ENSP00000287820:E79K	ENSP00000287820:E79K	E	+	1	0	PPARG	12396355	1.000000	0.71417	1.000000	0.80357	0.457000	0.32468	7.528000	0.81941	2.741000	0.93983	0.585000	0.79938	GAA	PPARG	-	pfam_PPARgamma_N	ENSG00000132170		0.418	PPARG-002	KNOWN	basic|CCDS	protein_coding	PPARG	HGNC	protein_coding	OTTHUMT00000251979.2	57	0.00	0	G	NM_005037		12421355	12421355	+1	no_errors	ENST00000287820	ensembl	human	known	69_37n	missense	56	18.84	13	SNP	1.000	A
PPAT	5471	genome.wustl.edu	37	4	57268337	57268337	+	Silent	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr4:57268337T>C	ENST00000264220.2	-	6	809	c.672A>G	c.(670-672)acA>acG	p.T224T	PPAT_ENST00000507648.1_5'UTR	NM_002703.4	NP_002694.3	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	224	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				'de novo' IMP biosynthetic process (GO:0006189)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|G1/S transition of mitotic cell cycle (GO:0000082)|glutamine catabolic process (GO:0006543)|kidney development (GO:0001822)|lactation (GO:0007595)|maternal process involved in female pregnancy (GO:0060135)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|protein homotetramerization (GO:0051289)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|amidophosphoribosyltransferase activity (GO:0004044)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	20	Glioma(25;0.08)|all_neural(26;0.101)				Fluorouracil(DB00544)|L-Glutamine(DB00130)|Mercaptopurine(DB01033)	CTGTTTCTGATGTTTTTTTCT	0.308																																						dbGAP											0													99.0	100.0	99.0					4																	57268337		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS3505.1	4q12	2012-10-02			ENSG00000128059	ENSG00000128059	2.4.2.14		9238	protein-coding gene	gene with protein product		172450					Standard	NM_002703		Approved	GPAT, PRAT	uc003hbr.3	Q06203	OTTHUMG00000128842	ENST00000264220.2:c.672A>G	4.37:g.57268337T>C				Silent	SNP	pfam_GATase_dom,pfam_PRibTrfase,pirsf_Amd_phspho_trans,tigrfam_Amd_phspho_trans	p.T224	ENST00000264220.2	37	c.672	CCDS3505.1	4																																																																																			PPAT	-	pfam_GATase_dom,pirsf_Amd_phspho_trans,tigrfam_Amd_phspho_trans	ENSG00000128059		0.308	PPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAT	HGNC	protein_coding	OTTHUMT00000250781.2	102	0.00	0	T	NM_002703		57268337	57268337	-1	no_errors	ENST00000264220	ensembl	human	known	69_37n	silent	63	21.25	17	SNP	0.001	C
PPFIA3	8541	genome.wustl.edu	37	19	49651945	49651945	+	Missense_Mutation	SNP	A	A	G	rs145480643		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr19:49651945A>G	ENST00000334186.4	+	25	3383	c.3034A>G	c.(3034-3036)Atg>Gtg	p.M1012V	PPFIA3_ENST00000602351.1_Missense_Mutation_p.M1003V	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	1012	SAM 2. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		TTATGGGATTATGTGCCTGAA	0.567																																						dbGAP											0													72.0	64.0	67.0					19																	49651945		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.3034A>G	19.37:g.49651945A>G	ENSP00000335614:p.Met1012Val		A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.M1012V	ENST00000334186.4	37	c.3034	CCDS12758.1	19	.	.	.	.	.	.	.	.	.	.	A	19.13	3.768098	0.69878	.	.	ENSG00000177380	ENST00000334186	T	0.48836	0.8	4.89	4.89	0.63831	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.253264	0.24033	N	0.042171	T	0.37705	0.1013	L	0.27053	0.805	0.80722	D	1	B;P	0.44006	0.27;0.824	B;B	0.40864	0.027;0.342	T	0.37150	-0.9718	10	0.62326	D	0.03	-8.5598	13.7826	0.63091	1.0:0.0:0.0:0.0	.	1003;1012	O75145-2;O75145	.;LIPA3_HUMAN	V	1012	ENSP00000335614:M1012V	ENSP00000335614:M1012V	M	+	1	0	PPFIA3	54343757	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.431000	0.80335	1.964000	0.57103	0.533000	0.62120	ATG	PPFIA3	-	pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	ENSG00000177380		0.567	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIA3	HGNC	protein_coding	OTTHUMT00000465688.1	59	0.00	0	A	NM_003660		49651945	49651945	+1	no_errors	ENST00000334186	ensembl	human	known	69_37n	missense	36	16.28	7	SNP	1.000	G
PPP3CA	5530	genome.wustl.edu	37	4	102004357	102004357	+	Missense_Mutation	SNP	T	T	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr4:102004357T>G	ENST00000394854.3	-	7	1529	c.846A>C	c.(844-846)gaA>gaC	p.E282D	PPP3CA_ENST00000512215.1_Intron|PPP3CA_ENST00000523694.2_Missense_Mutation_p.E215D|PPP3CA_ENST00000507176.1_Missense_Mutation_p.E184D|PPP3CA_ENST00000394853.4_Missense_Mutation_p.E282D|PPP3CA_ENST00000323055.6_Missense_Mutation_p.E282D	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	282	Catalytic.				calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		CATCTTGGGCTTCGTGGGCTC	0.438																																						dbGAP											0													278.0	291.0	287.0					4																	102004357		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.846A>C	4.37:g.102004357T>G	ENSP00000378323:p.Glu282Asp		A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.E282D	ENST00000394854.3	37	c.846	CCDS34037.1	4	.	.	.	.	.	.	.	.	.	.	T	25.1	4.605561	0.87157	.	.	ENSG00000138814	ENST00000394854;ENST00000323055;ENST00000394853;ENST00000507176;ENST00000523694	T;T;T;T;T	0.06218	3.33;3.33;3.33;3.33;3.33	5.32	5.32	0.75619	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.059202	0.64402	D	0.000003	T	0.44561	0.1299	H	0.99555	4.625	0.58432	D	0.999998	D;D;D;D;D	0.76494	0.995;0.973;0.999;0.997;0.997	D;D;D;D;D	0.70016	0.967;0.967;0.967;0.966;0.966	T	0.70241	-0.4926	10	0.87932	D	0	-7.76	15.3042	0.73979	0.0:0.0:0.0:1.0	.	282;282;282;184;215	Q08209;A8W6Z7;Q08209-2;E7ETC2;A1A441	PP2BA_HUMAN;.;.;.;.	D	282;282;282;184;215	ENSP00000378323:E282D;ENSP00000320580:E282D;ENSP00000378322:E282D;ENSP00000422990:E184D;ENSP00000429350:E215D	ENSP00000320580:E282D	E	-	3	2	PPP3CA	102223380	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.753000	0.68736	2.008000	0.58898	0.533000	0.62120	GAA	PPP3CA	-	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	ENSG00000138814		0.438	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PPP3CA	HGNC	protein_coding	OTTHUMT00000258379.2	57	0.00	0	T	NM_000944		102004357	102004357	-1	no_errors	ENST00000394854	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	1.000	G
PRKCDBP	112464	genome.wustl.edu	37	11	6340459	6340459	+	Silent	SNP	G	G	A	rs367750552		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr11:6340459G>A	ENST00000303927.3	-	2	890	c.720C>T	c.(718-720)acC>acT	p.T240T	PRKCDBP_ENST00000530979.1_Silent_p.T272T	NM_145040.2	NP_659477.2	Q969G5	PRDBP_HUMAN	protein kinase C, delta binding protein	240					cortical actin cytoskeleton organization (GO:0030866)|negative regulation of fermentation (GO:1901003)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	caveola (GO:0005901)|protein complex (GO:0043234)				large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GATCTTCCTCGGTGTCCTGCG	0.677																																						dbGAP											0													90.0	101.0	97.0					11																	6340459		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AF339881	CCDS7762.1	11p15.4	2011-04-20			ENSG00000170955	ENSG00000170955			9400	protein-coding gene	gene with protein product	"""sdr-related gene product that binds to c-kinase"""					9054438	Standard	NM_145040		Approved	SRBC, HSRBC, MGC20400, cavin-3, CAVIN3	uc001mcu.1	Q969G5	OTTHUMG00000133378	ENST00000303927.3:c.720C>T	11.37:g.6340459G>A				Silent	SNP	NULL	p.T240	ENST00000303927.3	37	c.720	CCDS7762.1	11																																																																																			PRKCDBP	-	NULL	ENSG00000170955		0.677	PRKCDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCDBP	HGNC	protein_coding	OTTHUMT00000257228.2	29	0.00	0	G	NM_145040		6340459	6340459	-1	no_errors	ENST00000303927	ensembl	human	known	69_37n	silent	19	24.00	6	SNP	0.049	A
PROSER1	80209	genome.wustl.edu	37	13	39603474	39603474	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr13:39603474T>C	ENST00000352251.3	-	4	1052	c.219A>G	c.(217-219)atA>atG	p.I73M	PROSER1_ENST00000350125.3_Missense_Mutation_p.I51M	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	73																	AACAGTTGAGTATATTGACCA	0.294																																						dbGAP											0													84.0	83.0	84.0					13																	39603474		1807	4083	5890	-	-	-	SO:0001583	missense	0			AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.219A>G	13.37:g.39603474T>C	ENSP00000332034:p.Ile73Met		A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Missense_Mutation	SNP	NULL	p.I51M	ENST00000352251.3	37	c.153	CCDS9368.2	13	.	.	.	.	.	.	.	.	.	.	T	17.43	3.387487	0.61956	.	.	ENSG00000120685	ENST00000352251;ENST00000350125;ENST00000436678;ENST00000418503	T;T	0.52754	0.65;0.76	5.46	1.75	0.24633	.	.	.	.	.	T	0.47783	0.1464	N	0.24115	0.695	0.49915	D	0.999832	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.996	T	0.31724	-0.9933	8	.	.	.	-16.8725	7.0064	0.24838	0.1205:0.0:0.3471:0.5324	.	51;73	A6NJ97;Q86XN7	.;PRSR1_HUMAN	M	73;51;52;51	ENSP00000332034:I73M;ENSP00000339123:I51M	.	I	-	3	3	PROSER1	38501474	0.996000	0.38824	1.000000	0.80357	0.980000	0.70556	0.222000	0.17699	0.335000	0.23614	0.402000	0.26972	ATA	PROSER1	-	NULL	ENSG00000120685		0.294	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PROSER1	HGNC	protein_coding	OTTHUMT00000044607.5	73	0.00	0	T	NM_025138		39603474	39603474	-1	no_errors	ENST00000350125	ensembl	human	known	69_37n	missense	78	23.53	24	SNP	1.000	C
PWP1	11137	genome.wustl.edu	37	12	108090359	108090359	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:108090359C>T	ENST00000412830.3	+	6	779	c.611C>T	c.(610-612)aCt>aTt	p.T204I	PWP1_ENST00000541166.1_Missense_Mutation_p.T142I	NM_007062.1	NP_008993.1	Q13610	PWP1_HUMAN	PWP1 homolog (S. cerevisiae)	204					transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|endometrium(4)|kidney(1)|large_intestine(8)|lung(6)|urinary_tract(1)	23						GATGATTCTACTGGTAATTAG	0.343																																						dbGAP											0													135.0	131.0	133.0					12																	108090359		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000067	CCDS9114.1	12q23.3	2013-06-10				ENSG00000136045		"""WD repeat domain containing"""	17015	protein-coding gene	gene with protein product	"""endonuclein"""					7828893, 11850830	Standard	NM_007062		Approved	IEF-SSP-9502	uc001tmo.1	Q13610	OTTHUMG00000169913	ENST00000412830.3:c.611C>T	12.37:g.108090359C>T	ENSP00000387365:p.Thr204Ile		A8K3R6|Q7Z3X9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.T204I	ENST00000412830.3	37	c.611	CCDS9114.1	12	.	.	.	.	.	.	.	.	.	.	C	12.94	2.089507	0.36855	.	.	ENSG00000136045	ENST00000412830;ENST00000258531;ENST00000546068;ENST00000538327;ENST00000541166	T;T	0.29917	1.55;2.15	5.82	5.82	0.92795	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.294390	0.37809	N	0.001937	T	0.25791	0.0628	L	0.32530	0.975	0.28033	N	0.934075	B	0.06786	0.001	B	0.12837	0.008	T	0.07481	-1.0770	10	0.25106	T	0.35	.	16.0117	0.80406	0.0:0.8655:0.1345:0.0	.	204	Q13610	PWP1_HUMAN	I	204;204;204;204;142	ENSP00000387365:T204I;ENSP00000445249:T142I	ENSP00000258531:T204I	T	+	2	0	PWP1	106614489	0.961000	0.32948	0.998000	0.56505	0.881000	0.50899	1.699000	0.37804	2.770000	0.95276	0.643000	0.83706	ACT	PWP1	-	superfamily_WD40_repeat_dom	ENSG00000136045		0.343	PWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PWP1	HGNC	protein_coding	OTTHUMT00000406539.1	102	0.00	0	C	NM_007062		108090359	108090359	+1	no_errors	ENST00000412830	ensembl	human	known	69_37n	missense	73	10.98	9	SNP	0.564	T
RAE1	8480	genome.wustl.edu	37	20	55940493	55940493	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr20:55940493G>A	ENST00000395841.2	+	5	790	c.370G>A	c.(370-372)Gca>Aca	p.A124T	RAE1_ENST00000371242.2_Missense_Mutation_p.A124T|RAE1_ENST00000527947.1_Missense_Mutation_p.A124T|RAE1_ENST00000395840.2_Missense_Mutation_p.A124T	NM_003610.3	NP_003601.1	P78406	RAE1L_HUMAN	ribonucleic acid export 1	124					carbohydrate metabolic process (GO:0005975)|cellular response to organic cyclic compound (GO:0071407)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|nuclear pore (GO:0005643)|nucleolus (GO:0005730)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|RNA binding (GO:0003723)			breast(1)|endometrium(5)|large_intestine(4)|lung(6)|prostate(3)|skin(2)	21	Lung NSC(12;0.00263)|all_lung(29;0.00828)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;3.7e-14)|Epithelial(14;1.07e-09)|all cancers(14;1.11e-08)			GATACAGATCGCACAGGTAAC	0.403																																						dbGAP											0													80.0	75.0	77.0					20																	55940493		2203	4300	6503	-	-	-	SO:0001583	missense	0			U84720	CCDS13458.1	20q13.31	2013-08-28	2013-08-28		ENSG00000101146	ENSG00000101146		"""WD repeat domain containing"""	9828	protein-coding gene	gene with protein product		603343	"""RAE1 (RNA export 1, S.pombe) homolog"", ""RAE1 RNA export 1 homolog (S. pombe)"""			9370289, 9256445	Standard	XM_005260582		Approved	Mnrp41	uc002xyi.3	P78406	OTTHUMG00000032819	ENST00000395841.2:c.370G>A	20.37:g.55940493G>A	ENSP00000379182:p.Ala124Thr		A8K882|O15306|Q3SYL7|Q5TCH8|Q6V708|Q9H100|Q9NQM6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.A124T	ENST00000395841.2	37	c.370	CCDS13458.1	20	.	.	.	.	.	.	.	.	.	.	G	28.1	4.886845	0.91814	.	.	ENSG00000101146	ENST00000395841;ENST00000371242;ENST00000527947;ENST00000411894;ENST00000429339;ENST00000395840	T;T;T;T;T;T	0.70164	-0.46;-0.46;-0.46;1.62;1.62;-0.46	5.35	5.35	0.76521	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.098210	0.64402	D	0.000001	T	0.78007	0.4216	L	0.48877	1.53	0.80722	D	1	D;D;D	0.89917	1.0;0.987;0.987	D;D;D	0.87578	0.998;0.922;0.922	T	0.79522	-0.1769	10	0.87932	D	0	-21.315	17.6079	0.88044	0.0:0.0:1.0:0.0	.	124;124;124	E9PQ57;A8K882;P78406	.;.;RAE1L_HUMAN	T	124	ENSP00000379182:A124T;ENSP00000360286:A124T;ENSP00000432609:A124T;ENSP00000392097:A124T;ENSP00000393264:A124T;ENSP00000379181:A124T	ENSP00000360286:A124T	A	+	1	0	RAE1	55373900	1.000000	0.71417	0.989000	0.46669	0.583000	0.36354	9.100000	0.94213	2.659000	0.90383	0.655000	0.94253	GCA	RAE1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000101146		0.403	RAE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAE1	HGNC	protein_coding	OTTHUMT00000079842.2	31	0.00	0	G			55940493	55940493	+1	no_errors	ENST00000371242	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	1.000	A
RBM33	155435	genome.wustl.edu	37	7	155567691	155567691	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:155567691A>G	ENST00000401878.3	+	18	3667	c.3469A>G	c.(3469-3471)Atg>Gtg	p.M1157V	RBM33_ENST00000341148.3_Missense_Mutation_p.M93V	NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	1157	RRM.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		TCACAGGCATATGATAGATTT	0.468																																						dbGAP											0													127.0	119.0	121.0					7																	155567691		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.3469A>G	7.37:g.155567691A>G	ENSP00000384160:p.Met1157Val		A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Missense_Mutation	SNP	smart_RRM_dom	p.M1157V	ENST00000401878.3	37	c.3469	CCDS5941.2	7	.	.	.	.	.	.	.	.	.	.	A	19.30	3.801897	0.70682	.	.	ENSG00000184863	ENST00000401878;ENST00000341148	T;T	0.38887	3.34;1.11	4.95	4.95	0.65309	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.48286	U	0.000186	T	0.58119	0.2100	L	0.59436	1.845	0.40768	D	0.98306	D	0.58268	0.982	D	0.68943	0.961	T	0.59112	-0.7515	10	0.41790	T	0.15	.	13.2277	0.59924	1.0:0.0:0.0:0.0	.	1157	Q96EV2	RBM33_HUMAN	V	1157;93	ENSP00000384160:M1157V;ENSP00000341583:M93V	ENSP00000341583:M93V	M	+	1	0	RBM33	155260452	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.821000	0.86641	1.862000	0.54008	0.533000	0.62120	ATG	RBM33	-	smart_RRM_dom	ENSG00000184863		0.468	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBM33	HGNC	protein_coding	OTTHUMT00000317225.3	96	0.00	0	A	NM_001008408		155567691	155567691	+1	no_errors	ENST00000401878	ensembl	human	known	69_37n	missense	51	15.00	9	SNP	1.000	G
RBMXL1	494115	genome.wustl.edu	37	1	89448795	89448795	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:89448795G>A	ENST00000321792.5	-	2	1142	c.715C>T	c.(715-717)Cga>Tga	p.R239*	CCBL2_ENST00000260508.4_Intron|RBMXL1_ENST00000413769.1_5'Flank|RBMXL1_ENST00000399794.2_Nonsense_Mutation_p.R239*|CCBL2_ENST00000370491.3_Intron|CCBL2_ENST00000370485.2_Intron|CCBL2_ENST00000446900.2_Intron	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	239					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										GTATAATCTCGTGGTGGTGGT	0.423																																						dbGAP											0													182.0	160.0	168.0					1																	89448795		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.715C>T	1.37:g.89448795G>A	ENSP00000318415:p.Arg239*			Nonsense_Mutation	SNP	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.R239*	ENST00000321792.5	37	c.715	CCDS716.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.945992	0.97956	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	.	.	.	1.76	-3.52	0.04682	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.9011	0.24283	0.0:0.0:0.4771:0.5229	.	.	.	.	X	239	.	ENSP00000318415:R239X	R	-	1	2	RBMXL1	89221383	1.000000	0.71417	0.846000	0.33378	0.768000	0.43524	1.766000	0.38491	-0.857000	0.04115	0.306000	0.20318	CGA	RBMXL1	-	NULL	ENSG00000213516		0.423	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL1	HGNC	protein_coding	OTTHUMT00000029403.3	128	0.00	0	G	NM_019610		89448795	89448795	-1	no_errors	ENST00000321792	ensembl	human	known	69_37n	nonsense	53	18.46	12	SNP	0.993	A
RBMXL3	139804	genome.wustl.edu	37	X	114425534	114425534	+	Silent	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chrX:114425534T>C	ENST00000424776.3	+	1	1572	c.1530T>C	c.(1528-1530)taT>taC	p.Y510Y	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	510	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						GAGGCCACTATGAGGAGAACC	0.637																																						dbGAP											0													34.0	35.0	35.0					X																	114425534		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.1530T>C	X.37:g.114425534T>C			B4DXC0	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.Y510	ENST00000424776.3	37	c.1530	CCDS55478.1	X																																																																																			RBMXL3	-	NULL	ENSG00000175718		0.637	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	25	0.00	0	T	NM_001145346		114425534	114425534	+1	no_errors	ENST00000424776	ensembl	human	known	69_37n	silent	15	25.00	5	SNP	0.030	C
REM1	28954	genome.wustl.edu	37	20	30064292	30064292	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr20:30064292G>A	ENST00000201979.2	+	2	337	c.44G>A	c.(43-45)cGg>cAg	p.R15Q	DEFB124_ENST00000481595.1_Intron	NM_014012.4	NP_054731.2	O75628	REM1_HUMAN	RAS (RAD and GEM)-like GTP-binding 1	15					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			kidney(3)|large_intestine(3)|lung(14)|pancreas(2)|upper_aerodigestive_tract(1)	23	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			CCTCTGCACCGGCGAGCCAGC	0.617																																						dbGAP											0													87.0	100.0	95.0					20																	30064292		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152863	CCDS13181.1	20q11.21	2014-05-09	2004-04-14	2004-04-16	ENSG00000088320	ENSG00000088320			15922	protein-coding gene	gene with protein product	"""GTPase GES"""	610388	"""RAS (RAD and GEM)-like GTP-binding"""	REM		10831614, 14623965	Standard	NM_014012		Approved	GES	uc002wwa.3	O75628	OTTHUMG00000032168	ENST00000201979.2:c.44G>A	20.37:g.30064292G>A	ENSP00000201979:p.Arg15Gln		E1P5L1|Q5TZR7|Q5TZR8|Q9NP57	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Fe2_transport_prot_B_N,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,pirsf_Small_GTPase_GEM/REM/Rad,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R15Q	ENST00000201979.2	37	c.44	CCDS13181.1	20	.	.	.	.	.	.	.	.	.	.	G	25.2	4.612341	0.87258	.	.	ENSG00000088320	ENST00000201979	T	0.69040	-0.37	4.55	4.55	0.56014	.	0.000000	0.64402	D	0.000010	T	0.73418	0.3584	L	0.34521	1.04	0.32296	N	0.56564	D	0.89917	1.0	D	0.91635	0.999	T	0.78720	-0.2094	10	0.72032	D	0.01	.	14.874	0.70481	0.0:0.0:1.0:0.0	.	15	O75628	REM1_HUMAN	Q	15	ENSP00000201979:R15Q	ENSP00000201979:R15Q	R	+	2	0	REM1	29527953	0.983000	0.35010	0.025000	0.17156	0.884000	0.51177	6.690000	0.74567	2.350000	0.79820	0.655000	0.94253	CGG	REM1	-	pirsf_Small_GTPase_GEM/REM/Rad	ENSG00000088320		0.617	REM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REM1	HGNC	protein_coding	OTTHUMT00000078508.2	46	0.00	0	G	NM_014012		30064292	30064292	+1	no_errors	ENST00000201979	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.496	A
RFESD	317671	genome.wustl.edu	37	5	94991896	94991896	+	Silent	SNP	T	T	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:94991896T>A	ENST00000311364.4	+	5	1774	c.357T>A	c.(355-357)atT>atA	p.I119I	SPATA9_ENST00000477047.2_Intron|RFESD_ENST00000458310.1_Silent_p.I172I|RFESD_ENST00000380005.4_Silent_p.I172I|RFESD_ENST00000513950.2_3'UTR	NM_173362.3	NP_775498.1	Q8TAC1	RFESD_HUMAN	Rieske (Fe-S) domain containing	119	Rieske 2. {ECO:0000255|PROSITE- ProRule:PRU00628}.						2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			autonomic_ganglia(2)|endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	6		all_cancers(142;0.000215)|all_epithelial(76;7.43e-07)|all_lung(232;0.0318)|Lung NSC(167;0.041)|Ovarian(225;0.051)|Colorectal(57;0.162)		all cancers(79;5.94e-17)		AGCAAAGGATTCACACAGTGA	0.383																																						dbGAP											0													88.0	89.0	88.0					5																	94991896		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC035110	CCDS4075.1, CCDS47248.1	5q15	2010-12-07			ENSG00000175449	ENSG00000175449			29587	protein-coding gene	gene with protein product						12477932	Standard	NM_173362		Approved		uc003klg.3	Q8TAC1	OTTHUMG00000121168	ENST00000311364.4:c.357T>A	5.37:g.94991896T>A			J3KPH1	Silent	SNP	pfam_Rieske_2Fe-2S,superfamily_Rieske_2Fe-2S	p.I172	ENST00000311364.4	37	c.516	CCDS4075.1	5																																																																																			RFESD	-	superfamily_Rieske_2Fe-2S	ENSG00000175449		0.383	RFESD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFESD	HGNC	protein_coding	OTTHUMT00000241654.1	46	0.00	0	T	NM_173362		94991896	94991896	+1	no_errors	ENST00000380005	ensembl	human	known	69_37n	silent	42	16.00	8	SNP	1.000	A
