#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ANKRD36C	400986	genome.wustl.edu	37	2	96521886	96521886	+	Missense_Mutation	SNP	G	G	A	rs199628470		TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr2:96521886G>A	ENST00000456556.1	-	63	4207	c.4123C>T	c.(4123-4125)Cgc>Tgc	p.R1375C	ANKRD36C_ENST00000419039.2_Missense_Mutation_p.R402C|ANKRD36C_ENST00000420871.2_Missense_Mutation_p.R626C			Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	1375							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						TGCATCAAGCGGTTTTCATGC	0.343													g|||	1	0.000199681	0.0	0.0014	5008	,	,		20090	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.4123C>T	2.37:g.96521886G>A	ENSP00000403302:p.Arg1375Cys		C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R1375C	ENST00000456556.1	37	c.4123		2	.	.	.	.	.	.	.	.	.	.	g	4.593	0.110211	0.08780	.	.	ENSG00000174501	ENST00000420871;ENST00000456556;ENST00000419039	T;T;T	0.30182	1.54;1.54;1.54	1.87	1.87	0.25490	.	.	.	.	.	T	0.10165	0.0249	N	0.03050	-0.425	0.18873	N	0.999989	D	0.54047	0.964	B	0.38106	0.265	T	0.04752	-1.0929	9	0.27082	T	0.32	.	5.5887	0.17289	0.0:0.0:0.6755:0.3245	.	1375	Q5JPF3	AN36C_HUMAN	C	626;1375;402	ENSP00000415231:R626C;ENSP00000403302:R1375C;ENSP00000407838:R402C	ENSP00000407838:R402C	R	-	1	0	AC073995.2	95885613	0.995000	0.38212	0.049000	0.19019	0.066000	0.16364	2.097000	0.41748	1.361000	0.45981	0.313000	0.20887	CGC	ANKRD36C	-	NULL	ENSG00000174501		0.343	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ANKRD36C	HGNC	protein_coding	OTTHUMT00000338799.2	31	0.00	0	G	NM_001010914		96521886	96521886	-1	no_errors	ENST00000456556	ensembl	human	known	69_37n	missense	40	21.57	11	SNP	0.189	A
ARID1A	8289	genome.wustl.edu	37	1	27100207	27100207	+	Splice_Site	SNP	C	C	T	rs387906846		TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr1:27100207C>T	ENST00000324856.7	+	16	4374	c.4003C>T	c.(4003-4005)Cga>Tga	p.R1335*	ARID1A_ENST00000540690.1_5'UTR|ARID1A_ENST00000457599.2_Splice_Site_p.R1335*|ARID1A_ENST00000374152.2_Splice_Site_p.R952*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1335	Gln-rich.				androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.R1335*(2)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		gcagcagcaACGGTGAGTAAA	0.577			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	dbGAP		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	2	Substitution - Nonsense(2)	endometrium(2)											77.0	78.0	78.0					1																	27100207		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.4004+1C>T	1.37:g.27100207C>T			D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.R1335*	ENST00000324856.7	37	c.4003	CCDS285.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	41|41	8.995900|8.995900	0.99029|0.99029	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152|ENST00000430799	.|.	.|.	.|.	5.4|5.4	4.47|4.47	0.54385|0.54385	.|.	0.157191|.	0.56097|.	D|.	0.000033|.	.|T	.|0.48409	.|0.1498	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.45041	.|-0.9288	.|4	0.02654|.	T|.	1|.	0.3533|0.3533	4.3329|4.3329	0.11073|0.11073	0.1892:0.6214:0.0:0.1894|0.1892:0.6214:0.0:0.1894	.|.	.|.	.|.	.|.	X|M	1335;1335;952|231	.|.	ENSP00000320485:R1335X|.	R|T	+|+	1|2	2|0	ARID1A|ARID1A	26972794|26972794	0.973000|0.973000	0.33851|0.33851	0.999000|0.999000	0.59377|0.59377	0.994000|0.994000	0.84299|0.84299	2.562000|2.562000	0.45914|0.45914	1.240000|1.240000	0.43803|0.43803	0.655000|0.655000	0.94253|0.94253	CGA|ACG	ARID1A	-	NULL	ENSG00000117713		0.577	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	32	0.00	0	C	NM_139135	Nonsense_Mutation	27100207	27100207	+1	no_errors	ENST00000324856	ensembl	human	known	69_37n	nonsense	25	44.44	20	SNP	0.945	T
CCR1	1230	genome.wustl.edu	37	3	46245419	46245419	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr3:46245419A>T	ENST00000296140.3	-	2	511	c.386T>A	c.(385-387)aTt>aAt	p.I129N	CCR3_ENST00000357422.2_Intron	NM_001295.2	NP_001286.1	P32246	CCR1_HUMAN	chemokine (C-C motif) receptor 1	129					calcium ion transport (GO:0006816)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|exocytosis (GO:0006887)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of bone mineralization (GO:0030502)|negative regulation of gene expression (GO:0010629)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of osteoclast differentiation (GO:0045672)|response to wounding (GO:0009611)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|C-C chemokine receptor activity (GO:0016493)|chemokine (C-C motif) ligand 5 binding (GO:0071791)|chemokine (C-C motif) ligand 7 binding (GO:0035717)|chemokine receptor activity (GO:0004950)|phosphatidylinositol phospholipase C activity (GO:0004435)			autonomic_ganglia(1)|large_intestine(6)|lung(6)|pancreas(1)|skin(3)	17				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		GTACCTGTCAATCGTCAGCAG	0.512																																						dbGAP											0													90.0	86.0	87.0					3																	46245419		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2737.1	3p21	2012-08-08			ENSG00000163823	ENSG00000163823		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1602	protein-coding gene	gene with protein product		601159		SCYAR1, CMKBR1		7679328	Standard	NM_001295		Approved	CKR-1, MIP1aR, CD191	uc003cph.1	P32246	OTTHUMG00000133451	ENST00000296140.3:c.386T>A	3.37:g.46245419A>T	ENSP00000296140:p.Ile129Asn		Q86VA9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Chemokine_CCR1,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CCR5,prints_P2_purnocptor,prints_NPY_rcpt,prints_ATII_rcpt	p.I129N	ENST00000296140.3	37	c.386	CCDS2737.1	3	.	.	.	.	.	.	.	.	.	.	A	20.7	4.041678	0.75732	.	.	ENSG00000163823	ENST00000296140	T	0.41758	0.99	4.86	4.86	0.63082	GPCR, rhodopsin-like superfamily (1);	0.705104	0.13346	N	0.394755	T	0.76737	0.4029	H	0.97635	4.045	0.19300	N	0.999979	D	0.64830	0.994	D	0.69479	0.964	T	0.72833	-0.4173	10	0.87932	D	0	.	14.7717	0.69684	1.0:0.0:0.0:0.0	.	129	P32246	CCR1_HUMAN	N	129	ENSP00000296140:I129N	ENSP00000296140:I129N	I	-	2	0	CCR1	46220423	0.772000	0.28567	0.028000	0.17463	0.973000	0.67179	6.204000	0.72143	1.955000	0.56771	0.533000	0.62120	ATT	CCR1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000163823		0.512	CCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR1	HGNC	protein_coding	OTTHUMT00000257325.2	27	0.00	0	A	NM_001295		46245419	46245419	-1	no_errors	ENST00000296140	ensembl	human	known	69_37n	missense	16	44.83	13	SNP	0.114	T
