#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AARS	16	genome.wustl.edu	37	16	70296393	70296393	+	Silent	SNP	C	C	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr16:70296393C>T	ENST00000261772.8	-	12	1670	c.1527G>A	c.(1525-1527)ctG>ctA	p.L509L	AARS_ENST00000564359.1_Intron|RN7SL407P_ENST00000583724.1_RNA	NM_001605.2	NP_001596.2			alanyl-tRNA synthetase											breast(3)|cervix(2)|endometrium(5)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)		TCTCCCTGCGCAGAGCCATCA	0.527																																						dbGAP											0													128.0	96.0	106.0					16																	70296393		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			D32050	CCDS32474.1	16q22.1	2014-09-17			ENSG00000090861	ENSG00000090861	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	20	protein-coding gene	gene with protein product	"""alanine tRNA ligase 1, cytoplasmic"""	601065				8595897	Standard	NM_001605		Approved		uc002eyn.1	P49588	OTTHUMG00000177042	ENST00000261772.8:c.1527G>A	16.37:g.70296393C>T				Silent	SNP	pfam_Ala-tRNA-synth_IIc_N,pfam_tRNA_SAD,pfam_Pesterase_DHHA1,superfamily_Ala-tRNA-synth_IIc_anticod-bd,superfamily_Thr/Ala-tRNA-synth_IIc_edit,smart_tRNA_SAD,prints_Ala-tRNA-synth_IIc,pfscan_Ala-tRNA-synth_IIc_core,tigrfam_Ala-tRNA-synth_IIc	p.L509	ENST00000261772.8	37	c.1527	CCDS32474.1	16																																																																																			AARS	-	pfam_Ala-tRNA-synth_IIc_N,pfscan_Ala-tRNA-synth_IIc_core,tigrfam_Ala-tRNA-synth_IIc	ENSG00000090861		0.527	AARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AARS	HGNC	protein_coding	OTTHUMT00000435021.2	32	0.00	0	C	NM_001605		70296393	70296393	-1	no_errors	ENST00000261772	ensembl	human	known	69_37n	silent	21	16.00	4	SNP	1.000	T
ACAP1	9744	genome.wustl.edu	37	17	7249758	7249758	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr17:7249758C>T	ENST00000158762.3	+	12	1161	c.955C>T	c.(955-957)Ctc>Ttc	p.L319F		NM_014716.3	NP_055531.1	Q15027	ACAP1_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1	319	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.|Required for formation of endosomal tubules when overexpressed with PIP5K1C.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)	endosome (GO:0005768)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(3)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(3)|skin(1)|urinary_tract(1)	33						CACAGTGAAACTCTGCCCTGA	0.532											OREG0024135	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													130.0	113.0	119.0					17																	7249758		2203	4300	6503	-	-	-	SO:0001583	missense	0			D30758	CCDS11101.1	17p13.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000072818	ENSG00000072818		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16467	protein-coding gene	gene with protein product		607763	"""centaurin, beta 1"""	CENTB1		11050434, 11062263	Standard	NM_014716		Approved	KIAA0050	uc002ggd.2	Q15027	OTTHUMG00000102199	ENST00000158762.3:c.955C>T	17.37:g.7249758C>T	ENSP00000158762:p.Leu319Phe	640	Q53XN9	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_ArfGAP,prints_ArfGAP	p.L319F	ENST00000158762.3	37	c.955	CCDS11101.1	17	.	.	.	.	.	.	.	.	.	.	C	11.86	1.765731	0.31228	.	.	ENSG00000072818	ENST00000158762	T	0.75589	-0.95	5.59	5.59	0.84812	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.280429	0.34460	N	0.003956	T	0.78910	0.4358	L	0.45137	1.4	0.80722	D	1	D	0.60575	0.988	P	0.59288	0.855	T	0.74878	-0.3514	10	0.26408	T	0.33	.	17.0756	0.86585	0.0:1.0:0.0:0.0	.	319	Q15027	ACAP1_HUMAN	F	319	ENSP00000158762:L319F	ENSP00000158762:L319F	L	+	1	0	ACAP1	7190482	1.000000	0.71417	1.000000	0.80357	0.630000	0.37929	2.748000	0.47483	2.645000	0.89757	0.491000	0.48974	CTC	ACAP1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000072818		0.532	ACAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAP1	HGNC	protein_coding	OTTHUMT00000220049.4	85	0.00	0	C	NM_014716		7249758	7249758	+1	no_errors	ENST00000158762	ensembl	human	known	69_37n	missense	103	12.71	15	SNP	1.000	T
PHYKPL	85007	genome.wustl.edu	37	5	177656992	177656992	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr5:177656992A>T	ENST00000308158.5	-	3	521	c.287T>A	c.(286-288)cTg>cAg	p.L96Q	PHYKPL_ENST00000476170.2_Missense_Mutation_p.L96Q|PHYKPL_ENST00000481811.1_Intron	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	96						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	GGTCTCTGACAGCCTCTGCGC	0.567																																						dbGAP											0													123.0	114.0	117.0					5																	177656992		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.287T>A	5.37:g.177656992A>T	ENSP00000310978:p.Leu96Gln		A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom	p.L96Q	ENST00000308158.5	37	c.287	CCDS4434.1	5	.	.	.	.	.	.	.	.	.	.	A	21.5	4.164244	0.78339	.	.	ENSG00000175309	ENST00000308158;ENST00000323594;ENST00000476170	D;T;D	0.91996	-2.95;-0.13;-2.95	5.26	4.09	0.47781	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.080835	0.52532	D	0.000066	D	0.97701	0.9246	H	0.99732	4.735	0.58432	D	0.999998	D	0.89917	1.0	D	0.81914	0.995	D	0.96687	0.9508	10	0.87932	D	0	-2.1552	9.4354	0.38635	0.9146:0.0:0.0854:0.0	.	96	Q8IUZ5	AT2L2_HUMAN	Q	96;110;96	ENSP00000310978:L96Q;ENSP00000321290:L110Q;ENSP00000421810:L96Q	ENSP00000310978:L96Q	L	-	2	0	AGXT2L2	177589598	1.000000	0.71417	0.804000	0.32291	0.989000	0.77384	9.259000	0.95561	0.956000	0.37904	0.459000	0.35465	CTG	AGXT2L2	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000175309		0.567	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT2L2	HGNC	protein_coding	OTTHUMT00000253477.1	40	0.00	0	A	NM_032921		177656992	177656992	-1	no_errors	ENST00000308158	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	0.998	T
AIFM1	9131	genome.wustl.edu	37	X	129299563	129299563	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chrX:129299563A>C	ENST00000287295.3	-	1	298	c.68T>G	c.(67-69)gTg>gGg	p.V23G	AIFM1_ENST00000319908.3_Missense_Mutation_p.V23G|AIFM1_ENST00000535724.1_5'UTR|AIFM1_ENST00000346424.2_Missense_Mutation_p.V23G	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1	23					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	TCGGACGCACACGGTCCGCAC	0.657																																						dbGAP											0													55.0	37.0	43.0					X																	129299563		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.68T>G	X.37:g.129299563A>C	ENSP00000287295:p.Val23Gly		A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_OxRdtase_NAD-bd_dom,superfamily_FAD/NAD-linked_Rdtase_dimer,prints_FAD_pyr_nucl-diS_OxRdtase	p.V23G	ENST00000287295.3	37	c.68	CCDS14618.1	X	.	.	.	.	.	.	.	.	.	.	A	15.15	2.747693	0.49257	.	.	ENSG00000156709	ENST00000346424;ENST00000319908;ENST00000287295	T;T;T	0.56611	0.45;1.01;1.01	4.67	2.1	0.27182	.	0.584196	0.18673	N	0.134388	T	0.42268	0.1195	L	0.47716	1.5	0.58432	D	0.999999	B;B;P;B	0.40211	0.003;0.0;0.707;0.393	B;B;B;B	0.40066	0.002;0.0;0.318;0.143	T	0.27971	-1.0058	10	0.87932	D	0	-0.7765	4.4558	0.11642	0.5946:0.2047:0.0:0.2007	.	23;23;23;23	Q1L6K6;O95831-2;O95831-3;O95831	.;.;.;AIFM1_HUMAN	G	23	ENSP00000316320:V23G;ENSP00000315122:V23G;ENSP00000287295:V23G	ENSP00000287295:V23G	V	-	2	0	AIFM1	129127244	0.985000	0.35326	0.925000	0.36789	0.997000	0.91878	1.625000	0.37029	0.190000	0.20209	0.486000	0.48141	GTG	AIFM1	-	NULL	ENSG00000156709		0.657	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIFM1	HGNC	protein_coding	OTTHUMT00000058247.2	80	0.00	0	A			129299563	129299563	-1	no_errors	ENST00000287295	ensembl	human	known	69_37n	missense	66	15.38	12	SNP	0.739	C
ALS2CL	259173	genome.wustl.edu	37	3	46729146	46729146	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr3:46729146C>A	ENST00000318962.4	-	4	414	c.331G>T	c.(331-333)Gtg>Ttg	p.V111L	ALS2CL_ENST00000415953.1_Missense_Mutation_p.V111L	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	111					endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		GCCTGCACCACCATGCAGCTT	0.622																																						dbGAP											0													113.0	91.0	99.0					3																	46729146		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.331G>T	3.37:g.46729146C>A	ENSP00000313670:p.Val111Leu		Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Missense_Mutation	SNP	pfam_MORN,pfam_VPS9,superfamily_DH-domain,smart_MORN,pfscan_VPS9	p.V111L	ENST00000318962.4	37	c.331	CCDS2743.1	3	.	.	.	.	.	.	.	.	.	.	C	14.39	2.521841	0.44866	.	.	ENSG00000178038	ENST00000318962;ENST00000415953	T;T	0.16324	2.35;2.35	4.89	4.89	0.63831	Dbl homology (DH) domain (1);	0.327319	0.25925	N	0.027410	T	0.12433	0.0302	L	0.34521	1.04	0.80722	D	1	P	0.41393	0.748	B	0.31812	0.136	T	0.03818	-1.1001	10	0.66056	D	0.02	.	13.4162	0.60970	0.0:1.0:0.0:0.0	.	111	Q60I27	AL2CL_HUMAN	L	111	ENSP00000313670:V111L;ENSP00000413223:V111L	ENSP00000313670:V111L	V	-	1	0	ALS2CL	46704150	0.964000	0.33143	0.623000	0.29173	0.493000	0.33554	3.806000	0.55583	2.541000	0.85698	0.591000	0.81541	GTG	ALS2CL	-	superfamily_DH-domain	ENSG00000178038		0.622	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2CL	HGNC	protein_coding	OTTHUMT00000250567.3	39	0.00	0	C	NM_147129		46729146	46729146	-1	no_errors	ENST00000318962	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	0.862	A
ANKRD18DP	348840	genome.wustl.edu	37	3	197785509	197785509	+	RNA	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr3:197785509G>A	ENST00000435620.2	-	0	1789					NR_003291.1				ankyrin repeat domain 18D, pseudogene																		GTTGAAGCAAGAGACTGTCAC	0.423																																						dbGAP											0																																										-	-	-			0			BC042518		3q29	2011-11-23			ENSG00000226435	ENSG00000226435			28016	pseudogene	pseudogene							Standard	NR_003291		Approved		uc003fyx.3		OTTHUMG00000150228		3.37:g.197785509G>A				RNA	SNP	-	NULL	ENST00000435620.2	37	NULL		3																																																																																			ANKRD18DP	-	-	ENSG00000226435		0.423	ANKRD18DP-001	KNOWN	basic	processed_transcript	ANKRD18DP	HGNC	pseudogene	OTTHUMT00000316910.2	42	0.00	0	G	NR_003291		197785509	197785509	-1	no_errors	ENST00000335478	ensembl	human	known	69_37n	rna	31	20.51	8	SNP	0.941	A
ARNTL	406	genome.wustl.edu	37	11	13381920	13381920	+	Silent	SNP	C	C	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr11:13381920C>T	ENST00000403290.1	+	9	763	c.408C>T	c.(406-408)aaC>aaT	p.N136N	ARNTL_ENST00000361003.4_Silent_p.N136N|ARNTL_ENST00000401424.1_Silent_p.N93N|ARNTL_ENST00000403482.3_Silent_p.N134N|ARNTL_ENST00000389707.4_Silent_p.N136N|ARNTL_ENST00000389708.3_Silent_p.N136N|ARNTL_ENST00000403510.3_Silent_p.N93N|ARNTL_ENST00000497429.1_3'UTR|ARNTL_ENST00000396441.3_Silent_p.N136N			O00327	BMAL1_HUMAN	aryl hydrocarbon receptor nuclear translocator-like	136					circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of cell cycle (GO:0051726)|regulation of cellular senescence (GO:2000772)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|nuclear body (GO:0016604)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|Hsp90 protein binding (GO:0051879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|signal transducer activity (GO:0004871)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(2)|large_intestine(11)|lung(5)|upper_aerodigestive_tract(1)	20				Epithelial(150;0.0243)		CAGAAGCAAACTACAAACCAA	0.348																																						dbGAP											0													182.0	164.0	170.0					11																	13381920		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0			D89722	CCDS31430.1, CCDS44543.1, CCDS73259.1	11p15	2013-05-21			ENSG00000133794	ENSG00000133794		"""Basic helix-loop-helix proteins"""	701	protein-coding gene	gene with protein product		602550				9144434, 9079689	Standard	XM_005252930		Approved	MOP3, JAP3, BMAL1, PASD3, bHLHe5	uc001mkp.3	O00327	OTTHUMG00000150623	ENST00000403290.1:c.408C>T	11.37:g.13381920C>T			A2I2N6|A8K645|B5ME11|B7WPG7|D3DQW6|O00313|O00314|O00315|O00316|O00317|Q4G136|Q8IUT4|Q99631|Q99649	Silent	SNP	pfam_PAS_fold,pfam_PAS_fold_3,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,prints_Nuc_translocat,pfscan_PAS,pfscan_HLH_DNA-bd,tigrfam_PAS	p.N136	ENST00000403290.1	37	c.408		11																																																																																			ARNTL	-	superfamily_HLH_DNA-bd	ENSG00000133794		0.348	ARNTL-004	KNOWN	basic|appris_candidate_longest	protein_coding	ARNTL	HGNC	protein_coding	OTTHUMT00000319173.1	37	0.00	0	C	NM_001178		13381920	13381920	+1	no_errors	ENST00000403290	ensembl	human	known	69_37n	silent	18	25.00	6	SNP	1.000	T
ASPM	259266	genome.wustl.edu	37	1	197112244	197112244	+	Missense_Mutation	SNP	G	G	C	rs587783215		TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:197112244G>C	ENST00000367409.4	-	3	1394	c.1138C>G	c.(1138-1140)Cag>Gag	p.Q380E	ASPM_ENST00000294732.7_Missense_Mutation_p.Q380E	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	380					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TCTAGATCCTGATTTAGTCCA	0.299																																						dbGAP											0													48.0	52.0	51.0					1																	197112244		2187	4272	6459	-	-	-	SO:0001583	missense	0			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.1138C>G	1.37:g.197112244G>C	ENSP00000356379:p.Gln380Glu		Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.Q380E	ENST00000367409.4	37	c.1138	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	G	5.952	0.359571	0.11239	.	.	ENSG00000066279	ENST00000367409;ENST00000294732	T;T	0.53423	0.62;1.91	5.45	0.697	0.18081	.	0.594143	0.16232	N	0.223575	T	0.24509	0.0594	L	0.31578	0.945	0.09310	N	1	B;B	0.16396	0.0;0.017	B;B	0.04013	0.001;0.001	T	0.25916	-1.0118	10	0.02654	T	1	.	4.4795	0.11760	0.0891:0.4258:0.3494:0.1358	.	380;380	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	E	380	ENSP00000356379:Q380E;ENSP00000294732:Q380E	ENSP00000294732:Q380E	Q	-	1	0	ASPM	195378867	0.000000	0.05858	0.002000	0.10522	0.977000	0.68977	0.459000	0.21908	0.313000	0.23062	0.579000	0.79373	CAG	ASPM	-	NULL	ENSG00000066279		0.299	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1	28	0.00	0	G	NM_018136		197112244	197112244	-1	no_errors	ENST00000367409	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.001	C
ATOH8	84913	genome.wustl.edu	37	2	85999764	85999764	+	Intron	SNP	A	A	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr2:85999764A>C	ENST00000306279.3	+	2	1256				ATOH8_ENST00000463422.1_3'UTR	NM_032827.6	NP_116216.2	Q96SQ7	ATOH8_HUMAN	atonal homolog 8 (Drosophila)						cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(1)|lung(2)	5						CTCAGGATACAACAGCGCGAG	0.552																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK074681	CCDS1985.1	2p11.2	2013-05-21			ENSG00000168874	ENSG00000168874		"""Basic helix-loop-helix proteins"""	24126	protein-coding gene	gene with protein product	"""basic helix loop helix transcription factor 6"""					12419857	Standard	NM_032827		Approved	HATH6, FLJ14708, bHLHa21	uc002sqn.3	Q96SQ7	OTTHUMG00000130178	ENST00000306279.3:c.960+8459A>C	2.37:g.85999764A>C			Q504S2|Q659B0	RNA	SNP	-	NULL	ENST00000306279.3	37	NULL	CCDS1985.1	2																																																																																			ATOH8	-	-	ENSG00000168874		0.552	ATOH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATOH8	HGNC	protein_coding	OTTHUMT00000252496.1	36	0.00	0	A	NM_032827		85999764	85999764	+1	no_errors	ENST00000463422	ensembl	human	putative	69_37n	rna	19	20.83	5	SNP	1.000	C
B3GAT3	26229	genome.wustl.edu	37	11	62388132	62388132	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr11:62388132C>T	ENST00000265471.5	-	2	321	c.94G>A	c.(94-96)Gac>Aac	p.D32N	B3GAT3_ENST00000531383.1_Missense_Mutation_p.D32N|B3GAT3_ENST00000534026.1_Missense_Mutation_p.D32N	NM_012200.3	NP_036332.2	O94766	B3GA3_HUMAN	beta-1,3-glucuronyltransferase 3	32					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|glucuronosyltransferase activity (GO:0015020)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)|urinary_tract(1)	12						GGAAGGCAGTCACATGGCTGG	0.602																																						dbGAP											0													22.0	25.0	24.0					11																	62388132		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB009598	CCDS8025.1	11q12	2014-07-08	2014-07-08		ENSG00000149541	ENSG00000149541	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	923	protein-coding gene	gene with protein product	"""glucuronosyltransferase I"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 3"""	606374	"""beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)"""			9506957	Standard	NM_012200		Approved	GlcAT-I	uc001ntw.3	O94766	OTTHUMG00000167685	ENST00000265471.5:c.94G>A	11.37:g.62388132C>T	ENSP00000265471:p.Asp32Asn		B7ZAB3|Q96I06|Q9UEP0	Missense_Mutation	SNP	pfam_Glyco_trans_43	p.D32N	ENST00000265471.5	37	c.94	CCDS8025.1	11	.	.	.	.	.	.	.	.	.	.	C	29.5	5.013298	0.93346	.	.	ENSG00000149541	ENST00000265471;ENST00000531383;ENST00000534026;ENST00000534715	T;T;T;T	0.66280	-0.18;-0.19;-0.2;0.56	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.74959	0.3785	L	0.58101	1.795	0.53688	D	0.999977	D;D;D	0.89917	0.993;0.993;1.0	D;D;D	0.80764	0.984;0.984;0.994	T	0.73251	-0.4042	10	0.39692	T	0.17	.	14.9659	0.71193	0.0:1.0:0.0:0.0	.	32;38;32	B7ZAB3;Q5U676;O94766	.;.;B3GA3_HUMAN	N	32;32;32;55	ENSP00000265471:D32N;ENSP00000431359:D32N;ENSP00000432474:D32N;ENSP00000432854:D55N	ENSP00000265471:D32N	D	-	1	0	B3GAT3	62144708	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.222000	0.65277	2.599000	0.87857	0.655000	0.94253	GAC	B3GAT3	-	NULL	ENSG00000149541		0.602	B3GAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GAT3	HGNC	protein_coding	OTTHUMT00000395588.1	60	0.00	0	C	NM_012200		62388132	62388132	-1	no_errors	ENST00000265471	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	1.000	T
BAX	581	genome.wustl.edu	37	19	49459541	49459541	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr19:49459541G>A	ENST00000345358.7	+	4	372	c.320G>A	c.(319-321)tGg>tAg	p.W107*	BAX_ENST00000293288.8_Nonsense_Mutation_p.W107*|BAX_ENST00000415969.2_Nonsense_Mutation_p.W107*|BAX_ENST00000354470.3_Nonsense_Mutation_p.W58*|BAX_ENST00000539787.1_Nonsense_Mutation_p.W107*|BAX_ENST00000391871.3_3'UTR	NM_138761.3|NM_138764.4	NP_620116.1|NP_620119.2	Q07812	BAX_HUMAN	BCL2-associated X protein	107					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic process involved in patterning of blood vessels (GO:1902262)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|B cell homeostatic proliferation (GO:0002358)|B cell negative selection (GO:0002352)|B cell receptor apoptotic signaling pathway (GO:1990117)|blood vessel remodeling (GO:0001974)|cellular response to organic substance (GO:0071310)|cellular response to UV (GO:0034644)|cerebral cortex development (GO:0021987)|development of secondary sexual characteristics (GO:0045136)|ectopic germ cell programmed cell death (GO:0035234)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells within a tissue (GO:0048873)|hypothalamus development (GO:0021854)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein binding (GO:0032091)|neuron apoptotic process (GO:0051402)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic DNA fragmentation (GO:1902512)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of developmental pigmentation (GO:0048087)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-embryonic camera-type eye morphogenesis (GO:0048597)|protein homooligomerization (GO:0051260)|protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:0001844)|protein oligomerization (GO:0051259)|regulation of cell cycle (GO:0051726)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of mitochondrial membrane permeability involved in programmed necrotic cell death (GO:1902445)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of nitrogen utilization (GO:0006808)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|release of cytochrome c from mitochondria (GO:0001836)|release of matrix enzymes from mitochondria (GO:0032976)|response to axon injury (GO:0048678)|response to gamma radiation (GO:0010332)|response to salt stress (GO:0009651)|response to toxic substance (GO:0009636)|retina development in camera-type eye (GO:0060041)|retinal cell apoptotic process (GO:1990009)|retinal cell programmed cell death (GO:0046666)|Sertoli cell proliferation (GO:0060011)|spermatid differentiation (GO:0048515)|T cell homeostatic proliferation (GO:0001777)|thymocyte apoptotic process (GO:0070242)|transformed cell apoptotic process (GO:0006927)|vagina development (GO:0060068)|viral process (GO:0016032)	BAX complex (GO:0097144)|Bcl-2 family protein complex (GO:0097136)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrial permeability transition pore complex (GO:0005757)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	BH3 domain binding (GO:0051434)|channel activity (GO:0015267)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(7)|skin(2)|urinary_tract(4)	17		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000159)|all cancers(93;0.00047)|GBM - Glioblastoma multiforme(486;0.018)|Epithelial(262;0.0279)		AACTTCAACTGGGGCCGGGTT	0.592																																						dbGAP											0													70.0	74.0	73.0					19																	49459541		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS12742.1, CCDS12743.1, CCDS12744.1, CCDS12745.1, CCDS12745.2	19q13.3-q13.4	2014-03-07			ENSG00000087088	ENSG00000087088			959	protein-coding gene	gene with protein product		600040				8358790	Standard	NM_138761		Approved	BCL2L4	uc002plf.1	Q07812	OTTHUMG00000160476	ENST00000345358.7:c.320G>A	19.37:g.49459541G>A	ENSP00000263262:p.Trp107*		A8K4W1|P55269|Q07814|Q07815|Q8WZ49|Q9NR76|Q9NYG7|Q9UCZ6|Q9UCZ7|Q9UQD6	Nonsense_Mutation	SNP	pfam_Bcl2_BH,smart_Bcl2_BH,pfscan_Bcl2-like_apoptosis,prints_Bcl2_BH	p.W107*	ENST00000345358.7	37	c.320	CCDS12742.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.9|29.9	5.046942|5.046942	0.93740|0.93740	.|.	.|.	ENSG00000087088|ENSG00000087088	ENST00000506183|ENST00000539787;ENST00000345358;ENST00000415969;ENST00000354470;ENST00000293288	.|.	.|.	.|.	4.05|4.05	4.05|4.05	0.47172|0.47172	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.33177|.	0.0854|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.15065|.	-1.0450|.	4|.	.|0.02654	.|T	.|1	-8.8103|-8.8103	12.029|12.029	0.53388|0.53388	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	R|X	41|107;107;107;58;107	.|.	.|ENSP00000293288:W107X	G|W	+|+	1|2	0|0	BAX|BAX	54151353|54151353	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.958000|0.958000	0.62258|0.62258	6.967000|6.967000	0.76079|0.76079	2.549000|2.549000	0.85964|0.85964	0.563000|0.563000	0.77884|0.77884	GGG|TGG	BAX	-	pfam_Bcl2_BH,smart_Bcl2_BH,pfscan_Bcl2-like_apoptosis,prints_Bcl2_BH	ENSG00000087088		0.592	BAX-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BAX	HGNC	protein_coding	OTTHUMT00000360767.1	44	0.00	0	G	NM_138763		49459541	49459541	+1	no_errors	ENST00000293288	ensembl	human	known	69_37n	nonsense	23	17.86	5	SNP	1.000	A
BPIFB3	359710	genome.wustl.edu	37	20	31647749	31647749	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr20:31647749G>T	ENST00000375494.3	+	4	439	c.439G>T	c.(439-441)Gtg>Ttg	p.V147L	AL121756.1_ENST00000579962.1_RNA	NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	147	Leu-rich.				innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										GACATCGCGGGTGGCGCTGGC	0.652																																						dbGAP											0													78.0	62.0	68.0					20																	31647749		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.439G>T	20.37:g.31647749G>T	ENSP00000364643:p.Val147Leu		Q5TDX7	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.V147L	ENST00000375494.3	37	c.439	CCDS13212.1	20	.	.	.	.	.	.	.	.	.	.	G	12.82	2.051954	0.36181	.	.	ENSG00000186190	ENST00000375494	T	0.05447	3.44	4.79	3.8	0.43715	.	0.000000	0.50627	D	0.000104	T	0.17662	0.0424	M	0.61703	1.905	0.30013	N	0.815014	D	0.63046	0.992	D	0.77004	0.989	T	0.01074	-1.1460	10	0.25751	T	0.34	-17.5307	10.4137	0.44309	0.0:0.0:0.8065:0.1935	.	147	P59826	BPIB3_HUMAN	L	147	ENSP00000364643:V147L	ENSP00000364643:V147L	V	+	1	0	BPIFB3	31111410	1.000000	0.71417	1.000000	0.80357	0.068000	0.16541	3.016000	0.49607	2.481000	0.83766	0.561000	0.74099	GTG	BPIFB3	-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N	ENSG00000186190		0.652	BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB3	HGNC	protein_coding	OTTHUMT00000078654.2	33	0.00	0	G	NM_182658		31647749	31647749	+1	no_errors	ENST00000375494	ensembl	human	known	69_37n	missense	21	27.59	8	SNP	0.979	T
BTF3	689	genome.wustl.edu	37	5	72798898	72798898	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr5:72798898G>C	ENST00000335895.8	+	4	492	c.341G>C	c.(340-342)aGt>aCt	p.S114T	BTF3_ENST00000514505.2_3'UTR|BTF3_ENST00000380591.3_Missense_Mutation_p.S158T	NM_001207.4	NP_001198.2	O00478	BT3A3_HUMAN	basic transcription factor 3	316	Ig-like V-type 1.				T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(2)|lung(2)	5		Lung NSC(167;0.00405)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;2.73e-54)		GGTGCGGATAGTCTGACTAGT	0.463																																						dbGAP											0													72.0	72.0	72.0					5																	72798898		2203	4300	6503	-	-	-	SO:0001583	missense	0			M90352	CCDS4019.1, CCDS34185.1	5q13.3	2010-06-17			ENSG00000145741	ENSG00000145741			1125	protein-coding gene	gene with protein product		602542	"""nascent-polypeptide-associated complex beta polypeptide"""	NACB		2320128, 1386332, 15716105	Standard	NM_001207		Approved	BTF3a, BTF3b	uc003kcr.1	P20290	OTTHUMG00000102031	ENST00000335895.8:c.341G>C	5.37:g.72798898G>C	ENSP00000338516:p.Ser114Thr		B4DWI7|E9PCP5	Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx,pfscan_Nas_poly-pep-assoc_cplx	p.S158T	ENST00000335895.8	37	c.473	CCDS4019.1	5	.	.	.	.	.	.	.	.	.	.	G	21.2	4.112652	0.77210	.	.	ENSG00000145741	ENST00000335895;ENST00000380591;ENST00000507081;ENST00000509708	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	U	0.000000	T	0.69984	0.3172	M	0.76433	2.335	0.80722	D	1	P	0.41313	0.745	P	0.44394	0.448	T	0.72590	-0.4247	9	0.49607	T	0.09	-11.4046	19.2707	0.94008	0.0:0.0:1.0:0.0	.	158	P20290	BTF3_HUMAN	T	114;158;76;56	.	ENSP00000338516:S114T	S	+	2	0	BTF3	72834654	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.289000	0.96061	2.620000	0.88729	0.650000	0.86243	AGT	BTF3	-	NULL	ENSG00000145741		0.463	BTF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTF3	HGNC	protein_coding	OTTHUMT00000219815.2	43	0.00	0	G	NM_001207		72798898	72798898	+1	no_errors	ENST00000380591	ensembl	human	known	69_37n	missense	24	25.00	8	SNP	1.000	C
ADIRF	10974	genome.wustl.edu	37	10	88728307	88728307	+	Silent	SNP	A	A	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr10:88728307A>T	ENST00000372013.3	+	1	359	c.6A>T	c.(4-6)gcA>gcT	p.A2A	ADIRF-AS1_ENST00000440490.1_RNA|RP11-96C23.15_ENST00000609363.1_RNA|ADIRF-AS1_ENST00000418273.2_RNA|RP11-96C23.5_ENST00000433214.2_RNA|ADIRF-AS1_ENST00000609111.1_RNA	NM_006829.2	NP_006820.1	Q15847	ADIRF_HUMAN	adipogenesis regulatory factor	2					cell differentiation (GO:0030154)|cellular response to cisplatin (GO:0072719)|cellular response to radiation (GO:0071478)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of response to drug (GO:2001023)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)											AAGCCATGGCAAGCAAGGGCT	0.632																																						dbGAP											0													46.0	40.0	42.0					10																	88728307		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			BC004471	CCDS7381.1	10q23.31	2013-02-20	2013-02-20	2013-02-20	ENSG00000148671	ENSG00000148671			24043	protein-coding gene	gene with protein product	"""adipose specific 2"", ""adipose most abundant gene transcript 2"", ""adipogenesis factor rich in obesity"""		"""chromosome 10 open reading frame 116"""	C10orf116		8619847, 23239344	Standard	NM_006829		Approved	APM2, AFRO	uc001ked.2	Q15847	OTTHUMG00000018668	ENST00000372013.3:c.6A>T	10.37:g.88728307A>T				Silent	SNP	NULL	p.A2	ENST00000372013.3	37	c.6	CCDS7381.1	10																																																																																			C10orf116	-	NULL	ENSG00000148671		0.632	ADIRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf116	HGNC	protein_coding	OTTHUMT00000049194.1	40	0.00	0	A	NM_006829		88728307	88728307	+1	no_errors	ENST00000372013	ensembl	human	known	69_37n	silent	35	14.63	6	SNP	1.000	T
C15orf27	123591	genome.wustl.edu	37	15	76496517	76496517	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr15:76496517A>T	ENST00000388942.3	+	11	1733	c.1457A>T	c.(1456-1458)aAc>aTc	p.N486I		NM_152335.2	NP_689548.2	Q2M3C6	CO027_HUMAN	chromosome 15 open reading frame 27	486					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|membrane depolarization during action potential (GO:0086010)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	voltage-gated calcium channel activity (GO:0005245)			endometrium(1)|large_intestine(1)|lung(10)|pancreas(1)	13						AGTCTGTTCAACCAGAAGAAC	0.607																																						dbGAP											0													78.0	83.0	81.0					15																	76496517		2197	4294	6491	-	-	-	SO:0001583	missense	0			AK095509	CCDS10289.2	15q23-q24.1	2012-09-27			ENSG00000169758	ENSG00000169758			26763	protein-coding gene	gene with protein product						14702039, 22020278	Standard	NM_152335		Approved	FLJ38190	uc002bbq.3	Q2M3C6	OTTHUMG00000142918	ENST00000388942.3:c.1457A>T	15.37:g.76496517A>T	ENSP00000373594:p.Asn486Ile		Q8N993|Q96LL5	Missense_Mutation	SNP	NULL	p.N486I	ENST00000388942.3	37	c.1457	CCDS10289.2	15	.	.	.	.	.	.	.	.	.	.	A	21.4	4.140231	0.77775	.	.	ENSG00000169758	ENST00000388942	T	0.55413	0.52	4.75	4.75	0.60458	.	0.047350	0.85682	D	0.000000	T	0.65544	0.2701	M	0.74258	2.255	0.58432	D	0.999996	P	0.52061	0.95	P	0.55455	0.776	T	0.70586	-0.4831	10	0.87932	D	0	-18.6975	12.0307	0.53396	1.0:0.0:0.0:0.0	.	486	Q2M3C6	CO027_HUMAN	I	486	ENSP00000373594:N486I	ENSP00000373594:N486I	N	+	2	0	C15orf27	74283572	1.000000	0.71417	0.998000	0.56505	0.938000	0.57974	6.707000	0.74654	1.764000	0.52075	0.455000	0.32223	AAC	C15orf27	-	NULL	ENSG00000169758		0.607	C15orf27-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C15orf27	HGNC	protein_coding	OTTHUMT00000286637.2	18	0.00	0	A	NM_152335		76496517	76496517	+1	no_errors	ENST00000388942	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	1.000	T