RGAG4	340526	genome.wustl.edu	37	X	71350651	71350651	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chrX:71350651C>T	ENST00000545866.1	-	1	1107	c.740G>A	c.(739-741)gGc>gAc	p.G247D	RGAG4_ENST00000609883.1_Missense_Mutation_p.G247D|NHSL2_ENST00000540800.1_Intron|NHSL2_ENST00000373677.1_5'Flank	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	247										cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					GGTACAGTGGCCCTGCTTGAG	0.547																																						dbGAP											0													48.0	49.0	49.0					X																	71350651		1962	4153	6115	-	-	-	SO:0001583	missense	0			AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.740G>A	X.37:g.71350651C>T	ENSP00000441366:p.Gly247Asp		A7E2W7|Q8NCM4|Q9NPX1	Missense_Mutation	SNP	pfam_Retrotrans_gag	p.G247D	ENST00000545866.1	37	c.740	CCDS55446.1	X	.	.	.	.	.	.	.	.	.	.	C	16.90	3.249292	0.59103	.	.	ENSG00000242732	ENST00000545866;ENST00000479991	T;T	0.14266	2.52;2.52	4.23	4.23	0.50019	Retrotransposon gag protein (1);	.	.	.	.	T	0.34106	0.0886	M	0.73217	2.22	0.30785	N	0.741586	D	0.89917	1.0	D	0.80764	0.994	T	0.14309	-1.0477	8	.	.	.	-5.4874	10.951	0.47330	0.0:1.0:0.0:0.0	.	247	Q5HYW3	RGAG4_HUMAN	D	247	ENSP00000441366:G247D;ENSP00000418667:G247D	.	G	-	2	0	RGAG4	71267376	0.967000	0.33354	0.910000	0.35882	0.886000	0.51366	2.923000	0.48868	2.350000	0.79820	0.529000	0.55759	GGC	RGAG4	-	pfam_Retrotrans_gag	ENSG00000242732		0.547	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG4	HGNC	protein_coding	OTTHUMT00000057171.1	37	0.00	0	C	NM_001024455		71350651	71350651	-1	no_errors	ENST00000479991	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	0.896	T
RMND1	55005	genome.wustl.edu	37	6	151766618	151766618	+	Missense_Mutation	SNP	T	T	G	rs138900217	byFrequency	TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:151766618T>G	ENST00000367303.4	-	2	451	c.329A>C	c.(328-330)aAa>aCa	p.K110T	RMND1_ENST00000491268.1_5'UTR|RMND1_ENST00000336451.3_5'Flank	NM_017909.2	NP_060379.2	Q9NWS8	RMND1_HUMAN	required for meiotic nuclear division 1 homolog (S. cerevisiae)	110					translation (GO:0006412)	mitochondrion (GO:0005739)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.146)	OV - Ovarian serous cystadenocarcinoma(155;6.8e-11)		CAGATTTGGTTTGTGGGTCAC	0.408																																						dbGAP											0													150.0	146.0	148.0					6																	151766618		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000634	CCDS5232.1, CCDS75539.1	6q25.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000155906	ENSG00000155906			21176	protein-coding gene	gene with protein product		614917	"""chromosome 6 open reading frame 96"""	C6orf96			Standard	NM_001271937		Approved	bA351K16.3, FLJ20627, RMD1	uc003qoi.3	Q9NWS8	OTTHUMG00000015837	ENST00000367303.4:c.329A>C	6.37:g.151766618T>G	ENSP00000356272:p.Lys110Thr		A8K8H4|Q0VDG6|Q5SZ48|Q5SZ83|Q6NSC5|Q96EN7	Missense_Mutation	SNP	pfam_DUF155	p.K110T	ENST00000367303.4	37	c.329	CCDS5232.1	6	.	.	.	.	.	.	.	.	.	.	T	6.802	0.516948	0.13005	.	.	ENSG00000155906	ENST00000367303	T	0.49720	0.77	5.46	-2.98	0.05513	.	0.430688	0.23674	N	0.045685	T	0.12774	0.0310	L	0.32530	0.975	0.36874	D	0.889043	B;B	0.26809	0.16;0.008	B;B	0.26770	0.073;0.003	T	0.03863	-1.0997	10	0.48119	T	0.1	-5.9673	2.7733	0.05340	0.1199:0.3599:0.1236:0.3967	.	110;110	Q9NWS8-3;Q9NWS8	.;RMND1_HUMAN	T	110	ENSP00000356272:K110T	ENSP00000356272:K110T	K	-	2	0	RMND1	151808311	0.000000	0.05858	0.875000	0.34327	0.124000	0.20399	-2.185000	0.01252	-0.505000	0.06568	-0.460000	0.05396	AAA	RMND1	-	NULL	ENSG00000155906		0.408	RMND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RMND1	HGNC	protein_coding	OTTHUMT00000042718.2	98	0.00	0	T	NM_017909		151766618	151766618	-1	no_errors	ENST00000367303	ensembl	human	known	69_37n	missense	56	21.13	15	SNP	0.113	G
RNF14	9604	genome.wustl.edu	37	5	141359789	141359789	+	Silent	SNP	G	G	A	rs141694109		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:141359789G>A	ENST00000394520.2	+	6	1245	c.936G>A	c.(934-936)ccG>ccA	p.P312P	RNF14_ENST00000394514.2_Silent_p.P186P|AC005740.5_ENST00000520882.1_RNA|RNF14_ENST00000394515.3_Silent_p.P136P|RNF14_ENST00000540015.1_Intron|RNF14_ENST00000356143.1_Silent_p.P312P|RNF14_ENST00000347642.3_Silent_p.P312P|RNF14_ENST00000394519.1_Silent_p.P312P	NM_001201365.1|NM_004290.4	NP_001188294.1|NP_004281.1	Q9UBS8	RNF14_HUMAN	ring finger protein 14	312					androgen receptor signaling pathway (GO:0030521)|positive regulation of transcription, DNA-templated (GO:0045893)|protein ubiquitination (GO:0016567)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|small conjugating protein ligase activity (GO:0019787)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15		all_hematologic(541;0.0536)|Ovarian(839;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		GCCCCCGGCCGTGCTGCCAGC	0.547																																						dbGAP											0													112.0	99.0	103.0					5																	141359789		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF060544	CCDS4270.1, CCDS4271.1	5q23.3-q31.1	2008-02-05			ENSG00000013561	ENSG00000013561		"""RING-type (C3HC4) zinc fingers"""	10058	protein-coding gene	gene with protein product		605675				10085091, 10320776	Standard	NM_183399		Approved	ARA54, HFB30, TRIAD2	uc003lmc.3	Q9UBS8	OTTHUMG00000129660	ENST00000394520.2:c.936G>A	5.37:g.141359789G>A			A0AV26|A6NMR2|A8MTW5|B3KN72|B7ZLV2|D3DQE4|O94793|Q6IBV0	Silent	SNP	pfam_RWD-domain,pfam_Znf_C6HC,superfamily_UBQ-conjugating_enzyme/RWD,smart_RWD-domain,smart_Znf_C6HC,pfscan_RWD-domain,pfscan_Znf_RING	p.P312	ENST00000394520.2	37	c.936	CCDS4270.1	5																																																																																			RNF14	-	pfam_Znf_C6HC,smart_Znf_C6HC	ENSG00000013561		0.547	RNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF14	HGNC	protein_coding	OTTHUMT00000251860.2	38	0.00	0	G	NM_004290		141359789	141359789	+1	no_errors	ENST00000347642	ensembl	human	known	69_37n	silent	35	10.26	4	SNP	0.231	A
RNF34	80196	genome.wustl.edu	37	12	121853973	121853973	+	Silent	SNP	G	G	A	rs537636270		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:121853973G>A	ENST00000392464.2	+	2	87	c.18G>A	c.(16-18)acG>acA	p.T6T	RNF34_ENST00000392465.3_Silent_p.T7T|RNF34_ENST00000361234.5_Silent_p.T6T|RNF34_ENST00000555076.1_Intron					ring finger protein 34, E3 ubiquitin protein ligase											breast(1)|large_intestine(1)	2	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000432)|Epithelial(86;0.00233)		CGGGTGCCACGTCTATGTGGG	0.532																																						dbGAP											0													107.0	93.0	98.0					12																	121853973		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF306709, AB084914	CCDS9221.1, CCDS31915.1, CCDS73538.1	12q24.31	2012-02-23	2012-02-23			ENSG00000170633		"""RING-type (C3HC4) zinc fingers"""	17297	protein-coding gene	gene with protein product		608299	"""ring finger protein 34"""			12118383	Standard	NM_025126		Approved	RIFF, FLJ21786, RIF	uc001ual.2	Q969K3		ENST00000392464.2:c.18G>A	12.37:g.121853973G>A				Silent	SNP	superfamily_Znf_FYVE_PHD,smart_Znf_RING,pfscan_Znf_RING	p.T7	ENST00000392464.2	37	c.21		12																																																																																			RNF34	-	NULL	ENSG00000170633		0.532	RNF34-005	PUTATIVE	basic|exp_conf	protein_coding	RNF34	HGNC	protein_coding	OTTHUMT00000413892.1	40	0.00	0	G	NM_194271		121853973	121853973	+1	no_errors	ENST00000392465	ensembl	human	known	69_37n	silent	44	12.00	6	SNP	0.007	A
RNH1	6050	genome.wustl.edu	37	11	502136	502136	+	Silent	SNP	G	G	A	rs71462090|rs71022920	byFrequency	TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr11:502136G>A	ENST00000534797.1	-	1	1434	c.27C>T	c.(25-27)gaC>gaT	p.D9D	RNH1_ENST00000397614.1_Silent_p.D9D|RNH1_ENST00000438658.2_Silent_p.D9D|RNH1_ENST00000397604.3_Silent_p.D9D|RNH1_ENST00000533592.1_5'UTR|RNH1_ENST00000356187.5_Silent_p.D9D|RNH1_ENST00000397615.2_Silent_p.D9D|RNH1_ENST00000354420.2_Silent_p.D9D|RNH1_ENST00000533410.1_Silent_p.D9D			O60930	RNH1_HUMAN	ribonuclease/angiogenin inhibitor 1	0					mitochondrial DNA replication (GO:0006264)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|nucleic acid binding (GO:0003676)|ribonuclease activity (GO:0004540)|RNA binding (GO:0003723)|RNA-DNA hybrid ribonuclease activity (GO:0004523)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.26e-26)|Epithelial(43;1.34e-25)|OV - Ovarian serous cystadenocarcinoma(40;5.31e-20)|BRCA - Breast invasive adenocarcinoma(625;8.01e-05)|Lung(200;0.0378)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CACACTGGATGTCCAGGCTCT	0.617																																						dbGAP											0													75.0	58.0	64.0					11																	502136		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS7697.1	11p15.5	2008-02-05	2005-06-01	2005-06-01	ENSG00000023191	ENSG00000023191			10074	protein-coding gene	gene with protein product		173320	"""ribonuclease/angiogenin inhibitor"""	RNH			Standard	NM_203386		Approved	RAI	uc001lpo.1	P13489	OTTHUMG00000119086	ENST00000534797.1:c.27C>T	11.37:g.502136G>A			B3KQU4|O60523|O60857|Q57Z93|Q5U0C1|Q6FHD4	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_Cys-con_subtyp	p.D9	ENST00000534797.1	37	c.27	CCDS7697.1	11																																																																																			RNH1	-	NULL	ENSG00000023191		0.617	RNH1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNH1	HGNC	protein_coding	OTTHUMT00000384301.1	55	0.00	0	G	NM_203389		502136	502136	-1	no_errors	ENST00000354420	ensembl	human	known	69_37n	silent	40	13.04	6	SNP	0.797	A
ROCK1	6093	genome.wustl.edu	37	18	18539823	18539823	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr18:18539823G>A	ENST00000399799.2	-	29	4430	c.3490C>T	c.(3490-3492)Cca>Tca	p.P1164S		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	1164	Auto-inhibitory.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					ACCATAGATGGATTGGATTGC	0.308																																						dbGAP											0													61.0	57.0	58.0					18																	18539823		2202	4297	6499	-	-	-	SO:0001583	missense	0				CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.3490C>T	18.37:g.18539823G>A	ENSP00000382697:p.Pro1164Ser		B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Rho-bd,pfam_HR1_rho-bd,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Rho-assoc_coiled-coil_kinase,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.P1164S	ENST00000399799.2	37	c.3490	CCDS11870.2	18	.	.	.	.	.	.	.	.	.	.	G	30	5.050314	0.93740	.	.	ENSG00000067900	ENST00000399799	T	0.23950	1.88	5.23	5.23	0.72850	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.59238	0.2179	M	0.87038	2.855	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.66590	-0.5885	10	0.87932	D	0	.	19.1617	0.93535	0.0:0.0:1.0:0.0	.	1164	Q13464	ROCK1_HUMAN	S	1164	ENSP00000382697:P1164S	ENSP00000382697:P1164S	P	-	1	0	ROCK1	16793821	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.810000	0.99221	2.590000	0.87494	0.585000	0.79938	CCA	ROCK1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pirsf_Rho-assoc_coiled-coil_kinase,pfscan_Pleckstrin_homology	ENSG00000067900		0.308	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROCK1	HGNC	protein_coding	OTTHUMT00000254641.2	54	0.00	0	G	NM_005406		18539823	18539823	-1	no_errors	ENST00000399799	ensembl	human	known	69_37n	missense	61	17.57	13	SNP	1.000	A
RPGRIP1L	23322	genome.wustl.edu	37	16	53706790	53706792	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	TTC	TTC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr16:53706790_53706792delTTC	ENST00000379925.3	-	8	1069_1071	c.1019_1021delGAA	c.(1018-1023)agaata>ata	p.R340del	RPGRIP1L_ENST00000262135.4_In_Frame_Del_p.R340del|RPGRIP1L_ENST00000563746.1_In_Frame_Del_p.R340del|RPGRIP1L_ENST00000564374.1_In_Frame_Del_p.R340del	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	340					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				ACCTCTTCTATTCTTCTTTCAGA	0.33																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0				CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.1019_1021delGAA	16.37:g.53706793_53706795delTTC	ENSP00000369257:p.Arg340del		A0PJ88|Q9Y2K8	In_Frame_Del	DEL	pfam_DUF3250,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.R340in_frame_del	ENST00000379925.3	37	c.1021_1019	CCDS32447.1	16																																																																																			RPGRIP1L	-	NULL	ENSG00000103494		0.330	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	RPGRIP1L	HGNC	protein_coding	OTTHUMT00000422187.1	60	0.00	0	TTC	NM_015272		53706790	53706792	-1	no_errors	ENST00000379925	ensembl	human	known	69_37n	in_frame_del	31	29.55	13	DEL	0.912:0.872:0.870	-
RPS6KA3	6197	genome.wustl.edu	37	X	20213261	20213261	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chrX:20213261G>A	ENST00000379565.3	-	5	535	c.328C>T	c.(328-330)Cga>Tga	p.R110*	RPS6KA3_ENST00000379548.4_Nonsense_Mutation_p.R81*|RPS6KA3_ENST00000540702.1_Nonsense_Mutation_p.R82*|RPS6KA3_ENST00000544447.1_Nonsense_Mutation_p.R82*	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	110	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	ACTCGGTCTCGAACTATAAAA	0.333																																						dbGAP											0			GRCh37	CM981715	RPS6KA3	M							149.0	115.0	127.0					X																	20213261		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.328C>T	X.37:g.20213261G>A	ENSP00000368884:p.Arg110*		B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R110*	ENST00000379565.3	37	c.328	CCDS14197.1	X	.	.	.	.	.	.	.	.	.	.	G	29.0	4.971780	0.92919	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702;ENST00000457145;ENST00000438357	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.1165	0.65156	0.0:0.0:0.8501:0.1499	.	.	.	.	X	110;82;81;82;81;82	.	ENSP00000368865:R81X	R	-	1	2	RPS6KA3	20123182	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.849000	0.39318	2.494000	0.84150	0.600000	0.82982	CGA	RPS6KA3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	ENSG00000177189		0.333	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPS6KA3	HGNC	protein_coding	OTTHUMT00000056011.3	82	0.00	0	G	NM_004586		20213261	20213261	-1	no_errors	ENST00000379565	ensembl	human	known	69_37n	nonsense	54	16.92	11	SNP	1.000	A
RPUSD1	113000	genome.wustl.edu	37	16	837647	837647	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr16:837647T>C	ENST00000561734.1	-	1	334	c.91A>G	c.(91-93)Agc>Ggc	p.S31G	RPUSD1_ENST00000007264.2_Missense_Mutation_p.S31G|RPUSD1_ENST00000565809.1_Missense_Mutation_p.S31G|RPUSD1_ENST00000567114.1_Intron|CHTF18_ENST00000317063.6_5'Flank|CHTF18_ENST00000262315.9_5'Flank|CHTF18_ENST00000455171.2_5'Flank			Q9UJJ7	RUSD1_HUMAN	RNA pseudouridylate synthase domain containing 1	31					pseudouridine synthesis (GO:0001522)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			endometrium(3)|lung(2)|skin(2)	7		Hepatocellular(780;0.00335)				CACGCCTTGCTGTCAATGCGA	0.647																																						dbGAP											0													57.0	54.0	55.0					16																	837647		2196	4298	6494	-	-	-	SO:0001583	missense	0			AE006465	CCDS10426.1	16p13.3	2013-02-11	2005-01-31	2005-01-31	ENSG00000007376	ENSG00000007376		"""RNA pseudouridylate synthase domain containing"""	14173	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 40"""	C16orf40			Standard	NM_058192		Approved	RLUCL, MGC19600	uc002ckb.3	Q9UJJ7	OTTHUMG00000047840	ENST00000561734.1:c.91A>G	16.37:g.837647T>C	ENSP00000455026:p.Ser31Gly		D3DU66	Splice_Site	SNP	-	e1-2	ENST00000561734.1	37	c.1-2	CCDS10426.1	16	.	.	.	.	.	.	.	.	.	.	T	16.74	3.206366	0.58343	.	.	ENSG00000007376	ENST00000007264	T	0.20738	2.05	4.18	3.05	0.35203	Pseudouridine synthase, RsuA and RluB/C/D/E/F (1);Pseudouridine synthase, catalytic domain (1);	0.041576	0.85682	D	0.000000	T	0.15392	0.0371	L	0.28694	0.88	0.80722	D	1	B	0.20368	0.044	B	0.22601	0.04	T	0.05338	-1.0891	10	0.87932	D	0	-26.6166	8.7826	0.34800	0.1692:0.0:0.0:0.8308	.	31	Q9UJJ7	RUSD1_HUMAN	G	31	ENSP00000007264:S31G	ENSP00000007264:S31G	S	-	1	0	RPUSD1	777648	1.000000	0.71417	0.993000	0.49108	0.766000	0.43426	4.873000	0.63057	0.618000	0.30179	0.391000	0.25812	AGC	RPUSD1	-	-	ENSG00000007376		0.647	RPUSD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RPUSD1	HGNC	protein_coding	OTTHUMT00000420620.1	14	0.00	0	T	NM_058192		837647	837647	-1	no_stop_codon	ENST00000569601	ensembl	human	putative	69_37n	splice_site	11	26.67	4	SNP	1.000	C
RUNX2	860	genome.wustl.edu	37	6	45399682	45399682	+	Missense_Mutation	SNP	G	G	A	rs104893995		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:45399682G>A	ENST00000371438.1	+	3	864	c.506G>A	c.(505-507)cGg>cAg	p.R169Q	RUNX2_ENST00000352853.5_Missense_Mutation_p.R237Q|RUNX2_ENST00000371432.3_Missense_Mutation_p.R155Q|RUNX2_ENST00000541979.1_Missense_Mutation_p.R237Q|RUNX2_ENST00000465038.2_Missense_Mutation_p.R169Q|RUNX2_ENST00000576263.1_Missense_Mutation_p.R169Q|RUNX2_ENST00000359524.5_Missense_Mutation_p.R155Q|RUNX2_ENST00000371436.6_Missense_Mutation_p.R169Q	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	169	Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.		R -> P (in CLCD). {ECO:0000269|PubMed:11857736, ECO:0000269|PubMed:12424590}.|R -> Q (in CLCD). {ECO:0000269|PubMed:10545612}.		BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						GCTGAGCTCCGGAATGCCTCT	0.478																																						dbGAP											0			GRCh37	CM020508|CM992608	RUNX2	M	rs104893995						143.0	134.0	137.0					6																	45399682		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.506G>A	6.37:g.45399682G>A	ENSP00000360493:p.Arg169Gln		O14614|O14615|O95181	Missense_Mutation	SNP	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pfscan_AML1/Runt_N,prints_AML1_Runt	p.R237Q	ENST00000371438.1	37	c.710	CCDS43467.2	6	.	.	.	.	.	.	.	.	.	.	G	36	5.663029	0.96745	.	.	ENSG00000124813	ENST00000465038;ENST00000352853;ENST00000541979;ENST00000371438;ENST00000371436;ENST00000359524;ENST00000371432	D;D;D;D;D;D;D	0.99567	-6.18;-6.18;-6.18;-6.18;-6.18;-6.18;-6.18	5.23	5.23	0.72850	Acute myeloid leukemia 1 (AML 1)/Runt (2);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99722	0.9892	M	0.90425	3.115	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.77557	0.937;0.971;0.99	D	0.97695	1.0181	10	0.87932	D	0	-0.7151	19.1642	0.93548	0.0:0.0:1.0:0.0	.	237;169;155	F6RGB9;Q13950;Q13950-2	.;RUNX2_HUMAN;.	Q	169;237;237;169;169;155;155	ENSP00000420707:R169Q;ENSP00000319087:R237Q;ENSP00000446290:R237Q;ENSP00000360493:R169Q;ENSP00000360491:R169Q;ENSP00000352514:R155Q;ENSP00000360486:R155Q	ENSP00000319087:R237Q	R	+	2	0	RUNX2	45507660	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.375000	0.97178	2.600000	0.87896	0.650000	0.86243	CGG	RUNX2	-	pfam_AML1/Runt_N,superfamily_p53-like_TF_DNA-bd,pfscan_AML1/Runt_N,prints_AML1_Runt	ENSG00000124813		0.478	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	RUNX2	HGNC	protein_coding	OTTHUMT00000040755.2	80	0.00	0	G	NM_004348		45399682	45399682	+1	no_errors	ENST00000352853	ensembl	human	known	69_37n	missense	42	10.64	5	SNP	1.000	A
RYR1	6261	genome.wustl.edu	37	19	38987176	38987176	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr19:38987176G>A	ENST00000359596.3	+	41	6791	c.6791G>A	c.(6790-6792)gGc>gAc	p.G2264D	RYR1_ENST00000355481.4_Missense_Mutation_p.G2264D|RYR1_ENST00000360985.3_Missense_Mutation_p.G2264D			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2264	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AGTGGCATCGGCCTGGGTGAG	0.622																																						dbGAP											0													40.0	45.0	43.0					19																	38987176		2203	4299	6502	-	-	-	SO:0001583	missense	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.6791G>A	19.37:g.38987176G>A	ENSP00000352608:p.Gly2264Asp		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.G2264D	ENST00000359596.3	37	c.6791	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936345	0.73442	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.95377	-3.69;-3.69;-3.69	4.83	4.83	0.62350	Intracellular calcium-release channel (1);	0.000000	0.64402	U	0.000002	D	0.96990	0.9017	L	0.58101	1.795	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96824	0.9606	10	0.46703	T	0.11	.	17.6847	0.88253	0.0:0.0:1.0:0.0	.	2264;2264	P21817-2;P21817	.;RYR1_HUMAN	D	2264	ENSP00000352608:G2264D;ENSP00000347667:G2264D;ENSP00000354254:G2264D	ENSP00000347667:G2264D	G	+	2	0	RYR1	43679016	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.612000	0.98347	2.499000	0.84300	0.555000	0.69702	GGC	RYR1	-	pfam_Ca-rel_channel	ENSG00000196218		0.622	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	23	0.00	0	G			38987176	38987176	+1	no_errors	ENST00000359596	ensembl	human	known	69_37n	missense	10	37.50	6	SNP	1.000	A
RYR3	6263	genome.wustl.edu	37	15	34049768	34049768	+	Silent	SNP	C	C	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr15:34049768C>A	ENST00000389232.4	+	60	8746	c.8676C>A	c.(8674-8676)gcC>gcA	p.A2892A	RYR3_ENST00000415757.3_Silent_p.A2892A	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2892					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GCGGATATGCCTCCCATAAGG	0.507																																						dbGAP											0													70.0	65.0	67.0					15																	34049768		1926	4146	6072	-	-	-	SO:0001819	synonymous_variant	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.8676C>A	15.37:g.34049768C>A			O15175|Q15412	Silent	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.A2892	ENST00000389232.4	37	c.8676	CCDS45210.1	15																																																																																			RYR3	-	superfamily_ARM-type_fold	ENSG00000198838		0.507	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	100	0.00	0	C			34049768	34049768	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	silent	47	17.54	10	SNP	1.000	A
RYR3	6263	genome.wustl.edu	37	15	34156378	34156378	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr15:34156378G>A	ENST00000389232.4	+	103	14575	c.14505G>A	c.(14503-14505)gaG>gaA	p.E4835E	RP11-3D4.2_ENST00000560268.1_RNA|RYR3_ENST00000415757.3_Silent_p.E4830E	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	4835					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ATGAAACAGAGCACACGGGTC	0.378																																						dbGAP											0													89.0	90.0	90.0					15																	34156378		1851	4090	5941	-	-	-	SO:0001819	synonymous_variant	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.14505G>A	15.37:g.34156378G>A			O15175|Q15412	Silent	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.E4835	ENST00000389232.4	37	c.14505	CCDS45210.1	15																																																																																			RYR3	-	NULL	ENSG00000198838		0.378	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	66	0.00	0	G			34156378	34156378	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	silent	26	18.75	6	SNP	0.897	A