CDC6	990	genome.wustl.edu	37	17	38447837	38447837	+	Frame_Shift_Del	DEL	A	A	-			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr17:38447837delA	ENST00000209728.4	+	4	1048	c.577delA	c.(577-579)aaafs	p.K194fs		NM_001254.3	NP_001245.1	Q99741	CDC6_HUMAN	cell division cycle 6	194					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|positive regulation of chromosome segregation (GO:0051984)|positive regulation of cytokinesis (GO:0032467)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|traversing start control point of mitotic cell cycle (GO:0007089)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|kinase binding (GO:0019900)|nucleotide binding (GO:0000166)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	21						CATCTGTGGGAAAAAAGCTGG	0.502																																						dbGAP											0													107.0	114.0	112.0					17																	38447837		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			U77949	CCDS11365.1	17q21.3	2013-01-17	2013-01-17		ENSG00000094804	ENSG00000094804			1744	protein-coding gene	gene with protein product		602627	"""CDC6 (cell division cycle 6, S. cerevisiae) homolog"", ""CDC6 cell division cycle 6 homolog (S. cerevisiae)"", ""cell division cycle 6 homolog (S. cerevisiae)"""	CDC18L		8990175, 9566895	Standard	NM_001254		Approved		uc002huj.1	Q99741	OTTHUMG00000133324	ENST00000209728.4:c.577delA	17.37:g.38447837delA	ENSP00000209728:p.Lys194fs		Q8TB30	Frame_Shift_Del	DEL	pfam_ATPase_AAA_core,pfam_Cdc6_C_dom,smart_AAA+_ATPase,pirsf_Cell_div_Cdc6	p.A195fs	ENST00000209728.4	37	c.577	CCDS11365.1	17																																																																																			CDC6	-	smart_AAA+_ATPase,pirsf_Cell_div_Cdc6	ENSG00000094804		0.502	CDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC6	HGNC	protein_coding	OTTHUMT00000257129.1	33	0.00	0	A			38447837	38447837	+1	no_errors	ENST00000209728	ensembl	human	known	69_37n	frame_shift_del	34	30.19	16	DEL	0.924	-
DNA2	1763	genome.wustl.edu	37	10	70182495	70182495	+	Silent	SNP	G	G	A			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr10:70182495G>A	ENST00000358410.3	-	15	2411	c.2361C>T	c.(2359-2361)gaC>gaT	p.D787D	DNA2_ENST00000399179.2_Intron|DNA2_ENST00000399180.2_Silent_p.D873D	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	787	Helicase activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						GCTGCTGATGGTCCCCCACTA	0.398																																						dbGAP											0													38.0	38.0	38.0					10																	70182495		1834	4081	5915	-	-	-	SO:0001819	synonymous_variant	0			D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.2361C>T	10.37:g.70182495G>A			Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	NULL	p.P109S	ENST00000358410.3	37	c.325		10	.	.	.	.	.	.	.	.	.	.	G	7.126	0.579015	0.13686	.	.	ENSG00000138346	ENST00000440722	.	.	.	5.66	-4.2	0.03823	.	.	.	.	.	T	0.54743	0.1877	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55134	-0.8188	4	.	.	.	.	11.0385	0.47816	0.3419:0.1017:0.5564:0.0	.	.	.	.	S	109	.	.	P	-	1	0	DNA2	69852501	0.992000	0.36948	0.973000	0.42090	0.920000	0.55202	0.286000	0.18902	-0.693000	0.05121	-1.353000	0.01230	CCA	DNA2	-	NULL	ENSG00000138346		0.398	DNA2-001	KNOWN	basic|appris_principal	protein_coding	DNA2	HGNC	protein_coding	OTTHUMT00000048334.2	35	0.00	0	G			70182495	70182495	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000440722	ensembl	human	putative	69_37n	missense	31	11.43	4	SNP	0.974	A
EFS	10278	genome.wustl.edu	37	14	23826504	23826504	+	Silent	SNP	C	C	T			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr14:23826504C>T	ENST00000216733.3	-	6	2224	c.1617G>A	c.(1615-1617)gtG>gtA	p.V539V	EFS_ENST00000351354.3_Silent_p.V446V|EFS_ENST00000429593.2_Silent_p.V370V|RP11-124D2.3_ENST00000554010.1_RNA	NM_005864.2	NP_005855.1	O43281	EFS_HUMAN	embryonal Fyn-associated substrate	539					cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)	16	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		TTACACACTGCACCATCTCTT	0.612																																						dbGAP											0													63.0	62.0	62.0					14																	23826504		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB001466	CCDS9595.1, CCDS9596.1, CCDS61404.1	14q11.2-q12	2011-04-13			ENSG00000100842	ENSG00000100842		"""Cas scaffolding proteins"""	16898	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 3"""	609906				9349509	Standard	NM_005864		Approved	EFS2, EFS1, HEFS, SIN, CASS3	uc001wjo.4	O43281	OTTHUMG00000028741	ENST00000216733.3:c.1617G>A	14.37:g.23826504C>T			B2RAJ7|B4DJ56|E9PGU2|O43282	Silent	SNP	pfam_CAS_DUF3513,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	p.V539	ENST00000216733.3	37	c.1617	CCDS9595.1	14																																																																																			EFS	-	pfam_CAS_DUF3513	ENSG00000100842		0.612	EFS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EFS	HGNC	protein_coding	OTTHUMT00000071770.2	20	0.00	0	C			23826504	23826504	-1	no_errors	ENST00000216733	ensembl	human	known	69_37n	silent	11	31.25	5	SNP	0.008	T
EMR3	84658	genome.wustl.edu	37	19	14748981	14748981	+	Missense_Mutation	SNP	C	C	T	rs559170756	byFrequency	TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr19:14748981C>T	ENST00000253673.5	-	11	1520	c.1420G>A	c.(1420-1422)Gtt>Att	p.V474I	EMR3_ENST00000344373.4_Missense_Mutation_p.V422I|EMR3_ENST00000599900.1_Missense_Mutation_p.V259I|EMR3_ENST00000443157.2_Missense_Mutation_p.V348I	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	474					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						ACAGCGGGAACGCCATAGCCG	0.527													C|||	3	0.000599042	0.0	0.0	5008	,	,		21272	0.001		0.0	False		,,,				2504	0.002					dbGAP											0													179.0	140.0	153.0					19																	14748981		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.1420G>A	19.37:g.14748981C>T	ENSP00000253673:p.Val474Ile			Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_Ca-bd,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CD97	p.V474I	ENST00000253673.5	37	c.1420	CCDS12315.1	19	.	.	.	.	.	.	.	.	.	.	C	4.286	0.052277	0.08291	.	.	ENSG00000131355	ENST00000443157;ENST00000253673;ENST00000344373	T;T;T	0.36699	1.24;1.24;1.24	4.34	2.1	0.27182	GPCR, family 2-like (1);	.	.	.	.	T	0.17280	0.0415	N	0.05619	-0.005	0.09310	N	1	P;P;B	0.42248	0.461;0.774;0.173	B;B;B	0.38921	0.148;0.285;0.179	T	0.06862	-1.0803	9	0.27082	T	0.32	.	7.8981	0.29719	0.0:0.7744:0.0:0.2256	.	348;422;474	E7EW83;Q9BY15-2;Q9BY15	.;.;EMR3_HUMAN	I	348;474;422	ENSP00000396208:V348I;ENSP00000253673:V474I;ENSP00000340758:V422I	ENSP00000253673:V474I	V	-	1	0	EMR3	14609981	0.000000	0.05858	0.889000	0.34880	0.072000	0.16883	-2.033000	0.01425	1.046000	0.40249	-0.143000	0.13931	GTT	EMR3	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000131355		0.527	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMR3	HGNC	protein_coding	OTTHUMT00000466488.1	24	0.00	0	C	NM_032571		14748981	14748981	-1	no_errors	ENST00000253673	ensembl	human	known	69_37n	missense	31	22.50	9	SNP	0.346	T