CCDC178	374864	genome.wustl.edu	37	18	30926332	30926332	+	Silent	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr18:30926332G>T	ENST00000383096.3	-	9	683	c.501C>A	c.(499-501)ctC>ctA	p.L167L	CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000300227.8_Silent_p.L167L|CCDC178_ENST00000583930.1_Silent_p.L167L|CCDC178_ENST00000579947.1_Silent_p.L167L|CCDC178_ENST00000403303.1_Silent_p.L167L|CCDC178_ENST00000402325.1_Silent_p.L167L|CCDC178_ENST00000406524.2_Silent_p.L167L			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	167																	TGGCCTCTGAGAGCAATGTTT	0.348																																						dbGAP											0													89.0	84.0	86.0					18																	30926332		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.501C>A	18.37:g.30926332G>T			A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Silent	SNP	NULL	p.L167	ENST00000383096.3	37	c.501	CCDS42424.1	18																																																																																			C18orf34	-	NULL	ENSG00000166960		0.348	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C18orf34	HGNC	protein_coding	OTTHUMT00000255373.2	13	0.00	0	G	NM_198995		30926332	30926332	-1	no_errors	ENST00000406524	ensembl	human	known	69_37n	silent	16	30.43	7	SNP	0.093	T
C1orf101	257044	genome.wustl.edu	37	1	244780912	244780912	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:244780912G>T	ENST00000366534.4	+	20	2626	c.2572G>T	c.(2572-2574)Ggt>Tgt	p.G858C	C1orf101_ENST00000366533.4_Intron|C1orf101_ENST00000366531.3_Missense_Mutation_p.G707C	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101	858						CatSper complex (GO:0036128)				NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			CAGTTCTAATGGTAACCATAT	0.348																																						dbGAP											0													236.0	191.0	205.0					1																	244780912		692	1589	2281	-	-	-	SO:0001583	missense	0			BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.2572G>T	1.37:g.244780912G>T	ENSP00000355492:p.Gly858Cys		B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Missense_Mutation	SNP	NULL	p.G858C	ENST00000366534.4	37	c.2572	CCDS44340.1	1	.	.	.	.	.	.	.	.	.	.	G	8.317	0.823396	0.16678	.	.	ENSG00000179397	ENST00000366534;ENST00000428042;ENST00000366531	T;T;T	0.23147	1.92;1.92;1.92	5.73	-11.5	0.00074	.	2.830510	0.00942	N	0.002845	T	0.15912	0.0383	L	0.29908	0.895	0.09310	N	1	D;D	0.56035	0.961;0.974	B;P	0.46452	0.42;0.517	T	0.51671	-0.8676	10	0.46703	T	0.11	.	0.9743	0.01423	0.2309:0.1124:0.186:0.4707	.	778;858	B1AQM6;Q5SY80	.;CA101_HUMAN	C	858;778;707	ENSP00000355492:G858C;ENSP00000395796:G778C;ENSP00000355489:G707C	ENSP00000355489:G707C	G	+	1	0	C1orf101	242847535	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-2.836000	0.00740	-3.548000	0.00143	-0.290000	0.09829	GGT	C1orf101	-	NULL	ENSG00000179397		0.348	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	C1orf101	HGNC	protein_coding	OTTHUMT00000096701.1	33	0.00	0	G	NM_173807		244780912	244780912	+1	no_errors	ENST00000366534	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	0.000	T
CFAP61	26074	genome.wustl.edu	37	20	20144813	20144813	+	Missense_Mutation	SNP	G	G	T	rs116315783	byFrequency	TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr20:20144813G>T	ENST00000245957.5	+	11	1222	c.1146G>T	c.(1144-1146)agG>agT	p.R382S	C20orf26_ENST00000451767.2_Missense_Mutation_p.R382S|C20orf26_ENST00000377306.1_Missense_Mutation_p.R382S|C20orf26_ENST00000389656.3_5'UTR|C20orf26_ENST00000377309.2_5'UTR	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		382										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		CCATCTACAGGGGAGCCTCAG	0.498																																						dbGAP											0													119.0	118.0	118.0					20																	20144813		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000245957.5:c.1146G>T	20.37:g.20144813G>T	ENSP00000245957:p.Arg382Ser		A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase	p.R382S	ENST00000245957.5	37	c.1146	CCDS33447.1	20	.	.	.	.	.	.	.	.	.	.	G	17.80	3.478584	0.63849	.	.	ENSG00000089101	ENST00000340348;ENST00000389655;ENST00000245957;ENST00000377306;ENST00000451767	T;T;T	0.11930	2.73;2.73;2.73	5.47	-0.574	0.11738	.	0.525797	0.19809	N	0.105567	T	0.04452	0.0122	N	0.08118	0	0.54753	D	0.999989	B;B;B;B	0.29301	0.241;0.021;0.225;0.034	B;B;B;B	0.25140	0.058;0.014;0.053;0.04	T	0.43988	-0.9357	10	0.18710	T	0.47	.	3.5234	0.07751	0.4821:0.0:0.3351:0.1828	.	382;382;337;382	Q8NHU2-3;F8W6K4;F8W6E2;Q8NHU2	.;.;.;CT026_HUMAN	S	337;382;382;382;382	ENSP00000245957:R382S;ENSP00000366521:R382S;ENSP00000414537:R382S	ENSP00000245957:R382S	R	+	3	2	C20orf26	20092813	0.223000	0.23663	0.060000	0.19600	0.989000	0.77384	0.388000	0.20735	0.076000	0.16826	0.655000	0.94253	AGG	C20orf26	-	NULL	ENSG00000089101		0.498	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf26	HGNC	protein_coding	OTTHUMT00000078228.3	29	0.00	0	G			20144813	20144813	+1	no_errors	ENST00000245957	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	0.165	T
CATIP	375307	genome.wustl.edu	37	2	219232223	219232223	+	Silent	SNP	G	G	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr2:219232223G>C	ENST00000289388.3	+	9	932	c.903G>C	c.(901-903)tcG>tcC	p.S301S	AC021016.6_ENST00000441749.1_RNA|C2orf62_ENST00000481940.1_3'UTR	NM_198559.1	NP_940961.1	Q7Z7H3	CATIP_HUMAN		301					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGCTCTATTCGAAGTTCCTGG	0.547																																						dbGAP											0													108.0	110.0	109.0					2																	219232223		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000289388.3:c.903G>C	2.37:g.219232223G>C				Silent	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.S301	ENST00000289388.3	37	c.903	CCDS2414.1	2																																																																																			C2orf62	-	NULL	ENSG00000158428		0.547	C2orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf62	HGNC	protein_coding	OTTHUMT00000256771.1	56	0.00	0	G			219232223	219232223	+1	no_errors	ENST00000289388	ensembl	human	known	69_37n	silent	25	16.67	5	SNP	0.001	C
C4orf50	389197	genome.wustl.edu	37	4	5966798	5966798	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr4:5966798G>C	ENST00000324058.5	-	6	621	c.532C>G	c.(532-534)Ccc>Gcc	p.P178A	C4orf50_ENST00000531445.1_Missense_Mutation_p.P652A			Q6ZRC1	CD050_HUMAN	chromosome 4 open reading frame 50	178										breast(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(2)|skin(3)|urinary_tract(1)	15						TCCGGCTCGGGAATAGGCCAG	0.478																																						dbGAP											0													77.0	80.0	79.0					4																	5966798		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC140710		4p16.1	2009-04-14			ENSG00000181215	ENSG00000181215			33766	protein-coding gene	gene with protein product							Standard	XM_003119922		Approved	FLJ46481		Q6ZRC1	OTTHUMG00000149971	ENST00000324058.5:c.532C>G	4.37:g.5966798G>C	ENSP00000317287:p.Pro178Ala			Missense_Mutation	SNP	NULL	p.P652A	ENST00000324058.5	37	c.1954		4	.	.	.	.	.	.	.	.	.	.	G	3.863	-0.029409	0.07589	.	.	ENSG00000181215	ENST00000531445;ENST00000324058	T;T	0.44881	0.91;0.91	3.24	-0.525	0.11917	.	1.218190	0.06054	N	0.657082	T	0.34832	0.0911	L	0.53249	1.67	0.09310	N	1	P	0.40180	0.705	B	0.38327	0.271	T	0.28396	-1.0045	10	0.52906	T	0.07	-0.6427	2.7063	0.05163	0.3645:0.0:0.4273:0.2082	.	178	Q6ZRC1	CD050_HUMAN	A	652;178	ENSP00000437121:P652A;ENSP00000317287:P178A	ENSP00000317287:P178A	P	-	1	0	C4orf50	6017699	0.001000	0.12720	0.000000	0.03702	0.034000	0.12701	-0.096000	0.11059	-0.160000	0.11002	-0.218000	0.12543	CCC	C4orf50	-	NULL	ENSG00000181215		0.478	C4orf50-201	KNOWN	basic|appris_candidate	protein_coding	C4orf50	HGNC	protein_coding		28	0.00	0	G	NM_207405		5966798	5966798	-1	no_errors	ENST00000531445	ensembl	human	known	69_37n	missense	9	50.00	9	SNP	0.000	C
C9orf92	100129385	genome.wustl.edu	37	9	16215799	16215799	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr9:16215799delC	ENST00000380685.1	-	2	181	c.68delG	c.(67-69)agafs	p.R23fs	C9orf92_ENST00000380683.1_Frame_Shift_Del_p.R54fs			A6NGG3	CI092_HUMAN	chromosome 9 open reading frame 92	23																	GGTGGTGTTTCTCACATAGTA	0.507																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS65012.1	9p22.3	2012-03-26			ENSG00000205549	ENSG00000205549			19054	protein-coding gene	gene with protein product							Standard	NM_001271829		Approved	Em:AL513424.1	uc031tcu.1	A6NGG3	OTTHUMG00000019588	ENST00000380685.1:c.68delG	9.37:g.16215799delC	ENSP00000370060:p.Arg23fs		A6NMF8	Frame_Shift_Del	DEL	NULL	p.R54fs	ENST00000380685.1	37	c.161		9																																																																																			C9orf92	-	NULL	ENSG00000205549		0.507	C9orf92-001	KNOWN	basic|appris_candidate	protein_coding	C9orf92	HGNC	protein_coding	OTTHUMT00000051773.1	51	0.00	0	C			16215799	16215799	-1	no_errors	ENST00000380683	ensembl	human	known	69_37n	frame_shift_del	51	13.56	8	DEL	0.000	-
C9orf92	100129385	genome.wustl.edu	37	9	16215801	16215801	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr9:16215801delC	ENST00000380685.1	-	2	179	c.66delG	c.(64-66)gtgfs	p.V22fs	C9orf92_ENST00000380683.1_Frame_Shift_Del_p.V53fs			A6NGG3	CI092_HUMAN	chromosome 9 open reading frame 92	22																	TGGTGTTTCTCACATAGTAGA	0.502																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS65012.1	9p22.3	2012-03-26			ENSG00000205549	ENSG00000205549			19054	protein-coding gene	gene with protein product							Standard	NM_001271829		Approved	Em:AL513424.1	uc031tcu.1	A6NGG3	OTTHUMG00000019588	ENST00000380685.1:c.66delG	9.37:g.16215801delC	ENSP00000370060:p.Val22fs		A6NMF8	Frame_Shift_Del	DEL	NULL	p.R54fs	ENST00000380685.1	37	c.159		9																																																																																			C9orf92	-	NULL	ENSG00000205549		0.502	C9orf92-001	KNOWN	basic|appris_candidate	protein_coding	C9orf92	HGNC	protein_coding	OTTHUMT00000051773.1	51	0.00	0	C			16215801	16215801	-1	no_errors	ENST00000380683	ensembl	human	known	69_37n	frame_shift_del	51	13.56	8	DEL	0.016	-
CACNA1H	8912	genome.wustl.edu	37	16	1250536	1250536	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr16:1250536G>A	ENST00000348261.5	+	7	1332	c.1084G>A	c.(1084-1086)Gac>Aac	p.D362N	CACNA1H_ENST00000565831.1_Missense_Mutation_p.D362N|CACNA1H_ENST00000358590.4_Missense_Mutation_p.D362N	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	362					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CATCAACTTCGACAACATCGG	0.652																																						dbGAP											0													55.0	60.0	58.0					16																	1250536		2119	4213	6332	-	-	-	SO:0001583	missense	0			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.1084G>A	16.37:g.1250536G>A	ENSP00000334198:p.Asp362Asn		B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_PKD_2	p.D362N	ENST00000348261.5	37	c.1084	CCDS45375.1	16	.	.	.	.	.	.	.	.	.	.	G	34	5.354342	0.95830	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.97529	-4.42;-4.42	4.4	4.4	0.53042	Ion transport (1);	0.053364	0.64402	D	0.000001	D	0.98629	0.9541	M	0.90595	3.13	0.39838	D	0.973077	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.99923	1.1264	10	0.87932	D	0	.	16.1439	0.81551	0.0:0.0:1.0:0.0	.	362;362	O95180-2;O95180	.;CAC1H_HUMAN	N	362	ENSP00000334198:D362N;ENSP00000351401:D362N	ENSP00000334198:D362N	D	+	1	0	CACNA1H	1190537	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.500000	0.81588	2.275000	0.75901	0.586000	0.80456	GAC	CACNA1H	-	pfam_Ion_trans_dom	ENSG00000196557		0.652	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CACNA1H	HGNC	protein_coding	OTTHUMT00000421601.1	49	0.00	0	G	NM_001005407		1250536	1250536	+1	no_errors	ENST00000348261	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	1.000	A
CAPZA1	829	genome.wustl.edu	37	1	113212745	113212745	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:113212745G>T	ENST00000263168.3	+	10	1524	c.852G>T	c.(850-852)caG>caT	p.Q284H	CAPZA1_ENST00000476936.1_3'UTR	NM_006135.2	NP_006126.1	P52907	CAZA1_HUMAN	capping protein (actin filament) muscle Z-line, alpha 1	284					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|WASH complex (GO:0071203)	actin binding (GO:0003779)			breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAGAAATGCAGAATGCTTAAA	0.413																																						dbGAP											0													64.0	61.0	62.0					1																	113212745		2203	4300	6503	-	-	-	SO:0001583	missense	0			U56637	CCDS30805.1	1p13.2	2014-05-09			ENSG00000116489	ENSG00000116489			1488	protein-coding gene	gene with protein product		601580				7665558, 9119363	Standard	NM_006135		Approved		uc001ecj.1	P52907	OTTHUMG00000011769	ENST00000263168.3:c.852G>T	1.37:g.113212745G>T	ENSP00000263168:p.Gln284His		Q53FQ6|Q6FHD5	Missense_Mutation	SNP	pfam_WASH_F-actin_cap_alpha,prints_WASH_F-actin_cap_alpha	p.Q284H	ENST00000263168.3	37	c.852	CCDS30805.1	1	.	.	.	.	.	.	.	.	.	.	G	14.39	2.521611	0.44866	.	.	ENSG00000116489	ENST00000263168	.	.	.	5.46	3.21	0.36854	.	0.115977	0.64402	D	0.000010	T	0.29158	0.0725	L	0.34521	1.04	0.41216	D	0.986471	B	0.09022	0.002	B	0.06405	0.002	T	0.27157	-1.0082	9	0.49607	T	0.09	-22.335	11.2543	0.49045	0.1949:0.0:0.8051:0.0	.	284	P52907	CAZA1_HUMAN	H	284	.	ENSP00000263168:Q284H	Q	+	3	2	CAPZA1	113014268	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.067000	0.30616	1.470000	0.48102	0.644000	0.83932	CAG	CAPZA1	-	NULL	ENSG00000116489		0.413	CAPZA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPZA1	HGNC	protein_coding	OTTHUMT00000032567.2	21	0.00	0	G	NM_006135		113212745	113212745	+1	no_errors	ENST00000263168	ensembl	human	known	69_37n	missense	16	15.79	3	SNP	1.000	T
CCDC3	83643	genome.wustl.edu	37	10	13043387	13043387	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr10:13043387G>T	ENST00000378825.3	-	1	310	c.184C>A	c.(184-186)Ctg>Atg	p.L62M	CCDC3_ENST00000378839.1_Intron	NM_031455.3	NP_113643.1	Q9BQI4	CCDC3_HUMAN	coiled-coil domain containing 3	62						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(2)	11		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)			TGCCAGGGCAGGTGGTTGTAG	0.726																																						dbGAP											0													7.0	10.0	9.0					10																	13043387		2148	4250	6398	-	-	-	SO:0001583	missense	0			BC051334	CCDS7093.1, CCDS60484.1	10p14	2004-02-13			ENSG00000151468	ENSG00000151468			23813	protein-coding gene	gene with protein product							Standard	NM_031455		Approved	DKFZp761F241	uc001ilq.1	Q9BQI4	OTTHUMG00000017689	ENST00000378825.3:c.184C>A	10.37:g.13043387G>T	ENSP00000368102:p.Leu62Met		Q5VYV8|Q5VYV9	Missense_Mutation	SNP	NULL	p.L62M	ENST00000378825.3	37	c.184	CCDS7093.1	10	.	.	.	.	.	.	.	.	.	.	G	15.73	2.919164	0.52546	.	.	ENSG00000151468	ENST00000378825	.	.	.	4.55	2.61	0.31194	.	0.072879	0.56097	N	0.000025	T	0.45135	0.1327	M	0.74258	2.255	0.41847	D	0.990153	P	0.46277	0.875	B	0.37091	0.241	T	0.39563	-0.9608	9	0.49607	T	0.09	-18.4439	6.0337	0.19694	0.089:0.0:0.5705:0.3405	.	62	Q9BQI4	CCDC3_HUMAN	M	62	.	ENSP00000368102:L62M	L	-	1	2	CCDC3	13083393	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.618000	0.54188	0.315000	0.23110	0.561000	0.74099	CTG	CCDC3	-	NULL	ENSG00000151468		0.726	CCDC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC3	HGNC	protein_coding	OTTHUMT00000046829.1	42	0.00	0	G	NM_031455		13043387	13043387	-1	no_errors	ENST00000378825	ensembl	human	known	69_37n	missense	41	22.64	12	SNP	1.000	T
CCNB3	85417	genome.wustl.edu	37	X	50054000	50054000	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chrX:50054000C>A	ENST00000376042.1	+	6	3129	c.2831C>A	c.(2830-2832)tCc>tAc	p.S944Y	CCNB3_ENST00000376038.1_Intron|CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000276014.7_Missense_Mutation_p.S944Y			Q8WWL7	CCNB3_HUMAN	cyclin B3	944					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)		p.S944Y(4)		breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					AAGGAGTTGTCCTTCAAGGAG	0.463																																						dbGAP											4	Substitution - Missense(4)	lung(4)											86.0	80.0	82.0					X																	50054000		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.2831C>A	X.37:g.50054000C>A	ENSP00000365210:p.Ser944Tyr		B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like	p.S944Y	ENST00000376042.1	37	c.2831	CCDS14331.1	X	.	.	.	.	.	.	.	.	.	.	C	12.44	1.939368	0.34189	.	.	ENSG00000147082	ENST00000376042;ENST00000276014	T;T	0.18810	2.19;2.19	3.69	-7.03	0.01584	.	44.926000	0.00166	N	0.000000	T	0.15046	0.0363	L	0.39898	1.24	0.09310	N	1	B	0.19331	0.035	B	0.08055	0.003	T	0.11542	-1.0583	9	.	.	.	.	7.1401	0.25552	0.1553:0.6303:0.0:0.2144	.	944	Q8WWL7	CCNB3_HUMAN	Y	944	ENSP00000365210:S944Y;ENSP00000276014:S944Y	.	S	+	2	0	CCNB3	50070740	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.115000	0.01328	-1.712000	0.01393	-0.268000	0.10319	TCC	CCNB3	-	NULL	ENSG00000147082		0.463	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB3	HGNC	protein_coding	OTTHUMT00000056558.1	21	0.00	0	C			50054000	50054000	+1	no_errors	ENST00000276014	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	0.000	A
CDHR1	92211	genome.wustl.edu	37	10	85968097	85968097	+	Silent	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr10:85968097G>A	ENST00000372117.3	+	11	1234	c.1131G>A	c.(1129-1131)ctG>ctA	p.L377L	CDHR1_ENST00000440770.2_Silent_p.L136L|CDHR1_ENST00000332904.3_Silent_p.L377L	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	377	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						GAGAGATCCTGCGGGGCCTCA	0.567																																						dbGAP											0													72.0	69.0	70.0					10																	85968097		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.1131G>A	10.37:g.85968097G>A			Q69YZ8|Q8IXY5	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L377	ENST00000372117.3	37	c.1131	CCDS7372.1	10																																																																																			CDHR1	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000148600		0.567	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR1	HGNC	protein_coding	OTTHUMT00000049111.1	17	0.00	0	G	NM_033100		85968097	85968097	+1	no_errors	ENST00000372117	ensembl	human	known	69_37n	silent	12	36.84	7	SNP	0.780	A
CHD5	26038	genome.wustl.edu	37	1	6166527	6166527	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:6166527G>A	ENST00000262450.3	-	40	5884	c.5785C>T	c.(5785-5787)Ccc>Tcc	p.P1929S	CHD5_ENST00000378021.1_Intron	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CGGAAGTTGGGCCCAAAGTTG	0.647																																						dbGAP											0													25.0	23.0	24.0					1																	6166527		2144	4225	6369	-	-	-	SO:0001583	missense	0			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.5785C>T	1.37:g.6166527G>A	ENSP00000262450:p.Pro1929Ser		A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.P1929S	ENST00000262450.3	37	c.5785	CCDS57.1	1	.	.	.	.	.	.	.	.	.	.	g	13.71	2.317374	0.40996	.	.	ENSG00000116254	ENST00000262450	D	0.90504	-2.68	4.86	3.94	0.45596	.	0.583196	0.15659	N	0.250991	D	0.83653	0.5301	N	0.24115	0.695	0.80722	D	1	B	0.20052	0.041	B	0.17979	0.02	T	0.76796	-0.2827	10	0.26408	T	0.33	-15.6841	13.3216	0.60436	0.0775:0.0:0.9225:0.0	.	1929	Q8TDI0	CHD5_HUMAN	S	1929	ENSP00000262450:P1929S	ENSP00000262450:P1929S	P	-	1	0	CHD5	6089114	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.972000	0.56838	1.169000	0.42739	0.491000	0.48974	CCC	CHD5	-	NULL	ENSG00000116254		0.647	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	34	0.00	0	G	NM_015557		6166527	6166527	-1	no_errors	ENST00000262450	ensembl	human	known	69_37n	missense	8	27.27	3	SNP	1.000	A
CEP85	64793	genome.wustl.edu	37	1	26604889	26604889	+	3'UTR	SNP	C	C	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:26604889C>G	ENST00000252992.4	+	0	3525				SH3BGRL3_ENST00000319041.6_5'Flank|SH3BGRL3_ENST00000270792.5_5'Flank|CEP85_ENST00000469609.1_3'UTR	NM_001281517.1|NM_022778.2	NP_001268446.1|NP_073615.2	Q6P2H3	CEP85_HUMAN	centrosomal protein 85kDa							centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|spindle pole (GO:0000922)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(11)|skin(2)	25						TTGGGCCAGCCGTGCCTCCTC	0.547																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK024038	CCDS277.1, CCDS60038.1	1p36.11	2014-02-20	2011-05-06	2011-05-06	ENSG00000130695	ENSG00000130695			25309	protein-coding gene	gene with protein product			"""coiled-coil domain containing 21"""	CCDC21		12477932	Standard	NM_022778		Approved	DKFZP434L0117	uc001bls.1	Q6P2H3	OTTHUMG00000003380	ENST00000252992.4:c.*1105C>G	1.37:g.26604889C>G			B4DRL1|D3DPK4|F8W7K4|Q5VY68|Q5VY70|Q9H6Q1|Q9H828|Q9UF52	RNA	SNP	-	NULL	ENST00000252992.4	37	NULL	CCDS277.1	1																																																																																			CEP85	-	-	ENSG00000130695		0.547	CEP85-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	CEP85	HGNC	protein_coding	OTTHUMT00000009492.2	69	0.00	0	C	NM_022778		26604889	26604889	+1	no_errors	ENST00000469609	ensembl	human	known	69_37n	rna	45	19.64	11	SNP	0.000	G
CLIP2	7461	genome.wustl.edu	37	7	73731953	73731953	+	Missense_Mutation	SNP	G	G	T	rs553860682		TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr7:73731953G>T	ENST00000395060.1	+	1	77	c.77G>T	c.(76-78)gGg>gTg	p.G26V	CLIP2_ENST00000223398.6_Missense_Mutation_p.G26V|CLIP2_ENST00000361545.5_Missense_Mutation_p.G26V			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	26						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						ACATCTACTGGGTCAGCTTCA	0.667													G|||	1	0.000199681	0.0	0.0	5008	,	,		18170	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													68.0	72.0	71.0					7																	73731953		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.77G>T	7.37:g.73731953G>T	ENSP00000378500:p.Gly26Val		O14527|O43611	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_t-SNARE,pfscan_CAP-Gly_domain	p.G26V	ENST00000395060.1	37	c.77	CCDS5569.1	7	.	.	.	.	.	.	.	.	.	.	G	15.97	2.989945	0.54041	.	.	ENSG00000106665	ENST00000539676;ENST00000223398;ENST00000361545;ENST00000395060	T;T;T	0.59906	0.23;0.29;0.23	4.52	4.52	0.55395	.	0.157159	0.41396	D	0.000895	T	0.60869	0.2302	L	0.27053	0.805	0.41654	D	0.989145	D;D	0.89917	0.983;1.0	P;D	0.91635	0.74;0.999	T	0.55464	-0.8137	10	0.20519	T	0.43	-39.8215	12.629	0.56646	0.0:0.0:1.0:0.0	.	26;26	Q9UDT6-2;Q9UDT6	.;CLIP2_HUMAN	V	26	ENSP00000223398:G26V;ENSP00000355151:G26V;ENSP00000378500:G26V	ENSP00000223398:G26V	G	+	2	0	CLIP2	73369889	1.000000	0.71417	0.050000	0.19076	0.071000	0.16799	4.642000	0.61383	2.340000	0.79590	0.561000	0.74099	GGG	CLIP2	-	NULL	ENSG00000106665		0.667	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP2	HGNC	protein_coding	OTTHUMT00000252556.1	73	0.00	0	G	NM_003388		73731953	73731953	+1	no_errors	ENST00000223398	ensembl	human	known	69_37n	missense	38	20.83	10	SNP	0.265	T
COL4A5	1287	genome.wustl.edu	37	X	107863632	107863632	+	Nonsense_Mutation	SNP	A	A	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chrX:107863632A>T	ENST00000361603.2	+	31	2897	c.2653A>T	c.(2653-2655)Aaa>Taa	p.K885*	COL4A5_ENST00000328300.6_Nonsense_Mutation_p.K885*	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	885	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GCTTCCAGGAAAAGCAGGTGC	0.473									Alport syndrome with Diffuse Leiomyomatosis																													dbGAP											0													35.0	34.0	35.0					X																	107863632		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.2653A>T	X.37:g.107863632A>T	ENSP00000354505:p.Lys885*		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Nonsense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.K885*	ENST00000361603.2	37	c.2653	CCDS14543.1	X	.	.	.	.	.	.	.	.	.	.	A	42	9.796934	0.99266	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	.	.	.	6.17	3.86	0.44501	.	0.123351	0.56097	D	0.000032	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	13.2819	0.60219	0.5275:0.4725:0.0:0.0	.	.	.	.	X	885	.	ENSP00000331902:K885X	K	+	1	0	COL4A5	107750288	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	2.187000	0.42602	0.904000	0.36572	0.486000	0.48141	AAA	COL4A5	-	pfam_Collagen	ENSG00000188153		0.473	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	HGNC	protein_coding	OTTHUMT00000057880.2	56	0.00	0	A			107863632	107863632	+1	no_errors	ENST00000328300	ensembl	human	known	69_37n	nonsense	35	16.67	7	SNP	1.000	T
COL6A3	1293	genome.wustl.edu	37	2	238271947	238271949	+	Missense_Mutation	TNP	CCT	CCT	AAG	rs565974324		TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C|C|T	C|C|T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr2:238271947_238271949CCT>AAG	ENST00000295550.4	-	14	6462_6464	c.6010_6012AGG>CTT	c.(6010-6012)AGG>CTT	p.R2004L	COL6A3_ENST00000347401.3_Missense_Mutation_p.R1803L|COL6A3_ENST00000472056.1_Missense_Mutation_p.R1397L|COL6A3_ENST00000409809.1_Missense_Mutation_p.R1798L|COL6A3_ENST00000346358.4_Missense_Mutation_p.R1804L|COL6A3_ENST00000353578.4_Missense_Mutation_p.R1798L	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2004	Nonhelical region.|VWFA 10. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GCCTCAGGGGCCTGTCATACATA	0.493																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.6010_6012AGG>CTT	2.37:g.238271947CCT>AAG	ENSP00000295550:p.Arg2004Leu		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation|Missense_Mutation|Silent	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.R2004S|p.R2004M|p.R2004	ENST00000295550.4	37	c.6012|c.6011|c.6010	CCDS33412.1	2																																																																																			COL6A3	-	smart_VWF_A,pfscan_VWF_A	ENSG00000163359		0.493	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	26	0.00	0	C|C|T	NM_004369		238271947|238271948|238271949	238271947|238271948|238271949	-1	no_errors	ENST00000295550	ensembl	human	known	69_37n	missense|missense|silent	13	59.38	19	SNP	1.000|1.000|0.974	A|A|G
COL6A6	131873	genome.wustl.edu	37	3	130317219	130317219	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr3:130317219G>T	ENST00000358511.6	+	18	4575	c.4544G>T	c.(4543-4545)gGa>gTa	p.G1515V	COL6A6_ENST00000453409.2_Missense_Mutation_p.G1515V	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1515	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GGAGCTCCTGGAGTTGACAGT	0.378																																						dbGAP											0													40.0	41.0	41.0					3																	130317219		1779	3980	5759	-	-	-	SO:0001583	missense	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.4544G>T	3.37:g.130317219G>T	ENSP00000351310:p.Gly1515Val		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.G1515V	ENST00000358511.6	37	c.4544	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	G	14.34	2.505421	0.44558	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.99186	-4.21;-5.53	5.84	5.84	0.93424	.	.	.	.	.	D	0.99239	0.9735	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99289	1.0898	9	0.87932	D	0	.	15.6361	0.76953	0.0:0.0:1.0:0.0	.	1515	A6NMZ7	CO6A6_HUMAN	V	1515	ENSP00000351310:G1515V;ENSP00000399236:G1515V	ENSP00000351310:G1515V	G	+	2	0	COL6A6	131799909	1.000000	0.71417	1.000000	0.80357	0.027000	0.11550	4.833000	0.62766	2.763000	0.94921	0.650000	0.86243	GGA	COL6A6	-	NULL	ENSG00000206384		0.378	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	50	0.00	0	G	NM_001102608		130317219	130317219	+1	no_errors	ENST00000358511	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	1.000	T
CWH43	80157	genome.wustl.edu	37	4	48996814	48996814	+	Silent	SNP	A	A	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr4:48996814A>G	ENST00000226432.4	+	5	873	c.690A>G	c.(688-690)ccA>ccG	p.P230P	CWH43_ENST00000513409.1_Silent_p.P203P	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	230					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						ATCCACATCCAGGGCCAGATC	0.517																																						dbGAP											0													97.0	88.0	91.0					4																	48996814		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.690A>G	4.37:g.48996814A>G			B2RPD7	Silent	SNP	superfamily_Endo/exonuclease/phosphatase	p.P230	ENST00000226432.4	37	c.690	CCDS3486.1	4																																																																																			CWH43	-	NULL	ENSG00000109182		0.517	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWH43	HGNC	protein_coding	OTTHUMT00000250496.2	79	0.00	0	A	NM_025087		48996814	48996814	+1	no_errors	ENST00000226432	ensembl	human	known	69_37n	silent	46	38.67	29	SNP	0.188	G
CSN1S1	1446	genome.wustl.edu	37	4	70810696	70810696	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr4:70810696A>C	ENST00000246891.4	+	15	580	c.531A>C	c.(529-531)gaA>gaC	p.E177D	CSN1S1_ENST00000444405.3_Missense_Mutation_p.E168D|CSN1S1_ENST00000507772.1_Missense_Mutation_p.E169D|CSN1S1_ENST00000505782.1_Missense_Mutation_p.E161D|CSN1S1_ENST00000507763.1_Missense_Mutation_p.E168D	NM_001890.1	NP_001881.1	P47710	CASA1_HUMAN	casein alpha s1	177						extracellular region (GO:0005576)|extracellular space (GO:0005615)	transporter activity (GO:0005215)			lung(5)|prostate(1)|upper_aerodigestive_tract(1)	7						AAAATTATGAAAAAAATAACG	0.388																																						dbGAP											0													163.0	153.0	156.0					4																	70810696		1857	4100	5957	-	-	-	SO:0001583	missense	0			X78416	CCDS47067.1, CCDS54769.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000126545	ENSG00000126545			2445	protein-coding gene	gene with protein product		115450	"""casein, alpha"""	CASA, CSN1		9050925, 7619062	Standard	NM_001890		Approved		uc003hep.1	P47710	OTTHUMG00000160843	ENST00000246891.4:c.531A>C	4.37:g.70810696A>C	ENSP00000246891:p.Glu177Asp		A1A510|A1A511|E9PB60|Q4PNR5	Missense_Mutation	SNP	NULL	p.E177D	ENST00000246891.4	37	c.531	CCDS47067.1	4	.	.	.	.	.	.	.	.	.	.	A	6.123	0.390915	0.11581	.	.	ENSG00000126545	ENST00000246891;ENST00000444405;ENST00000354865;ENST00000507763;ENST00000507772;ENST00000505782;ENST00000510936	T;T;T;T;T;T	0.54675	0.57;0.56;0.56;0.57;0.6;0.59	4.28	-2.42	0.06542	.	0.498381	0.17025	N	0.189941	T	0.54334	0.1852	L	0.55481	1.735	0.22034	N	0.999407	D;D;D	0.64830	0.994;0.994;0.994	D;D;D	0.63703	0.917;0.917;0.917	T	0.57797	-0.7749	9	0.27785	T	0.31	-1.4033	4.9374	0.13948	0.4336:0.1755:0.3909:0.0	.	169;168;177	E9PDQ1;E9PB60;P47710	.;.;CASA1_HUMAN	D	177;168;169;168;169;161;68	ENSP00000246891:E177D;ENSP00000413157:E168D;ENSP00000422611:E168D;ENSP00000427490:E169D;ENSP00000426684:E161D;ENSP00000421314:E68D	ENSP00000246891:E177D	E	+	3	2	CSN1S1	70845285	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.385000	0.20685	-0.405000	0.07599	-0.290000	0.09829	GAA	CSN1S1	-	NULL	ENSG00000126545		0.388	CSN1S1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSN1S1	HGNC	protein_coding	OTTHUMT00000362629.1	69	0.00	0	A			70810696	70810696	+1	no_errors	ENST00000246891	ensembl	human	known	69_37n	missense	28	34.88	15	SNP	0.000	C