SAE1	10055	genome.wustl.edu	37	19	47653513	47653513	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr19:47653513C>T	ENST00000270225.7	+	3	333	c.265C>T	c.(265-267)Cga>Tga	p.R89*	SAE1_ENST00000540850.1_5'UTR|SAE1_ENST00000392776.3_Nonsense_Mutation_p.R89*|SAE1_ENST00000413379.3_Nonsense_Mutation_p.R89*|SAE1_ENST00000598840.1_Nonsense_Mutation_p.R89*	NM_005500.2	NP_005491.1	Q9UBE0	SAE1_HUMAN	SUMO1 activating enzyme subunit 1	89					cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|regulation of mitotic cell cycle (GO:0007346)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP-dependent protein binding (GO:0043008)|enzyme activator activity (GO:0008047)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|ubiquitin activating enzyme activity (GO:0004839)			endometrium(3)|large_intestine(5)|lung(4)|ovary(1)	13		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;0.00013)|OV - Ovarian serous cystadenocarcinoma(262;0.000146)|Epithelial(262;0.00697)|GBM - Glioblastoma multiforme(486;0.0278)		GTCTGTTGGCCGAAATAGGGC	0.438																																						dbGAP											0													100.0	100.0	100.0					19																	47653513		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC018271	CCDS12696.1, CCDS54284.1, CCDS54285.1	19q13.32	2013-09-26				ENSG00000142230		"""Ubiquitin-like modifier activating enzymes"""	30660	protein-coding gene	gene with protein product	"""activator Of sumo 1"""	613294				10187858, 9920803, 10217437	Standard	NM_005500		Approved	AOS1, FLJ3091, Sua1	uc002pgc.3	Q9UBE0		ENST00000270225.7:c.265C>T	19.37:g.47653513C>T	ENSP00000270225:p.Arg89*		B2RDP5|B3KMQ2|F5GXX7|G3XAK6|O95717|Q9P020	Nonsense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like	p.R89*	ENST00000270225.7	37	c.265	CCDS12696.1	19	.	.	.	.	.	.	.	.	.	.	C	37	6.300795	0.97453	.	.	ENSG00000142230	ENST00000413379;ENST00000270225;ENST00000392776;ENST00000414294	.	.	.	5.24	5.24	0.73138	.	0.192559	0.46145	D	0.000320	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	13.5771	0.61881	0.1562:0.8438:0.0:0.0	.	.	.	.	X	89	.	ENSP00000270225:R89X	R	+	1	2	SAE1	52345353	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.150000	0.42254	2.609000	0.88269	0.655000	0.94253	CGA	SAE1	-	pfam_ThiF_NAD_FAD-bd,superfamily_Molybdenum_cofac_synth_MoeB	ENSG00000142230		0.438	SAE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SAE1	HGNC	protein_coding	OTTHUMT00000466775.1	62	0.00	0	C	NM_005500		47653513	47653513	+1	no_errors	ENST00000270225	ensembl	human	known	69_37n	nonsense	40	13.04	6	SNP	1.000	T
SAMM50	25813	genome.wustl.edu	37	22	44385035	44385035	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr22:44385035C>A	ENST00000350028.4	+	13	1277	c.1120C>A	c.(1120-1122)Ctc>Atc	p.L374I	SAMM50_ENST00000396202.3_Missense_Mutation_p.L164I	NM_015380.4	NP_056195.3	Q9Y512	SAM50_HUMAN	SAMM50 sorting and assembly machinery component	374					cellular protein metabolic process (GO:0044267)|protein import into mitochondrial outer membrane (GO:0045040)|protein targeting to mitochondrion (GO:0006626)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrial sorting and assembly machinery complex (GO:0001401)|mitochondrion (GO:0005739)				endometrium(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				CGGCCTGCACCTCTACACCCC	0.532																																						dbGAP											0													146.0	135.0	139.0					22																	44385035		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001087	CCDS14055.1	22q13.31	2013-08-21	2013-08-21	2005-11-20	ENSG00000100347	ENSG00000100347			24276	protein-coding gene	gene with protein product		612058	"""sorting and assembly machinery component 50 homolog (S. cerevisiae)"""			15644312	Standard	NM_015380		Approved	CGI-51, TRG-3, YNL026W, OMP85, TOB55	uc003bej.3	Q9Y512	OTTHUMG00000150557	ENST00000350028.4:c.1120C>A	22.37:g.44385035C>A	ENSP00000345445:p.Leu374Ile		Q53HC4|Q56VW7|Q969Y9|Q96I46|Q9NW85|Q9UQM9	Missense_Mutation	SNP	pfam_Bac_surfAg_D15	p.L374I	ENST00000350028.4	37	c.1120	CCDS14055.1	22	.	.	.	.	.	.	.	.	.	.	C	17.02	3.283168	0.59867	.	.	ENSG00000100347	ENST00000350028;ENST00000396202	T;T	0.53423	0.62;0.62	4.21	4.21	0.49690	Bacterial surface antigen (D15) (1);	0.000000	0.64402	D	0.000001	T	0.48277	0.1491	M	0.63843	1.955	0.80722	D	1	P;B	0.38827	0.649;0.057	B;B	0.43274	0.414;0.168	T	0.50972	-0.8764	10	0.49607	T	0.09	-13.8688	9.744	0.40435	0.0:0.9045:0.0:0.0955	.	179;374	B3KUE6;Q9Y512	.;SAM50_HUMAN	I	374;164	ENSP00000345445:L374I;ENSP00000379505:L164I	ENSP00000345445:L374I	L	+	1	0	SAMM50	42716368	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	1.779000	0.38624	2.067000	0.61834	0.650000	0.86243	CTC	SAMM50	-	pfam_Bac_surfAg_D15	ENSG00000100347		0.532	SAMM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMM50	HGNC	protein_coding	OTTHUMT00000318898.2	59	0.00	0	C	NM_015380		44385035	44385035	+1	no_errors	ENST00000350028	ensembl	human	known	69_37n	missense	48	20.00	12	SNP	1.000	A
SCAF11	9169	genome.wustl.edu	37	12	46320516	46320517	+	Frame_Shift_Ins	INS	-	-	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:46320516_46320517insT	ENST00000369367.3	-	11	3200_3201	c.2967_2968insA	c.(2965-2970)ccagagfs	p.E990fs	SCAF11_ENST00000465950.1_Frame_Shift_Ins_p.E675fs|SCAF11_ENST00000549162.1_Frame_Shift_Ins_p.E798fs|SCAF11_ENST00000419565.2_Frame_Shift_Ins_p.E990fs|SCAF11_ENST00000550629.1_5'Flank	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	990					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						TTCTGTTTCTCTGGGTCATTCT	0.406																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.2968dupA	12.37:g.46320517_46320517dupT	ENSP00000358374:p.Glu990fs		A6NEU9|A6NLW5|Q8IW59	Frame_Shift_Ins	INS	smart_Znf_RING,pfscan_Znf_RING	p.E989fs	ENST00000369367.3	37	c.2968_2967	CCDS8748.2	12																																																																																			SCAF11	-	NULL	ENSG00000139218		0.406	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF11	HGNC	protein_coding	OTTHUMT00000313992.2	61	0.00	0	-	NM_004719		46320516	46320517	-1	no_errors	ENST00000369367	ensembl	human	known	69_37n	frame_shift_ins	65	13.33	10	INS	0.998:0.794	T
SEC14L5	9717	genome.wustl.edu	37	16	5046950	5046950	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr16:5046950G>A	ENST00000251170.7	+	8	1055	c.875G>A	c.(874-876)cGc>cAc	p.R292H		NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)	292						integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						TTGAGCTGGCGCAAGCAGCAC	0.597																																						dbGAP											0													43.0	42.0	42.0					16																	5046950		1923	4122	6045	-	-	-	SO:0001583	missense	0			AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.875G>A	16.37:g.5046950G>A	ENSP00000251170:p.Arg292His			Missense_Mutation	SNP	pfam_PRELI/MSF1,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,superfamily_GOLD,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,pfscan_PRELI/MSF1,prints_CRAL-bd_toc_tran	p.R292H	ENST00000251170.7	37	c.875	CCDS45403.1	16	.	.	.	.	.	.	.	.	.	.	G	33	5.271207	0.95429	.	.	ENSG00000103184	ENST00000251170	D	0.86956	-2.19	4.66	4.66	0.58398	Cellular retinaldehyde-binding/triple function, C-terminal (1);Phosphatidylinositol transfer protein-like, N-terminal (1);	0.226322	0.29924	N	0.010851	D	0.96087	0.8725	H	0.97315	3.98	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.97623	1.0137	10	0.87932	D	0	-10.918	18.0897	0.89471	0.0:0.0:1.0:0.0	.	292	O43304	S14L5_HUMAN	H	292	ENSP00000251170:R292H	ENSP00000251170:R292H	R	+	2	0	SEC14L5	4986951	1.000000	0.71417	0.994000	0.49952	0.954000	0.61252	9.099000	0.94207	2.573000	0.86826	0.491000	0.48974	CGC	SEC14L5	-	superfamily_CRAL/TRIO_N_dom	ENSG00000103184		0.597	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L5	HGNC	protein_coding	OTTHUMT00000434379.1	51	0.00	0	G			5046950	5046950	+1	no_errors	ENST00000251170	ensembl	human	known	69_37n	missense	31	16.22	6	SNP	1.000	A
SEC24C	9632	genome.wustl.edu	37	10	75510956	75510956	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr10:75510956A>G	ENST00000339365.2	+	4	425	c.263A>G	c.(262-264)cAa>cGa	p.Q88R	SEC24C_ENST00000546025.1_Intron|SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000411652.2_Intron|SEC24C_ENST00000540668.1_Intron|SEC24C_ENST00000345254.4_Missense_Mutation_p.Q88R	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	88					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					CAGTTTGGCCAAGGAGATGTA	0.537																																						dbGAP											0													83.0	67.0	72.0					10																	75510956		2203	4300	6503	-	-	-	SO:0001583	missense	0			D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.263A>G	10.37:g.75510956A>G	ENSP00000343405:p.Gln88Arg		B4DZT4|Q8WV25	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.Q88R	ENST00000339365.2	37	c.263	CCDS7332.1	10	.	.	.	.	.	.	.	.	.	.	A	21.7	4.186627	0.78789	.	.	ENSG00000176986	ENST00000345254;ENST00000339365	T;T	0.78364	-1.17;-1.17	5.77	5.77	0.91146	.	0.288191	0.41194	D	0.000935	T	0.68742	0.3034	L	0.46157	1.445	0.80722	D	1	P	0.38922	0.651	B	0.33521	0.165	T	0.67277	-0.5711	10	0.11182	T	0.66	-6.8652	16.068	0.80903	1.0:0.0:0.0:0.0	.	88	P53992	SC24C_HUMAN	R	88	ENSP00000321845:Q88R;ENSP00000343405:Q88R	ENSP00000343405:Q88R	Q	+	2	0	SEC24C	75180962	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.873000	0.63057	2.326000	0.78906	0.533000	0.62120	CAA	SEC24C	-	NULL	ENSG00000176986		0.537	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24C	HGNC	protein_coding	OTTHUMT00000048679.1	37	0.00	0	A			75510956	75510956	+1	no_errors	ENST00000339365	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	1.000	G
SEMA4D	10507	genome.wustl.edu	37	9	91994160	91994160	+	Frame_Shift_Del	DEL	G	G	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr9:91994160delG	ENST00000450295.1	-	16	2824	c.2048delC	c.(2047-2049)ccafs	p.P683fs	SEMA4D_ENST00000343780.4_Intron|SEMA4D_ENST00000420987.1_Intron|SEMA4D_ENST00000339861.4_Intron|SEMA4D_ENST00000422704.2_Frame_Shift_Del_p.P683fs|SEMA4D_ENST00000438547.2_Frame_Shift_Del_p.P683fs|SEMA4D_ENST00000455551.2_Intron|SEMA4D_ENST00000356444.2_Frame_Shift_Del_p.P683fs			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	683					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						GGCTGGGGTTGGGGGAGAAGA	0.607																																						dbGAP											0													64.0	69.0	67.0					9																	91994160		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.2048delC	9.37:g.91994160delG	ENSP00000416523:p.Pro683fs		B2RPM6|Q7Z5S4|Q8N8B0	Frame_Shift_Del	DEL	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,pfam_Immunoglobulin,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,smart_Ig_sub2,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.P683fs	ENST00000450295.1	37	c.2048	CCDS6685.1	9																																																																																			SEMA4D	-	NULL	ENSG00000187764		0.607	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA4D	HGNC	protein_coding	OTTHUMT00000342411.1	42	0.00	0	G	NM_006378		91994160	91994160	-1	no_errors	ENST00000356444	ensembl	human	known	69_37n	frame_shift_del	20	12.00	3	DEL	0.000	-
SETBP1	26040	genome.wustl.edu	37	18	42532994	42532994	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr18:42532994C>T	ENST00000282030.5	+	4	3985	c.3689C>T	c.(3688-3690)aCc>aTc	p.T1230I		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1230						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GAGGTGGACACCCTGTCTACA	0.517									Schinzel-Giedion syndrome																													dbGAP											0													73.0	72.0	73.0					18																	42532994		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.3689C>T	18.37:g.42532994C>T	ENSP00000282030:p.Thr1230Ile		A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	smart_AT_hook_DNA-bd_motif	p.T1230I	ENST00000282030.5	37	c.3689	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	C	21.2	4.110355	0.77210	.	.	ENSG00000152217	ENST00000282030	T	0.70986	-0.53	6.17	5.29	0.74685	.	0.052235	0.85682	D	0.000000	T	0.75064	0.3799	L	0.32530	0.975	0.33198	D	0.551781	D	0.53885	0.963	P	0.58454	0.839	T	0.82904	-0.0226	10	0.72032	D	0.01	.	16.8466	0.85982	0.1295:0.8705:0.0:0.0	.	1230	Q9Y6X0	SETBP_HUMAN	I	1230	ENSP00000282030:T1230I	ENSP00000282030:T1230I	T	+	2	0	SETBP1	40786992	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.563000	0.53784	1.575000	0.49775	0.655000	0.94253	ACC	SETBP1	-	NULL	ENSG00000152217		0.517	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4	32	0.00	0	C	NM_001130110		42532994	42532994	+1	no_errors	ENST00000282030	ensembl	human	known	69_37n	missense	27	25.00	9	SNP	1.000	T
SETD1B	23067	genome.wustl.edu	37	12	122263255	122263255	+	Frame_Shift_Del	DEL	C	C	-	rs545140521		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:122263255delC	ENST00000604567.1	+	13	5388	c.5320delC	c.(5320-5322)cccfs	p.P1775fs	SETD1B_ENST00000542440.1_Frame_Shift_Del_p.P1732fs|SETD1B_ENST00000267197.5_Frame_Shift_Del_p.P1732fs			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	1775					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						CACCGATGAGCCCCCCGCAGA	0.647																																						dbGAP											0													35.0	39.0	38.0					12																	122263255		692	1591	2283	-	-	-	SO:0001589	frameshift_variant	0			AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.5320delC	12.37:g.122263255delC	ENSP00000474253:p.Pro1775fs		F6MFW1	Frame_Shift_Del	DEL	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.A1733fs	ENST00000604567.1	37	c.5191		12																																																																																			SETD1B	-	pfam_COMPASS_Set1_N-SET	ENSG00000139718		0.647	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	SETD1B	HGNC	protein_coding	OTTHUMT00000468264.1	29	0.00	0	C	XM_037523		122263255	122263255	+1	no_errors	ENST00000267197	ensembl	human	known	69_37n	frame_shift_del	12	33.33	6	DEL	1.000	-
SETDB2	83852	genome.wustl.edu	37	13	50050946	50050946	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr13:50050946A>G	ENST00000317257.8	+	7	1501	c.676A>G	c.(676-678)Acc>Gcc	p.T226A	SETDB2_ENST00000258672.5_Missense_Mutation_p.T214A|SETDB2_ENST00000354234.4_Missense_Mutation_p.T214A	NM_031915.2	NP_114121.2	Q96T68	SETB2_HUMAN	SET domain, bifurcated 2	226	MBD. {ECO:0000255|PROSITE- ProRule:PRU00338}.				chromosome segregation (GO:0007059)|heart looping (GO:0001947)|histone H3-K9 methylation (GO:0051567)|left/right axis specification (GO:0070986)|mitotic nuclear division (GO:0007067)|negative regulation of transcription, DNA-templated (GO:0045892)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	15		Lung NSC(96;0.000408)|Breast(56;0.00131)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.1e-09)		TTCTTTCAATACCTATGTTCA	0.388																																						dbGAP											0													113.0	114.0	113.0					13																	50050946		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF334407	CCDS9417.1, CCDS53868.1	13q14	2011-07-01	2003-05-06	2003-05-09	ENSG00000136169	ENSG00000136169		"""Chromatin-modifying enzymes / K-methyltransferases"""	20263	protein-coding gene	gene with protein product		607865	"""chromosome 13 open reading frame 4"""	C13orf4		11306461	Standard	NM_031915		Approved	CLLD8, CLLL8, KMT1F	uc001vda.3	Q96T68	OTTHUMG00000016918	ENST00000317257.8:c.676A>G	13.37:g.50050946A>G	ENSP00000326477:p.Thr226Ala		Q5TC65|Q5TC66|Q5W0A7|Q659A7|Q86UD6|Q96AI6	Missense_Mutation	SNP	pfam_SET_dom,pfam_Pre-SET_dom,pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Methyl_CpG_DNA-bd,pfscan_SET_dom,pfscan_Pre-SET_dom	p.T226A	ENST00000317257.8	37	c.676	CCDS9417.1	13	.	.	.	.	.	.	.	.	.	.	A	18.47	3.630210	0.67015	.	.	ENSG00000136169	ENST00000354234;ENST00000317257;ENST00000258672	D;D;D	0.99338	-5.76;-5.76;-5.76	5.96	5.96	0.96718	Methyl-CpG DNA binding (3);DNA-binding, integrase-type (1);	0.043191	0.85682	D	0.000000	D	0.98830	0.9605	L	0.41356	1.27	0.53688	D	0.999972	B;D;D	0.89917	0.4;1.0;1.0	B;D;D	0.91635	0.131;0.999;0.999	D	0.99898	1.1153	10	0.11182	T	0.66	.	16.4484	0.83959	1.0:0.0:0.0:0.0	.	226;214;226	Q96T68-3;Q96T68-2;Q96T68	.;.;SETB2_HUMAN	A	214;226;214	ENSP00000346175:T214A;ENSP00000326477:T226A;ENSP00000258672:T214A	ENSP00000258672:T214A	T	+	1	0	SETDB2	48948947	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.050000	0.64251	2.285000	0.76669	0.533000	0.62120	ACC	SETDB2	-	pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd	ENSG00000136169		0.388	SETDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SETDB2	HGNC	protein_coding	OTTHUMT00000044925.1	58	0.00	0	A	NM_031915		50050946	50050946	+1	no_errors	ENST00000317257	ensembl	human	known	69_37n	missense	33	13.16	5	SNP	1.000	G
SFN	2810	genome.wustl.edu	37	1	27189737	27189737	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:27189737C>T	ENST00000339276.4	+	1	105	c.34C>T	c.(34-36)Ctg>Ttg	p.L12L		NM_006142.3	NP_006133.1	Q9Y3B8	ORN_HUMAN	stratifin	0					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide metabolic process (GO:0009117)	focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(2)	9		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.1e-52)|Epithelial(14;2.31e-52)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)|GBM - Glioblastoma multiforme(114;0.0767)|Lung(427;0.215)		GAAGGCCAAGCTGGCAGAGCA	0.627																																						dbGAP											0													51.0	56.0	54.0					1																	27189737		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC023552	CCDS288.1	1p36.11	2008-02-05			ENSG00000175793	ENSG00000175793			10773	protein-coding gene	gene with protein product	"""14-3-3 sigma"""	601290				8515476	Standard	NM_006142		Approved	YWHAS	uc001bnc.1	P31947	OTTHUMG00000004093	ENST00000339276.4:c.34C>T	1.37:g.27189737C>T			B2R532|Q32Q18|Q53FT1|Q6FIC6|Q9UFY7	Silent	SNP	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3	p.L12	ENST00000339276.4	37	c.34	CCDS288.1	1																																																																																			SFN	-	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3	ENSG00000175793		0.627	SFN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFN	HGNC	protein_coding	OTTHUMT00000011709.1	23	0.00	0	C	NM_006142		27189737	27189737	+1	no_errors	ENST00000339276	ensembl	human	known	69_37n	silent	14	33.33	7	SNP	0.985	T
SH2B1	25970	genome.wustl.edu	37	16	28884971	28884971	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr16:28884971G>A	ENST00000322610.8	+	11	2540	c.2101G>A	c.(2101-2103)Gtg>Atg	p.V701M	SH2B1_ENST00000563674.1_3'UTR|SH2B1_ENST00000337120.5_3'UTR|SH2B1_ENST00000538342.1_3'UTR|SH2B1_ENST00000359285.5_3'UTR			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1	701					blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						GCTGGTCCCCGTGGTTGAATT	0.667																																						dbGAP											0													75.0	113.0	101.0					16																	28884971		692	1591	2283	-	-	-	SO:0001583	missense	0			AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2		ENST00000322610.8:c.2101G>A	16.37:g.28884971G>A	ENSP00000321221:p.Val701Met		A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Missense_Mutation	SNP	pfam_Phe_ZIP,pfam_Pleckstrin_homology,pfam_SH2,superfamily_Phe_ZIP,smart_Pleckstrin_homology,smart_SH2,prints_SH2,pfscan_SH2	p.V701M	ENST00000322610.8	37	c.2101	CCDS53996.1	16	.	.	.	.	.	.	.	.	.	.	G	10.03	1.239394	0.22711	.	.	ENSG00000178188	ENST00000322610	T	0.48201	0.82	3.78	-0.339	0.12647	.	0.499033	0.14987	N	0.286883	T	0.24353	0.0590	N	0.14661	0.345	0.80722	D	1	B	0.15930	0.015	B	0.06405	0.002	T	0.07083	-1.0791	9	.	.	.	-11.3648	7.4548	0.27258	0.408:0.0:0.592:0.0	.	701	Q9NRF2	SH2B1_HUMAN	M	701	ENSP00000321221:V701M	.	V	+	1	0	SH2B1	28792472	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	0.370000	0.20433	-0.027000	0.13873	-0.229000	0.12294	GTG	SH2B1	-	NULL	ENSG00000178188		0.667	SH2B1-001	KNOWN	basic|CCDS	protein_coding	SH2B1	HGNC	protein_coding	OTTHUMT00000432666.1	70	0.00	0	G	NM_015503		28884971	28884971	+1	no_errors	ENST00000322610	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	1.000	A
SHISA3	152573	genome.wustl.edu	37	4	42403144	42403144	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr4:42403144G>A	ENST00000319234.4	+	2	611	c.393G>A	c.(391-393)caG>caA	p.Q131Q		NM_001080505.1	NP_001073974.1	A0PJX4	SHSA3_HUMAN	shisa family member 3	131					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	12						AGCCCTCGCAGCAGCCAATCC	0.577																																						dbGAP											0													188.0	200.0	196.0					4																	42403144		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC012029	CCDS33979.1	4p13	2013-07-31	2013-07-31		ENSG00000178343	ENSG00000178343		"""Shisa homologs"""	25159	protein-coding gene	gene with protein product			"""shisa homolog 3 (Xenopus laevis)"""				Standard	NM_001080505		Approved	hShisa3	uc003gwp.3	A0PJX4	OTTHUMG00000161043	ENST00000319234.4:c.393G>A	4.37:g.42403144G>A			A0PJX3|Q96EQ5	Silent	SNP	NULL	p.Q131	ENST00000319234.4	37	c.393	CCDS33979.1	4																																																																																			SHISA3	-	NULL	ENSG00000178343		0.577	SHISA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHISA3	HGNC	protein_coding	OTTHUMT00000363539.1	113	0.00	0	G	NM_001080505		42403144	42403144	+1	no_errors	ENST00000319234	ensembl	human	known	69_37n	silent	43	17.31	9	SNP	1.000	A
SIRT3	23410	genome.wustl.edu	37	11	233199	233199	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr11:233199G>T	ENST00000382743.4	-	3	592	c.490C>A	c.(490-492)Ctg>Atg	p.L164M	SIRT3_ENST00000524564.1_Missense_Mutation_p.L100M|SIRT3_ENST00000528702.1_5'UTR|SIRT3_ENST00000529382.1_Missense_Mutation_p.L22M|SIRT3_ENST00000532956.1_Missense_Mutation_p.L164M|SIRT3_ENST00000525319.1_Missense_Mutation_p.L83M	NM_001017524.2|NM_012239.5	NP_001017524.1|NP_036371.1	Q9NTG7	SIR3_HUMAN	sirtuin 3	164	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				aerobic respiration (GO:0009060)|peptidyl-lysine deacetylation (GO:0034983)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)	membrane (GO:0016020)|mitochondrion (GO:0005739)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|zinc ion binding (GO:0008270)			endometrium(1)|lung(5)|urinary_tract(1)	7		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.66e-27)|Epithelial(43;2.02e-26)|OV - Ovarian serous cystadenocarcinoma(40;2.9e-21)|BRCA - Breast invasive adenocarcinoma(625;3.88e-05)|Lung(200;0.111)|LUSC - Lung squamous cell carcinoma(625;0.129)		TTGCTGTACAGGCCACTCCCC	0.552																																						dbGAP											0													57.0	60.0	59.0					11																	233199		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF083108	CCDS7691.1, CCDS53590.1	11p15.5	2010-06-25	2010-06-25		ENSG00000142082	ENSG00000142082			14931	protein-coding gene	gene with protein product		604481	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 3"", ""sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae)"""			10381378, 18215119	Standard	NM_012239		Approved	SIR2L3	uc001lok.4	Q9NTG7	OTTHUMG00000119074	ENST00000382743.4:c.490C>A	11.37:g.233199G>T	ENSP00000372191:p.Leu164Met		B7Z5U6|Q9Y6E8	Missense_Mutation	SNP	pfam_NAD-dep_deAcase_sirtuin,pirsf_NAD-dep_deAcase_SIR2_euk,pfscan_NAD-dep_deAcase_sirtuin	p.L164M	ENST00000382743.4	37	c.490	CCDS7691.1	11	.	.	.	.	.	.	.	.	.	.	G	17.66	3.445460	0.63178	.	.	ENSG00000142082	ENST00000382743;ENST00000525319;ENST00000524564;ENST00000532956;ENST00000529382;ENST00000528469;ENST00000525776	T;T;T;T;T;T;T	0.59224	0.28;0.28;0.28;0.28;0.28;0.28;0.28	5.29	2.36	0.29203	.	0.213902	0.40908	D	0.000990	T	0.80287	0.4595	H	0.95260	3.645	0.37509	D	0.917077	D;D;D;D;D	0.89917	1.0;0.999;0.994;0.996;0.999	D;D;D;D;D	0.87578	0.997;0.998;0.988;0.981;0.994	T	0.82796	-0.0280	10	0.87932	D	0	-8.4975	9.4934	0.38974	0.229:0.0:0.771:0.0	.	164;164;83;100;164	E9PM75;B7Z7G4;E9PK80;E9PN58;Q9NTG7	.;.;.;.;SIRT3_HUMAN	M	164;83;100;164;22;22;22	ENSP00000372191:L164M;ENSP00000435464:L83M;ENSP00000432937:L100M;ENSP00000433077:L164M;ENSP00000437216:L22M;ENSP00000432857:L22M;ENSP00000433132:L22M	ENSP00000372191:L164M	L	-	1	2	SIRT3	223199	1.000000	0.71417	0.004000	0.12327	0.804000	0.45430	4.804000	0.62554	0.212000	0.20703	0.651000	0.88453	CTG	SIRT3	-	pfam_NAD-dep_deAcase_sirtuin,pirsf_NAD-dep_deAcase_SIR2_euk,pfscan_NAD-dep_deAcase_sirtuin	ENSG00000142082		0.552	SIRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT3	HGNC	protein_coding	OTTHUMT00000239288.3	54	0.00	0	G			233199	233199	-1	no_errors	ENST00000382743	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	0.936	T
