#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ANKRD30BL	554226	genome.wustl.edu	37	2	133015115	133015115	+	5'UTR	SNP	A	A	C	rs72869476	byFrequency	TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr2:133015115A>C	ENST00000470729.1	-	0	427				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						ATCAAGGGGGAAGTGGAGGAG	0.667																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-998T>G	2.37:g.133015115A>C			B8ZZL7	RNA	SNP	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			ANKRD30BL	-	-	ENSG00000163046		0.667	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331354.1	8	0.00	0	A	NR_027019		133015115	133015115	-1	no_errors	ENST00000470729	ensembl	human	known	69_37n	rna	11	26.67	4	SNP	0.019	C
ARL6IP6	151188	genome.wustl.edu	37	2	153591569	153591569	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr2:153591569G>C	ENST00000326446.5	+	3	1227	c.516G>C	c.(514-516)tgG>tgC	p.W172C	ARL6IP6_ENST00000463690.1_3'UTR	NM_152522.5	NP_689735.1	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation factor-like 6 interacting protein 6	172						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	5						GCTTTTCTTGGACAGTGACTT	0.388																																						dbGAP											0													158.0	153.0	155.0					2																	153591569		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023109	CCDS2197.1	2q23	2014-05-12	2014-05-12		ENSG00000177917	ENSG00000177917			24048	protein-coding gene	gene with protein product							Standard	NM_152522		Approved	MGC33864	uc002tyn.3	Q8N6S5	OTTHUMG00000131901	ENST00000326446.5:c.516G>C	2.37:g.153591569G>C	ENSP00000315357:p.Trp172Cys		B2RDS6|Q7Z4G7	Missense_Mutation	SNP	NULL	p.W172C	ENST00000326446.5	37	c.516	CCDS2197.1	2	.	.	.	.	.	.	.	.	.	.	G	20.2	3.941563	0.73557	.	.	ENSG00000177917	ENST00000326446	.	.	.	5.87	5.87	0.94306	.	0.076287	0.56097	D	0.000024	T	0.79759	0.4501	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80567	-0.1325	9	0.87932	D	0	-16.5191	18.9906	0.92789	0.0:0.0:1.0:0.0	.	172;172	B3KMZ5;Q8N6S5	.;AR6P6_HUMAN	C	172	.	ENSP00000315357:W172C	W	+	3	0	ARL6IP6	153299815	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.359000	0.79477	2.780000	0.95670	0.655000	0.94253	TGG	ARL6IP6	-	NULL	ENSG00000177917		0.388	ARL6IP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL6IP6	HGNC	protein_coding	OTTHUMT00000254852.3	59	0.00	0	G	NM_152522		153591569	153591569	+1	no_errors	ENST00000326446	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	1.000	C
ACVR1C	130399	genome.wustl.edu	37	2	158399221	158399221	+	Missense_Mutation	SNP	T	T	G			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr2:158399221T>G	ENST00000243349.8	-	6	1457	c.1097A>C	c.(1096-1098)aAg>aCg	p.K366T	ACVR1C_ENST00000409680.3_Missense_Mutation_p.K316T|ACVR1C_ENST00000348328.5_Missense_Mutation_p.K209T|ACVR1C_ENST00000335450.7_Missense_Mutation_p.K286T	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC											NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						GTCTTACCTCTTGGTTCCCAC	0.458																																						dbGAP											0													203.0	197.0	199.0					2																	158399221		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.1097A>C	2.37:g.158399221T>G	ENSP00000243349:p.Lys366Thr			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.K366T	ENST00000243349.8	37	c.1097	CCDS2205.1	2	.	.	.	.	.	.	.	.	.	.	T	21.5	4.158489	0.78114	.	.	ENSG00000123612	ENST00000243349;ENST00000409680;ENST00000348328;ENST00000335450	D;D;D;D	0.93189	-3.18;-3.18;-3.18;-3.18	5.77	5.77	0.91146	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.111515	0.39407	N	0.001369	D	0.94883	0.8346	L	0.56124	1.755	0.58432	D	0.999999	D;P;D	0.59767	0.986;0.89;0.967	D;P;D	0.65443	0.92;0.532;0.935	D	0.94849	0.8012	10	0.66056	D	0.02	.	11.443	0.50107	0.0:0.0721:0.0:0.9279	.	209;286;366	Q8NER5-2;Q8NER5-3;Q8NER5	.;.;ACV1C_HUMAN	T	366;316;209;286	ENSP00000243349:K366T;ENSP00000387168:K316T;ENSP00000335139:K209T;ENSP00000335178:K286T	ENSP00000243349:K366T	K	-	2	0	ACVR1C	158107467	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	6.258000	0.72487	2.330000	0.79161	0.528000	0.53228	AAG	ACVR1C	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000123612		0.458	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1C	HGNC	protein_coding	OTTHUMT00000254924.2	47	0.00	0	T	NM_145259		158399221	158399221	-1	no_errors	ENST00000243349	ensembl	human	known	69_37n	missense	46	28.12	18	SNP	1.000	G
ATG16L1	55054	genome.wustl.edu	37	2	234201045	234201045	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr2:234201045C>G	ENST00000392017.4	+	16	1850	c.1593C>G	c.(1591-1593)ttC>ttG	p.F531L	ATG16L1_ENST00000392018.1_Missense_Mutation_p.F548L|ATG16L1_ENST00000347464.5_Missense_Mutation_p.F368L|ATG16L1_ENST00000392020.4_Missense_Mutation_p.F512L|ATG16L1_ENST00000373525.5_Missense_Mutation_p.F352L	NM_001190266.1|NM_001190267.1|NM_030803.6	NP_001177195.1|NP_001177196.1|NP_110430.5	Q676U5	A16L1_HUMAN	autophagy related 16-like 1 (S. cerevisiae)	531					autophagic vacuole assembly (GO:0000045)|negative stranded viral RNA replication (GO:0039689)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(7)|prostate(3)|skin(1)	25		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		CACCTGGGTTCAAGTGCGGCT	0.557																																						dbGAP											0													138.0	125.0	130.0					2																	234201045		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000897	CCDS2502.2, CCDS2503.2, CCDS54438.1	2q37.1	2014-02-12	2012-06-06	2005-09-13	ENSG00000085978	ENSG00000085978		"""WD repeat domain containing"""	21498	protein-coding gene	gene with protein product		610767	"""APG16 autophagy 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like 1 (S. cerevisiae)"""	APG16L, ATG16L			Standard	NM_017974		Approved	WDR30, FLJ10035, ATG16A	uc002vty.3	Q676U5	OTTHUMG00000133619	ENST00000392017.4:c.1593C>G	2.37:g.234201045C>G	ENSP00000375872:p.Phe531Leu		A3EXK9|A3EXL0|B6ZDH0|Q6IPN1|Q6UXW4|Q6ZVZ5|Q8NCY2|Q96JV5|Q9H619	Missense_Mutation	SNP	pfam_Autophagy-rel_prot_16,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Prefoldin,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.F531L	ENST00000392017.4	37	c.1593	CCDS2503.2	2	.	.	.	.	.	.	.	.	.	.	C	16.90	3.251146	0.59212	.	.	ENSG00000085978	ENST00000392017;ENST00000347464;ENST00000373525;ENST00000392020;ENST00000392018;ENST00000334050	T;T;T;T;T	0.17370	2.28;2.28;2.28;2.28;2.28	5.59	5.59	0.84812	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.17023	0.0409	L	0.60012	1.86	0.80722	D	1	B;B;B;B;B	0.16603	0.013;0.002;0.018;0.001;0.011	B;B;B;B;B	0.25291	0.03;0.008;0.059;0.004;0.026	T	0.06250	-1.0837	10	0.10902	T	0.67	.	10.1027	0.42515	0.0:0.8521:0.0:0.1479	.	485;512;352;531;368	B7ZLM5;Q676U5-2;Q676U5-4;Q676U5;A3EXL0	.;.;.;A16L1_HUMAN;.	L	531;368;352;512;548;190	ENSP00000375872:F531L;ENSP00000318259:F368L;ENSP00000362625:F352L;ENSP00000375875:F512L;ENSP00000375873:F548L	ENSP00000334016:F190L	F	+	3	2	ATG16L1	233865784	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.777000	0.47717	2.625000	0.88918	0.655000	0.94253	TTC	ATG16L1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000085978		0.557	ATG16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG16L1	HGNC	protein_coding	OTTHUMT00000257069.2	66	0.00	0	C	NM_017974		234201045	234201045	+1	no_errors	ENST00000392017	ensembl	human	known	69_37n	missense	43	35.82	24	SNP	1.000	G
ATP8A2	51761	genome.wustl.edu	37	13	26129206	26129206	+	Splice_Site	SNP	G	G	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr13:26129206G>A	ENST00000381655.2	+	13	1405	c.1263G>A	c.(1261-1263)caG>caA	p.Q421Q	ATP8A2_ENST00000255283.8_Splice_Site_p.Q381Q	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	381					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		AGCTTGGGCAGGTGAAAAAGC	0.433																																						dbGAP											0													93.0	91.0	91.0					13																	26129206		1849	4095	5944	-	-	-	SO:0001630	splice_region_variant	0			AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.1263+1G>A	13.37:g.26129206G>A			Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.Q421	ENST00000381655.2	37	c.1263	CCDS41873.1	13																																																																																			ATP8A2	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000132932		0.433	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8A2	HGNC	protein_coding	OTTHUMT00000044236.2	32	0.00	0	G	NM_016529	Silent	26129206	26129206	+1	no_errors	ENST00000381655	ensembl	human	known	69_37n	silent	10	76.19	32	SNP	1.000	A
BPTF	2186	genome.wustl.edu	37	17	65925540	65925540	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr17:65925540G>T	ENST00000321892.4	+	19	6526	c.6465G>T	c.(6463-6465)agG>agT	p.R2155S	BPTF_ENST00000335221.5_Missense_Mutation_p.R2155S|BPTF_ENST00000306378.6_Missense_Mutation_p.R2029S|BPTF_ENST00000424123.3_Missense_Mutation_p.R2016S			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2155					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TCCAGCCCAGGACAGCAACAG	0.423																																						dbGAP											0													104.0	88.0	93.0					17																	65925540		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.6465G>T	17.37:g.65925540G>T	ENSP00000315454:p.Arg2155Ser		Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.R2155S	ENST00000321892.4	37	c.6465		17	.	.	.	.	.	.	.	.	.	.	G	9.657	1.143134	0.21205	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	T;T;T	0.66280	-0.14;-0.14;-0.2	5.95	1.29	0.21616	.	.	.	.	.	T	0.63105	0.2483	L	0.34521	1.04	0.48830	D	0.999718	D;D	0.65815	0.994;0.995	D;P	0.66602	0.945;0.791	T	0.55321	-0.8159	9	0.16420	T	0.52	-14.832	11.8508	0.52410	0.2746:0.0:0.7254:0.0	.	2029;2155	Q12830-2;Q12830-4	.;.	S	2029;2155;2155	ENSP00000307208:R2029S;ENSP00000334351:R2155S;ENSP00000315454:R2155S	ENSP00000307208:R2029S	R	+	3	2	BPTF	63356002	1.000000	0.71417	0.826000	0.32828	0.461000	0.32589	0.895000	0.28363	0.428000	0.26173	-0.143000	0.13931	AGG	BPTF	-	NULL	ENSG00000171634		0.423	BPTF-201	KNOWN	basic	protein_coding	BPTF	HGNC	protein_coding		59	0.00	0	G	NM_182641, NM_004459		65925540	65925540	+1	no_errors	ENST00000321892	ensembl	human	known	69_37n	missense	80	16.67	16	SNP	0.993	T
C12orf56	115749	genome.wustl.edu	37	12	64746739	64746739	+	Missense_Mutation	SNP	T	T	G			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr12:64746739T>G	ENST00000543942.2	-	2	976	c.350A>C	c.(349-351)aAa>aCa	p.K117T	RPS11P6_ENST00000535684.1_RNA|C12orf56_ENST00000333722.5_Missense_Mutation_p.K117T|snoU13_ENST00000459220.1_RNA	NM_001170633.1	NP_001164104.1	Q8IXR9	CL056_HUMAN	chromosome 12 open reading frame 56	117										NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)	15			GBM - Glioblastoma multiforme(3;0.000582)	GBM - Glioblastoma multiforme(28;0.0259)		GTTTGACTTTTTACACTCTTT	0.368																																						dbGAP											0													117.0	110.0	112.0					12																	64746739		1831	4079	5910	-	-	-	SO:0001583	missense	0				CCDS44935.1, CCDS61182.1	12q14.2	2012-08-15			ENSG00000185306	ENSG00000185306			26967	protein-coding gene	gene with protein product							Standard	NM_001099676		Approved		uc021qzu.1	Q8IXR9	OTTHUMG00000168782	ENST00000543942.2:c.350A>C	12.37:g.64746739T>G	ENSP00000446101:p.Lys117Thr			Missense_Mutation	SNP	NULL	p.K117T	ENST00000543942.2	37	c.350		12	.	.	.	.	.	.	.	.	.	.	T	0.142	-1.101105	0.01843	.	.	ENSG00000185306	ENST00000333722;ENST00000543942;ENST00000433716;ENST00000543259	.	.	.	4.27	-0.533	0.11887	.	1.387560	0.05096	N	0.486235	T	0.15522	0.0374	N	0.03608	-0.345	0.09310	N	1	B	0.26547	0.152	B	0.20955	0.032	T	0.19811	-1.0294	8	.	.	.	-1.2988	7.0016	0.24813	0.0:0.4647:0.0:0.5353	.	117	Q8IXR9-2	.	T	117;117;117;104	.	.	K	-	2	0	C12orf56	63033006	0.099000	0.21834	0.008000	0.14137	0.002000	0.02628	-0.364000	0.07583	0.024000	0.15214	-0.256000	0.11100	AAA	C12orf56	-	NULL	ENSG00000185306		0.368	C12orf56-008	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf56	HGNC	protein_coding	OTTHUMT00000401058.2	47	0.00	0	T	NM_001099676		64746739	64746739	-1	no_errors	ENST00000333722	ensembl	human	known	69_37n	missense	51	12.07	7	SNP	0.013	G
CAMK2D	817	genome.wustl.edu	37	4	114429417	114429417	+	Intron	SNP	T	T	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr4:114429417T>A	ENST00000342666.5	-	13	984				CAMK2D_ENST00000514328.1_Intron|CAMK2D_ENST00000394522.3_Intron|CAMK2D_ENST00000418639.2_Intron|CAMK2D_ENST00000394526.2_Missense_Mutation_p.K331M|CAMK2D_ENST00000508738.1_Missense_Mutation_p.K331M|CAMK2D_ENST00000505990.1_Intron|CAMK2D_ENST00000515496.1_Missense_Mutation_p.K331M|CAMK2D_ENST00000379773.2_Intron|CAMK2D_ENST00000394524.3_Intron|CAMK2D_ENST00000454265.2_Missense_Mutation_p.K331M|CAMK2D_ENST00000511664.1_Intron|CAMK2D_ENST00000429180.1_Intron|CAMK2D_ENST00000296402.5_Intron			Q13557	KCC2D_HUMAN	calcium/calmodulin-dependent protein kinase II delta						calcium ion transport (GO:0006816)|cardiac muscle cell contraction (GO:0086003)|cellular response to calcium ion (GO:0071277)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle cell action potential (GO:0098901)|regulation of cardiac muscle cell action potential involved in regulation of contraction (GO:0098909)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cell growth (GO:0001558)|regulation of cellular localization (GO:0060341)|regulation of generation of L-type calcium current (GO:1902514)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of histone deacetylase activity (GO:1901725)|regulation of membrane depolarization (GO:0003254)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of the force of heart contraction (GO:0002026)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|relaxation of cardiac muscle (GO:0055119)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|calcium channel complex (GO:0034704)|calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intercalated disc (GO:0014704)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|ion channel binding (GO:0044325)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|sodium channel inhibitor activity (GO:0019871)|titin binding (GO:0031432)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	13		Ovarian(17;0.00369)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000271)		CGAACTGGACTTCCTTTTCTG	0.343																																						dbGAP											0													45.0	38.0	40.0					4																	114429417		1548	3519	5067	-	-	-	SO:0001627	intron_variant	0			U50361	CCDS3703.1, CCDS3704.1, CCDS43263.1, CCDS47127.1, CCDS54797.1	4q26	2008-10-30	2008-10-30		ENSG00000145349	ENSG00000145349			1462	protein-coding gene	gene with protein product		607708	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II delta"""	CAMKD			Standard	NM_001221		Approved		uc003ibi.3	Q13557	OTTHUMG00000132910	ENST00000342666.5:c.984+1376A>T	4.37:g.114429417T>A			A8MVS8|Q52PK4|Q59G21|Q8N553|Q9UGH6|Q9UQE9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ca/CaM-dep_prot_kinase-assoc,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.K331M	ENST00000342666.5	37	c.992	CCDS3703.1	4	.	.	.	.	.	.	.	.	.	.	T	15.27	2.784600	0.49997	.	.	ENSG00000145349	ENST00000454265;ENST00000394526;ENST00000515496;ENST00000508738	T;T;T;T	0.69806	-0.35;-0.35;-0.35;-0.43	5.55	4.37	0.52481	.	.	.	.	.	T	0.55924	0.1951	L	0.36672	1.1	0.80722	D	1	B	0.10296	0.003	B	0.08055	0.003	T	0.51639	-0.8680	9	0.51188	T	0.08	.	11.3539	0.49605	0.0:0.0711:0.0:0.9288	.	331	Q13557-3	.	M	331	ENSP00000415248:K331M;ENSP00000378034:K331M;ENSP00000423482:K331M;ENSP00000422566:K331M	ENSP00000378034:K331M	K	-	2	0	CAMK2D	114648866	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.862000	0.69560	0.938000	0.37419	0.533000	0.62120	AAG	CAMK2D	-	superfamily_Kinase-like_dom	ENSG00000145349		0.343	CAMK2D-003	KNOWN	basic|CCDS	protein_coding	CAMK2D	HGNC	protein_coding	OTTHUMT00000256420.2	31	0.00	0	T			114429417	114429417	-1	no_errors	ENST00000454265	ensembl	human	known	69_37n	missense	27	28.95	11	SNP	1.000	A
CBWD3	445571	genome.wustl.edu	37	9	70863777	70863777	+	Missense_Mutation	SNP	G	G	T	rs62548542	byFrequency	TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr9:70863777G>T	ENST00000360171.6	+	4	945	c.394G>T	c.(394-396)Gac>Tac	p.D132Y	CBWD3_ENST00000377342.5_Missense_Mutation_p.D132Y	NM_201453.2	NP_958861.2	Q5JTY5	CBWD3_HUMAN	COBW domain containing 3	132				D -> Y (in Ref. 1; AAQ76870). {ECO:0000305}.			ATP binding (GO:0005524)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		GAAATTTGATGACATACTGTT	0.323													.|||	3371	0.673123	0.7284	0.7363	5008	,	,		17800	0.4623		0.7883	False		,,,				2504	0.6524					dbGAP											0													3.0	2.0	2.0					9																	70863777		1004	1993	2997	-	-	-	SO:0001583	missense	0			BC069006	CCDS35038.1, CCDS35038.2	9q13	2014-05-06			ENSG00000196873	ENSG00000196873			18519	protein-coding gene	gene with protein product		611080				15233989, 12421752	Standard	XM_005277637		Approved	bA561O23.1	uc004aga.4	Q5JTY5	OTTHUMG00000184383	ENST00000360171.6:c.394G>T	9.37:g.70863777G>T	ENSP00000353295:p.Asp132Tyr		B4DNG9|Q6VB91	Missense_Mutation	SNP	pfam_Cbl_biosynth_CobW-like,pfam_Cbl_biosynth_CobW-like_C,superfamily_Cbl_biosynth_CobW-like_C,smart_Cbl_biosynth_CobW-like_C	p.D132Y	ENST00000360171.6	37	c.394	CCDS35038.1	9	.	.	.	.	.	.	.	.	.	.	.	0.023	-1.403851	0.01165	.	.	ENSG00000196873	ENST00000360171;ENST00000447896;ENST00000455061;ENST00000455820;ENST00000377344;ENST00000377342	T;T	0.39229	1.09;1.09	3.51	2.34	0.29019	Cobalamin (vitamin B12) biosynthesis CobW-like (1);	0.000000	0.85682	N	0.000000	T	0.03783	0.0107	N	0.00002	-3.625	0.50632	P	1.1399999999994748E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.34030	-0.9845	9	0.02654	T	1	-0.5034	5.5703	0.17192	0.0:0.0982:0.1728:0.7291	.	132	Q5JTY5	CBWD3_HUMAN	Y	132;132;132;132;96;132	ENSP00000353295:D132Y;ENSP00000366559:D132Y	ENSP00000353295:D132Y	D	+	1	0	CBWD3	70053597	1.000000	0.71417	0.995000	0.50966	0.722000	0.41435	5.539000	0.67199	-0.013000	0.14199	-1.433000	0.01084	GAC	CBWD3	-	pfam_Cbl_biosynth_CobW-like	ENSG00000196873		0.323	CBWD3-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	CBWD3	HGNC	protein_coding	OTTHUMT00000052526.1	9	0.00	0	G	NM_201453		70863777	70863777	+1	no_errors	ENST00000360171	ensembl	human	known	69_37n	missense	9	35.71	5	SNP	1.000	T