DHRS4-AS1	55449	genome.wustl.edu	37	14	24410154	24410154	+	IGR	SNP	C	C	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr14:24410154C>G	ENST00000354854.1	+	0	1257				DHRS4-AS1_ENST00000556379.1_RNA			Q9P1J3	DHAS1_HUMAN	DHRS4 antisense RNA 1																		AATAGCTCAGCTAGCAGGAAC	0.502																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AF116636		14q11.2	2013-10-11	2012-08-16	2012-04-30	ENSG00000215256	ENSG00000215256		"""Long non-coding RNAs"""	23175	non-coding RNA	RNA, long non-coding			"""chromosome 14 open reading frame 167"", ""DHRS4 antisense RNA 1 (non-protein coding)"""	C14orf167		22891334	Standard	NR_023924		Approved	PRO1488, AS1DHRS4	uc001wky.3	Q9P1J3	OTTHUMG00000171901		14.37:g.24410154C>G				RNA	SNP	-	NULL	ENST00000354854.1	37	NULL		14																																																																																			DHRS4-AS1	-	-	ENSG00000215256		0.502	DHRS4-AS1-201	KNOWN	basic|appris_principal	protein_coding	DHRS4-AS1	HGNC	protein_coding		31	0.00	0	C	NR_023921		24410154	24410154	-1	no_errors	ENST00000555045	ensembl	human	known	69_37n	rna	24	27.27	9	SNP	0.019	G
DOCK4	9732	genome.wustl.edu	37	7	111368358	111368358	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr7:111368358G>A	ENST00000437633.1	-	52	6129	c.5873C>T	c.(5872-5874)cCc>cTc	p.P1958L	DOCK4_ENST00000494651.2_Missense_Mutation_p.P841L|DOCK4_ENST00000428084.1_Missense_Mutation_p.P1967L	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1958	Pro-rich.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				GCGGGGCAGGGGCCTGGGCCG	0.592																																						dbGAP											0													12.0	15.0	14.0					7																	111368358		1769	3976	5745	-	-	-	SO:0001583	missense	0				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.5873C>T	7.37:g.111368358G>A	ENSP00000404179:p.Pro1958Leu		O14584|O94824|Q8NB45	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_SH3_domain,pfscan_SH3_domain	p.P1967L	ENST00000437633.1	37	c.5900	CCDS47688.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.64|19.64	3.865934|3.865934	0.71949|0.71949	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288|ENST00000423057;ENST00000445943	T;T;T|T;T	0.07908|0.04970	3.92;3.15;3.91|3.52;4.04	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	0.051076|0.051076	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.19446|0.19446	0.0467|0.0467	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	P;P;P;P;P;D|.	0.89917|.	0.455;0.944;0.608;0.608;0.728;1.0|.	B;P;B;B;B;D|.	0.91635|.	0.18;0.646;0.244;0.244;0.425;0.999|.	T|T	0.00792|0.00792	-1.1564|-1.1564	10|8	0.49607|0.25106	T|T	0.09|0.35	.|.	19.2917|19.2917	0.94102|0.94102	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	827;841;2003;1958;1929;271|.	B7Z2K9;F5GXW1;Q149N5;Q8N1I0;Q8N1I0-2;Q8N1I0-4|.	.;.;.;DOCK4_HUMAN;.;.|.	L|S	1946;1967;841;1958;1917|1381;1991	ENSP00000410746:P1967L;ENSP00000440944:P841L;ENSP00000404179:P1958L|ENSP00000412834:P1381S;ENSP00000397412:P1991S	ENSP00000345432:P1917L|ENSP00000412834:P1381S	P|P	-|-	2|1	0|0	DOCK4|DOCK4	111155594|111155594	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.823000|0.823000	0.46562|0.46562	7.288000|7.288000	0.78691|0.78691	2.571000|2.571000	0.86741|0.86741	0.561000|0.561000	0.74099|0.74099	CCC|CCC	DOCK4	-	NULL	ENSG00000128512		0.592	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK4	HGNC	protein_coding	OTTHUMT00000338369.4	26	0.00	0	G	NM_014705		111368358	111368358	-1	no_errors	ENST00000428084	ensembl	human	known	69_37n	missense	12	20.00	3	SNP	1.000	A
EBAG9	9166	genome.wustl.edu	37	8	110575711	110575711	+	Intron	SNP	A	A	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr8:110575711A>C	ENST00000337573.5	+	7	821				EBAG9_ENST00000395785.2_Intron|EBAG9_ENST00000531677.1_Missense_Mutation_p.K203Q	NM_001278938.1|NM_004215.3	NP_001265867.1|NP_004206.1	O00559	RCAS1_HUMAN	estrogen receptor binding site associated, antigen, 9						regulation of cell growth (GO:0001558)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	peptidase activator activity involved in apoptotic process (GO:0016505)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)	10			OV - Ovarian serous cystadenocarcinoma(57;1.39e-14)			CCAATCAGTAAAGATAGAGAG	0.418																																						dbGAP											0													291.0	268.0	275.0					8																	110575711		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			AB007619	CCDS6313.1	8q23	2013-03-07			ENSG00000147654	ENSG00000147654			3123	protein-coding gene	gene with protein product		605772					Standard	NM_004215		Approved	EB9, RCAS1	uc003ynf.3	O00559	OTTHUMG00000165346	ENST00000337573.5:c.522-957A>C	8.37:g.110575711A>C			A8K3N6|Q5Y8C7|Q6IB20|Q9BS76	Missense_Mutation	SNP	pirsf_Cancer-assoc_antigen_RCAS1	p.K203Q	ENST00000337573.5	37	c.607	CCDS6313.1	8	.	.	.	.	.	.	.	.	.	.	A	8.173	0.792071	0.16258	.	.	ENSG00000147654	ENST00000531677	.	.	.	3.26	0.759	0.18438	.	2.796210	0.02064	N	0.051009	T	0.20292	0.0488	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.10636	-1.0621	6	0.20519	T	0.43	.	3.2996	0.06978	0.6238:0.2432:0.133:0.0	.	.	.	.	Q	203	.	ENSP00000432082:K203Q	K	+	1	0	EBAG9	110644887	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	0.371000	0.20450	0.146000	0.19002	0.402000	0.26972	AAG	EBAG9	-	pirsf_Cancer-assoc_antigen_RCAS1	ENSG00000147654		0.418	EBAG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EBAG9	HGNC	protein_coding	OTTHUMT00000383536.1	77	0.00	0	A	NM_004215		110575711	110575711	+1	no_errors	ENST00000531677	ensembl	human	novel	69_37n	missense	37	37.29	22	SNP	0.000	C
EHMT2	10919	genome.wustl.edu	37	6	31855581	31855581	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr6:31855581C>T	ENST00000375537.4	-	14	1909	c.1903G>A	c.(1903-1905)Gcc>Acc	p.A635T	EHMT2_ENST00000375530.4_Missense_Mutation_p.A601T|EHMT2_ENST00000375528.4_Missense_Mutation_p.A658T|EHMT2_ENST00000395728.3_Missense_Mutation_p.A692T|EHMT2_ENST00000480912.1_5'UTR	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	635					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						ATGACCAGGGCCTTTTCCAGG	0.652																																						dbGAP											0													104.0	125.0	117.0					6																	31855581		1509	2706	4215	-	-	-	SO:0001583	missense	0			AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.1903G>A	6.37:g.31855581C>T	ENSP00000364687:p.Ala635Thr		B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.A692T	ENST00000375537.4	37	c.2074	CCDS4725.1	6	.	.	.	.	.	.	.	.	.	.	C	28.3	4.907813	0.92107	.	.	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537;ENST00000442298	T;T;T;T	0.71579	-0.58;-0.45;-0.4;-0.57	5.42	5.42	0.78866	.	0.125962	0.53938	D	0.000057	T	0.62660	0.2446	L	0.27053	0.805	0.80722	D	1	P;P;P;P	0.51449	0.885;0.93;0.885;0.945	P;P;P;P	0.53760	0.621;0.734;0.621;0.647	T	0.62595	-0.6821	10	0.34782	T	0.22	.	17.9856	0.89155	0.0:1.0:0.0:0.0	.	658;601;635;449	A2ABF8;Q96KQ7-2;Q96KQ7;Q59FM7	.;.;EHMT2_HUMAN;.	T	692;658;601;635;449	ENSP00000379078:A692T;ENSP00000364678:A658T;ENSP00000364680:A601T;ENSP00000364687:A635T	ENSP00000364678:A658T	A	-	1	0	EHMT2	31963560	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.013000	0.76373	2.534000	0.85438	0.585000	0.79938	GCC	EHMT2	-	NULL	ENSG00000204371		0.652	EHMT2-001	KNOWN	basic|CCDS	protein_coding	EHMT2	HGNC	protein_coding	OTTHUMT00000076355.5	45	0.00	0	C	NM_006709		31855581	31855581	-1	no_errors	ENST00000395728	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	1.000	T
ELL2	22936	genome.wustl.edu	37	5	95234410	95234410	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr5:95234410A>T	ENST00000237853.4	-	8	1408	c.1059T>A	c.(1057-1059)aaT>aaA	p.N353K	ELL2_ENST00000431061.2_Intron	NM_012081.5	NP_036213.2	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	353					regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|transcription elongation from RNA polymerase II promoter (GO:0006368)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	24		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		CACTGGTGGGATTCAAATGAC	0.502																																						dbGAP											0													105.0	126.0	119.0					5																	95234410		2197	4297	6494	-	-	-	SO:0001583	missense	0			U88629	CCDS4080.1	5q15	2010-11-29			ENSG00000118985	ENSG00000118985			17064	protein-coding gene	gene with protein product		601874				9108030	Standard	NM_012081		Approved		uc003klr.4	O00472	OTTHUMG00000122085	ENST00000237853.4:c.1059T>A	5.37:g.95234410A>T	ENSP00000237853:p.Asn353Lys		B4DNK7	Missense_Mutation	SNP	pfam_RNA_pol_II_elong_fac_ELL,pfam_Occludin_RNApol2_elong_fac_ELL	p.N353K	ENST00000237853.4	37	c.1059	CCDS4080.1	5	.	.	.	.	.	.	.	.	.	.	A	14.58	2.577083	0.45902	.	.	ENSG00000118985	ENST00000237853	T	0.22134	1.97	5.08	1.41	0.22369	.	0.352458	0.32819	N	0.005601	T	0.16685	0.0401	L	0.43152	1.355	0.80722	D	1	B	0.25105	0.118	B	0.21917	0.037	T	0.05632	-1.0873	10	0.62326	D	0.03	-3.0132	8.9054	0.35521	0.7789:0.0:0.2211:0.0	.	353	O00472	ELL2_HUMAN	K	353	ENSP00000237853:N353K	ENSP00000237853:N353K	N	-	3	2	ELL2	95260166	0.358000	0.24947	0.998000	0.56505	0.989000	0.77384	0.211000	0.17474	0.140000	0.18849	-0.263000	0.10527	AAT	ELL2	-	NULL	ENSG00000118985		0.502	ELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL2	HGNC	protein_coding	OTTHUMT00000242846.1	83	0.00	0	A	NM_012081		95234410	95234410	-1	no_errors	ENST00000237853	ensembl	human	known	69_37n	missense	29	21.62	8	SNP	1.000	T
ETV3L	440695	genome.wustl.edu	37	1	157069066	157069066	+	Missense_Mutation	SNP	G	G	T	rs370221827		TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:157069066G>T	ENST00000454449.2	-	2	447	c.163C>A	c.(163-165)Cgc>Agc	p.R55S		NM_001004341.2	NP_001004341.1	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	55					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Hepatocellular(266;0.158)	Prostate(1639;0.184)				ATGACATGGCGGAACTCTTCC	0.602																																						dbGAP											0													45.0	45.0	45.0					1																	157069066		2203	4296	6499	-	-	-	SO:0001583	missense	0			AK131392	CCDS30893.1	1q23.1	2013-09-24	2008-09-12		ENSG00000253831	ENSG00000253831			33834	protein-coding gene	gene with protein product			"""ets variant gene 3-like"""				Standard	NM_001004341		Approved	FLJ16478	uc001fqq.2	Q6ZN32	OTTHUMG00000041325	ENST00000454449.2:c.163C>A	1.37:g.157069066G>T	ENSP00000430271:p.Arg55Ser			Missense_Mutation	SNP	pfam_Ets,smart_Ets,prints_Ets,pfscan_Ets	p.R55S	ENST00000454449.2	37	c.163	CCDS30893.1	1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.380018	0.82682	.	.	ENSG00000253831	ENST00000454449	T	0.52754	0.65	4.86	4.86	0.63082	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (3);	0.400219	0.18570	N	0.137372	T	0.16727	0.0402	N	0.02296	-0.605	0.49213	D	0.999764	P	0.37466	0.596	B	0.40782	0.34	T	0.18618	-1.0331	10	0.31617	T	0.26	.	16.9231	0.86168	0.0:0.0:1.0:0.0	.	55	Q6ZN32	ETV3L_HUMAN	S	55	ENSP00000430271:R55S	ENSP00000430271:R55S	R	-	1	0	ETV3L	155335690	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.267000	0.65530	2.500000	0.84329	0.655000	0.94253	CGC	ETV3L	-	pfam_Ets,smart_Ets,pfscan_Ets	ENSG00000253831		0.602	ETV3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV3L	HGNC	protein_coding	OTTHUMT00000099024.2	43	0.00	0	G	NM_001004341		157069066	157069066	-1	no_errors	ENST00000454449	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	1.000	T
EXOC3L4	91828	genome.wustl.edu	37	14	103566608	103566608	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr14:103566608G>T	ENST00000380069.3	+	1	128	c.52G>T	c.(52-54)Gag>Tag	p.E18*	RP11-736N17.8_ENST00000559843.1_RNA	NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	18					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						GAGTCCCAAGGAGGCTGAGGA	0.632																																						dbGAP											0													20.0	21.0	20.0					14																	103566608		2202	4296	6498	-	-	-	SO:0001587	stop_gained	0			AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.52G>T	14.37:g.103566608G>T	ENSP00000369409:p.Glu18*		Q14CR2	Nonsense_Mutation	SNP	pfam_Sec6	p.E18*	ENST00000380069.3	37	c.52	CCDS32163.1	14	.	.	.	.	.	.	.	.	.	.	G	21.5	4.164694	0.78339	.	.	ENSG00000205436	ENST00000380069	.	.	.	2.85	1.93	0.25924	.	0.225469	0.29139	N	0.013033	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-18.7171	7.7678	0.28991	0.0:0.2601:0.7399:0.0	.	.	.	.	X	18	.	ENSP00000369409:E18X	E	+	1	0	EXOC3L4	102636361	0.197000	0.23362	0.600000	0.28864	0.128000	0.20619	1.615000	0.36922	0.754000	0.32968	0.462000	0.41574	GAG	EXOC3L4	-	NULL	ENSG00000205436		0.632	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC3L4	HGNC	protein_coding	OTTHUMT00000415663.1	27	0.00	0	G	XM_941093		103566608	103566608	+1	no_errors	ENST00000380069	ensembl	human	known	69_37n	nonsense	10	56.52	13	SNP	0.667	T
FAT1	2195	genome.wustl.edu	37	4	187539186	187539186	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr4:187539186G>A	ENST00000441802.2	-	10	8763	c.8554C>T	c.(8554-8556)Caa>Taa	p.Q2852*		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2852	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TCCACACTTTGTGACTGATCC	0.428										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	dbGAP											0													126.0	115.0	119.0					4																	187539186		1942	4157	6099	-	-	-	SO:0001587	stop_gained	0			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.8554C>T	4.37:g.187539186G>A	ENSP00000406229:p.Gln2852*			Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.Q2852*	ENST00000441802.2	37	c.8554	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	G	49	15.694589	0.99842	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	.	.	.	4.86	4.86	0.63082	.	0.057279	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	18.5503	0.91062	0.0:0.0:1.0:0.0	.	.	.	.	X	2852;2854	.	ENSP00000260147:Q2854X	Q	-	1	0	FAT1	187776180	1.000000	0.71417	0.879000	0.34478	0.438000	0.31896	9.657000	0.98554	2.682000	0.91365	0.650000	0.86243	CAA	FAT1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000083857		0.428	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3	52	0.00	0	G	NM_005245		187539186	187539186	-1	no_errors	ENST00000441802	ensembl	human	known	69_37n	nonsense	21	36.36	12	SNP	0.995	A
FBXL18	80028	genome.wustl.edu	37	7	5529775	5529775	+	Missense_Mutation	SNP	G	G	C	rs191668941	byFrequency	TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr7:5529775G>C	ENST00000453700.3	-	5	2186	c.2069C>G	c.(2068-2070)aCg>aGg	p.T690R	FBXL18_ENST00000382368.3_Intron			Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	690									FBXL18/RNF216(2)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)	21		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		GGCTCGAGACGTCCTGGCTGA	0.607																																						dbGAP											0													21.0	21.0	21.0					7																	5529775		876	1991	2867	-	-	-	SO:0001583	missense	0			AK057042	CCDS43546.1	7p22.2	2011-06-09			ENSG00000155034	ENSG00000155034		"""F-boxes / Leucine-rich repeats"""	21874	protein-coding gene	gene with protein product		609084					Standard	NM_024963		Approved	FLJ11467, Fbl18	uc003son.4	Q96ME1	OTTHUMG00000151832	ENST00000453700.3:c.2069C>G	7.37:g.5529775G>C	ENSP00000444797:p.Thr690Arg		Q9BR90|Q9BTC7|Q9HAK7	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.T690R	ENST00000453700.3	37	c.2069		7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.009|0.009	-1.838335|-1.838335	0.00573|0.00573	.|.	.|.	ENSG00000155034|ENSG00000155034	ENST00000458142|ENST00000312577;ENST00000453700	.|T	.|0.48201	.|0.82	1.29|1.29	-2.11|-2.11	0.07187|0.07187	.|.	.|.	.|.	.|.	.|.	T|T	0.29817|0.29817	0.0745|0.0745	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.16482|0.16482	-1.0401|-1.0401	4|8	.|0.48119	.|T	.|0.1	.|.	4.595|4.595	0.12325|0.12325	0.2316:0.3063:0.4621:0.0|0.2316:0.3063:0.4621:0.0	.|.	.|690	.|F5H4Z4	.|.	G|R	574|690	.|ENSP00000444797:T690R	.|ENSP00000311990:T690R	R|T	-|-	1|2	0|0	FBXL18|FBXL18	5496301|5496301	0.002000|0.002000	0.14202|0.14202	0.001000|0.001000	0.08648|0.08648	0.003000|0.003000	0.03518|0.03518	-0.495000|-0.495000	0.06443|0.06443	-0.775000|-0.775000	0.04584|0.04584	-2.101000|-2.101000	0.00361|0.00361	CGT|ACG	FBXL18	-	NULL	ENSG00000155034		0.607	FBXL18-201	KNOWN	basic	protein_coding	FBXL18	HGNC	protein_coding		29	0.00	0	G	NM_024963		5529775	5529775	-1	no_errors	ENST00000453700	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	0.001	C
FGD1	2245	genome.wustl.edu	37	X	54496512	54496512	+	Silent	SNP	C	C	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chrX:54496512C>T	ENST00000375135.3	-	4	1771	c.1038G>A	c.(1036-1038)gaG>gaA	p.E346E		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	346					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						cttcctcctcctcctcgtcgt	0.622																																						dbGAP											0													38.0	34.0	35.0					X																	54496512		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.1038G>A	X.37:g.54496512C>T			Q5H999|Q8N4D9	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.E346	ENST00000375135.3	37	c.1038	CCDS14359.1	X																																																																																			FGD1	-	NULL	ENSG00000102302		0.622	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD1	HGNC	protein_coding	OTTHUMT00000056801.1	50	0.00	0	C	NM_004463		54496512	54496512	-1	no_errors	ENST00000375135	ensembl	human	known	69_37n	silent	55	11.29	7	SNP	0.996	T
MACROD1	28992	genome.wustl.edu	37	11	63884804	63884804	+	Intron	SNP	C	C	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr11:63884804C>A	ENST00000255681.6	-	3	584				FLRT1_ENST00000246841.3_Silent_p.L355L|RP11-21A7A.3_ENST00000543817.1_RNA	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1						cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|large_intestine(3)|lung(6)|skin(1)	11						TGCGGGGCCTCATGTGCCAGG	0.642																																						dbGAP											0													51.0	51.0	51.0					11																	63884804		2201	4296	6497	-	-	-	SO:0001627	intron_variant	0			AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.517+33906G>T	11.37:g.63884804C>A			Q9UH96	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Fibronectin_type3	p.L355	ENST00000255681.6	37	c.1065	CCDS8056.1	11																																																																																			FLRT1	-	smart_Cys-rich_flank_reg_C	ENSG00000126500		0.642	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT1	HGNC	protein_coding	OTTHUMT00000396570.1	52	0.00	0	C	NM_014067		63884804	63884804	+1	no_errors	ENST00000246841	ensembl	human	known	69_37n	silent	31	32.61	15	SNP	1.000	A
GARNL3	84253	genome.wustl.edu	37	9	130083004	130083004	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr9:130083004C>G	ENST00000373387.4	+	6	866	c.514C>G	c.(514-516)Ctg>Gtg	p.L172V	GARNL3_ENST00000314904.5_Missense_Mutation_p.L172V|GARNL3_ENST00000435213.2_Missense_Mutation_p.L150V	NM_032293.4	NP_115669.3	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	172					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)|small GTPase regulator activity (GO:0005083)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(24)|ovary(1)|skin(1)|urinary_tract(2)	41						TGCCATGAATCTGGACAAATT	0.378																																						dbGAP											0													53.0	53.0	53.0					9																	130083004		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC034983	CCDS6869.2, CCDS69663.1	9q34.13	2009-09-14	2004-08-09		ENSG00000136895	ENSG00000136895			25425	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 3"""			11230166	Standard	NM_032293		Approved	DKFZp761J1523, bA356B19.1	uc011mae.2	Q5VVW2	OTTHUMG00000020700	ENST00000373387.4:c.514C>G	9.37:g.130083004C>G	ENSP00000362485:p.Leu172Val		B4DEP7|B7Z3Q6|Q8IYU1|Q8N951|Q8ND89|Q9BQH6	Missense_Mutation	SNP	pfam_Citron,pfam_Rap_GAP,smart_Citron,pfscan_Rap_GAP	p.L172V	ENST00000373387.4	37	c.514	CCDS6869.2	9	.	.	.	.	.	.	.	.	.	.	C	10.70	1.425115	0.25639	.	.	ENSG00000136895	ENST00000439286;ENST00000373399;ENST00000425970;ENST00000435213;ENST00000314904;ENST00000373387	D;D;D;D;D	0.93906	-3.31;-3.31;-3.31;-3.31;-3.31	5.63	5.63	0.86233	.	0.255560	0.39210	N	0.001435	D	0.87819	0.6273	N	0.20685	0.6	0.39667	D	0.970706	B;B	0.13145	0.007;0.007	B;B	0.14023	0.01;0.009	T	0.82979	-0.0188	9	.	.	.	.	17.539	0.87842	0.0:1.0:0.0:0.0	.	172;150	Q5VVW2;B7Z3Q6	GARL3_HUMAN;.	V	195;195;150;150;172;172	ENSP00000400579:L195V;ENSP00000411329:L150V;ENSP00000396205:L150V;ENSP00000313970:L172V;ENSP00000362485:L172V	.	L	+	1	2	GARNL3	129122825	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.616000	0.46376	2.798000	0.96311	0.655000	0.94253	CTG	GARNL3	-	NULL	ENSG00000136895		0.378	GARNL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GARNL3	HGNC	protein_coding	OTTHUMT00000054151.3	36	0.00	0	C	NM_032293		130083004	130083004	+1	no_errors	ENST00000373387	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	1.000	G
GAS2L1	10634	genome.wustl.edu	37	22	29704316	29704316	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr22:29704316G>A	ENST00000406549.3	+	2	371	c.221G>A	c.(220-222)cGt>cAt	p.R74H	GAS2L1_ENST00000407647.2_Missense_Mutation_p.R74H|GAS2L1_ENST00000341313.6_Missense_Mutation_p.R74H|GAS2L1_ENST00000407854.1_Missense_Mutation_p.R74H|GAS2L1_ENST00000360113.2_Missense_Mutation_p.R74H|GAS2L1_ENST00000403764.1_Missense_Mutation_p.R74H|GAS2L1_ENST00000471961.1_Missense_Mutation_p.R74H	NM_001278730.1	NP_001265659.1	Q99501	GA2L1_HUMAN	growth arrest-specific 2 like 1	74	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell cycle arrest (GO:0007050)|cellular response to starvation (GO:0009267)|cellular response to thyroid hormone stimulus (GO:0097067)|microtubule bundle formation (GO:0001578)|negative regulation of cell growth (GO:0030308)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of gene expression (GO:0010629)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)|thyroid hormone receptor binding (GO:0046966)			endometrium(2)|lung(2)|prostate(1)	5						GAGGCTGCCCGTGCATTGGCA	0.692																																						dbGAP											0													17.0	15.0	16.0					22																	29704316		2194	4293	6487	-	-	-	SO:0001583	missense	0			BC001782	CCDS63438.1, CCDS74840.1	22q12.2	2008-06-11			ENSG00000185340	ENSG00000185340			16955	protein-coding gene	gene with protein product		602128				8975699, 12584248, 1607387	Standard	NM_001278730		Approved	GAR22	uc003afc.1	Q99501	OTTHUMG00000151108	ENST00000406549.3:c.221G>A	22.37:g.29704316G>A	ENSP00000383995:p.Arg74His		B5MCR7|Q53EN7|Q92640|Q9BUY9	Missense_Mutation	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.R74H	ENST00000406549.3	37	c.221		22	.	.	.	.	.	.	.	.	.	.	G	12.58	1.979984	0.34942	.	.	ENSG00000185340	ENST00000407647;ENST00000416823;ENST00000428622;ENST00000333679;ENST00000406549;ENST00000360113;ENST00000341313;ENST00000403764;ENST00000471961;ENST00000407854	T;T;T;T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98	4.63	4.63	0.57726	Calponin homology domain (5);	0.396820	0.20968	N	0.082459	T	0.35451	0.0932	L	0.39147	1.195	0.33431	D	0.58112	B;P;P;P	0.42692	0.439;0.787;0.532;0.532	B;B;B;B	0.41894	0.076;0.207;0.369;0.369	T	0.50988	-0.8762	10	0.38643	T	0.18	-11.3244	10.6991	0.45915	0.0951:0.0:0.9049:0.0	.	74;74;74;74	B5MCR7;E7EQM6;A0A5E8;Q99501	.;.;.;GA2L1_HUMAN	H	74	ENSP00000385554:R74H;ENSP00000395988:R74H;ENSP00000388645:R74H;ENSP00000383995:R74H;ENSP00000353229:R74H;ENSP00000344012:R74H;ENSP00000385358:R74H;ENSP00000450152:R74H;ENSP00000385023:R74H	ENSP00000332834:R74H	R	+	2	0	GAS2L1	28034316	0.000000	0.05858	0.908000	0.35775	0.092000	0.18411	0.080000	0.14802	2.126000	0.65437	0.491000	0.48974	CGT	GAS2L1	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000185340		0.692	GAS2L1-002	PUTATIVE	basic|exp_conf	protein_coding	GAS2L1	HGNC	protein_coding	OTTHUMT00000321365.1	71	0.00	0	G	NM_006478		29704316	29704316	+1	no_errors	ENST00000403764	ensembl	human	known	69_37n	missense	52	21.21	14	SNP	0.969	A
GCAT	23464	genome.wustl.edu	37	22	38208968	38208968	+	Silent	SNP	T	T	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr22:38208968T>C	ENST00000248924.6	+	3	458	c.402T>C	c.(400-402)tgT>tgC	p.C134C	GCAT_ENST00000415371.1_3'UTR|GCAT_ENST00000323205.6_Silent_p.C160C	NM_014291.3	NP_055106.1	O75600	KBL_HUMAN	glycine C-acetyltransferase	134	Pyridoxal phosphate binding. {ECO:0000250}.				biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|L-threonine catabolic process to glycine (GO:0019518)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	glycine C-acetyltransferase activity (GO:0008890)|pyridoxal phosphate binding (GO:0030170)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	12	Melanoma(58;0.045)				Glycine(DB00145)	ATCCCAGCTGTTATGACGCCA	0.557																																						dbGAP											0													90.0	81.0	84.0					22																	38208968		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF077740	CCDS13957.1, CCDS54527.1	22q13.1	2010-01-19	2010-01-19		ENSG00000100116	ENSG00000100116	2.3.1.29		4188	protein-coding gene	gene with protein product	"""2-amino-3-ketobutyrate coenzyme A ligase"""	607422	"""glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase)"""				Standard	NM_014291		Approved	KBL	uc003aua.2	O75600	OTTHUMG00000150664	ENST00000248924.6:c.402T>C	22.37:g.38208968T>C			E2QC23|Q6ZWF1|Q96CA9	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	p.V119A	ENST00000248924.6	37	c.356	CCDS13957.1	22	.	.	.	.	.	.	.	.	.	.	T	8.174	0.792299	0.16258	.	.	ENSG00000100116	ENST00000451984	.	.	.	5.58	-1.45	0.08828	.	.	.	.	.	T	0.63827	0.2544	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61073	-0.7136	4	.	.	.	-11.8245	13.0185	0.58773	0.0:0.7696:0.0:0.2304	.	.	.	.	A	119	.	.	V	+	2	0	GCAT	36538914	0.923000	0.31300	0.964000	0.40570	0.593000	0.36681	-0.008000	0.12788	-0.219000	0.10003	0.533000	0.62120	GTT	GCAT	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000100116		0.557	GCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCAT	HGNC	protein_coding	OTTHUMT00000319506.1	54	0.00	0	T	NM_014291.2		38208968	38208968	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000451984	ensembl	human	novel	69_37n	missense	38	29.63	16	SNP	1.000	C
GLI2	2736	genome.wustl.edu	37	2	121708834	121708834	+	Missense_Mutation	SNP	C	C	G	rs370629096	byFrequency	TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr2:121708834C>G	ENST00000452319.1	+	4	330	c.270C>G	c.(268-270)agC>agG	p.S90R	GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000314490.11_5'UTR|GLI2_ENST00000361492.4_Missense_Mutation_p.S90R					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CTGCCCTCAGCGGCAGCCCTG	0.632																																						dbGAP											0													98.0	111.0	106.0					2																	121708834		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.270C>G	2.37:g.121708834C>G	ENSP00000390436:p.Ser90Arg			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S90R	ENST00000452319.1	37	c.270	CCDS33283.1	2	.	.	.	.	.	.	.	.	.	.	C	11.03	1.517748	0.27123	.	.	ENSG00000074047	ENST00000452319;ENST00000361492	T;T	0.47528	0.84;0.84	5.28	-0.906	0.10524	.	0.170023	0.52532	D	0.000071	T	0.58538	0.2129	L	0.55481	1.735	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.995	P;D;P	0.75484	0.887;0.986;0.689	T	0.56475	-0.7973	10	0.59425	D	0.04	.	12.0678	0.53598	0.0:0.7474:0.0:0.2526	.	90;90;90	B4DT63;P10070;Q0VGA0	.;GLI2_HUMAN;.	R	90	ENSP00000390436:S90R;ENSP00000354586:S90R	ENSP00000354586:S90R	S	+	3	2	GLI2	121425304	0.000000	0.05858	0.985000	0.45067	0.822000	0.46500	-2.203000	0.01234	-0.380000	0.07894	-0.226000	0.12346	AGC	GLI2	-	NULL	ENSG00000074047		0.632	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	GLI2	HGNC	protein_coding	OTTHUMT00000332293.3	60	0.00	0	C	NM_005270		121708834	121708834	+1	no_errors	ENST00000361492	ensembl	human	known	69_37n	missense	36	21.74	10	SNP	0.960	G
GPATCH2	55105	genome.wustl.edu	37	1	217671688	217671688	+	Intron	SNP	T	T	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:217671688T>A	ENST00000366935.3	-	7	1317				GPATCH2_ENST00000489246.2_Intron	NM_018040.2	NP_060510.1	Q9NW75	GPTC2_HUMAN	G patch domain containing 2						negative regulation of phosphatase activity (GO:0010923)		nucleic acid binding (GO:0003676)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)	35				OV - Ovarian serous cystadenocarcinoma(81;0.0397)|all cancers(67;0.0744)|GBM - Glioblastoma multiforme(131;0.0872)		TGGATTACAATGGTCCTTACC	0.443																																						dbGAP											0													237.0	233.0	234.0					1																	217671688		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AK001114	CCDS1518.1, CCDS73031.1	1q41	2013-01-28		2006-12-13	ENSG00000092978	ENSG00000092978		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""G patch domain containing"""	25499	protein-coding gene	gene with protein product	"""cancer/testis antigen 110"", ""protein phosphatase 1, regulatory subunit 30"""			GPATC2		19432882, 15375528	Standard	XM_005273174		Approved	FLJ10252, CT110, PPP1R30	uc001hlf.1	Q9NW75	OTTHUMG00000000527	ENST00000366935.3:c.1206+9A>T	1.37:g.217671688T>A			Q5VYK7|Q5VYK8|Q86YE7	RNA	SNP	-	NULL	ENST00000366935.3	37	NULL	CCDS1518.1	1																																																																																			GPATCH2	-	-	ENSG00000092978		0.443	GPATCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH2	HGNC	protein_coding	OTTHUMT00000001272.1	26	0.00	0	T	NM_018040		217671688	217671688	-1	no_errors	ENST00000485274	ensembl	human	known	69_37n	rna	24	17.24	5	SNP	0.000	A