SIK3	23387	genome.wustl.edu	37	11	116734457	116734457	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr11:116734457G>A	ENST00000292055.4	-	15	1747	c.1712C>T	c.(1711-1713)gCt>gTt	p.A571V	SIK3_ENST00000375288.1_Silent_p.L3L|SIK3_ENST00000375300.1_Missense_Mutation_p.A629V|SIK3_ENST00000542607.1_Missense_Mutation_p.A571V|SIK3_ENST00000446921.2_Missense_Mutation_p.A629V|SIK3_ENST00000434315.2_Missense_Mutation_p.A470V|SIK3_ENST00000488337.1_5'UTR	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	571					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						GATGCTCGCAGCCCCATCTGA	0.542																																						dbGAP											0													154.0	149.0	151.0					11																	116734457		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.1712C>T	11.37:g.116734457G>A	ENSP00000292055:p.Ala571Val		A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom	p.A629V	ENST00000292055.4	37	c.1886	CCDS8379.1	11	.	.	.	.	.	.	.	.	.	.	g	35	5.464439	0.96257	.	.	ENSG00000160584	ENST00000375300;ENST00000292055;ENST00000542607;ENST00000434315	T;T;T;T	0.75589	-0.92;-0.95;-0.84;-0.48	5.53	5.53	0.82687	Protein kinase-like domain (1);	0.000000	0.41194	U	0.000938	T	0.81654	0.4868	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.996	D	0.83425	0.0035	10	0.87932	D	0	.	19.4611	0.94918	0.0:0.0:1.0:0.0	.	571;470;571	A1A5A8;A1A5A9;Q9Y2K2	.;.;SIK3_HUMAN	V	629;571;571;470	ENSP00000364449:A629V;ENSP00000292055:A571V;ENSP00000438108:A571V;ENSP00000415873:A470V	ENSP00000292055:A571V	A	-	2	0	SIK3	116239667	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.592000	0.87571	0.561000	0.74099	GCT	SIK3	-	NULL	ENSG00000160584		0.542	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIK3	HGNC	protein_coding		90	0.00	0	G	NM_025164		116734457	116734457	-1	no_errors	ENST00000375300	ensembl	human	known	69_37n	missense	43	15.69	8	SNP	1.000	A
SKIV2L2	23517	genome.wustl.edu	37	5	54624574	54624574	+	Silent	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:54624574T>C	ENST00000230640.5	+	5	704	c.450T>C	c.(448-450)tgT>tgC	p.C150C	SKIV2L2_ENST00000545714.1_Silent_p.C49C	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	150	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				CCATTCAGTGTGTTGACAATA	0.373																																					Melanoma(2;92 134 23744 29976 33782)	dbGAP											0													176.0	169.0	171.0					5																	54624574		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.450T>C	5.37:g.54624574T>C			Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	NULL	p.V82A	ENST00000230640.5	37	c.245	CCDS3967.1	5																																																																																			SKIV2L2	-	NULL	ENSG00000039123		0.373	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIV2L2	HGNC	protein_coding	OTTHUMT00000214108.1	106	0.00	0	T			54624574	54624574	+1	no_errors	ENST00000506750	ensembl	human	known	69_37n	missense	85	13.27	13	SNP	1.000	C
SLC25A18	83733	genome.wustl.edu	37	22	18070764	18070764	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr22:18070764G>A	ENST00000327451.6	+	9	1187	c.649G>A	c.(649-651)Ggt>Agt	p.G217S	AC004019.13_ENST00000443935.1_RNA|SLC25A18_ENST00000399813.1_Missense_Mutation_p.G217S	NM_031481.1	NP_113669.1	Q9H1K4	GHC2_HUMAN	solute carrier family 25 (glutamate carrier), member 18	217						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	symporter activity (GO:0015293)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)	18				Lung(27;0.124)		CGAGCTCGCCGGTAAGGCGTC	0.527																																					Colon(118;1560 1625 18964 29606 50093)	dbGAP											0													209.0	167.0	181.0					22																	18070764		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY008285	CCDS13744.1	22q11.2	2013-05-22	2012-03-29		ENSG00000182902	ENSG00000182902		"""Solute carriers"""	10988	protein-coding gene	gene with protein product		609303	"""solute carrier family 25 (mitochondrial carrier), member 18"""			11381032, 11897791	Standard	NM_031481		Approved		uc002zmp.1	Q9H1K4	OTTHUMG00000150089	ENST00000327451.6:c.649G>A	22.37:g.18070764G>A	ENSP00000329033:p.Gly217Ser			Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.G217S	ENST00000327451.6	37	c.649	CCDS13744.1	22	.	.	.	.	.	.	.	.	.	.	G	14.12	2.441866	0.43326	.	.	ENSG00000182902	ENST00000327451;ENST00000399813	D;D	0.81579	-1.51;-1.51	4.54	4.54	0.55810	Mitochondrial carrier domain (2);	0.590344	0.18517	N	0.138896	T	0.78515	0.4295	L	0.43152	1.355	0.33544	D	0.5952	P	0.44946	0.846	P	0.45195	0.473	D	0.83710	0.0187	10	0.38643	T	0.18	.	16.4595	0.84032	0.0:0.0:1.0:0.0	.	217	Q9H1K4	GHC2_HUMAN	S	217	ENSP00000329033:G217S;ENSP00000382710:G217S	ENSP00000329033:G217S	G	+	1	0	SLC25A18	16450764	1.000000	0.71417	0.669000	0.29828	0.350000	0.29205	7.031000	0.76491	2.234000	0.73211	0.555000	0.69702	GGT	SLC25A18	-	superfamily_Mt_carrier_dom	ENSG00000182902		0.527	SLC25A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A18	HGNC	protein_coding	OTTHUMT00000316214.3	89	0.00	0	G	NM_031481		18070764	18070764	+1	no_errors	ENST00000327451	ensembl	human	known	69_37n	missense	49	15.52	9	SNP	0.742	A
SLC9A2	6549	genome.wustl.edu	37	2	103321037	103321037	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:103321037A>G	ENST00000233969.2	+	10	2022	c.1880A>G	c.(1879-1881)gAc>gGc	p.D627G		NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	627					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						CTGACAGCCGACACAAGTGAG	0.433																																						dbGAP											0													85.0	80.0	82.0					2																	103321037		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.1880A>G	2.37:g.103321037A>G	ENSP00000233969:p.Asp627Gly		B2RMS2	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_2,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.D627G	ENST00000233969.2	37	c.1880	CCDS2062.1	2	.	.	.	.	.	.	.	.	.	.	A	13.62	2.291533	0.40494	.	.	ENSG00000115616	ENST00000233969	T	0.61392	0.11	5.25	5.25	0.73442	.	0.640148	0.17425	N	0.174687	T	0.52386	0.1731	L	0.43152	1.355	0.46317	D	0.998989	B	0.09022	0.002	B	0.06405	0.002	T	0.49698	-0.8912	10	0.54805	T	0.06	.	15.4496	0.75262	1.0:0.0:0.0:0.0	.	627	Q9UBY0	SL9A2_HUMAN	G	627	ENSP00000233969:D627G	ENSP00000233969:D627G	D	+	2	0	SLC9A2	102687469	1.000000	0.71417	0.987000	0.45799	0.444000	0.32077	3.845000	0.55880	2.097000	0.63578	0.533000	0.62120	GAC	SLC9A2	-	prints_Na/H_exchanger_2,tigrfam_NaH_exchanger	ENSG00000115616		0.433	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A2	HGNC	protein_coding	OTTHUMT00000253292.2	60	0.00	0	A			103321037	103321037	+1	no_errors	ENST00000233969	ensembl	human	known	69_37n	missense	29	21.62	8	SNP	1.000	G
SMAD3	4088	genome.wustl.edu	37	15	67358560	67358560	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr15:67358560A>G	ENST00000327367.4	+	1	378	c.68A>G	c.(67-69)cAg>cGg	p.Q23R		NM_005902.3	NP_005893.1	P84022	SMAD3_HUMAN	SMAD family member 3	23	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell-cell junction organization (GO:0045216)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|embryonic pattern specification (GO:0009880)|endoderm development (GO:0007492)|evasion or tolerance of host defenses by virus (GO:0019049)|extrinsic apoptotic signaling pathway (GO:0097191)|gene expression (GO:0010467)|heart looping (GO:0001947)|immune response (GO:0006955)|immune system development (GO:0002520)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|lens fiber cell differentiation (GO:0070306)|liver development (GO:0001889)|mesoderm formation (GO:0001707)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)|nodal signaling pathway (GO:0038092)|osteoblast development (GO:0002076)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta3 production (GO:0032916)|primary miRNA processing (GO:0031053)|protein stabilization (GO:0050821)|regulation of binding (GO:0051098)|regulation of epithelial cell proliferation (GO:0050678)|regulation of immune response (GO:0050776)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|somitogenesis (GO:0001756)|T cell activation (GO:0042110)|thyroid gland development (GO:0030878)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transport (GO:0006810)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|bHLH transcription factor binding (GO:0043425)|chromatin DNA binding (GO:0031490)|co-SMAD binding (GO:0070410)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(11)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		AAGGGCGAGCAGAACGGGCAG	0.647																																						dbGAP											0													84.0	80.0	81.0					15																	67358560		2201	4299	6500	-	-	-	SO:0001583	missense	0			BC050743	CCDS10222.1, CCDS45288.1, CCDS53950.1, CCDS53951.1	15q21-q22	2006-11-06	2006-11-06	2004-05-26	ENSG00000166949	ENSG00000166949		"""SMADs"""	6769	protein-coding gene	gene with protein product		603109	"""MAD, mothers against decapentaplegic homolog 3 (Drosophila)"", ""SMAD, mothers against DPP homolog 3 (Drosophila)"""	MADH3		8774881, 8673135	Standard	NM_001145102		Approved	JV15-2, HsT17436	uc002aqj.3	P84022	OTTHUMG00000133230	ENST00000327367.4:c.68A>G	15.37:g.67358560A>G	ENSP00000332973:p.Gln23Arg		A8K4B6|B7Z4Z5|B7Z6M9|B7Z9Q2|F5H383|O09064|O09144|O14510|O35273|Q92940|Q93002|Q9GKR4	Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.Q23R	ENST00000327367.4	37	c.68	CCDS10222.1	15	.	.	.	.	.	.	.	.	.	.	A	15.86	2.958787	0.53400	.	.	ENSG00000166949	ENST00000327367;ENST00000535241	T	0.74421	-0.84	4.55	4.55	0.56014	MAD homology, MH1 (3);	0.070992	0.64402	D	0.000018	T	0.66684	0.2814	L	0.38175	1.15	0.52099	D	0.999948	B	0.25850	0.136	B	0.28553	0.091	T	0.67971	-0.5532	10	0.72032	D	0.01	.	13.3665	0.60687	1.0:0.0:0.0:0.0	.	23	P84022	SMAD3_HUMAN	R	23	ENSP00000332973:Q23R	ENSP00000332973:Q23R	Q	+	2	0	SMAD3	65145614	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.619000	0.67729	1.794000	0.52575	0.454000	0.30748	CAG	SMAD3	-	superfamily_MAD_homology_MH1,pfscan_MAD_homology_MH1	ENSG00000166949		0.647	SMAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD3	HGNC	protein_coding	OTTHUMT00000256967.2	34	0.00	0	A	NM_005902		67358560	67358560	+1	no_errors	ENST00000327367	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	G
SMARCC2	6601	genome.wustl.edu	37	12	56572801	56572801	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:56572801C>T	ENST00000267064.4	-	12	1207	c.1121G>A	c.(1120-1122)gGc>gAc	p.G374D	RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000550164.1_Missense_Mutation_p.G374D|SMARCC2_ENST00000394023.3_Missense_Mutation_p.G374D|SMARCC2_ENST00000550859.1_5'Flank|SMARCC2_ENST00000347471.4_Missense_Mutation_p.G374D	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	374					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			CATGGTGCCGCCTTTGACTGG	0.522																																						dbGAP											0													78.0	79.0	79.0					12																	56572801		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.1121G>A	12.37:g.56572801C>T	ENSP00000267064:p.Gly374Asp		F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.G374D	ENST00000267064.4	37	c.1121	CCDS8907.1	12	.	.	.	.	.	.	.	.	.	.	C	29.8	5.036866	0.93630	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T	0.49720	0.81;0.83;0.77	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.70404	0.3220	M	0.79693	2.465	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.83275	0.992;0.996;0.992;0.992;0.996	T	0.72626	-0.4236	10	0.49607	T	0.09	-12.4514	17.1013	0.86651	0.0:1.0:0.0:0.0	.	263;374;379;374;374	B4DF22;F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;.;SMRC2_HUMAN;.	D	374	ENSP00000449396:G374D;ENSP00000302919:G374D;ENSP00000267064:G374D	ENSP00000267064:G374D	G	-	2	0	SMARCC2	54859068	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.151000	0.77411	2.647000	0.89833	0.650000	0.86243	GGC	SMARCC2	-	superfamily_Chromodomain-like	ENSG00000139613		0.522	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCC2	HGNC	protein_coding	OTTHUMT00000408370.1	63	0.00	0	C			56572801	56572801	-1	no_errors	ENST00000267064	ensembl	human	known	69_37n	missense	45	15.09	8	SNP	1.000	T
SMG9	56006	genome.wustl.edu	37	19	44252160	44252160	+	Frame_Shift_Del	DEL	G	G	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr19:44252160delG	ENST00000270066.6	-	3	537	c.195delC	c.(193-195)cccfs	p.P65fs	SMG9_ENST00000601170.1_Frame_Shift_Del_p.P65fs	NM_019108.2	NP_061981.2	Q9H0W8	SMG9_HUMAN	SMG9 nonsense mediated mRNA decay factor	65					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|intracellular (GO:0005622)	identical protein binding (GO:0042802)			kidney(1)|large_intestine(5)|liver(1)|lung(7)|pancreas(1)|prostate(2)|urinary_tract(2)	19						AGAGGATGATGGGGGTTTTCT	0.537																																						dbGAP											0													159.0	144.0	149.0					19																	44252160		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC008869	CCDS33043.2	19q13.31	2013-07-02	2013-07-02	2011-06-21	ENSG00000105771	ENSG00000105771			25763	protein-coding gene	gene with protein product		613176	"""chromosome 19 open reading frame 61"", ""smg-9 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C19orf61		11230166, 19417104	Standard	NM_019108		Approved	FLJ12886	uc002oxj.2	Q9H0W8	OTTHUMG00000150337	ENST00000270066.6:c.195delC	19.37:g.44252160delG	ENSP00000270066:p.Pro65fs		O60429|Q9H9A9	Frame_Shift_Del	DEL	pfam_Smg8/Smg9	p.I66fs	ENST00000270066.6	37	c.195	CCDS33043.2	19																																																																																			SMG9	-	NULL	ENSG00000105771		0.537	SMG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG9	HGNC	protein_coding	OTTHUMT00000317668.1	113	0.00	0	G	NM_019108		44252160	44252160	-1	no_errors	ENST00000270066	ensembl	human	known	69_37n	frame_shift_del	51	13.33	8	DEL	1.000	-
SNTG2	54221	genome.wustl.edu	37	2	1312322	1312322	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:1312322C>T	ENST00000308624.5	+	15	1470	c.1341C>T	c.(1339-1341)ttC>ttT	p.F447F	SNTG2_ENST00000407292.1_Silent_p.F320F	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	447					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		CGGTGGATTTCGCGTTGGGAT	0.453																																						dbGAP											0													226.0	188.0	200.0					2																	1312322		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.1341C>T	2.37:g.1312322C>T			Q05AH5	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.F447	ENST00000308624.5	37	c.1341	CCDS46220.1	2																																																																																			SNTG2	-	NULL	ENSG00000172554		0.453	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG2	HGNC	protein_coding	OTTHUMT00000322454.1	70	0.00	0	C	NM_018968		1312322	1312322	+1	no_errors	ENST00000308624	ensembl	human	known	69_37n	silent	60	13.04	9	SNP	0.993	T
SP1	6667	genome.wustl.edu	37	12	53775933	53775933	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:53775933T>C	ENST00000327443.4	+	3	300	c.202T>C	c.(202-204)Tgc>Cgc	p.C68R	SP1_ENST00000426431.2_Missense_Mutation_p.C61R	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	68	Repressor domain.|Ser/Thr-rich.				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		GGCAGCAACTTGCAGCAGAAT	0.567											OREG0021870	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													53.0	53.0	53.0					12																	53775933		2203	4300	6503	-	-	-	SO:0001583	missense	0			J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.202T>C	12.37:g.53775933T>C	ENSP00000329357:p.Cys68Arg	995	E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C68R	ENST00000327443.4	37	c.202	CCDS8857.1	12	.	.	.	.	.	.	.	.	.	.	T	16.96	3.266704	0.59540	.	.	ENSG00000185591	ENST00000327443;ENST00000426431	T;T	0.37235	1.22;1.21	4.13	4.13	0.48395	.	0.000000	0.64402	D	0.000011	T	0.55146	0.1902	M	0.64997	1.995	0.80722	D	1	D	0.71674	0.998	D	0.77557	0.99	T	0.59611	-0.7422	10	0.87932	D	0	.	12.5677	0.56318	0.0:0.0:0.0:1.0	.	68	P08047	SP1_HUMAN	R	68;61	ENSP00000329357:C68R;ENSP00000404263:C61R	ENSP00000329357:C68R	C	+	1	0	SP1	52062200	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.800000	0.85949	1.870000	0.54199	0.383000	0.25322	TGC	SP1	-	NULL	ENSG00000185591		0.567	SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP1	HGNC	protein_coding	OTTHUMT00000407044.1	33	0.00	0	T			53775933	53775933	+1	no_errors	ENST00000327443	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	1.000	C
SPACA7	122258	genome.wustl.edu	37	13	113088826	113088826	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr13:113088826G>T	ENST00000283550.3	+	7	618	c.551G>T	c.(550-552)aGg>aTg	p.R184M	SPACA7_ENST00000375699.3_Missense_Mutation_p.R153M	NM_145248.4	NP_660291.2	Q96KW9	SPAC7_HUMAN	sperm acrosome associated 7	184						acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)				large_intestine(5)|lung(4)|skin(3)|urinary_tract(1)	13						GAGCAGCAGAGGACCAGCGCA	0.592																																						dbGAP											0													81.0	67.0	72.0					13																	113088826		2198	4300	6498	-	-	-	SO:0001583	missense	0			BC016750	CCDS9524.1	13q34	2013-10-11	2011-03-15	2011-03-15	ENSG00000153498	ENSG00000153498			29575	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 28"""	C13orf28		22495889	Standard	NM_145248		Approved		uc001vsd.2	Q96KW9	OTTHUMG00000017365	ENST00000283550.3:c.551G>T	13.37:g.113088826G>T	ENSP00000283550:p.Arg184Met		Q5T8L1	Missense_Mutation	SNP	NULL	p.R184M	ENST00000283550.3	37	c.551	CCDS9524.1	13	.	.	.	.	.	.	.	.	.	.	G	11.27	1.588108	0.28268	.	.	ENSG00000153498	ENST00000283550;ENST00000375699	T;T	0.56611	0.51;0.45	2.62	-0.2	0.13216	.	.	.	.	.	T	0.41419	0.1158	N	0.14661	0.345	0.09310	N	1	D	0.65815	0.995	P	0.55824	0.785	T	0.22068	-1.0227	9	0.41790	T	0.15	.	3.1213	0.06392	0.2838:0.2299:0.4863:0.0	.	184	Q96KW9	SPAC7_HUMAN	M	184;153	ENSP00000283550:R184M;ENSP00000364851:R153M	ENSP00000283550:R184M	R	+	2	0	SPACA7	112136827	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.824000	0.04438	-0.092000	0.12417	-0.424000	0.05967	AGG	SPACA7	-	NULL	ENSG00000153498		0.592	SPACA7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPACA7	HGNC	protein_coding	OTTHUMT00000045820.2	40	0.00	0	G	NM_145248		113088826	113088826	+1	no_errors	ENST00000283550	ensembl	human	known	69_37n	missense	21	27.59	8	SNP	0.000	T
SPAG6	9576	genome.wustl.edu	37	10	22680768	22680768	+	Silent	SNP	G	G	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr10:22680768G>T	ENST00000376624.3	+	8	1258	c.1116G>T	c.(1114-1116)cgG>cgT	p.R372R	SPAG6_ENST00000313311.6_Silent_p.R372R|SPAG6_ENST00000376603.2_Silent_p.R448R|SPAG6_ENST00000376601.1_Silent_p.R133R|RP11-301N24.3_ENST00000422675.1_RNA|SPAG6_ENST00000538630.1_Silent_p.R347R|SPAG6_ENST00000490361.1_3'UTR	NM_001253855.1|NM_012443.3	NP_001240784.1|NP_036575.1	O75602	SPAG6_HUMAN	sperm associated antigen 6	372					cell projection organization (GO:0030030)|spermatid development (GO:0007286)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|prostate(1)|skin(2)	27						AACACGCACGGGCTGTTGCAG	0.443																																						dbGAP											0													119.0	111.0	114.0					10																	22680768		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF079363	CCDS7139.1, CCDS7140.1, CCDS58071.1, CCDS73072.1	10p12.31	2014-01-21			ENSG00000077327	ENSG00000077327		"""Armadillo repeat containing"""	11215	protein-coding gene	gene with protein product	"""axoneme central apparatus protein"""	605730				10493827	Standard	NM_012443		Approved	Repro-SA-1, pf16, CT141	uc001iri.3	O75602	OTTHUMG00000017808	ENST00000376624.3:c.1116G>T	10.37:g.22680768G>T			A8K1I8|B4DXZ4|Q5VUX5|Q5VUX6|Q5VUX7|Q6FI74|Q8NHQ6	Silent	SNP	pfam_Armadillo,pfam_HEAT,pfam_26S_Psome_nonATP_su5,superfamily_ARM-type_fold,smart_Armadillo	p.R448	ENST00000376624.3	37	c.1344	CCDS7139.1	10																																																																																			SPAG6	-	superfamily_ARM-type_fold	ENSG00000077327		0.443	SPAG6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG6	HGNC	protein_coding	OTTHUMT00000047187.1	72	0.00	0	G			22680768	22680768	+1	no_errors	ENST00000376603	ensembl	human	known	69_37n	silent	50	16.67	10	SNP	0.568	T
SPEN	23013	genome.wustl.edu	37	1	16256950	16256950	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:16256950delT	ENST00000375759.3	+	11	4419	c.4215delT	c.(4213-4215)tctfs	p.S1405fs		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1405					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CTCGATTGTCTTTTTTATTGA	0.413																																						dbGAP											0													77.0	76.0	77.0					1																	16256950		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.4215delT	1.37:g.16256950delT	ENSP00000364912:p.Ser1405fs		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Frame_Shift_Del	DEL	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.L1407fs	ENST00000375759.3	37	c.4215	CCDS164.1	1																																																																																			SPEN	-	NULL	ENSG00000065526		0.413	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	35	0.00	0	T	NM_015001		16256950	16256950	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	frame_shift_del	29	17.14	6	DEL	1.000	-
SPSB2	84727	genome.wustl.edu	37	12	6981614	6981615	+	Frame_Shift_Ins	INS	-	-	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:6981614_6981615insG	ENST00000524270.1	-	2	637_638	c.451_452insC	c.(451-453)cagfs	p.Q151fs	SPSB2_ENST00000519357.1_Frame_Shift_Ins_p.Q151fs|LRRC23_ENST00000433346.1_5'Flank|RPL13P5_ENST00000412023.1_RNA|SPSB2_ENST00000523102.1_Frame_Shift_Ins_p.Q151fs	NM_032641.3	NP_116030.1	Q99619	SPSB2_HUMAN	splA/ryanodine receptor domain and SOCS box containing 2	151	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)		p.Q151K(1)		kidney(2)|lung(2)|upper_aerodigestive_tract(1)	5						CGCTGGATACTGGGGGGCTCCG	0.653											OREG0021639	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	lung(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AF403027	CCDS8567.1	12p13.31	2008-02-05				ENSG00000111671			29522	protein-coding gene	gene with protein product		611658				8723724, 12076535	Standard	NM_001146316		Approved	GRCC9, SSB-2	uc001qrl.3	Q99619		ENST00000524270.1:c.452dupC	12.37:g.6981620_6981620dupG	ENSP00000428338:p.Gln151fs	638	B7Z4W1|D3DUT0	Frame_Shift_Ins	INS	pfam_SPRY_rcpt,pfam_SOCS_C,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,smart_SOCS_C,pfscan_B30.2/SPRY,pfscan_SOCS_C	p.Q151fs	ENST00000524270.1	37	c.452_451	CCDS8567.1	12																																																																																			SPSB2	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000111671		0.653	SPSB2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SPSB2	HGNC	protein_coding	OTTHUMT00000375721.1	25	0.00	0	-	NM_032641		6981614	6981615	-1	no_errors	ENST00000523102	ensembl	human	known	69_37n	frame_shift_ins	17	19.05	4	INS	0.000:0.001	G