FLG	2312	genome.wustl.edu	37	1	152278434	152278434	+	Missense_Mutation	SNP	T	T	G	rs61816760	byFrequency	TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr1:152278434T>G	ENST00000368799.1	-	3	8963	c.8928A>C	c.(8926-8928)gaA>gaC	p.E2976D	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2976	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATCCATGTCTTTCTCCTGCAC	0.552									Ichthyosis				t|||	1439	0.28734	0.3381	0.3112	5008	,	,		25713	0.12		0.3847	False		,,,				2504	0.274					dbGAP											0													7.0	10.0	9.0					1																	152278434		1063	2952	4015	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8928A>C	1.37:g.152278434T>G	ENSP00000357789:p.Glu2976Asp		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.E2976D	ENST00000368799.1	37	c.8928	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	t	8.054	0.766581	0.15983	.	.	ENSG00000143631	ENST00000368799	T	0.04603	3.59	4.01	0.0184	0.14117	.	.	.	.	.	T	0.00906	0.0030	L	0.31294	0.92	0.80722	P	0.0	P	0.38280	0.625	B	0.37422	0.249	T	0.44283	-0.9338	8	0.12766	T	0.61	.	3.0129	0.06049	0.18:0.2108:0.0:0.6092	.	2976	P20930	FILA_HUMAN	D	2976	ENSP00000357789:E2976D	ENSP00000357789:E2976D	E	-	3	2	FLG	150545058	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.304000	0.02741	-0.088000	0.12506	-0.565000	0.04167	GAA	FLG	-	pfam_Filaggrin	ENSG00000143631		0.552	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	11	0.00	0	T	NM_002016		152278434	152278434	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	0.000	G
FCAMR	83953	genome.wustl.edu	37	1	207134288	207134288	+	Silent	SNP	A	A	G			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr1:207134288A>G	ENST00000324852.4	-	6	1407	c.933T>C	c.(931-933)agT>agC	p.S311S	FCAMR_ENST00000450945.2_Intron|FCAMR_ENST00000486178.1_5'Flank|FCAMR_ENST00000400962.3_Intron	NM_001170631.1	NP_001164102.1	Q8WWV6	FCAMR_HUMAN	Fc receptor, IgA, IgM, high affinity	266					immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(1)	11						TTGAAGGTGGACTCTCTGGAA	0.572																																					Ovarian(199;1883 2142 16966 44409 45154)	dbGAP											0													120.0	100.0	106.0					1																	207134288		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AF354295	CCDS41460.1, CCDS53468.1	1q32.1	2013-01-14			ENSG00000162897	ENSG00000162897		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	24692	protein-coding gene	gene with protein product		605484				11779189	Standard	NM_001122979		Approved	FKSG87, FCA/MR, CD351	uc001hfa.4	Q8WWV6	OTTHUMG00000036579	ENST00000324852.4:c.933T>C	1.37:g.207134288A>G			Q32M82|Q8WWV5|Q96SA2	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.S311	ENST00000324852.4	37	c.933	CCDS53468.1	1																																																																																			FCAMR	-	NULL	ENSG00000162897		0.572	FCAMR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	FCAMR	HGNC	protein_coding	OTTHUMT00000088969.2	24	0.00	0	A	NM_032029		207134288	207134288	-1	no_errors	ENST00000324852	ensembl	human	novel	69_37n	silent	60	22.08	17	SNP	0.007	G
GADD45GIP1	90480	genome.wustl.edu	37	19	13065285	13065285	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr19:13065285G>A	ENST00000316939.1	-	2	429	c.406C>T	c.(406-408)Cag>Tag	p.Q136*		NM_052850.3	NP_443082.2	Q8TAE8	G45IP_HUMAN	growth arrest and DNA-damage-inducible, gamma interacting protein 1	136	Poly-Gln.				cell cycle (GO:0007049)|viral process (GO:0016032)	mitochondrion (GO:0005739)|nucleus (GO:0005634)				ovary(2)|prostate(1)|skin(1)	4						TGCTGCTGCTGCCAGTTCACA	0.637																																						dbGAP											0													63.0	57.0	59.0					19																	13065285		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF479749	CCDS12290.1	19p13.2	2014-02-12				ENSG00000179271			29996	protein-coding gene	gene with protein product	"""papillomavirus L2 interacting nuclear protein 1"", ""CKII beta binding protein 2"", ""CR6 interacting factor 1"", ""p53-responsive gene 6"""	605162				10441517, 12482659	Standard	NM_052850		Approved	PLINP-1, MGC4667, MGC4758, CKBBP2, PRG6, Plinp1, CRIF1, CKbetaBP2	uc002mwb.4	Q8TAE8		ENST00000316939.1:c.406C>T	19.37:g.13065285G>A	ENSP00000323065:p.Gln136*		Q8IVM3|Q8TE51|Q969P9|Q9BSM6	Nonsense_Mutation	SNP	pfam_Damage-induce-interacting_prot	p.Q136*	ENST00000316939.1	37	c.406	CCDS12290.1	19	.	.	.	.	.	.	.	.	.	.	G	14.14	2.446827	0.43429	.	.	ENSG00000179271	ENST00000316939	.	.	.	4.92	2.63	0.31362	.	0.079986	0.49916	D	0.000136	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-20.9358	11.9983	0.53216	0.0:0.0:0.69:0.31	.	.	.	.	X	136	.	ENSP00000323065:Q136X	Q	-	1	0	GADD45GIP1	12926285	0.998000	0.40836	0.988000	0.46212	0.374000	0.29953	1.903000	0.39858	1.053000	0.40415	0.558000	0.71614	CAG	GADD45GIP1	-	pfam_Damage-induce-interacting_prot	ENSG00000179271		0.637	GADD45GIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GADD45GIP1	HGNC	protein_coding	OTTHUMT00000452759.2	29	0.00	0	G	NM_052850		13065285	13065285	-1	no_errors	ENST00000316939	ensembl	human	known	69_37n	nonsense	25	13.79	4	SNP	0.977	A
GBP4	115361	genome.wustl.edu	37	1	89662872	89662872	+	Silent	SNP	G	G	A			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr1:89662872G>A	ENST00000355754.6	-	2	253	c.156C>T	c.(154-156)ccC>ccT	p.P52P		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	52	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		CCACCACCACGGGCTGAGAAA	0.483																																						dbGAP											0													134.0	119.0	124.0					1																	89662872		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.156C>T	1.37:g.89662872G>A			B2R630|Q05D63|Q6NSL0|Q86T99	Silent	SNP	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C	p.P52	ENST00000355754.6	37	c.156	CCDS721.1	1																																																																																			GBP4	-	pfam_Guanylate-bd_N	ENSG00000162654		0.483	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP4	HGNC	protein_coding	OTTHUMT00000029409.1	53	0.00	0	G	NM_052941		89662872	89662872	-1	no_errors	ENST00000355754	ensembl	human	known	69_37n	silent	45	28.79	19	SNP	0.684	A