GRTP1	79774	genome.wustl.edu	37	13	114009686	114009686	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr13:114009686G>T	ENST00000375431.4	-	3	366	c.292C>A	c.(292-294)Ctt>Att	p.L98I	GRTP1-AS1_ENST00000423246.1_RNA|GRTP1_ENST00000326039.3_Missense_Mutation_p.L20I|GRTP1_ENST00000375430.4_Missense_Mutation_p.L98I|GRTP1-AS1_ENST00000419199.1_RNA	NM_024719.2	NP_078995.2	Q5TC63	GRTP1_HUMAN	growth hormone regulated TBC protein 1	98	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	14	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0314)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0978)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			CCCTGGAGAAGCTGGTGGTAG	0.677																																						dbGAP											0													80.0	71.0	74.0					13																	114009686		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026127	CCDS9534.2, CCDS66591.1, CCDS73606.1	13q34	2011-11-30			ENSG00000139835	ENSG00000139835			20310	protein-coding gene	gene with protein product						11564724	Standard	NM_001286732		Approved	FLJ22474, TBC1D6	uc001vtn.3	Q5TC63	OTTHUMG00000017381	ENST00000375431.4:c.292C>A	13.37:g.114009686G>T	ENSP00000364580:p.Leu98Ile		B9A6K2|Q2M232|Q5TC64|Q66K26|Q6P659|Q8N528|Q9H695	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.L98I	ENST00000375431.4	37	c.292	CCDS9534.2	13	.	.	.	.	.	.	.	.	.	.	G	13.78	2.338371	0.41398	.	.	ENSG00000139835	ENST00000375431;ENST00000326039;ENST00000375430	T;T;T	0.11277	2.79;2.79;2.79	4.5	4.5	0.54988	Rab-GAP/TBC domain (4);	0.176387	0.38492	U	0.001667	T	0.29288	0.0729	M	0.79258	2.445	0.42447	D	0.992736	D;D;D	0.69078	0.995;0.997;0.994	D;P;D	0.66196	0.913;0.858;0.942	T	0.02301	-1.1180	10	0.72032	D	0.01	.	9.8513	0.41059	0.095:0.0:0.905:0.0	.	98;20;98	B9A6K2;Q5TC63-2;Q5TC63	.;.;GRTP1_HUMAN	I	98;20;98	ENSP00000364580:L98I;ENSP00000321850:L20I;ENSP00000364579:L98I	ENSP00000321850:L20I	L	-	1	0	GRTP1	113057687	1.000000	0.71417	0.032000	0.17829	0.181000	0.23173	4.797000	0.62503	2.332000	0.79248	0.591000	0.81541	CTT	GRTP1	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000139835		0.677	GRTP1-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	GRTP1	HGNC	protein_coding	OTTHUMT00000045882.5	70	0.00	0	G	NM_024719		114009686	114009686	-1	no_errors	ENST00000375430	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.572	T
HDAC6	10013	genome.wustl.edu	37	X	48681535	48681535	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chrX:48681535A>T	ENST00000334136.5	+	25	2904	c.2726A>T	c.(2725-2727)cAg>cTg	p.Q909L	HDAC6_ENST00000444343.2_Missense_Mutation_p.Q923L|HDAC6_ENST00000376619.2_Missense_Mutation_p.Q909L			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	909					aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	ACTCAGGACCAGCCCTCAGAG	0.617																																					Pancreas(112;205 1675 2305 8976 15959)	dbGAP											0													31.0	28.0	29.0					X																	48681535		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.2726A>T	X.37:g.48681535A>T	ENSP00000334061:p.Gln909Leu		O94975|Q6NT75|Q7L3E5|Q96CY0	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,prints_His_deacetylse	p.Q923L	ENST00000334136.5	37	c.2768	CCDS14306.1	X	.	.	.	.	.	.	.	.	.	.	A	16.87	3.241307	0.58995	.	.	ENSG00000094631	ENST00000444343;ENST00000334136;ENST00000376619	T;T;T	0.60548	0.18;0.18;0.18	5.65	4.41	0.53225	.	2.090420	0.01756	N	0.030237	T	0.48150	0.1484	L	0.27053	0.805	0.58432	D	0.999995	B;B;B;B	0.33694	0.309;0.421;0.031;0.309	B;B;B;B	0.29785	0.037;0.107;0.006;0.037	T	0.34030	-0.9845	10	0.41790	T	0.15	0.2635	9.6951	0.40152	0.8282:0.1717:0.0:0.0	.	899;272;557;909	B4DZN1;B3KY98;B3KVK5;Q9UBN7	.;.;.;HDAC6_HUMAN	L	923;909;909	ENSP00000398566:Q923L;ENSP00000334061:Q909L;ENSP00000365804:Q909L	ENSP00000334061:Q909L	Q	+	2	0	HDAC6	48566479	0.910000	0.30920	0.776000	0.31678	0.567000	0.35839	5.029000	0.64121	2.000000	0.58554	0.486000	0.48141	CAG	HDAC6	-	NULL	ENSG00000094631		0.617	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC6	HGNC	protein_coding	OTTHUMT00000083394.2	78	0.00	0	A	NM_006044		48681535	48681535	+1	no_errors	ENST00000444343	ensembl	human	known	69_37n	missense	46	29.23	19	SNP	0.506	T
HHIP	64399	genome.wustl.edu	37	4	145655921	145655921	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr4:145655921A>G	ENST00000296575.3	+	12	2444	c.1789A>G	c.(1789-1791)Acg>Gcg	p.T597A		NM_022475.2	NP_071920.1	Q96QV1	HHIP_HUMAN	hedgehog interacting protein	597					carbohydrate metabolic process (GO:0005975)|dorsal/ventral pattern formation (GO:0009953)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|negative regulation of signal transduction (GO:0009968)|negative regulation of smoothened signaling pathway (GO:0045879)|neuroblast proliferation (GO:0007405)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|skeletal system morphogenesis (GO:0048705)|smoothened signaling pathway (GO:0007224)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	hedgehog family protein binding (GO:0097108)|oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		ATGCAGAGCCACGGTACAACC	0.473																																						dbGAP											0													107.0	99.0	102.0					4																	145655921		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024645	CCDS3762.1	4q31.21-q31.3	2008-08-29	2001-11-29		ENSG00000164161	ENSG00000164161			14866	protein-coding gene	gene with protein product		606178	"""hedgehog-interacting protein"""			11435703, 11731473	Standard	NM_022475		Approved	HIP, FLJ20992	uc003ijs.2	Q96QV1	OTTHUMG00000161428	ENST00000296575.3:c.1789A>G	4.37:g.145655921A>G	ENSP00000296575:p.Thr597Ala		Q6PK09|Q8NCI7|Q9BXK3|Q9H1J4|Q9H7E7	Missense_Mutation	SNP	pfam_Folate_rcpt-like,superfamily_Quinoprot_gluc/sorb_DH,smart_EGF-like,pfscan_EG-like_dom	p.T597A	ENST00000296575.3	37	c.1789	CCDS3762.1	4	.	.	.	.	.	.	.	.	.	.	A	8.319	0.823812	0.16678	.	.	ENSG00000164161	ENST00000296575	T	0.05258	3.47	6.05	-6.01	0.02199	.	0.820956	0.11556	N	0.552261	T	0.03178	0.0093	L	0.36672	1.1	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.47774	-0.9091	10	0.09084	T	0.74	2.4364	2.8404	0.05527	0.279:0.3625:0.2587:0.0998	.	597	Q96QV1	HHIP_HUMAN	A	597	ENSP00000296575:T597A	ENSP00000296575:T597A	T	+	1	0	HHIP	145875371	0.875000	0.30112	0.000000	0.03702	0.175000	0.22909	2.288000	0.43514	-1.286000	0.02384	-0.297000	0.09499	ACG	HHIP	-	NULL	ENSG00000164161		0.473	HHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHIP	HGNC	protein_coding	OTTHUMT00000364887.2	36	0.00	0	A			145655921	145655921	+1	no_errors	ENST00000296575	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	0.001	G
HPGD	3248	genome.wustl.edu	37	4	175414428	175414428	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr4:175414428delT	ENST00000296522.6	-	6	982	c.536delA	c.(535-537)aatfs	p.N179fs	HPGD_ENST00000422112.2_Frame_Shift_Del_p.N111fs|HPGD_ENST00000541923.1_Frame_Shift_Del_p.N58fs|HPGD_ENST00000296521.7_Intron|HPGD_ENST00000510901.1_Frame_Shift_Del_p.N58fs|HPGD_ENST00000542498.1_Intron	NM_000860.5|NM_001145816.2|NM_001256301.1|NM_001256307.1	NP_000851.2|NP_001139288.1|NP_001243230.1|NP_001243236.1	P15428	PGDH_HUMAN	hydroxyprostaglandin dehydrogenase 15-(NAD)	179					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|ductus arteriosus closure (GO:0097070)|female pregnancy (GO:0007565)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|ovulation (GO:0030728)|parturition (GO:0007567)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|thrombin receptor signaling pathway (GO:0070493)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|catalytic activity (GO:0003824)|NAD binding (GO:0051287)|NAD+ binding (GO:0070403)|prostaglandin E receptor activity (GO:0004957)|protein homodimerization activity (GO:0042803)			kidney(1)|lung(3)|prostate(3)	7		Prostate(90;0.00763)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;2.6e-18)|Epithelial(43;4.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.23e-09)|GBM - Glioblastoma multiforme(59;0.00176)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.0253)		ACAAATGGCATTCAGTCTCAC	0.368																																						dbGAP											0													112.0	106.0	108.0					4																	175414428		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0				CCDS3821.1, CCDS54821.1, CCDS58933.1, CCDS58934.1, CCDS58935.1	4q34-q35	2011-09-14			ENSG00000164120	ENSG00000164120	1.1.1.141	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	5154	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 36C, member 1"""	601688				19027726	Standard	NM_000860		Approved	SDR36C1	uc003itu.3	P15428	OTTHUMG00000160772	ENST00000296522.6:c.536delA	4.37:g.175414428delT	ENSP00000296522:p.Asn179fs		B4DTA4|B4DU74|B4DV57|D3DP43|E7EV11|O00749|Q06F08|Q12998	Frame_Shift_Del	DEL	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH,prints_ADH_insect,prints_DH_sc/Rdtase_SDR,prints_DHB_DH	p.N179fs	ENST00000296522.6	37	c.536	CCDS3821.1	4																																																																																			HPGD	-	prints_Glc/ribitol_DH,prints_ADH_insect,prints_DHB_DH	ENSG00000164120		0.368	HPGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPGD	HGNC	protein_coding	OTTHUMT00000362228.3	54	0.00	0	T			175414428	175414428	-1	no_errors	ENST00000296522	ensembl	human	known	69_37n	frame_shift_del	10	16.67	2	DEL	1.000	-
HSPA12A	259217	genome.wustl.edu	37	10	118460472	118460472	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr10:118460472C>T	ENST00000369209.3	-	4	527	c.423G>A	c.(421-423)atG>atA	p.M141I		NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	141						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		TGTGCAGCTTCATCTTGAACT	0.592																																						dbGAP											0													83.0	90.0	88.0					10																	118460472		2031	4177	6208	-	-	-	SO:0001583	missense	0			AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.423G>A	10.37:g.118460472C>T	ENSP00000358211:p.Met141Ile			Missense_Mutation	SNP	NULL	p.M141I	ENST00000369209.3	37	c.423	CCDS41569.1	10	.	.	.	.	.	.	.	.	.	.	C	25.1	4.606099	0.87157	.	.	ENSG00000165868	ENST00000369209	T	0.03663	3.85	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.20373	0.0490	M	0.79805	2.47	0.80722	D	1	D	0.60575	0.988	D	0.66602	0.945	T	0.00098	-1.2070	10	0.62326	D	0.03	.	19.6599	0.95861	0.0:1.0:0.0:0.0	.	141	O43301	HS12A_HUMAN	I	141	ENSP00000358211:M141I	ENSP00000358211:M141I	M	-	3	0	HSPA12A	118450462	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.726000	0.84824	2.652000	0.90054	0.655000	0.94253	ATG	HSPA12A	-	NULL	ENSG00000165868		0.592	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA12A	HGNC	protein_coding	OTTHUMT00000050530.1	38	0.00	0	C	NM_025015		118460472	118460472	-1	no_errors	ENST00000369209	ensembl	human	known	69_37n	missense	31	34.04	16	SNP	1.000	T
INPP4B	8821	genome.wustl.edu	37	4	143007327	143007327	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr4:143007327C>G	ENST00000513000.1	-	25	2890	c.2457G>C	c.(2455-2457)aaG>aaC	p.K819N	INPP4B_ENST00000262992.4_Missense_Mutation_p.K819N|INPP4B_ENST00000308502.4_Missense_Mutation_p.K819N|INPP4B_ENST00000508116.1_Missense_Mutation_p.K819N|INPP4B_ENST00000509777.1_Missense_Mutation_p.K819N	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	819					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					TTTCTACATTCTTTCTTTTTT	0.338																																						dbGAP											0													114.0	115.0	115.0					4																	143007327		2203	4300	6503	-	-	-	SO:0001583	missense	0			U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.2457G>C	4.37:g.143007327C>G	ENSP00000425487:p.Lys819Asn		Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.K819N	ENST00000513000.1	37	c.2457	CCDS3757.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.6|21.6	4.178394|4.178394	0.78564|0.78564	.|.	.|.	ENSG00000109452|ENSG00000109452	ENST00000542702|ENST00000513000;ENST00000262992;ENST00000308502;ENST00000508116;ENST00000509777;ENST00000511838	.|T;T;T;T;T;T	.|0.31247	.|1.53;1.53;1.53;1.53;1.5;1.53	6.17|6.17	3.51|3.51	0.40186|0.40186	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.58250|0.58250	0.2109|0.2109	M|M	0.87269|0.87269	2.87|2.87	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.76575	.|0.988	T|T	0.62431|0.62431	-0.6856|-0.6856	6|10	0.87932|0.72032	D|D	0|0.01	.|.	11.8059|11.8059	0.52155|0.52155	0.0:0.8088:0.0:0.1912|0.0:0.8088:0.0:0.1912	.|.	.|819	.|O15327	.|INP4B_HUMAN	Q|N	634|819;819;819;819;819;634	.|ENSP00000425487:K819N;ENSP00000262992:K819N;ENSP00000308441:K819N;ENSP00000423954:K819N;ENSP00000422793:K819N;ENSP00000426207:K634N	ENSP00000446046:E634Q|ENSP00000262992:K819N	E|K	-|-	1|3	0|2	INPP4B|INPP4B	143226777|143226777	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.904000|1.904000	0.39868|0.39868	0.462000|0.462000	0.27095|0.27095	0.655000|0.655000	0.94253|0.94253	GAA|AAG	INPP4B	-	NULL	ENSG00000109452		0.338	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP4B	HGNC	protein_coding	OTTHUMT00000364587.1	73	0.00	0	C	NM_003866		143007327	143007327	-1	no_errors	ENST00000509777	ensembl	human	known	69_37n	missense	44	15.38	8	SNP	1.000	G
IQGAP2	10788	genome.wustl.edu	37	5	75871577	75871577	+	Silent	SNP	T	T	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr5:75871577T>C	ENST00000274364.6	+	5	738	c.441T>C	c.(439-441)taT>taC	p.Y147Y	IQGAP2_ENST00000379730.3_5'UTR	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	147	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		GAATGATATATTGCATTCACG	0.294																																						dbGAP											0													50.0	54.0	52.0					5																	75871577		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.441T>C	5.37:g.75871577T>C			A8K4V1|B7Z8A4|J3KR91	Silent	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_Rsp5_WWP,pfscan_RasGAP	p.Y147	ENST00000274364.6	37	c.441	CCDS34188.1	5																																																																																			IQGAP2	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000145703		0.294	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP2	HGNC	protein_coding	OTTHUMT00000368877.1	43	0.00	0	T	NM_006633		75871577	75871577	+1	no_errors	ENST00000274364	ensembl	human	known	69_37n	silent	21	25.00	7	SNP	0.999	C
IQSEC1	9922	genome.wustl.edu	37	3	12963630	12963630	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr3:12963630C>G	ENST00000273221.4	-	5	2101	c.1885G>C	c.(1885-1887)Gag>Cag	p.E629Q		NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	629	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CTGAACGCCTCTATGAGCCGC	0.617																																						dbGAP											0													59.0	61.0	61.0					3																	12963630		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.1885G>C	3.37:g.12963630C>G	ENSP00000273221:p.Glu629Gln		O94863|Q96D85	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.E629Q	ENST00000273221.4	37	c.1885	CCDS33703.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.9|24.9	4.582817|4.582817	0.86748|0.86748	.|.	.|.	ENSG00000144711|ENSG00000144711	ENST00000273221;ENST00000435445;ENST00000429247|ENST00000450726	T;T|.	0.60548|.	0.18;0.18|.	4.84|4.84	4.84|4.84	0.62591|0.62591	SEC7-like, alpha orthogonal bundle (1);SEC7-like (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73837|0.73837	0.3638|0.3638	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B;D;B|.	0.59357|.	0.329;0.985;0.072|.	B;P;B|.	0.62435|.	0.426;0.902;0.331|.	T|T	0.73795|0.73795	-0.3870|-0.3870	9|4	0.51188|.	T|.	0.08|.	.|.	17.942|17.942	0.89028|0.89028	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	615;615;629|.	E9PG60;C9JMG9;Q6DN90|.	.;.;IQEC1_HUMAN|.	Q|T	629;615;615|629	ENSP00000273221:E629Q;ENSP00000402299:E615Q|.	ENSP00000273221:E629Q|.	E|R	-|-	1|2	0|0	IQSEC1|IQSEC1	12938630|12938630	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.849000|0.849000	0.48306|0.48306	7.778000|7.778000	0.85637|0.85637	2.229000|2.229000	0.72834|0.72834	0.655000|0.655000	0.94253|0.94253	GAG|AGA	IQSEC1	-	pfam_Sec7,superfamily_Sec7,smart_Sec7,pfscan_Sec7	ENSG00000144711		0.617	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQSEC1	HGNC	protein_coding	OTTHUMT00000339865.2	34	0.00	0	C	NM_014869		12963630	12963630	-1	no_errors	ENST00000273221	ensembl	human	known	69_37n	missense	40	16.67	8	SNP	1.000	G
ITGB2	3689	genome.wustl.edu	37	21	46306292	46306292	+	Silent	SNP	A	A	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr21:46306292A>T	ENST00000397850.2	-	17	2753	c.2301T>A	c.(2299-2301)gcT>gcA	p.A767A	ITGB2_ENST00000397854.3_Silent_p.A710A|ITGB2_ENST00000302347.5_Silent_p.A767A|ITGB2_ENST00000355153.4_Silent_p.A767A|ITGB2_ENST00000397852.1_Silent_p.A767A|ITGB2_ENST00000397857.1_Silent_p.A767A			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	767					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	CCTAACTCTCAGCAAACTTGG	0.557																																						dbGAP											0													137.0	123.0	128.0					21																	46306292		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.2301T>A	21.37:g.46306292A>T			B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Silent	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_tail,pfam_Integrin_bsu_cyt,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,prints_Integrin_bsu	p.A767	ENST00000397850.2	37	c.2301	CCDS13716.1	21																																																																																			ITGB2	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_cyt	ENSG00000160255		0.557	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB2	HGNC	protein_coding	OTTHUMT00000206566.2	78	0.00	0	A	NM_000211		46306292	46306292	-1	no_errors	ENST00000302347	ensembl	human	known	69_37n	silent	35	23.91	11	SNP	0.992	T
KCNMA1	3778	genome.wustl.edu	37	10	78704719	78704719	+	Missense_Mutation	SNP	G	G	T	rs201192736		TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr10:78704719G>T	ENST00000286628.8	-	23	2713	c.2714C>A	c.(2713-2715)aCg>aAg	p.T905K	RP11-443A13.5_ENST00000458661.2_RNA|RP11-443A13.5_ENST00000426234.1_RNA|KCNMA1_ENST00000286627.5_Missense_Mutation_p.T847K|KCNMA1_ENST00000372443.1_Missense_Mutation_p.T847K|RP11-443A13.5_ENST00000608791.1_RNA|KCNMA1_ENST00000372440.1_Missense_Mutation_p.T847K|RP11-443A13.5_ENST00000598613.1_RNA|KCNMA1_ENST00000354353.5_Missense_Mutation_p.T908K|KCNMA1_ENST00000404771.3_Missense_Mutation_p.T905K|KCNMA1_ENST00000406533.3_Missense_Mutation_p.T909K|RP11-443A13.5_ENST00000600782.1_RNA|KCNMA1_ENST00000404857.1_Missense_Mutation_p.T888K	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	905					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.T847M(1)		breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	ACTTAATGGCGTACCCTTTGG	0.453																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											88.0	74.0	79.0					10																	78704719		2203	4300	6503	-	-	-	SO:0001583	missense	0			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.2714C>A	10.37:g.78704719G>T	ENSP00000286628:p.Thr905Lys		F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Nonsense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_dom,pfam_Ion_trans_2,pfam_RCK_N,prints_K_chnl_Ca-activ_BK_asu,prints_K_chnl	p.Y835*	ENST00000286628.8	37	c.2505		10	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	24.7|24.7|24.7	4.564531|4.564531|4.564531	0.86439|0.86439|0.86439	.|.|.	.|.|.	ENSG00000156113|ENSG00000156113|ENSG00000156113	ENST00000372403|ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708|ENST00000372421;ENST00000434208	.|T;T;T;T;T;T;T;T;T|.	.|0.50813|.	.|0.73;0.73;0.73;0.73;0.73;0.73;0.73;0.73;0.73|.	5.74|5.74|5.74	5.74|5.74|5.74	0.90152|0.90152|0.90152	.|NAD(P)-binding domain (1);|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	T|T|.	0.48059|0.48059|.	0.1479|0.1479|.	N|N|N	0.08118|0.08118|0.08118	0|0|0	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;P;P;P;P;B;P;P|.	.|0.56035|.	.|0.974;0.527;0.658;0.912;0.658;0.281;0.942;0.656|.	.|P;B;B;P;B;B;P;B|.	.|0.59171|.	.|0.853;0.244;0.425;0.545;0.425;0.155;0.544;0.343|.	T|T|.	0.42999|0.42999|.	-0.9418|-0.9418|.	5|10|.	.|0.87932|.	.|D|.	.|0|.	-9.8039|-9.8039|-9.8039	19.9196|19.9196|19.9196	0.97082|0.97082|0.97082	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|876;850;888;905;847;658;908;847|.	.|Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;C9JFZ9;F8WA96;Q5SVJ7|.	.|.;.;.;KCMA1_HUMAN;.;.;.;.|.	S|K|X	798|847;784;840;879;842;847;847;879;909;908;888;658|835;554	.|ENSP00000361517:T847K;ENSP00000361485:T784K;ENSP00000361514:T840K;ENSP00000396608:T879K;ENSP00000361520:T847K;ENSP00000286627:T847K;ENSP00000385552:T909K;ENSP00000346321:T908K;ENSP00000385806:T888K|.	.|ENSP00000286627:T847K|.	R|T|Y	-|-|-	1|2|3	0|0|2	KCNMA1|KCNMA1|KCNMA1	78374725|78374725|78374725	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.992000|0.992000|0.992000	0.81027|0.81027|0.81027	9.758000|9.758000|9.758000	0.98927|0.98927|0.98927	2.708000|2.708000|2.708000	0.92522|0.92522|0.92522	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	CGC|ACG|TAC	KCNMA1	-	NULL	ENSG00000156113		0.453	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	KCNMA1	HGNC	protein_coding	OTTHUMT00000048885.3	29	0.00	0	G	NM_002247		78704719	78704719	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000372421	ensembl	human	known	69_37n	nonsense	16	20.00	4	SNP	1.000	T
KCNU1	157855	genome.wustl.edu	37	8	36697999	36697999	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr8:36697999T>A	ENST00000399881.3	+	15	1574	c.1537T>A	c.(1537-1539)Tgg>Agg	p.W513R		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	513					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TAAACAGACCTGGAAGAAACA	0.403																																						dbGAP											0													85.0	79.0	81.0					8																	36697999		1899	4128	6027	-	-	-	SO:0001583	missense	0			BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.1537T>A	8.37:g.36697999T>A	ENSP00000382770:p.Trp513Arg			Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2,prints_K_chnl_Ca-activ_BK_asu	p.W513R	ENST00000399881.3	37	c.1537	CCDS55220.1	8	.	.	.	.	.	.	.	.	.	.	T	13.63	2.294766	0.40594	.	.	ENSG00000215262	ENST00000399881	T	0.64438	-0.1	5.84	5.84	0.93424	Potassium channel, calcium-activated, BK, alpha subunit (1);	0.476093	0.15549	U	0.256545	T	0.79287	0.4420	M	0.79011	2.435	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80243	-0.1463	10	0.87932	D	0	-4.7826	12.6026	0.56504	0.0:0.0:0.0:1.0	.	513	A8MYU2	KCNU1_HUMAN	R	513	ENSP00000382770:W513R	ENSP00000382770:W513R	W	+	1	0	KCNU1	36817157	0.997000	0.39634	0.812000	0.32479	0.020000	0.10135	3.850000	0.55918	2.232000	0.73038	0.533000	0.62120	TGG	KCNU1	-	pfam_K_chnl_Ca-activ_BK_asu	ENSG00000215262		0.403	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	KCNU1	HGNC	protein_coding	OTTHUMT00000376631.1	54	0.00	0	T	NM_001031836		36697999	36697999	+1	no_errors	ENST00000399881	ensembl	human	known	69_37n	missense	19	36.67	11	SNP	0.968	A
KIAA1755	85449	genome.wustl.edu	37	20	36869996	36869996	+	Silent	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr20:36869996G>T	ENST00000279024.4	-	3	808	c.537C>A	c.(535-537)acC>acA	p.T179T		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	179										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				TGGTTATCTTGGTCCAAGGCA	0.532																																						dbGAP											0													128.0	132.0	131.0					20																	36869996		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.537C>A	20.37:g.36869996G>T			Q9C0A8	Silent	SNP	superfamily_CRAL-TRIO_dom	p.T179	ENST00000279024.4	37	c.537	CCDS33467.1	20																																																																																			KIAA1755	-	NULL	ENSG00000149633		0.532	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1755	HGNC	protein_coding	OTTHUMT00000079144.3	53	0.00	0	G	NM_001029864		36869996	36869996	-1	no_errors	ENST00000279024	ensembl	human	known	69_37n	silent	33	16.67	7	SNP	0.220	T
KIF27	55582	genome.wustl.edu	37	9	86485475	86485475	+	Nonsense_Mutation	SNP	T	T	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr9:86485475T>A	ENST00000297814.2	-	12	2859	c.2716A>T	c.(2716-2718)Aaa>Taa	p.K906*	KIF27_ENST00000413982.1_Nonsense_Mutation_p.K840*|RP11-575L7.4_ENST00000586211.1_RNA|KIF27_ENST00000334204.2_Intron|RP11-575L7.4_ENST00000421734.3_RNA|RP11-575L7.4_ENST00000589817.1_RNA|RP11-575L7.4_ENST00000590368.1_RNA|RP11-575L7.4_ENST00000589233.1_RNA|RP11-575L7.4_ENST00000591217.1_RNA	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	906					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						TTTCTCCTTTTCAAGTTACAT	0.353																																						dbGAP											0													73.0	70.0	71.0					9																	86485475		2202	4297	6499	-	-	-	SO:0001587	stop_gained	0			AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.2716A>T	9.37:g.86485475T>A	ENSP00000297814:p.Lys906*		B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Nonsense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.K906*	ENST00000297814.2	37	c.2716	CCDS6665.1	9	.	.	.	.	.	.	.	.	.	.	T	34	5.337618	0.95758	.	.	ENSG00000165115	ENST00000297814;ENST00000413982	.	.	.	3.74	1.12	0.20585	.	0.360406	0.22679	U	0.056979	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.7292	0.28777	0.0:0.0:0.4268:0.5732	.	.	.	.	X	906;840	.	ENSP00000297814:K906X	K	-	1	0	KIF27	85675295	0.010000	0.17322	0.304000	0.25085	0.358000	0.29455	0.050000	0.14120	0.097000	0.17492	0.240000	0.17902	AAA	KIF27	-	NULL	ENSG00000165115		0.353	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF27	HGNC	protein_coding	OTTHUMT00000052861.1	69	0.00	0	T	NM_017576		86485475	86485475	-1	no_errors	ENST00000297814	ensembl	human	known	69_37n	nonsense	43	40.28	29	SNP	0.025	A
KIF5C	3800	genome.wustl.edu	37	2	149799215	149799215	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr2:149799215C>A	ENST00000435030.1	+	7	898	c.530C>A	c.(529-531)cCt>cAt	p.P177H	KIF5C_ENST00000414838.2_Missense_Mutation_p.P82H			O60282	KIF5C_HUMAN	kinesin family member 5C	177	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.|Microtubule-binding.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		GTGTCGAGCCCTGAGGAAGTC	0.488																																						dbGAP											0													74.0	73.0	73.0					2																	149799215		1970	4149	6119	-	-	-	SO:0001583	missense	0			AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.530C>A	2.37:g.149799215C>A	ENSP00000393379:p.Pro177His		O95079|Q2YDC5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.P177H	ENST00000435030.1	37	c.530		2	.	.	.	.	.	.	.	.	.	.	C	18.82	3.705519	0.68615	.	.	ENSG00000168280	ENST00000435030;ENST00000414838;ENST00000334436	T;T	0.72942	-0.7;-0.7	5.48	5.48	0.80851	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.85682	0.5753	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86669	0.1909	9	0.87932	D	0	.	19.5489	0.95310	0.0:1.0:0.0:0.0	.	177	O60282	KIF5C_HUMAN	H	177;82;80	ENSP00000393379:P177H;ENSP00000410115:P82H	ENSP00000334176:P80H	P	+	2	0	KIF5C	149507461	1.000000	0.71417	0.968000	0.41197	0.121000	0.20230	7.580000	0.82523	2.850000	0.98022	0.655000	0.94253	CCT	KIF5C	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000168280		0.488	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	KIF5C	HGNC	protein_coding	OTTHUMT00000332562.3	31	0.00	0	C	NM_004522		149799215	149799215	+1	no_errors	ENST00000435030	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	1.000	A
LAMB1	3912	genome.wustl.edu	37	7	107564469	107564469	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr7:107564469C>G	ENST00000222399.6	-	34	5518	c.5288G>C	c.(5287-5289)aGa>aCa	p.R1763T	LAMB1_ENST00000393561.1_Missense_Mutation_p.R1787T	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1763	Domain I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.R1763T(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						TCCTTCCAGTCTTGCTAATTC	0.353																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											145.0	138.0	140.0					7																	107564469		2203	4300	6503	-	-	-	SO:0001583	missense	0			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.5288G>C	7.37:g.107564469C>G	ENSP00000222399:p.Arg1763Thr		Q14D91	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.R1763T	ENST00000222399.6	37	c.5288	CCDS5750.1	7	.	.	.	.	.	.	.	.	.	.	C	7.867	0.727243	0.15439	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	D;D	0.94417	-3.42;-3.42	5.53	4.64	0.57946	.	.	.	.	.	D	0.85314	0.5668	N	0.08118	0	0.20403	N	0.99991	B;B;B	0.24426	0.002;0.103;0.037	B;B;B	0.26094	0.004;0.066;0.024	T	0.72643	-0.4231	9	0.15066	T	0.55	.	6.9124	0.24342	0.0:0.7551:0.0:0.2449	.	1763;1787;1060	P07942;G3XAI2;Q8TAS6	LAMB1_HUMAN;.;.	T	1787;1763	ENSP00000377191:R1787T;ENSP00000222399:R1763T	ENSP00000222399:R1763T	R	-	2	0	LAMB1	107351705	0.936000	0.31750	0.616000	0.29078	0.833000	0.47200	2.511000	0.45476	2.755000	0.94549	0.650000	0.86243	AGA	LAMB1	-	NULL	ENSG00000091136		0.353	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	HGNC	protein_coding	OTTHUMT00000314584.1	50	0.00	0	C	NM_002291		107564469	107564469	-1	no_errors	ENST00000222399	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	0.054	G
LRRC28	123355	genome.wustl.edu	37	15	99926306	99926306	+	Nonstop_Mutation	SNP	G	G	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr15:99926306G>C	ENST00000301981.3	+	10	1343	c.1103G>C	c.(1102-1104)tGa>tCa	p.*368S	LRRC28_ENST00000422500.2_Nonstop_Mutation_p.*299S|LRRC28_ENST00000447360.2_3'UTR|LRRC28_ENST00000331450.5_Nonstop_Mutation_p.*94S|LRRC28_ENST00000558879.1_3'UTR	NM_144598.2	NP_653199.2	Q86X40	LRC28_HUMAN	leucine rich repeat containing 28	0										endometrium(2)|large_intestine(3)|lung(6)|prostate(1)	12	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)			CTGCTGAGTTGATAAACACTC	0.532																																						dbGAP											0													224.0	223.0	224.0					15																	99926306		2197	4297	6494	-	-	-	SO:0001578	stop_lost	0			AK091588	CCDS10380.1, CCDS66873.1	15q26.3	2004-06-29			ENSG00000168904	ENSG00000168904			28355	protein-coding gene	gene with protein product						12975309	Standard	XM_005254861		Approved	MGC24976, FLJ34269, FLJ45242	uc002bva.1	Q86X40	OTTHUMG00000149854	ENST00000301981.3:c.1103G>C	15.37:g.99926306G>C	ENSP00000304923:p.*368Serext*1		A8KA22|Q6UY49|Q6ZSS6	Nonstop_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.*368S	ENST00000301981.3	37	c.1103	CCDS10380.1	15	.	.	.	.	.	.	.	.	.	.	G	17.84	3.488049	0.64074	.	.	ENSG00000168904	ENST00000301981;ENST00000422500;ENST00000331450	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0666	0.93114	0.0:0.0:1.0:0.0	.	.	.	.	S	368;299;94	.	.	X	+	2	2	LRRC28	97743829	1.000000	0.71417	0.991000	0.47740	0.821000	0.46438	7.182000	0.77689	2.736000	0.93811	0.655000	0.94253	TGA	LRRC28	-	NULL	ENSG00000168904		0.532	LRRC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC28	HGNC	protein_coding	OTTHUMT00000313546.1	52	0.00	0	G	NM_144598		99926306	99926306	+1	no_errors	ENST00000301981	ensembl	human	known	69_37n	nonstop	84	10.64	10	SNP	1.000	C