SSH3	54961	genome.wustl.edu	37	11	67079319	67079319	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr11:67079319G>A	ENST00000308127.4	+	14	2119	c.1941G>A	c.(1939-1941)caG>caA	p.Q647Q	SSH3_ENST00000308298.7_Silent_p.Q382Q|SSH3_ENST00000376757.5_3'UTR	NM_017857.3	NP_060327.3	Q8TE77	SSH3_HUMAN	slingshot protein phosphatase 3	647					protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|DNA binding (GO:0003677)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			TGGTGAGACAGGCCAGCGTGC	0.642																																						dbGAP											0													69.0	57.0	61.0					11																	67079319		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0			AF085851	CCDS8157.1	11q13	2013-03-05	2013-03-05		ENSG00000172830	ENSG00000172830		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30581	protein-coding gene	gene with protein product		606780	"""slingshot homolog 3 (Drosophila)"""			11832213	Standard	NM_017857		Approved	FLJ20515, FLJ10928	uc001okj.3	Q8TE77	OTTHUMG00000167105	ENST00000308127.4:c.1941G>A	11.37:g.67079319G>A			Q6PK42|Q76I75|Q8N9L8|Q8WYL0|Q9NV45|Q9NWZ7	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.Q647	ENST00000308127.4	37	c.1941	CCDS8157.1	11																																																																																			SSH3	-	NULL	ENSG00000172830		0.642	SSH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH3	HGNC	protein_coding	OTTHUMT00000393167.1	13	0.00	0	G	NM_018276		67079319	67079319	+1	no_errors	ENST00000308127	ensembl	human	known	69_37n	silent	7	36.36	4	SNP	1.000	A
SSR2	6746	genome.wustl.edu	37	1	155984778	155984778	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:155984778G>T	ENST00000295702.4	-	4	408	c.337C>A	c.(337-339)Ctg>Atg	p.L113M	SSR2_ENST00000529008.1_Intron|SSR2_ENST00000480567.1_Missense_Mutation_p.L113M|SSR2_ENST00000496742.1_Intron	NM_003145.3	NP_003136.1	P43308	SSRB_HUMAN	signal sequence receptor, beta (translocon-associated protein beta)	113					cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|stomach(1)	10	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCCTGGGCCAGGTAAGTAATT	0.522																																						dbGAP											0													90.0	82.0	85.0					1																	155984778		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000341	CCDS1126.1	1q21-q23	2008-02-05			ENSG00000163479	ENSG00000163479			11324	protein-coding gene	gene with protein product		600867				7789174	Standard	NM_003145		Approved	TLAP, TRAPB	uc001fmx.3	P43308	OTTHUMG00000017456	ENST00000295702.4:c.337C>A	1.37:g.155984778G>T	ENSP00000295702:p.Leu113Met		B2R9K9|D3DVA7|Q53HI0|Q5VY95|Q5VY96|Q6IB31|Q9BWE4	Missense_Mutation	SNP	pfam_TRAP_beta,pirsf_TRAP_beta	p.L113M	ENST00000295702.4	37	c.337	CCDS1126.1	1	.	.	.	.	.	.	.	.	.	.	G	14.05	2.418485	0.42918	.	.	ENSG00000163479	ENST00000295702;ENST00000480567;ENST00000531917	.	.	.	5.15	4.24	0.50183	.	0.076830	0.53938	D	0.000053	T	0.45935	0.1367	L	0.42245	1.32	0.43617	D	0.995998	P;B	0.49696	0.927;0.059	P;B	0.52109	0.69;0.053	T	0.42749	-0.9433	9	0.35671	T	0.21	-6.8574	11.2438	0.48985	0.0881:0.0:0.9119:0.0	.	134;113	Q6MZE4;P43308	.;SSRB_HUMAN	M	113	.	ENSP00000295702:L113M	L	-	1	2	SSR2	154251402	1.000000	0.71417	0.999000	0.59377	0.768000	0.43524	3.220000	0.51207	1.410000	0.46936	0.313000	0.20887	CTG	SSR2	-	pfam_TRAP_beta,pirsf_TRAP_beta	ENSG00000163479		0.522	SSR2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SSR2	HGNC	protein_coding	OTTHUMT00000046172.2	59	0.00	0	G	NM_003145		155984778	155984778	-1	no_errors	ENST00000295702	ensembl	human	known	69_37n	missense	43	12.24	6	SNP	1.000	T
ST3GAL1	6482	genome.wustl.edu	37	8	134477024	134477024	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr8:134477024G>A	ENST00000319914.5	-	6	1707	c.680C>T	c.(679-681)tCc>tTc	p.S227F	ST3GAL1_ENST00000522652.1_Missense_Mutation_p.S227F|ST3GAL1_ENST00000399640.2_Missense_Mutation_p.S227F|ST3GAL1_ENST00000521180.1_Missense_Mutation_p.S227F			Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 1	227					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylneuraminate metabolic process (GO:0006054)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein phosphorylation (GO:0006468)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			endometrium(3)|large_intestine(2)|lung(11)|prostate(1)	17	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			GACTCACTGGGAAATGGTGCC	0.647																																						dbGAP											0													102.0	89.0	93.0					8																	134477024		2203	4300	6503	-	-	-	SO:0001583	missense	0			L29555	CCDS6373.1	8q24.22	2013-03-01	2003-01-14	2005-02-07	ENSG00000008513	ENSG00000008513	2.4.99.4	"""Sialyltransferases"""	10862	protein-coding gene	gene with protein product	"""ST3Gal I"""	607187	"""sialyltransferase 4A (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4A		10504389, 7655169	Standard	NM_003033		Approved	ST3O, SIATFL, ST3GalA.1	uc003yuk.2	Q11201	OTTHUMG00000164534	ENST00000319914.5:c.680C>T	8.37:g.134477024G>A	ENSP00000318445:p.Ser227Phe		O60677|Q9UN51	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.S227F	ENST00000319914.5	37	c.680	CCDS6373.1	8	.	.	.	.	.	.	.	.	.	.	G	16.00	2.999767	0.54147	.	.	ENSG00000008513	ENST00000319914;ENST00000399640;ENST00000521180;ENST00000522652;ENST00000523854	T;T;T;T;T	0.46451	1.52;1.52;1.52;1.52;0.87	4.9	3.94	0.45596	.	0.400389	0.27986	N	0.017041	T	0.28896	0.0717	N	0.21282	0.65	0.26716	N	0.970876	B	0.29085	0.232	B	0.30716	0.119	T	0.24083	-1.0170	10	0.56958	D	0.05	.	9.79	0.40699	0.0:0.0:0.5783:0.4217	.	227	Q11201	SIA4A_HUMAN	F	227;227;227;227;97	ENSP00000318445:S227F;ENSP00000414073:S227F;ENSP00000428540:S227F;ENSP00000430515:S227F;ENSP00000429638:S97F	ENSP00000318445:S227F	S	-	2	0	ST3GAL1	134546206	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	2.031000	0.41117	2.271000	0.75665	0.561000	0.74099	TCC	ST3GAL1	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000008513		0.647	ST3GAL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ST3GAL1	HGNC	protein_coding	OTTHUMT00000379132.1	25	0.00	0	G	NM_003033		134477024	134477024	-1	no_errors	ENST00000319914	ensembl	human	known	69_37n	missense	14	22.22	4	SNP	1.000	A
STK38L	23012	genome.wustl.edu	37	12	27475300	27475300	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:27475300G>T	ENST00000389032.3	+	14	1476	c.1307G>T	c.(1306-1308)tGg>tTg	p.W436L	STK38L_ENST00000539577.1_Missense_Mutation_p.W343L	NM_015000.3	NP_055815.1			serine/threonine kinase 38 like											breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12	Colorectal(261;0.0847)					TCCAAAGACTGGGTTTTTCTC	0.368																																						dbGAP											0													98.0	108.0	104.0					12																	27475300		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023182	CCDS31761.1	12p11.23	2014-04-23			ENSG00000211455	ENSG00000211455			17848	protein-coding gene	gene with protein product	"""nuclear Dbf2-related 2"""	615836				16488889	Standard	NM_015000		Approved	KIAA0965, NDR2	uc001rhr.3	Q9Y2H1	OTTHUMG00000169284	ENST00000389032.3:c.1307G>T	12.37:g.27475300G>T	ENSP00000373684:p.Trp436Leu			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.W436L	ENST00000389032.3	37	c.1307	CCDS31761.1	12	.	.	.	.	.	.	.	.	.	.	G	0.486	-0.877809	0.02550	.	.	ENSG00000211455	ENST00000389032;ENST00000539577	T;T	0.37584	1.19;1.19	4.93	4.93	0.64822	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);	0.130286	0.56097	D	0.000031	T	0.20129	0.0484	N	0.10707	0.03	0.80722	D	1	B;B	0.15473	0.013;0.005	B;B	0.22880	0.042;0.042	T	0.09818	-1.0657	10	0.02654	T	1	.	18.5305	0.90990	0.0:0.0:1.0:0.0	.	343;436	B4E3J8;Q9Y2H1	.;ST38L_HUMAN	L	436;343	ENSP00000373684:W436L;ENSP00000446386:W343L	ENSP00000373684:W436L	W	+	2	0	STK38L	27366567	1.000000	0.71417	1.000000	0.80357	0.134000	0.20937	9.847000	0.99503	2.444000	0.82710	0.460000	0.39030	TGG	STK38L	-	pfam_Pkinase_C,smart_AGC-kinase_C	ENSG00000211455		0.368	STK38L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK38L	HGNC	protein_coding	OTTHUMT00000403297.1	33	0.00	0	G	NM_015000		27475300	27475300	+1	no_errors	ENST00000389032	ensembl	human	known	69_37n	missense	35	18.60	8	SNP	1.000	T
STAB2	55576	genome.wustl.edu	37	12	104129268	104129268	+	Splice_Site	SNP	G	G	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:104129268G>T	ENST00000388887.2	+	52	5664		c.e52-1			NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CACTCCTACAGGTTTTAGCTG	0.502																																						dbGAP											0													66.0	55.0	59.0					12																	104129268		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.5461-1G>T	12.37:g.104129268G>T				Splice_Site	SNP	-	e52-1	ENST00000388887.2	37	c.5461-1	CCDS31888.1	12	.	.	.	.	.	.	.	.	.	.	G	17.00	3.277469	0.59758	.	.	ENSG00000136011	ENST00000388887;ENST00000258495	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7822	0.78269	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STAB2	102653398	1.000000	0.71417	0.817000	0.32601	0.222000	0.24845	5.995000	0.70631	2.463000	0.83235	0.455000	0.32223	.	STAB2	-	-	ENSG00000136011		0.502	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	HGNC	protein_coding	OTTHUMT00000407089.1	35	0.00	0	G		Intron	104129268	104129268	+1	no_errors	ENST00000388887	ensembl	human	known	69_37n	splice_site	31	18.42	7	SNP	0.997	T
SUCLA2	8803	genome.wustl.edu	37	13	48563103	48563103	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr13:48563103G>A	ENST00000378654.3	-	3	341	c.285C>T	c.(283-285)gtC>gtT	p.V95V	SUCLA2_ENST00000544100.1_5'UTR|SUCLA2_ENST00000534875.1_Silent_p.V37V|SUCLA2_ENST00000497202.1_5'UTR|SUCLA2_ENST00000543413.1_Silent_p.V37V	NM_003850.2	NP_003841.1	Q9P2R7	SUCB1_HUMAN	succinate-CoA ligase, ADP-forming, beta subunit	95	ATP-grasp.				cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|succinyl-CoA pathway (GO:0006781)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(3)|skin(4)	15		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)	CCTTTATCACGACATCTTTTG	0.368																																						dbGAP											0													105.0	105.0	105.0					13																	48563103		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF058953	CCDS9406.1	13q12.2-q13.3	2010-04-16			ENSG00000136143	ENSG00000136143	6.2.1.5		11448	protein-coding gene	gene with protein product		603921				9765291	Standard	NM_003850		Approved		uc001vbs.3	Q9P2R7	OTTHUMG00000016889	ENST00000378654.3:c.285C>T	13.37:g.48563103G>A			B2RDE7|O95194|Q5T9Q4|Q5T9Q6|Q9NV21|Q9NVP7	Silent	SNP	pfam_ATP-grasp_succ-CoA_synth-type,pfam_CoA_ligase,superfamily_Succinyl-CoA_synth-like,tigrfam_Succ_CoA_synthase_bsu	p.V95	ENST00000378654.3	37	c.285	CCDS9406.1	13																																																																																			SUCLA2	-	pfam_ATP-grasp_succ-CoA_synth-type,tigrfam_Succ_CoA_synthase_bsu	ENSG00000136143		0.368	SUCLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUCLA2	HGNC	protein_coding	OTTHUMT00000044852.1	43	0.00	0	G			48563103	48563103	-1	no_errors	ENST00000378654	ensembl	human	known	69_37n	silent	36	12.20	5	SNP	1.000	A
SUSD2	56241	genome.wustl.edu	37	22	24584283	24584283	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr22:24584283G>T	ENST00000358321.3	+	14	2693	c.2432G>T	c.(2431-2433)aGg>aTg	p.R811M		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	811					immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						CTGCGCCGCAGGAAGGGCAAC	0.657																																						dbGAP											0													64.0	67.0	66.0					22																	24584283		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.2432G>T	22.37:g.24584283G>T	ENSP00000351075:p.Arg811Met		Q9H5Y6	Missense_Mutation	SNP	pfam_AMOP,pfam_VWF_type-D,pfam_Sushi_SCR_CCP,pfam_Somatomedin_B_dom,superfamily_Complement_control_module,superfamily_Ig_E-set,smart_AMOP,smart_VWF_type-D,smart_Sushi_SCR_CCP,pfscan_AMOP,pfscan_Somatomedin_B_dom,pfscan_Sushi_SCR_CCP	p.R811M	ENST00000358321.3	37	c.2432	CCDS13824.1	22	.	.	.	.	.	.	.	.	.	.	G	13.11	2.139250	0.37728	.	.	ENSG00000099994	ENST00000358321	T	0.26223	1.75	4.71	2.56	0.30785	.	0.887861	0.09894	N	0.742029	T	0.18593	0.0446	L	0.27053	0.805	0.19775	N	0.999952	B	0.22800	0.075	B	0.17098	0.017	T	0.24548	-1.0157	10	0.72032	D	0.01	-23.262	8.1818	0.31315	0.1791:0.0:0.8209:0.0	.	811	Q9UGT4	SUSD2_HUMAN	M	811	ENSP00000351075:R811M	ENSP00000351075:R811M	R	+	2	0	SUSD2	22914283	0.990000	0.36364	0.657000	0.29651	0.194000	0.23727	2.399000	0.44495	0.520000	0.28426	0.555000	0.69702	AGG	SUSD2	-	NULL	ENSG00000099994		0.657	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD2	HGNC	protein_coding	OTTHUMT00000320088.1	33	0.00	0	G	NM_019601		24584283	24584283	+1	no_errors	ENST00000358321	ensembl	human	known	69_37n	missense	21	27.59	8	SNP	0.398	T
SV2A	9900	genome.wustl.edu	37	1	149884981	149884981	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:149884981delC	ENST00000369146.3	-	2	902	c.412delG	c.(412-414)gagfs	p.E138fs	SV2A_ENST00000369145.1_Frame_Shift_Del_p.E138fs	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	138					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	CGTTGTGCCTCCCCCCGGCCC	0.632																																						dbGAP											0													91.0	93.0	93.0					1																	149884981		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.412delG	1.37:g.149884981delC	ENSP00000358142:p.Glu138fs		D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Frame_Shift_Del	DEL	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2_chordata	p.E138fs	ENST00000369146.3	37	c.412	CCDS940.1	1																																																																																			SV2A	-	tigrfam_SV2_chordata	ENSG00000159164		0.632	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2A	HGNC	protein_coding	OTTHUMT00000033754.1	26	0.00	0	C			149884981	149884981	-1	no_errors	ENST00000369146	ensembl	human	known	69_37n	frame_shift_del	17	22.73	5	DEL	0.998	-
SYCP2L	221711	genome.wustl.edu	37	6	10911066	10911066	+	Silent	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:10911066A>G	ENST00000283141.6	+	12	1178	c.882A>G	c.(880-882)tcA>tcG	p.S294S	RP11-637O19.3_ENST00000480294.1_3'UTR|SYCP2L_ENST00000543878.1_Silent_p.S135S	NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	294						nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			GGGTGTATTCATTTCCGTGTA	0.413																																						dbGAP											0													262.0	239.0	246.0					6																	10911066		1913	4121	6034	-	-	-	SO:0001819	synonymous_variant	0			AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.882A>G	6.37:g.10911066A>G			A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Silent	SNP	NULL	p.S294	ENST00000283141.6	37	c.882	CCDS43423.1	6																																																																																			SYCP2L	-	NULL	ENSG00000153157		0.413	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2L	HGNC	protein_coding	OTTHUMT00000039845.3	124	0.00	0	A	NM_194299		10911066	10911066	+1	no_errors	ENST00000283141	ensembl	human	known	69_37n	silent	81	13.83	13	SNP	0.997	G
SYPL1	6856	genome.wustl.edu	37	7	105733467	105733467	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:105733467C>T	ENST00000011473.2	-	5	619	c.573G>A	c.(571-573)ccG>ccA	p.P191P	SYPL1_ENST00000455385.2_Silent_p.P173P|SYPL1_ENST00000470347.1_Silent_p.P173P	NM_006754.3	NP_006745.1	Q16563	SYPL1_HUMAN	synaptophysin-like 1	191	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|integral component of synaptic vesicle membrane (GO:0030285)|secretory granule (GO:0030141)	transporter activity (GO:0005215)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	7						TCTTACAAGGCGGAAGTTCAT	0.378																																						dbGAP											0													85.0	71.0	75.0					7																	105733467		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5736.1, CCDS47685.1	7q22.2	2005-05-24	2005-05-24	2005-05-24	ENSG00000008282	ENSG00000008282			11507	protein-coding gene	gene with protein product			"""synaptophysin-like protein"""	SYPL			Standard	NM_006754		Approved		uc003vdp.4	Q16563	OTTHUMG00000157587	ENST00000011473.2:c.573G>A	7.37:g.105733467C>T			A4D0R2|Q96AR8	Missense_Mutation	SNP	pfam_MARVEL-like_dom,prints_Synaptophysin/porin	p.R97H	ENST00000011473.2	37	c.290	CCDS5736.1	7	.	.	.	.	.	.	.	.	.	.	C	6.015	0.371149	0.11409	.	.	ENSG00000008282	ENST00000464029	.	.	.	5.51	-4.63	0.03359	.	.	.	.	.	T	0.16385	0.0394	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.27331	-1.0077	4	.	.	.	.	0.8656	0.01202	0.1852:0.1961:0.296:0.3227	.	.	.	.	H	97	.	.	R	-	2	0	SYPL1	105520703	0.000000	0.05858	0.001000	0.08648	0.104000	0.19210	-1.509000	0.02264	-0.567000	0.06046	0.655000	0.94253	CGC	SYPL1	-	pfam_MARVEL-like_dom	ENSG00000008282		0.378	SYPL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYPL1	HGNC	protein_coding	OTTHUMT00000349221.1	40	0.00	0	C			105733467	105733467	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000464029	ensembl	human	putative	69_37n	missense	42	16.00	8	SNP	0.001	T
TACC2	10579	genome.wustl.edu	37	10	123848088	123848088	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr10:123848088G>A	ENST00000369005.1	+	5	5895	c.5555G>A	c.(5554-5556)gGt>gAt	p.G1852D	TACC2_ENST00000334433.3_Missense_Mutation_p.G1852D|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000453444.2_Missense_Mutation_p.G1852D|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000515273.1_Missense_Mutation_p.G1852D|TACC2_ENST00000515603.1_Missense_Mutation_p.G1852D	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	1852					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)	p.G1852V(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				GAGACCAGAGGTGCGGAAGGA	0.493																																						dbGAP											1	Substitution - Missense(1)	lung(1)											77.0	68.0	71.0					10																	123848088		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.5555G>A	10.37:g.123848088G>A	ENSP00000358001:p.Gly1852Asp		Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	pfam_TACC	p.G1852D	ENST00000369005.1	37	c.5555	CCDS7626.1	10	.	.	.	.	.	.	.	.	.	.	G	10.15	1.270844	0.23221	.	.	ENSG00000138162	ENST00000369005;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000453444;ENST00000340076	T;T;T;T;T	0.03124	4.33;4.04;4.26;4.33;4.04	5.04	-0.0637	0.13775	.	.	.	.	.	T	0.02418	0.0074	N	0.14661	0.345	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.002;0.002;0.002	T	0.44817	-0.9303	9	0.40728	T	0.16	2.4099	7.1094	0.25382	0.5146:0.0:0.4854:0.0	.	1852;1852;1852	E9PBC6;E7EMZ9;O95359	.;.;TACC2_HUMAN	D	1852;1852;1852;1852;1852;1842	ENSP00000358001:G1852D;ENSP00000424467:G1852D;ENSP00000427618:G1852D;ENSP00000334280:G1852D;ENSP00000395048:G1852D	ENSP00000334280:G1852D	G	+	2	0	TACC2	123838078	0.001000	0.12720	0.000000	0.03702	0.051000	0.14879	0.745000	0.26259	0.074000	0.16767	0.643000	0.83706	GGT	TACC2	-	NULL	ENSG00000138162		0.493	TACC2-001	KNOWN	basic|CCDS	protein_coding	TACC2	HGNC	protein_coding	OTTHUMT00000090004.1	38	0.00	0	G			123848088	123848088	+1	no_errors	ENST00000334433	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	0.000	A
TANC2	26115	genome.wustl.edu	37	17	61176555	61176555	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:61176555C>T	ENST00000424789.2	+	3	163	c.159C>T	c.(157-159)agC>agT	p.S53S	TANC2_ENST00000389520.4_Silent_p.S53S	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	53					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						CCACAGAAAGCGACTGTGCTT	0.478																																						dbGAP											0													56.0	59.0	58.0					17																	61176555		2085	4209	6294	-	-	-	SO:0001819	synonymous_variant	0			AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.159C>T	17.37:g.61176555C>T			Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Nonsense_Mutation	SNP	NULL	p.R26*	ENST00000424789.2	37	c.76	CCDS45754.1	17																																																																																			TANC2	-	NULL	ENSG00000170921		0.478	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TANC2	HGNC	protein_coding	OTTHUMT00000444765.1	50	0.00	0	C			61176555	61176555	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000580466	ensembl	human	novel	69_37n	nonsense	30	18.92	7	SNP	0.999	T
TANC2	26115	genome.wustl.edu	37	17	61498332	61498332	+	Silent	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:61498332A>G	ENST00000424789.2	+	25	4993	c.4989A>G	c.(4987-4989)tcA>tcG	p.S1663S	TANC2_ENST00000389520.4_Silent_p.S1673S|RP11-269G24.3_ENST00000583552.1_RNA	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1663					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						ATCAAGGGTCAATTGGGGGAA	0.542																																						dbGAP											0													74.0	79.0	77.0					17																	61498332		2171	4282	6453	-	-	-	SO:0001819	synonymous_variant	0			AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.4989A>G	17.37:g.61498332A>G			Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_TPR_repeat,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.S1663	ENST00000424789.2	37	c.4989	CCDS45754.1	17																																																																																			TANC2	-	NULL	ENSG00000170921		0.542	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TANC2	HGNC	protein_coding	OTTHUMT00000444765.1	43	0.00	0	A			61498332	61498332	+1	no_errors	ENST00000424789	ensembl	human	known	69_37n	silent	36	18.18	8	SNP	0.996	G
TBC1D25	4943	genome.wustl.edu	37	X	48398283	48398283	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chrX:48398283G>A	ENST00000376771.4	+	1	439	c.98G>A	c.(97-99)cGa>cAa	p.R33Q	TBC1D25_ENST00000476141.1_3'UTR|TBC1D25_ENST00000537536.1_5'UTR	NM_002536.2	NP_002527.1	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	33	Poly-Glu.				autophagy (GO:0006914)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of autophagic vacuole maturation (GO:1901096)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						GAGGAGGAGCGAGAGGTGGTG	0.731																																						dbGAP											0													9.0	12.0	11.0					X																	48398283		1906	3642	5548	-	-	-	SO:0001583	missense	0			L08240	CCDS35242.1	Xp11.23	2014-01-28	2007-01-12	2007-01-12	ENSG00000068354	ENSG00000068354			8092	protein-coding gene	gene with protein product		311240	"""ornithine aminotransferase-like 1"""	OATL1		21383079	Standard	NM_002536		Approved		uc004dka.1	Q3MII6	OTTHUMG00000024123	ENST00000376771.4:c.98G>A	X.37:g.48398283G>A	ENSP00000365962:p.Arg33Gln		Q08AN9|Q3MII4|Q8TAR9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.R33Q	ENST00000376771.4	37	c.98	CCDS35242.1	X	.	.	.	.	.	.	.	.	.	.	G	20.3	3.967467	0.74131	.	.	ENSG00000068354	ENST00000376771;ENST00000427713;ENST00000418627	T	0.20332	2.08	3.96	3.96	0.45880	.	0.080704	0.47852	D	0.000218	T	0.17066	0.0410	M	0.72118	2.19	0.80722	D	1	P;P	0.39181	0.663;0.663	B;B	0.20184	0.028;0.028	T	0.07558	-1.0766	10	0.72032	D	0.01	-4.8333	6.8239	0.23872	0.1289:0.0:0.8711:0.0	.	33;33	B4DF03;Q3MII6	.;TBC25_HUMAN	Q	33	ENSP00000365962:R33Q	ENSP00000365962:R33Q	R	+	2	0	TBC1D25	48283227	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.761000	0.62243	1.970000	0.57323	0.519000	0.50382	CGA	TBC1D25	-	NULL	ENSG00000068354		0.731	TBC1D25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D25	HGNC	protein_coding	OTTHUMT00000060764.2	13	0.00	0	G	NM_002536		48398283	48398283	+1	no_errors	ENST00000376771	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	1.000	A