CCDC173	129881	genome.wustl.edu	37	2	170537535	170537535	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr2:170537535G>C	ENST00000447353.1	-	2	381	c.276C>G	c.(274-276)caC>caG	p.H92Q		NM_001085447.1	NP_001078916.1	Q0VFZ6	CC173_HUMAN	coiled-coil domain containing 173	92																	TATTAGTCCAGTGTTTTACCA	0.383																																						dbGAP											0													176.0	175.0	175.0					2																	170537535		1977	4154	6131	-	-	-	SO:0001583	missense	0			BC015980, BC117445	CCDS46445.1	2q31.1	2012-08-07	2012-08-07	2012-08-07	ENSG00000154479	ENSG00000154479			25064	protein-coding gene	gene with protein product	"""hypothetical LOC129881"""		"""chromosome 2 open reading frame 77"""	C2orf77		12477932	Standard	NM_001085447		Approved	LOC129881	uc002ufe.2	Q0VFZ6	OTTHUMG00000154116	ENST00000447353.1:c.276C>G	2.37:g.170537535G>C	ENSP00000391504:p.His92Gln		Q6PJF6	Missense_Mutation	SNP	NULL	p.H92Q	ENST00000447353.1	37	c.276	CCDS46445.1	2	.	.	.	.	.	.	.	.	.	.	g	12.48	1.951215	0.34471	.	.	ENSG00000154479	ENST00000447353;ENST00000419478	D	0.87729	-2.29	5.79	-7.6	0.01303	.	0.398783	0.23079	U	0.052178	D	0.87273	0.6136	L	0.53249	1.67	0.22213	N	0.999287	D	0.60160	0.987	P	0.53912	0.737	D	0.84018	0.0352	10	0.48119	T	0.1	.	20.2533	0.98412	0.3328:0.0:0.6672:0.0	.	92	Q0VFZ6	CB077_HUMAN	Q	92;68	ENSP00000408143:H68Q	ENSP00000408143:H68Q	H	-	3	2	C2orf77	170245781	0.437000	0.25593	0.493000	0.27502	0.330000	0.28571	-0.402000	0.07223	-2.066000	0.00886	-2.644000	0.00150	CAC	CCDC173	-	NULL	ENSG00000154479		0.383	CCDC173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC173	HGNC	protein_coding	OTTHUMT00000333954.2	37	0.00	0	G	NM_001085447		170537535	170537535	-1	no_errors	ENST00000447353	ensembl	human	known	69_37n	missense	23	46.51	20	SNP	0.243	C
CCDC88C	440193	genome.wustl.edu	37	14	91779648	91779648	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr14:91779648C>T	ENST00000389857.6	-	15	2598	c.2512G>A	c.(2512-2514)Gag>Aag	p.E838K		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	838					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GCCTCCTTCTCCAGCAGCTTC	0.632																																						dbGAP											0													61.0	67.0	65.0					14																	91779648		2170	4260	6430	-	-	-	SO:0001583	missense	0				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.2512G>A	14.37:g.91779648C>T	ENSP00000374507:p.Glu838Lys		Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	pfam_HOOK,superfamily_Prefoldin,superfamily_Fum_Rdtase/Succ_DH_flav-like_C	p.E838K	ENST00000389857.6	37	c.2512	CCDS45151.1	14	.	.	.	.	.	.	.	.	.	.	C	22.5	4.296351	0.81025	.	.	ENSG00000015133	ENST00000389857	T	0.19532	2.14	5.03	5.03	0.67393	.	0.130222	0.33938	U	0.004413	T	0.37433	0.1003	M	0.75264	2.295	0.80722	D	1	P	0.50943	0.94	P	0.52424	0.698	T	0.16188	-1.0411	10	0.48119	T	0.1	-29.2988	14.0382	0.64658	0.0:0.8489:0.1511:0.0	.	838	Q9P219	DAPLE_HUMAN	K	838	ENSP00000374507:E838K	ENSP00000374507:E838K	E	-	1	0	CCDC88C	90849401	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.862000	0.62976	2.338000	0.79540	0.561000	0.74099	GAG	CCDC88C	-	superfamily_Prefoldin	ENSG00000015133		0.632	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88C	HGNC	protein_coding	OTTHUMT00000411650.1	31	0.00	0	C	XM_029353		91779648	91779648	-1	no_errors	ENST00000389857	ensembl	human	known	69_37n	missense	22	33.33	11	SNP	1.000	T
CDK12	51755	genome.wustl.edu	37	17	37627547	37627547	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr17:37627547G>T	ENST00000447079.4	+	2	1495	c.1462G>T	c.(1462-1464)Gag>Tag	p.E488*	CDK12_ENST00000430627.2_Nonsense_Mutation_p.E488*	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	488					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						TGAGAACTCCGAGAAGCATCT	0.393			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																												dbGAP		Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	0													105.0	112.0	110.0					17																	37627547		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.1462G>T	17.37:g.37627547G>T	ENSP00000398880:p.Glu488*		A7E2B2|B4DYX4|B9EIQ6|O94978	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E488*	ENST00000447079.4	37	c.1462	CCDS11337.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.586354	0.97684	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	.	.	.	5.98	4.99	0.66335	.	0.271361	0.26237	N	0.025539	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-5.1119	15.2508	0.73545	0.0:0.1446:0.8554:0.0	.	.	.	.	X	488	.	ENSP00000407720:E488X	E	+	1	0	CDK12	34881073	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.658000	0.61497	1.495000	0.48549	0.650000	0.86243	GAG	CDK12	-	NULL	ENSG00000167258		0.393	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK12	HGNC	protein_coding	OTTHUMT00000256941.4	35	0.00	0	G	NM_016507		37627547	37627547	+1	no_errors	ENST00000447079	ensembl	human	known	69_37n	nonsense	27	47.06	24	SNP	1.000	T
CDKAL1	54901	genome.wustl.edu	37	6	21198270	21198270	+	Frame_Shift_Del	DEL	G	G	-			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr6:21198270delG	ENST00000378610.1	+	12	1328	c.1318delG	c.(1318-1320)gtgfs	p.V440fs	CDKAL1_ENST00000274695.4_Frame_Shift_Del_p.V440fs|CDKAL1_ENST00000378624.4_Frame_Shift_Del_p.V349fs			Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein 1-like 1	440	TRAM. {ECO:0000255|PROSITE- ProRule:PRU00208}.				maintenance of translational fidelity (GO:1990145)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|N6-threonylcarbomyladenosine methylthiotransferase activity (GO:0035598)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|stomach(1)	29	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			AAGACAACAAGTGTTAGTAAC	0.378																																						dbGAP											0													91.0	87.0	88.0					6																	21198270		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK000349	CCDS4546.1	6p22.2	2008-02-05			ENSG00000145996	ENSG00000145996			21050	protein-coding gene	gene with protein product		611259					Standard	NM_017774		Approved	FLJ20342	uc003ndd.2	Q5VV42	OTTHUMG00000014340	ENST00000378610.1:c.1318delG	6.37:g.21198270delG	ENSP00000367873:p.Val440fs		A8K6S0|Q6P385|Q6ZR27|Q9NXB3	Frame_Shift_Del	DEL	pfam_Methylthiotransferase_N,pfam_rSAM,pfam_TRAM_dom,smart_Elp3/MiaB/NifB,pfscan_TRAM_dom,tigrfam_MiaB-like_B,tigrfam_Methylthiotransferase	p.V440fs	ENST00000378610.1	37	c.1318	CCDS4546.1	6																																																																																			CDKAL1	-	pfam_TRAM_dom,pfscan_TRAM_dom,tigrfam_MiaB-like_B,tigrfam_Methylthiotransferase	ENSG00000145996		0.378	CDKAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKAL1	HGNC	protein_coding	OTTHUMT00000039986.1	46	0.00	0	G	NM_017774		21198270	21198270	+1	no_errors	ENST00000274695	ensembl	human	known	69_37n	frame_shift_del	26	22.86	8	DEL	1.000	-
CDKAL1	54901	genome.wustl.edu	37	6	21198272	21198272	+	Silent	SNP	G	G	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr6:21198272G>T	ENST00000378610.1	+	12	1330	c.1320G>T	c.(1318-1320)gtG>gtT	p.V440V	CDKAL1_ENST00000274695.4_Silent_p.V440V|CDKAL1_ENST00000378624.4_Silent_p.V349V			Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein 1-like 1	440	TRAM. {ECO:0000255|PROSITE- ProRule:PRU00208}.				maintenance of translational fidelity (GO:1990145)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|N6-threonylcarbomyladenosine methylthiotransferase activity (GO:0035598)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|stomach(1)	29	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			GACAACAAGTGTTAGTAACAG	0.373																																						dbGAP											0													92.0	89.0	90.0					6																	21198272		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000349	CCDS4546.1	6p22.2	2008-02-05			ENSG00000145996	ENSG00000145996			21050	protein-coding gene	gene with protein product		611259					Standard	NM_017774		Approved	FLJ20342	uc003ndd.2	Q5VV42	OTTHUMG00000014340	ENST00000378610.1:c.1320G>T	6.37:g.21198272G>T			A8K6S0|Q6P385|Q6ZR27|Q9NXB3	Silent	SNP	pfam_Methylthiotransferase_N,pfam_rSAM,pfam_TRAM_dom,smart_Elp3/MiaB/NifB,pfscan_TRAM_dom,tigrfam_MiaB-like_B,tigrfam_Methylthiotransferase	p.V440	ENST00000378610.1	37	c.1320	CCDS4546.1	6																																																																																			CDKAL1	-	pfam_TRAM_dom,pfscan_TRAM_dom,tigrfam_MiaB-like_B,tigrfam_Methylthiotransferase	ENSG00000145996		0.373	CDKAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKAL1	HGNC	protein_coding	OTTHUMT00000039986.1	47	0.00	0	G	NM_017774		21198272	21198272	+1	no_errors	ENST00000274695	ensembl	human	known	69_37n	silent	26	25.71	9	SNP	1.000	T
CNGB3	54714	genome.wustl.edu	37	8	87588343	87588343	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr8:87588343C>T	ENST00000320005.5	-	18	2166	c.2119G>A	c.(2119-2121)Gaa>Aaa	p.E707K		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	707					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						tctcctccttcAGAATTTTCT	0.294																																						dbGAP											0													36.0	38.0	37.0					8																	87588343		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.2119G>A	8.37:g.87588343C>T	ENSP00000316605:p.Glu707Lys		C9JA51|Q9NRE9	Missense_Mutation	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.E707K	ENST00000320005.5	37	c.2119	CCDS6244.1	8	.	.	.	.	.	.	.	.	.	.	C	6.845	0.525182	0.13066	.	.	ENSG00000170289	ENST00000320005	T	0.61627	0.09	4.55	2.49	0.30216	.	2.697960	0.01652	U	0.024625	T	0.26484	0.0647	N	0.01352	-0.895	0.09310	N	1	B;B	0.13594	0.008;0.005	B;B	0.11329	0.006;0.004	T	0.44143	-0.9347	10	0.06625	T	0.88	.	4.3835	0.11305	0.2163:0.6444:0.0:0.1394	.	702;707	Q9NQW8-2;Q9NQW8	.;CNGB3_HUMAN	K	707	ENSP00000316605:E707K	ENSP00000316605:E707K	E	-	1	0	CNGB3	87657459	0.000000	0.05858	0.020000	0.16555	0.643000	0.38383	0.005000	0.13129	0.479000	0.27511	0.467000	0.42956	GAA	CNGB3	-	NULL	ENSG00000170289		0.294	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGB3	HGNC	protein_coding	OTTHUMT00000375107.1	55	0.00	0	C	NM_019098		87588343	87588343	-1	no_errors	ENST00000320005	ensembl	human	known	69_37n	missense	43	51.69	46	SNP	0.026	T
CNTNAP1	8506	genome.wustl.edu	37	17	40835917	40835917	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr17:40835917C>T	ENST00000264638.4	+	2	363	c.146C>T	c.(145-147)gCg>gTg	p.A49V	CCR10_ENST00000332438.4_5'Flank|CTD-3193K9.4_ENST00000593139.1_RNA|CTD-3193K9.3_ENST00000592440.1_RNA|CCR10_ENST00000591765.1_5'Flank	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	49	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		CTCCTTACTGCGCCGAGATTC	0.662																																						dbGAP											0													37.0	36.0	36.0					17																	40835917		2203	4300	6503	-	-	-	SO:0001583	missense	0			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.146C>T	17.37:g.40835917C>T	ENSP00000264638:p.Ala49Val			Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.A49V	ENST00000264638.4	37	c.146	CCDS11436.1	17	.	.	.	.	.	.	.	.	.	.	C	10.75	1.438689	0.25900	.	.	ENSG00000108797	ENST00000264638	D	0.98362	-4.89	4.8	3.78	0.43462	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.499846	0.17485	N	0.172553	D	0.95497	0.8537	L	0.35487	1.065	0.09310	N	1	B	0.19706	0.038	B	0.19391	0.025	D	0.90430	0.4423	10	0.46703	T	0.11	.	12.7903	0.57530	0.0:0.8204:0.1796:0.0	.	49	P78357	CNTP1_HUMAN	V	49	ENSP00000264638:A49V	ENSP00000264638:A49V	A	+	2	0	CNTNAP1	38089443	0.263000	0.24083	0.006000	0.13384	0.004000	0.04260	4.053000	0.57427	2.499000	0.84300	0.462000	0.41574	GCG	CNTNAP1	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000108797		0.662	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP1	HGNC	protein_coding	OTTHUMT00000452342.1	15	0.00	0	C	NM_003632		40835917	40835917	+1	no_errors	ENST00000264638	ensembl	human	known	69_37n	missense	12	47.83	11	SNP	0.004	T
COL6A3	1293	genome.wustl.edu	37	2	238262027	238262027	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr2:238262027C>A	ENST00000295550.4	-	25	7099	c.6647G>T	c.(6646-6648)gGc>gTc	p.G2216V	COL6A3_ENST00000346358.4_Missense_Mutation_p.G2016V|COL6A3_ENST00000409809.1_Missense_Mutation_p.G2010V|COL6A3_ENST00000353578.4_Missense_Mutation_p.G2010V|COL6A3_ENST00000472056.1_Missense_Mutation_p.G1609V|COL6A3_ENST00000347401.3_Missense_Mutation_p.G2015V	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2216	Collagen-like 3.|Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GCCCGGCTGGCCAGGACCGCC	0.512																																						dbGAP											0													63.0	58.0	59.0					2																	238262027		2203	4300	6503	-	-	-	SO:0001583	missense	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.6647G>T	2.37:g.238262027C>A	ENSP00000295550:p.Gly2216Val		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.G2216V	ENST00000295550.4	37	c.6647	CCDS33412.1	2	.	.	.	.	.	.	.	.	.	.	C	9.336	1.061845	0.19987	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.99532	-6.1;-6.1;-6.1;-6.1;-6.1;-6.1	5.21	5.21	0.72293	.	0.000000	0.51477	D	0.000086	D	0.99837	0.9926	H	0.99169	4.455	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;1.0;0.999	D	0.96491	0.9364	10	0.87932	D	0	.	16.9555	0.86258	0.0:1.0:0.0:0.0	.	1609;1609;2010;2216	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	V	2216;2015;2010;1609;2010;2016	ENSP00000295550:G2216V;ENSP00000315609:G2015V;ENSP00000315873:G2010V;ENSP00000418285:G1609V;ENSP00000386844:G2010V;ENSP00000295546:G2016V	ENSP00000295550:G2216V	G	-	2	0	COL6A3	237926766	1.000000	0.71417	0.996000	0.52242	0.129000	0.20672	5.391000	0.66266	2.429000	0.82318	0.655000	0.94253	GGC	COL6A3	-	NULL	ENSG00000163359		0.512	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	26	0.00	0	C	NM_004369		238262027	238262027	-1	no_errors	ENST00000295550	ensembl	human	known	69_37n	missense	22	42.11	16	SNP	1.000	A
COL9A1	1297	genome.wustl.edu	37	6	70935663	70935663	+	Silent	SNP	G	G	A	rs534752381		TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr6:70935663G>A	ENST00000357250.6	-	37	2711	c.2553C>T	c.(2551-2553)aaC>aaT	p.N851N	COL9A1_ENST00000370499.4_Silent_p.N608N|COL9A1_ENST00000489611.1_5'UTR|COL9A1_ENST00000320755.7_Silent_p.N608N|RP1-149L1.1_ENST00000522264.1_RNA	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	851	Collagen-like 10.|Triple-helical region (COL1).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						CAGGCAAACCGTTGGGACCTC	0.433													T|||	1	0.000199681	0.0	0.0014	5008	,	,		15756	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													79.0	74.0	76.0					6																	70935663		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.2553C>T	6.37:g.70935663G>A			Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Silent	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.N851	ENST00000357250.6	37	c.2553	CCDS4971.1	6																																																																																			COL9A1	-	pfam_Collagen	ENSG00000112280		0.433	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A1	HGNC	protein_coding	OTTHUMT00000041131.2	23	0.00	0	G			70935663	70935663	-1	no_errors	ENST00000357250	ensembl	human	known	69_37n	silent	16	23.81	5	SNP	0.998	A
CUBN	8029	genome.wustl.edu	37	10	17110195	17110195	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr10:17110195G>A	ENST00000377833.4	-	21	2941	c.2876C>T	c.(2875-2877)aCt>aTt	p.T959I		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	959	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TATATGCCAAGTACAGTTGAT	0.378																																						dbGAP											0													163.0	156.0	158.0					10																	17110195		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.2876C>T	10.37:g.17110195G>A	ENSP00000367064:p.Thr959Ile		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.T959I	ENST00000377833.4	37	c.2876	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	G	13.99	2.400622	0.42613	.	.	ENSG00000107611	ENST00000377833	T	0.29142	1.58	5.55	5.55	0.83447	CUB (5);	0.000000	0.46758	D	0.000263	T	0.24547	0.0595	L	0.35414	1.06	0.80722	D	1	B	0.27068	0.167	B	0.24541	0.054	T	0.03306	-1.1050	10	0.27785	T	0.31	.	14.7496	0.69516	0.0713:0.0:0.9287:0.0	.	959	O60494	CUBN_HUMAN	I	959	ENSP00000367064:T959I	ENSP00000367064:T959I	T	-	2	0	CUBN	17150201	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.077000	0.64419	2.615000	0.88500	0.655000	0.94253	ACT	CUBN	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000107611		0.378	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	32	0.00	0	G	NM_001081		17110195	17110195	-1	no_errors	ENST00000377833	ensembl	human	known	69_37n	missense	36	20.00	9	SNP	1.000	A