LYZL4	131375	genome.wustl.edu	37	3	42448452	42448452	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr3:42448452T>C	ENST00000287748.3	-	3	453	c.178A>G	c.(178-180)Atg>Gtg	p.M60V	LYZL4_ENST00000441172.1_Missense_Mutation_p.M60V|LYZL4_ENST00000470991.1_5'UTR	NM_144634.2	NP_653235.1	Q96KX0	LYZL4_HUMAN	lysozyme-like 4	60					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)|nucleus (GO:0005634)	lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(1)|lung(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.222)		TAGATGGCCATGGGGTTGAAC	0.572																																						dbGAP											0													102.0	83.0	90.0					3																	42448452		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016747, AF326749	CCDS2697.1	3p21.33	2006-04-12			ENSG00000157093	ENSG00000157093			28387	protein-coding gene	gene with protein product		612750				12477932	Standard	NM_144634		Approved	MGC26768, LYC4	uc003cle.3	Q96KX0	OTTHUMG00000131793	ENST00000287748.3:c.178A>G	3.37:g.42448452T>C	ENSP00000287748:p.Met60Val			Missense_Mutation	SNP	pfam_Glyco_hydro_22,superfamily_Lysozyme-like_dom,smart_Glyco_hydro_22,prints_Glyco_hydro_22,prints_Glyco_hydro_22_lys	p.M60V	ENST00000287748.3	37	c.178	CCDS2697.1	3	.	.	.	.	.	.	.	.	.	.	T	10.66	1.413442	0.25465	.	.	ENSG00000157093	ENST00000287748;ENST00000441172	T;T	0.68624	-0.34;-0.34	4.31	-2.65	0.06095	Lysozyme-like domain (1);	1.506580	0.04255	N	0.339365	T	0.53142	0.1778	L	0.38838	1.175	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38023	-0.9680	10	0.54805	T	0.06	-0.0079	4.6224	0.12461	0.5672:0.099:0.0:0.3338	.	60	Q96KX0	LYZL4_HUMAN	V	60	ENSP00000287748:M60V;ENSP00000387897:M60V	ENSP00000287748:M60V	M	-	1	0	LYZL4	42423456	0.005000	0.15991	0.029000	0.17559	0.466000	0.32739	-0.380000	0.07427	-0.692000	0.05128	0.460000	0.39030	ATG	LYZL4	-	pfam_Glyco_hydro_22,superfamily_Lysozyme-like_dom,smart_Glyco_hydro_22,prints_Glyco_hydro_22_lys	ENSG00000157093		0.572	LYZL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYZL4	HGNC	protein_coding	OTTHUMT00000254729.2	46	0.00	0	T	NM_144634		42448452	42448452	-1	no_errors	ENST00000287748	ensembl	human	known	69_37n	missense	52	35.80	29	SNP	0.074	C
MAN2B2	23324	genome.wustl.edu	37	4	6598859	6598859	+	Silent	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr4:6598859G>A	ENST00000285599.3	+	8	1113	c.1077G>A	c.(1075-1077)acG>acA	p.T359T	MAN2B2_ENST00000504248.1_Silent_p.T308T	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	359					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						AGGCCTGGACGGGCTTCTACA	0.612																																						dbGAP											0													96.0	105.0	102.0					4																	6598859		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.1077G>A	4.37:g.6598859G>A			Q66MP2|Q86T67	Missense_Mutation	SNP	pfam_Glyco_hydro_38_core,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Glyco_hydro-type_carb-bd,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.R358Q	ENST00000285599.3	37	c.1073	CCDS33951.1	4	.	.	.	.	.	.	.	.	.	.	G	8.974	0.973688	0.18736	.	.	ENSG00000013288	ENST00000505907	.	.	.	5.13	-10.3	0.00346	.	.	.	.	.	T	0.30479	0.0766	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38993	-0.9635	4	.	.	.	-28.2197	0.394	0.00415	0.2654:0.2536:0.2438:0.2372	.	.	.	.	Q	358	.	.	R	+	2	0	MAN2B2	6649760	0.000000	0.05858	0.406000	0.26421	0.952000	0.60782	-2.631000	0.00871	-2.369000	0.00603	-0.275000	0.10095	CGG	MAN2B2	-	pfam_Glyco_hydro_38_cen_dom,smart_Glyco_hydro_38_cen_dom	ENSG00000013288		0.612	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2B2	HGNC	protein_coding	OTTHUMT00000359106.2	83	0.00	0	G	NM_015274		6598859	6598859	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000505907	ensembl	human	known	69_37n	missense	71	12.35	10	SNP	0.040	A
MAP2K1	5604	genome.wustl.edu	37	15	66727520	66727520	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr15:66727520G>T	ENST00000307102.5	+	2	767	c.236G>T	c.(235-237)gGc>gTc	p.G79V		NM_002755.3	NP_002746.1	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	79	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi inheritance (GO:0048313)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte differentiation (GO:0030216)|labyrinthine layer development (GO:0060711)|MAPK cascade (GO:0000165)|melanosome transport (GO:0032402)|mitotic nuclear division (GO:0007067)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell proliferation (GO:0008285)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|neurotrophin TRK receptor signaling pathway (GO:0048011)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|regulation of vascular smooth muscle contraction (GO:0003056)|response to axon injury (GO:0048678)|response to glucocorticoid (GO:0051384)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vesicle transport along microtubule (GO:0047496)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine phosphatase activity (GO:0004728)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(8)|urinary_tract(1)	20					Bosutinib(DB06616)|Trametinib(DB08911)	GCTGGCAATGGCGGTGTGGTG	0.517																																						dbGAP											0													162.0	149.0	154.0					15																	66727520		2201	4299	6500	-	-	-	SO:0001583	missense	0			L11284	CCDS10216.1	15q22.1-q22.33	2014-09-17			ENSG00000169032	ENSG00000169032	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6840	protein-coding gene	gene with protein product		176872		PRKMK1		9465908, 8388392	Standard	NM_002755		Approved	MEK1, MAPKK1	uc010bhq.3	Q02750	OTTHUMG00000133196	ENST00000307102.5:c.236G>T	15.37:g.66727520G>T	ENSP00000302486:p.Gly79Val			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G79V	ENST00000307102.5	37	c.236	CCDS10216.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.0|28.0	4.877549|4.877549	0.91664|0.91664	.|.	.|.	ENSG00000169032|ENSG00000169032	ENST00000307102|ENST00000425818	D|.	0.93547|.	-3.24|.	5.24|5.24	5.24|5.24	0.73138|0.73138	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.097175|.	0.64402|.	D|.	0.000001|.	T|T	0.68302|0.68302	0.2986|0.2986	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	D;D|.	0.71674|.	0.998;0.996|.	D;D|.	0.76575|.	0.988;0.983|.	T|T	0.65232|0.65232	-0.6218|-0.6218	10|5	0.59425|.	D|.	0.04|.	-17.8282|-17.8282	17.8302|17.8302	0.88680|0.88680	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	57;79|.	B4DFY5;Q02750|.	.;MP2K1_HUMAN|.	V|C	79|18	ENSP00000302486:G79V|.	ENSP00000302486:G79V|.	G|W	+|+	2|3	0|0	MAP2K1|MAP2K1	64514574|64514574	1.000000|1.000000	0.71417|0.71417	0.956000|0.956000	0.39512|0.39512	0.974000|0.974000	0.67602|0.67602	9.723000|9.723000	0.98772|0.98772	2.443000|2.443000	0.82685|0.82685	0.591000|0.591000	0.81541|0.81541	GGC|TGG	MAP2K1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000169032		0.517	MAP2K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K1	HGNC	protein_coding	OTTHUMT00000256906.4	40	0.00	0	G			66727520	66727520	+1	no_errors	ENST00000307102	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	T
MECOM	2122	genome.wustl.edu	37	3	169099259	169099259	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr3:169099259C>G	ENST00000494292.1	-	2	188	c.91G>C	c.(91-93)Gat>Cat	p.D31H	MECOM_ENST00000485957.1_5'UTR	NM_004991.3	NP_004982.2	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	31					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						CCATCTGCATCTGGCATTTCT	0.428																																						dbGAP											0													52.0	52.0	52.0					3																	169099259		1920	4130	6050	-	-	-	SO:0001583	missense	0			S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000494292.1:c.91G>C	3.37:g.169099259C>G	ENSP00000417899:p.Asp31His		Q13466|Q6FH90	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.D31H	ENST00000494292.1	37	c.91		3	.	.	.	.	.	.	.	.	.	.	C	15.50	2.852297	0.51270	.	.	ENSG00000085276	ENST00000494292;ENST00000486748	T	0.06294	3.32	5.83	5.83	0.93111	.	0.093185	0.47093	D	0.000243	T	0.20901	0.0503	L	0.44542	1.39	0.80722	D	1	D;P	0.89917	1.0;0.801	D;P	0.72075	0.976;0.452	T	0.00047	-1.2210	10	0.87932	D	0	.	20.1184	0.97949	0.0:1.0:0.0:0.0	.	31;31	Q13465;Q03112-3	MDS1_HUMAN;.	H	31;55	ENSP00000417899:D31H	ENSP00000419537:D55H	D	-	1	0	MECOM	170581953	1.000000	0.71417	1.000000	0.80357	0.061000	0.15899	4.859000	0.62954	2.775000	0.95449	0.650000	0.86243	GAT	MECOM	-	NULL	ENSG00000085276		0.428	MECOM-004	KNOWN	basic|appris_principal	protein_coding	MECOM	HGNC	protein_coding	OTTHUMT00000351517.3	52	0.00	0	C	NM_005241, NM_004991		169099259	169099259	-1	no_errors	ENST00000494292	ensembl	human	known	69_37n	missense	61	10.29	7	SNP	1.000	G
MED18	54797	genome.wustl.edu	37	1	28661311	28661311	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:28661311G>T	ENST00000373842.4	+	3	666	c.457G>T	c.(457-459)Gtg>Ttg	p.V153L	MED18_ENST00000398997.2_Missense_Mutation_p.V153L|MED18_ENST00000479574.1_3'UTR	NM_001127350.1|NM_017638.2	NP_001120822.1|NP_060108.2	Q9BUE0	MED18_HUMAN	mediator complex subunit 18	153						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7		Colorectal(325;0.000147)|Lung NSC(340;0.000818)|all_lung(284;0.000996)|Renal(390;0.00357)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0557)|Ovarian(437;0.113)		OV - Ovarian serous cystadenocarcinoma(117;2.36e-22)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0141)|READ - Rectum adenocarcinoma(331;0.0649)		CCGCATCCTGGTGCCAGGGAA	0.502																																						dbGAP											0													154.0	135.0	142.0					1																	28661311		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002694	CCDS322.1	1p35.3	2007-07-30	2007-07-30		ENSG00000130772	ENSG00000130772			25944	protein-coding gene	gene with protein product		612384	"""mediator of RNA polymerase II transcription, subunit 18 homolog (S. cerevisiae)"""			15175163	Standard	NM_001127350		Approved	FLJ20045, p28b	uc009vtg.3	Q9BUE0	OTTHUMG00000003537	ENST00000373842.4:c.457G>T	1.37:g.28661311G>T	ENSP00000362948:p.Val153Leu		D3DPM1|Q9NXU9	Missense_Mutation	SNP	pfam_Mediator_Med18_met/fun	p.V153L	ENST00000373842.4	37	c.457	CCDS322.1	1	.	.	.	.	.	.	.	.	.	.	G	13.28	2.188665	0.38609	.	.	ENSG00000130772	ENST00000373842;ENST00000398997	.	.	.	5.84	2.6	0.31112	Mediator complex, subunit Med18, metazoa/fungi (1);	0.124501	0.52532	D	0.000064	T	0.28300	0.0699	L	0.40543	1.245	0.21933	N	0.999464	B	0.02656	0.0	B	0.01281	0.0	T	0.08848	-1.0702	9	0.29301	T	0.29	-16.1296	5.9093	0.19018	0.2202:0.1571:0.6227:0.0	.	153	Q9BUE0	MED18_HUMAN	L	153	.	ENSP00000362948:V153L	V	+	1	0	MED18	28533898	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	2.582000	0.46085	1.471000	0.48121	0.655000	0.94253	GTG	MED18	-	pfam_Mediator_Med18_met/fun	ENSG00000130772		0.502	MED18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED18	HGNC	protein_coding	OTTHUMT00000009856.1	41	0.00	0	G	NM_017638		28661311	28661311	+1	no_errors	ENST00000373842	ensembl	human	known	69_37n	missense	52	13.33	8	SNP	1.000	T
SLIT3	6586	genome.wustl.edu	37	5	168195160	168195160	+	Intron	SNP	G	G	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr5:168195160G>C	ENST00000519560.1	-	14	1879				SLIT3_ENST00000332966.8_Intron|SLIT3_ENST00000404867.3_Intron|MIR218-2_ENST00000385006.1_RNA	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)						apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTGCAGGAGAGCACGGTGCTT	0.627																																					Ovarian(29;311 847 10864 17279 24903)	dbGAP											0													22.0	25.0	24.0					5																	168195160		1567	3582	5149	-	-	-	SO:0001627	intron_variant	0			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.1459+4625C>G	5.37:g.168195160G>C			A6H8U9|J3KNP3|O95804|Q9UFH5	RNA	SNP	-	NULL	ENST00000519560.1	37	NULL	CCDS4369.1	5																																																																																			MIR218-2	-	-	ENSG00000207739		0.627	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR218-2	HGNC	protein_coding	OTTHUMT00000252792.4	73	0.00	0	G	NM_003062		168195160	168195160	-1	no_errors	ENST00000385006	ensembl	human	known	69_37n	rna	36	20.00	9	SNP	1.000	C
MPHOSPH10	10199	genome.wustl.edu	37	2	71375164	71375164	+	Silent	SNP	A	A	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr2:71375164A>T	ENST00000244230.2	+	9	1945	c.1593A>T	c.(1591-1593)ccA>ccT	p.P531P		NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	531					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						CAAATCTGCCAGCCATAACCA	0.443																																						dbGAP											0													179.0	185.0	183.0					2																	71375164		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.1593A>T	2.37:g.71375164A>T			A0AVJ8	Silent	SNP	pfam_Mpp10,pirsf_snoRNP_Mpp10	p.P531	ENST00000244230.2	37	c.1593	CCDS1916.1	2																																																																																			MPHOSPH10	-	pfam_Mpp10,pirsf_snoRNP_Mpp10	ENSG00000124383		0.443	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPHOSPH10	HGNC	protein_coding	OTTHUMT00000251924.2	38	0.00	0	A	NM_005791		71375164	71375164	+1	no_errors	ENST00000244230	ensembl	human	known	69_37n	silent	20	16.67	4	SNP	0.136	T
ZAK	51776	genome.wustl.edu	37	2	174074578	174074578	+	Intron	SNP	C	C	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr2:174074578C>T	ENST00000375213.3	+	10	929				MLK7-AS1_ENST00000423106.2_RNA|MLTK_ENST00000409176.2_Intron|MLTK_ENST00000338983.3_Intron|MLTK_ENST00000539448.1_Intron|MLK7-AS1_ENST00000422703.1_RNA|MLTK_ENST00000431503.2_Intron|MLK7-AS1_ENST00000419609.1_RNA	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN							activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)										GTAGCCCCGACAGCAGGCCAC	0.488																																						dbGAP											0													57.0	48.0	51.0					2																	174074578		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0																														ENST00000375213.3:c.851+15C>T	2.37:g.174074578C>T			B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	RNA	SNP	-	NULL	ENST00000375213.3	37	NULL	CCDS42777.1	2																																																																																			MLK7-AS1	-	-	ENSG00000238133		0.488	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLK7-AS1	HGNC	protein_coding	OTTHUMT00000255401.1	19	0.00	0	C			174074578	174074578	-1	no_errors	ENST00000423106	ensembl	human	known	69_37n	rna	20	33.33	10	SNP	0.000	T
MRPL16	54948	genome.wustl.edu	37	11	59574217	59574217	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr11:59574217G>C	ENST00000300151.4	-	4	572	c.359C>G	c.(358-360)gCc>gGc	p.A120G		NM_017840.3	NP_060310.1	Q9NX20	RM16_HUMAN	mitochondrial ribosomal protein L16	120					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(1)|liver(1)|lung(8)	11						TCGCCATATGGCAAACATGTT	0.522																																						dbGAP											0													134.0	119.0	124.0					11																	59574217		2201	4295	6496	-	-	-	SO:0001583	missense	0			AF183428	CCDS7976.1	11q12.1	2012-09-13			ENSG00000166902	ENSG00000166902		"""Mitochondrial ribosomal proteins / large subunits"""	14476	protein-coding gene	gene with protein product		611829					Standard	NM_017840		Approved	FLJ20484, PNAS-111	uc001noh.2	Q9NX20	OTTHUMG00000167410	ENST00000300151.4:c.359C>G	11.37:g.59574217G>C	ENSP00000300151:p.Ala120Gly		Q9BYD0|Q9HB70	Missense_Mutation	SNP	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,prints_Ribosomal_L16	p.A120G	ENST00000300151.4	37	c.359	CCDS7976.1	11	.	.	.	.	.	.	.	.	.	.	G	17.84	3.486812	0.63962	.	.	ENSG00000166902	ENST00000300151;ENST00000534340	T	0.26223	1.75	6.07	5.14	0.70334	Ribosomal protein L10e/L16 (2);	0.138266	0.64402	N	0.000003	T	0.35307	0.0927	M	0.83852	2.665	0.80722	D	1	B	0.17465	0.022	B	0.30316	0.114	T	0.23691	-1.0181	10	0.52906	T	0.07	-11.6244	9.4772	0.38878	0.0745:0.145:0.7804:0.0	.	120	Q9NX20	RM16_HUMAN	G	120;17	ENSP00000300151:A120G	ENSP00000300151:A120G	A	-	2	0	MRPL16	59330793	1.000000	0.71417	0.938000	0.37757	0.999000	0.98932	6.596000	0.74113	1.538000	0.49270	0.655000	0.94253	GCC	MRPL16	-	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,prints_Ribosomal_L16	ENSG00000166902		0.522	MRPL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL16	HGNC	protein_coding	OTTHUMT00000394521.1	66	0.00	0	G	NM_017840		59574217	59574217	-1	no_errors	ENST00000300151	ensembl	human	known	69_37n	missense	48	23.81	15	SNP	0.998	C
MRPL18	29074	genome.wustl.edu	37	6	160212106	160212106	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr6:160212106A>G	ENST00000367034.4	+	2	309	c.187A>G	c.(187-189)Agg>Ggg	p.R63G	TCP1_ENST00000392168.2_5'Flank|TCP1_ENST00000321394.7_5'Flank|TCP1_ENST00000546023.1_5'Flank|TCP1_ENST00000420894.2_5'Flank|MRPL18_ENST00000480842.1_3'UTR|TCP1_ENST00000544255.1_5'Flank	NM_014161.3	NP_054880.2	Q9H0U6	RM18_HUMAN	mitochondrial ribosomal protein L18	63					rRNA import into mitochondrion (GO:0035928)|translation (GO:0006412)	extracellular space (GO:0005615)|mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	5S rRNA binding (GO:0008097)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	11		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.79e-06)		ATCTGTAGCCAGGAAAGAGCG	0.557																																						dbGAP											0													31.0	37.0	35.0					6																	160212106		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161556	CCDS5270.1	6q25.3	2012-09-13			ENSG00000112110	ENSG00000112110		"""Mitochondrial ribosomal proteins / large subunits"""	14477	protein-coding gene	gene with protein product		611831				11042152, 11551941	Standard	NM_014161		Approved	HSPC071	uc003qsw.4	Q9H0U6	OTTHUMG00000015942	ENST00000367034.4:c.187A>G	6.37:g.160212106A>G	ENSP00000356001:p.Arg63Gly		Q5TAP9|Q9NZW8	Missense_Mutation	SNP	pfam_Ribosomal_L18/L5	p.R63G	ENST00000367034.4	37	c.187	CCDS5270.1	6	.	.	.	.	.	.	.	.	.	.	A	17.42	3.384246	0.61845	.	.	ENSG00000112110	ENST00000367034	T	0.51325	0.71	5.33	-4.79	0.03200	.	0.130283	0.52532	D	0.000061	T	0.36441	0.0967	M	0.68952	2.095	0.33015	D	0.528095	P	0.43231	0.801	P	0.49012	0.598	T	0.53358	-0.8450	10	0.49607	T	0.09	-15.8739	13.7352	0.62813	0.2588:0.6782:0.063:0.0	.	63	Q9H0U6	RM18_HUMAN	G	63	ENSP00000356001:R63G	ENSP00000356001:R63G	R	+	1	2	MRPL18	160132096	0.871000	0.30034	0.971000	0.41717	0.992000	0.81027	0.967000	0.29344	-0.488000	0.06726	0.533000	0.62120	AGG	MRPL18	-	NULL	ENSG00000112110		0.557	MRPL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL18	HGNC	protein_coding	OTTHUMT00000042925.1	66	0.00	0	A			160212106	160212106	+1	no_errors	ENST00000367034	ensembl	human	known	69_37n	missense	29	34.09	15	SNP	0.969	G
MRPL42	28977	genome.wustl.edu	37	12	93870793	93870793	+	Splice_Site	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr12:93870793G>T	ENST00000549982.1	+	3	295	c.134G>T	c.(133-135)tGc>tTc	p.C45F	MRPL42_ENST00000548545.1_Splice_Site_p.C45F|MRPL42_ENST00000552217.1_Splice_Site_p.C45F|MRPL42_ENST00000393128.4_Splice_Site_p.C45F|MRPL42_ENST00000361630.2_Splice_Site_p.C45F|MRPL42_ENST00000547098.1_Splice_Site_p.C45F	NM_014050.3|NM_172177.3	NP_054769.1|NP_751917.1	Q9Y6G3	RM42_HUMAN	mitochondrial ribosomal protein L42	45					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)	7						GACTATAATTGGTATGTATTA	0.289																																						dbGAP											0													109.0	111.0	110.0					12																	93870793		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB051626	CCDS9045.1	12q22	2014-02-12			ENSG00000198015	ENSG00000198015		"""Mitochondrial ribosomal proteins / large subunits"", ""Mitochondrial ribosomal proteins / small subunits"""	14493	protein-coding gene	gene with protein product	"""mitochondrial ribosomal protein S32"""	611847				11279123, 11042152	Standard	NM_014050		Approved	MRPS32, MRP-L31, RPML31, PTD007, HSPC204, MRPL31	uc001tcr.3	Q9Y6G3	OTTHUMG00000170157	ENST00000549982.1:c.134+1G>T	12.37:g.93870793G>T			Q6FID1|Q96Q48|Q9P0S1	Missense_Mutation	SNP	pfam_Ribosomal-S32_mit	p.C45F	ENST00000549982.1	37	c.134	CCDS9045.1	12	.	.	.	.	.	.	.	.	.	.	G	18.02	3.530769	0.64860	.	.	ENSG00000198015	ENST00000549982;ENST00000361630;ENST00000552217;ENST00000393128	.	.	.	5.32	5.32	0.75619	.	0.141394	0.45867	D	0.000323	T	0.76399	0.3982	M	0.81802	2.56	0.80722	D	1	P;P	0.47762	0.853;0.9	P;P	0.56563	0.602;0.801	T	0.75548	-0.3279	9	0.33141	T	0.24	-0.5675	16.7647	0.85521	0.0:0.0:1.0:0.0	.	45;45	Q9Y6G3;A6NCI0	RM42_HUMAN;.	F	45	.	ENSP00000355202:C45F	C	+	2	0	MRPL42	92394924	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.512000	0.67030	2.457000	0.83068	0.585000	0.79938	TGC	MRPL42	-	pfam_Ribosomal-S32_mit	ENSG00000198015		0.289	MRPL42-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPL42	HGNC	protein_coding	OTTHUMT00000407715.1	39	0.00	0	G	NM_014050	Missense_Mutation	93870793	93870793	+1	no_errors	ENST00000361630	ensembl	human	known	69_37n	missense	24	11.11	3	SNP	1.000	T
MTPAP	55149	genome.wustl.edu	37	10	30662734	30662734	+	Intron	SNP	G	G	C	rs7476284	byFrequency	TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr10:30662734G>C	ENST00000488290.1	-	1	139							Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase						cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						TCTAAAGGGAGAGCCTGATGA	0.517													.|||	3483	0.695487	0.6309	0.7478	5008	,	,		16512	0.7599		0.7266	False		,,,				2504	0.6472					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000488290.1:c.3964+497C>G	10.37:g.30662734G>C			D3DRX0|Q659E3|Q6P7E5|Q9HA74	RNA	SNP	-	NULL	ENST00000488290.1	37	NULL		10																																																																																			MTPAP	-	-	ENSG00000107951		0.517	MTPAP-002	KNOWN	basic	processed_transcript	MTPAP	HGNC	protein_coding	OTTHUMT00000047427.1	23	0.00	0	G	NM_018109		30662734	30662734	-1	no_errors	ENST00000471055	ensembl	human	known	69_37n	rna	14	22.22	4	SNP	0.093	C
MUC19	283463	genome.wustl.edu	37	12	40959495	40959495	+	3'UTR	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr12:40959495G>T	ENST00000454784.4	+	0	18930							Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						AAAGACTATAGACTGTAAACC	0.443																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.*7304G>T	12.37:g.40959495G>T			Q8NA85	Missense_Mutation	SNP	pfam_Cys_knot,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.R508I	ENST00000454784.4	37	c.1523		12	.	.	.	.	.	.	.	.	.	.	G	10.85	1.466867	0.26335	.	.	ENSG00000205592	ENST00000380816	.	.	.	5.52	2.52	0.30459	.	.	.	.	.	T	0.25827	0.0629	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.18999	-1.0319	4	.	.	.	.	4.8655	0.13606	0.1775:0.0:0.654:0.1685	.	.	.	.	I	508	.	.	R	+	2	0	MUC19	39245762	0.065000	0.20965	0.291000	0.24904	0.077000	0.17291	0.802000	0.27069	0.815000	0.34398	0.650000	0.86243	AGA	MUC19	-	smart_VWF_C,pfscan_VWF_C	ENSG00000205592		0.443	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	39	0.00	0	G	XM_003403524		40959495	40959495	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000380816	ensembl	human	novel	69_37n	missense	19	13.64	3	SNP	0.150	T
MYO7B	4648	genome.wustl.edu	37	2	128387299	128387299	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr2:128387299C>A	ENST00000409816.2	+	33	4658	c.4626C>A	c.(4624-4626)aaC>aaA	p.N1542K	RP11-286H15.1_ENST00000609697.1_RNA|MYO7B_ENST00000389524.4_Missense_Mutation_p.N1542K|MYO7B_ENST00000409090.1_Missense_Mutation_p.N395K|MYO7B_ENST00000428314.1_Missense_Mutation_p.N1542K			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1542	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CCTCTGAGAACTGGACCCTCG	0.622																																						dbGAP											0													35.0	42.0	40.0					2																	128387299		1993	4160	6153	-	-	-	SO:0001583	missense	0				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.4626C>A	2.37:g.128387299C>A	ENSP00000386461:p.Asn1542Lys		Q14786|Q8TEE1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.N1542K	ENST00000409816.2	37	c.4626	CCDS46405.1	2	.	.	.	.	.	.	.	.	.	.	c	10.94	1.492240	0.26774	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000272666;ENST00000409816;ENST00000409090	T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35	5.83	0.494	0.16884	Src homology-3 domain (3);Variant SH3 (1);	0.459125	0.25475	N	0.030417	T	0.50086	0.1595	L	0.42245	1.32	0.26912	N	0.966875	P	0.37594	0.601	B	0.37198	0.243	T	0.43507	-0.9387	10	0.49607	T	0.09	.	2.9165	0.05754	0.1134:0.4565:0.2228:0.2073	.	1542	Q6PIF6	MYO7B_HUMAN	K	1542;1542;637;1542;395	ENSP00000374175:N1542K;ENSP00000415090:N1542K;ENSP00000386461:N1542K;ENSP00000386850:N395K	ENSP00000272666:N637K	N	+	3	2	MYO7B	128103769	0.692000	0.27719	0.990000	0.47175	0.113000	0.19764	0.326000	0.19646	0.324000	0.23333	0.655000	0.94253	AAC	MYO7B	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000169994		0.622	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	HGNC	protein_coding	OTTHUMT00000331124.3	53	0.00	0	C	XM_291001		128387299	128387299	+1	no_errors	ENST00000389524	ensembl	human	known	69_37n	missense	57	10.94	7	SNP	0.343	A
NCF2	4688	genome.wustl.edu	37	1	183536063	183536063	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:183536063G>T	ENST00000367535.3	-	9	1167	c.916C>A	c.(916-918)Cag>Aag	p.Q306K	NCF2_ENST00000367536.1_Missense_Mutation_p.Q306K|NCF2_ENST00000418089.1_Missense_Mutation_p.Q225K|NCF2_ENST00000413720.1_Missense_Mutation_p.Q261K|NCF2_ENST00000469280.1_5'Flank	NM_000433.3	NP_000424.2	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	306					aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cellular response to hormone stimulus (GO:0032870)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron apoptotic process (GO:0043525)|respiratory burst (GO:0045730)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hyperoxia (GO:0055093)|response to laminar fluid shear stress (GO:0034616)|response to lipopolysaccharide (GO:0032496)|response to progesterone (GO:0032570)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|NADPH oxidase complex (GO:0043020)|nucleolus (GO:0005730)|phagolysosome (GO:0032010)	electron carrier activity (GO:0009055)|protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30					Dextromethorphan(DB00514)	ACCTGGGGCTGCTGCTGAGGG	0.512																																						dbGAP											0													94.0	81.0	85.0					1																	183536063		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001606	CCDS1356.1, CCDS53446.1, CCDS53447.1	1q25	2014-09-17	2008-07-31		ENSG00000116701	ENSG00000116701		"""Tetratricopeptide (TTC) repeat domain containing"""	7661	protein-coding gene	gene with protein product	"""NADPH oxidase activator 2"", ""chronic granulomatous disease, autosomal 2"""	608515	"""neutrophil cytosolic factor 2 (65kD, chronic granulomatous disease, autosomal 2)"""				Standard	NM_000433		Approved	p67phox, NOXA2	uc001gqk.4	P19878	OTTHUMG00000035329	ENST00000367535.3:c.916C>A	1.37:g.183536063G>T	ENSP00000356505:p.Gln306Lys		B2R6Q1|B4DKQ7|B4DQA7|E9PHJ2|E9PHX3|Q2PP06|Q8NFC7|Q9BV51	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_TPR-1,pfam_OPR_PB1,superfamily_SH3_domain,smart_TPR_repeat,smart_SH3_domain,smart_OPR_PB1,pfscan_SH3_domain,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_p67phox,prints_SH3_domain	p.Q306K	ENST00000367535.3	37	c.916	CCDS1356.1	1	.	.	.	.	.	.	.	.	.	.	G	12.77	2.036813	0.35893	.	.	ENSG00000116701	ENST00000367536;ENST00000392014;ENST00000413720;ENST00000418089;ENST00000367535;ENST00000419402	T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58	4.45	3.53	0.40419	Src homology-3 domain (1);	0.226724	0.47093	D	0.000254	T	0.22282	0.0537	L	0.53671	1.685	0.25074	N	0.990976	B;B;B	0.12013	0.001;0.005;0.003	B;B;B	0.09377	0.001;0.004;0.004	T	0.29181	-1.0020	10	0.07482	T	0.82	-44.5052	7.0558	0.25099	0.0904:0.0:0.7381:0.1714	.	225;261;306	E9PHJ2;E9PHX3;P19878	.;.;NCF2_HUMAN	K	306;378;261;225;306;45	ENSP00000356506:Q306K;ENSP00000399294:Q261K;ENSP00000407217:Q225K;ENSP00000356505:Q306K;ENSP00000406198:Q45K	ENSP00000356505:Q306K	Q	-	1	0	NCF2	181802686	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.558000	0.53749	1.094000	0.41399	0.655000	0.94253	CAG	NCF2	-	superfamily_SH3_domain	ENSG00000116701		0.512	NCF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NCF2	HGNC	protein_coding	OTTHUMT00000085483.1	50	0.00	0	G	NM_000433		183536063	183536063	-1	no_errors	ENST00000367535	ensembl	human	known	69_37n	missense	39	46.58	34	SNP	1.000	T
NFASC	23114	genome.wustl.edu	37	1	204991709	204991709	+	3'UTR	SNP	C	C	T	rs369341677		TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:204991709C>T	ENST00000401399.1	+	0	9964				NFASC_ENST00000338515.6_3'UTR|NFASC_ENST00000539706.1_3'UTR|NFASC_ENST00000367170.4_3'UTR|NFASC_ENST00000367171.4_3'UTR|NFASC_ENST00000367172.4_3'UTR|NFASC_ENST00000339876.6_3'UTR|NFASC_ENST00000338586.6_3'UTR|NFASC_ENST00000367169.4_3'UTR|NFASC_ENST00000360049.4_3'UTR|NFASC_ENST00000495396.1_3'UTR			O94856	NFASC_HUMAN	neurofascin						axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TCCTTTTTTGCGAGTTATTTT	0.443																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.*6042C>T	1.37:g.204991709C>T			B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	RNA	SNP	-	NULL	ENST00000401399.1	37	NULL	CCDS53460.1	1																																																																																			NFASC	-	-	ENSG00000163531		0.443	NFASC-001	KNOWN	basic|CCDS	protein_coding	NFASC	HGNC	protein_coding	OTTHUMT00000131237.1	51	0.00	0	C	NM_001005388		204991709	204991709	+1	no_errors	ENST00000495396	ensembl	human	known	69_37n	rna	69	19.77	17	SNP	0.000	T