TCERG1	10915	genome.wustl.edu	37	5	145883505	145883506	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	GA	GA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:145883505_145883506delGA	ENST00000296702.5	+	18	2704_2705	c.2666_2667delGA	c.(2665-2667)cgafs	p.R889fs	TCERG1_ENST00000394421.2_Frame_Shift_Del_p.R868fs|TCERG1_ENST00000509787.1_3'UTR	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	889					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAAATAGATCGAGAGAGAGAGC	0.421																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.2666_2667delGA	5.37:g.145883513_145883514delGA	ENSP00000296702:p.Arg889fs		Q2NKN2|Q59EA1	Frame_Shift_Del	DEL	pfam_FF_domain,pfam_WW_Rsp5_WWP,superfamily_FF_domain,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_FF_domain,pfscan_WW_Rsp5_WWP	p.E892fs	ENST00000296702.5	37	c.2666_2667	CCDS4282.1	5																																																																																			TCERG1	-	superfamily_FF_domain	ENSG00000113649		0.421	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCERG1	HGNC	protein_coding	OTTHUMT00000251886.1	58	0.00	0	GA	NM_001040006		145883505	145883506	+1	no_errors	ENST00000296702	ensembl	human	known	69_37n	frame_shift_del	48	18.64	11	DEL	1.000:0.891	-
TET3	200424	genome.wustl.edu	37	2	74275076	74275076	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr2:74275076delC	ENST00000409262.3	+	1	1627	c.1627delC	c.(1627-1629)cccfs	p.P544fs		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	544					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CAGCCTGCTGCCCCCTACTCA	0.637																																						dbGAP											0													25.0	27.0	26.0					2																	74275076		1973	4153	6126	-	-	-	SO:0001589	frameshift_variant	0				CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.1627delC	2.37:g.74275076delC	ENSP00000386869:p.Pro544fs		A6NEI3|Q86Z24|Q8TBM9	Frame_Shift_Del	DEL	NULL	p.P544fs	ENST00000409262.3	37	c.1627	CCDS46339.1	2																																																																																			TET3	-	NULL	ENSG00000187605		0.637	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TET3	HGNC	protein_coding	OTTHUMT00000328141.4	20	0.00	0	C			74275076	74275076	+1	no_errors	ENST00000409262	ensembl	human	known	69_37n	frame_shift_del	10	31.25	5	DEL	1.000	-
TGFBR2	7048	genome.wustl.edu	37	3	30713659	30713659	+	Silent	SNP	C	C	T	rs193922666		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr3:30713659C>T	ENST00000295754.5	+	4	1366	c.984C>T	c.(982-984)caC>caT	p.H328H	TGFBR2_ENST00000359013.4_Silent_p.H353H	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	328	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		H -> Y (in a lung neuroendocrine carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						CCGCCTTCCACGCCAAGGGCA	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		21199	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													94.0	82.0	86.0					3																	30713659		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.984C>T	3.37:g.30713659C>T			B4DTV5|Q15580|Q6DKT6|Q99474	Silent	SNP	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Activin_II/TGFBeta-II_recpt,pfscan_Prot_kinase_cat_dom	p.H353	ENST00000295754.5	37	c.1059	CCDS2648.1	3																																																																																			TGFBR2	-	pirsf_Transform_growth_fac-b_typ-2,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000163513		0.592	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR2	HGNC	protein_coding	OTTHUMT00000252994.2	19	0.00	0	C			30713659	30713659	+1	no_errors	ENST00000359013	ensembl	human	known	69_37n	silent	15	25.00	5	SNP	0.166	T
THSD7A	221981	genome.wustl.edu	37	7	11464340	11464340	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:11464340C>T	ENST00000423059.4	-	16	3617	c.3366G>A	c.(3364-3366)gtG>gtA	p.V1122V	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1122	TSP type-1 11. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TTCGGGTTTGCACGCCCTCTC	0.483										HNSCC(18;0.044)																												dbGAP											0													240.0	227.0	231.0					7																	11464340		1983	4168	6151	-	-	-	SO:0001819	synonymous_variant	0				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.3366G>A	7.37:g.11464340C>T				Silent	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.V1122	ENST00000423059.4	37	c.3366	CCDS47543.1	7																																																																																			THSD7A	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000005108		0.483	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	HGNC	protein_coding	OTTHUMT00000325944.4	84	0.00	0	C	XM_928187.2		11464340	11464340	-1	no_errors	ENST00000423059	ensembl	human	known	69_37n	silent	40	20.00	10	SNP	0.991	T
TIPRL	261726	genome.wustl.edu	37	1	168168159	168168159	+	Silent	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:168168159T>C	ENST00000367833.2	+	6	760	c.615T>C	c.(613-615)gcT>gcC	p.A205A		NM_152902.3	NP_690866.1	O75663	TIPRL_HUMAN	TOR signaling pathway regulator	205	Interaction with PPP2CA.				DNA damage checkpoint (GO:0000077)|negative regulation of protein phosphatase type 2A activity (GO:0034048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|kidney(1)|large_intestine(1)|ovary(2)|skin(1)	6	all_hematologic(923;0.215)					AAATACAGGCTGACAAGACCT	0.279																																						dbGAP											0													50.0	53.0	52.0					1																	168168159		2200	4299	6499	-	-	-	SO:0001819	synonymous_variant	0			AB097034	CCDS1270.1, CCDS30935.1	1q23.2	2014-03-07	2014-03-07		ENSG00000143155	ENSG00000143155			30231	protein-coding gene	gene with protein product		611807	"""TIP41, TOR signaling pathway regulator-like (S. cerevisiae)"""			12761501	Standard	NM_001031800		Approved	MGC3794, dJ69E11.3, TIP41	uc001gfg.3	O75663	OTTHUMG00000034646	ENST00000367833.2:c.615T>C	1.37:g.168168159T>C			B2R8V3|Q5HYB2|Q8IZ86	Silent	SNP	pfam_TIP41-like	p.A205	ENST00000367833.2	37	c.615	CCDS1270.1	1																																																																																			TIPRL	-	pfam_TIP41-like	ENSG00000143155		0.279	TIPRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIPRL	HGNC	protein_coding	OTTHUMT00000083822.1	53	0.00	0	T	NM_152902		168168159	168168159	+1	no_errors	ENST00000367833	ensembl	human	known	69_37n	silent	40	13.04	6	SNP	0.921	C
TMC1	117531	genome.wustl.edu	37	9	75445589	75445589	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr9:75445589G>A	ENST00000297784.5	+	23	2791	c.2251G>A	c.(2251-2253)Gca>Aca	p.A751T	TMC1_ENST00000486417.1_3'UTR|TMC1_ENST00000396237.3_Missense_Mutation_p.A751T|TMC1_ENST00000340019.3_Missense_Mutation_p.A751T	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	751	Poly-Ala.				auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						AATGGCAGCTGCACGAGCAGG	0.318																																					Pancreas(75;173 1345 14232 34245 43413)	dbGAP											0													79.0	88.0	85.0					9																	75445589		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.2251G>A	9.37:g.75445589G>A	ENSP00000297784:p.Ala751Thr		A8MVZ2|B1AM91	Missense_Mutation	SNP	pfam_TMC	p.A751T	ENST00000297784.5	37	c.2251	CCDS6643.1	9	.	.	.	.	.	.	.	.	.	.	G	14.31	2.496618	0.44352	.	.	ENSG00000165091	ENST00000297784;ENST00000340019;ENST00000537917;ENST00000542143;ENST00000396237	T;T;T	0.67171	-0.25;-0.25;-0.25	5.07	5.07	0.68467	.	0.160396	0.42420	D	0.000712	T	0.44052	0.1275	N	0.16602	0.42	0.20489	N	0.999892	P	0.43477	0.808	B	0.36534	0.227	T	0.35525	-0.9785	10	0.13108	T	0.6	-11.3566	11.181	0.48627	0.0927:0.0:0.9073:0.0	.	751	Q8TDI8	TMC1_HUMAN	T	751;751;718;745;751	ENSP00000297784:A751T;ENSP00000341433:A751T;ENSP00000379538:A751T	ENSP00000297784:A751T	A	+	1	0	TMC1	74635409	0.975000	0.34042	0.686000	0.30086	0.938000	0.57974	3.777000	0.55364	2.790000	0.95986	0.650000	0.86243	GCA	TMC1	-	NULL	ENSG00000165091		0.318	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC1	HGNC	protein_coding	OTTHUMT00000052655.1	118	0.00	0	G			75445589	75445589	+1	no_errors	ENST00000297784	ensembl	human	known	69_37n	missense	90	10.00	10	SNP	0.499	A
TMEM185A	84548	genome.wustl.edu	37	X	148690503	148690503	+	Silent	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chrX:148690503A>G	ENST00000316916.8	-	3	538	c.234T>C	c.(232-234)tgT>tgC	p.C78C	TMEM185A_ENST00000536359.1_Silent_p.C19C|TMEM185A_ENST00000507237.1_Silent_p.C78C	NM_032508.2	NP_115897.1	Q8NFB2	T185A_HUMAN	transmembrane protein 185A	78						dendrite (GO:0030425)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(3)|lung(10)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					TAAACTCCACACACGTTTCTC	0.433																																						dbGAP											0													124.0	105.0	112.0					X																	148690503		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AF353675	CCDS14689.1, CCDS55523.1, CCDS76041.1	Xq28	2014-01-28	2007-02-05	2007-02-05	ENSG00000155984	ENSG00000269556			17125	protein-coding gene	gene with protein product		300031	"""chromosome X open reading frame 13"", ""family with sequence similarity 11, member A"""	CXorf13, FAM11A		12404111	Standard	NM_032508		Approved		uc022cgl.1	Q8NFB2	OTTHUMG00000022625	ENST00000316916.8:c.234T>C	X.37:g.148690503A>G			B3KTZ3|Q3SYH1|Q96CW3|Q96KE8	Missense_Mutation	SNP	pfam_TM_Fragile-X-F-assoc	p.C77R	ENST00000316916.8	37	c.229	CCDS14689.1	X																																																																																			TMEM185A	-	NULL	ENSG00000155984		0.433	TMEM185A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM185A	HGNC	protein_coding	OTTHUMT00000058710.4	54	0.00	0	A	NM_032508		148690503	148690503	-1	no_errors	ENST00000502900	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	1.000	G
TNRC6B	23112	genome.wustl.edu	37	22	40717093	40717093	+	Splice_Site	SNP	G	G	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr22:40717093G>T	ENST00000454349.2	+	22	5185		c.e22-1		TNRC6B_ENST00000402203.1_Splice_Site|TNRC6B_ENST00000335727.9_Splice_Site|TNRC6B_ENST00000301923.9_Splice_Site	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B						epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						TTACTCCTTAGATTGATGGGT	0.468																																						dbGAP											0													80.0	72.0	74.0					22																	40717093		2008	4200	6208	-	-	-	SO:0001630	splice_region_variant	0			AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.4975-1G>T	22.37:g.40717093G>T			B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Splice_Site	SNP	-	e22-1	ENST00000454349.2	37	c.4975-1	CCDS54533.1	22	.	.	.	.	.	.	.	.	.	.	G	26.3	4.724730	0.89298	.	.	ENSG00000100354	ENST00000301923;ENST00000402203;ENST00000454349;ENST00000400140;ENST00000335727;ENST00000446273	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8022	0.96513	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TNRC6B	39047039	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.760000	0.98935	2.764000	0.94973	0.650000	0.86243	.	TNRC6B	-	-	ENSG00000100354		0.468	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	TNRC6B	HGNC	protein_coding		31	0.00	0	G		Intron	40717093	40717093	+1	no_errors	ENST00000454349	ensembl	human	known	69_37n	splice_site	32	20.00	8	SNP	1.000	T
TOP1MT	116447	genome.wustl.edu	37	8	144406751	144406751	+	Silent	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr8:144406751C>T	ENST00000329245.4	-	6	754	c.720G>A	c.(718-720)gtG>gtA	p.V240V	TOP1MT_ENST00000523676.1_Silent_p.V142V|TOP1MT_ENST00000519148.1_Silent_p.V142V|TOP1MT_ENST00000521193.1_Silent_p.V142V	NM_052963.2	NP_443195.1	Q969P6	TOP1M_HUMAN	topoisomerase (DNA) I, mitochondrial	240					DNA replication (GO:0006260)|DNA topological change (GO:0006265)	chromosome (GO:0005694)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)			endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	23	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	TATCGGAGCGCACCTCCTTCC	0.562																																						dbGAP											0													116.0	106.0	109.0					8																	144406751		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF349018	CCDS6400.1, CCDS59115.1	8q24.3	2006-04-12				ENSG00000184428			29787	protein-coding gene	gene with protein product		606387				11526219	Standard	NM_052963		Approved		uc003yxz.4	Q969P6		ENST00000329245.4:c.720G>A	8.37:g.144406751C>T			B7ZAR5|E7ES89|Q86ST4|Q86V82	Silent	SNP	pfam_TopoI_DNA-bd_euk,pfam_TopoI_cat_euk,superfamily_TopoI_DNA-bd_euk,superfamily_DNA_brk_join_enz,superfamily_TopoI_insert_euk,smart_TopoI_euk,prints_TopoI	p.V240	ENST00000329245.4	37	c.720	CCDS6400.1	8																																																																																			TOP1MT	-	pfam_TopoI_DNA-bd_euk,superfamily_TopoI_DNA-bd_euk,smart_TopoI_euk	ENSG00000184428		0.562	TOP1MT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP1MT	HGNC	protein_coding	OTTHUMT00000381247.3	26	0.00	0	C	NM_052963		144406751	144406751	-1	no_errors	ENST00000329245	ensembl	human	known	69_37n	silent	14	30.00	6	SNP	0.122	T
TRANK1	9881	genome.wustl.edu	37	3	36896783	36896783	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr3:36896783C>T	ENST00000429976.2	-	12	4545	c.4298G>A	c.(4297-4299)cGc>cAc	p.R1433H	TRANK1_ENST00000301807.6_Missense_Mutation_p.R883H|TRANK1_ENST00000428977.2_Missense_Mutation_p.R883H	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	1433							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						ATCGCTGAAGCGGAAGGCCAC	0.567																																						dbGAP											0													122.0	119.0	120.0					3																	36896783		2074	4209	6283	-	-	-	SO:0001583	missense	0			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.4298G>A	3.37:g.36896783C>T	ENSP00000416168:p.Arg1433His		Q8N8K0	Missense_Mutation	SNP	pfam_UvrD-like_ATP-bd,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom	p.R1433H	ENST00000429976.2	37	c.4298	CCDS46789.2	3	.	.	.	.	.	.	.	.	.	.	C	22.7	4.319006	0.81469	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	D;D;D	0.82255	-1.59;-1.59;-1.59	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000010	D	0.92437	0.7599	M	0.85197	2.74	0.58432	D	0.999992	D	0.89917	1.0	D	0.91635	0.999	D	0.92922	0.6356	10	0.87932	D	0	.	19.8624	0.96787	0.0:1.0:0.0:0.0	.	1433	O15050	TRNK1_HUMAN	H	883;1433;883	ENSP00000416826:R883H;ENSP00000416168:R1433H;ENSP00000301807:R883H	ENSP00000301807:R883H	R	-	2	0	TRANK1	36871787	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.023000	0.70848	2.780000	0.95670	0.561000	0.74099	CGC	TRANK1	-	pfam_UvrD-like_ATP-bd	ENSG00000168016		0.567	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TRANK1	HGNC	protein_coding		36	0.00	0	C	NM_014831		36896783	36896783	-1	no_errors	ENST00000429976	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	1.000	T
TRERF1	55809	genome.wustl.edu	37	6	42204015	42204015	+	Silent	SNP	C	C	T	rs539205473		TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:42204015C>T	ENST00000372922.4	-	16	3556	c.2994G>A	c.(2992-2994)acG>acA	p.T998T	TRERF1_ENST00000340840.2_Silent_p.T915T|TRERF1_ENST00000354325.2_Silent_p.T915T|TRERF1_ENST00000372917.4_Silent_p.T915T|TRERF1_ENST00000541110.1_Silent_p.T1018T	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	998	Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GCGGCCCCTCCGTGGGAGCCA	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		15113	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													49.0	55.0	53.0					6																	42204015		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.2994G>A	6.37:g.42204015C>T			Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Silent	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.T1018	ENST00000372922.4	37	c.3054	CCDS4867.1	6																																																																																			TRERF1	-	NULL	ENSG00000124496		0.622	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRERF1	HGNC	protein_coding	OTTHUMT00000040551.2	87	0.00	0	C	NM_033502		42204015	42204015	-1	no_errors	ENST00000541110	ensembl	human	known	69_37n	silent	43	15.69	8	SNP	0.003	T
TRRAP	8295	genome.wustl.edu	37	7	98574180	98574180	+	Silent	SNP	G	G	A	rs202052450	byFrequency	TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:98574180G>A	ENST00000359863.4	+	54	8222	c.8013G>A	c.(8011-8013)gcG>gcA	p.A2671A	TRRAP_ENST00000446306.3_Silent_p.A2653A|TRRAP_ENST00000355540.3_Silent_p.A2653A	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	2671					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			AGCCCAGCGCGCTGAACTGCT	0.587													G|||	2	0.000399361	0.0008	0.0	5008	,	,		16590	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													68.0	63.0	65.0					7																	98574180		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.8013G>A	7.37:g.98574180G>A			A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.R2393H	ENST00000359863.4	37	c.7178	CCDS59066.1	7	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	1.696	-0.502753	0.04261	.	.	ENSG00000196367	ENST00000456197	.	.	.	5.92	-11.8	0.00035	.	.	.	.	.	T	0.30727	0.0774	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54173	-0.8333	4	.	.	.	.	1.042	0.01561	0.4008:0.2035:0.1399:0.2558	.	.	.	.	H	2393	.	.	R	+	2	0	TRRAP	98412116	0.000000	0.05858	0.000000	0.03702	0.213000	0.24496	-5.765000	0.00099	-4.634000	0.00038	-2.094000	0.00368	CGC	TRRAP	-	NULL	ENSG00000196367		0.587	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	48	0.00	0	G	NM_003496		98574180	98574180	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000456197	ensembl	human	novel	69_37n	missense	21	16.00	4	SNP	0.000	A
TTC16	158248	genome.wustl.edu	37	9	130485513	130485513	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr9:130485513C>T	ENST00000373289.3	+	7	853	c.773C>T	c.(772-774)gCg>gTg	p.A258V	TTC16_ENST00000489226.1_3'UTR|TTC16_ENST00000393748.4_Missense_Mutation_p.A82V|PTRH1_ENST00000419060.1_Intron|PTRH1_ENST00000429848.1_Intron	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	258										central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						CGCCAAGATGCGGGGATCCTG	0.647																																						dbGAP											0													62.0	58.0	59.0					9																	130485513		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.773C>T	9.37:g.130485513C>T	ENSP00000362386:p.Ala258Val		B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A258V	ENST00000373289.3	37	c.773	CCDS6875.1	9	.	.	.	.	.	.	.	.	.	.	C	15.28	2.787800	0.49997	.	.	ENSG00000167094	ENST00000373289;ENST00000393748;ENST00000316259	T;T	0.64991	2.18;-0.13	4.99	4.99	0.66335	Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.77798	0.4184	M	0.76328	2.33	0.20975	N	0.999814	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.999	T	0.70313	-0.4906	10	0.72032	D	0.01	-27.8116	13.6986	0.62595	0.0:1.0:0.0:0.0	.	245;210;258	B4DZ42;B4DH05;Q8NEE8	.;.;TTC16_HUMAN	V	258;82;203	ENSP00000362386:A258V;ENSP00000377349:A82V	ENSP00000319048:A203V	A	+	2	0	TTC16	129525334	0.957000	0.32711	0.133000	0.22050	0.022000	0.10575	2.502000	0.45398	2.619000	0.88677	0.456000	0.33151	GCG	TTC16	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000167094		0.647	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC16	HGNC	protein_coding	OTTHUMT00000054224.1	24	0.00	0	C	NM_144965		130485513	130485513	+1	no_errors	ENST00000373289	ensembl	human	known	69_37n	missense	11	38.89	7	SNP	0.272	T
TTLL8	164714	genome.wustl.edu	37	22	50471764	50471764	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr22:50471764G>A	ENST00000266182.6	-	10	1149	c.1150C>T	c.(1150-1152)Ctc>Ttc	p.L384F	TTLL8_ENST00000440475.1_Missense_Mutation_p.L364F			A6PVC2	TTLL8_HUMAN	tubulin tyrosine ligase-like family, member 8	400	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(4)	12		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)		TCACAGATGAGCAGCGGCGTC	0.562																																						dbGAP											0													51.0	59.0	56.0					22																	50471764		2154	4270	6424	-	-	-	SO:0001583	missense	0					22q13.33	2013-02-14			ENSG00000138892	ENSG00000138892		"""Tubulin tyrosine ligase-like family"""	34000	protein-coding gene	gene with protein product						15890843	Standard	XM_003403745		Approved			A6PVC2	OTTHUMG00000150241	ENST00000266182.6:c.1150C>T	22.37:g.50471764G>A	ENSP00000266182:p.Leu384Phe		B5MDV0	Missense_Mutation	SNP	pfam_Tub_tyr_ligase	p.L384F	ENST00000266182.6	37	c.1150		22	.	.	.	.	.	.	.	.	.	.	G	20.5	4.005148	0.74932	.	.	ENSG00000138892	ENST00000266182;ENST00000440475;ENST00000433387	T;T;T	0.17691	2.26;2.26;2.26	4.44	4.44	0.53790	.	0.086502	0.48286	D	0.000199	T	0.51873	0.1700	H	0.95917	3.74	0.37955	D	0.932787	D	0.89917	1.0	D	0.91635	0.999	T	0.67197	-0.5731	10	0.87932	D	0	.	9.7314	0.40363	0.097:0.0:0.903:0.0	.	384	B5MDV0	.	F	384;364;400	ENSP00000266182:L384F;ENSP00000387509:L364F;ENSP00000392252:L400F	ENSP00000266182:L384F	L	-	1	0	TTLL8	48813891	1.000000	0.71417	0.998000	0.56505	0.927000	0.56198	5.042000	0.64202	2.300000	0.77407	0.561000	0.74099	CTC	TTLL8	-	pfam_Tub_tyr_ligase	ENSG00000138892		0.562	TTLL8-201	KNOWN	basic|appris_candidate_longest	protein_coding	TTLL8	HGNC	protein_coding		23	0.00	0	G	NM_001080447		50471764	50471764	-1	no_errors	ENST00000266182	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	1.000	A
TYR	7299	genome.wustl.edu	37	11	88911273	88911273	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr11:88911273G>A	ENST00000263321.5	+	1	654	c.152G>A	c.(151-153)gGc>gAc	p.G51D	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	51					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	CAGCTTTCAGGCAGAGGTTCC	0.562																																						dbGAP											0													61.0	52.0	55.0					11																	88911273		2201	4299	6500	-	-	-	SO:0001583	missense	0			M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.152G>A	11.37:g.88911273G>A	ENSP00000263321:p.Gly51Asp		Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.G51D	ENST00000263321.5	37	c.152	CCDS8284.1	11	.	.	.	.	.	.	.	.	.	.	G	20.6	4.020306	0.75275	.	.	ENSG00000077498	ENST00000263321	D	0.99445	-5.91	6.07	6.07	0.98685	.	0.095612	0.64402	D	0.000001	D	0.99423	0.9796	M	0.94142	3.5	0.58432	D	0.99999	P	0.50943	0.94	P	0.48770	0.589	D	0.98824	1.0748	9	.	.	.	.	15.7545	0.78013	0.0666:0.0:0.9334:0.0	.	51	P14679	TYRO_HUMAN	D	51	ENSP00000263321:G51D	.	G	+	2	0	TYR	88550921	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	4.662000	0.61525	2.885000	0.99019	0.655000	0.94253	GGC	TYR	-	NULL	ENSG00000077498		0.562	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYR	HGNC	protein_coding	OTTHUMT00000394045.2	37	0.00	0	G	NM_000372		88911273	88911273	+1	no_errors	ENST00000263321	ensembl	human	known	69_37n	missense	22	35.29	12	SNP	1.000	A