ERBB2	2064	genome.wustl.edu	37	17	37872089	37872089	+	Missense_Mutation	SNP	T	T	G			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr17:37872089T>G	ENST00000269571.5	+	12	1569	c.1410T>G	c.(1408-1410)caT>caG	p.H470Q	ERBB2_ENST00000584450.1_Missense_Mutation_p.H470Q|ERBB2_ENST00000445658.2_Missense_Mutation_p.H194Q|ERBB2_ENST00000584601.1_Missense_Mutation_p.H440Q|ERBB2_ENST00000540042.1_Missense_Mutation_p.H440Q|ERBB2_ENST00000540147.1_Missense_Mutation_p.H440Q|ERBB2_ENST00000406381.2_Missense_Mutation_p.H440Q|ERBB2_ENST00000578199.1_Missense_Mutation_p.H440Q|ERBB2_ENST00000541774.1_Missense_Mutation_p.H455Q			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	470					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	TCATCCACCATAACACCCACC	0.637		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																												dbGAP		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	0													121.0	85.0	97.0					17																	37872089		2203	4300	6503	-	-	-	SO:0001583	missense	0			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.1410T>G	17.37:g.37872089T>G	ENSP00000269571:p.His470Gln		B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.H470Q	ENST00000269571.5	37	c.1410	CCDS32642.1	17	.	.	.	.	.	.	.	.	.	.	T	6.046	0.376869	0.11466	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147;ENST00000540042	T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02	5.93	3.84	0.44239	EGF receptor, L domain (1);	.	.	.	.	T	0.24774	0.0601	N	0.21142	0.635	0.30998	N	0.720645	B;B;B;B	0.22346	0.006;0.068;0.02;0.006	B;B;B;B	0.21917	0.035;0.037;0.037;0.034	T	0.27502	-1.0072	9	0.11794	T	0.64	.	6.7037	0.23238	0.1447:0.7065:0.0:0.1489	.	194;440;455;470	B4DTR1;F5H1T4;P04626-4;P04626	.;.;.;ERBB2_HUMAN	Q	440;455;194;470;440;440	ENSP00000385185:H440Q;ENSP00000446466:H455Q;ENSP00000404047:H194Q;ENSP00000269571:H470Q;ENSP00000443562:H440Q;ENSP00000446382:H440Q	ENSP00000269571:H470Q	H	+	3	2	ERBB2	35125615	0.000000	0.05858	0.970000	0.41538	0.017000	0.09413	-0.388000	0.07352	0.823000	0.34589	-1.559000	0.00887	CAT	ERBB2	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_EGF_rcpt_L	ENSG00000141736		0.637	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB2	HGNC	protein_coding	OTTHUMT00000445621.2	28	0.00	0	T			37872089	37872089	+1	no_errors	ENST00000269571	ensembl	human	known	69_37n	missense	16	60.00	24	SNP	1.000	G
FAM111A	63901	genome.wustl.edu	37	11	58920622	58920622	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr11:58920622C>G	ENST00000528737.1	+	5	4299	c.1481C>G	c.(1480-1482)gCa>gGa	p.A494G	FAM111A_ENST00000420244.1_Missense_Mutation_p.A494G|FAM111A_ENST00000531147.1_Missense_Mutation_p.A494G|FAM111A_ENST00000361723.3_Missense_Mutation_p.A494G|FAM111A_ENST00000533703.1_Missense_Mutation_p.A494G			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	494	Interaction with SV40 large T antigen.				defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				GGTCAGCGAGCAAAGAAATGT	0.413																																						dbGAP											0													96.0	98.0	98.0					11																	58920622		2201	4295	6496	-	-	-	SO:0001583	missense	0			AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.1481C>G	11.37:g.58920622C>G	ENSP00000434435:p.Ala494Gly		A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like	p.A494G	ENST00000528737.1	37	c.1481	CCDS7973.1	11	.	.	.	.	.	.	.	.	.	.	C	5.899	0.350050	0.11182	.	.	ENSG00000166801	ENST00000528737;ENST00000420244;ENST00000361723;ENST00000533703;ENST00000531147	T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95	4.67	-2.43	0.06522	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	2.047700	0.01699	N	0.027101	T	0.25195	0.0612	N	0.16478	0.41	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.09662	-1.0664	10	0.18276	T	0.48	-16.1003	6.3129	0.21174	0.2586:0.3906:0.0:0.3508	.	494	Q96PZ2	F111A_HUMAN	G	494	ENSP00000434435:A494G;ENSP00000406683:A494G;ENSP00000355264:A494G;ENSP00000433154:A494G;ENSP00000431631:A494G	ENSP00000355264:A494G	A	+	2	0	FAM111A	58677198	0.000000	0.05858	0.002000	0.10522	0.020000	0.10135	-1.509000	0.02264	-0.534000	0.06315	-1.028000	0.02416	GCA	FAM111A	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like	ENSG00000166801		0.413	FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM111A	HGNC	protein_coding	OTTHUMT00000393975.1	32	0.00	0	C	NM_022074		58920622	58920622	+1	no_errors	ENST00000361723	ensembl	human	known	69_37n	missense	15	37.50	9	SNP	0.000	G
FAM9B	171483	genome.wustl.edu	37	X	9000176	9000176	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chrX:9000176G>T	ENST00000327220.5	-	4	540	c.176C>A	c.(175-177)aCt>aAt	p.T59N	FAM9B_ENST00000362066.3_Missense_Mutation_p.T104N|FAM9B_ENST00000428477.1_Missense_Mutation_p.T59N			Q8IZU0	FAM9B_HUMAN	family with sequence similarity 9, member B	59						nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11		Hepatocellular(5;0.219)				CATACCTGCAGTATCTTCTGG	0.333																																						dbGAP											0													65.0	56.0	59.0					X																	9000176		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS14132.1	Xp22.31	2014-02-17			ENSG00000177138	ENSG00000177138			18404	protein-coding gene	gene with protein product	"""testis expressed 39B"""	300478				12213195, 21085121, 21998597, 22936694	Standard	XM_005274456		Approved	TEX39B	uc011mhu.2	Q8IZU0	OTTHUMG00000021114	ENST00000327220.5:c.176C>A	X.37:g.9000176G>T	ENSP00000318716:p.Thr59Asn		Q0IJ68|Q8N7Z8	Missense_Mutation	SNP	pfam_Cor1/Xlr/Xmr	p.T59N	ENST00000327220.5	37	c.176	CCDS14132.1	X	.	.	.	.	.	.	.	.	.	.	G	8.001	0.755477	0.15846	.	.	ENSG00000177138	ENST00000362066;ENST00000327220;ENST00000428477	.	.	.	0.235	-0.47	0.12131	.	.	.	.	.	T	0.29783	0.0744	N	0.14661	0.345	0.09310	N	1	P;P	0.51653	0.947;0.947	P;P	0.55965	0.788;0.788	T	0.18023	-1.0350	7	0.87932	D	0	.	.	.	.	.	59;104	Q8IZU0;Q8N7Z8	FAM9B_HUMAN;.	N	104;59;59	.	ENSP00000318716:T59N	T	-	2	0	FAM9B	8960176	0.034000	0.19679	0.085000	0.20634	0.086000	0.17979	-0.936000	0.03946	-0.724000	0.04908	-0.713000	0.03633	ACT	FAM9B	-	NULL	ENSG00000177138		0.333	FAM9B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM9B	HGNC	protein_coding	OTTHUMT00000055702.2	23	0.00	0	G	NM_205849		9000176	9000176	-1	no_errors	ENST00000327220	ensembl	human	known	69_37n	missense	11	47.62	10	SNP	0.087	T
FBXW8	26259	genome.wustl.edu	37	12	117465283	117465283	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr12:117465283C>G	ENST00000309909.5	+	10	1708	c.1626C>G	c.(1624-1626)gaC>gaG	p.D542E	FBXW8_ENST00000455858.2_Missense_Mutation_p.D476E			Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8	542					cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|labyrinthine layer blood vessel development (GO:0060716)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|spongiotrophoblast layer development (GO:0060712)	Cul7-RING ubiquitin ligase complex (GO:0031467)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)				endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	22	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)		GAAACGCCGACCTGGACAGCT	0.587																																						dbGAP											0													95.0	76.0	82.0					12																	117465283		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF176707	CCDS9182.1, CCDS44988.1	12q24.23	2013-01-09	2007-02-08	2003-06-13				"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13597	protein-coding gene	gene with protein product		609073	"""F-box only protein 29"", ""F-box and WD-40 domain protein 8"""	FBXO29		10531035, 10531037	Standard	NM_012174		Approved	FBX29, FBW6, FBW8	uc001twg.1	Q8N3Y1	OTTHUMG00000169329	ENST00000309909.5:c.1626C>G	12.37:g.117465283C>G	ENSP00000310686:p.Asp542Glu		Q9UK95	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_Quinonprotein_ADH-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D542E	ENST00000309909.5	37	c.1626	CCDS9182.1	12	.	.	.	.	.	.	.	.	.	.	C	8.526	0.869857	0.17322	.	.	ENSG00000174989	ENST00000309909;ENST00000455858;ENST00000505227	T;T	0.10192	2.91;2.9	5.26	2.29	0.28610	.	0.195945	0.53938	N	0.000055	T	0.09862	0.0242	L	0.57536	1.79	0.30831	N	0.736712	P;P	0.38195	0.488;0.622	B;B	0.33454	0.055;0.164	T	0.11641	-1.0579	10	0.22706	T	0.39	-9.6659	10.3283	0.43807	0.0:0.6787:0.2504:0.0708	.	542;476	Q8N3Y1;Q8N3Y1-2	FBXW8_HUMAN;.	E	542;476;476	ENSP00000310686:D542E;ENSP00000389144:D476E	ENSP00000310686:D542E	D	+	3	2	FBXW8	115949666	1.000000	0.71417	0.982000	0.44146	0.089000	0.18198	0.933000	0.28897	0.555000	0.29079	0.462000	0.41574	GAC	FBXW8	-	NULL	ENSG00000174989		0.587	FBXW8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW8	HGNC	protein_coding	OTTHUMT00000403561.1	23	0.00	0	C	NM_012174		117465283	117465283	+1	no_errors	ENST00000309909	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	1.000	G
GCGR	2642	genome.wustl.edu	37	17	79769817	79769817	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr17:79769817C>A	ENST00000400723.3	+	9	1166	c.873C>A	c.(871-873)aaC>aaA	p.N291K	GCGR_ENST00000570996.1_Missense_Mutation_p.N321K	NM_000160.3	NP_000151.1	P47871	GLR_HUMAN	glucagon receptor	291					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|exocytosis (GO:0006887)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|hormone-mediated signaling pathway (GO:0009755)|positive regulation of GTPase activity (GO:0043547)|regulation of blood pressure (GO:0008217)|regulation of glycogen metabolic process (GO:0070873)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|guanyl-nucleotide exchange factor activity (GO:0005085)|peptide hormone binding (GO:0017046)			endometrium(2)	2					Glucagon recombinant(DB00040)	TGTTCGAGAACGTCCAGTGAG	0.682																																						dbGAP											0													97.0	87.0	90.0					17																	79769817		692	1591	2283	-	-	-	SO:0001583	missense	0			U03469, L20316	CCDS54177.1	17q25	2012-08-10			ENSG00000215644	ENSG00000215644		"""GPCR / Class B : Glucagon receptors"""	4192	protein-coding gene	gene with protein product		138033				8020989	Standard	XM_006722276		Approved	GGR	uc010wuw.2	P47871		ENST00000400723.3:c.873C>A	17.37:g.79769817C>A	ENSP00000383558:p.Asn291Lys		Q2M3M5	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_glucagon_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_GLP1/glucagon_rcpt,prints_GPCR_2_GIP_rcpt	p.N291K	ENST00000400723.3	37	c.873	CCDS54177.1	17	.	.	.	.	.	.	.	.	.	.	c	11.89	1.774035	0.31411	.	.	ENSG00000215644	ENST00000400723	T	0.40225	1.04	5.04	-0.512	0.11966	GPCR, family 2-like (1);	.	.	.	.	T	0.64811	0.2632	M	0.89163	3.01	0.35078	D	0.763111	D	0.89917	1.0	D	0.91635	0.999	T	0.72200	-0.4362	9	0.87932	D	0	.	9.4744	0.38862	0.0:0.5006:0.0:0.4994	.	291	P47871	GLR_HUMAN	K	291	ENSP00000383558:N291K	ENSP00000383558:N291K	N	+	3	2	GCGR	.	0.000000	0.05858	0.110000	0.21437	0.160000	0.22226	-0.254000	0.08781	-0.004000	0.14419	0.561000	0.74099	AAC	GCGR	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_GIP_rcpt	ENSG00000215644		0.682	GCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCGR	HGNC	protein_coding	OTTHUMT00000439676.1	32	0.00	0	C	NM_000160		79769817	79769817	+1	no_errors	ENST00000400723	ensembl	human	known	69_37n	missense	67	11.84	9	SNP	0.036	A
GPR32	2854	genome.wustl.edu	37	19	51274851	51274851	+	Missense_Mutation	SNP	A	A	C	rs201404376		TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr19:51274851A>C	ENST00000270590.4	+	1	1131	c.994A>C	c.(994-996)Act>Cct	p.T332P		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	332					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CCAGTCTTTGACTTCTGCCCT	0.552																																					Esophageal Squamous(113;152 1581 5732 15840 44398)	dbGAP											0													66.0	71.0	69.0					19																	51274851		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.994A>C	19.37:g.51274851A>C	ENSP00000270590:p.Thr332Pro		Q502U7|Q6NWS5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Frt_met_rcpt	p.T332P	ENST00000270590.4	37	c.994	CCDS12801.1	19	.	.	.	.	.	.	.	.	.	.	a	0.006	-2.066505	0.00382	.	.	ENSG00000142511	ENST00000270590	T	0.36699	1.24	2.71	-0.781	0.10965	.	.	.	.	.	T	0.12518	0.0304	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31138	-0.9954	9	0.02654	T	1	.	3.6506	0.08202	0.205:0.5623:0.0:0.2327	.	332	O75388	GPR32_HUMAN	P	332	ENSP00000270590:T332P	ENSP00000270590:T332P	T	+	1	0	GPR32	55966663	0.000000	0.05858	0.025000	0.17156	0.653000	0.38743	0.089000	0.15002	-0.262000	0.09392	-0.755000	0.03482	ACT	GPR32	-	prints_Frt_met_rcpt	ENSG00000142511		0.552	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR32	HGNC	protein_coding	OTTHUMT00000465016.1	29	0.00	0	A			51274851	51274851	+1	no_errors	ENST00000270590	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	0.018	C
GRM1	2911	genome.wustl.edu	37	6	146480580	146480580	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr6:146480580G>T	ENST00000282753.1	+	2	1032	c.797G>T	c.(796-798)gGg>gTg	p.G266V	GRM1_ENST00000392299.2_Missense_Mutation_p.G266V|GRM1_ENST00000507907.1_Missense_Mutation_p.G266V|GRM1_ENST00000361719.2_Missense_Mutation_p.G266V|GRM1_ENST00000492807.2_Missense_Mutation_p.G266V|GRM1_ENST00000355289.4_Missense_Mutation_p.G266V			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	266					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		AGCAACGCTGGGGAGAAGAGC	0.547																																						dbGAP											0													106.0	94.0	98.0					6																	146480580		2203	4300	6503	-	-	-	SO:0001583	missense	0			U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.797G>T	6.37:g.146480580G>T	ENSP00000282753:p.Gly266Val		B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Metabotropic_Glu_rcpt_Homer-bd,pfam_GPCR_3_9-Cys_dom,prints_GPCR_3_mtglu_rcpt_1,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_5,pfscan_GPCR_3_C	p.G266V	ENST00000282753.1	37	c.797	CCDS5209.1	6	.	.	.	.	.	.	.	.	.	.	G	27.4	4.831062	0.91036	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67;-1.67;-1.67	5.52	5.52	0.82312	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.85660	0.5748	L	0.35854	1.095	0.80722	D	1	B;D;B;B	0.89917	0.371;1.0;0.425;0.371	B;D;B;B	0.97110	0.141;1.0;0.221;0.198	D	0.85515	0.1200	10	0.48119	T	0.1	.	19.4372	0.94801	0.0:0.0:1.0:0.0	.	266;266;261;266	F8W805;Q13255;Q59HC2;Q13255-2	.;GRM1_HUMAN;.;.	V	266	ENSP00000354896:G266V;ENSP00000376119:G266V;ENSP00000424095:G266V;ENSP00000282753:G266V;ENSP00000347437:G266V;ENSP00000425599:G266V	ENSP00000282753:G266V	G	+	2	0	GRM1	146522273	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.415000	0.97375	2.601000	0.87937	0.655000	0.94253	GGG	GRM1	-	pfam_ANF_lig-bd_rcpt	ENSG00000152822		0.547	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM1	HGNC	protein_coding	OTTHUMT00000042574.1	33	0.00	0	G	NM_000838		146480580	146480580	+1	no_errors	ENST00000282753	ensembl	human	known	69_37n	missense	26	31.58	12	SNP	1.000	T
GRXCR2	643226	genome.wustl.edu	37	5	145252322	145252322	+	Silent	SNP	G	G	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr5:145252322G>A	ENST00000377976.1	-	1	209	c.210C>T	c.(208-210)gtC>gtT	p.V70V		NM_001080516.1	NP_001073985.1	A6NFK2	GRCR2_HUMAN	glutaredoxin, cysteine rich 2	70						cell projection (GO:0042995)				breast(1)|endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						GGGGCCTGGGGACTTCCCCAG	0.527																																						dbGAP											0													83.0	84.0	83.0					5																	145252322		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34263.1	5q32	2014-03-14			ENSG00000204928	ENSG00000204928			33862	protein-coding gene	gene with protein product		615762				24619944	Standard	NM_001080516		Approved	DFNB101	uc003lns.1	A6NFK2	OTTHUMG00000163417	ENST00000377976.1:c.210C>T	5.37:g.145252322G>A				Silent	SNP	NULL	p.V70	ENST00000377976.1	37	c.210	CCDS34263.1	5																																																																																			GRXCR2	-	NULL	ENSG00000204928		0.527	GRXCR2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	GRXCR2	HGNC	protein_coding	OTTHUMT00000373289.2	35	0.00	0	G			145252322	145252322	-1	no_errors	ENST00000377976	ensembl	human	known	69_37n	silent	24	22.58	7	SNP	0.823	A
GSTO2	119391	genome.wustl.edu	37	10	106037866	106037866	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr10:106037866T>A	ENST00000338595.2	+	4	678	c.358T>A	c.(358-360)Ttt>Att	p.F120I	GSTO2_ENST00000429569.2_Missense_Mutation_p.F92I|GSTO2_ENST00000450629.2_Missense_Mutation_p.F120I|GSTO2_ENST00000369707.2_Missense_Mutation_p.F92I|GSTO2_ENST00000401888.2_Missense_Mutation_p.F120I|GSTO2_ENST00000477078.2_3'UTR	NM_183239.1	NP_899062.1	Q9H4Y5	GSTO2_HUMAN	glutathione S-transferase omega 2	120	GST C-terminal.				cellular response to arsenic-containing substance (GO:0071243)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione dehydrogenase (ascorbate) activity (GO:0045174)|glutathione transferase activity (GO:0004364)|methylarsonate reductase activity (GO:0050610)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	11		Colorectal(252;0.178)		Epithelial(162;1.14e-09)|all cancers(201;3.89e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0155)	Glutathione(DB00143)	ATTGGAGCTATTTTGTAAGGT	0.373																																						dbGAP											0													81.0	72.0	75.0					10																	106037866		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY191318	CCDS7556.1, CCDS53574.1, CCDS53575.1	10q25.1	2012-06-21			ENSG00000065621	ENSG00000065621	2.5.1.18, 1.8.5.1, 1.20.4.2	"""Glutathione S-transferases / Soluble"""	23064	protein-coding gene	gene with protein product		612314				12618591	Standard	NM_001191013		Approved		uc001kyb.3	Q9H4Y5	OTTHUMG00000019006	ENST00000338595.2:c.358T>A	10.37:g.106037866T>A	ENSP00000345023:p.Phe120Ile		A8K771|B4DJW6|E7ESD6|Q49TW5|Q5GM70|Q5JU15|Q86WP3	Missense_Mutation	SNP	pfam_Glutathione_S-Trfase_N,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_GST_omega	p.F120I	ENST00000338595.2	37	c.358	CCDS7556.1	10	.	.	.	.	.	.	.	.	.	.	T	33	5.238642	0.95240	.	.	ENSG00000065621	ENST00000369708;ENST00000338595;ENST00000450629;ENST00000401888;ENST00000369707;ENST00000429569	T;T;T;T;T	0.13089	2.67;2.67;2.62;2.67;2.62	5.48	5.48	0.80851	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Thioredoxin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.39410	0.1077	M	0.82823	2.61	0.80722	D	1	P;P;D;D	0.71674	0.784;0.952;0.998;0.998	P;P;D;D	0.63381	0.465;0.781;0.914;0.914	T	0.38972	-0.9636	10	0.87932	D	0	-23.4082	15.868	0.79080	0.0:0.0:0.0:1.0	.	92;120;120;120	B4DML4;B4DJW6;B4DU59;Q9H4Y5	.;.;.;GSTO2_HUMAN	I	120;120;120;120;92;92	ENSP00000345023:F120I;ENSP00000390986:F120I;ENSP00000386011:F120I;ENSP00000358721:F92I;ENSP00000407381:F92I	ENSP00000345023:F120I	F	+	1	0	GSTO2	106027856	1.000000	0.71417	0.987000	0.45799	0.973000	0.67179	7.244000	0.78228	2.220000	0.72140	0.533000	0.62120	TTT	GSTO2	-	superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold	ENSG00000065621		0.373	GSTO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTO2	HGNC	protein_coding	OTTHUMT00000050210.2	33	0.00	0	T	NM_183239		106037866	106037866	+1	no_errors	ENST00000338595	ensembl	human	known	69_37n	missense	38	20.83	10	SNP	1.000	A