NMD3	51068	genome.wustl.edu	37	3	160952962	160952962	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr3:160952962G>T	ENST00000460469.1	+	6	994	c.539G>T	c.(538-540)gGa>gTa	p.G180V	NMD3_ENST00000472947.1_Missense_Mutation_p.G180V|NMD3_ENST00000478160.1_3'UTR|NMD3_ENST00000351193.2_Missense_Mutation_p.G180V			Q96D46	NMD3_HUMAN	NMD3 ribosome export adaptor	180					protein transport (GO:0015031)|ribosomal large subunit export from nucleus (GO:0000055)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|ribosomal large subunit binding (GO:0043023)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(10)|ovary(1)|skin(1)|urinary_tract(2)	25			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			CTGAAATATGGAATGCATCAG	0.279																																						dbGAP											0													34.0	39.0	37.0					3																	160952962		2196	4274	6470	-	-	-	SO:0001583	missense	0			BC013317	CCDS3194.1	3q26.1	2013-08-06	2013-08-06		ENSG00000169251	ENSG00000169251			24250	protein-coding gene	gene with protein product		611021	"""NMD3 homolog (S. cerevisiae)"""			10810093, 23782956, 12773398	Standard	NM_015938		Approved	CGI-07	uc003feb.1	Q96D46	OTTHUMG00000159063	ENST00000460469.1:c.539G>T	3.37:g.160952962G>T	ENSP00000419004:p.Gly180Val		D3DNM7|Q9Y2Z6	Missense_Mutation	SNP	pfam_NMD3	p.G180V	ENST00000460469.1	37	c.539	CCDS3194.1	3	.	.	.	.	.	.	.	.	.	.	G	13.24	2.176989	0.38413	.	.	ENSG00000169251	ENST00000493066;ENST00000351193;ENST00000472947;ENST00000463518;ENST00000460469;ENST00000540137	T;T;T;T;T	0.45668	0.93;0.9;0.89;0.93;0.9	4.47	3.56	0.40772	.	0.165039	0.51477	D	0.000090	T	0.39279	0.1072	L	0.47716	1.5	0.48571	D	0.999675	B;B	0.32939	0.27;0.391	B;B	0.35770	0.21;0.113	T	0.36089	-0.9762	10	0.59425	D	0.04	-11.8356	13.5015	0.61459	0.0:0.1583:0.8417:0.0	.	180;180	C9JA08;Q96D46	.;NMD3_HUMAN	V	180;180;180;180;180;60	ENSP00000419030:G180V;ENSP00000307525:G180V;ENSP00000417559:G180V;ENSP00000418908:G180V;ENSP00000419004:G180V	ENSP00000307525:G180V	G	+	2	0	NMD3	162435656	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.719000	0.47244	0.948000	0.37687	0.591000	0.81541	GGA	NMD3	-	pfam_NMD3	ENSG00000169251		0.279	NMD3-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NMD3	HGNC	protein_coding	OTTHUMT00000353114.1	58	0.00	0	G	NM_015938		160952962	160952962	+1	no_errors	ENST00000351193	ensembl	human	known	69_37n	missense	44	18.52	10	SNP	1.000	T
NODAL	4838	genome.wustl.edu	37	10	72192733	72192733	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr10:72192733G>T	ENST00000287139.3	-	3	1002	c.1003C>A	c.(1003-1005)Cac>Aac	p.H335N	AC022532.1_ENST00000420338.2_5'Flank	NM_018055.4	NP_060525.3	Q96S42	NODAL_HUMAN	nodal growth differentiation factor	335					axial mesodermal cell fate specification (GO:0048327)|brain development (GO:0007420)|cell migration involved in gastrulation (GO:0042074)|digestive tract morphogenesis (GO:0048546)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic pattern specification (GO:0009880)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|endodermal cell differentiation (GO:0035987)|epiblast cell-extraembryonic ectoderm cell signaling involved in anterior/posterior axis specification (GO:0060802)|floor plate morphogenesis (GO:0033505)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|heart looping (GO:0001947)|inhibition of neuroepithelial cell differentiation (GO:0002085)|left lung morphogenesis (GO:0060460)|liver development (GO:0001889)|maternal placenta development (GO:0001893)|maternal process involved in parturition (GO:0060137)|mesendoderm development (GO:0048382)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of chorionic trophoblast cell proliferation (GO:1901383)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of trophoblast cell migration (GO:1901164)|neural fold formation (GO:0001842)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|placenta development (GO:0001890)|polarity specification of proximal/distal axis (GO:0010085)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gastrulation (GO:0010470)|regulation of stem cell maintenance (GO:2000036)|SMAD protein signal transduction (GO:0060395)|stem cell maintenance (GO:0019827)|transforming growth factor beta receptor signaling pathway involved in primitive streak formation (GO:0090010)|trophectodermal cellular morphogenesis (GO:0001831)|vasculature development (GO:0001944)	extracellular space (GO:0005615)	morphogen activity (GO:0016015)|type I activin receptor binding (GO:0070698)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	15						TCTTTATGGTGATCTAGGAGC	0.537																																						dbGAP											0													252.0	199.0	217.0					10																	72192733		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC033585	CCDS7304.1	10q22.1	2012-12-07	2012-12-07		ENSG00000156574	ENSG00000156574			7865	protein-coding gene	gene with protein product		601265	"""nodal, mouse, homolog"", ""nodal homolog (mouse)"""			9354794	Standard	NM_018055		Approved		uc001jrc.2	Q96S42	OTTHUMG00000018408	ENST00000287139.3:c.1003C>A	10.37:g.72192733G>T	ENSP00000287139:p.His335Asn		Q2M3A5|Q8N4V3	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C	p.H335N	ENST00000287139.3	37	c.1003	CCDS7304.1	10	.	.	.	.	.	.	.	.	.	.	G	22.5	4.293881	0.81025	.	.	ENSG00000156574	ENST00000287139;ENST00000414871	D;D	0.83419	-1.72;-1.72	5.84	5.84	0.93424	Transforming growth factor-beta, C-terminal (3);	0.096933	0.64402	D	0.000001	T	0.75874	0.3909	L	0.37507	1.11	0.47153	D	0.999335	P	0.36086	0.536	B	0.38327	0.271	T	0.71227	-0.4655	10	0.13853	T	0.58	.	13.8277	0.63361	0.0:0.0:0.8469:0.1531	.	335	Q96S42	NODAL_HUMAN	N	335;280	ENSP00000287139:H335N;ENSP00000394468:H280N	ENSP00000287139:H335N	H	-	1	0	NODAL	71862739	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	7.155000	0.77445	2.779000	0.95612	0.655000	0.94253	CAC	NODAL	-	pfam_TGF-b_C,smart_TGF-b_C	ENSG00000156574		0.537	NODAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NODAL	HGNC	protein_coding	OTTHUMT00000048511.1	31	0.00	0	G	NM_018055		72192733	72192733	-1	no_errors	ENST00000287139	ensembl	human	known	69_37n	missense	16	23.81	5	SNP	1.000	T
NT5E	4907	genome.wustl.edu	37	6	86195080	86195080	+	Silent	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr6:86195080G>A	ENST00000257770.3	+	4	928	c.879G>A	c.(877-879)gaG>gaA	p.E293E	NT5E_ENST00000369651.3_Silent_p.E293E	NM_002526.3	NP_002517.1	P21589	5NTD_HUMAN	5'-nucleotidase, ecto (CD73)	293					adenosine biosynthetic process (GO:0046086)|AMP catabolic process (GO:0006196)|dephosphorylation (GO:0016311)|DNA metabolic process (GO:0006259)|negative regulation of inflammatory response (GO:0050728)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Cytarabine(DB00987)|Pentoxifylline(DB00806)	TGAAGATCGAGTTTGATGAAA	0.458																																					Melanoma(140;797 1765 2035 2752 18208)	dbGAP											0													153.0	136.0	141.0					6																	86195080		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X55740	CCDS5002.1, CCDS56439.1	6q14-q21	2013-08-28	2002-04-18	2002-04-19	ENSG00000135318	ENSG00000135318	3.1.3.5	"""CD molecules"""	8021	protein-coding gene	gene with protein product		129190	"""5' nucleotidase (CD73)"""	NT5			Standard	NM_002526		Approved	CD73, eN, eNT, CALJA	uc003pko.4	P21589	OTTHUMG00000015139	ENST00000257770.3:c.879G>A	6.37:g.86195080G>A			B3KQI8|O75520|Q5W116	Missense_Mutation	SNP	pfam_5'-Nucleotdase_C,superfamily_5'-Nucleotdase_C	p.S58N	ENST00000257770.3	37	c.173	CCDS5002.1	6	.	.	.	.	.	.	.	.	.	.	G	8.804	0.933577	0.18206	.	.	ENSG00000135318	ENST00000416334	.	.	.	5.63	1.21	0.21127	.	.	.	.	.	T	0.35770	0.0943	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.19647	-1.0299	4	.	.	.	-11.5023	5.1106	0.14808	0.3216:0.3112:0.3672:0.0	.	.	.	.	N	58	.	.	S	+	2	0	NT5E	86251799	0.968000	0.33430	0.998000	0.56505	0.974000	0.67602	0.168000	0.16622	0.301000	0.22738	0.462000	0.41574	AGT	NT5E	-	NULL	ENSG00000135318		0.458	NT5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5E	HGNC	protein_coding	OTTHUMT00000041388.1	45	0.00	0	G			86195080	86195080	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000416334	ensembl	human	known	69_37n	missense	37	17.78	8	SNP	0.840	A
RABEP1	9135	genome.wustl.edu	37	17	5264483	5264483	+	Intron	SNP	T	T	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr17:5264483T>G	ENST00000546142.2	+	9	1282				RABEP1_ENST00000262477.6_Intron|RABEP1_ENST00000537505.1_Intron|NUP88_ENST00000573169.1_5'UTR|RABEP1_ENST00000408982.2_Intron|RABEP1_ENST00000341923.6_Intron			Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1						apoptotic process (GO:0006915)|endocytosis (GO:0006897)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	8						AACTTGGCCATATGTATTTTC	0.383																																						dbGAP											0													51.0	48.0	49.0					17																	5264483		1897	4121	6018	-	-	-	SO:0001627	intron_variant	0			AF098638	CCDS42243.1, CCDS45592.1	17p13.2	2008-02-05				ENSG00000029725			17677	protein-coding gene	gene with protein product		603616				8521472	Standard	NM_001291582		Approved	neurocrescin, RAB5EP, RABPT5, rabaptin-5	uc002gbm.4	Q15276		ENST00000546142.2:c.1096-20T>G	17.37:g.5264483T>G			B2RAG7|O95369|Q8IVX3	RNA	SNP	-	NULL	ENST00000546142.2	37	NULL	CCDS45592.1	17																																																																																			NUP88	-	-	ENSG00000108559		0.383	RABEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP88	HGNC	protein_coding	OTTHUMT00000439349.1	55	0.00	0	T	NM_004703		5264483	5264483	-1	no_errors	ENST00000573169	ensembl	human	known	69_37n	rna	30	42.31	22	SNP	0.025	G
OBSCN	84033	genome.wustl.edu	37	1	228486289	228486289	+	Intron	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:228486289G>A	ENST00000422127.1	+	43	11703				OBSCN_ENST00000284548.11_Intron|OBSCN_ENST00000366709.4_Intron|OBSCN_ENST00000359599.6_3'UTR|OBSCN_ENST00000570156.2_Missense_Mutation_p.G4361S|OBSCN_ENST00000366707.4_Missense_Mutation_p.G1051S|RP5-1139B12.4_ENST00000602778.1_RNA	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CAGAGATGGGGGCAGATACAG	0.577																																						dbGAP											0													177.0	151.0	159.0					1																	228486289		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11659+3545G>A	1.37:g.228486289G>A			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_DH-domain,pfam_Fibronectin_type3,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.G1051S	ENST00000422127.1	37	c.3151	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	15.72	2.916826	0.52546	.	.	ENSG00000154358	ENST00000366707	T	0.29917	1.55	4.68	1.73	0.24493	.	.	.	.	.	T	0.25344	0.0616	.	.	.	0.40430	D	0.979937	.	.	.	.	.	.	T	0.04961	-1.0915	6	0.18710	T	0.47	.	7.6151	0.28152	0.1507:0.1356:0.7137:0.0	.	.	.	.	S	1051	ENSP00000355668:G1051S	ENSP00000355668:G1051S	G	+	1	0	OBSCN	226552912	0.002000	0.14202	0.017000	0.16124	0.630000	0.37929	1.213000	0.32407	0.197000	0.20387	-0.254000	0.11334	GGC	OBSCN	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000154358		0.577	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		35	0.00	0	G	NM_052843		228486289	228486289	+1	no_errors	ENST00000366707	ensembl	human	known	69_37n	missense	32	13.51	5	SNP	0.594	A
OR11H4	390442	genome.wustl.edu	37	14	20711477	20711477	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr14:20711477T>A	ENST00000315409.2	+	1	580	c.527T>A	c.(526-528)cTc>cAc	p.L176H		NM_001004479.1	NP_001004479.1	Q8NGC9	O11H4_HUMAN	olfactory receptor, family 11, subfamily H, member 4	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	29	all_cancers(95;0.000888)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0146)		ATCTCCCAACTCCCCTTCTGT	0.458																																						dbGAP											0													207.0	190.0	196.0					14																	20711477		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32034.1	14q11.2	2013-09-24			ENSG00000176198	ENSG00000176198		"""GPCR / Class A : Olfactory receptors"""	15347	protein-coding gene	gene with protein product							Standard	NM_001004479		Approved		uc010tld.2	Q8NGC9	OTTHUMG00000170852	ENST00000315409.2:c.527T>A	14.37:g.20711477T>A	ENSP00000318997:p.Leu176His		B2RNQ4|Q6IF07	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L176H	ENST00000315409.2	37	c.527	CCDS32034.1	14	.	.	.	.	.	.	.	.	.	.	T	17.05	3.290549	0.59976	.	.	ENSG00000176198	ENST00000315409	T	0.00301	8.21	4.87	4.87	0.63330	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000171	T	0.00906	0.0030	M	0.93016	3.37	0.21627	N	0.999611	D	0.89917	1.0	D	0.91635	0.999	T	0.19745	-1.0296	10	0.87932	D	0	-17.7784	12.4501	0.55673	0.0:0.0:0.0:1.0	.	176	Q8NGC9	O11H4_HUMAN	H	176	ENSP00000318997:L176H	ENSP00000318997:L176H	L	+	2	0	OR11H4	19781317	0.452000	0.25713	0.980000	0.43619	0.993000	0.82548	3.967000	0.56802	2.041000	0.60428	0.528000	0.53228	CTC	OR11H4	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176198		0.458	OR11H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H4	HGNC	protein_coding	OTTHUMT00000410678.1	52	0.00	0	T			20711477	20711477	+1	no_errors	ENST00000315409	ensembl	human	known	69_37n	missense	44	21.43	12	SNP	0.397	A
OR1C1	26188	genome.wustl.edu	37	1	247921583	247921583	+	Missense_Mutation	SNP	G	G	T	rs558055449		TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:247921583G>T	ENST00000408896.2	-	1	399	c.126C>A	c.(124-126)aaC>aaA	p.N42K		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	42					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			TGATGAGCATGTTCCCCAAGG	0.488																																						dbGAP											0													71.0	69.0	70.0					1																	247921583		2106	4238	6344	-	-	-	SO:0001583	missense	0			X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.126C>A	1.37:g.247921583G>T	ENSP00000386138:p.Asn42Lys		B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.N42K	ENST00000408896.2	37	c.126	CCDS41481.1	1	.	.	.	.	.	.	.	.	.	.	G	14.57	2.574472	0.45902	.	.	ENSG00000221888	ENST00000408896	T	0.75704	-0.96	2.92	2.92	0.33932	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	D	0.89836	0.6830	H	0.98525	4.255	0.23923	N	0.996459	D	0.89917	1.0	D	0.91635	0.999	T	0.78934	-0.2008	9	0.87932	D	0	.	6.2865	0.21037	0.2396:0.0:0.7604:0.0	.	42	Q15619	OR1C1_HUMAN	K	42	ENSP00000386138:N42K	ENSP00000386138:N42K	N	-	3	2	OR1C1	245988206	0.007000	0.16637	0.549000	0.28204	0.661000	0.39034	-0.110000	0.10824	1.626000	0.50381	0.650000	0.86243	AAC	OR1C1	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000221888		0.488	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1C1	HGNC	protein_coding	OTTHUMT00000096855.1	17	0.00	0	G			247921583	247921583	-1	no_errors	ENST00000408896	ensembl	human	known	69_37n	missense	10	23.08	3	SNP	0.904	T
OR2B2	81697	genome.wustl.edu	37	6	27879224	27879224	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr6:27879224G>A	ENST00000303324.2	-	1	950	c.874C>T	c.(874-876)Ctt>Ttt	p.L292F		NM_033057.2	NP_149046.2	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B, member 2	292						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	22						TTGTTCCTAAGTGTATATATA	0.403																																						dbGAP											0													71.0	72.0	72.0					6																	27879224		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z98744	CCDS4641.1	6p22.3-p21.3	2014-02-19	2002-02-28		ENSG00000168131	ENSG00000168131		"""GPCR / Class A : Olfactory receptors"""	13966	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 9"""	OR2B9			Standard	NM_033057		Approved	hs6M1-10, OR6-1, OR2B2Q	uc011dkw.2	Q9GZK3	OTTHUMG00000014495	ENST00000303324.2:c.874C>T	6.37:g.27879224G>A	ENSP00000304419:p.Leu292Phe		B2RNH2|Q9GZL2|Q9Y299	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L292F	ENST00000303324.2	37	c.874	CCDS4641.1	6	.	.	.	.	.	.	.	.	.	.	G	18.58	3.653895	0.67472	.	.	ENSG00000168131	ENST00000303324	T	0.39787	1.06	4.16	4.16	0.48862	.	0.000000	0.34700	U	0.003753	T	0.43787	0.1263	L	0.35644	1.08	0.31136	N	0.707139	D	0.89917	1.0	D	0.91635	0.999	T	0.39820	-0.9595	10	0.72032	D	0.01	.	14.7438	0.69474	0.0:0.0:1.0:0.0	.	292	Q9GZK3	OR2B2_HUMAN	F	292	ENSP00000304419:L292F	ENSP00000304419:L292F	L	-	1	0	OR2B2	27987203	0.678000	0.27586	0.971000	0.41717	0.703000	0.40648	0.941000	0.29005	2.236000	0.73375	0.313000	0.20887	CTT	OR2B2	-	prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000168131		0.403	OR2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2B2	HGNC	protein_coding	OTTHUMT00000040163.1	46	0.00	0	G			27879224	27879224	-1	no_errors	ENST00000303324	ensembl	human	known	69_37n	missense	34	17.07	7	SNP	0.940	A
OR4A16	81327	genome.wustl.edu	37	11	55111386	55111386	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr11:55111386C>A	ENST00000314721.2	+	1	760	c.710C>A	c.(709-711)aCc>aAc	p.T237N		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						GCCCTGCCTACCTGCATCTCC	0.403																																						dbGAP											0													167.0	155.0	159.0					11																	55111386		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.710C>A	11.37:g.55111386C>A	ENSP00000325128:p.Thr237Asn		Q6IFL3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T237N	ENST00000314721.2	37	c.710	CCDS31499.1	11	.	.	.	.	.	.	.	.	.	.	c	13.82	2.350277	0.41599	.	.	ENSG00000181961	ENST00000314721	T	0.40476	1.03	2.54	2.54	0.30619	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.77082	0.4078	H	0.99435	4.565	0.37444	D	0.914542	D	0.69078	0.997	D	0.80764	0.994	D	0.85773	0.1356	9	0.87932	D	0	.	10.7712	0.46323	0.0:1.0:0.0:0.0	.	237	Q8NH70	O4A16_HUMAN	N	237	ENSP00000325128:T237N	ENSP00000325128:T237N	T	+	2	0	OR4A16	54867962	0.995000	0.38212	0.994000	0.49952	0.281000	0.26958	3.559000	0.53756	1.421000	0.47157	0.423000	0.28283	ACC	OR4A16	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000181961		0.403	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A16	HGNC	protein_coding	OTTHUMT00000391160.1	68	0.00	0	C	NM_001005274		55111386	55111386	+1	no_errors	ENST00000314721	ensembl	human	known	69_37n	missense	43	14.00	7	SNP	0.997	A
OR6Q1	219952	genome.wustl.edu	37	11	57798717	57798717	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr11:57798717A>T	ENST00000302622.3	+	1	316	c.293A>T	c.(292-294)tAt>tTt	p.Y98F	OR9Q1_ENST00000335397.3_Intron	NM_001005186.2	NP_001005186.2	Q8NGQ2	OR6Q1_HUMAN	olfactory receptor, family 6, subfamily Q, member 1	98						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			biliary_tract(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(21;0.0707)|all_epithelial(135;0.142)				AATATCTCTTATGCTGATTGC	0.478																																						dbGAP											0													172.0	162.0	165.0					11																	57798717		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065737	CCDS31541.1	11q12.1	2012-08-09			ENSG00000172381	ENSG00000172381		"""GPCR / Class A : Olfactory receptors"""	15302	protein-coding gene	gene with protein product							Standard	NM_001005186		Approved		uc010rjz.2	Q8NGQ2	OTTHUMG00000168831	ENST00000302622.3:c.293A>T	11.37:g.57798717A>T	ENSP00000307734:p.Tyr98Phe		B9EKW1|Q6IFH1|Q96R34	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Y98F	ENST00000302622.3	37	c.293	CCDS31541.1	11	.	.	.	.	.	.	.	.	.	.	A	0.021	-1.423056	0.01126	.	.	ENSG00000172381	ENST00000302622	T	0.00384	7.6	4.8	0.751	0.18392	GPCR, rhodopsin-like superfamily (1);	0.230663	0.22258	N	0.062454	T	0.00109	0.0003	N	0.03177	-0.4	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.35549	-0.9784	10	0.02654	T	1	.	9.645	0.39861	0.3535:0.0:0.0:0.6465	.	98	Q8NGQ2	OR6Q1_HUMAN	F	98	ENSP00000307734:Y98F	ENSP00000307734:Y98F	Y	+	2	0	OR6Q1	57555293	0.000000	0.05858	0.473000	0.27253	0.587000	0.36485	-0.064000	0.11636	0.176000	0.19873	0.523000	0.50628	TAT	OR6Q1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000172381		0.478	OR6Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6Q1	HGNC	protein_coding	OTTHUMT00000401257.1	66	0.00	0	A	NM_001005186		57798717	57798717	+1	no_errors	ENST00000302622	ensembl	human	known	69_37n	missense	58	14.71	10	SNP	0.100	T
OR4D11	219986	genome.wustl.edu	37	11	59271930	59271930	+	Missense_Mutation	SNP	G	G	T	rs267603041		TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr11:59271930G>T	ENST00000313253.1	+	1	882	c.882G>T	c.(880-882)atG>atT	p.M294I		NM_001004706.1	NP_001004706.1	Q8NGI4	OR4DB_HUMAN	olfactory receptor, family 4, subfamily D, member 11	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29						ACCAGGAAATGAAGTCAGCCA	0.522																																						dbGAP											0													80.0	76.0	77.0					11																	59271930		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065810	CCDS31563.1	11q12.1	2012-08-09		2004-03-10	ENSG00000176200	ENSG00000176200		"""GPCR / Class A : Olfactory receptors"""	15174	protein-coding gene	gene with protein product				OR4D11P			Standard	NM_001004706		Approved		uc001noa.1	Q8NGI4	OTTHUMG00000167342	ENST00000313253.1:c.882G>T	11.37:g.59271930G>T	ENSP00000320077:p.Met294Ile			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M294I	ENST00000313253.1	37	c.882	CCDS31563.1	11	.	.	.	.	.	.	.	.	.	.	g	12.19	1.862191	0.32884	.	.	ENSG00000176200	ENST00000313253	T	0.34859	1.34	5.44	5.44	0.79542	.	0.096735	0.45606	D	0.000353	T	0.23133	0.0559	N	0.12182	0.205	0.36680	D	0.878996	B	0.12630	0.006	B	0.15484	0.013	T	0.13176	-1.0519	10	0.56958	D	0.05	-48.3305	12.8781	0.58001	0.0:0.0:0.8372:0.1628	.	294	Q8NGI4	OR4DB_HUMAN	I	294	ENSP00000320077:M294I	ENSP00000320077:M294I	M	+	3	0	OR4D11	59028506	0.981000	0.34729	1.000000	0.80357	0.782000	0.44232	0.336000	0.19823	2.554000	0.86153	0.557000	0.71058	ATG	OR4D11	-	prints_7TM_GPCR_Rhodpsn	ENSG00000176200		0.522	OR4D11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D11	HGNC	protein_coding	OTTHUMT00000394236.1	49	0.00	0	G	NM_001004706		59271930	59271930	+1	no_errors	ENST00000313253	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	1.000	T
OR6Y1	391112	genome.wustl.edu	37	1	158517370	158517370	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:158517370T>A	ENST00000302617.3	-	1	525	c.526A>T	c.(526-528)Atg>Ttg	p.M176L		NM_001005189.1	NP_001005189.1	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y, member 1	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_hematologic(112;0.0378)					ATCTGAGGCATGCCACAGTAG	0.488																																						dbGAP											0													60.0	52.0	55.0					1																	158517370		2202	4300	6502	-	-	-	SO:0001583	missense	0			BK004192	CCDS30899.1	1q23.1	2012-08-09			ENSG00000197532	ENSG00000197532		"""GPCR / Class A : Olfactory receptors"""	14823	protein-coding gene	gene with protein product				OR6Y2			Standard	NM_001005189		Approved		uc010pil.2	Q8NGX8	OTTHUMG00000019629	ENST00000302617.3:c.526A>T	1.37:g.158517370T>A	ENSP00000304807:p.Met176Leu		Q6IFS0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.M176L	ENST00000302617.3	37	c.526	CCDS30899.1	1	.	.	.	.	.	.	.	.	.	.	T	8.749	0.920783	0.17982	.	.	ENSG00000197532	ENST00000302617	T	0.79033	-1.23	5.34	2.87	0.33458	GPCR, rhodopsin-like superfamily (1);	0.185512	0.26891	N	0.021979	T	0.28034	0.0691	N	0.01048	-1.04	0.09310	N	1	B	0.13145	0.007	B	0.15052	0.012	T	0.31916	-0.9926	10	0.51188	T	0.08	.	9.3931	0.38386	0.4811:0.0:0.0:0.5189	.	176	Q8NGX8	OR6Y1_HUMAN	L	176	ENSP00000304807:M176L	ENSP00000304807:M176L	M	-	1	0	OR6Y1	156783994	0.000000	0.05858	0.922000	0.36590	0.429000	0.31625	-0.659000	0.05323	1.013000	0.39391	-0.333000	0.08304	ATG	OR6Y1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000197532		0.488	OR6Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6Y1	HGNC	protein_coding	OTTHUMT00000051844.1	31	0.00	0	T	NM_001005189		158517370	158517370	-1	no_errors	ENST00000302617	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.081	A
OXSM	54995	genome.wustl.edu	37	3	25831376	25831376	+	5'Flank	SNP	C	C	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr3:25831376C>A	ENST00000280701.3	+	0	0				OXSM_ENST00000420173.2_5'Flank|NGLY1_ENST00000417874.2_5'UTR	NM_017897.2	NP_060367.1	Q9NWU1	OXSM_HUMAN	3-oxoacyl-ACP synthase, mitochondrial						acyl-CoA metabolic process (GO:0006637)|medium-chain fatty acid biosynthetic process (GO:0051792)|short-chain fatty acid biosynthetic process (GO:0051790)	mitochondrion (GO:0005739)	3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						GGCAGGTCCTCGATTATCGGC	0.532																																						dbGAP											0													91.0	85.0	87.0					3																	25831376		692	1591	2283	-	-	-	SO:0001631	upstream_gene_variant	0			BC008202	CCDS2643.1, CCDS46780.1	3p24.2	2010-03-19			ENSG00000151093	ENSG00000151093	2.3.1.41		26063	protein-coding gene	gene with protein product	"""beta-ketoacyl synthase"""	610324				12477932	Standard	NM_017897		Approved	KS, FLJ20604, FASN2D	uc003cdn.3	Q9NWU1	OTTHUMG00000130477		3.37:g.25831376C>A	Exception_encountered			RNA	SNP	-	NULL	ENST00000280701.3	37	NULL	CCDS2643.1	3																																																																																			OXSM	-	-	ENSG00000151093		0.532	OXSM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXSM	HGNC	protein_coding	OTTHUMT00000252876.2	24	0.00	0	C	NM_017897		25831376	25831376	+1	no_errors	ENST00000464688	ensembl	human	putative	69_37n	rna	23	17.86	5	SNP	0.000	A
PARP8	79668	genome.wustl.edu	37	5	50090981	50090981	+	Silent	SNP	T	T	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr5:50090981T>A	ENST00000281631.5	+	12	1316	c.1158T>A	c.(1156-1158)acT>acA	p.T386T	PARP8_ENST00000514067.2_Silent_p.T386T|PARP8_ENST00000514342.2_Silent_p.T139T|PARP8_ENST00000505697.2_Silent_p.T386T|PARP8_ENST00000503750.2_Silent_p.T386T|PARP8_ENST00000505554.1_Silent_p.T365T|PARP8_ENST00000511363.2_3'UTR	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	386						intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				GACTATTGACTCGATCTTGTT	0.423																																						dbGAP											0													111.0	107.0	108.0					5																	50090981		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.1158T>A	5.37:g.50090981T>A			Q3KRB7|Q6DHZ1|Q9H754	Silent	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.T386	ENST00000281631.5	37	c.1158	CCDS3954.1	5																																																																																			PARP8	-	NULL	ENSG00000151883		0.423	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP8	HGNC	protein_coding	OTTHUMT00000214035.3	32	0.00	0	T	NM_024615		50090981	50090981	+1	no_errors	ENST00000281631	ensembl	human	known	69_37n	silent	24	22.58	7	SNP	1.000	A
PCDH1	5097	genome.wustl.edu	37	5	141243274	141243274	+	Silent	SNP	C	C	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr5:141243274C>G	ENST00000394536.3	-	3	2761	c.2622G>C	c.(2620-2622)gtG>gtC	p.V874V	PCDH1_ENST00000287008.3_Silent_p.V874V|PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000536585.1_Silent_p.V852V|PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000456271.1_Silent_p.V862V	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	874					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		TGCAGTAGCGCACAAGAACCG	0.592																																					Ovarian(132;1609 1739 4190 14731 45037)	dbGAP											0													181.0	191.0	188.0					5																	141243274		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.2622G>C	5.37:g.141243274C>G			Q8IUP2	Silent	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V874	ENST00000394536.3	37	c.2622	CCDS43375.1	5																																																																																			PCDH1	-	pfam_Protocadherin	ENSG00000156453		0.592	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH1	HGNC	protein_coding	OTTHUMT00000251862.1	67	0.00	0	C	NM_032420		141243274	141243274	-1	no_errors	ENST00000287008	ensembl	human	known	69_37n	silent	38	17.39	8	SNP	0.994	G
PCDH10	57575	genome.wustl.edu	37	4	134072729	134072729	+	Silent	SNP	T	T	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr4:134072729T>C	ENST00000264360.5	+	1	2260	c.1434T>C	c.(1432-1434)ccT>ccC	p.P478P	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	478	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		ACAACGTGCCTGGCGCCTACA	0.602																																						dbGAP											0													79.0	76.0	77.0					4																	134072729		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1434T>C	4.37:g.134072729T>C			Q4W5F6|Q96SF0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P478	ENST00000264360.5	37	c.1434	CCDS34063.1	4																																																																																			PCDH10	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000138650		0.602	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	19	0.00	0	T	NM_032961		134072729	134072729	+1	no_errors	ENST00000264360	ensembl	human	known	69_37n	silent	15	28.57	6	SNP	0.007	C
PCDHGA2	56113	genome.wustl.edu	37	5	140720608	140720608	+	Silent	SNP	T	T	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr5:140720608T>C	ENST00000394576.2	+	1	2070	c.2070T>C	c.(2068-2070)acT>acC	p.T690T	PCDHGA3_ENST00000253812.6_5'Flank|PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	690					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGACCTCACTCTGTACCTGG	0.677																																						dbGAP											0													105.0	112.0	110.0					5																	140720608		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.2070T>C	5.37:g.140720608T>C			Q52LL6|Q9Y5D5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.T690	ENST00000394576.2	37	c.2070	CCDS47289.1	5																																																																																			PCDHGA2	-	NULL	ENSG00000081853		0.677	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA2	HGNC	protein_coding	OTTHUMT00000374738.1	106	0.00	0	T	NM_018915		140720608	140720608	+1	no_errors	ENST00000394576	ensembl	human	known	69_37n	silent	72	18.18	16	SNP	0.018	C
PCED1B	91523	genome.wustl.edu	37	12	47629972	47629972	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr12:47629972G>T	ENST00000546455.1	+	4	1857	c.1126G>T	c.(1126-1128)Ggt>Tgt	p.G376C	RP11-493L12.3_ENST00000547748.1_RNA|PCED1B_ENST00000432328.1_Missense_Mutation_p.G376C			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B	376	Pro-rich.						hydrolase activity (GO:0016787)										TTTTATGGTTGGTCCTCAGCT	0.532																																						dbGAP											0													151.0	144.0	147.0					12																	47629972		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617	ENST00000546455.1:c.1126G>T	12.37:g.47629972G>T	ENSP00000446688:p.Gly376Cys		Q96B20	Missense_Mutation	SNP	superfamily_Esterase_SGNH_hydro-type	p.G376C	ENST00000546455.1	37	c.1126	CCDS8752.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.58|13.58	2.279262|2.279262	0.40294|0.40294	.|.	.|.	ENSG00000179715|ENSG00000179715	ENST00000546455;ENST00000432328|ENST00000330951	T;T|.	0.33438|.	1.41;1.41|.	3.94|3.94	-1.5|-1.5	0.08691|0.08691	.|.	0.923975|.	0.08839|.	N|.	0.886097|.	T|T	0.22820|0.22820	0.0551|0.0551	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	B|.	0.15141|.	0.012|.	B|.	0.12156|.	0.007|.	T|T	0.29458|0.29458	-1.0011|-1.0011	10|6	0.66056|0.87932	D|D	0.02|0	0.0025|0.0025	3.0469|3.0469	0.06157|0.06157	0.2941:0.0:0.3763:0.3296|0.2941:0.0:0.3763:0.3296	.|.	376|.	Q96HM7|.	F113B_HUMAN|.	C|F	376|219	ENSP00000446688:G376C;ENSP00000396040:G376C|.	ENSP00000396040:G376C|ENSP00000328560:L219F	G|L	+|+	1|3	0|2	FAM113B|FAM113B	45916239|45916239	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.008000|0.008000	0.06430|0.06430	-0.706000|-0.706000	0.05047|0.05047	-0.289000|-0.289000	0.09038|0.09038	0.655000|0.655000	0.94253|0.94253	GGT|TTG	PCED1B	-	NULL	ENSG00000179715		0.532	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCED1B	HGNC	protein_coding	OTTHUMT00000405079.1	52	0.00	0	G	NM_138371		47629972	47629972	+1	no_errors	ENST00000432328	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	0.000	T