GSPT2	23708	genome.wustl.edu	37	X	51487776	51487776	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chrX:51487776G>A	ENST00000340438.4	+	1	1296	c.1054G>A	c.(1054-1056)Gat>Aat	p.D352N		NM_018094.4	NP_060564.2	Q8IYD1	ERF3B_HUMAN	G1 to S phase transition 2	352	G4. {ECO:0000255|PROSITE- ProRule:PRU01059}.|tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Ovarian(276;0.236)					TAATAAGATGGATGATCCCAC	0.373																																						dbGAP											0													80.0	75.0	76.0					X																	51487776		2203	4300	6503	-	-	-	SO:0001583	missense	0			AI285711	CCDS14336.1	Xp11.22	2008-05-14			ENSG00000189369	ENSG00000189369			4622	protein-coding gene	gene with protein product		300418				10575220	Standard	NM_018094		Approved	eRF3b, FLJ10441	uc004dpl.3	Q8IYD1	OTTHUMG00000021538	ENST00000340438.4:c.1054G>A	X.37:g.51487776G>A	ENSP00000341247:p.Asp352Asn		Q9H909|Q9NVY0|Q9NY44	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,pfam_Ataxin-2_C,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_elong_init/rib_B-barrel,prints_ProtSyn_GTP-bd	p.D352N	ENST00000340438.4	37	c.1054	CCDS14336.1	X	.	.	.	.	.	.	.	.	.	.	G	18.91	3.723615	0.68959	.	.	ENSG00000189369	ENST00000340438;ENST00000502175	D	0.81996	-1.56	4.54	4.54	0.55810	Protein synthesis factor, GTP-binding (2);	0.000000	0.85682	D	0.000000	D	0.95201	0.8444	H	0.99712	4.72	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96775	0.9571	10	0.87932	D	0	-5.6573	14.1788	0.65559	0.0:0.0:1.0:0.0	.	352	Q8IYD1	ERF3B_HUMAN	N	352;269	ENSP00000341247:D352N	ENSP00000341247:D352N	D	+	1	0	GSPT2	51504516	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.097000	0.94193	2.521000	0.84997	0.592000	0.82586	GAT	GSPT2	-	pfam_ProtSyn_GTP-bd,prints_ProtSyn_GTP-bd	ENSG00000189369		0.373	GSPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSPT2	HGNC	protein_coding	OTTHUMT00000056587.1	48	0.00	0	G			51487776	51487776	+1	no_errors	ENST00000340438	ensembl	human	known	69_37n	missense	58	12.12	8	SNP	1.000	A
HOXB1	3211	genome.wustl.edu	37	17	46607829	46607829	+	Silent	SNP	G	G	A	rs368471890		TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr17:46607829G>A	ENST00000239174.6	-	1	530	c.438C>T	c.(436-438)aaC>aaT	p.N146N	HOXB1_ENST00000577092.1_Silent_p.N146N	NM_002144.3	NP_002135.2	P14653	HXB1_HUMAN	homeobox B1	146					anatomical structure formation involved in morphogenesis (GO:0048646)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|multicellular organismal development (GO:0007275)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CGGTCTGCTCGTTCCCATAAG	0.647																																						dbGAP											0													60.0	63.0	62.0					17																	46607829		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32675.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120094	ENSG00000120094		"""Homeoboxes / ANTP class : HOXL subclass"""	5111	protein-coding gene	gene with protein product		142968	"""homeo box B1"""	HOX2, HOX2I		1973146, 1358459	Standard	NM_002144		Approved		uc002ink.1	P14653	OTTHUMG00000159929	ENST00000239174.6:c.438C>T	17.37:g.46607829G>A			Q4VB03	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.N146	ENST00000239174.6	37	c.438	CCDS32675.1	17																																																																																			HOXB1	-	NULL	ENSG00000120094		0.647	HOXB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB1	HGNC	protein_coding	OTTHUMT00000358383.3	31	0.00	0	G			46607829	46607829	-1	no_errors	ENST00000239174	ensembl	human	known	69_37n	silent	46	24.59	15	SNP	0.008	A
HELZ	9931	genome.wustl.edu	37	17	65184495	65184495	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr17:65184495C>A	ENST00000358691.5	-	12	1268	c.1102G>T	c.(1102-1104)Gac>Tac	p.D368Y	HELZ_ENST00000580168.1_Missense_Mutation_p.D368Y|HELZ_ENST00000580662.1_5'Flank	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	368						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					AATCCAAAGTCGAAAACTATG	0.363																																						dbGAP											0													142.0	135.0	137.0					17																	65184495		1842	4097	5939	-	-	-	SO:0001583	missense	0			D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.1102G>T	17.37:g.65184495C>A	ENSP00000351524:p.Asp368Tyr		I6L9H4	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.D368Y	ENST00000358691.5	37	c.1102	CCDS42374.1	17	.	.	.	.	.	.	.	.	.	.	C	13.79	2.342341	0.41498	.	.	ENSG00000198265	ENST00000358691;ENST00000417253	D;T	0.90261	-2.64;0.39	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.95564	0.8558	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.98	D	0.95367	0.8461	10	0.66056	D	0.02	-18.6776	19.8753	0.96867	0.0:1.0:0.0:0.0	.	368;368	B7ZLW2;P42694	.;HELZ_HUMAN	Y	368	ENSP00000351524:D368Y;ENSP00000411144:D368Y	ENSP00000351524:D368Y	D	-	1	0	HELZ	62614957	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.288000	0.78691	2.711000	0.92665	0.655000	0.94253	GAC	HELZ	-	NULL	ENSG00000198265		0.363	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HELZ	HGNC	protein_coding	OTTHUMT00000447068.1	47	0.00	0	C	NM_014877		65184495	65184495	-1	no_errors	ENST00000358691	ensembl	human	known	69_37n	missense	61	12.86	9	SNP	1.000	A
MUC17	140453	genome.wustl.edu	37	7	100678652	100678652	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr7:100678652C>T	ENST00000306151.4	+	3	4019	c.3955C>T	c.(3955-3957)Cct>Tct	p.P1319S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1319	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAGTTCATCTCCTACACCTGC	0.483																																						dbGAP											0													245.0	230.0	235.0					7																	100678652		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.3955C>T	7.37:g.100678652C>T	ENSP00000302716:p.Pro1319Ser		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.P1319S	ENST00000306151.4	37	c.3955	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	c	0.069	-1.205473	0.01568	.	.	ENSG00000169876	ENST00000306151	T	0.03152	4.03	0.471	-0.792	0.10925	.	.	.	.	.	T	0.02193	0.0068	L	0.29908	0.895	0.09310	N	1	B	0.20887	0.049	B	0.12837	0.008	T	0.48186	-0.9057	8	0.05436	T	0.98	.	.	.	.	.	1319	Q685J3	MUC17_HUMAN	S	1319	ENSP00000302716:P1319S	ENSP00000302716:P1319S	P	+	1	0	MUC17	100465372	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	-4.178000	0.00279	-0.293000	0.08986	-1.525000	0.00928	CCT	MUC17	-	NULL	ENSG00000169876		0.483	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	59	0.00	0	C	NM_001040105		100678652	100678652	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	missense	52	16.13	10	SNP	0.016	T