GULP1	51454	genome.wustl.edu	37	2	189452661	189452661	+	Silent	SNP	A	A	G			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr2:189452661A>G	ENST00000409580.1	+	12	1542	c.828A>G	c.(826-828)aaA>aaG	p.K276K	GULP1_ENST00000409843.1_Silent_p.K276K|GULP1_ENST00000409830.1_Silent_p.K276K|GULP1_ENST00000409805.1_Silent_p.K173K|GULP1_ENST00000409609.1_Silent_p.K276K|GULP1_ENST00000359135.3_Silent_p.K276K			Q9UBP9	GULP1_HUMAN	GULP, engulfment adaptor PTB domain containing 1	276					apoptotic process (GO:0006915)|lipid transport (GO:0006869)|phagocytosis, engulfment (GO:0006911)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	signal transducer activity (GO:0004871)			endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0423)|Epithelial(96;0.158)			TTCAATCAAAATTAGATGAGA	0.373																																					Pancreas(178;563 2065 20199 42378 52815)	dbGAP											0													79.0	79.0	79.0					2																	189452661		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF191771	CCDS2295.1, CCDS58742.1, CCDS58743.1	2q32.3-q33	2008-02-05			ENSG00000144366	ENSG00000144366			18649	protein-coding gene	gene with protein product		608165				11729193	Standard	NM_001252668		Approved	CED6, CED-6, GULP	uc010fru.3	Q9UBP9	OTTHUMG00000132647	ENST00000409580.1:c.828A>G	2.37:g.189452661A>G			B2RB51|B4DQ40|B8ZZ72|D3DPH1|E9PB86|Q53PC1|Q53RF3|Q9BVL3	Missense_Mutation	SNP	NULL	p.N101S	ENST00000409580.1	37	c.302	CCDS2295.1	2	.	.	.	.	.	.	.	.	.	.	A	10.21	1.288453	0.23478	.	.	ENSG00000144366	ENST00000451191;ENST00000433052	.	.	.	5.74	3.39	0.38822	.	.	.	.	.	T	0.58836	0.2150	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52215	-0.8605	4	.	.	.	-12.4431	9.1573	0.37000	0.7856:0.0:0.2144:0.0	.	.	.	.	S	101;161	.	.	N	+	2	0	GULP1	189160906	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.387000	0.44389	0.463000	0.27118	0.482000	0.46254	AAT	GULP1	-	NULL	ENSG00000144366		0.373	GULP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GULP1	HGNC	protein_coding	OTTHUMT00000335722.1	68	0.00	0	A	NM_016315		189452661	189452661	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000451191	ensembl	human	putative	69_37n	missense	36	32.08	17	SNP	1.000	G
ITLN2	142683	genome.wustl.edu	37	1	160921037	160921037	+	Silent	SNP	C	C	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr1:160921037C>T	ENST00000368029.3	-	4	294	c.237G>A	c.(235-237)caG>caA	p.Q79Q	ITLN2_ENST00000494442.1_5'Flank|RP11-544M22.1_ENST00000356006.3_RNA	NM_080878.2	NP_543154.1	Q8WWU7	ITLN2_HUMAN	intelectin 2	79	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	19	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CACAGAAGGTCTGGTAGACAA	0.577																																						dbGAP											0													89.0	82.0	84.0					1																	160921037		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY065973	CCDS1212.1	1q22-q23.5	2013-02-06			ENSG00000158764	ENSG00000158764		"""Fibrinogen C domain containing"""	20599	protein-coding gene	gene with protein product		609874				11181563	Standard	NM_080878		Approved	HL-2	uc001fxd.3	Q8WWU7	OTTHUMG00000028605	ENST00000368029.3:c.237G>A	1.37:g.160921037C>T			Q17RR2|Q5VYI0	Silent	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C	p.Q79	ENST00000368029.3	37	c.237	CCDS1212.1	1																																																																																			ITLN2	-	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C	ENSG00000158764		0.577	ITLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITLN2	HGNC	protein_coding	OTTHUMT00000071465.1	24	0.00	0	C	NM_080878		160921037	160921037	-1	no_errors	ENST00000368029	ensembl	human	known	69_37n	silent	22	33.33	11	SNP	1.000	T
KIFC3	3801	genome.wustl.edu	37	16	57828979	57828979	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr16:57828979G>A	ENST00000379655.4	-	3	504	c.247C>T	c.(247-249)Cag>Tag	p.Q83*	KIFC3_ENST00000541240.1_Nonsense_Mutation_p.Q105*|KIFC3_ENST00000539578.1_5'UTR|KIFC3_ENST00000465878.2_5'UTR|KIFC3_ENST00000421376.2_5'UTR|KIFC3_ENST00000445690.2_Nonsense_Mutation_p.Q83*|KIFC3_ENST00000566975.1_5'UTR	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3	83					ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				GCTCGGCACTGAGCTAGGGCT	0.647																																						dbGAP											0													37.0	40.0	39.0					16																	57828979		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0			BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455	ENST00000379655.4:c.247C>T	16.37:g.57828979G>A	ENSP00000368976:p.Gln83*		A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	Nonsense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.Q83*	ENST00000379655.4	37	c.247	CCDS10789.2	16	.	.	.	.	.	.	.	.	.	.	G	22.1	4.249047	0.80024	.	.	ENSG00000140859	ENST00000379655;ENST00000445690;ENST00000541240	.	.	.	6.02	6.02	0.97574	.	1.822690	0.02588	N	0.099678	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	16.0408	0.80680	0.0:0.0:1.0:0.0	.	.	.	.	X	83;83;105	.	ENSP00000368976:Q83X	Q	-	1	0	KIFC3	56386480	1.000000	0.71417	0.970000	0.41538	0.851000	0.48451	5.238000	0.65366	2.865000	0.98341	0.655000	0.94253	CAG	KIFC3	-	NULL	ENSG00000140859		0.647	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIFC3	HGNC	protein_coding	OTTHUMT00000257329.2	8	0.00	0	G	NM_005550		57828979	57828979	-1	no_errors	ENST00000379655	ensembl	human	known	69_37n	nonsense	15	30.43	7	SNP	0.989	A
KLF15	28999	genome.wustl.edu	37	3	126070957	126070957	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr3:126070957G>A	ENST00000296233.3	-	2	1039	c.809C>T	c.(808-810)tCc>tTc	p.S270F	KLF15_ENST00000509675.1_5'Flank	NM_014079.3	NP_054798.1	Q9UIH9	KLF15_HUMAN	Kruppel-like factor 15	270					cardiac muscle hypertrophy in response to stress (GO:0014898)|cellular response to peptide (GO:1901653)|glial cell differentiation (GO:0010001)|glomerular visceral epithelial cell differentiation (GO:0072112)|glucose transport (GO:0015758)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|lung(7)|ovary(2)|skin(2)	12				GBM - Glioblastoma multiforme(114;0.147)		GTTCAAGTTGGAGGAGGGTAC	0.647																																						dbGAP											0													34.0	24.0	28.0					3																	126070957		2192	4291	6483	-	-	-	SO:0001583	missense	0			AB029254	CCDS3036.1	3q21.3	2013-01-08			ENSG00000163884	ENSG00000163884		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	14536	protein-coding gene	gene with protein product	"""kidney-enriched Kruppel-like factor"""	606465				10982849	Standard	NM_014079		Approved	KKLF	uc011bkk.1	Q9UIH9	OTTHUMG00000162689	ENST00000296233.3:c.809C>T	3.37:g.126070957G>A	ENSP00000296233:p.Ser270Phe			Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S270F	ENST00000296233.3	37	c.809	CCDS3036.1	3	.	.	.	.	.	.	.	.	.	.	g	19.63	3.862765	0.71949	.	.	ENSG00000163884	ENST00000296233	T	0.08634	3.07	4.98	4.98	0.66077	.	0.210291	0.51477	D	0.000091	T	0.21227	0.0511	M	0.63428	1.95	0.47183	D	0.999346	D	0.67145	0.996	P	0.56700	0.804	T	0.00241	-1.1886	10	0.49607	T	0.09	.	16.1165	0.81306	0.0:0.0:1.0:0.0	.	270	Q9UIH9	KLF15_HUMAN	F	270	ENSP00000296233:S270F	ENSP00000296233:S270F	S	-	2	0	KLF15	127553647	1.000000	0.71417	0.874000	0.34290	0.839000	0.47603	7.515000	0.81761	2.475000	0.83589	0.486000	0.48141	TCC	KLF15	-	NULL	ENSG00000163884		0.647	KLF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF15	HGNC	protein_coding	OTTHUMT00000370096.1	18	0.00	0	G	NM_014079		126070957	126070957	-1	no_errors	ENST00000296233	ensembl	human	known	69_37n	missense	19	38.71	12	SNP	0.996	A
KRBA2	124751	genome.wustl.edu	37	17	8273116	8273116	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr17:8273116G>A	ENST00000331336.2	-	2	820	c.815C>T	c.(814-816)tCc>tTc	p.S272F	RP11-849F2.5_ENST00000583963.1_RNA|RP11-849F2.7_ENST00000582471.1_3'UTR|KRBA2_ENST00000396267.1_Missense_Mutation_p.S190F|RP11-849F2.5_ENST00000580537.1_RNA	NM_213597.2	NP_998762.1	Q6ZNG9	KRBA2_HUMAN	KRAB-A domain containing 2	272	Integrase catalytic. {ECO:0000255|PROSITE-ProRule:PRU00457}.				DNA integration (GO:0015074)|regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			endometrium(2)|kidney(2)|large_intestine(7)|lung(5)|stomach(1)|urinary_tract(1)	18						ATCGGCACTGGACTGCATGTC	0.448																																						dbGAP											0													89.0	86.0	87.0					17																	8273116		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024723	CCDS11141.1	17p13.1	2013-01-08	2006-08-15		ENSG00000184619	ENSG00000184619		"""-"""	26989	protein-coding gene	gene with protein product			"""KRAB A domain containing 2"""			12477932	Standard	NM_213597		Approved		uc002glf.1	Q6ZNG9	OTTHUMG00000132864	ENST00000331336.2:c.815C>T	17.37:g.8273116G>A	ENSP00000328017:p.Ser272Phe		Q8IYY0	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_RNaseH-like_dom,superfamily_Krueppel-associated_box,pfscan_Integrase_cat-core	p.S272F	ENST00000331336.2	37	c.815	CCDS11141.1	17	.	.	.	.	.	.	.	.	.	.	g	14.79	2.640495	0.47153	.	.	ENSG00000184619	ENST00000396267;ENST00000331336	T;T	0.24908	1.85;1.83	2.96	2.96	0.34315	Integrase, catalytic core (1);Ribonuclease H-like (1);	.	.	.	.	T	0.19886	0.0478	L	0.38175	1.15	0.27259	N	0.958687	P	0.34615	0.459	B	0.32211	0.142	T	0.12811	-1.0533	9	0.66056	D	0.02	.	9.6691	0.40002	0.0:0.0:1.0:0.0	.	272	Q6ZNG9	KRBA2_HUMAN	F	190;272	ENSP00000379565:S190F;ENSP00000328017:S272F	ENSP00000328017:S272F	S	-	2	0	KRBA2	8213841	0.999000	0.42202	0.975000	0.42487	0.731000	0.41821	3.687000	0.54692	1.981000	0.57761	0.650000	0.86243	TCC	KRBA2	-	superfamily_RNaseH-like_dom,pfscan_Integrase_cat-core	ENSG00000184619		0.448	KRBA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KRBA2	HGNC	protein_coding	OTTHUMT00000256338.1	12	0.00	0	G	NM_213597		8273116	8273116	-1	no_errors	ENST00000331336	ensembl	human	known	69_37n	missense	6	60.00	9	SNP	0.985	A
KSR1	8844	genome.wustl.edu	37	17	25937188	25937188	+	Missense_Mutation	SNP	T	T	G			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr17:25937188T>G	ENST00000319524.6	+	18	2387	c.2387T>G	c.(2386-2388)cTg>cGg	p.L796R	KSR1_ENST00000509603.2_Missense_Mutation_p.L774R|KSR1_ENST00000582410.1_Missense_Mutation_p.L10R|KSR1_ENST00000398988.3_Missense_Mutation_p.L659R|KSR1_ENST00000268763.6_Missense_Mutation_p.L659R			Q8IVT5	KSR1_HUMAN	kinase suppressor of ras 1	796	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	28	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		GAGGATCAGCTGCCATTCTCC	0.587											OREG0024262	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(88;1120 1336 6324 10502 16832)	dbGAP											0													93.0	97.0	95.0					17																	25937188		2021	4182	6203	-	-	-	SO:0001583	missense	0			U43586	CCDS58532.1	17q11.2	2012-05-23	2005-12-14	2005-12-14	ENSG00000141068	ENSG00000141068			6465	protein-coding gene	gene with protein product		601132	"""kinase suppressor of ras"""	KSR		8521512	Standard	XM_006722151		Approved	RSU2	uc031qzj.1	Q8IVT5	OTTHUMG00000132051	ENST00000319524.6:c.2387T>G	17.37:g.25937188T>G	ENSP00000323178:p.Leu796Arg	782	F8WEA9|H7BYU0|Q13476	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L796R	ENST00000319524.6	37	c.2387		17	.	.	.	.	.	.	.	.	.	.	T	13.44	2.236514	0.39498	.	.	ENSG00000141068	ENST00000319524;ENST00000509603;ENST00000268763;ENST00000398982	T;T;T	0.41065	1.01;1.01;1.01	5.82	5.82	0.92795	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.62756	0.2454	M	0.66378	2.025	0.80722	D	1	D;B	0.89917	1.0;0.28	D;B	0.97110	1.0;0.381	T	0.61845	-0.6979	10	0.40728	T	0.16	.	15.3651	0.74516	0.0:0.0:0.0:1.0	.	794;774	Q8IVT5;F5H0K8	KSR1_HUMAN;.	R	796;774;659;659	ENSP00000323178:L796R;ENSP00000438795:L774R;ENSP00000268763:L659R	ENSP00000268763:L659R	L	+	2	0	KSR1	22961315	1.000000	0.71417	1.000000	0.80357	0.552000	0.35366	7.925000	0.87563	2.222000	0.72286	0.533000	0.62120	CTG	KSR1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000141068		0.587	KSR1-202	KNOWN	basic|appris_candidate_longest	protein_coding	KSR1	HGNC	protein_coding		27	0.00	0	T	NM_014238		25937188	25937188	+1	no_errors	ENST00000319524	ensembl	human	known	69_37n	missense	21	46.15	18	SNP	1.000	G
LRRTM1	347730	genome.wustl.edu	37	2	80530609	80530609	+	Silent	SNP	C	C	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr2:80530609C>T	ENST00000295057.3	-	2	992	c.336G>A	c.(334-336)ctG>ctA	p.L112L	CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000540488.1_Intron|LRRTM1_ENST00000409148.1_Silent_p.L112L|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000541047.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	112					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						TAACTCGGCGCAGTTTCTGAA	0.597										HNSCC(69;0.2)																												dbGAP											0													174.0	165.0	168.0					2																	80530609		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.336G>A	2.37:g.80530609C>T			A8K397|D6W5K1|Q96DN1	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L112	ENST00000295057.3	37	c.336	CCDS1966.1	2																																																																																			LRRTM1	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000162951		0.597	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM1	HGNC	protein_coding	OTTHUMT00000313614.1	36	0.00	0	C	NM_178839		80530609	80530609	-1	no_errors	ENST00000295057	ensembl	human	known	69_37n	silent	32	38.46	20	SNP	1.000	T
MAS1	4142	genome.wustl.edu	37	6	160328344	160328344	+	Silent	SNP	C	C	G			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr6:160328344C>G	ENST00000252660.4	+	1	371	c.357C>G	c.(355-357)ggC>ggG	p.G119G		NM_002377.2	NP_002368.1	P04201	MAS_HUMAN	MAS1 proto-oncogene, G protein-coupled receptor	119					activation of NF-kappaB-inducing kinase activity (GO:0007250)|anatomical structure morphogenesis (GO:0009653)|cell proliferation (GO:0008283)|cellular response to peptide hormone stimulus (GO:0071375)|G-protein coupled receptor signaling pathway (GO:0007186)|hippocampus development (GO:0021766)|male gonad development (GO:0008584)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|protein kinase C signaling (GO:0070528)|regulation of inflammatory response (GO:0050727)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	angiotensin receptor activity (GO:0001595)|angiotensin type II receptor activity (GO:0004945)|G-protein coupled receptor activity (GO:0004930)|peptide binding (GO:0042277)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.6e-06)		ACAACACGGGCCTCTATCTGC	0.478																																						dbGAP											0													140.0	133.0	135.0					6																	160328344		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M13150	CCDS5272.1	6q24-q27	2014-06-26	2014-06-26		ENSG00000130368	ENSG00000130368		"""GPCR / Class A : Orphans"""	6899	protein-coding gene	gene with protein product		165180	"""MAS1 oncogene"""				Standard	NM_002377		Approved		uc003qsz.3	P04201	OTTHUMG00000015944	ENST00000252660.4:c.357C>G	6.37:g.160328344C>G			E1P5B3|Q2TBC9|Q6FG47	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Mas_TM,prints_7TM_GPCR_Rhodpsn	p.G119	ENST00000252660.4	37	c.357	CCDS5272.1	6																																																																																			MAS1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000130368		0.478	MAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAS1	HGNC	protein_coding	OTTHUMT00000042930.2	38	0.00	0	C	NM_002377		160328344	160328344	+1	no_errors	ENST00000252660	ensembl	human	known	69_37n	silent	21	22.22	6	SNP	1.000	G
MBD5	55777	genome.wustl.edu	37	2	149247498	149247498	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr2:149247498G>T	ENST00000407073.1	+	12	4595	c.3598G>T	c.(3598-3600)Gag>Tag	p.E1200*	MBD5_ENST00000404807.1_Nonsense_Mutation_p.E1433*	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	1200					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.E1200*(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		GTGGGACGGGGAGCAAAGCCC	0.473																																						dbGAP											1	Substitution - Nonsense(1)	lung(1)											103.0	104.0	103.0					2																	149247498		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.3598G>T	2.37:g.149247498G>T	ENSP00000386049:p.Glu1200*		A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Nonsense_Mutation	SNP	superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd,pfscan_PWWP	p.E1200*	ENST00000407073.1	37	c.3598	CCDS33302.1	2	.	.	.	.	.	.	.	.	.	.	G	50	16.115777	0.99854	.	.	ENSG00000204406	ENST00000407073;ENST00000404807	.	.	.	6.01	6.01	0.97437	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-7.9267	20.5182	0.99214	0.0:0.0:1.0:0.0	.	.	.	.	X	1200;1433	.	ENSP00000384672:E1433X	E	+	1	0	MBD5	148963968	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.760000	0.91671	2.860000	0.98153	0.655000	0.94253	GAG	MBD5	-	NULL	ENSG00000204406		0.473	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD5	HGNC	protein_coding	OTTHUMT00000318111.2	27	0.00	0	G			149247498	149247498	+1	no_errors	ENST00000407073	ensembl	human	known	69_37n	nonsense	24	14.29	4	SNP	1.000	T