PDE3B	5140	genome.wustl.edu	37	11	14808117	14808117	+	Silent	SNP	T	T	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr11:14808117T>C	ENST00000282096.4	+	3	1517	c.1164T>C	c.(1162-1164)ggT>ggC	p.G388G	PDE3B_ENST00000455098.2_Intron	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	388					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)	p.G388G(1)		NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	GCTTAATGGGTGCTTTCTCAG	0.453																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											193.0	203.0	200.0					11																	14808117		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0			U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.1164T>C	11.37:g.14808117T>C			B7ZM37|O00639|Q14408|Q6SEI4	Silent	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	p.G388	ENST00000282096.4	37	c.1164	CCDS7817.1	11																																																																																			PDE3B	-	NULL	ENSG00000152270		0.453	PDE3B-001	KNOWN	basic|CCDS	protein_coding	PDE3B	HGNC	protein_coding	OTTHUMT00000386974.1	63	0.00	0	T	NM_000922		14808117	14808117	+1	no_errors	ENST00000282096	ensembl	human	known	69_37n	silent	33	21.43	9	SNP	1.000	C
PER3	8863	genome.wustl.edu	37	1	7890053	7890053	+	Missense_Mutation	SNP	G	G	A	rs1776342	byFrequency	TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:7890053G>A	ENST00000361923.2	+	18	3194	c.3019G>A	c.(3019-3021)Gct>Act	p.A1007T	RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Missense_Mutation_p.A1016T	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	1007	5 X 18 AA tandem repeats of S-[HP]-[AP]- T-[AT]-[GST]-[ATV]-L-S-[MT]-G-[LS]-P-P- [MRS]-[EKR]-[NST]-P.|Ser-rich.		A -> T (in dbSNP:rs1776342).|Missing (associated with eveningness and better cognitive performance during sleep deprivation exepriments; dbSNP:rs57875989).		circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.A1007T(1)		breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		TACTGCCAGCGCTCTGTCCAC	0.587																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											87.0	69.0	75.0					1																	7890053		1995	3902	5897	-	-	-	SO:0001583	missense	0			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.3019G>A	1.37:g.7890053G>A	ENSP00000355031:p.Ala1007Thr		Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,smart_PAS,pfscan_PAS	p.A1007T	ENST00000361923.2	37	c.3019	CCDS89.1	1	.	.	.	.	.	.	.	.	.	.	g	0.668	-0.803078	0.02841	.	.	ENSG00000049246	ENST00000377532;ENST00000361923	T;T	0.14391	2.51;2.51	0.119	0.119	0.14685	Period circadian-like, C-terminal (1);	9.368370	0.00166	N	0.000019	T	0.09158	0.0226	N	0.20685	0.6	0.09310	N	1	B;B;B;B;B	0.25048	0.025;0.007;0.066;0.117;0.007	B;B;B;B;B	0.23018	0.002;0.004;0.004;0.043;0.004	T	0.25676	-1.0125	9	0.18710	T	0.47	.	.	.	.	rs1776342	56;1007;1016;1016;1007	B4DR65;A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;.;PER3_HUMAN	T	1016;1007	ENSP00000366755:A1016T;ENSP00000355031:A1007T	ENSP00000355031:A1007T	A	+	1	0	PER3	7812640	0.000000	0.05858	0.068000	0.19968	0.074000	0.17049	-0.849000	0.04322	0.275000	0.22094	0.280000	0.19369	GCT	PER3	-	pfam_Period_circadian-like_C	ENSG00000049246		0.587	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PER3	HGNC	protein_coding	OTTHUMT00000003607.1	51	0.00	0	G	NM_016831		7890053	7890053	+1	no_errors	ENST00000361923	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.080	A
PER3	8863	genome.wustl.edu	37	1	7890055	7890055	+	Silent	SNP	T	T	A	rs11121034	byFrequency	TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:7890055T>A	ENST00000361923.2	+	18	3196	c.3021T>A	c.(3019-3021)gcT>gcA	p.A1007A	RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Silent_p.A1016A	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	1007	5 X 18 AA tandem repeats of S-[HP]-[AP]- T-[AT]-[GST]-[ATV]-L-S-[MT]-G-[LS]-P-P- [MRS]-[EKR]-[NST]-P.|Ser-rich.		A -> T (in dbSNP:rs1776342).|Missing (associated with eveningness and better cognitive performance during sleep deprivation exepriments; dbSNP:rs57875989).		circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		CTGCCAGCGCTCTGTCCACAG	0.587																																						dbGAP											0													90.0	71.0	77.0					1																	7890055		1995	3900	5895	-	-	-	SO:0001819	synonymous_variant	0			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.3021T>A	1.37:g.7890055T>A			Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Silent	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,smart_PAS,pfscan_PAS	p.A1007	ENST00000361923.2	37	c.3021	CCDS89.1	1																																																																																			PER3	-	pfam_Period_circadian-like_C	ENSG00000049246		0.587	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PER3	HGNC	protein_coding	OTTHUMT00000003607.1	50	0.00	0	T	NM_016831		7890055	7890055	+1	no_errors	ENST00000361923	ensembl	human	known	69_37n	silent	23	14.81	4	SNP	0.063	A
PKD1	5310	genome.wustl.edu	37	16	2156874	2156874	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr16:2156874C>G	ENST00000262304.4	-	17	7349	c.7141G>C	c.(7141-7143)Gtg>Ctg	p.V2381L	PKD1_ENST00000561991.1_5'Flank|PKD1_ENST00000423118.1_Missense_Mutation_p.V2381L	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2381	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CTGCGGCTCACTTCGTACACG	0.652																																						dbGAP											0													8.0	10.0	9.0					16																	2156874		1255	2339	3594	-	-	-	SO:0001583	missense	0			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.7141G>C	16.37:g.2156874C>G	ENSP00000262304:p.Val2381Leu		Q15140|Q15141	Missense_Mutation	SNP	pfam_PKD_dom,pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_LipOase_LH2,pfam_C-type_lectin,pfam_WSC_carb-bd,pfam_GPS_dom,superfamily_C-type_lectin_fold,superfamily_Lipase_LipOase,superfamily_PKD_dom,superfamily_Fe_hydrogenase,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_WSC_carb-bd_subgr,smart_PKD/Chitinase_dom,smart_C-type_lectin,smart_GPS_dom,smart_LipOase_LH2,pfscan_GPS_dom,pfscan_C-type_lectin,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like,pfscan_WSC_carb-bd,prints_PKD_1,tigrfam_Polycystin_cat	p.V2381L	ENST00000262304.4	37	c.7141	CCDS32369.1	16	.	.	.	.	.	.	.	.	.	.	c	18.14	3.556791	0.65425	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101;ENST00000382481	T;T	0.73897	-0.79;-0.79	4.61	4.61	0.57282	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);Polycystin cation channel (1);	0.068481	0.64402	D	0.000016	D	0.84633	0.5515	M	0.68317	2.08	0.46396	D	0.999024	D;D	0.76494	0.999;0.995	D;D	0.73708	0.981;0.957	D	0.84769	0.0766	10	0.46703	T	0.11	.	18.0628	0.89382	0.0:1.0:0.0:0.0	.	2381;2381	P98161-3;P98161	.;PKD1_HUMAN	L	2381;2381;1732;660	ENSP00000262304:V2381L;ENSP00000399501:V2381L	ENSP00000262304:V2381L	V	-	1	0	PKD1	2096875	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.271000	0.65553	2.584000	0.87258	0.544000	0.68410	GTG	PKD1	-	pfam_PKD/REJ-like,pfscan_REJ-like,tigrfam_Polycystin_cat	ENSG00000008710		0.652	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKD1	HGNC	protein_coding	OTTHUMT00000341688.1	108	0.00	0	C			2156874	2156874	-1	no_errors	ENST00000262304	ensembl	human	known	69_37n	missense	61	20.78	16	SNP	1.000	G
PLA2G12A	81579	genome.wustl.edu	37	4	110638792	110638792	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr4:110638792C>G	ENST00000243501.5	-	3	630	c.363G>C	c.(361-363)aaG>aaC	p.K121N	PLA2G12A_ENST00000502283.1_Missense_Mutation_p.K119N|PLA2G12A_ENST00000502772.1_5'UTR	NM_030821.4	NP_110448.2	Q9BZM1	PG12A_HUMAN	phospholipase A2, group XIIA	121					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)			kidney(1)|lung(1)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000268)		CACAGTCATTCTTGCTTTTGC	0.448																																						dbGAP											0													202.0	171.0	181.0					4																	110638792		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3686.1	4q25	2010-11-24	2004-01-13	2004-01-14	ENSG00000123739	ENSG00000123739	3.1.1.4		18554	protein-coding gene	gene with protein product		611652	"""phospholipase A2, group XII"""	PLA2G12		11031251	Standard	NM_030821		Approved		uc003hzp.3	Q9BZM1	OTTHUMG00000131915	ENST00000243501.5:c.363G>C	4.37:g.110638792C>G	ENSP00000243501:p.Lys121Asn		Q9BZ89	Missense_Mutation	SNP	pfam_PLipase_A2_secretory_G12,superfamily_PLipase_A2	p.K121N	ENST00000243501.5	37	c.363	CCDS3686.1	4	.	.	.	.	.	.	.	.	.	.	C	22.5	4.294447	0.81025	.	.	ENSG00000123739	ENST00000243501;ENST00000502283	.	.	.	5.47	4.61	0.57282	Phospholipase A2 (2);	0.051728	0.85682	D	0.000000	T	0.71550	0.3353	M	0.86502	2.82	0.58432	D	0.999999	D;D	0.56968	0.978;0.978	P;P	0.58266	0.836;0.836	T	0.74460	-0.3658	9	0.87932	D	0	.	6.1237	0.20167	0.0:0.6599:0.0:0.3401	.	121;121	Q542Y6;Q9BZM1	.;PG12A_HUMAN	N	121;119	.	ENSP00000243501:K121N	K	-	3	2	PLA2G12A	110858241	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.245000	0.43133	1.268000	0.44264	0.650000	0.86243	AAG	PLA2G12A	-	pfam_PLipase_A2_secretory_G12,superfamily_PLipase_A2	ENSG00000123739		0.448	PLA2G12A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLA2G12A	HGNC	protein_coding	OTTHUMT00000254868.3	53	0.00	0	C			110638792	110638792	-1	no_errors	ENST00000243501	ensembl	human	known	69_37n	missense	34	15.00	6	SNP	1.000	G
PLCD4	84812	genome.wustl.edu	37	2	219494264	219494264	+	Missense_Mutation	SNP	T	T	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr2:219494264T>G	ENST00000450993.2	+	8	1336	c.997T>G	c.(997-999)Tgc>Ggc	p.C333G	PLCD4_ENST00000417849.1_Missense_Mutation_p.C333G|PLCD4_ENST00000432688.1_Missense_Mutation_p.C333G	NM_032726.3	NP_116115.1	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4	333	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				acrosome reaction (GO:0007340)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|urinary_tract(3)	23		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GGGGTGCCGCTGCGTGGAGGT	0.582																																						dbGAP											0													61.0	66.0	64.0					2																	219494264		2039	4181	6220	-	-	-	SO:0001583	missense	0			AI366170	CCDS46516.1	2q35	2013-01-10			ENSG00000115556	ENSG00000115556	3.1.4.11	"""EF-hand domain containing"""	9062	protein-coding gene	gene with protein product		605939				10702683, 9056492	Standard	NM_032726		Approved		uc021vwx.1	Q9BRC7	OTTHUMG00000154743	ENST00000450993.2:c.997T>G	2.37:g.219494264T>G	ENSP00000388631:p.Cys333Gly		Q53FS8	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_EF_hand_Ca-bd,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.C333G	ENST00000450993.2	37	c.997	CCDS46516.1	2	.	.	.	.	.	.	.	.	.	.	T	26.4	4.736772	0.89482	.	.	ENSG00000115556	ENST00000450993;ENST00000251959;ENST00000417849;ENST00000432688	T;T;T	0.69435	-0.4;-0.4;-0.4	5.19	5.19	0.71726	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.000000	0.85682	D	0.000000	D	0.88358	0.6415	H	0.98256	4.185	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.92449	0.5968	10	0.72032	D	0.01	.	14.8778	0.70507	0.0:0.0:0.0:1.0	.	333	Q9BRC7	PLCD4_HUMAN	G	333	ENSP00000388631:C333G;ENSP00000396942:C333G;ENSP00000396185:C333G	ENSP00000251959:C333G	C	+	1	0	PLCD4	219202508	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.668000	0.83897	2.184000	0.69523	0.459000	0.35465	TGC	PLCD4	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom,prints_Pinositol_PLipase_C	ENSG00000115556		0.582	PLCD4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	PLCD4	HGNC	protein_coding	OTTHUMT00000336876.1	61	0.00	0	T			219494264	219494264	+1	no_errors	ENST00000417849	ensembl	human	known	69_37n	missense	15	31.82	7	SNP	1.000	G
PLVAP	83483	genome.wustl.edu	37	19	17476455	17476455	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr19:17476455G>T	ENST00000252590.4	-	3	880	c.819C>A	c.(817-819)gaC>gaA	p.D273E	CTD-2278I10.1_ENST00000597592.1_RNA	NM_031310.1	NP_112600.1	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	273					MAPK cascade (GO:0000165)|positive regulation of cellular extravasation (GO:0002693)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TGGGCATGTGGTCGCAGGCTC	0.637																																						dbGAP											0													48.0	47.0	47.0					19																	17476455		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF326591	CCDS32952.1	19p13.2	2008-07-17				ENSG00000130300			13635	protein-coding gene	gene with protein product	"""fenestrated-endothelial linked structure protein; PV-1 protein"""	607647				11401446	Standard	NM_031310		Approved	gp68, PV-1, PV1, FELS	uc002ngk.1	Q9BX97		ENST00000252590.4:c.819C>A	19.37:g.17476455G>T	ENSP00000252590:p.Asp273Glu		Q86VP0|Q8N8Y0|Q8ND68|Q8TER8|Q9BZD5	Missense_Mutation	SNP	pfam_PV-1	p.D273E	ENST00000252590.4	37	c.819	CCDS32952.1	19	.	.	.	.	.	.	.	.	.	.	G	10.31	1.315892	0.23908	.	.	ENSG00000130300	ENST00000252590	.	.	.	5.17	-0.76	0.11041	.	0.457448	0.24991	N	0.033995	T	0.16085	0.0387	N	0.14661	0.345	0.09310	N	1	B	0.32409	0.37	B	0.34242	0.178	T	0.34725	-0.9817	9	0.05833	T	0.94	-43.6061	9.6553	0.39921	0.0:0.45:0.4199:0.13	.	273	Q9BX97	PLVAP_HUMAN	E	273	.	ENSP00000252590:D273E	D	-	3	2	PLVAP	17337455	0.001000	0.12720	0.293000	0.24932	0.096000	0.18686	-0.348000	0.07740	0.115000	0.18071	0.455000	0.32223	GAC	PLVAP	-	pfam_PV-1	ENSG00000130300		0.637	PLVAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLVAP	HGNC	protein_coding	OTTHUMT00000463655.1	62	0.00	0	G	NM_031310		17476455	17476455	-1	no_errors	ENST00000252590	ensembl	human	known	69_37n	missense	33	13.16	5	SNP	0.013	T
PODN	127435	genome.wustl.edu	37	1	53544664	53544664	+	Silent	SNP	C	C	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:53544664C>T	ENST00000312553.5	+	8	1633	c.1626C>T	c.(1624-1626)ccC>ccT	p.P542P	PODN_ENST00000395871.2_Silent_p.P400P|PODN_ENST00000371500.3_Silent_p.P523P|RP11-334A14.5_ENST00000447867.1_RNA	NM_001199081.1|NM_153703.4	NP_001186010.1|NP_714914.2	Q7Z5L7	PODN_HUMAN	podocan	494					negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CCCTGGGCCCCCGTGCCTGGG	0.692																																						dbGAP											0													6.0	7.0	7.0					1																	53544664		2143	4224	6367	-	-	-	SO:0001819	synonymous_variant	0			AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000312553.5:c.1626C>T	1.37:g.53544664C>T			B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	Silent	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	p.P542	ENST00000312553.5	37	c.1626	CCDS573.1	1																																																																																			PODN	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000174348		0.692	PODN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PODN	HGNC	protein_coding	OTTHUMT00000024735.1	23	0.00	0	C	NM_153703		53544664	53544664	+1	no_errors	ENST00000312553	ensembl	human	known	69_37n	silent	10	44.44	8	SNP	0.011	T
POF1B	79983	genome.wustl.edu	37	X	84614599	84614599	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chrX:84614599G>T	ENST00000262753.4	-	4	539	c.394C>A	c.(394-396)Cca>Aca	p.P132T	POF1B_ENST00000373145.3_Missense_Mutation_p.P132T	NM_024921.3	NP_079197.3	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	132						tight junction (GO:0005923)		p.P132S(1)		central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)	35						GTGGTCTGTGGATATGTAGTA	0.318																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											154.0	139.0	144.0					X																	84614599		2203	4298	6501	-	-	-	SO:0001583	missense	0			BC017500	CCDS14452.1	Xq21.2	2008-02-05			ENSG00000124429	ENSG00000124429			13711	protein-coding gene	gene with protein product		300603				11299520	Standard	NM_024921		Approved	POF, FLJ22792	uc004eer.2	Q8WVV4	OTTHUMG00000021934	ENST00000262753.4:c.394C>A	X.37:g.84614599G>T	ENSP00000262753:p.Pro132Thr		A8K2U5|Q5H9E9|Q5H9F0|Q8NG12|Q9H5Y2|Q9H738|Q9H744	Missense_Mutation	SNP	NULL	p.P132T	ENST00000262753.4	37	c.394	CCDS14452.1	X	.	.	.	.	.	.	.	.	.	.	G	15.95	2.982963	0.53827	.	.	ENSG00000124429	ENST00000262753;ENST00000373145;ENST00000276124	T;T	0.11169	2.8;2.8	4.77	4.77	0.60923	.	0.000000	0.46442	D	0.000298	T	0.22589	0.0545	L	0.47716	1.5	0.32461	N	0.544055	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.07635	-1.0762	10	0.19147	T	0.46	.	11.9219	0.52797	0.0:0.0:1.0:0.0	.	132;132	Q8WVV4-1;Q8WVV4	.;POF1B_HUMAN	T	132	ENSP00000262753:P132T;ENSP00000362238:P132T	ENSP00000262753:P132T	P	-	1	0	POF1B	84501255	1.000000	0.71417	0.999000	0.59377	0.705000	0.40729	3.974000	0.56852	2.199000	0.70637	0.506000	0.49869	CCA	POF1B	-	NULL	ENSG00000124429		0.318	POF1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	POF1B	HGNC	protein_coding	OTTHUMT00000057391.2	54	0.00	0	G	NM_024921		84614599	84614599	-1	no_errors	ENST00000373145	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	1.000	T
POLR2J4	84820	genome.wustl.edu	37	7	44053976	44053976	+	RNA	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr7:44053976G>A	ENST00000427076.1	-	0	357				POLR2J4_ENST00000326391.6_RNA|RP5-1165K10.2_ENST00000454572.1_RNA	NR_003655.2				polymerase (RNA) II (DNA directed) polypeptide J4, pseudogene																		AGCACCCGAGGGACCCTGCAG	0.627																																						dbGAP											0																																										-	-	-			0					7p13	2008-08-21			ENSG00000214783	ENSG00000214783			28195	pseudogene	pseudogene						15586814	Standard	NR_003655		Approved	MGC13098	uc010kxw.2		OTTHUMG00000155253		7.37:g.44053976G>A				RNA	SNP	-	NULL	ENST00000427076.1	37	NULL		7																																																																																			POLR2J4	-	-	ENSG00000214783		0.627	POLR2J4-002	KNOWN	basic|readthrough_transcript	processed_transcript	POLR2J4	HGNC	processed_transcript	OTTHUMT00000473169.1	30	0.00	0	G	NR_003655		44053976	44053976	-1	no_errors	ENST00000326391	ensembl	human	known	69_37n	rna	28	12.50	4	SNP	0.005	A
PRSS50	29122	genome.wustl.edu	37	3	46754418	46754418	+	Silent	SNP	C	C	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr3:46754418C>T	ENST00000460241.1	-	10	2564	c.894G>A	c.(892-894)gaG>gaA	p.E298E	PRSS50_ENST00000315170.7_Silent_p.E298E			Q9UI38	TSP50_HUMAN	protease, serine, 50	298	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	serine-type endopeptidase activity (GO:0004252)|threonine-type endopeptidase activity (GO:0004298)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11						TGTGGGTGTCCTCCGCACACA	0.542																																					Pancreas(41;915 1239 11561 17469)	dbGAP											0													257.0	226.0	237.0					3																	46754418		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF100707	CCDS2745.1	3p21.31	2011-05-24			ENSG00000206549	ENSG00000206549		"""Serine peptidases / Serine peptidases"""	17910	protein-coding gene	gene with protein product	"""cancer/testis antigen 20"", ""testes specific protease 50"""	607950				10397268	Standard	NM_013270		Approved	TSP50, CT20	uc003cqe.1	Q9UI38	OTTHUMG00000164067	ENST00000460241.1:c.894G>A	3.37:g.46754418C>T				Silent	SNP	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.E298	ENST00000460241.1	37	c.894	CCDS2745.1	3																																																																																			PRSS50	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000206549		0.542	PRSS50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS50	HGNC	protein_coding	OTTHUMT00000354544.1	54	0.00	0	C			46754418	46754418	-1	no_errors	ENST00000315170	ensembl	human	known	69_37n	silent	55	12.70	8	SNP	0.072	T
PTPN9	5780	genome.wustl.edu	37	15	75763106	75763106	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr15:75763106C>T	ENST00000306726.2	-	11	1786	c.1274G>A	c.(1273-1275)cGa>cAa	p.R425Q		NM_002833.2	NP_002824.1	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type 9	425	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GAAGCCAAATCGGATCCGAGA	0.463																																						dbGAP											0													138.0	130.0	132.0					15																	75763106		2197	4294	6491	-	-	-	SO:0001583	missense	0				CCDS10280.1	15q23	2011-06-09			ENSG00000169410	ENSG00000169410		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9661	protein-coding gene	gene with protein product		600768				1557404	Standard	NM_002833		Approved	MEG2	uc002bal.3	P43378	OTTHUMG00000142838	ENST00000306726.2:c.1274G>A	15.37:g.75763106C>T	ENSP00000303554:p.Arg425Gln		Q53XR9	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_CRAL-TRIO_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_CRAL-bd_toc_tran	p.R425Q	ENST00000306726.2	37	c.1274	CCDS10280.1	15	.	.	.	.	.	.	.	.	.	.	C	11.72	1.723443	0.30593	.	.	ENSG00000169410	ENST00000306726;ENST00000544966	D	0.83506	-1.73	5.87	1.85	0.25348	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.564097	0.18913	N	0.127692	T	0.60483	0.2272	N	0.10760	0.04	0.37447	D	0.914679	B	0.06786	0.001	B	0.04013	0.001	T	0.46762	-0.9168	10	0.14252	T	0.57	.	5.9373	0.19173	0.0:0.5853:0.1261:0.2886	.	425	P43378	PTN9_HUMAN	Q	425;415	ENSP00000303554:R425Q	ENSP00000303554:R425Q	R	-	2	0	PTPN9	73550159	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	1.391000	0.34475	0.382000	0.24878	0.655000	0.94253	CGA	PTPN9	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000169410		0.463	PTPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN9	HGNC	protein_coding	OTTHUMT00000286474.1	72	0.00	0	C			75763106	75763106	-1	no_errors	ENST00000306726	ensembl	human	known	69_37n	missense	63	18.18	14	SNP	0.996	T
PUM1	9698	genome.wustl.edu	37	1	31538615	31538615	+	5'Flank	SNP	C	C	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:31538615C>G	ENST00000257075.5	-	0	0				PUM1_ENST00000426105.2_5'Flank|PUM1_ENST00000373742.2_Silent_p.P6P|PUM1_ENST00000373741.4_Silent_p.P6P|PUM1_ENST00000440538.2_5'Flank|PUM1_ENST00000373747.3_5'Flank|PUM1_ENST00000424085.2_5'Flank|PUM1_ENST00000423018.2_5'Flank	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1						membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		GCCCCGGCCCCGGCGGTGGCA	0.677																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795		1.37:g.31538615C>G	Exception_encountered		A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Silent	SNP	pfam_Pumilio_RNA-bd_rpt,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.P6	ENST00000257075.5	37	c.18	CCDS338.1	1																																																																																			PUM1	-	NULL	ENSG00000134644		0.677	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PUM1	HGNC	protein_coding	OTTHUMT00000010671.1	68	0.00	0	C			31538615	31538615	-1	no_errors	ENST00000373741	ensembl	human	putative	69_37n	silent	34	26.09	12	SNP	0.995	G
RALGAPA2	57186	genome.wustl.edu	37	20	20501588	20501588	+	Missense_Mutation	SNP	A	A	T	rs376344829		TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr20:20501588A>T	ENST00000202677.7	-	31	4064	c.4057T>A	c.(4057-4059)Ttg>Atg	p.L1353M		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	1353					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						AGGTTACCCAATTCTGCTGAT	0.473																																						dbGAP											0													88.0	84.0	85.0					20																	20501588		1903	4128	6031	-	-	-	SO:0001583	missense	0			AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.4057T>A	20.37:g.20501588A>T	ENSP00000202677:p.Leu1353Met		Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Missense_Mutation	SNP	pfam_Rap_GAP,superfamily_ARM-type_fold,pfscan_Rap_GAP	p.L1353M	ENST00000202677.7	37	c.4057	CCDS46584.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.17|11.17	1.559349|1.559349	0.27827|0.27827	.|.	.|.	ENSG00000188559|ENSG00000188559	ENST00000202677|ENST00000430436	T|.	0.30981|.	1.51|.	6.17|6.17	-8.15|-8.15	0.01065|0.01065	.|.	0.068010|.	0.64402|.	D|.	0.000011|.	T|T	0.50360|0.50360	0.1611|0.1611	L|L	0.60455|0.60455	1.87|1.87	0.21105|0.21105	N|N	0.999783|0.999783	D;D;B|.	0.67145|.	0.994;0.996;0.227|.	P;D;B|.	0.66351|.	0.83;0.943;0.179|.	T|T	0.54801|0.54801	-0.8239|-0.8239	10|5	0.33940|.	T|.	0.23|.	.|.	17.63|17.63	0.88103|0.88103	0.6394:0.0:0.3606:0.0|0.6394:0.0:0.3606:0.0	.|.	1191;1353;1353|.	A8MSM5;Q2PPJ7-2;Q2PPJ7|.	.;.;RGPA2_HUMAN|.	M|K	1353|1169	ENSP00000202677:L1353M|.	ENSP00000202677:L1353M|.	L|N	-|-	1|3	2|2	RALGAPA2|RALGAPA2	20449588|20449588	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.147000|0.147000	0.21601|0.21601	-0.388000|-0.388000	0.07352|0.07352	-1.644000|-1.644000	0.01517|0.01517	-1.836000|-1.836000	0.00589|0.00589	TTG|AAT	RALGAPA2	-	NULL	ENSG00000188559		0.473	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGAPA2	HGNC	protein_coding	OTTHUMT00000471941.1	30	0.00	0	A	NM_020343		20501588	20501588	-1	no_errors	ENST00000202677	ensembl	human	known	69_37n	missense	8	42.86	6	SNP	0.000	T
RGS12	6002	genome.wustl.edu	37	4	3344159	3344159	+	Intron	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr4:3344159G>T	ENST00000344733.5	+	3	2785				RGS12_ENST00000336727.3_Intron|RGS12_ENST00000306648.7_5'UTR|RGS12_ENST00000382788.3_Intron|RGS12_ENST00000543385.1_Intron	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12						positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TCCTGCGCCGGAGTTGGTTGG	0.413																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.1882-505G>T	4.37:g.3344159G>T			B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	RNA	SNP	-	NULL	ENST00000344733.5	37	NULL	CCDS3366.1	4																																																																																			RGS12	-	-	ENSG00000159788		0.413	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS12	HGNC	protein_coding	OTTHUMT00000206602.1	39	0.00	0	G	NM_002926		3344159	3344159	+1	no_errors	ENST00000513784	ensembl	human	known	69_37n	rna	27	12.90	4	SNP	0.004	T
RNF123	63891	genome.wustl.edu	37	3	49742109	49742109	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr3:49742109G>T	ENST00000327697.6	+	22	2023	c.1879G>T	c.(1879-1881)Gtg>Ttg	p.V627L	RNF123_ENST00000432042.1_Missense_Mutation_p.V481L	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	627					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		AGCCAACATTGTGATCGACCC	0.622																																						dbGAP											0													59.0	49.0	52.0					3																	49742109		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.1879G>T	3.37:g.49742109G>T	ENSP00000328287:p.Val627Leu		A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,smart_Znf_RING,pfscan_B30.2/SPRY,pfscan_Znf_RING	p.V627L	ENST00000327697.6	37	c.1879	CCDS33758.1	3	.	.	.	.	.	.	.	.	.	.	G	11.70	1.715650	0.30413	.	.	ENSG00000164068	ENST00000327697;ENST00000389066;ENST00000432042	T;T	0.74421	-0.57;-0.84	4.76	1.45	0.22620	.	0.593407	0.14709	N	0.303084	T	0.47192	0.1432	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17198	-1.0377	10	0.18276	T	0.48	-4.399	4.4893	0.11806	0.1074:0.4227:0.3613:0.1086	.	481;627	C9J266;Q5XPI4	.;RN123_HUMAN	L	627;627;481	ENSP00000328287:V627L;ENSP00000392443:V481L	ENSP00000328287:V627L	V	+	1	0	RNF123	49717113	0.616000	0.27035	0.997000	0.53966	0.992000	0.81027	0.326000	0.19646	0.436000	0.26393	0.561000	0.74099	GTG	RNF123	-	NULL	ENSG00000164068		0.622	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF123	HGNC	protein_coding	OTTHUMT00000346475.2	33	0.00	0	G	NM_022064		49742109	49742109	+1	no_errors	ENST00000327697	ensembl	human	known	69_37n	missense	12	40.00	8	SNP	0.977	T
RNF167	26001	genome.wustl.edu	37	17	4843979	4843979	+	5'UTR	SNP	A	A	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr17:4843979A>G	ENST00000262482.6	+	0	431				RNF167_ENST00000570492.1_3'UTR|SLC25A11_ENST00000225665.7_5'Flank|RNF167_ENST00000576229.1_5'UTR|RNF167_ENST00000571816.1_5'UTR|SLC25A11_ENST00000544061.2_5'Flank|RNF167_ENST00000575111.1_5'UTR|RNF167_ENST00000572430.1_Intron	NM_015528.1	NP_056343.1	Q9H6Y7	RN167_HUMAN	ring finger protein 167						negative regulation of cell cycle (GO:0045786)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(1)	4						CCCGTACCAGAAAAGGATACA	0.552																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AL050060	CCDS11060.1	17p13.3	2013-02-21			ENSG00000108523	ENSG00000108523		"""RING-type (C3HC4) zinc fingers"""	24544	protein-coding gene	gene with protein product		610431				23129617, 23353890	Standard	NM_015528		Approved	DKFZP566H073	uc002fzs.3	Q9H6Y7	OTTHUMG00000099397	ENST00000262482.6:c.-226A>G	17.37:g.4843979A>G			D3DTK8|Q6XYE0|Q8NDC1|Q9Y3V1	RNA	SNP	-	NULL	ENST00000262482.6	37	NULL	CCDS11060.1	17																																																																																			RNF167	-	-	ENSG00000108523		0.552	RNF167-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF167	HGNC	protein_coding	OTTHUMT00000216854.3	56	0.00	0	A	NM_015528		4843979	4843979	+1	no_errors	ENST00000570492	ensembl	human	known	69_37n	rna	25	53.70	29	SNP	0.000	G
ROS1	6098	genome.wustl.edu	37	6	117700254	117700254	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr6:117700254A>C	ENST00000368508.3	-	17	2763	c.2565T>G	c.(2563-2565)atT>atG	p.I855M	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Missense_Mutation_p.I850M	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	855					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TGTACAGGTGAATACATTGAC	0.398			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																	dbGAP		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	0													102.0	92.0	96.0					6																	117700254		2203	4300	6503	-	-	-	SO:0001583	missense	0			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.2565T>G	6.37:g.117700254A>C	ENSP00000357494:p.Ile855Met		Q15368|Q5TDB5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_LDLR_classB_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom	p.I855M	ENST00000368508.3	37	c.2565	CCDS5116.1	6	.	.	.	.	.	.	.	.	.	.	A	15.19	2.761086	0.49468	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	D;D	0.94650	-3.48;-3.48	3.9	0.0546	0.14311	.	0.324036	0.26503	N	0.024017	T	0.81197	0.4772	N	0.19112	0.55	0.80722	D	1	D	0.54772	0.968	P	0.48368	0.575	T	0.77338	-0.2625	10	0.34782	T	0.22	.	0.9353	0.01344	0.3865:0.1615:0.0976:0.3544	.	855	P08922	ROS1_HUMAN	M	855;850	ENSP00000357494:I855M;ENSP00000357493:I850M	ENSP00000357493:I850M	I	-	3	3	ROS1	117806947	0.995000	0.38212	0.999000	0.59377	0.968000	0.65278	0.172000	0.16704	0.013000	0.14918	-0.344000	0.07964	ATT	ROS1	-	NULL	ENSG00000047936		0.398	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	HGNC	protein_coding	OTTHUMT00000043464.1	37	0.00	0	A			117700254	117700254	-1	no_errors	ENST00000368508	ensembl	human	known	69_37n	missense	25	56.14	32	SNP	0.998	C