NEB	4703	genome.wustl.edu	37	2	152534685	152534685	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr2:152534685T>C	ENST00000172853.10	-	33	3419	c.3272A>G	c.(3271-3273)gAc>gGc	p.D1091G	NEB_ENST00000409198.1_Missense_Mutation_p.D1091G|NEB_ENST00000604864.1_Missense_Mutation_p.D1091G|NEB_ENST00000397345.3_Missense_Mutation_p.D1091G|NEB_ENST00000427231.2_Missense_Mutation_p.D1091G|NEB_ENST00000603639.1_Missense_Mutation_p.D1091G			P20929	NEBU_HUMAN	nebulin	1091					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CTTTTCATAGTCTTTTTTGTA	0.363																																						dbGAP											0													40.0	36.0	37.0					2																	152534685		1809	4077	5886	-	-	-	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.3272A>G	2.37:g.152534685T>C	ENSP00000172853:p.Asp1091Gly		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.D1091G	ENST00000172853.10	37	c.3272		2	.	.	.	.	.	.	.	.	.	.	T	11.23	1.576241	0.28092	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	5.59	4.42	0.53409	.	0.376015	0.27932	N	0.017273	T	0.32823	0.0842	N	0.01515	-0.825	0.80722	D	1	B	0.23058	0.079	B	0.39935	0.314	T	0.24941	-1.0146	10	0.32370	T	0.25	.	11.314	0.49381	0.0:0.0721:0.0:0.9279	.	1091	P20929	NEBU_HUMAN	G	1091	ENSP00000386259:D1091G;ENSP00000380505:D1091G;ENSP00000416578:D1091G;ENSP00000172853:D1091G	ENSP00000172853:D1091G	D	-	2	0	NEB	152242931	0.648000	0.27313	1.000000	0.80357	0.967000	0.64934	0.770000	0.26618	0.949000	0.37715	0.533000	0.62120	GAC	NEB	-	pfam_Nebulin_35r-motif,superfamily_Adhesion_dom_bac,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.363	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		25	0.00	0	T	NM_004543		152534685	152534685	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	1.000	C
TENM1	10178	genome.wustl.edu	37	X	123663729	123663729	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chrX:123663729C>A	ENST00000371130.3	-	16	2819	c.2756G>T	c.(2755-2757)aGc>aTc	p.S919I	TENM1_ENST00000422452.2_Missense_Mutation_p.S919I	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	919					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ATCTTGCCGGCTGATGGTAAA	0.488																																						dbGAP											0													145.0	115.0	125.0					X																	123663729		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.2756G>T	X.37:g.123663729C>A	ENSP00000360171:p.Ser919Ile		B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.S919I	ENST00000371130.3	37	c.2756	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	18.62	3.663651	0.67700	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.17370	2.28;2.28	5.93	5.93	0.95920	.	0.092366	0.85682	D	0.000000	T	0.43765	0.1262	M	0.68952	2.095	0.58432	D	0.999998	D;D;D	0.71674	0.998;0.997;0.992	D;D;P	0.78314	0.991;0.942;0.858	T	0.27773	-1.0064	10	0.87932	D	0	.	19.2667	0.93990	0.0:1.0:0.0:0.0	.	918;919;919	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	I	919	ENSP00000360171:S919I;ENSP00000403954:S919I	ENSP00000360171:S919I	S	-	2	0	ODZ1	123491410	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.055000	0.57441	2.502000	0.84385	0.594000	0.82650	AGC	ODZ1	-	superfamily_CarboxyPept-like_regulatory	ENSG00000009694		0.488	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	43	0.00	0	C	NM_014253		123663729	123663729	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	missense	56	16.42	11	SNP	1.000	A
PCDH12	51294	genome.wustl.edu	37	5	141329143	141329143	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr5:141329143G>A	ENST00000231484.3	-	3	4194	c.2984C>T	c.(2983-2985)gCa>gTa	p.A995V	AC005740.6_ENST00000607378.1_RNA	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	995					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCTGGGATTGCACTCCTGCA	0.493																																						dbGAP											0													117.0	111.0	113.0					5																	141329143		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.2984C>T	5.37:g.141329143G>A	ENSP00000231484:p.Ala995Val		Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A995V	ENST00000231484.3	37	c.2984	CCDS4269.1	5	.	.	.	.	.	.	.	.	.	.	G	9.881	1.201570	0.22121	.	.	ENSG00000113555	ENST00000231484	T	0.62639	0.01	5.8	4.03	0.46877	.	0.749345	0.13515	N	0.382123	T	0.56761	0.2007	L	0.54323	1.7	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.53107	-0.8485	10	0.72032	D	0.01	.	9.0488	0.36363	0.1687:0.0:0.8313:0.0	.	995	Q9NPG4	PCD12_HUMAN	V	995	ENSP00000231484:A995V	ENSP00000231484:A995V	A	-	2	0	PCDH12	141309327	0.016000	0.18221	0.013000	0.15412	0.103000	0.19146	1.954000	0.40362	0.811000	0.34303	0.655000	0.94253	GCA	PCDH12	-	NULL	ENSG00000113555		0.493	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH12	HGNC	protein_coding	OTTHUMT00000251858.1	40	0.00	0	G	NM_016580		141329143	141329143	-1	no_errors	ENST00000231484	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	0.003	A
PRDM4	11108	genome.wustl.edu	37	12	108150667	108150667	+	Silent	SNP	G	G	C			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr12:108150667G>C	ENST00000228437.5	-	3	546	c.87C>G	c.(85-87)gtC>gtG	p.V29V	PRDM4_ENST00000547268.1_5'UTR|RP11-864J10.4_ENST00000546714.1_RNA	NM_012406.3	NP_036538.3	Q9UKN5	PRDM4_HUMAN	PR domain containing 4	29					cell proliferation (GO:0008283)|negative regulation of cell cycle (GO:0045786)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|methyltransferase activity (GO:0008168)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	20						GACTTCCTGAGACTGGCAAGG	0.517																																						dbGAP											0													90.0	70.0	77.0					12																	108150667		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF144757	CCDS9115.1	12q23-q24.1	2013-01-08				ENSG00000110851		"""Zinc fingers, C2H2-type"""	9348	protein-coding gene	gene with protein product		605780				10552934	Standard	NM_012406		Approved	PFM1	uc001tmp.3	Q9UKN5	OTTHUMG00000169914	ENST00000228437.5:c.87C>G	12.37:g.108150667G>C			Q9UFA6	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pirsf_Znf_PRDM4,pfscan_SET_dom,pfscan_Znf_C2H2	p.V29	ENST00000228437.5	37	c.87	CCDS9115.1	12																																																																																			PRDM4	-	pirsf_Znf_PRDM4	ENSG00000110851		0.517	PRDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM4	HGNC	protein_coding	OTTHUMT00000406546.1	28	0.00	0	G	NM_012406		108150667	108150667	-1	no_errors	ENST00000228437	ensembl	human	known	69_37n	silent	25	30.56	11	SNP	1.000	C