METTL4	64863	genome.wustl.edu	37	18	2567097	2567097	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr18:2567097G>C	ENST00000574538.1	-	2	894	c.119C>G	c.(118-120)aCt>aGt	p.T40S	METTL4_ENST00000319888.6_Missense_Mutation_p.T40S	NM_022840.3	NP_073751.3	Q8N3J2	METL4_HUMAN	methyltransferase like 4	40					nucleobase-containing compound metabolic process (GO:0006139)		methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	17						AACAGAAGTAGTGAACTCCTT	0.413																																						dbGAP											0													91.0	83.0	85.0					18																	2567097		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11826.1	18p11.31	2008-02-05			ENSG00000101574	ENSG00000101574			24726	protein-coding gene	gene with protein product						12477932	Standard	NM_022840		Approved	FLJ23017, HsT661	uc002klh.4	Q8N3J2	OTTHUMG00000131482	ENST00000574538.1:c.119C>G	18.37:g.2567097G>C	ENSP00000458290:p.Thr40Ser		B2RNA1|Q2TAA7|Q9H5U9	Missense_Mutation	SNP	pfam_MT-A70-like,pfscan_MT-A70-like	p.T40S	ENST00000574538.1	37	c.119	CCDS11826.1	18	.	.	.	.	.	.	.	.	.	.	G	8.164	0.790200	0.16258	.	.	ENSG00000101574	ENST00000319888	T	0.22945	1.93	5.34	2.35	0.29111	.	0.820419	0.10213	N	0.701927	T	0.19927	0.0479	M	0.63428	1.95	0.09310	N	1	B	0.31077	0.307	B	0.20577	0.03	T	0.24905	-1.0147	10	0.17369	T	0.5	-0.8469	4.3491	0.11146	0.2043:0.1895:0.6062:0.0	.	40	Q8N3J2	METL4_HUMAN	S	40	ENSP00000320349:T40S	ENSP00000320349:T40S	T	-	2	0	METTL4	2557097	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.209000	0.17435	0.805000	0.34159	0.655000	0.94253	ACT	METTL4	-	NULL	ENSG00000101574		0.413	METTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL4	HGNC	protein_coding	OTTHUMT00000254326.3	28	0.00	0	G	NM_022840		2567097	2567097	-1	no_errors	ENST00000574538	ensembl	human	known	69_37n	missense	18	37.93	11	SNP	0.000	C
MGRN1	23295	genome.wustl.edu	37	16	4715104	4715104	+	Splice_Site	SNP	G	G	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr16:4715104G>T	ENST00000399577.5	+	7	723	c.630G>T	c.(628-630)gtG>gtT	p.V210V	MGRN1_ENST00000586183.1_Splice_Site_p.V210V|MGRN1_ENST00000415496.1_Silent_p.V211V|MGRN1_ENST00000262370.7_Splice_Site_p.V210V|MGRN1_ENST00000588994.1_Splice_Site_p.V210V	NM_001142290.2	NP_001135762.1	O60291	MGRN1_HUMAN	mahogunin ring finger 1, E3 ubiquitin protein ligase	210					endosome to lysosome transport (GO:0008333)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18						CCCCAGCAGTGGTGGAAGTGA	0.657																																						dbGAP											0													51.0	59.0	57.0					16																	4715104		2115	4225	6340	-	-	-	SO:0001630	splice_region_variant	0			AB011116	CCDS42115.1, CCDS45401.1, CCDS45402.1, CCDS45401.2, CCDS59256.1	16p13	2012-02-23	2012-02-23					"""RING-type (C3HC4) zinc fingers"""	20254	protein-coding gene	gene with protein product		607559	"""mahogunin, ring finger 1"""			9628581	Standard	NM_015246		Approved	KIAA0544, RNF156	uc002cxa.3	O60291		ENST00000399577.5:c.629-1G>T	16.37:g.4715104G>T			A4URL3|A4URL4|Q86W76	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.G175C	ENST00000399577.5	37	c.523	CCDS45402.1	16																																																																																			MGRN1	-	NULL	ENSG00000102858		0.657	MGRN1-004	KNOWN	basic|CCDS	protein_coding	MGRN1	HGNC	protein_coding	OTTHUMT00000432060.2	21	0.00	0	G		Silent	4715104	4715104	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000590790	ensembl	human	novel	69_37n	missense	17	34.62	9	SNP	1.000	T
MKS1	54903	genome.wustl.edu	37	17	56285904	56285904	+	Silent	SNP	T	T	G			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr17:56285904T>G	ENST00000393119.2	-	12	1139	c.1065A>C	c.(1063-1065)acA>acC	p.T355T	MKS1_ENST00000313863.6_Silent_p.T355T|MKS1_ENST00000337050.7_Silent_p.T355T|MKS1_ENST00000546108.1_Silent_p.T152T|MKS1_ENST00000537529.2_Silent_p.T345T	NM_017777.3	NP_060247.2	Q9NXB0	MKS1_HUMAN	Meckel syndrome, type 1	355	B9. {ECO:0000255|PROSITE- ProRule:PRU00713}.				branching morphogenesis of an epithelial tube (GO:0048754)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)				endometrium(5)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						TGCAGGTCTGTGTTACTCCTG	0.493																																						dbGAP											0													96.0	96.0	96.0					17																	56285904		1959	4157	6116	-	-	-	SO:0001819	synonymous_variant	0			DQ185029	CCDS11603.2, CCDS54148.1	17q21-q24	2014-09-17			ENSG00000011143	ENSG00000011143			7121	protein-coding gene	gene with protein product	"""POC12 centriolar protein homolog (Chlamydomonas)"""	609883		MKS		7550354, 16415886, 18327255	Standard	NM_017777		Approved	FLJ20345, POC12, BBS13	uc002ivr.2	Q9NXB0	OTTHUMG00000133714	ENST00000393119.2:c.1065A>C	17.37:g.56285904T>G			B7WNX4|F5H885|Q284T0|Q96G13	Missense_Mutation	SNP	pfam_B9_dom	p.H181P	ENST00000393119.2	37	c.542	CCDS11603.2	17	.	.	.	.	.	.	.	.	.	.	T	9.666	1.145315	0.21288	.	.	ENSG00000011143	ENST00000313863	.	.	.	5.58	0.48	0.16804	.	.	.	.	.	T	0.42899	0.1223	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21449	-1.0245	4	.	.	.	-7.9493	2.4328	0.04476	0.1141:0.1468:0.3643:0.3749	.	.	.	.	P	356	.	.	H	-	2	0	MKS1	53640903	0.049000	0.20398	1.000000	0.80357	0.889000	0.51656	-1.032000	0.03574	0.040000	0.15660	0.454000	0.30748	CAC	MKS1	-	pfam_B9_dom	ENSG00000011143		0.493	MKS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MKS1	HGNC	protein_coding	OTTHUMT00000258015.2	39	0.00	0	T	NM_017777		56285904	56285904	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000577824	ensembl	human	putative	69_37n	missense	55	14.06	9	SNP	0.969	G
MS4A10	341116	genome.wustl.edu	37	11	60558546	60558546	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr11:60558546C>A	ENST00000308287.1	+	3	379	c.283C>A	c.(283-285)Cca>Aca	p.P95T		NM_206893.3	NP_996776.2	Q96PG2	M4A10_HUMAN	membrane-spanning 4-domains, subfamily A, member 10	95						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|skin(2)	21						GTCTTGGTATCCATTCTGGGG	0.582																																						dbGAP											0													98.0	98.0	98.0					11																	60558546		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK122633	CCDS7992.1	11q12.2	2008-02-05				ENSG00000172689			13368	protein-coding gene	gene with protein product		608403				11486273, 11401424	Standard	NM_206893		Approved	CD20L7, MS4A9	uc001npz.1	Q96PG2		ENST00000308287.1:c.283C>A	11.37:g.60558546C>A	ENSP00000311862:p.Pro95Thr		B2RP45|Q96PG3	Missense_Mutation	SNP	pfam_CD20-like	p.P95T	ENST00000308287.1	37	c.283	CCDS7992.1	11	.	.	.	.	.	.	.	.	.	.	C	15.89	2.967732	0.53507	.	.	ENSG00000172689	ENST00000308287	T	0.04234	3.67	4.67	4.67	0.58626	.	0.264874	0.20227	N	0.096574	T	0.20292	0.0488	M	0.78049	2.395	0.31849	N	0.622433	D	0.89917	1.0	D	0.78314	0.991	T	0.05289	-1.0894	10	0.42905	T	0.14	-13.703	13.0564	0.58982	0.0:1.0:0.0:0.0	.	95	Q96PG2	M4A10_HUMAN	T	95	ENSP00000311862:P95T	ENSP00000311862:P95T	P	+	1	0	MS4A10	60315122	0.995000	0.38212	0.816000	0.32577	0.479000	0.33129	3.557000	0.53741	2.133000	0.65898	0.462000	0.41574	CCA	MS4A10	-	pfam_CD20-like	ENSG00000172689		0.582	MS4A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A10	HGNC	protein_coding	OTTHUMT00000395619.1	36	0.00	0	C	NM_206893		60558546	60558546	+1	no_errors	ENST00000308287	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	0.942	A
PC	5091	genome.wustl.edu	37	11	66619395	66619395	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr11:66619395C>T	ENST00000393958.2	-	15	1941	c.1848G>A	c.(1846-1848)atG>atA	p.M616I	PC_ENST00000529047.1_5'Flank|PC_ENST00000393960.1_Missense_Mutation_p.M616I|PC_ENST00000528224.1_5'Flank|PC_ENST00000393955.2_Missense_Mutation_p.M616I	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	616	Carboxyltransferase.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	ACAGGAAGCGCATGGCGACGT	0.642																																						dbGAP											0													48.0	46.0	47.0					11																	66619395		2200	4295	6495	-	-	-	SO:0001583	missense	0			U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.1848G>A	11.37:g.66619395C>T	ENSP00000377530:p.Met616Ile		B4DN00|Q16705	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_Carboxylase_cons_dom,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_PYR_CT,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pirsf_Pyruv_COase,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_PYR_CT,pfscan_Biotin_lipoyl,tigrfam_Pyruv_COase	p.M616I	ENST00000393958.2	37	c.1848	CCDS8152.1	11	.	.	.	.	.	.	.	.	.	.	C	20.2	3.943242	0.73672	.	.	ENSG00000173599	ENST00000393955;ENST00000393958;ENST00000393960	D;D;D	0.97505	-4.41;-4.41;-4.41	4.56	4.56	0.56223	Aldolase-type TIM barrel (1);Pyruvate carboxyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.94265	0.8158	L	0.31578	0.945	0.80722	D	1	B	0.16166	0.016	B	0.26969	0.075	D	0.92193	0.5761	10	0.72032	D	0.01	-44.2672	14.8869	0.70575	0.0:1.0:0.0:0.0	.	616	P11498	PYC_HUMAN	I	616	ENSP00000377527:M616I;ENSP00000377530:M616I;ENSP00000377532:M616I	ENSP00000377527:M616I	M	-	3	0	PC	66375971	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.665000	0.68052	2.372000	0.80975	0.561000	0.74099	ATG	PC	-	pfam_PYR_CT,pirsf_Pyruv_COase,pfscan_PYR_CT,tigrfam_Pyruv_COase	ENSG00000173599		0.642	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PC	HGNC	protein_coding	OTTHUMT00000393115.1	18	0.00	0	C	NM_001040716		66619395	66619395	-1	no_errors	ENST00000393958	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	1.000	T
PKM	5315	genome.wustl.edu	37	15	72499505	72499505	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr15:72499505C>T	ENST00000335181.5	-	7	1053	c.950G>A	c.(949-951)tGc>tAc	p.C317Y	PKM_ENST00000565184.1_Missense_Mutation_p.C317Y|PKM_ENST00000568459.1_Missense_Mutation_p.C317Y|PKM_ENST00000449901.2_Missense_Mutation_p.C302Y|PKM_ENST00000389093.3_Missense_Mutation_p.C317Y|PKM_ENST00000568883.1_Missense_Mutation_p.C152Y|PKM_ENST00000565154.1_Missense_Mutation_p.C317Y|PKM_ENST00000319622.6_Missense_Mutation_p.C317Y	NM_002654.4	NP_002645.3	P14618	KPYM_HUMAN	pyruvate kinase, muscle	317	Interaction with POU5F1.				carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|programmed cell death (GO:0012501)|small molecule metabolic process (GO:0044281)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			endometrium(1)|lung(7)	8					Pyruvic acid(DB00119)	AGCTCGGTTGCACCGTCCAAT	0.532																																						dbGAP											0													120.0	86.0	98.0					15																	72499505		2199	4297	6496	-	-	-	SO:0001583	missense	0			M23725	CCDS32284.1, CCDS32285.1, CCDS55972.1, CCDS73752.1	15q23	2012-10-02		2012-05-23	ENSG00000067225	ENSG00000067225	2.7.1.40		9021	protein-coding gene	gene with protein product		179050		PKM2		2040271	Standard	NM_002654		Approved	THBP1, OIP3, PK3	uc002atr.1	P14618	OTTHUMG00000172709	ENST00000335181.5:c.950G>A	15.37:g.72499505C>T	ENSP00000334983:p.Cys317Tyr		A6NFK3|B2R5N8|B3KRY0|B4DFX8|B4DUU6|P14786|Q53GK4|Q96E76|Q9BWB5|Q9UCV6|Q9UPF2	Missense_Mutation	SNP	pfam_Pyrv_Knase_brl,pfam_Pyrv_Knase_C,superfamily_Pyrv/PenolPyrv_Kinase,superfamily_Pyrv_Knase_C,superfamily_Pyrv_Knase-like_insert_dom,prints_Pyr_Knase,tigrfam_Pyr_Knase	p.C317Y	ENST00000335181.5	37	c.950	CCDS32284.1	15	.	.	.	.	.	.	.	.	.	.	C	25.5	4.641473	0.87859	.	.	ENSG00000067225	ENST00000319622;ENST00000335181;ENST00000434220;ENST00000327974;ENST00000389093;ENST00000449901	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	5.09	5.09	0.68999	Pyruvate/Phosphoenolpyruvate kinase (2);Pyruvate kinase, barrel (1);	0.000000	0.85682	D	0.000000	D	0.86075	0.5846	H	0.97077	3.935	0.80722	D	1	P;B;P;D;P;B;P;B;P	0.55172	0.675;0.384;0.539;0.97;0.578;0.333;0.863;0.335;0.947	B;B;B;P;P;B;P;B;P	0.55965	0.349;0.349;0.349;0.749;0.47;0.174;0.679;0.145;0.788	D	0.91115	0.4925	10	0.87932	D	0	-31.9454	18.8464	0.92209	0.0:1.0:0.0:0.0	.	243;302;297;297;317;317;152;244;152	B4DNK4;B4DUU6;B4DRT3;E7EUQ8;P14618;P14618-2;Q504U3;E9PF79;E7EUJ4	.;.;.;.;KPYM_HUMAN;.;.;.;.	Y	317;317;244;152;317;302	ENSP00000320171:C317Y;ENSP00000334983:C317Y;ENSP00000373745:C317Y;ENSP00000403365:C302Y	ENSP00000320171:C317Y	C	-	2	0	PKM2	70286559	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.509000	0.84616	0.561000	0.74099	TGC	PKM	-	pfam_Pyrv_Knase_brl,superfamily_Pyrv/PenolPyrv_Kinase,prints_Pyr_Knase,tigrfam_Pyr_Knase	ENSG00000067225		0.532	PKM-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKM	HGNC	protein_coding	OTTHUMT00000420056.1	27	0.00	0	C			72499505	72499505	-1	no_errors	ENST00000319622	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	1.000	T
PLXNC1	10154	genome.wustl.edu	37	12	94673274	94673274	+	Silent	SNP	C	C	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr12:94673274C>T	ENST00000258526.4	+	22	3873	c.3624C>T	c.(3622-3624)atC>atT	p.I1208I	PLXNC1_ENST00000547057.1_Silent_p.I255I|RP11-1105G2.3_ENST00000547927.1_5'Flank|PLXNC1_ENST00000545312.1_5'UTR|RP11-1105G2.3_ENST00000551941.1_Intron|RP11-1105G2.4_ENST00000550111.1_RNA	NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	1208					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						TTGAAAAAATCCCGGAAAACG	0.388																																						dbGAP											0													88.0	85.0	86.0					12																	94673274		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.3624C>T	12.37:g.94673274C>T			Q59H25	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Plexin_repeat,pfam_IPT_TIG_rcpt,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Plexin-like_fold,superfamily_Ig_E-set,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.I1208	ENST00000258526.4	37	c.3624	CCDS9049.1	12																																																																																			PLXNC1	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000136040		0.388	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNC1	HGNC	protein_coding	OTTHUMT00000408126.2	47	0.00	0	C			94673274	94673274	+1	no_errors	ENST00000258526	ensembl	human	known	69_37n	silent	20	35.48	11	SNP	1.000	T
PPP1R32	220004	genome.wustl.edu	37	11	61249870	61249870	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr11:61249870G>C	ENST00000338608.2	+	3	322	c.197G>C	c.(196-198)aGt>aCt	p.S66T	RP11-286N22.8_ENST00000544880.1_Intron|PPP1R32_ENST00000432063.2_Missense_Mutation_p.S66T|RP11-286N22.8_ENST00000543044.1_3'UTR	NM_145017.2	NP_659454.2	Q7Z5V6	PPR32_HUMAN	protein phosphatase 1, regulatory subunit 32	66							phosphatase binding (GO:0019902)										TGCCAAGCCAGTCTGGAGGCC	0.612											OREG0021002	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													45.0	51.0	49.0					11																	61249870		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK057333	CCDS8008.1, CCDS53641.1	11q12.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000162148	ENSG00000162148		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28869	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 66"""	C11orf66		12477932	Standard	NM_145017		Approved	IIIG9, FLJ32771	uc001nru.2	Q7Z5V6	OTTHUMG00000168176	ENST00000338608.2:c.197G>C	11.37:g.61249870G>C	ENSP00000344140:p.Ser66Thr	1052	Q4G0P4|Q96M77	Missense_Mutation	SNP	NULL	p.S66T	ENST00000338608.2	37	c.197	CCDS8008.1	11	.	.	.	.	.	.	.	.	.	.	G	4.179	0.031804	0.08101	.	.	ENSG00000162148	ENST00000432063;ENST00000338608	T;T	0.48836	0.8;1.41	5.04	-8.66	0.00866	.	1.121610	0.06753	N	0.780435	T	0.32315	0.0825	L	0.31926	0.97	0.09310	N	1	B;B	0.21225	0.021;0.053	B;B	0.17722	0.013;0.019	T	0.30179	-0.9987	10	0.17369	T	0.5	-12.7741	15.4873	0.75575	0.1445:0.1062:0.7493:0.0	.	66;66	Q7Z5V6-2;Q7Z5V6	.;PPR32_HUMAN	T	66	ENSP00000391560:S66T;ENSP00000344140:S66T	ENSP00000344140:S66T	S	+	2	0	C11orf66	61006446	0.000000	0.05858	0.000000	0.03702	0.142000	0.21351	-0.947000	0.03901	-1.338000	0.02233	-0.136000	0.14681	AGT	PPP1R32	-	NULL	ENSG00000162148		0.612	PPP1R32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R32	HGNC	protein_coding	OTTHUMT00000398621.1	27	0.00	0	G	NM_145017		61249870	61249870	+1	no_errors	ENST00000338608	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	0.000	C
PPP1R32	220004	genome.wustl.edu	37	11	61253382	61253382	+	Splice_Site	SNP	C	C	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr11:61253382C>A	ENST00000338608.2	+	7	811	c.686C>A	c.(685-687)cCt>cAt	p.P229H	PPP1R32_ENST00000366212.4_5'Flank|PPP1R32_ENST00000432063.2_Splice_Site_p.P229H	NM_145017.2	NP_659454.2	Q7Z5V6	PPR32_HUMAN	protein phosphatase 1, regulatory subunit 32	229							phosphatase binding (GO:0019902)										CCTGGGGACCCTGTAAGTCGG	0.567																																						dbGAP											0													39.0	41.0	41.0					11																	61253382		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0			AK057333	CCDS8008.1, CCDS53641.1	11q12.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000162148	ENSG00000162148		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28869	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 66"""	C11orf66		12477932	Standard	NM_145017		Approved	IIIG9, FLJ32771	uc001nru.2	Q7Z5V6	OTTHUMG00000168176	ENST00000338608.2:c.687+1C>A	11.37:g.61253382C>A			Q4G0P4|Q96M77	Missense_Mutation	SNP	NULL	p.P229H	ENST00000338608.2	37	c.686	CCDS8008.1	11	.	.	.	.	.	.	.	.	.	.	C	14.86	2.662316	0.47572	.	.	ENSG00000162148	ENST00000432063;ENST00000338608;ENST00000542951	T;T;T	0.43688	0.94;1.41;1.1	4.77	4.77	0.60923	.	0.210965	0.33496	N	0.004858	T	0.58991	0.2161	M	0.73962	2.25	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.63877	0.919;0.919	T	0.56854	-0.7910	10	0.15499	T	0.54	-17.8808	14.7188	0.69289	0.0:1.0:0.0:0.0	.	229;229	Q7Z5V6-2;Q7Z5V6	.;PPR32_HUMAN	H	229;229;9	ENSP00000391560:P229H;ENSP00000344140:P229H;ENSP00000441053:P9H	ENSP00000344140:P229H	P	+	2	0	C11orf66	61009958	0.125000	0.22332	0.912000	0.35992	0.311000	0.27955	1.250000	0.32850	2.187000	0.69744	0.462000	0.41574	CCT	PPP1R32	-	NULL	ENSG00000162148		0.567	PPP1R32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R32	HGNC	protein_coding	OTTHUMT00000398621.1	26	0.00	0	C	NM_145017	Missense_Mutation	61253382	61253382	+1	no_errors	ENST00000338608	ensembl	human	known	69_37n	missense	11	31.25	5	SNP	0.990	A