TYW1B	441250	genome.wustl.edu	37	7	72081768	72081768	+	RNA	SNP	G	G	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:72081768G>T	ENST00000435769.2	-	0	1797				TYW1B_ENST00000343721.5_RNA|TYW1B_ENST00000438125.1_RNA			Q6NUM6	TYW1B_HUMAN	tRNA-yW synthesizing protein 1 homolog B (S. cerevisiae)						tRNA processing (GO:0008033)		4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)										CCTCATGCCAGGGCACATGGG	0.488																																						dbGAP											0													225.0	177.0	192.0					7																	72081768		692	1591	2283	-	-	-			0			BC068520	CCDS69309.1	7q11.23	2011-08-11	2009-07-28		ENSG00000254184	ENSG00000277149			33908	protein-coding gene	gene with protein product	"""radical S-adenosyl methionine and flavodoxin domains 1"", ""non-protein coding RNA 69"", ""long intergenic non-protein coding RNA 69"""		"""tRNA-yW synthesizing protein 1 homolog B (non-protein coding)"""				Standard	NM_001145440		Approved	RSAFD2, MGC87315, NCRNA00069, LINC00069	uc011kej.2	Q6NUM6	OTTHUMG00000157067		7.37:g.72081768G>T			A6NG09|B4DFY2|Q3KQX2	RNA	SNP	-	NULL	ENST00000435769.2	37	NULL		7																																																																																			TYW1B	-	-	ENSG00000254184		0.488	TYW1B-001	KNOWN	basic	polymorphic_pseudogene	TYW1B	HGNC	polymorphic_pseudogene	OTTHUMT00000347346.2	113	0.00	0	G	NM_001145440		72081768	72081768	-1	no_errors	ENST00000438125	ensembl	human	known	69_37n	rna	61	12.86	9	SNP	0.998	T
UBA6	55236	genome.wustl.edu	37	4	68528872	68528872	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr4:68528872C>T	ENST00000322244.5	-	12	1081	c.1022G>A	c.(1021-1023)cGc>cAc	p.R341H	UBA6_ENST00000420827.2_Missense_Mutation_p.R341H	NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	341					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)			central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						ATTTGGCTTGCGACTGTATTT	0.328																																						dbGAP											0													130.0	132.0	131.0					4																	68528872		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.1022G>A	4.37:g.68528872C>T	ENSP00000313454:p.Arg341His		A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.R341H	ENST00000322244.5	37	c.1022	CCDS3516.1	4	.	.	.	.	.	.	.	.	.	.	C	16.50	3.141376	0.57044	.	.	ENSG00000033178	ENST00000322244;ENST00000420827	T;T	0.38401	1.14;1.14	6.03	5.2	0.72013	Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.049152	0.85682	N	0.000000	T	0.33644	0.0870	L	0.52759	1.655	0.80722	D	1	B;B	0.25007	0.116;0.013	B;B	0.12156	0.007;0.003	T	0.06954	-1.0798	10	0.37606	T	0.19	-14.2386	14.7656	0.69637	0.0:0.9307:0.0:0.0693	.	341;341	A0AVT1-3;A0AVT1	.;UBA6_HUMAN	H	341	ENSP00000313454:R341H;ENSP00000399234:R341H	ENSP00000313454:R341H	R	-	2	0	UBA6	68211467	1.000000	0.71417	0.994000	0.49952	0.934000	0.57294	4.846000	0.62860	1.568000	0.49683	0.557000	0.71058	CGC	UBA6	-	superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_UBQ-activ_enz_E1	ENSG00000033178		0.328	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA6	HGNC	protein_coding	OTTHUMT00000251429.2	58	0.00	0	C	NM_018227		68528872	68528872	-1	no_errors	ENST00000322244	ensembl	human	known	69_37n	missense	38	11.36	5	SNP	1.000	T
UFL1	23376	genome.wustl.edu	37	6	97001369	97001369	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:97001369C>T	ENST00000369278.4	+	19	2441	c.2375C>T	c.(2374-2376)aCg>aTg	p.T792M		NM_015323.4	NP_056138.1	O94874	UFL1_HUMAN	UFM1-specific ligase 1	792					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein ufmylation (GO:0071569)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	UFM1 conjugating enzyme activity (GO:0071568)										TCATCTGTGACGGAAGAGTAA	0.368																																						dbGAP											0													59.0	60.0	60.0					6																	97001369		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC036379	CCDS5034.1	6q16.3	2011-08-18	2011-08-18	2011-08-18	ENSG00000014123	ENSG00000014123			23039	protein-coding gene	gene with protein product	"""novel LZAP-binding protein"", ""Regulator of CDK5RAP3 and DDRGK1"""	613372	"""KIAA0776"""	KIAA0776		20018847, 20164180, 20228063, 20531390	Standard	NM_015323		Approved	NLBP, Maxer, RCAD	uc003por.3	O94874	OTTHUMG00000015238	ENST00000369278.4:c.2375C>T	6.37:g.97001369C>T	ENSP00000358283:p.Thr792Met		A0PJ53|B4DJ57|C0H5X5|Q8N765|Q9NTQ0	Missense_Mutation	SNP	pfam_E3_UFM1_ligase_1	p.T792M	ENST00000369278.4	37	c.2375	CCDS5034.1	6	.	.	.	.	.	.	.	.	.	.	C	21.4	4.143356	0.77888	.	.	ENSG00000014123	ENST00000369278	T	0.48201	0.82	5.53	5.53	0.82687	.	0.100399	0.64402	D	0.000002	T	0.54143	0.1840	M	0.72894	2.215	0.48135	D	0.999596	D	0.76494	0.999	P	0.56088	0.791	T	0.58808	-0.7571	10	0.72032	D	0.01	-15.9134	14.6379	0.68702	0.1456:0.8544:0.0:0.0	.	792	O94874	UFL1_HUMAN	M	792	ENSP00000358283:T792M	ENSP00000358283:T792M	T	+	2	0	KIAA0776	97108090	1.000000	0.71417	0.985000	0.45067	0.888000	0.51559	2.801000	0.47908	2.761000	0.94854	0.650000	0.86243	ACG	UFL1	-	NULL	ENSG00000014123		0.368	UFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFL1	HGNC	protein_coding	OTTHUMT00000041557.1	32	0.00	0	C	NM_015323		97001369	97001369	+1	no_errors	ENST00000369278	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	1.000	T
USP15	9958	genome.wustl.edu	37	12	62786055	62786056	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:62786055_62786056delTT	ENST00000280377.5	+	18	2366_2367	c.2308_2309delTT	c.(2308-2310)tttfs	p.F770fs	USP15_ENST00000353364.3_Frame_Shift_Del_p.F741fs|USP15_ENST00000393654.3_Frame_Shift_Del_p.F745fs	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	770	USP.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		TCTTTAGGACTTTGAAAAACAT	0.292																																					Melanoma(181;615 2041 39364 49691 50001)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.2308_2309delTT	12.37:g.62786055_62786056delTT	ENSP00000280377:p.Phe770fs		Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Frame_Shift_Del	DEL	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,superfamily_RNA3'P_cycl/enolpyr_Trfase_a/b,smart_Pept_C19_DUSP,pfscan_Peptidase_C19	p.F770fs	ENST00000280377.5	37	c.2308_2309	CCDS58251.1	12																																																																																			USP15	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000135655		0.292	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP15	HGNC	protein_coding	OTTHUMT00000407831.2	36	0.00	0	TT	NM_006313		62786055	62786056	+1	no_errors	ENST00000280377	ensembl	human	known	69_37n	frame_shift_del	38	11.36	5	DEL	1.000:1.000	-
VPRBP	9730	genome.wustl.edu	37	3	51452257	51452257	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr3:51452257C>T	ENST00000335891.5	-	11	2320	c.2311G>A	c.(2311-2313)Gcc>Acc	p.A771T				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	1220					B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		TAGTTGTTGGCAAGATCTGGG	0.443																																						dbGAP											0													110.0	101.0	104.0					3																	51452257		1917	4122	6039	-	-	-	SO:0001583	missense	0			AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.2311G>A	3.37:g.51452257C>T	ENSP00000338857:p.Ala771Thr		Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.A771T	ENST00000335891.5	37	c.2311		3	.	.	.	.	.	.	.	.	.	.	C	33	5.195680	0.94960	.	.	ENSG00000145041	ENST00000423656;ENST00000335891	T;T	0.55588	0.51;0.51	6.07	6.07	0.98685	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.67420	0.2891	L	0.43152	1.355	0.80722	D	1	D	0.67145	0.996	D	0.76071	0.987	T	0.59752	-0.7395	10	0.32370	T	0.25	-13.3699	20.6439	0.99570	0.0:1.0:0.0:0.0	.	1220	Q9Y4B6	VPRBP_HUMAN	T	791;771	ENSP00000393183:A791T;ENSP00000338857:A771T	ENSP00000338857:A771T	A	-	1	0	VPRBP	51427297	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.429000	0.80309	2.890000	0.99128	0.650000	0.86243	GCC	VPRBP	-	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold	ENSG00000145041		0.443	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	VPRBP	HGNC	protein_coding		63	0.00	0	C	NM_014703		51452257	51452257	-1	no_errors	ENST00000335891	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	1.000	T
VPS16	64601	genome.wustl.edu	37	20	2840965	2840965	+	Silent	SNP	G	G	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr20:2840965G>T	ENST00000380445.3	+	4	393	c.321G>T	c.(319-321)ctG>ctT	p.L107L	VPS16_ENST00000380469.3_Silent_p.L107L|VPS16_ENST00000380443.3_5'Flank	NM_022575.2	NP_072097.2	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 homolog (S. cerevisiae)	107					intracellular protein transport (GO:0006886)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|axon (GO:0030424)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	37						GTGCTGTACTGGTTTATGGGC	0.592																																						dbGAP											0													189.0	168.0	175.0					20																	2840965		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF308801	CCDS13036.1, CCDS13037.1	20p13	2009-07-07	2009-07-07	2009-07-07	ENSG00000215305	ENSG00000215305			14584	protein-coding gene	gene with protein product		608550					Standard	NM_022575		Approved		uc002whe.3	Q9H269	OTTHUMG00000031714	ENST00000380445.3:c.321G>T	20.37:g.2840965G>T			Q5JUB1|Q8WU31|Q96EE7|Q96N92|Q9H1Q4|Q9H1Q5	Silent	SNP	pfam_Vps16_N,pfam_Vps16_C,pirsf_VPS16	p.L107	ENST00000380445.3	37	c.321	CCDS13036.1	20																																																																																			VPS16	-	pfam_Vps16_N,pirsf_VPS16	ENSG00000215305		0.592	VPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS16	HGNC	protein_coding	OTTHUMT00000077658.2	122	0.81	1	G	NM_022575		2840965	2840965	+1	no_errors	ENST00000380445	ensembl	human	known	69_37n	silent	50	15.25	9	SNP	0.990	T
WBP11	51729	genome.wustl.edu	37	12	14948019	14948019	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:14948019A>G	ENST00000261167.2	-	6	640	c.407T>C	c.(406-408)gTg>gCg	p.V136A		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	136					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						AATACTCTCCACTTCCACATG	0.418																																						dbGAP											0													100.0	91.0	95.0					12																	14948019		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.407T>C	12.37:g.14948019A>G	ENSP00000261167:p.Val136Ala		Q96AY8	Missense_Mutation	SNP	pfam_WW_dom-bd_prot_11	p.V136A	ENST00000261167.2	37	c.407	CCDS8666.1	12	.	.	.	.	.	.	.	.	.	.	A	18.75	3.691165	0.68271	.	.	ENSG00000084463	ENST00000261167;ENST00000537574	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.55178	0.1904	L	0.56280	1.765	0.58432	D	0.999997	P	0.49961	0.93	B	0.42916	0.402	T	0.62096	-0.6926	9	0.72032	D	0.01	-14.7308	13.2723	0.60167	1.0:0.0:0.0:0.0	.	136	Q9Y2W2	WBP11_HUMAN	A	136	.	ENSP00000261167:V136A	V	-	2	0	WBP11	14839286	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.046000	0.93817	2.030000	0.59900	0.533000	0.62120	GTG	WBP11	-	NULL	ENSG00000084463		0.418	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBP11	HGNC	protein_coding	OTTHUMT00000400850.1	37	0.00	0	A	NM_016312		14948019	14948019	-1	no_errors	ENST00000261167	ensembl	human	known	69_37n	missense	32	17.95	7	SNP	1.000	G
WDFY3	23001	genome.wustl.edu	37	4	85654705	85654705	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr4:85654705G>A	ENST00000295888.4	-	44	7458	c.7051C>T	c.(7051-7053)Ctg>Ttg	p.L2351L	WDFY3_ENST00000322366.6_Silent_p.L2351L	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2351	Sufficient for translocalization to p62 bodies/ALIS.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TCCCTCAACAGCTCGCACTCG	0.567																																						dbGAP											0													111.0	112.0	111.0					4																	85654705		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.7051C>T	4.37:g.85654705G>A			Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L2351	ENST00000295888.4	37	c.7051	CCDS3609.1	4																																																																																			WDFY3	-	superfamily_Cyclin-like	ENSG00000163625		0.567	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	31	0.00	0	G	NM_014991		85654705	85654705	-1	no_errors	ENST00000295888	ensembl	human	known	69_37n	silent	28	17.65	6	SNP	1.000	A
WDR11	55717	genome.wustl.edu	37	10	122643389	122643389	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr10:122643389A>G	ENST00000263461.6	+	14	2083	c.1837A>G	c.(1837-1839)Ata>Gta	p.I613V	WDR11_ENST00000604509.1_3'UTR	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	270					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						CTTCCCTACAATAACTGCTTT	0.348																																						dbGAP											0													77.0	73.0	74.0					10																	122643389		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.1837A>G	10.37:g.122643389A>G	ENSP00000263461:p.Ile613Val		A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.I613V	ENST00000263461.6	37	c.1837	CCDS7619.1	10	.	.	.	.	.	.	.	.	.	.	A	6.460	0.453083	0.12283	.	.	ENSG00000120008	ENST00000263461	T	0.48201	0.82	5.86	-1.05	0.10036	WD40/YVTN repeat-like-containing domain (1);	0.217660	0.47455	N	0.000236	T	0.17109	0.0411	N	0.05280	-0.08	0.22552	N	0.99899	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.31251	-0.9950	10	0.02654	T	1	-11.6011	7.1115	0.25392	0.477:0.1235:0.3994:0.0	.	613;613;142	Q9BZH6;B2RCJ6;Q659C9	WDR11_HUMAN;.;.	V	613	ENSP00000263461:I613V	ENSP00000263461:I613V	I	+	1	0	WDR11	122633379	0.261000	0.24063	0.532000	0.27989	0.963000	0.63663	0.755000	0.26405	-0.080000	0.12685	-0.321000	0.08615	ATA	WDR11	-	NULL	ENSG00000120008		0.348	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	WDR11	HGNC	protein_coding	OTTHUMT00000050707.2	72	0.00	0	A			122643389	122643389	+1	no_errors	ENST00000263461	ensembl	human	known	69_37n	missense	41	28.07	16	SNP	0.165	G
WTIP	126374	genome.wustl.edu	37	19	34991089	34991089	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr19:34991089G>A	ENST00000590071.2	+	8	1545	c.1208G>A	c.(1207-1209)gGc>gAc	p.G403D	WTIP_ENST00000270288.6_Missense_Mutation_p.G627D	NM_001080436.1	NP_001073905.1	A6NIX2	WTIP_HUMAN	Wilms tumor 1 interacting protein	403	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cytoskeleton organization (GO:0007010)|gene silencing by miRNA (GO:0035195)|negative regulation of hippo signaling (GO:0035331)|positive regulation of gene silencing by miRNA (GO:2000637)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasmic mRNA processing body (GO:0000932)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)	4	all_lung(56;5.94e-07)|Lung NSC(56;9.35e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			CCCCTGGCGGGCCACCTACTG	0.662																																						dbGAP											0													32.0	40.0	38.0					19																	34991089		2109	4219	6328	-	-	-	SO:0001583	missense	0			AK130059	CCDS59375.1	19q13.11	2012-03-16			ENSG00000142279	ENSG00000142279			20964	protein-coding gene	gene with protein product	"""WT1-interacting protein"""	614790				14736876	Standard	NM_001080436		Approved		uc002nvm.3	A6NIX2		ENST00000590071.2:c.1208G>A	19.37:g.34991089G>A	ENSP00000466953:p.Gly403Asp			Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.G627D	ENST00000590071.2	37	c.1880	CCDS59375.1	19	.	.	.	.	.	.	.	.	.	.	G	15.11	2.736376	0.49045	.	.	ENSG00000142279	ENST00000270288	D	0.88586	-2.4	4.47	4.47	0.54385	Zinc finger, LIM-type (4);	0.057499	0.64402	D	0.000001	D	0.90731	0.7091	L	0.42008	1.315	0.80722	D	1	P	0.44946	0.846	P	0.58620	0.842	D	0.89260	0.3597	10	0.30854	T	0.27	.	16.2497	0.82475	0.0:0.0:1.0:0.0	.	627	A6NIX2	WTIP_HUMAN	D	627	ENSP00000270288:G627D	ENSP00000270288:G627D	G	+	2	0	WTIP	39682929	1.000000	0.71417	0.998000	0.56505	0.130000	0.20726	7.286000	0.78671	2.168000	0.68352	0.305000	0.20034	GGC	WTIP	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000142279		0.662	WTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WTIP	HGNC	protein_coding	OTTHUMT00000459381.3	42	0.00	0	G	XM_059037		34991089	34991089	+1	no_errors	ENST00000270288	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	1.000	A
WWP2	11060	genome.wustl.edu	37	16	69965781	69965781	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr16:69965781G>T	ENST00000359154.2	+	16	1771	c.1670G>T	c.(1669-1671)gGg>gTg	p.G557V	WWP2_ENST00000448661.1_Missense_Mutation_p.G557V|WWP2_ENST00000544162.1_3'UTR|MIR140_ENST00000385282.1_RNA|WWP2_ENST00000568684.1_Missense_Mutation_p.G118V|WWP2_ENST00000356003.2_Missense_Mutation_p.G557V|WWP2_ENST00000542271.1_Missense_Mutation_p.G441V	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	557	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTGGACTATGGGGGCATCGCC	0.622																																						dbGAP											0													78.0	80.0	80.0					16																	69965781		2198	4300	6498	-	-	-	SO:0001583	missense	0			BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.1670G>T	16.37:g.69965781G>T	ENSP00000352069:p.Gly557Val		A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_WW_Rsp5_WWP	p.G557V	ENST00000359154.2	37	c.1670	CCDS10885.1	16	.	.	.	.	.	.	.	.	.	.	G	24.5	4.539804	0.85917	.	.	ENSG00000198373	ENST00000359154;ENST00000545099;ENST00000448661;ENST00000356003;ENST00000544162;ENST00000542271	T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45	5.27	5.27	0.74061	HECT (3);	0.045708	0.85682	D	0.000000	D	0.90349	0.6980	H	0.99454	4.575	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.94500	0.7709	9	.	.	.	.	19.2502	0.93921	0.0:0.0:1.0:0.0	.	557	O00308	WWP2_HUMAN	V	557;118;557;557;444;441	ENSP00000352069:G557V;ENSP00000396871:G557V;ENSP00000348283:G557V;ENSP00000445616:G441V	.	G	+	2	0	WWP2	68523282	1.000000	0.71417	0.636000	0.29352	0.716000	0.41182	9.768000	0.98965	2.619000	0.88677	0.561000	0.74099	GGG	WWP2	-	superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000198373		0.622	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWP2	HGNC	protein_coding	OTTHUMT00000268954.1	14	0.00	0	G	NM_007014		69965781	69965781	+1	no_errors	ENST00000356003	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	1.000	T
XKR6	286046	genome.wustl.edu	37	8	10755666	10755666	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr8:10755666C>A	ENST00000416569.2	-	3	1748	c.1722G>T	c.(1720-1722)ttG>ttT	p.L574F	XKR6_ENST00000304437.2_Missense_Mutation_p.L295F	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6	574						integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		AAGGACGCCCCAACGGGGTAG	0.552																																						dbGAP											0													51.0	51.0	51.0					8																	10755666		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.1722G>T	8.37:g.10755666C>A	ENSP00000416707:p.Leu574Phe		Q8TBA0	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.L574F	ENST00000416569.2	37	c.1722	CCDS5978.2	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.714|8.714	0.912830|0.912830	0.17907|0.17907	.|.	.|.	ENSG00000171044|ENSG00000171044	ENST00000304437;ENST00000416569|ENST00000382461	D;D|.	0.86497|.	-2.12;-2.13|.	4.73|4.73	2.91|2.91	0.33838|0.33838	.|.	0.454267|.	0.23594|.	N|.	0.046501|.	T|T	0.23330|0.23330	0.0564|0.0564	N|N	0.22421|0.22421	0.69|0.69	0.24980|0.24980	N|N	0.99161|0.99161	B|.	0.21147|.	0.052|.	B|.	0.25884|.	0.064|.	T|T	0.19910|0.19910	-1.0291|-1.0291	10|5	0.31617|.	T|.	0.26|.	-2.1554|-2.1554	5.2926|5.2926	0.15735|0.15735	0.1743:0.6396:0.0:0.1861|0.1743:0.6396:0.0:0.1861	.|.	574|.	Q5GH73|.	XKR6_HUMAN|.	F|L	295;574|351	ENSP00000307120:L295F;ENSP00000416707:L574F|.	ENSP00000307120:L295F|.	L|W	-|-	3|2	2|0	XKR6|XKR6	10793076|10793076	0.835000|0.835000	0.29415|0.29415	0.969000|0.969000	0.41365|0.41365	0.919000|0.919000	0.55068|0.55068	0.026000|0.026000	0.13599|0.13599	0.583000|0.583000	0.29574|0.29574	0.555000|0.555000	0.69702|0.69702	TTG|TGG	XKR6	-	NULL	ENSG00000171044		0.552	XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR6	HGNC	protein_coding	OTTHUMT00000383958.1	23	0.00	0	C	NM_173683		10755666	10755666	-1	no_errors	ENST00000416569	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	1.000	A
XPO4	64328	genome.wustl.edu	37	13	21362688	21362689	+	Frame_Shift_Ins	INS	-	-	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr13:21362688_21362689insT	ENST00000255305.6	-	20	3054_3055	c.2983_2984insA	c.(2983-2985)atafs	p.I995fs	XPO4_ENST00000400602.2_Frame_Shift_Ins_p.I995fs			Q9C0E2	XPO4_HUMAN	exportin 4	995					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		AAGCTGTGGTATTTTTTCAGGA	0.317																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.2984dupA	13.37:g.21362694_21362694dupT	ENSP00000255305:p.Ile995fs		Q5VUZ5|Q8N3V6|Q9H934	Frame_Shift_Ins	INS	superfamily_ARM-type_fold	p.I995fs	ENST00000255305.6	37	c.2984_2983	CCDS41872.1	13																																																																																			XPO4	-	superfamily_ARM-type_fold	ENSG00000132953		0.317	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	XPO4	HGNC	protein_coding	OTTHUMT00000044096.1	47	0.00	0	-	NM_022459		21362688	21362689	-1	no_errors	ENST00000255305	ensembl	human	known	69_37n	frame_shift_ins	45	18.18	10	INS	1.000:1.000	T
YARS2	51067	genome.wustl.edu	37	12	32903765	32903765	+	Missense_Mutation	SNP	G	G	A	rs377140710	byFrequency	TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr12:32903765G>A	ENST00000324868.8	-	3	1018	c.991C>T	c.(991-993)Cat>Tat	p.H331Y	YARS2_ENST00000551673.1_5'Flank	NM_001040436.2	NP_001035526.1	Q9Y2Z4	SYYM_HUMAN	tyrosyl-tRNA synthetase 2, mitochondrial	331					gene expression (GO:0010467)|mitochondrial tyrosyl-tRNA aminoacylation (GO:0070184)|translation (GO:0006412)|tRNA aminoacylation (GO:0043039)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)|tyrosine binding (GO:0072545)|tyrosine-tRNA ligase activity (GO:0004831)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	16	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)	TGCATGATATGATCAATCTCT	0.423													G|||	4	0.000798722	0.0	0.0	5008	,	,		17543	0.002		0.0	False		,,,				2504	0.002					dbGAP											0													86.0	80.0	82.0					12																	32903765		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132939	CCDS31770.1	12p11.21	2014-03-19	2007-02-23		ENSG00000139131	ENSG00000139131	6.1.1.1	"""Aminoacyl tRNA synthetases / Class I"""	24249	protein-coding gene	gene with protein product	"""tyrosine tRNA ligase 2, mitochondrial"""	610957				15779907, 15840810	Standard	NM_001040436		Approved	FLJ13995, CGI-04, mt-TyrRS	uc001rli.3	Q9Y2Z4	OTTHUMG00000169454	ENST00000324868.8:c.991C>T	12.37:g.32903765G>A	ENSP00000320658:p.His331Tyr		D3DUW8|Q9H817	Missense_Mutation	SNP	pfam_aa-tRNA-synth_Ic,prints_Tyr-tRNA-synth,tigrfam_Tyr-tRNA-synth	p.H331Y	ENST00000324868.8	37	c.991	CCDS31770.1	12	.	.	.	.	.	.	.	.	.	.	G	13.43	2.234508	0.39498	.	.	ENSG00000139131	ENST00000324868	T	0.41758	0.99	5.06	5.06	0.68205	.	0.228496	0.46145	D	0.000303	T	0.38321	0.1036	L	0.40543	1.245	0.44000	D	0.9967	B	0.15719	0.014	B	0.12837	0.008	T	0.22138	-1.0225	10	0.62326	D	0.03	-16.269	16.9729	0.86305	0.0:0.0:1.0:0.0	.	331	Q9Y2Z4	SYYM_HUMAN	Y	331	ENSP00000320658:H331Y	ENSP00000320658:H331Y	H	-	1	0	YARS2	32795032	1.000000	0.71417	0.996000	0.52242	0.289000	0.27227	3.821000	0.55700	2.515000	0.84797	0.650000	0.86243	CAT	YARS2	-	pfam_aa-tRNA-synth_Ic,tigrfam_Tyr-tRNA-synth	ENSG00000139131		0.423	YARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YARS2	HGNC	protein_coding	OTTHUMT00000404153.1	47	0.00	0	G	NM_015936		32903765	32903765	-1	no_errors	ENST00000324868	ensembl	human	known	69_37n	missense	47	14.55	8	SNP	1.000	A