RPL37A	6168	genome.wustl.edu	37	2	217364721	217364722	+	In_Frame_Ins	INS	-	-	GAA			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr2:217364721_217364722insGAA	ENST00000491306.1	+	3	868_869	c.182_183insGAA	c.(181-186)atgaag>atGAAgaag	p.62_63insK	RPL37A_ENST00000600880.1_In_Frame_Ins_p.62_63insK|RPL37A_ENST00000456586.1_In_Frame_Ins_p.38_39insK|RPL37A_ENST00000427280.2_In_Frame_Ins_p.38_39insK|AC098820.3_ENST00000453157.1_RNA|RPL37A_ENST00000446558.1_In_Frame_Ins_p.62_63insK|RPL37A_ENST00000598925.1_In_Frame_Ins_p.38_39insK|AC098820.3_ENST00000438978.1_RNA|RPL37A_ENST00000441179.2_In_Frame_Ins_p.38_39insK	NM_000998.4	NP_000989.1	P61513	RL37A_HUMAN	ribosomal protein L37a	62					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			NS(1)|ovary(1)	2		Renal(323;0.0458)		Epithelial(149;3.51e-06)|all cancers(144;0.000249)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGTTCCTGCATGAAGACAGTGG	0.465																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0				CCDS2404.1	2q35	2011-04-06			ENSG00000197756	ENSG00000197756		"""L ribosomal proteins"""	10348	protein-coding gene	gene with protein product		613314				1437567	Standard	NM_000998		Approved	L37A	uc002vgf.3	P61513	OTTHUMG00000133052	ENST00000491306.1:c.183_185dupGAA	2.37:g.217364722_217364724dupGAA	ENSP00000418082:p.Lys62_Lys62dup		P12751|Q6FGF5	In_Frame_Ins	INS	pfam_Ribosomal_L37ae,superfamily_Ribosomal_zn-bd_dom,tigrfam_Ribosomal_L37ae	p.63in_frame_insK	ENST00000491306.1	37	c.182_183	CCDS2404.1	2																																																																																			RPL37A	-	pfam_Ribosomal_L37ae,superfamily_Ribosomal_zn-bd_dom,tigrfam_Ribosomal_L37ae	ENSG00000197756		0.465	RPL37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL37A	HGNC	protein_coding	OTTHUMT00000256665.2	65	0.00	0	-	NM_000998		217364721	217364722	+1	no_errors	ENST00000491306	ensembl	human	known	69_37n	in_frame_ins	60	32.58	29	INS	1.000:1.000	GAA
SCN8A	6334	genome.wustl.edu	37	12	52200943	52200943	+	Silent	SNP	T	T	C			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr12:52200943T>C	ENST00000354534.6	+	27	5851	c.5673T>C	c.(5671-5673)cgT>cgC	p.R1891R	AC068987.1_ENST00000599343.1_5'Flank|SCN8A_ENST00000545061.1_Silent_p.R1850R|RP11-923I11.3_ENST00000565518.1_lincRNA	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1891					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CCACACTGCGTCGCAAGCAGG	0.547																																						dbGAP											0													134.0	140.0	138.0					12																	52200943		2076	4219	6295	-	-	-	SO:0001819	synonymous_variant	0			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.5673T>C	12.37:g.52200943T>C			B9VWG8|O95788|Q9NYX2|Q9UPB2	Silent	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.R1891	ENST00000354534.6	37	c.5673	CCDS44891.1	12																																																																																			SCN8A	-	NULL	ENSG00000196876		0.547	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	HGNC	protein_coding	OTTHUMT00000404372.3	27	0.00	0	T	NM_014191		52200943	52200943	+1	no_errors	ENST00000354534	ensembl	human	known	69_37n	silent	30	14.29	5	SNP	0.997	C
SEL1L	6400	genome.wustl.edu	37	14	81955632	81955632	+	Silent	SNP	A	A	G			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr14:81955632A>G	ENST00000336735.4	-	14	1475	c.1359T>C	c.(1357-1359)ctT>ctC	p.L453L		NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	453	Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		AGGCCATTCCAAGCCCACTCT	0.428																																						dbGAP											0													96.0	89.0	91.0					14																	81955632		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.1359T>C	14.37:g.81955632A>G			Q6UWT6|Q9P1T9|Q9UHK7	Silent	SNP	pfam_Sel1-like,pfam_FN_type2_col-bd,superfamily_Kringle-like,smart_FN_type2_col-bd,smart_Sel1-like,pfscan_FN_type2_col-bd	p.L453	ENST00000336735.4	37	c.1359	CCDS9876.1	14																																																																																			SEL1L	-	pfam_Sel1-like,smart_Sel1-like	ENSG00000071537		0.428	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEL1L	HGNC	protein_coding	OTTHUMT00000413325.1	34	0.00	0	A	NM_005065		81955632	81955632	-1	no_errors	ENST00000336735	ensembl	human	known	69_37n	silent	28	12.50	4	SNP	0.880	G
SERPINB9	5272	genome.wustl.edu	37	6	2890539	2890539	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr6:2890539G>A	ENST00000380698.4	-	7	1078	c.989C>T	c.(988-990)gCg>gTg	p.A330V		NM_004155.5	NP_004146.1	P50453	SPB9_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 9	330					cellular response to estrogen stimulus (GO:0071391)|immune response (GO:0006955)|mast cell mediated immunity (GO:0002448)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(4)|large_intestine(3)|lung(5)|pancreas(1)|prostate(1)	15	Ovarian(93;0.0412)	all_hematologic(90;0.108)				CGACGCTGCCGCTGCCTCGGT	0.537																																						dbGAP											0													104.0	91.0	96.0					6																	2890539		2203	4300	6503	-	-	-	SO:0001583	missense	0			L40378	CCDS4478.1	6p25.2	2014-02-18	2005-08-18		ENSG00000170542	ENSG00000170542		"""Serine (or cysteine) peptidase inhibitors"""	8955	protein-coding gene	gene with protein product		601799	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 9"""	PI9		8530382, 9858835, 24172014	Standard	NM_004155		Approved	CAP3	uc003mug.4	P50453	OTTHUMG00000014131	ENST00000380698.4:c.989C>T	6.37:g.2890539G>A	ENSP00000370074:p.Ala330Val		B2RBW3|Q5TD03	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom,prints_Serpin_B9/Maspin	p.A330V	ENST00000380698.4	37	c.989	CCDS4478.1	6	.	.	.	.	.	.	.	.	.	.	G	16.27	3.076884	0.55753	.	.	ENSG00000170542	ENST00000380698	D	0.85629	-2.01	4.66	2.87	0.33458	Serpin domain (3);	0.099724	0.64402	N	0.000002	D	0.83031	0.5166	M	0.89214	3.015	0.58432	D	0.999997	B	0.25850	0.136	B	0.36504	0.226	T	0.81656	-0.0834	10	0.51188	T	0.08	.	10.4487	0.44509	0.1619:0.0:0.8381:0.0	.	330	P50453	SPB9_HUMAN	V	330	ENSP00000370074:A330V	ENSP00000370074:A330V	A	-	2	0	SERPINB9	2835538	0.938000	0.31826	0.001000	0.08648	0.014000	0.08584	3.700000	0.54786	0.645000	0.30675	-0.137000	0.14449	GCG	SERPINB9	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000170542		0.537	SERPINB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB9	HGNC	protein_coding	OTTHUMT00000039656.1	22	0.00	0	G			2890539	2890539	-1	no_errors	ENST00000380698	ensembl	human	known	69_37n	missense	14	46.15	12	SNP	0.852	A