PTPRZ1	5803	genome.wustl.edu	37	7	121698936	121698936	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr7:121698936T>A	ENST00000393386.2	+	28	7022	c.6611T>A	c.(6610-6612)cTt>cAt	p.L2204H	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.L1337H	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	2204	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						ACTTTTGAACTTATAAGTGTT	0.373																																						dbGAP											0													104.0	110.0	108.0					7																	121698936		2203	4300	6503	-	-	-	SO:0001583	missense	0			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.6611T>A	7.37:g.121698936T>A	ENSP00000377047:p.Leu2204His		A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a	p.L2204H	ENST00000393386.2	37	c.6611	CCDS34740.1	7	.	.	.	.	.	.	.	.	.	.	T	26.5	4.741947	0.89573	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.14893	2.47;2.47	5.86	5.86	0.93980	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.186472	0.37857	N	0.001915	T	0.52075	0.1712	M	0.90922	3.16	0.51767	D	0.999939	D;D;D	0.89917	0.997;0.999;1.0	P;D;D	0.91635	0.874;0.992;0.999	T	0.63305	-0.6667	10	0.87932	D	0	.	16.2669	0.82588	0.0:0.0:0.0:1.0	.	1343;1337;2204	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	H	2204;1337	ENSP00000377047:L2204H;ENSP00000410000:L1337H	ENSP00000377047:L2204H	L	+	2	0	PTPRZ1	121486172	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.240000	0.73641	0.533000	0.62120	CTT	PTPRZ1	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000106278		0.373	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1	54	0.00	0	T	NM_002851		121698936	121698936	+1	no_errors	ENST00000393386	ensembl	human	known	69_37n	missense	57	14.93	10	SNP	1.000	A
RANBP3	8498	genome.wustl.edu	37	19	5918623	5918623	+	Silent	SNP	G	G	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr19:5918623G>A	ENST00000340578.6	-	15	1414	c.1357C>T	c.(1357-1359)Ctg>Ttg	p.L453L	RANBP3_ENST00000541471.1_Silent_p.L325L|RANBP3_ENST00000034275.8_Silent_p.L385L|RANBP3_ENST00000439268.2_Silent_p.L448L|RANBP3_ENST00000591092.1_Silent_p.L380L	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	453	RanBD1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						TTGAGGATCAGTCGCAGGCTC	0.617																																						dbGAP											0													133.0	150.0	145.0					19																	5918623		2132	4228	6360	-	-	-	SO:0001819	synonymous_variant	0			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.1357C>T	19.37:g.5918623G>A			B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Silent	SNP	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	p.L453	ENST00000340578.6	37	c.1357	CCDS42478.1	19																																																																																			RANBP3	-	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	ENSG00000031823		0.617	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RANBP3	HGNC	protein_coding	OTTHUMT00000452304.1	34	0.00	0	G	NM_007322		5918623	5918623	-1	no_errors	ENST00000340578	ensembl	human	known	69_37n	silent	17	52.78	19	SNP	1.000	A
RB1	5925	genome.wustl.edu	37	13	49039484	49039484	+	Frame_Shift_Del	DEL	A	A	-			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr13:49039484delA	ENST00000267163.4	+	23	2607	c.2469delA	c.(2467-2469)acafs	p.T823fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	823	Domain C; mediates interaction with E4F1.|Interaction with LIMD1.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(11)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CAACACCAACAAAAATGACTC	0.373		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												dbGAP	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	26	Whole gene deletion(15)|Unknown(11)	bone(11)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|lung(1)|liver(1)											61.0	64.0	63.0					13																	49039484		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2469delA	13.37:g.49039484delA	ENSP00000267163:p.Thr823fs		A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	pfam_Rb_C,pfam_RB_A,pfam_RB_B,pfam_DUF3452_retinoblatoma-assoc,superfamily_Cyclin-like,superfamily_FH2_actin-bd,smart_Cyclin-like	p.M825fs	ENST00000267163.4	37	c.2469	CCDS31973.1	13																																																																																			RB1	-	pfam_Rb_C	ENSG00000139687		0.373	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	60	0.00	0	A			49039484	49039484	+1	no_errors	ENST00000267163	ensembl	human	known	69_37n	frame_shift_del	26	50.94	27	DEL	0.998	-
RB1CC1	9821	genome.wustl.edu	37	8	53570383	53570383	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr8:53570383C>A	ENST00000025008.5	-	15	2529	c.2006G>T	c.(2005-2007)aGa>aTa	p.R669I	RB1CC1_ENST00000539297.1_Missense_Mutation_p.R669I|RB1CC1_ENST00000435644.2_Missense_Mutation_p.R669I|RB1CC1_ENST00000521611.1_Intron	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	669					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				TGGAGGAGTTCTCGGTGAGGT	0.443																																					GBM(180;1701 2102 13475 42023 52570)	dbGAP											0													79.0	79.0	79.0					8																	53570383		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.2006G>T	8.37:g.53570383C>A	ENSP00000025008:p.Arg669Ile		Q86YR4|Q8WVU9|Q92601	Missense_Mutation	SNP	pfam_Autophagy-rel_p11	p.R669I	ENST00000025008.5	37	c.2006	CCDS34892.1	8	.	.	.	.	.	.	.	.	.	.	C	12.49	1.953604	0.34471	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	T;T;T	0.16897	2.31;2.31;2.31	5.66	4.78	0.61160	.	0.102315	0.64402	D	0.000001	T	0.14700	0.0355	L	0.27053	0.805	0.47659	D	0.999487	B;B	0.32526	0.374;0.257	B;B	0.38616	0.277;0.143	T	0.06935	-1.0799	10	0.66056	D	0.02	-9.5849	8.719	0.34430	0.0:0.7699:0.0:0.2301	.	669;669	Q8TDY2-2;Q8TDY2	.;RBCC1_HUMAN	I	669	ENSP00000025008:R669I;ENSP00000396067:R669I;ENSP00000445960:R669I	ENSP00000025008:R669I	R	-	2	0	RB1CC1	53732936	1.000000	0.71417	0.899000	0.35326	0.857000	0.48899	1.443000	0.35057	1.489000	0.48450	0.655000	0.94253	AGA	RB1CC1	-	NULL	ENSG00000023287		0.443	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RB1CC1	HGNC	protein_coding	OTTHUMT00000378011.1	23	0.00	0	C	NM_014781		53570383	53570383	-1	no_errors	ENST00000025008	ensembl	human	known	69_37n	missense	12	40.00	8	SNP	1.000	A
RNF220	55182	genome.wustl.edu	37	1	45110399	45110399	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr1:45110399G>C	ENST00000355387.2	+	9	1606	c.1156G>C	c.(1156-1158)Gag>Cag	p.E386Q	TMEM53_ENST00000372244.3_Intron|RNF220_ENST00000372247.2_Missense_Mutation_p.E386Q|RNF220_ENST00000443020.2_Missense_Mutation_p.E173Q|TMEM53_ENST00000372242.3_Intron|RNF220_ENST00000480686.1_3'UTR|RNF220_ENST00000361799.2_Missense_Mutation_p.E386Q|TMEM53_ENST00000372243.3_Intron			Q5VTB9	RN220_HUMAN	ring finger protein 220	386					protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(1)|large_intestine(3)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	29						CAGCGGCAAAGAGAACCCGGA	0.602																																						dbGAP											0													116.0	107.0	110.0					1																	45110399		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056424	CCDS510.1	1p34.1	2008-06-13	2008-06-13	2008-06-13	ENSG00000187147	ENSG00000187147		"""RING-type (C3HC4) zinc fingers"""	25552	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 164"""	C1orf164		11042152	Standard	NM_018150		Approved	FLJ10597	uc001clv.1	Q5VTB9	OTTHUMG00000007697	ENST00000355387.2:c.1156G>C	1.37:g.45110399G>C	ENSP00000347548:p.Glu386Gln		B3KPJ3|B4DLZ9|E9PCS1|Q4KMX2|Q9NVP6	Missense_Mutation	SNP	superfamily_Peptidase_M20_dimer,pfscan_Znf_RING	p.E386Q	ENST00000355387.2	37	c.1156	CCDS510.1	1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.925930	0.52759	.	.	ENSG00000187147	ENST00000355387;ENST00000361799;ENST00000453887;ENST00000372247;ENST00000443020;ENST00000440132;ENST00000335497;ENST00000372248	D;D;D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43;-2.43;-2.43	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.92473	0.7610	L	0.50333	1.59	0.80722	D	1	D;D;P;D;D	0.65815	0.995;0.995;0.938;0.966;0.981	P;P;B;P;D	0.65140	0.886;0.886;0.368;0.462;0.932	D	0.90394	0.4397	10	0.32370	T	0.25	.	19.9677	0.97275	0.0:0.0:1.0:0.0	.	128;173;65;102;386	B4DJE2;B4DLZ9;D3DPZ1;C9JJY2;Q5VTB9	.;.;.;.;RN220_HUMAN	Q	386;386;386;386;173;102;128;128	ENSP00000347548:E386Q;ENSP00000354872:E386Q;ENSP00000361321:E386Q;ENSP00000414640:E173Q;ENSP00000388533:E102Q;ENSP00000335580:E128Q	ENSP00000335580:E128Q	E	+	1	0	RNF220	44882986	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.998000	0.93550	2.727000	0.93392	0.650000	0.86243	GAG	RNF220	-	NULL	ENSG00000187147		0.602	RNF220-001	KNOWN	basic|CCDS	protein_coding	RNF220	HGNC	protein_coding	OTTHUMT00000020683.4	37	0.00	0	G	NM_018150		45110399	45110399	+1	no_errors	ENST00000355387	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	1.000	C
SBF2	81846	genome.wustl.edu	37	11	10019855	10019856	+	Missense_Mutation	DNP	GA	GA	CC			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G|A	G|A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr11:10019855_10019856GA>CC	ENST00000256190.8	-	9	1069_1070	c.932_933TC>GG	c.(931-933)cTC>cGG	p.L311R	SBF2_ENST00000527019.1_Intron	NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	311					cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		GTGGTTCTGGGAGGGAAGAGAG	0.327																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.932_933delinsCC	11.37:g.10019855_10019856delinsCC	ENSP00000256190:p.Leu311Arg		Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Silent|Missense_Mutation	SNP	pfam_SBF2,pfam_DENN_dom,pfam_uDENN_dom,pfam_Myotub-related,pfam_dDENN_dom,pfam_Pleckstrin_homology,pfam_GRAM,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_GRAM,smart_Pleckstrin_homology,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_Pleckstrin_homology	p.L311|p.L311R	ENST00000256190.8	37	c.933|c.932	CCDS31427.1	11																																																																																			SBF2	-	NULL	ENSG00000133812		0.327	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SBF2	HGNC	protein_coding	OTTHUMT00000386911.2	58	0.00	0	G|A	NM_030962		10019855|10019856	10019855|10019856	-1	no_errors	ENST00000256190	ensembl	human	known	69_37n	silent|missense	26	33.33	13	SNP	1.000	C
SLC22A3	6581	genome.wustl.edu	37	6	160858218	160858218	+	Silent	SNP	C	C	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr6:160858218C>T	ENST00000275300.2	+	7	1415	c.1263C>T	c.(1261-1263)tgC>tgT	p.C421C	SLC22A3_ENST00000392145.1_Silent_p.C421C	NM_021977.3	NP_068812.1	O75751	S22A3_HUMAN	solute carrier family 22 (organic cation transporter), member 3	421					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|histamine uptake (GO:0051615)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|regulation of appetite (GO:0032098)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dopamine transmembrane transporter activity (GO:0005329)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|toxin transporter activity (GO:0019534)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)	Adefovir Dipivoxil(DB00718)|Amphetamine(DB00182)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Colchicine(DB01394)|Desipramine(DB01151)|Dopamine(DB00988)|Estradiol(DB00783)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imipramine(DB00458)|Irinotecan(DB00762)|Lamivudine(DB00709)|Melphalan(DB01042)|Metformin(DB00331)|Methamphetamine(DB01577)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Phenoxybenzamine(DB00925)|Prazosin(DB00457)|Procainamide(DB01035)|Progesterone(DB00396)|Testosterone(DB00624)|Vincristine(DB00541)	GGGTGGCATGCCTTGTCACTG	0.507																																						dbGAP											0													112.0	115.0	114.0					6																	160858218		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF078749	CCDS5277.1	6q25.3	2013-07-18	2013-07-18		ENSG00000146477	ENSG00000146477		"""Solute carriers"""	10967	protein-coding gene	gene with protein product		604842	"""solute carrier family 22 (extraneuronal monoamine transporter), member 3"""			9632645, 9933568	Standard	NM_021977		Approved	OCT3, EMT	uc003qti.4	O75751	OTTHUMG00000015953	ENST00000275300.2:c.1263C>T	6.37:g.160858218C>T			Q5SYN6|Q9UP02	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.C421	ENST00000275300.2	37	c.1263	CCDS5277.1	6																																																																																			SLC22A3	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000146477		0.507	SLC22A3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC22A3	HGNC	protein_coding	OTTHUMT00000042953.1	32	0.00	0	C	NM_021977		160858218	160858218	+1	no_errors	ENST00000392145	ensembl	human	known	69_37n	silent	18	26.92	7	SNP	0.996	T
SLC26A10	65012	genome.wustl.edu	37	12	58018918	58018918	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr12:58018918C>T	ENST00000320442.4	+	11	1668	c.1357C>T	c.(1357-1359)Cca>Tca	p.P453S	SLC26A10_ENST00000490243.1_3'UTR|SLC26A10_ENST00000379218.2_3'UTR	NM_133489.2	NP_597996.2	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	453	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.					integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)	19	Melanoma(17;0.122)					GACTTCAAAGCCAGATGGCCC	0.517																																						dbGAP											0													268.0	259.0	262.0					12																	58018918		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8949.2	12q13	2013-07-18			ENSG00000135502	ENSG00000135502		"""Solute carriers"""	14470	protein-coding gene	gene with protein product							Standard	NM_133489		Approved		uc001spe.3	Q8NG04	OTTHUMG00000128505	ENST00000320442.4:c.1357C>T	12.37:g.58018918C>T	ENSP00000320217:p.Pro453Ser		A6NMJ2|B6ZDQ3|Q6ZWI7	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom	p.P453S	ENST00000320442.4	37	c.1357	CCDS8949.2	12	.	.	.	.	.	.	.	.	.	.	.	0.057	-1.234664	0.01505	.	.	ENSG00000135502	ENST00000320442	D	0.92699	-3.09	4.59	-2.41	0.06562	Sulphate transporter/antisigma-factor antagonist STAS (4);	.	.	.	.	T	0.72423	0.3458	N	0.02011	-0.69	0.09310	N	1	B	0.10296	0.003	B	0.14023	0.01	T	0.64373	-0.6423	9	0.09084	T	0.74	.	4.4737	0.11724	0.1504:0.4306:0.3302:0.0888	.	453	Q8NG04	S2610_HUMAN	S	453	ENSP00000320217:P453S	ENSP00000320217:P453S	P	+	1	0	SLC26A10	56305185	0.024000	0.19004	0.011000	0.14972	0.003000	0.03518	-0.045000	0.12003	-0.384000	0.07845	-0.304000	0.09214	CCA	SLC26A10	-	pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom	ENSG00000135502		0.517	SLC26A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A10	HGNC	protein_coding	OTTHUMT00000250311.2	81	0.00	0	C			58018918	58018918	+1	no_errors	ENST00000320442	ensembl	human	known	69_37n	missense	57	26.92	21	SNP	0.000	T
SLC35A5	55032	genome.wustl.edu	37	3	112299994	112299994	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr3:112299994A>G	ENST00000492406.1	+	6	1313	c.1030A>G	c.(1030-1032)Aca>Gca	p.T344A	SLC35A5_ENST00000460713.1_3'UTR	NM_017945.2	NP_060415.1	Q9BS91	S35A5_HUMAN	solute carrier family 35, member A5	344					nucleotide-sugar transport (GO:0015780)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)|sugar:proton symporter activity (GO:0005351)			endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|skin(1)	11						TGTCATTATCACAACAGTGTC	0.438																																						dbGAP											0													74.0	71.0	72.0					3																	112299994		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK000737	CCDS2967.1	3q13.13	2013-05-22			ENSG00000138459	ENSG00000138459		"""Solute carriers"""	20792	protein-coding gene	gene with protein product							Standard	NM_017945		Approved	FLJ20730	uc003dze.4	Q9BS91	OTTHUMG00000159263	ENST00000492406.1:c.1030A>G	3.37:g.112299994A>G	ENSP00000417654:p.Thr344Ala		D3DN66|Q69YY6|Q6ZMD6|Q9NWM9	Missense_Mutation	SNP	pfam_Nuc_sug_transpt,pfam_UAA,pfam_DMT,pfam_DUF250,pirsf_UDP/CMP-sugar_transptr,tigrfam_UDPgal_transpt	p.T344A	ENST00000492406.1	37	c.1030	CCDS2967.1	3	.	.	.	.	.	.	.	.	.	.	A	12.61	1.990420	0.35131	.	.	ENSG00000138459	ENST00000492406	T	0.44881	0.91	5.77	5.77	0.91146	.	0.090176	0.85682	D	0.000000	T	0.39809	0.1092	L	0.55990	1.75	0.53688	D	0.999977	P	0.36683	0.565	B	0.33846	0.171	T	0.21008	-1.0258	9	.	.	.	-4.5181	16.3892	0.83528	1.0:0.0:0.0:0.0	.	344	Q9BS91	S35A5_HUMAN	A	344	ENSP00000417654:T344A	.	T	+	1	0	SLC35A5	113782684	1.000000	0.71417	0.995000	0.50966	0.980000	0.70556	6.973000	0.76116	2.330000	0.79161	0.477000	0.44152	ACA	SLC35A5	-	pfam_Nuc_sug_transpt,pfam_UAA,pirsf_UDP/CMP-sugar_transptr,tigrfam_UDPgal_transpt	ENSG00000138459		0.438	SLC35A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35A5	HGNC	protein_coding	OTTHUMT00000354184.1	41	0.00	0	A	NM_017945		112299994	112299994	+1	no_errors	ENST00000492406	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	1.000	G