ZBTB41	360023	genome.wustl.edu	37	1	197169434	197169437	+	Frame_Shift_Del	DEL	GAGG	GAGG	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	GAGG	GAGG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr1:197169434_197169437delGAGG	ENST00000367405.4	-	1	235_238	c.167_170delCCTC	c.(166-171)ccctctfs	p.PS56fs	CRB1_ENST00000535699.1_5'Flank|ZBTB41_ENST00000467322.1_5'UTR	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	56					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						CTGATCTGGAGAGGGAGGAAGTTC	0.387																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.167_170delCCTC	1.37:g.197169438_197169441delGAGG	ENSP00000356375:p.Pro56fs		A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.P56fs	ENST00000367405.4	37	c.170_167	CCDS30960.1	1																																																																																			ZBTB41	-	NULL	ENSG00000177888		0.387	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB41	HGNC	protein_coding	OTTHUMT00000088249.2	39	0.00	0	GAGG	NM_194314		197169434	197169437	-1	no_errors	ENST00000367405	ensembl	human	known	69_37n	frame_shift_del	28	17.65	6	DEL	0.998:1.000:0.998:1.000	-
ZCCHC2	54877	genome.wustl.edu	37	18	60207019	60207019	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr18:60207019C>T	ENST00000269499.5	+	2	1463	c.1045C>T	c.(1045-1047)Cga>Tga	p.R349*	ZCCHC2_ENST00000586834.1_Nonsense_Mutation_p.R28*	NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	349						cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25						CAGAGCTCAGCGAGAAGGTAT	0.413																																						dbGAP											0													71.0	64.0	66.0					18																	60207019		1944	4146	6090	-	-	-	SO:0001587	stop_gained	0			AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664		"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49		11214970	Standard	NM_017742		Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		ENST00000269499.5:c.1045C>T	18.37:g.60207019C>T	ENSP00000269499:p.Arg349*		B2RPG6|Q8N3S1|Q9NXF6	Nonsense_Mutation	SNP	pfam_Znf_CCHC,superfamily_Phox,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.R349*	ENST00000269499.5	37	c.1045	CCDS45880.1	18	.	.	.	.	.	.	.	.	.	.	C	39	7.370585	0.98241	.	.	ENSG00000141664	ENST00000269499	.	.	.	5.99	5.99	0.97316	.	0.227470	0.31734	N	0.007141	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.3184	17.3924	0.87436	0.0:1.0:0.0:0.0	.	.	.	.	X	349	.	ENSP00000269499:R349X	R	+	1	2	ZCCHC2	58357999	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.949000	0.40313	2.847000	0.97988	0.655000	0.94253	CGA	ZCCHC2	-	superfamily_Phox	ENSG00000141664		0.413	ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	ZCCHC2	HGNC	protein_coding	OTTHUMT00000450083.1	51	0.00	0	C	NM_017742		60207019	60207019	+1	no_errors	ENST00000269499	ensembl	human	known	69_37n	nonsense	59	13.24	9	SNP	1.000	T
ZHX1	11244	genome.wustl.edu	37	8	124267675	124267675	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr8:124267675A>G	ENST00000522655.1	-	3	1052	c.512T>C	c.(511-513)gTt>gCt	p.V171A	ZHX1_ENST00000395571.3_Missense_Mutation_p.V171A|ZHX1_ENST00000297857.2_Missense_Mutation_p.V171A|ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000522595.1_5'Flank			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	171					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			CGAAGAAGAAACTTCTGTAGA	0.333																																						dbGAP											0													105.0	106.0	106.0					8																	124267675		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.512T>C	8.37:g.124267675A>G	ENSP00000428821:p.Val171Ala		Q8IWD8	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.V171A	ENST00000522655.1	37	c.512	CCDS6342.1	8	.	.	.	.	.	.	.	.	.	.	A	0.540	-0.853917	0.02630	.	.	ENSG00000165156	ENST00000297857;ENST00000395571;ENST00000522655	T;T;T	0.46451	0.87;0.87;0.87	5.66	1.95	0.26073	.	0.309039	0.23118	N	0.051734	T	0.18045	0.0433	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22487	-1.0215	9	0.09338	T	0.73	-5.8273	5.0997	0.14753	0.5094:0.1532:0.3373:0.0	.	171	Q9UKY1	ZHX1_HUMAN	A	171	ENSP00000297857:V171A;ENSP00000378938:V171A;ENSP00000428821:V171A	ENSP00000297857:V171A	V	-	2	0	ZHX1	124336856	0.000000	0.05858	0.976000	0.42696	0.912000	0.54170	0.364000	0.20325	0.414000	0.25790	0.454000	0.30748	GTT	ZHX1	-	NULL	ENSG00000165156		0.333	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZHX1	HGNC	protein_coding	OTTHUMT00000381759.1	46	0.00	0	A			124267675	124267675	-1	no_errors	ENST00000297857	ensembl	human	known	69_37n	missense	37	13.95	6	SNP	0.095	G
ZMYND8	23613	genome.wustl.edu	37	20	45855964	45855964	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr20:45855964C>T	ENST00000311275.7	-	18	3191	c.2938G>A	c.(2938-2940)Gaa>Aaa	p.E980K	ZMYND8_ENST00000536340.1_Missense_Mutation_p.E1007K|ZMYND8_ENST00000372023.3_Missense_Mutation_p.E902K|ZMYND8_ENST00000262975.4_Missense_Mutation_p.E934K|ZMYND8_ENST00000396281.4_Missense_Mutation_p.E980K|ZMYND8_ENST00000540497.1_Missense_Mutation_p.E928K|ZMYND8_ENST00000355972.4_Missense_Mutation_p.E980K|ZMYND8_ENST00000471951.2_Missense_Mutation_p.E1000K|ZMYND8_ENST00000352431.2_Missense_Mutation_p.E954K|ZMYND8_ENST00000446994.2_Missense_Mutation_p.E871K|ZMYND8_ENST00000458360.2_Missense_Mutation_p.E848K|ZMYND8_ENST00000461685.1_Missense_Mutation_p.E954K|ZMYND8_ENST00000360911.3_Missense_Mutation_p.E929K	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	980					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			TGTTTCATTTCGGAGAGCTCT	0.512																																						dbGAP											0													186.0	152.0	163.0					20																	45855964		2203	4300	6503	-	-	-	SO:0001583	missense	0			U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.2938G>A	20.37:g.45855964C>T	ENSP00000312237:p.Glu980Lys		B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Missense_Mutation	SNP	pfam_DUF3544,pfam_Bromodomain,pfam_PWWP,pfam_Znf_PHD-finger,pfam_Znf_MYND,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP,pfscan_PWWP,pfscan_Znf_MYND,pfscan_Znf_PHD-finger,pfscan_Bromodomain	p.E1007K	ENST00000311275.7	37	c.3019		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.4|25.4	4.632900|4.632900	0.87660|0.87660	.|.	.|.	ENSG00000101040|ENSG00000101040	ENST00000360911;ENST00000311275;ENST00000458360;ENST00000262975;ENST00000471951;ENST00000352431;ENST00000396281;ENST00000536340;ENST00000355972;ENST00000446994;ENST00000461685;ENST00000372023;ENST00000540497|ENST00000467200	T;T;T;T;T;T;T;T;T;T;T|.	0.75477|.	-0.94;-0.94;-0.94;-0.94;-0.94;-0.94;-0.94;-0.94;-0.94;0.4;-0.94|.	5.74|5.74	4.8|4.8	0.61643|0.61643	.|.	0.048659|.	0.85682|.	N|.	0.000000|.	T|T	0.72953|0.72953	0.3525|0.3525	M|M	0.72353|0.72353	2.195|2.195	0.53005|0.53005	D|D	0.999963|0.999963	B;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.89917|.	0.036;1.0;0.999;1.0;1.0;1.0;1.0;1.0;1.0;0.999;0.999;0.999;0.999;0.999;1.0;0.999|.	B;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.87578|.	0.008;0.998;0.995;0.991;0.998;0.998;0.996;0.996;0.998;0.995;0.995;0.995;0.98;0.972;0.991;0.995|.	T|T	0.73458|0.73458	-0.3976|-0.3976	10|5	0.49607|.	T|.	0.09|.	-21.9244|-21.9244	14.7152|14.7152	0.69262|0.69262	0.0:0.9307:0.0:0.0693|0.0:0.9307:0.0:0.0693	.|.	848;1007;902;909;1000;934;929;954;954;980;871;929;928;873;882;980|.	B7ZM62;F5H0X3;Q2HXV3;Q5TH11;Q9ULU4-7;Q9ULU4-9;Q9ULU4-14;Q9ULU4-12;Q9ULU4-13;Q9ULU4;B3KVL2;Q2HXV9;Q2HXV1;Q9ULU4-8;Q2HXV4;B7Z2A8|.	.;.;.;.;.;.;.;.;.;PKCB1_HUMAN;.;.;.;.;.;.|.	K|Q	929;980;848;935;1001;954;980;1007;980;871;954;902;928|861	ENSP00000354166:E929K;ENSP00000312237:E980K;ENSP00000392964:E848K;ENSP00000335537:E954K;ENSP00000379577:E980K;ENSP00000439800:E1007K;ENSP00000348246:E980K;ENSP00000396725:E871K;ENSP00000418210:E954K;ENSP00000361093:E902K;ENSP00000443086:E928K|.	ENSP00000262975:E935K|.	E|R	-|-	1|2	0|0	ZMYND8|ZMYND8	45289371|45289371	1.000000|1.000000	0.71417|0.71417	0.698000|0.698000	0.30274|0.30274	0.978000|0.978000	0.69477|0.69477	7.770000|7.770000	0.85390|0.85390	1.434000|1.434000	0.47414|0.47414	0.585000|0.585000	0.79938|0.79938	GAA|CGA	ZMYND8	-	NULL	ENSG00000101040		0.512	ZMYND8-007	KNOWN	basic	protein_coding	ZMYND8	HGNC	protein_coding	OTTHUMT00000079596.2	120	0.00	0	C	NM_183047		45855964	45855964	-1	no_errors	ENST00000536340	ensembl	human	known	69_37n	missense	55	22.54	16	SNP	1.000	T
ZNF12	7559	genome.wustl.edu	37	7	6730908	6730908	+	Silent	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr7:6730908T>C	ENST00000405858.1	-	5	2206	c.1665A>G	c.(1663-1665)ggA>ggG	p.G555G	AC073343.13_ENST00000366167.2_RNA|AC073343.2_ENST00000577401.1_RNA|ZNF12_ENST00000342651.5_Silent_p.G517G|ZNF12_ENST00000404360.1_Silent_p.G481G	NM_006956.2|NM_016265.3	NP_008887.2|NP_057349.2	P17014	ZNF12_HUMAN	zinc finger protein 12	555					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(3)	16		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		AGAAGAATTTTCCACATATAT	0.403																																						dbGAP											0													45.0	49.0	47.0					7																	6730908		2141	4282	6423	-	-	-	SO:0001819	synonymous_variant	0			X52334, AB021643	CCDS47538.1, CCDS47539.1	7p21.1	2013-01-08	2005-06-09		ENSG00000164631	ENSG00000164631		"""Zinc fingers, C2H2-type"", ""-"""	12902	protein-coding gene	gene with protein product		194536	"""zinc finger protein 325"""	ZNF325			Standard	NM_016265		Approved	KOX3, GIOT-3	uc003sqt.1	P17014	OTTHUMG00000151910	ENST00000405858.1:c.1665A>G	7.37:g.6730908T>C			A8MYC4|A8WFQ8|B2RNQ7|B4DF45|Q6N016|Q8NHZ0|Q9H9P0|Q9ULZ6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G555	ENST00000405858.1	37	c.1665	CCDS47538.1	7																																																																																			ZNF12	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000164631		0.403	ZNF12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF12	HGNC	protein_coding	OTTHUMT00000324373.2	40	0.00	0	T	NM_016265		6730908	6730908	-1	no_errors	ENST00000405858	ensembl	human	known	69_37n	silent	33	15.38	6	SNP	0.988	C
ZNF132	7691	genome.wustl.edu	37	19	58946279	58946279	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr19:58946279C>T	ENST00000254166.3	-	3	932	c.532G>A	c.(532-534)Gca>Aca	p.A178T		NM_003433.3	NP_003424.3	P52740	ZN132_HUMAN	zinc finger protein 132	178					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(1)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)		TTCATAAGTGCGTCCCTGTCC	0.532																																						dbGAP											0													157.0	124.0	135.0					19																	58946279		2203	4300	6503	-	-	-	SO:0001583	missense	0			U09411	CCDS12980.1	19q13.4	2013-01-08	2006-06-13			ENSG00000131849		"""Zinc fingers, C2H2-type"", ""-"""	12916	protein-coding gene	gene with protein product		604074	"""zinc finger protein 132 (clone pHZ-12)"""			7557990	Standard	NM_003433		Approved	pHZ-12	uc002qst.4	P52740		ENST00000254166.3:c.532G>A	19.37:g.58946279C>T	ENSP00000254166:p.Ala178Thr		Q32MI9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A178T	ENST00000254166.3	37	c.532	CCDS12980.1	19	.	.	.	.	.	.	.	.	.	.	C	4.645	0.119884	0.08881	.	.	ENSG00000131849	ENST00000254166	T	0.15139	2.45	2.89	-1.46	0.08800	.	.	.	.	.	T	0.07548	0.0190	N	0.11698	0.16	0.09310	N	1	B	0.20887	0.049	B	0.10450	0.005	T	0.40346	-0.9568	9	0.21540	T	0.41	.	6.0531	0.19796	0.3383:0.5033:0.0:0.1584	.	178	P52740	ZN132_HUMAN	T	178	ENSP00000254166:A178T	ENSP00000254166:A178T	A	-	1	0	ZNF132	63638091	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.339000	0.07832	-0.215000	0.10063	-0.347000	0.07816	GCA	ZNF132	-	NULL	ENSG00000131849		0.532	ZNF132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF132	HGNC	protein_coding	OTTHUMT00000467035.1	56	0.00	0	C	NM_003433		58946279	58946279	-1	no_errors	ENST00000254166	ensembl	human	known	69_37n	missense	33	23.26	10	SNP	0.000	T
ZNF292	23036	genome.wustl.edu	37	6	87966306	87966306	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:87966306C>T	ENST00000369577.3	+	8	3002	c.2959C>T	c.(2959-2961)Cag>Tag	p.Q987*	ZNF292_ENST00000339907.4_Nonsense_Mutation_p.Q982*	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	987						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TCCAGGTTTCCAGGAGAGAAA	0.398																																						dbGAP											0													89.0	86.0	87.0					6																	87966306		1881	4104	5985	-	-	-	SO:0001587	stop_gained	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.2959C>T	6.37:g.87966306C>T	ENSP00000358590:p.Gln987*		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q987*	ENST00000369577.3	37	c.2959	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	C	18.74	3.688993	0.68271	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	.	.	.	5.25	4.36	0.52297	.	0.639492	0.16800	N	0.199031	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	14.435	0.67274	0.0:0.7192:0.2808:0.0	.	.	.	.	X	987;982	.	ENSP00000342847:Q982X	Q	+	1	0	ZNF292	88023025	0.997000	0.39634	0.999000	0.59377	0.106000	0.19336	2.319000	0.43788	1.308000	0.44962	0.591000	0.81541	CAG	ZNF292	-	NULL	ENSG00000188994		0.398	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	33	0.00	0	C	NM_015021		87966306	87966306	+1	no_errors	ENST00000369577	ensembl	human	known	69_37n	nonsense	21	16.00	4	SNP	0.997	T
ZNF415	55786	genome.wustl.edu	37	19	53612925	53612925	+	De_novo_Start_OutOfFrame	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr19:53612925G>A	ENST00000601493.1	-	0	338				ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000455735.2_Missense_Mutation_p.R173C|ZNF415_ENST00000500065.4_Missense_Mutation_p.R125C|ZNF415_ENST00000421033.1_Missense_Mutation_p.R137C|ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000243643.4_Missense_Mutation_p.R125C|ZNF415_ENST00000601215.1_3'UTR|ZNF415_ENST00000440291.1_Missense_Mutation_p.R112C|ZNF415_ENST00000448501.1_Missense_Mutation_p.R173C			Q09FC8	ZN415_HUMAN	zinc finger protein 415						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		CTTCTATCGCGTTGGTCTCTC	0.408																																						dbGAP											0													126.0	113.0	118.0					19																	53612925		2203	4300	6503	-	-	-			0			AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000601493.1:c.-318C>T	19.37:g.53612925G>A			F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2	p.R173C	ENST00000601493.1	37	c.517		19	.	.	.	.	.	.	.	.	.	.	G	9.955	1.221299	0.22457	.	.	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	T;T;T;T;T;T	0.08282	3.11;3.11;3.11;3.11;3.11;3.11	2.71	-1.24	0.09435	.	.	.	.	.	T	0.04318	0.0119	N	0.02539	-0.55	0.09310	N	1	B;B;B;D;B;B	0.76494	0.0;0.003;0.0;0.999;0.0;0.0	B;B;B;P;B;B	0.51866	0.0;0.001;0.0;0.682;0.0;0.0	T	0.29397	-1.0013	9	0.41790	T	0.15	.	3.1318	0.06425	0.292:0.2287:0.4793:0.0	.	125;173;173;125;112;137	F5H287;B3KTG1;Q09FC8;Q09FC8-5;Q09FC8-4;Q09FC8-2	.;.;ZN415_HUMAN;.;.;.	C	125;125;173;137;173;112	ENSP00000243643:R125C;ENSP00000439435:R125C;ENSP00000396492:R173C;ENSP00000395055:R137C;ENSP00000388787:R173C;ENSP00000414601:R112C	ENSP00000243643:R125C	R	-	1	0	ZNF415	58304737	0.001000	0.12720	0.000000	0.03702	0.015000	0.08874	-0.228000	0.09114	-0.287000	0.09064	0.313000	0.20887	CGC	ZNF415	-	NULL	ENSG00000170954		0.408	ZNF415-008	PUTATIVE	basic	protein_coding	ZNF415	HGNC	protein_coding	OTTHUMT00000464038.1	74	0.00	0	G	NM_018355		53612925	53612925	-1	no_errors	ENST00000448501	ensembl	human	known	69_37n	missense	38	17.39	8	SNP	0.001	A
ZNF608	57507	genome.wustl.edu	37	5	123984089	123984089	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr5:123984089delT	ENST00000306315.5	-	4	2423	c.1988delA	c.(1987-1989)aagfs	p.K664fs	ZNF608_ENST00000504926.1_Frame_Shift_Del_p.K237fs	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	664							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		AAGGCCCTTCTTTTTGCCAGA	0.512																																						dbGAP											0													115.0	120.0	118.0					5																	123984089		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.1988delA	5.37:g.123984089delT	ENSP00000307746:p.Lys664fs		A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Frame_Shift_Del	DEL	NULL	p.K663fs	ENST00000306315.5	37	c.1988	CCDS34219.1	5																																																																																			ZNF608	-	NULL	ENSG00000168916		0.512	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	HGNC	protein_coding	OTTHUMT00000371300.1	48	0.00	0	T	XM_114432		123984089	123984089	-1	no_errors	ENST00000306315	ensembl	human	known	69_37n	frame_shift_del	25	13.79	4	DEL	1.000	-
ZNF780B	163131	genome.wustl.edu	37	19	40542427	40542427	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr19:40542427G>A	ENST00000434248.1	-	5	404	c.339C>T	c.(337-339)ctC>ctT	p.L113L	ZNF780B_ENST00000221355.6_5'UTR	NM_001005851.2	NP_001005851.1	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	113					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AAAAGGCCTCGAGGCCAAGTG	0.333																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK127063	CCDS46077.1	19q13.2	2013-01-08	2006-08-15	2006-08-15	ENSG00000128000	ENSG00000128000		"""Zinc fingers, C2H2-type"", ""-"""	33109	protein-coding gene	gene with protein product			"""zinc finger protein 779"""	ZNF779			Standard	NM_001005851		Approved		uc002omu.3	Q9Y6R6	OTTHUMG00000155118	ENST00000434248.1:c.339C>T	19.37:g.40542427G>A			B9EH00	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L113	ENST00000434248.1	37	c.339	CCDS46077.1	19																																																																																			ZNF780B	-	NULL	ENSG00000128000		0.333	ZNF780B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF780B	HGNC	protein_coding	OTTHUMT00000338466.1	58	0.00	0	G	NM_001005851		40542427	40542427	-1	no_errors	ENST00000434248	ensembl	human	known	69_37n	silent	54	18.18	12	SNP	0.002	A
ZNF830	91603	genome.wustl.edu	37	17	33289332	33289332	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:33289332delT	ENST00000361952.3	+	1	784	c.747delT	c.(745-747)ggtfs	p.G249fs	CCT6B_ENST00000314144.5_5'Flank|CCT6B_ENST00000436961.3_5'Flank|CCT6B_ENST00000421975.3_5'Flank	NM_052857.3	NP_443089.3	Q96NB3	ZN830_HUMAN	zinc finger protein 830	249					blastocyst growth (GO:0001832)|mitotic nuclear division (GO:0007067)|nuclear cell cycle DNA replication (GO:0033260)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(1)|liver(2)|lung(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(249;0.17)				TACCGGAAGGTTTTTTTGACG	0.458																																						dbGAP											0													64.0	61.0	62.0					17																	33289332		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK055707	CCDS32618.1	17q12	2013-10-23	2008-03-25	2008-03-25	ENSG00000198783	ENSG00000198783			28291	protein-coding gene	gene with protein product	"""orphan maintenance of genome 1"""		"""coiled-coil domain containing 16"""	CCDC16		23066043	Standard	NM_052857		Approved	MGC20398, OMCG1	uc002hih.4	Q96NB3	OTTHUMG00000179771	ENST00000361952.3:c.747delT	17.37:g.33289332delT	ENSP00000354518:p.Gly249fs		Q96F60|Q96GZ5|Q9BU38	Frame_Shift_Del	DEL	smart_Znf_U1	p.F251fs	ENST00000361952.3	37	c.747	CCDS32618.1	17																																																																																			ZNF830	-	NULL	ENSG00000198783		0.458	ZNF830-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF830	HGNC	protein_coding	OTTHUMT00000448018.1	28	0.00	0	T	NM_052857		33289332	33289332	+1	no_errors	ENST00000361952	ensembl	human	known	69_37n	frame_shift_del	19	25.00	7	DEL	0.993	-
ZSCAN12	9753	genome.wustl.edu	37	6	28359098	28359098	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr6:28359098T>C	ENST00000361028.1	-	4	1114	c.969A>G	c.(967-969)atA>atG	p.I323M	ZSCAN12_ENST00000396827.3_Missense_Mutation_p.I323M			O43309	ZSC12_HUMAN	zinc finger and SCAN domain containing 12	323					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|urinary_tract(1)	6						CTCCAGTGTGTATTATTTTGT	0.433																																						dbGAP											0													97.0	86.0	89.0					6																	28359098		692	1591	2283	-	-	-	SO:0001583	missense	0			AB007886		6p21	2013-01-08	2007-02-20	2007-02-20	ENSG00000158691	ENSG00000158691		"""-"", ""Zinc fingers, C2H2-type"""	13172	protein-coding gene	gene with protein product		603978	"""zinc finger protein 305"", ""zinc finger protein 96"""	ZNF305, ZNF96		9244436	Standard	NM_001163391		Approved	KIAA0426, ZNF29K1, ZFP96, dJ29K1.2	uc011dlh.2	O43309	OTTHUMG00000014522	ENST00000361028.1:c.969A>G	6.37:g.28359098T>C	ENSP00000354305:p.Ile323Met		O43724	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.I323M	ENST00000361028.1	37	c.969		6	.	.	.	.	.	.	.	.	.	.	T	15.65	2.895625	0.52121	.	.	ENSG00000158691	ENST00000361028;ENST00000396827	T;T	0.43294	0.95;0.95	4.08	-3.75	0.04372	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.213173	0.23876	N	0.043695	T	0.24084	0.0583	L	0.48935	1.535	0.19575	N	0.999967	D;P	0.60575	0.988;0.481	P;B	0.59288	0.855;0.3	T	0.14254	-1.0479	10	0.41790	T	0.15	.	3.1052	0.06339	0.2368:0.0855:0.468:0.2097	.	323;323	A8K187;O43309	.;ZSC12_HUMAN	M	323	ENSP00000354305:I323M;ENSP00000380039:I323M	ENSP00000354305:I323M	I	-	3	3	ZSCAN12	28467077	0.000000	0.05858	0.994000	0.49952	0.976000	0.68499	-2.284000	0.01154	-0.173000	0.10761	-0.299000	0.09455	ATA	ZSCAN12	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000158691		0.433	ZSCAN12-001	KNOWN	basic|appris_principal	protein_coding	ZSCAN12	HGNC	protein_coding	OTTHUMT00000040190.1	54	0.00	0	T	NM_014724		28359098	28359098	-1	no_errors	ENST00000361028	ensembl	human	known	69_37n	missense	41	10.87	5	SNP	0.290	C
ZZEF1	23140	genome.wustl.edu	37	17	3919737	3919737	+	Silent	SNP	G	G	A			TCGA-EW-A1IZ-01A-11D-A188-09	TCGA-EW-A1IZ-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	18db4143-48cc-424c-8d23-46cf23056528	e528b9ef-53e6-49d4-a86c-648a752d1835	g.chr17:3919737G>A	ENST00000381638.2	-	49	8149	c.8025C>T	c.(8023-8025)ggC>ggT	p.G2675G		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	2675							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						CCTCTCGGCAGCCCTGGAGCA	0.567																																						dbGAP											0													90.0	70.0	77.0					17																	3919737		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.8025C>T	17.37:g.3919737G>A			A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Silent	SNP	pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_CUB,smart_EF_hand_Ca-bd,smart_Znf_ZZ,pfscan_EF_HAND_2,pfscan_Znf_ZZ	p.G2675	ENST00000381638.2	37	c.8025	CCDS11043.1	17																																																																																			ZZEF1	-	NULL	ENSG00000074755		0.567	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZEF1	HGNC	protein_coding	OTTHUMT00000207480.1	50	0.00	0	G	NM_015113		3919737	3919737	-1	no_errors	ENST00000381638	ensembl	human	known	69_37n	silent	29	17.14	6	SNP	1.000	A