SIAH3	283514	genome.wustl.edu	37	13	46358082	46358082	+	Silent	SNP	G	G	C			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr13:46358082G>C	ENST00000400405.2	-	2	352	c.246C>G	c.(244-246)cgC>cgG	p.R82R		NM_198849.2	NP_942146.2	Q8IW03	SIAH3_HUMAN	siah E3 ubiquitin protein ligase family member 3	82	His-rich.				multicellular organismal development (GO:0007275)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			large_intestine(3)|lung(7)|ovary(1)|skin(1)	12						gggcgtggtggcggaggtggt	0.682																																						dbGAP											0													25.0	31.0	29.0					13																	46358082		2151	4235	6386	-	-	-	SO:0001819	synonymous_variant	0				CCDS41883.1	13q14.12	2012-02-23	2012-02-23		ENSG00000215475	ENSG00000215475			30553	protein-coding gene	gene with protein product		615609	"""seven in absentia homolog 3 (Drosophila)"""			12477932	Standard	NM_198849		Approved	FLJ39203	uc001vap.3	Q8IW03	OTTHUMG00000016862	ENST00000400405.2:c.246C>G	13.37:g.46358082G>C			B7ZBP0|Q8N8M6	Silent	SNP	pfam_7-in-absentia-prot_TRAF-dom,superfamily_TRAF-like	p.R82	ENST00000400405.2	37	c.246	CCDS41883.1	13																																																																																			SIAH3	-	NULL	ENSG00000215475		0.682	SIAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIAH3	HGNC	protein_coding	OTTHUMT00000044788.2	13	0.00	0	G	NM_198849		46358082	46358082	-1	no_errors	ENST00000400405	ensembl	human	known	69_37n	silent	17	26.09	6	SNP	0.116	C
SLC22A9	114571	genome.wustl.edu	37	11	63149641	63149641	+	Missense_Mutation	SNP	C	C	G	rs373670819	byFrequency	TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr11:63149641C>G	ENST00000279178.3	+	6	1214	c.965C>G	c.(964-966)tCc>tGc	p.S322C	SLC22A9_ENST00000310969.4_3'UTR	NM_080866.2	NP_543142.2	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion transporter), member 9	322					hormone transport (GO:0009914)|short-chain fatty acid import (GO:0015913)|sodium-independent organic anion transport (GO:0043252)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	anion:anion antiporter activity (GO:0015301)|short-chain fatty acid uptake transporter activity (GO:0015636)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	18						ATTTTGAAATCCACCATGAAA	0.418																																						dbGAP											0													143.0	147.0	146.0					11																	63149641		2201	4298	6499	-	-	-	SO:0001583	missense	0			AP001880	CCDS8043.1	11q12.3	2014-05-20	2008-01-11		ENSG00000149742	ENSG00000149742		"""Solute carriers"""	16261	protein-coding gene	gene with protein product		607579				11327718, 17393504	Standard	NM_080866		Approved	OAT4, FLJ23666, UST3, OAT7	uc001nww.3	Q8IVM8	OTTHUMG00000167805	ENST00000279178.3:c.965C>G	11.37:g.63149641C>G	ENSP00000279178:p.Ser322Cys		A0AVB7|A4PB24|Q8TCC8|Q8TEC0|Q8WYN7	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S322C	ENST00000279178.3	37	c.965	CCDS8043.1	11	.	.	.	.	.	.	.	.	.	.	C	15.55	2.865828	0.51588	.	.	ENSG00000149742	ENST00000279178	T	0.67171	-0.25	3.43	2.5	0.30297	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	.	.	.	.	T	0.79040	0.4379	M	0.82323	2.585	0.09310	N	0.999997	D	0.76494	0.999	D	0.67231	0.95	T	0.65467	-0.6161	9	0.66056	D	0.02	.	6.8869	0.24208	0.0:0.8671:0.0:0.1329	.	322	Q8IVM8	S22A9_HUMAN	C	322	ENSP00000279178:S322C	ENSP00000279178:S322C	S	+	2	0	SLC22A9	62906217	0.001000	0.12720	0.002000	0.10522	0.674000	0.39518	1.219000	0.32479	0.813000	0.34350	0.134000	0.15878	TCC	SLC22A9	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000149742		0.418	SLC22A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A9	HGNC	protein_coding	OTTHUMT00000396371.1	48	0.00	0	C	NM_080866		63149641	63149641	+1	no_errors	ENST00000279178	ensembl	human	known	69_37n	missense	50	17.74	11	SNP	0.004	G
SLC25A27	9481	genome.wustl.edu	37	6	46623636	46623636	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr6:46623636C>A	ENST00000371347.5	+	2	415	c.163C>A	c.(163-165)Ctt>Att	p.L55I	SLC25A27_ENST00000411689.2_Missense_Mutation_p.L55I|SLC25A27_ENST00000452689.2_De_novo_Start_InFrame	NM_001204051.1|NM_004277.4	NP_001190980.1|NP_004268.3	O95847	UCP4_HUMAN	solute carrier family 25, member 27	55					cellular triglyceride homeostasis (GO:0035356)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|negative regulation of mitochondrial membrane potential (GO:0010917)|neuron death (GO:0070997)|positive regulation of cell proliferation (GO:0008284)|regulation of glucose import (GO:0046324)|transport (GO:0006810)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)				central_nervous_system(1)|kidney(1)|lung(4)|prostate(1)|urinary_tract(1)	8			Lung(136;0.192)			AGAAGCAGCTCTTGCTCGGTT	0.483																																						dbGAP											0													79.0	80.0	80.0					6																	46623636		1875	4105	5980	-	-	-	SO:0001583	missense	0			AK090871	CCDS43470.1, CCDS56431.1	6p12.3	2013-05-22			ENSG00000153291	ENSG00000153291		"""Solute carriers"""	21065	protein-coding gene	gene with protein product		613725				10025957, 10772343	Standard	NM_004277		Approved	UCP4, FLJ33552	uc003oyh.3	O95847	OTTHUMG00000014786	ENST00000371347.5:c.163C>A	6.37:g.46623636C>A	ENSP00000360398:p.Leu55Ile		F5GWR4|Q5VTS9|Q8N518	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.L55I	ENST00000371347.5	37	c.163	CCDS43470.1	6	.	.	.	.	.	.	.	.	.	.	C	11.29	1.595732	0.28445	.	.	ENSG00000153291	ENST00000371347;ENST00000411689	T;T	0.78707	-1.2;-1.2	5.51	4.63	0.57726	Mitochondrial carrier domain (2);	0.000000	0.50627	D	0.000105	T	0.54062	0.1835	L	0.35723	1.085	0.80722	D	1	B;B	0.31485	0.139;0.325	B;B	0.32090	0.14;0.067	T	0.58306	-0.7659	10	0.36615	T	0.2	-12.1441	8.8868	0.35409	0.0:0.8303:0.0:0.1697	.	55;55	O95847;F5GWR4	UCP4_HUMAN;.	I	55	ENSP00000360398:L55I;ENSP00000412024:L55I	ENSP00000360398:L55I	L	+	1	0	SLC25A27	46731595	0.414000	0.25408	1.000000	0.80357	0.996000	0.88848	0.967000	0.29344	2.564000	0.86499	0.650000	0.86243	CTT	SLC25A27	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000153291		0.483	SLC25A27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A27	HGNC	protein_coding	OTTHUMT00000040791.1	37	0.00	0	C	NM_004277		46623636	46623636	+1	no_errors	ENST00000371347	ensembl	human	known	69_37n	missense	54	11.48	7	SNP	0.995	A