SLITRK6	84189	genome.wustl.edu	37	13	86369992	86369992	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr13:86369992T>A	ENST00000400286.2	-	2	1250	c.652A>T	c.(652-654)Aac>Tac	p.N218Y		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	218	LRRCT 1.				adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		GCCCATTTGTTGTCCTCCAAC	0.413																																						dbGAP											0													86.0	78.0	80.0					13																	86369992		1887	4106	5993	-	-	-	SO:0001583	missense	0			AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.652A>T	13.37:g.86369992T>A	ENSP00000383143:p.Asn218Tyr		A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.N218Y	ENST00000400286.2	37	c.652	CCDS41903.1	13	.	.	.	.	.	.	.	.	.	.	T	17.78	3.473993	0.63737	.	.	ENSG00000184564	ENST00000400286	T	0.66099	-0.19	5.96	5.96	0.96718	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83714	0.5314	M	0.93763	3.455	0.58432	D	0.999999	D	0.89917	1.0	D	0.69307	0.963	D	0.87980	0.2742	10	0.87932	D	0	-23.9933	15.2725	0.73717	0.0:0.0:0.0:1.0	.	218	Q9H5Y7	SLIK6_HUMAN	Y	218	ENSP00000383143:N218Y	ENSP00000383143:N218Y	N	-	1	0	SLITRK6	85267993	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	2.285000	0.76669	0.533000	0.62120	AAC	SLITRK6	-	smart_Cys-rich_flank_reg_C	ENSG00000184564		0.413	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK6	HGNC	protein_coding	OTTHUMT00000045404.2	16	0.00	0	T	NM_032229		86369992	86369992	-1	no_errors	ENST00000400286	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	1.000	A
TIAL1	7073	genome.wustl.edu	37	10	121347702	121347702	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr10:121347702G>C	ENST00000436547.2	-	2	135	c.91C>G	c.(91-93)Cag>Gag	p.Q31E	TIAL1_ENST00000369093.2_Missense_Mutation_p.Q31E|TIAL1_ENST00000369092.4_5'UTR	NM_003252.3	NP_003243.1	Q01085	TIAR_HUMAN	TIA1 cytotoxic granule-associated RNA binding protein-like 1	31	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|defense response (GO:0006952)|germ cell development (GO:0007281)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell division (GO:0017145)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(3)|ovary(1)	13		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00239)|BRCA - Breast invasive adenocarcinoma(275;0.0932)		GGTCCAATCTGACTGAACAAC	0.373																																						dbGAP											0													117.0	106.0	110.0					10																	121347702		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833106	CCDS7613.1, CCDS31295.1	10q	2013-02-12	2001-11-28		ENSG00000151923	ENSG00000151923		"""RNA binding motif (RRM) containing"""	11804	protein-coding gene	gene with protein product		603413	"""TIA1 cytotoxic granule-associated RNA-binding protein-like 1"""			1326761	Standard	XM_005270108		Approved	TIAR	uc001lej.1	Q01085	OTTHUMG00000019156	ENST00000436547.2:c.91C>G	10.37:g.121347702G>C	ENSP00000394902:p.Gln31Glu		A8K3T0|A8K4L9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.Q31E	ENST00000436547.2	37	c.91	CCDS7613.1	10	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025284	0.93518	.	.	ENSG00000151923	ENST00000369093;ENST00000436547	T;T	0.15487	2.42;2.42	5.71	5.71	0.89125	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.121996	0.64402	D	0.000020	T	0.30759	0.0775	N	0.25957	0.775	0.80722	D	1	P;D	0.59357	0.734;0.985	P;D	0.64506	0.839;0.926	T	0.01087	-1.1456	10	0.49607	T	0.09	-8.6178	20.2175	0.98301	0.0:0.0:1.0:0.0	.	31;31	A8K4L9;Q01085	.;TIAR_HUMAN	E	31	ENSP00000358089:Q31E;ENSP00000394902:Q31E	ENSP00000358089:Q31E	Q	-	1	0	TIAL1	121337692	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.731000	0.98807	2.850000	0.98022	0.655000	0.94253	CAG	TIAL1	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	ENSG00000151923		0.373	TIAL1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAL1	HGNC	protein_coding	OTTHUMT00000050672.2	52	0.00	0	G	NM_022333, NM_003252		121347702	121347702	-1	no_errors	ENST00000369093	ensembl	human	known	69_37n	missense	28	31.71	13	SNP	1.000	C
TMCC1	23023	genome.wustl.edu	37	3	129389639	129389639	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr3:129389639C>G	ENST00000393238.3	-	4	1385	c.1045G>C	c.(1045-1047)Ggt>Cgt	p.G349R	TMCC1_ENST00000329333.5_Missense_Mutation_p.G170R|TMCC1_ENST00000432054.2_Missense_Mutation_p.G25R|TMCC1_ENST00000426664.2_Missense_Mutation_p.G235R	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	349						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						GAAAACCCACCTTTGACACTA	0.537																																						dbGAP											0													102.0	96.0	98.0					3																	129389639		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1045G>C	3.37:g.129389639C>G	ENSP00000376930:p.Gly349Arg		A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	pfam_Predicted_TM_coiled-coil_2	p.G349R	ENST00000393238.3	37	c.1045	CCDS33855.1	3	.	.	.	.	.	.	.	.	.	.	C	23.7	4.450905	0.84209	.	.	ENSG00000172765	ENST00000432054;ENST00000393238;ENST00000426664;ENST00000329333	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.66277	0.2773	M	0.80028	2.48	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.60296	-0.7291	10	0.14252	T	0.57	-17.1859	19.8814	0.96900	0.0:1.0:0.0:0.0	.	170;349	B4DE04;O94876	.;TMCC1_HUMAN	R	25;349;235;170	ENSP00000404711:G25R;ENSP00000376930:G349R;ENSP00000389892:G235R;ENSP00000327349:G170R	ENSP00000327349:G170R	G	-	1	0	TMCC1	130872329	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.629000	0.83207	2.778000	0.95560	0.591000	0.81541	GGT	TMCC1	-	pfam_Predicted_TM_coiled-coil_2	ENSG00000172765		0.537	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCC1	HGNC	protein_coding	OTTHUMT00000356418.2	47	0.00	0	C	NM_015008		129389639	129389639	-1	no_errors	ENST00000393238	ensembl	human	known	69_37n	missense	28	31.71	13	SNP	1.000	G
TRPM2	7226	genome.wustl.edu	37	21	45843548	45843548	+	Missense_Mutation	SNP	T	T	G			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr21:45843548T>G	ENST00000397928.1	+	23	3927	c.3482T>G	c.(3481-3483)cTg>cGg	p.L1161R	TRPM2_ENST00000498430.1_3'UTR|AP001065.2_ENST00000423310.1_RNA|TRPM2_ENST00000300482.5_Missense_Mutation_p.L1161R|TRPM2_ENST00000397932.2_Missense_Mutation_p.L1211R|TRPM2_ENST00000300481.9_Missense_Mutation_p.L1141R	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	1161					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						ATGGTGGACCTGCTGGACCTG	0.657																																						dbGAP											0													77.0	52.0	60.0					21																	45843548		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.3482T>G	21.37:g.45843548T>G	ENSP00000381023:p.Leu1161Arg		D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	pfam_Ion_trans_dom,superfamily_NUDIX_hydrolase_dom-like	p.L1161R	ENST00000397928.1	37	c.3482	CCDS13710.1	21	.	.	.	.	.	.	.	.	.	.	T	12.22	1.872754	0.33069	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.77620	1.67;1.67;1.67;-1.11	4.13	2.91	0.33838	.	0.378221	0.22054	N	0.065280	T	0.64789	0.2630	L	0.45352	1.415	0.40646	D	0.98199	B;B;B	0.32693	0.256;0.38;0.136	B;B;B	0.28553	0.043;0.091;0.031	T	0.56998	-0.7886	10	0.22706	T	0.39	-10.176	8.5284	0.33319	0.1731:0.0:0.0:0.8269	.	1211;947;1161	E9PGK7;Q5KTC1;O94759	.;.;TRPM2_HUMAN	R	1161;1161;1141;1211	ENSP00000300482:L1161R;ENSP00000381023:L1161R;ENSP00000300481:L1141R;ENSP00000381026:L1211R	ENSP00000300481:L1141R	L	+	2	0	TRPM2	44667976	0.976000	0.34144	0.999000	0.59377	0.850000	0.48378	1.810000	0.38932	0.661000	0.30985	0.377000	0.23210	CTG	TRPM2	-	NULL	ENSG00000142185		0.657	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	HGNC	protein_coding	OTTHUMT00000098086.1	20	0.00	0	T	NM_003307		45843548	45843548	+1	no_errors	ENST00000300482	ensembl	human	known	69_37n	missense	17	32.00	8	SNP	0.993	G
TSPAN32	10077	genome.wustl.edu	37	11	2337855	2337855	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr11:2337855G>C	ENST00000182290.4	+	8	814	c.677G>C	c.(676-678)gGc>gCc	p.G226A	TSPAN32_ENST00000381121.3_Missense_Mutation_p.G226A|TSPAN32_ENST00000451520.2_Missense_Mutation_p.G215A	NM_139022.2	NP_620591.3	Q96QS1	TSN32_HUMAN	tetraspanin 32	226					cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|defense response to protozoan (GO:0042832)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid dendritic cell activation (GO:0030886)|platelet aggregation (GO:0070527)|regulation of defense response to virus (GO:0050688)	cell surface (GO:0009986)|integrin alphaIIb-beta3 complex (GO:0070442)|intracellular (GO:0005622)				breast(1)|central_nervous_system(1)|lung(4)|ovary(1)|skin(1)	8		all_epithelial(84;4.89e-05)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.00791)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000533)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		ATCCGCTGTGGCTGCAGCTTG	0.682																																						dbGAP											0													112.0	90.0	98.0					11																	2337855		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF176070	CCDS7733.1	11p15	2013-02-14	2005-08-16	2005-08-16	ENSG00000064201	ENSG00000064201		"""Tetraspanins"""	13410	protein-coding gene	gene with protein product		603853	"""pan-hematopoietic expression"""	TSSC6, PHEMX		10072438, 10950922	Standard	NM_139022		Approved		uc001lvy.1	Q96QS1	OTTHUMG00000009762	ENST00000182290.4:c.677G>C	11.37:g.2337855G>C	ENSP00000182290:p.Gly226Ala		Q96KX4|Q9HC50|Q9HC51|Q9Y5U1	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	p.G226A	ENST00000182290.4	37	c.677	CCDS7733.1	11	.	.	.	.	.	.	.	.	.	.	.	8.395	0.840631	0.16891	.	.	ENSG00000064201	ENST00000182290;ENST00000381121;ENST00000451520;ENST00000444307;ENST00000381117	T;T;T	0.45668	0.91;0.94;0.89	3.62	1.63	0.23807	.	0.998383	0.08103	U	0.997391	T	0.45736	0.1357	N	0.21448	0.665	0.09310	N	1	D;D;D;D	0.89917	1.0;0.994;0.986;0.995	D;D;P;D	0.75484	0.986;0.909;0.737;0.945	T	0.32214	-0.9915	10	0.49607	T	0.09	-6.1362	4.8677	0.13616	0.3052:0.0:0.6948:0.0	.	215;171;226;226	D3YTD1;G3XAG6;Q96QS1-3;Q96QS1	.;.;.;TSN32_HUMAN	A	226;226;215;162;171	ENSP00000182290:G226A;ENSP00000370513:G226A;ENSP00000405205:G215A	ENSP00000182290:G226A	G	+	2	0	TSPAN32	2294431	0.002000	0.14202	0.004000	0.12327	0.002000	0.02628	1.143000	0.31553	0.628000	0.30357	0.462000	0.41574	GGC	TSPAN32	-	NULL	ENSG00000064201		0.682	TSPAN32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSPAN32	HGNC	protein_coding	OTTHUMT00000026912.2	37	0.00	0	G	NM_139024		2337855	2337855	+1	no_errors	ENST00000182290	ensembl	human	known	69_37n	missense	13	43.48	10	SNP	0.003	C
TRPM5	29850	genome.wustl.edu	37	11	2439002	2439002	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr11:2439002C>T	ENST00000155858.6	-	7	972	c.964G>A	c.(964-966)Ggc>Agc	p.G322S	TRPM5_ENST00000452833.1_Missense_Mutation_p.G324S|TRPM5_ENST00000533060.1_Missense_Mutation_p.G322S|TRPM5_ENST00000528453.1_Missense_Mutation_p.G322S	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		TCCTCGGAGCCCTCCTGCTCG	0.647																																					NSCLC(1;49 61 17205 18850 43201)	dbGAP											0													36.0	33.0	34.0					11																	2439002		2193	4295	6488	-	-	-	SO:0001583	missense	0			AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.964G>A	11.37:g.2439002C>T	ENSP00000155858:p.Gly322Ser			Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom	p.G324S	ENST00000155858.6	37	c.970	CCDS31340.1	11	.	.	.	.	.	.	.	.	.	.	C	12.82	2.052626	0.36181	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453;ENST00000437542	T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41	3.92	2.97	0.34412	.	0.581665	0.13237	N	0.403124	T	0.25344	0.0616	L	0.35542	1.07	0.26097	N	0.980877	B;B;P	0.34909	0.121;0.121;0.475	B;B;B	0.38500	0.161;0.161;0.275	T	0.13469	-1.0508	10	0.49607	T	0.09	-17.8551	8.7582	0.34658	0.0:0.8092:0.0:0.1908	.	322;324;322	E9PRW0;Q9NZQ8-2;Q9NZQ8	.;.;TRPM5_HUMAN	S	316;322;324;322;322;322	ENSP00000434383:G316S;ENSP00000155858:G322S;ENSP00000387965:G324S;ENSP00000434121:G322S;ENSP00000436809:G322S	ENSP00000155858:G322S	G	-	1	0	TRPM5	2395578	0.560000	0.26570	0.997000	0.53966	0.574000	0.36063	1.557000	0.36299	1.909000	0.55274	0.313000	0.20887	GGC	TRPM5	-	NULL	ENSG00000070985		0.647	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPM5	HGNC	protein_coding	OTTHUMT00000027378.1	25	0.00	0	C	NM_014555		2439002	2439002	-1	no_errors	ENST00000452833	ensembl	human	known	69_37n	missense	12	29.41	5	SNP	0.817	T
CFAP46	54777	genome.wustl.edu	37	10	134754565	134754565	+	Splice_Site	SNP	C	C	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr10:134754565C>A	ENST00000368586.5	-	4	407		c.e4-1		RP13-137A17.4_ENST00000443633.1_lincRNA|TTC40_ENST00000368585.3_Splice_Site|TTC40_ENST00000368582.2_Splice_Site	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CAAATTCCTCCTAAGGCAACA	0.502											OREG0020643	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													140.0	131.0	134.0					10																	134754565		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0																														ENST00000368586.5:c.307-1G>T	10.37:g.134754565C>A		1613		Splice_Site	SNP	-	e4-1	ENST00000368586.5	37	c.307-1	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	C	12.00	1.805939	0.31961	.	.	ENSG00000171811	ENST00000368586;ENST00000368582;ENST00000368585	.	.	.	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5854	0.76479	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C10orf93	134604555	1.000000	0.71417	0.993000	0.49108	0.281000	0.26958	3.988000	0.56951	2.507000	0.84556	0.549000	0.68633	.	TTC40	-	-	ENSG00000171811		0.502	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	56	0.00	0	C		Intron	134754565	134754565	-1	no_errors	ENST00000368582	ensembl	human	known	69_37n	splice_site	52	25.71	18	SNP	1.000	A
TYMS	7298	genome.wustl.edu	37	18	670739	670739	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr18:670739T>C	ENST00000323274.10	+	5	743	c.604T>C	c.(604-606)Tat>Cat	p.Y202H	TYMS_ENST00000323250.5_Missense_Mutation_p.Y119H|TYMS_ENST00000323224.7_Missense_Mutation_p.Y168H|TYMS_ENST00000581920.1_3'UTR	NM_001071.2	NP_001062.1	P04818	TYSY_HUMAN	thymidylate synthetase	202					aging (GO:0007568)|cartilage development (GO:0051216)|circadian rhythm (GO:0007623)|deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|developmental growth (GO:0048589)|dTMP biosynthetic process (GO:0006231)|dTTP biosynthetic process (GO:0006235)|dUMP metabolic process (GO:0046078)|G1/S transition of mitotic cell cycle (GO:0000082)|immortalization of host cell by virus (GO:0019088)|intestinal epithelial cell maturation (GO:0060574)|mitotic cell cycle (GO:0000278)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|organ regeneration (GO:0031100)|polysaccharide metabolic process (GO:0005976)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to organophosphorus (GO:0046683)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|response to vitamin A (GO:0033189)|small molecule metabolic process (GO:0044281)|tetrahydrofolate metabolic process (GO:0046653)|uracil metabolic process (GO:0019860)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cofactor binding (GO:0048037)|drug binding (GO:0008144)|folic acid binding (GO:0005542)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|thymidylate synthase activity (GO:0004799)			endometrium(1)|large_intestine(3)|lung(2)|urinary_tract(2)	8					Capecitabine(DB01101)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Leucovorin(DB00650)|Methotrexate(DB00563)|Pemetrexed(DB00642)|Pralatrexate(DB06813)|Raltitrexed(DB00293)|Trifluridine(DB00432)|Trimethoprim(DB00440)	CTGCCAGTTCTATGTGGTGAA	0.562																																						dbGAP											0													163.0	136.0	145.0					18																	670739		2203	4300	6503	-	-	-	SO:0001583	missense	0			X02308	CCDS11821.1	18p11.31-p11.21	2014-09-17			ENSG00000176890	ENSG00000176890	2.1.1.45		12441	protein-coding gene	gene with protein product		188350		TS			Standard	NM_001071		Approved	Tsase, TMS, HsT422	uc010dka.1	P04818	OTTHUMG00000131473	ENST00000323274.10:c.604T>C	18.37:g.670739T>C	ENSP00000315644:p.Tyr202His		Q8WYK3|Q8WYK4	Missense_Mutation	SNP	pfam_Thymidylate_synthase,superfamily_Thymidate_synth/dCMP_Mease,prints_Thymidylate_synthase,tigrfam_Thymidylate_synthase	p.Y202H	ENST00000323274.10	37	c.604	CCDS11821.1	18	.	.	.	.	.	.	.	.	.	.	T	22.3	4.273324	0.80580	.	.	ENSG00000176890	ENST00000323274;ENST00000323224;ENST00000323250	.	.	.	5.86	5.86	0.93980	Thymidylate synthase/dCMP hydroxymethylase domain (2);	0.000000	0.85682	D	0.000000	T	0.79233	0.4411	M	0.76328	2.33	0.80722	D	1	P;D;P	0.89917	0.911;1.0;0.939	P;D;P	0.80764	0.839;0.994;0.864	T	0.81497	-0.0906	9	0.72032	D	0.01	-19.2266	16.2421	0.82418	0.0:0.0:0.0:1.0	.	119;168;202	Q8WYK4;Q8WYK3;P04818	.;.;TYSY_HUMAN	H	202;168;119	.	ENSP00000314727:Y168H	Y	+	1	0	TYMS	660739	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	7.871000	0.87180	2.239000	0.73571	0.460000	0.39030	TAT	TYMS	-	pfam_Thymidylate_synthase,superfamily_Thymidate_synth/dCMP_Mease,prints_Thymidylate_synthase,tigrfam_Thymidylate_synthase	ENSG00000176890		0.562	TYMS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYMS	HGNC	protein_coding	OTTHUMT00000254316.1	32	0.00	0	T	NM_001071		670739	670739	+1	no_errors	ENST00000323274	ensembl	human	known	69_37n	missense	27	30.77	12	SNP	1.000	C
UHRF1BP1L	23074	genome.wustl.edu	37	12	100496589	100496589	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr12:100496589C>G	ENST00000279907.7	-	4	505	c.293G>C	c.(292-294)aGa>aCa	p.R98T	UHRF1BP1L_ENST00000356828.3_Missense_Mutation_p.R98T	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	98										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						ATTAGGGCTTCTTGGTTCTTC	0.323																																						dbGAP											0													166.0	148.0	154.0					12																	100496589		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.293G>C	12.37:g.100496589C>G	ENSP00000279907:p.Arg98Thr		A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	NULL	p.R98T	ENST00000279907.7	37	c.293	CCDS31882.1	12	.	.	.	.	.	.	.	.	.	.	C	20.6	4.025673	0.75390	.	.	ENSG00000111647	ENST00000279907;ENST00000356828	T;T	0.33438	2.72;1.41	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.60025	0.2237	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	0.989;1.0	D;D	0.97110	0.985;1.0	T	0.66212	-0.5980	10	0.72032	D	0.01	-8.0169	18.2834	0.90105	0.0:1.0:0.0:0.0	.	98;98	A0JNW5-2;A0JNW5	.;UH1BL_HUMAN	T	98	ENSP00000279907:R98T;ENSP00000349285:R98T	ENSP00000279907:R98T	R	-	2	0	UHRF1BP1L	99020720	1.000000	0.71417	0.520000	0.27837	0.545000	0.35147	7.530000	0.81962	2.312000	0.78011	0.591000	0.81541	AGA	UHRF1BP1L	-	NULL	ENSG00000111647		0.323	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1L	HGNC	protein_coding	OTTHUMT00000407875.1	89	0.00	0	C	NM_001006947		100496589	100496589	-1	no_errors	ENST00000279907	ensembl	human	known	69_37n	missense	76	35.83	43	SNP	0.983	G