SZT2	23334	genome.wustl.edu	37	1	43911636	43911636	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr1:43911636A>T	ENST00000562955.1	+	62	8726	c.8726A>T	c.(8725-8727)aAg>aTg	p.K2909M	SZT2_ENST00000372442.1_Missense_Mutation_p.K2067M|SZT2-AS1_ENST00000396885.2_RNA	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	2966					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						CCTAAAACCAAGACTGATGGG	0.502																																						dbGAP											0													68.0	66.0	67.0					1																	43911636		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.8726A>T	1.37:g.43911636A>T	ENSP00000457168:p.Lys2909Met		A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	NULL	p.K2909M	ENST00000562955.1	37	c.8726	CCDS30694.2	1	.	.	.	.	.	.	.	.	.	.	A	17.41	3.381802	0.61845	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.57154	0.2034	L	0.29908	0.895	0.29764	N	0.835325	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.59037	-0.7529	9	0.72032	D	0.01	.	14.2222	0.65836	1.0:0.0:0.0:0.0	.	2966;2909	Q5T011;Q5T011-5	SZT2_HUMAN;.	M	2067	.	ENSP00000361519:K2067M	K	+	2	0	SZT2	43684223	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.067000	0.64357	1.984000	0.57885	0.533000	0.62120	AAG	SZT2	-	NULL	ENSG00000198198		0.502	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SZT2	HGNC	protein_coding	OTTHUMT00000019517.3	41	0.00	0	A	NM_015284		43911636	43911636	+1	no_errors	ENST00000562955	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	T
NDC1	55706	genome.wustl.edu	37	1	54298190	54298192	+	In_Frame_Del	DEL	TTA	TTA	-	rs577226450		TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	TTA	TTA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr1:54298190_54298192delTTA	ENST00000371429.3	-	3	849_851	c.251_253delTAA	c.(250-255)ataagt>agt	p.I84del	NDC1_ENST00000537333.1_5'UTR|NDC1_ENST00000540001.1_In_Frame_Del_p.I84del|NDC1_ENST00000234725.8_5'UTR|NDC1_ENST00000480952.1_5'UTR	NM_001168551.1|NM_018087.4	NP_001162023.1|NP_060557.3	Q9BTX1	NDC1_HUMAN	NDC1 transmembrane nucleoporin	84					mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore distribution (GO:0031081)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)										TTGAAAATACTTATTATTATTAT	0.305																																						dbGAP											0									,	223,4033		40,143,1945					,	4.0	1.0			44	436,7808		95,246,3781	no	coding,coding	TMEM48	NM_018087.4,NM_001168551.1	,	135,389,5726	A1A1,A1R,RR		5.2887,5.2397,5.272	,	,		659,11841				-	-	-	SO:0001651	inframe_deletion	0			AL354613	CCDS583.1	1p32.3	2014-01-28	2013-05-23	2013-05-23	ENSG00000058804	ENSG00000058804			25525	protein-coding gene	gene with protein product	"""nuclear division cycle 1 homolog (S. cerevisiae)"""	610115	"""transmembrane protein 48"""	TMEM48		16779818, 12958361	Standard	NR_033142		Approved	FLJ10407, NET3		Q9BTX1	OTTHUMG00000008073	ENST00000371429.3:c.251_253delTAA	1.37:g.54298199_54298201delTTA	ENSP00000360483:p.Ile84del		B4DHA3|B4DQQ5|G3XA81|Q8NB76|Q9H9T6|Q9NSG3|Q9NSG4|Q9NVZ7	In_Frame_Del	DEL	pfam_Nucleoporin_prot_Ndc1/Nup	p.I84in_frame_del	ENST00000371429.3	37	c.253_251	CCDS583.1	1																																																																																			TMEM48	-	pfam_Nucleoporin_prot_Ndc1/Nup	ENSG00000058804		0.305	NDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM48	HGNC	protein_coding	OTTHUMT00000022101.1	28	0.00	0	TTA	NM_018087		54298190	54298192	-1	no_errors	ENST00000371429	ensembl	human	known	69_37n	in_frame_del	45	11.76	6	DEL	0.991:0.982:0.979	-
TNFRSF11A	8792	genome.wustl.edu	37	18	60036221	60036221	+	Silent	SNP	A	A	G			TCGA-EW-A2FS-01A-11D-A17D-09	TCGA-EW-A2FS-10A-01D-A17D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e8aeaa53-be93-48db-bf32-900947a6cf05	663bdc96-b603-4dd7-ab57-27e5ca557a57	g.chr18:60036221A>G	ENST00000586569.1	+	9	1109	c.1071A>G	c.(1069-1071)acA>acG	p.T357T	TNFRSF11A_ENST00000269485.7_Intron	NM_001270949.1|NM_003839.3	NP_001257878.1|NP_003830.1	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily, member 11a, NFKB activator	357					adaptive immune response (GO:0002250)|cell-cell signaling (GO:0007267)|circadian temperature homeostasis (GO:0060086)|lymph node development (GO:0048535)|mammary gland alveolus development (GO:0060749)|monocyte chemotaxis (GO:0002548)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|response to cytokine (GO:0034097)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to radiation (GO:0009314)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(13)|skin(3)|upper_aerodigestive_tract(1)	29		Colorectal(73;0.188)				CCCAGCCCACAGACCAGTTAC	0.527																																						dbGAP											0													94.0	79.0	84.0					18																	60036221		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF018253	CCDS11980.1, CCDS59324.1, CCDS74227.1, CCDS74228.1	18q22.1	2014-09-17			ENSG00000141655	ENSG00000141655		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11908	protein-coding gene	gene with protein product		603499	"""tumor necrosis factor receptor superfamily, member 11a, activator of NFKB"", ""Paget disease of bone 2"", ""loss of heterozygosity, 18, chromosomal region 1"""	PDB2, LOH18CR1		9367155, 10615125	Standard	NM_001270951		Approved	RANK, CD265, FEO	uc002lin.4	Q9Y6Q6	OTTHUMG00000132779	ENST00000586569.1:c.1071A>G	18.37:g.60036221A>G			I4EC36|I4EC38|I4EC39|I7JE63|N0GVH0|Q59EP9	Silent	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,prints_TNFR_11A,prints_TNFR_11,pfscan_TNFR/NGFR_Cys_rich_reg	p.T357	ENST00000586569.1	37	c.1071	CCDS11980.1	18																																																																																			TNFRSF11A	-	prints_TNFR_11A	ENSG00000141655		0.527	TNFRSF11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF11A	HGNC	protein_coding	OTTHUMT00000256186.2	35	0.00	0	A			60036221	60036221	+1	no_errors	ENST00000586569	ensembl	human	known	69_37n	silent	25	13.79	4	SNP	0.014	G