CFAP44	55779	genome.wustl.edu	37	3	113098230	113098230	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr3:113098230C>T	ENST00000295868.2	-	17	2383	c.2221G>A	c.(2221-2223)Gaa>Aaa	p.E741K	WDR52_ENST00000475568.1_5'Flank|WDR52_ENST00000393845.2_Missense_Mutation_p.E741K	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						ATAAATATTTCAGGTAATGGc	0.438																																						dbGAP											0													89.0	88.0	88.0					3																	113098230		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000295868.2:c.2221G>A	3.37:g.113098230C>T	ENSP00000295868:p.Glu741Lys			Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E741K	ENST00000295868.2	37	c.2221	CCDS2972.1	3	.	.	.	.	.	.	.	.	.	.	C	4.623	0.115740	0.08831	.	.	ENSG00000206530	ENST00000393845;ENST00000295868	T;T	0.16743	2.32;2.32	5.42	0.292	0.15737	WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.16685	0.0401	L	0.58101	1.795	0.09310	N	1	B	0.15473	0.013	B	0.10450	0.005	T	0.24657	-1.0154	9	0.35671	T	0.21	.	8.9991	0.36069	0.1103:0.2838:0.5399:0.066	.	741	Q96MT7	WDR52_HUMAN	K	741	ENSP00000377428:E741K;ENSP00000295868:E741K	ENSP00000295868:E741K	E	-	1	0	WDR52	114580920	0.002000	0.14202	0.005000	0.12908	0.002000	0.02628	-0.004000	0.12878	-0.117000	0.11872	-0.300000	0.09419	GAA	WDR52	-	superfamily_WD40_repeat_dom	ENSG00000206530		0.438	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR52	HGNC	protein_coding	OTTHUMT00000354128.3	42	0.00	0	C			113098230	113098230	-1	no_errors	ENST00000393845	ensembl	human	known	69_37n	missense	30	25.00	10	SNP	0.002	T
XPC	7508	genome.wustl.edu	37	3	14219966	14219968	+	Splice_Site	DEL	CCT	CCT	-	rs72561774	byFrequency	TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	CCT	CCT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr3:14219966_14219968delCCT	ENST00000285021.7	-	1	315_317	c.101_103delAGG	c.(100-105)gaggat>gat	p.E34del	LSM3_ENST00000306024.3_5'UTR|XPC_ENST00000449060.2_Splice_Site_p.E34del	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	34	Glu-rich (acidic).|Poly-Glu.				DNA repair (GO:0006281)|intra-S DNA damage checkpoint (GO:0031573)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to drug (GO:0042493)|response to UV-B (GO:0010224)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|XPC complex (GO:0071942)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|heteroduplex DNA loop binding (GO:0000404)|single-stranded DNA binding (GO:0003697)	p.E34delE(1)		NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCGCTCTCACCCTCCTCCTCCTC	0.734			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													dbGAP	yes	Rec		Xeroderma pigmentosum (C)	3	3p25	7508	"""xeroderma pigmentosum, complementation group C"""		E	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)							,	315,1,3348		29,0,257,0,1,1545					,	5.2	1.0			23	706,1,7113		33,0,640,0,1,3236	no	codingComplex-near-splice,codingComplex-near-splice	XPC	NM_004628.4,NM_001145769.1	,	62,0,897,0,2,4781	A1A1,A1A2,A1R,A2A2,A2R,RR		9.0409,8.6245,8.908	,	,		1021,2,10461				-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS46763.1	3p25.1	2014-09-17			ENSG00000154767	ENSG00000154767			12816	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group C protein"""	613208				1522891	Standard	NM_004628		Approved	XPCC, RAD4	uc011ave.2	Q01831	OTTHUMG00000155526	ENST00000285021.7:c.103+1AGG>-	3.37:g.14219975_14219977delCCT			B4DIP3|E9PB96|E9PH69|Q53GT7|Q96AX0	In_Frame_Del	DEL	pfam_Rad4/PNGase_transGLS-fold,pfam_Rad4_beta-hairpin_dom3,pfam_Rad4_beta-hairpin_dom2,pfam_Rad4_beta-hairpin_dom1,tigrfam_DNA_repair_Rad4_subgr	p.E34in_frame_del	ENST00000285021.7	37	c.103_101	CCDS46763.1	3																																																																																			XPC	-	NULL	ENSG00000154767		0.734	XPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XPC	HGNC	protein_coding	OTTHUMT00000340517.3	11	0.00	0	CCT	NM_004628	In_Frame_Del	14219966	14219968	-1	no_errors	ENST00000285021	ensembl	human	known	69_37n	in_frame_del	5	28.57	2	DEL	0.927:0.902:0.864	-
CFAP44	55779	genome.wustl.edu	37	3	113122794	113122794	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr3:113122794G>A	ENST00000295868.2	-	9	1237	c.1075C>T	c.(1075-1077)Cga>Tga	p.R359*	WDR52-AS1_ENST00000498480.1_RNA|WDR52-AS1_ENST00000473329.1_RNA|WDR52_ENST00000393845.2_Nonsense_Mutation_p.R359*	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						CTTGTCCCTCGACAGAGCTCC	0.473																																						dbGAP											0													244.0	217.0	226.0					3																	113122794		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0																														ENST00000295868.2:c.1075C>T	3.37:g.113122794G>A	ENSP00000295868:p.Arg359*			Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R359*	ENST00000295868.2	37	c.1075	CCDS2972.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.131220	0.94473	.	.	ENSG00000206530	ENST00000393845;ENST00000295868	.	.	.	4.8	3.9	0.45041	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.6332	0.68671	0.0:0.0:0.8533:0.1467	.	.	.	.	X	359	.	ENSP00000295868:R359X	R	-	1	2	WDR52	114605484	1.000000	0.71417	0.961000	0.40146	0.530000	0.34684	4.841000	0.62824	1.328000	0.45358	0.561000	0.74099	CGA	WDR52	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000206530		0.473	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR52	HGNC	protein_coding	OTTHUMT00000354128.3	58	0.00	0	G			113122794	113122794	-1	no_errors	ENST00000393845	ensembl	human	known	69_37n	nonsense	38	43.28	29	SNP	1.000	A
ZBTB20	26137	genome.wustl.edu	37	3	114069881	114069881	+	Silent	SNP	C	C	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr3:114069881C>T	ENST00000474710.1	-	4	1222	c.1044G>A	c.(1042-1044)ctG>ctA	p.L348L	ZBTB20_ENST00000462705.1_Silent_p.L275L|ZBTB20-AS1_ENST00000467304.1_RNA|ZBTB20_ENST00000393785.2_Silent_p.L275L|ZBTB20_ENST00000357258.3_Silent_p.L275L|ZBTB20_ENST00000464560.1_Silent_p.L275L|ZBTB20_ENST00000471418.1_Silent_p.L275L|ZBTB20_ENST00000481632.1_Silent_p.L275L|ZBTB20-AS1_ENST00000475939.1_RNA|ZBTB20-AS1_ENST00000496219.1_RNA	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	348						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		CGTTGCGTTCCAGGATCTGCA	0.597																																					NSCLC(69;748 1344 9802 11203 30933)	dbGAP											0													131.0	93.0	106.0					3																	114069881		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.1044G>A	3.37:g.114069881C>T			Q63HP6|Q8N6R5|Q9Y410	Silent	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.L348	ENST00000474710.1	37	c.1044	CCDS54626.1	3																																																																																			ZBTB20	-	NULL	ENSG00000181722		0.597	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	ZBTB20	HGNC	protein_coding	OTTHUMT00000354951.1	28	0.00	0	C	NM_015642		114069881	114069881	-1	no_errors	ENST00000474710	ensembl	human	known	69_37n	silent	23	34.29	12	SNP	1.000	T
ZBTB8OS	339487	genome.wustl.edu	37	1	33099280	33099280	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr1:33099280T>C	ENST00000468695.1	-	4	347	c.329A>G	c.(328-330)tAt>tGt	p.Y110C	ZBTB8OS_ENST00000373501.2_Missense_Mutation_p.Y98C|ZBTB8OS_ENST00000341885.5_Intron|ZBTB8OS_ENST00000492007.1_Intron	NM_178547.2	NP_848642.1	Q8IWT0	ARCH_HUMAN	zinc finger and BTB domain containing 8 opposite strand	98					tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	extracellular vesicular exosome (GO:0070062)|tRNA-splicing ligase complex (GO:0072669)	metal ion binding (GO:0046872)			endometrium(1)|lung(4)|upper_aerodigestive_tract(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				ACTGAACTTATAAAGCCATTC	0.318																																						dbGAP											0													55.0	58.0	57.0					1																	33099280		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY151084	CCDS365.1	1p35.1	2010-09-30			ENSG00000176261	ENSG00000176261			24094	protein-coding gene	gene with protein product	"""archease"""	615891				12477932	Standard	NM_178547		Approved	ARCH	uc001bvp.3	Q8IWT0	OTTHUMG00000007856	ENST00000468695.1:c.329A>G	1.37:g.33099280T>C	ENSP00000417677:p.Tyr110Cys		Q5TGK5|Q6PDA1|Q8IWS9|Q8NEV6|Q8NEV7	Missense_Mutation	SNP	pfam_Archease_dom,superfamily_Archease_dom	p.Y110C	ENST00000468695.1	37	c.329	CCDS365.1	1	.	.	.	.	.	.	.	.	.	.	T	18.15	3.559262	0.65538	.	.	ENSG00000176261	ENST00000468695;ENST00000373501	.	.	.	5.4	5.4	0.78164	.	0.111045	0.64402	D	0.000005	T	0.78585	0.4306	M	0.77103	2.36	0.48236	D	0.999615	P;D	0.76494	0.94;0.999	P;D	0.69479	0.565;0.964	T	0.81775	-0.0778	9	0.87932	D	0	-17.2448	14.9121	0.70767	0.0:0.0:0.0:1.0	.	98;110	Q8IWT0-2;A8K0B5	.;.	C	110;98	.	ENSP00000362600:Y98C	Y	-	2	0	ZBTB8OS	32871867	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.569000	0.53827	2.180000	0.69256	0.533000	0.62120	TAT	ZBTB8OS	-	pfam_Archease_dom,superfamily_Archease_dom	ENSG00000176261		0.318	ZBTB8OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB8OS	HGNC	protein_coding	OTTHUMT00000021669.3	24	0.00	0	T	NM_178547		33099280	33099280	-1	no_errors	ENST00000468695	ensembl	human	known	69_37n	missense	27	18.18	6	SNP	1.000	C
ZC3H7B	23264	genome.wustl.edu	37	22	41752463	41752463	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr22:41752463G>A	ENST00000352645.4	+	21	2757	c.2500G>A	c.(2500-2502)Gac>Aac	p.D834N	ZC3H7B_ENST00000351589.4_Missense_Mutation_p.D834N	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	850					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						GATGCCCACGGACTACGCGGA	0.627																																						dbGAP											0													125.0	113.0	117.0					22																	41752463		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.2500G>A	22.37:g.41752463G>A	ENSP00000345793:p.Asp834Asn		A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_TPR-1,smart_TPR_repeat,smart_Znf_CCCH,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D834N	ENST00000352645.4	37	c.2500	CCDS14013.1	22	.	.	.	.	.	.	.	.	.	.	G	26.3	4.723679	0.89298	.	.	ENSG00000100403	ENST00000352645;ENST00000351589	T;T	0.43688	0.94;0.94	5.05	4.03	0.46877	.	0.051654	0.85682	D	0.000000	T	0.59851	0.2224	M	0.64170	1.965	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	T	0.62163	-0.6912	10	0.62326	D	0.03	-20.8962	13.2365	0.59972	0.0772:0.0:0.9228:0.0	.	834	Q9UGR2-2	.	N	834	ENSP00000345793:D834N;ENSP00000263243:D834N	ENSP00000263243:D834N	D	+	1	0	ZC3H7B	40082409	1.000000	0.71417	0.984000	0.44739	0.520000	0.34377	7.918000	0.87506	2.529000	0.85273	0.655000	0.94253	GAC	ZC3H7B	-	NULL	ENSG00000100403		0.627	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H7B	HGNC	protein_coding	OTTHUMT00000320696.1	25	0.00	0	G	NM_017590		41752463	41752463	+1	no_errors	ENST00000351589	ensembl	human	known	69_37n	missense	12	53.85	14	SNP	0.999	A
ZMPSTE24	10269	genome.wustl.edu	37	1	40734181	40734181	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr1:40734181G>C	ENST00000372759.3	+	4	613	c.448G>C	c.(448-450)Gaa>Caa	p.E150Q		NM_005857.4	NP_005848.2	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	150					CAAX-box protein processing (GO:0071586)|nuclear envelope organization (GO:0006998)|prenylated protein catabolic process (GO:0030327)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metalloexopeptidase activity (GO:0008235)			endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	16	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			TTTTGTGATAGAAGAAAAACA	0.338																																						dbGAP											0													86.0	84.0	84.0					1																	40734181		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y13834	CCDS449.1	1p34	2014-09-17	2012-12-10		ENSG00000084073	ENSG00000084073	3.4.24.84		12877	protein-coding gene	gene with protein product	"""Hutchinson-Gilford progeria syndrome"", ""CAAX prenyl protease 1 homolog"""	606480	"""zinc metalloproteinase (STE24 homolog, yeast)"", ""zinc metallopeptidase (STE24 homolog, yeast)"", ""zinc metallopeptidase STE24 homolog (S. cerevisiae)"""			10373325, 9700155, 16671095	Standard	NM_005857		Approved	FACE-1, Ste24p, STE24, HGPS, PRO1	uc001cfg.4	O75844	OTTHUMG00000005762	ENST00000372759.3:c.448G>C	1.37:g.40734181G>C	ENSP00000361845:p.Glu150Gln		B3KQI7|D3DPU7|Q8NDZ8|Q9UBQ2	Missense_Mutation	SNP	pfam_Peptidase_M48	p.E150Q	ENST00000372759.3	37	c.448	CCDS449.1	1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.985942	0.93044	.	.	ENSG00000084073	ENST00000372759	T	0.01005	5.45	5.25	5.25	0.73442	.	0.091921	0.85682	D	0.000000	T	0.09730	0.0239	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00875	-1.1531	10	0.72032	D	0.01	-16.9321	19.0404	0.92997	0.0:0.0:1.0:0.0	.	150	O75844	FACE1_HUMAN	Q	150	ENSP00000361845:E150Q	ENSP00000361845:E150Q	E	+	1	0	ZMPSTE24	40506768	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.175000	0.94831	2.720000	0.93068	0.549000	0.68633	GAA	ZMPSTE24	-	NULL	ENSG00000084073		0.338	ZMPSTE24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMPSTE24	HGNC	protein_coding	OTTHUMT00000015766.1	68	0.00	0	G			40734181	40734181	+1	no_errors	ENST00000372759	ensembl	human	known	69_37n	missense	50	21.88	14	SNP	1.000	C
ZMYND12	84217	genome.wustl.edu	37	1	42905556	42905556	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr1:42905556C>T	ENST00000372565.3	-	4	834	c.565G>A	c.(565-567)Gaa>Aaa	p.E189K	ZMYND12_ENST00000433602.2_Missense_Mutation_p.E79K	NM_032257.4	NP_115633.3	Q9H0C1	ZMY12_HUMAN	zinc finger, MYND-type containing 12	189						intracellular (GO:0005622)	metal ion binding (GO:0046872)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|skin(2)	17	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CGGGCCTCTTCATAGTTTTTC	0.378																																						dbGAP											0													111.0	113.0	112.0					1																	42905556		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057384	CCDS467.1	1p34.1	2008-02-05			ENSG00000066185	ENSG00000066185		"""Zinc fingers, MYND-type"""	21192	protein-coding gene	gene with protein product						11230166	Standard	NM_032257		Approved	DKFZp434N2435	uc001chj.3	Q9H0C1	OTTHUMG00000007333	ENST00000372565.3:c.565G>A	1.37:g.42905556C>T	ENSP00000361646:p.Glu189Lys		Q5VUS6|Q8TC87|Q96M51	Missense_Mutation	SNP	pfam_Znf_MYND,pfscan_Znf_MYND	p.E189K	ENST00000372565.3	37	c.565	CCDS467.1	1	.	.	.	.	.	.	.	.	.	.	C	14.47	2.546205	0.45383	.	.	ENSG00000066185	ENST00000372565;ENST00000433602	T;T	0.67171	-0.25;-0.25	6.01	5.11	0.69529	Tetratricopeptide-like helical (1);	0.255981	0.43919	D	0.000508	T	0.61776	0.2374	L	0.60455	1.87	0.37727	D	0.925122	B;B	0.13594	0.007;0.008	B;B	0.16289	0.009;0.015	T	0.60677	-0.7216	10	0.25106	T	0.35	-7.0959	13.2828	0.60226	0.0:0.9237:0.0:0.0763	.	79;189	E9PFV0;Q9H0C1	.;ZMY12_HUMAN	K	189;79	ENSP00000361646:E189K;ENSP00000398340:E79K	ENSP00000361646:E189K	E	-	1	0	ZMYND12	42678143	0.904000	0.30761	0.883000	0.34634	0.876000	0.50452	2.660000	0.46749	1.564000	0.49628	-0.143000	0.13931	GAA	ZMYND12	-	NULL	ENSG00000066185		0.378	ZMYND12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYND12	HGNC	protein_coding	OTTHUMT00000019170.1	65	0.00	0	C	NM_032257		42905556	42905556	-1	no_errors	ENST00000372565	ensembl	human	known	69_37n	missense	54	31.65	25	SNP	0.976	T
ZNF582	147948	genome.wustl.edu	37	19	56896271	56896271	+	Missense_Mutation	SNP	C	C	G	rs201702956		TCGA-EW-A1PD-01A-11D-A142-09	TCGA-EW-A1PD-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5a288561-bf14-4cb9-b2f5-9ece0e038319	8e2913c9-4903-4d07-a706-a42e19b2ed7a	g.chr19:56896271C>G	ENST00000301310.4	-	5	673	c.515G>C	c.(514-516)gGg>gCg	p.G172A	AC006116.12_ENST00000589671.1_RNA|ZNF582_ENST00000586929.1_Missense_Mutation_p.G172A	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	172					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		TTTATTATACCCAAAAGGTTT	0.338													C|||	1	0.000199681	0.0	0.0	5008	,	,		18691	0.0		0.001	False		,,,				2504	0.0				Ovarian(183;1887 2032 4349 30507 51343)	dbGAP											0													67.0	70.0	69.0					19																	56896271		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.515G>C	19.37:g.56896271C>G	ENSP00000301310:p.Gly172Ala		B4DQZ9|B7Z9R3|Q6PJT6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G172A	ENST00000301310.4	37	c.515	CCDS33121.1	19	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	9.813	1.183807	0.21870	.	.	ENSG00000018869	ENST00000301310	T	0.14266	2.52	4.63	-9.27	0.00659	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.499001	0.15021	N	0.284978	T	0.04272	0.0118	N	0.05467	-0.045	0.09310	N	1	B;B	0.14438	0.01;0.01	B;B	0.09377	0.004;0.004	T	0.22243	-1.0222	10	0.59425	D	0.04	.	5.1634	0.15073	0.1874:0.1166:0.0928:0.6032	.	172;203	Q96NG8;B4DQZ9	ZN582_HUMAN;.	A	172	ENSP00000301310:G172A	ENSP00000301310:G172A	G	-	2	0	ZNF582	61588083	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-6.226000	0.00075	-1.800000	0.01247	-0.282000	0.10007	GGG	ZNF582	-	pfscan_Znf_C2H2	ENSG00000018869		0.338	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF582	HGNC	protein_coding	OTTHUMT00000458387.2	45	0.00	0	C	NM_144690		56896271	56896271	-1	no_errors	ENST00000301310	ensembl	human	known	69_37n	missense	58	15.94	11	SNP	0.000	G