RTBDN	83546	genome.wustl.edu	37	19	12939557	12939557	+	Silent	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr19:12939557G>A	ENST00000458671.2	-	4	431	c.279C>T	c.(277-279)ctC>ctT	p.L93L	RTBDN_ENST00000589272.1_Silent_p.L125L|CTD-2265O21.3_ENST00000588469.1_RNA|RTBDN_ENST00000393233.2_Missense_Mutation_p.S52F|RTBDN_ENST00000322912.5_Silent_p.L125L|RTBDN_ENST00000592204.1_Silent_p.L103L	NM_001080997.2	NP_001074466.1	Q9BSG5	RTBDN_HUMAN	retbindin	93						extracellular region (GO:0005576)				kidney(1)|large_intestine(5)|liver(1)|lung(4)|prostate(1)	12						GGGCACGTTGGAGGTGTTCCA	0.637																																						dbGAP											0													91.0	88.0	89.0					19																	12939557		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY028917	CCDS12283.1, CCDS45994.1, CCDS59355.1, CCDS59356.1	19p13	2006-03-22				ENSG00000132026			30310	protein-coding gene	gene with protein product		609553				12107411	Standard	NM_001080997		Approved	FLJ36353	uc002mvj.4	Q9BSG5		ENST00000458671.2:c.279C>T	19.37:g.12939557G>A			F1T0I8|Q9BWT5	Missense_Mutation	SNP	NULL	p.S52F	ENST00000458671.2	37	c.155	CCDS45994.1	19	.	.	.	.	.	.	.	.	.	.	G	19.26	3.792790	0.70452	.	.	ENSG00000132026	ENST00000393233	T	0.39229	1.09	4.38	-0.528	0.11905	.	.	.	.	.	T	0.37183	0.0994	.	.	.	0.21652	N	0.999605	.	.	.	.	.	.	T	0.39781	-0.9597	6	0.87932	D	0	-40.5201	4.3942	0.11355	0.2171:0.3651:0.4178:0.0	.	.	.	.	F	52	ENSP00000376925:S52F	ENSP00000376925:S52F	S	-	2	0	RTBDN	12800557	0.862000	0.29867	0.862000	0.33874	0.924000	0.55760	0.199000	0.17237	-0.063000	0.13065	0.563000	0.77884	TCC	RTBDN	-	NULL	ENSG00000132026		0.637	RTBDN-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	RTBDN	HGNC	protein_coding	OTTHUMT00000451513.1	33	0.00	0	G	NM_031429		12939557	12939557	-1	no_errors	ENST00000393233	ensembl	human	known	69_37n	missense	10	37.50	6	SNP	0.636	A
SIGLEC6	946	genome.wustl.edu	37	19	52023428	52023428	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr19:52023428G>T	ENST00000425629.3	-	8	1424	c.1270C>A	c.(1270-1272)Ctc>Atc	p.L424I	SIGLEC6_ENST00000346477.3_Missense_Mutation_p.L408I|CTD-3073N11.9_ENST00000598220.1_RNA|SIGLEC6_ENST00000391797.3_3'UTR|SIGLEC6_ENST00000474054.1_5'UTR|SIGLEC6_ENST00000343300.4_3'UTR|SIGLEC6_ENST00000359982.4_3'UTR|SIGLEC6_ENST00000436458.1_Missense_Mutation_p.L372I	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	424					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		GCGTAGTGGAGCTCCTGCTCA	0.493																																						dbGAP											0													208.0	201.0	203.0					19																	52023428		2002	4187	6189	-	-	-	SO:0001583	missense	0			D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.1270C>A	19.37:g.52023428G>T	ENSP00000401502:p.Leu424Ile		A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Missense_Mutation	SNP	pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L424I	ENST00000425629.3	37	c.1270	CCDS12834.3	19	.	.	.	.	.	.	.	.	.	.	.	9.348	1.064811	0.20067	.	.	ENSG00000105492	ENST00000346477;ENST00000391797;ENST00000425629;ENST00000436458	T;T	0.05447	3.44;3.44	2.57	2.57	0.30868	.	.	.	.	.	T	0.08133	0.0203	M	0.64567	1.98	0.09310	N	1	P;P;P	0.43750	0.816;0.725;0.603	B;B;B	0.41374	0.232;0.355;0.232	T	0.21381	-1.0247	9	0.20519	T	0.43	.	8.7521	0.34622	0.0:0.0:1.0:0.0	.	372;408;424	C9JBE5;O43699-3;O43699	.;.;SIGL6_HUMAN	I	397;408;424;372	ENSP00000401502:L424I;ENSP00000410679:L372I	ENSP00000344064:L397I	L	-	1	0	SIGLEC6	56715240	0.002000	0.14202	0.023000	0.16930	0.024000	0.10985	0.435000	0.21510	1.726000	0.51525	0.609000	0.83330	CTC	SIGLEC6	-	NULL	ENSG00000105492		0.493	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC6	HGNC	protein_coding	OTTHUMT00000257670.3	60	0.00	0	G	NM_001245		52023428	52023428	-1	no_errors	ENST00000425629	ensembl	human	known	69_37n	missense	48	27.27	18	SNP	0.033	T
SLAMF1	6504	genome.wustl.edu	37	1	160607175	160607175	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:160607175A>T	ENST00000302035.6	-	2	570	c.221T>A	c.(220-222)gTc>gAc	p.V74D	SLAMF1_ENST00000355199.3_Missense_Mutation_p.V74D|SLAMF1_ENST00000538290.1_Missense_Mutation_p.V74D|SLAMF1_ENST00000235739.5_Missense_Mutation_p.V74D	NM_003037.2	NP_003028.1	Q13291	SLAF1_HUMAN	signaling lymphocytic activation molecule family member 1	74	Ig-like V-type.				lymphocyte activation (GO:0046649)|positive regulation of cell proliferation (GO:0008284)|regulation of catalytic activity (GO:0050790)|regulation of vesicle fusion (GO:0031338)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|phagocytic vesicle (GO:0045335)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			TTTGTTCTCGACACTGTTCTC	0.448																																						dbGAP											0													195.0	154.0	168.0					1																	160607175		2203	4300	6503	-	-	-	SO:0001583	missense	0			U33017	CCDS1207.1	1q23.3	2013-01-11	2003-10-29	2003-10-31	ENSG00000117090	ENSG00000117090		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10903	protein-coding gene	gene with protein product		603492	"""signaling lymphocytic activation molecule"""	SLAM		7617038	Standard	XM_005245456		Approved	CD150	uc001fwl.4	Q13291	OTTHUMG00000024006	ENST00000302035.6:c.221T>A	1.37:g.160607175A>T	ENSP00000306190:p.Val74Asp		Q5W172|Q9HBE8	Missense_Mutation	SNP	pfam_Sig_lymph_act_molc_N,pfscan_Ig-like	p.V74D	ENST00000302035.6	37	c.221	CCDS1207.1	1	.	.	.	.	.	.	.	.	.	.	A	18.34	3.603551	0.66445	.	.	ENSG00000117090	ENST00000302035;ENST00000235739;ENST00000392208;ENST00000538290;ENST00000355199	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	4.19	-1.6	0.08426	Signaling lymphocytic activation molecule, N-terminal (2);	2.773610	0.00977	N	0.003321	T	0.25232	0.0613	L	0.42245	1.32	0.25177	N	0.990238	P;P	0.52577	0.954;0.88	P;B	0.48189	0.57;0.378	T	0.05733	-1.0867	10	0.48119	T	0.1	0.1758	3.7198	0.08452	0.4015:0.0:0.4109:0.1877	.	74;74	B4E2E4;Q13291	.;SLAF1_HUMAN	D	74	ENSP00000306190:V74D;ENSP00000235739:V74D;ENSP00000438406:V74D;ENSP00000347333:V74D	ENSP00000235739:V74D	V	-	2	0	SLAMF1	158873799	0.007000	0.16637	0.025000	0.17156	0.717000	0.41224	-0.187000	0.09656	-0.277000	0.09193	0.402000	0.26972	GTC	SLAMF1	-	pfam_Sig_lymph_act_molc_N	ENSG00000117090		0.448	SLAMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAMF1	HGNC	protein_coding	OTTHUMT00000060454.1	55	0.00	0	A			160607175	160607175	-1	no_errors	ENST00000302035	ensembl	human	known	69_37n	missense	59	18.06	13	SNP	0.037	T
SLC17A4	10050	genome.wustl.edu	37	6	25776936	25776936	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr6:25776936G>T	ENST00000377905.4	+	9	1220	c.1101G>T	c.(1099-1101)agG>agT	p.R367S	SLC17A4_ENST00000439485.2_Missense_Mutation_p.R137S|SLC17A4_ENST00000397076.2_Missense_Mutation_p.R137S	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	367					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TCACCATCAGGAAACTCTTCA	0.493																																						dbGAP											0													159.0	144.0	149.0					6																	25776936		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.1101G>T	6.37:g.25776936G>T	ENSP00000367137:p.Arg367Ser		B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R367S	ENST00000377905.4	37	c.1101	CCDS4564.1	6	.	.	.	.	.	.	.	.	.	.	G	21.8	4.205270	0.79127	.	.	ENSG00000146039	ENST00000377905;ENST00000439485;ENST00000397076	T;T;T	0.65549	-0.16;-0.16;0.51	5.63	2.89	0.33648	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.56097	D	0.000029	T	0.79639	0.4480	H	0.97315	3.98	0.41717	D	0.989486	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.81529	-0.0891	10	0.87932	D	0	.	7.127	0.25477	0.2696:0.0:0.7304:0.0	.	137;137;367	E7EPE8;E7EU17;Q9Y2C5	.;.;S17A4_HUMAN	S	367;137;137	ENSP00000367137:R367S;ENSP00000391345:R137S;ENSP00000380266:R137S	ENSP00000367137:R367S	R	+	3	2	SLC17A4	25884915	1.000000	0.71417	0.996000	0.52242	0.999000	0.98932	1.827000	0.39102	0.870000	0.35726	0.655000	0.94253	AGG	SLC17A4	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000146039		0.493	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A4	HGNC	protein_coding	OTTHUMT00000040068.1	32	0.00	0	G			25776936	25776936	+1	no_errors	ENST00000377905	ensembl	human	known	69_37n	missense	39	17.02	8	SNP	1.000	T
SLC22A10	387775	genome.wustl.edu	37	11	63057905	63057905	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr11:63057905C>T	ENST00000332793.6	+	1	270	c.268C>T	c.(268-270)Cgc>Tgc	p.R90C	SLC22A10_ENST00000526800.1_Missense_Mutation_p.R38C|SLC22A10_ENST00000535888.1_Intron|SLC22A10_ENST00000544661.1_5'UTR|SLC22A10_ENST00000525620.1_Intron	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	90						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	GAAGTGTCGTCGCTTTGTCCA	0.488																																						dbGAP											0													113.0	116.0	115.0					11																	63057905		2201	4298	6499	-	-	-	SO:0001583	missense	0			AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.268C>T	11.37:g.63057905C>T	ENSP00000327569:p.Arg90Cys		Q68CJ0	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R90C	ENST00000332793.6	37	c.268	CCDS41661.1	11	.	.	.	.	.	.	.	.	.	.	C	14.09	2.432407	0.43224	.	.	ENSG00000184999	ENST00000332793;ENST00000526800	T;T	0.73152	1.07;-0.72	2.89	2.89	0.33648	.	0.000000	0.64402	U	0.000002	D	0.84840	0.5561	M	0.93638	3.44	0.22435	N	0.999101	D;D	0.89917	1.0;0.99	D;P	0.73708	0.981;0.572	T	0.74618	-0.3605	10	0.72032	D	0.01	.	7.4093	0.27009	0.2593:0.7407:0.0:0.0	.	38;90	E9PJB1;Q63ZE4	.;S22AA_HUMAN	C	90;38	ENSP00000327569:R90C;ENSP00000433908:R38C	ENSP00000327569:R90C	R	+	1	0	SLC22A10	62814481	0.044000	0.20184	0.565000	0.28409	0.710000	0.40934	1.640000	0.37186	1.662000	0.50781	0.579000	0.79373	CGC	SLC22A10	-	NULL	ENSG00000184999		0.488	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A10	HGNC	protein_coding	OTTHUMT00000382622.3	41	0.00	0	C	NM_001039752		63057905	63057905	+1	no_errors	ENST00000332793	ensembl	human	known	69_37n	missense	26	18.75	6	SNP	0.224	T
SLC23A3	151295	genome.wustl.edu	37	2	220033428	220033428	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr2:220033428G>C	ENST00000409878.3	-	5	652	c.620C>G	c.(619-621)tCt>tGt	p.S207C	SLC23A3_ENST00000455516.2_Missense_Mutation_p.S215C|SLC23A3_ENST00000396775.3_Intron|SLC23A3_ENST00000295738.7_Missense_Mutation_p.S207C	NM_001144889.1	NP_001138361.1	Q6PIS1	S23A3_HUMAN	solute carrier family 23, member 3	207					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	11		Renal(207;0.0474)		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCTGTGGGCAGAGAGCCCTGC	0.662																																						dbGAP											0													22.0	28.0	26.0					2																	220033428		1982	4148	6130	-	-	-	SO:0001583	missense	0			BC030243	CCDS42819.1, CCDS46517.1, CCDS46518.1	2q35	2013-07-18	2013-07-18		ENSG00000213901	ENSG00000213901		"""Solute carriers"""	20601	protein-coding gene	gene with protein product							Standard	NM_144712		Approved	SVCT3, FLJ31168, Yspl1	uc010zkr.2	Q6PIS1	OTTHUMG00000154616	ENST00000409878.3:c.620C>G	2.37:g.220033428G>C	ENSP00000386473:p.Ser207Cys		B7Z512|Q2PYN6|Q96NA6	Missense_Mutation	SNP	pfam_Xant/urac/vitC	p.S215C	ENST00000409878.3	37	c.644	CCDS46518.1	2	.	.	.	.	.	.	.	.	.	.	G	16.32	3.089562	0.55968	.	.	ENSG00000213901	ENST00000295738;ENST00000409878;ENST00000455516;ENST00000409370;ENST00000430764	T;T;T;T;T	0.21031	2.03;2.03;2.03;2.03;2.03	4.75	3.85	0.44370	.	0.171467	0.41294	N	0.000901	T	0.49898	0.1584	M	0.84948	2.725	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	1.0;1.0;0.992;1.0	T	0.57551	-0.7792	9	.	.	.	-9.739	14.4968	0.67694	0.0:0.1482:0.8518:0.0	.	207;215;207;207	Q6PIS1;B7Z512;Q6PIS1-2;B7Z508	S23A3_HUMAN;.;.;.	C	207;207;215;207;162	ENSP00000295738:S207C;ENSP00000386473:S207C;ENSP00000406546:S215C;ENSP00000386989:S207C;ENSP00000388907:S162C	.	S	-	2	0	SLC23A3	219741672	0.999000	0.42202	0.947000	0.38551	0.725000	0.41563	3.161000	0.50747	1.186000	0.42985	0.655000	0.94253	TCT	SLC23A3	-	pfam_Xant/urac/vitC	ENSG00000213901		0.662	SLC23A3-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SLC23A3	HGNC	protein_coding	OTTHUMT00000336331.2	22	0.00	0	G	NM_144712		220033428	220033428	-1	no_errors	ENST00000455516	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	0.995	C
SLC4A4	8671	genome.wustl.edu	37	4	72102346	72102346	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr4:72102346G>T	ENST00000264485.5	+	2	170	c.53G>T	c.(52-54)tGt>tTt	p.C18F	SLC4A4_ENST00000425175.1_Missense_Mutation_p.C18F|SLC4A4_ENST00000351898.6_Missense_Mutation_p.C18F	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	18					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	AAGCATGTGTGTGATGAAGAA	0.393																																						dbGAP											0													114.0	118.0	117.0					4																	72102346		1888	4115	6003	-	-	-	SO:0001583	missense	0			AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.53G>T	4.37:g.72102346G>T	ENSP00000264485:p.Cys18Phe		C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.C18F	ENST00000264485.5	37	c.53	CCDS43236.1	4	.	.	.	.	.	.	.	.	.	.	G	7.309	0.614640	0.14129	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000351898	T;T;T	0.76316	-1.01;-1.01;-0.63	5.82	5.82	0.92795	.	0.087849	0.85682	D	0.000000	T	0.75488	0.3856	L	0.33293	1	0.80722	D	1	B;D;D	0.63880	0.013;0.985;0.993	B;P;P	0.52217	0.014;0.693;0.675	T	0.69359	-0.5166	10	0.06099	T	0.92	.	20.1001	0.97870	0.0:0.0:1.0:0.0	.	18;18;18	A5JJ20;Q9Y6R1-4;Q9Y6R1	.;.;S4A4_HUMAN	F	18	ENSP00000264485:C18F;ENSP00000393557:C18F;ENSP00000307349:C18F	ENSP00000264485:C18F	C	+	2	0	SLC4A4	72321210	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.636000	0.83301	2.760000	0.94817	0.655000	0.94253	TGT	SLC4A4	-	NULL	ENSG00000080493		0.393	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A4	HGNC	protein_coding	OTTHUMT00000362090.1	34	0.00	0	G	NM_003759		72102346	72102346	+1	no_errors	ENST00000425175	ensembl	human	known	69_37n	missense	9	25.00	3	SNP	1.000	T
SP100	6672	genome.wustl.edu	37	2	231308967	231308967	+	Silent	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr2:231308967G>A	ENST00000264052.5	+	4	700	c.345G>A	c.(343-345)aaG>aaA	p.K115K	SP100_ENST00000340126.4_Silent_p.K115K|SP100_ENST00000427101.2_Silent_p.K90K|SP100_ENST00000341950.4_Silent_p.K115K|SP100_ENST00000409341.1_Silent_p.K115K|SP100_ENST00000409897.1_Silent_p.K80K|SP100_ENST00000409112.1_Silent_p.K115K|SP100_ENST00000409824.1_Silent_p.K90K	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen	115	HSR. {ECO:0000255|PROSITE- ProRule:PRU00747}.				cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		AACTGGAGAAGACATTTAACC	0.373																																						dbGAP											0													118.0	120.0	119.0					2																	231308967		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.345G>A	2.37:g.231308967G>A			B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Silent	SNP	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom	p.K115	ENST00000264052.5	37	c.345	CCDS2477.1	2																																																																																			SP100	-	pfam_Sp100	ENSG00000067066		0.373	SP100-001	KNOWN	basic|CCDS	protein_coding	SP100	HGNC	protein_coding	OTTHUMT00000256914.2	57	0.00	0	G	NM_003113		231308967	231308967	+1	no_errors	ENST00000340126	ensembl	human	known	69_37n	silent	28	20.00	7	SNP	0.690	A
TCTE1	202500	genome.wustl.edu	37	6	44254202	44254202	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr6:44254202G>T	ENST00000371505.4	-	3	467	c.345C>A	c.(343-345)gaC>gaA	p.D115E	TCTE1_ENST00000371504.1_5'Flank|TMEM151B_ENST00000438774.2_Intron|TCTE1_ENST00000371503.3_5'UTR|RP11-444E17.6_ENST00000505802.1_Intron	NM_182539.3	NP_872345.2	Q5JU00	TCTE1_HUMAN	t-complex-associated-testis-expressed 1	115										breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CCAGTGGTAGGTCAGGGGACA	0.602																																						dbGAP											0													123.0	119.0	121.0					6																	44254202		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035022	CCDS4910.1	6q21.1	2014-07-18			ENSG00000146221	ENSG00000146221			11693	protein-coding gene	gene with protein product		186975				2568335, 8646886	Standard	NM_182539		Approved	D6S46, MGC33600, FAP155	uc003oxi.2	Q5JU00	OTTHUMG00000014763	ENST00000371505.4:c.345C>A	6.37:g.44254202G>T	ENSP00000360560:p.Asp115Glu		B4DX59|Q8IYS6	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.D115E	ENST00000371505.4	37	c.345	CCDS4910.1	6	.	.	.	.	.	.	.	.	.	.	G	12.21	1.868800	0.32977	.	.	ENSG00000146221	ENST00000371505	T	0.26660	1.72	4.95	3.11	0.35812	.	0.316544	0.33813	N	0.004540	T	0.06781	0.0173	L	0.38175	1.15	0.80722	D	1	B	0.12630	0.006	B	0.08055	0.003	T	0.14868	-1.0457	10	0.24483	T	0.36	-33.5563	6.3498	0.21369	0.1596:0.2976:0.5428:0.0	.	115	Q5JU00	TCTE1_HUMAN	E	115	ENSP00000360560:D115E	ENSP00000360560:D115E	D	-	3	2	TCTE1	44362180	0.992000	0.36948	0.988000	0.46212	0.932000	0.56968	1.343000	0.33930	0.457000	0.26962	0.563000	0.77884	GAC	TCTE1	-	NULL	ENSG00000146221		0.602	TCTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCTE1	HGNC	protein_coding	OTTHUMT00000040736.1	66	0.00	0	G	NM_182539		44254202	44254202	-1	no_errors	ENST00000371505	ensembl	human	known	69_37n	missense	56	22.22	16	SNP	0.855	T
THAP7	80764	genome.wustl.edu	37	22	21356745	21356745	+	5'Flank	SNP	T	T	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr22:21356745T>C	ENST00000215742.4	-	0	0				THAP7-AS1_ENST00000429962.1_RNA|THAP7-AS1_ENST00000436079.1_RNA|THAP7-AS1_ENST00000452284.1_RNA|THAP7_ENST00000399133.2_5'Flank	NM_030573.2	NP_085050.2	Q9BT49	THAP7_HUMAN	THAP domain containing 7						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nuclear speck (GO:0016607)	C2H2 zinc finger domain binding (GO:0070742)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)			cervix(1)|lung(2)|prostate(3)|skin(1)|stomach(1)	8	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CGGAATGACCTCTGACGGAAG	0.642																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			BC004346	CCDS13787.1	22q11.2	2013-01-25			ENSG00000184436	ENSG00000184436		"""THAP (C2CH-type zinc finger) domain containing"""	23190	protein-coding gene	gene with protein product		609518				12575992	Standard	NM_030573		Approved	MGC10963	uc002ztr.1	Q9BT49	OTTHUMG00000150879		22.37:g.21356745T>C	Exception_encountered		B2RD97|D3DX40	RNA	SNP	-	NULL	ENST00000215742.4	37	NULL	CCDS13787.1	22																																																																																			THAP7-AS1	-	-	ENSG00000230513		0.642	THAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP7-AS1	HGNC	protein_coding	OTTHUMT00000320405.1	62	0.00	0	T	NM_030573		21356745	21356745	+1	no_errors	ENST00000429962	ensembl	human	known	69_37n	rna	47	11.32	6	SNP	0.000	C
TINAG	27283	genome.wustl.edu	37	6	54254718	54254718	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr6:54254718C>G	ENST00000259782.4	+	11	1522	c.1426C>G	c.(1426-1428)Cca>Gca	p.P476A		NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	476					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			TTCTGATGAACCATAACATAT	0.398																																						dbGAP											0													118.0	117.0	117.0					6																	54254718		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.1426C>G	6.37:g.54254718C>G	ENSP00000259782:p.Pro476Ala		Q5T467|Q9UJW1|Q9ULZ4	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,pfam_Somatomedin_B_dom,smart_Somatomedin_B_dom,smart_Peptidase_C1A_C,pfscan_Somatomedin_B_dom	p.P476A	ENST00000259782.4	37	c.1426	CCDS4955.1	6	.	.	.	.	.	.	.	.	.	.	C	17.41	3.382431	0.61845	.	.	ENSG00000137251	ENST00000339741;ENST00000259782;ENST00000370865	T	0.65732	-0.17	5.75	3.91	0.45181	.	0.095726	0.46758	N	0.000268	T	0.25975	0.0633	N	0.08118	0	0.80722	D	1	B	0.10296	0.003	B	0.10450	0.005	T	0.14144	-1.0483	10	0.87932	D	0	.	12.7419	0.57257	0.0:0.6837:0.3163:0.0	.	476	Q9UJW2	TINAG_HUMAN	A	335;476;155	ENSP00000259782:P476A	ENSP00000259782:P476A	P	+	1	0	TINAG	54362677	1.000000	0.71417	0.669000	0.29828	0.888000	0.51559	1.604000	0.36804	0.722000	0.32252	0.591000	0.81541	CCA	TINAG	-	NULL	ENSG00000137251		0.398	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TINAG	HGNC	protein_coding	OTTHUMT00000040984.1	43	0.00	0	C	NM_014464		54254718	54254718	+1	no_errors	ENST00000259782	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	0.994	G
TP53	7157	genome.wustl.edu	37	17	7578239	7578239	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr17:7578239C>A	ENST00000269305.4	-	6	799	c.610G>T	c.(610-612)Gag>Tag	p.E204*	TP53_ENST00000445888.2_Nonsense_Mutation_p.E204*|TP53_ENST00000420246.2_Nonsense_Mutation_p.E204*|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Nonsense_Mutation_p.E204*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E204*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E204*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	204	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> A (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in a sporadic cancer; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).|VE -> LV (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E204*(33)|p.0?(8)|p.?(5)|p.E72*(3)|p.E111*(3)|p.E204K(2)|p.E204fs*43(2)|p.E204Q(1)|p.E204fs*4(1)|p.V203_E204>V*(1)|p.V203_E204>LV(1)|p.E204fs*39(1)|p.G199fs*42(1)|p.E204_N210delEYLDDRN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCCAAATACTCCACACGCAAA	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	63	Substitution - Nonsense(39)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(5)|Substitution - Missense(3)|Complex - compound substitution(2)|Deletion - In frame(1)	lung(15)|haematopoietic_and_lymphoid_tissue(7)|large_intestine(6)|upper_aerodigestive_tract(5)|biliary_tract(5)|NS(5)|breast(4)|bone(4)|oesophagus(3)|ovary(3)|central_nervous_system(2)|stomach(1)|liver(1)|urinary_tract(1)|pancreas(1)											133.0	118.0	123.0					17																	7578239		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.610G>T	17.37:g.7578239C>A	ENSP00000269305:p.Glu204*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.E204*	ENST00000269305.4	37	c.610	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	14.28	2.489037	0.44249	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	-0.604	0.11626	.	0.445020	0.26082	N	0.026458	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-5.2849	1.4244	0.02320	0.133:0.2829:0.3261:0.258	.	.	.	.	X	204;204;204;204;204;204;193;111;72;111;72	.	ENSP00000269305:E204X	E	-	1	0	TP53	7518964	0.600000	0.26899	0.018000	0.16275	0.030000	0.12068	0.945000	0.29056	-0.004000	0.14419	0.655000	0.94253	GAG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	40	0.00	0	C	NM_000546		7578239	7578239	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	22	43.59	17	SNP	0.045	A
TRIM64C	646754	genome.wustl.edu	37	11	49080382	49080382	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr11:49080382G>T	ENST00000530230.1	-	1	282	c.283C>A	c.(283-285)Cat>Aat	p.H95N		NM_001206631.1	NP_001193560.1	A6NLI5	TR64C_HUMAN	tripartite motif containing 64C	95						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						GTCTCCTCATGGAGCACACAG	0.527																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS73287.1	11p11.12	2014-04-02	2011-01-25		ENSG00000214891	ENSG00000214891		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	37148	protein-coding gene	gene with protein product			"""tripartite motif-containing 64C"""				Standard	NM_001206631		Approved		uc021qiy.1	A6NLI5	OTTHUMG00000166752	ENST00000530230.1:c.283C>A	11.37:g.49080382G>T	ENSP00000431987:p.His95Asn			Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.H95N	ENST00000530230.1	37	c.283		11	.	.	.	.	.	.	.	.	.	.	G	12.02	1.813397	0.32053	.	.	ENSG00000214891	ENST00000530230	T	0.68479	-0.33	1.55	0.549	0.17213	.	.	.	.	.	T	0.81399	0.4814	H	0.96576	3.845	0.09310	N	1	.	.	.	.	.	.	T	0.71354	-0.4618	7	0.87932	D	0	.	4.9436	0.13978	0.0:0.0:0.6453:0.3547	.	.	.	.	N	95	ENSP00000431987:H95N	ENSP00000431987:H95N	H	-	1	0	TRIM64C	49036958	0.433000	0.25562	0.001000	0.08648	0.300000	0.27592	2.679000	0.46909	0.209000	0.20645	0.184000	0.17185	CAT	TRIM64C	-	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box	ENSG00000214891		0.527	TRIM64C-001	KNOWN	basic|appris_principal	protein_coding	TRIM64C	HGNC	protein_coding	OTTHUMT00000391366.1	74	0.00	0	G			49080382	49080382	-1	no_errors	ENST00000530230	ensembl	human	known	69_37n	missense	57	18.57	13	SNP	0.000	T
TRPA1	8989	genome.wustl.edu	37	8	72975065	72975065	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr8:72975065A>G	ENST00000262209.4	-	6	983	c.776T>C	c.(775-777)cTg>cCg	p.L259P		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	259					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	ACCATTGTCCAGGCACATTTT	0.378																																						dbGAP											0													152.0	139.0	143.0					8																	72975065		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.776T>C	8.37:g.72975065A>G	ENSP00000262209:p.Leu259Pro		A6NIN6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L259P	ENST00000262209.4	37	c.776	CCDS34908.1	8	.	.	.	.	.	.	.	.	.	.	A	23.0	4.359280	0.82353	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.72835	-0.69;2.1	5.62	5.62	0.85841	Ankyrin repeat-containing domain (4);	0.054148	0.64402	D	0.000001	D	0.89008	0.6593	H	0.96460	3.825	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	D	0.92487	0.5997	10	0.87932	D	0	-12.6684	15.8237	0.78678	1.0:0.0:0.0:0.0	.	259	O75762	TRPA1_HUMAN	P	111;259	ENSP00000428151:L111P;ENSP00000262209:L259P	ENSP00000262209:L259P	L	-	2	0	TRPA1	73137619	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	8.305000	0.89960	2.131000	0.65755	0.528000	0.53228	CTG	TRPA1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000104321		0.378	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPA1	HGNC	protein_coding	OTTHUMT00000379079.2	70	0.00	0	A	NM_007332		72975065	72975065	-1	no_errors	ENST00000262209	ensembl	human	known	69_37n	missense	24	25.00	8	SNP	1.000	G
TSGA10	80705	genome.wustl.edu	37	2	99695169	99695169	+	Nonsense_Mutation	SNP	T	T	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr2:99695169T>A	ENST00000393483.3	-	12	1679	c.835A>T	c.(835-837)Aaa>Taa	p.K279*	TSGA10_ENST00000539964.1_Nonsense_Mutation_p.K279*|TSGA10_ENST00000355053.4_Nonsense_Mutation_p.K279*|TSGA10_ENST00000542655.1_Nonsense_Mutation_p.K279*|TSGA10_ENST00000410001.1_Nonsense_Mutation_p.K279*|TSGA10_ENST00000478090.1_Intron	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	279					cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						TCAGATTTTTTATCCAAACAT	0.368																																						dbGAP											0													110.0	106.0	107.0					2																	99695169		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.835A>T	2.37:g.99695169T>A	ENSP00000377123:p.Lys279*		B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Nonsense_Mutation	SNP	NULL	p.K279*	ENST00000393483.3	37	c.835	CCDS2037.1	2	.	.	.	.	.	.	.	.	.	.	T	43	10.343917	0.99388	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482;ENST00000542655	.	.	.	5.15	5.15	0.70609	.	0.089102	0.49305	D	0.000157	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-29.2701	11.2807	0.49192	0.0:0.0:0.0:1.0	.	.	.	.	X	279	.	ENSP00000347161:K279X	K	-	1	0	TSGA10	99061601	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.800000	0.47900	2.159000	0.67721	0.383000	0.25322	AAA	TSGA10	-	NULL	ENSG00000135951		0.368	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA10	HGNC	protein_coding	OTTHUMT00000253125.1	29	0.00	0	T	NM_182911		99695169	99695169	-1	no_errors	ENST00000355053	ensembl	human	known	69_37n	nonsense	29	29.27	12	SNP	1.000	A
UBE4B	10277	genome.wustl.edu	37	1	10228305	10228305	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:10228305G>T	ENST00000253251.8	+	23	3762	c.2923G>T	c.(2923-2925)Gtc>Ttc	p.V975F	UBE4B_ENST00000343090.6_Missense_Mutation_p.V1104F|UBE4B_ENST00000377157.3_Missense_Mutation_p.V859F					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		CACGAAGCAGGTCCAGAAGCC	0.552																																						dbGAP											0													74.0	58.0	64.0					1																	10228305		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.2923G>T	1.37:g.10228305G>T	ENSP00000253251:p.Val975Phe			Missense_Mutation	SNP	pfam_Ub_conjug_fac_E4_core,pfam_Ubox_domain,smart_Ubox_domain	p.V1104F	ENST00000253251.8	37	c.3310	CCDS110.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.416305	0.96092	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.41758	0.99;0.99;0.99	5.2	5.2	0.72013	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.60483	0.2272	L	0.59436	1.845	0.80722	D	1	D;D	0.64830	0.994;0.991	D;P	0.63703	0.917;0.813	T	0.60244	-0.7301	10	0.48119	T	0.1	-21.8366	18.7638	0.91864	0.0:0.0:1.0:0.0	.	1104;975	O95155;O95155-2	UBE4B_HUMAN;.	F	975;859;1104	ENSP00000253251:V975F;ENSP00000366362:V859F;ENSP00000343001:V1104F	ENSP00000253251:V975F	V	+	1	0	UBE4B	10150892	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.860000	0.99555	2.426000	0.82243	0.563000	0.77884	GTC	UBE4B	-	pfam_Ub_conjug_fac_E4_core	ENSG00000130939		0.552	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE4B	HGNC	protein_coding	OTTHUMT00000005017.1	50	0.00	0	G	NM_006048		10228305	10228305	+1	no_errors	ENST00000343090	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	1.000	T
USP39	10713	genome.wustl.edu	37	2	85850904	85850904	+	Splice_Site	SNP	C	C	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr2:85850904C>T	ENST00000323701.6	+	4	579	c.569C>T	c.(568-570)aCg>aTg	p.T190M	USP39_ENST00000409766.3_Splice_Site_p.T190M|USP39_ENST00000409470.1_Splice_Site_p.T190M|USP39_ENST00000409025.1_Splice_Site_p.T190M|USP39_ENST00000459775.1_3'UTR|USP39_ENST00000450066.2_Splice_Site_p.T87M	NM_006590.3	NP_006581.2	Q53GS9	SNUT2_HUMAN	ubiquitin specific peptidase 39	190					cell cycle (GO:0007049)|cell division (GO:0051301)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|ubiquitin-dependent protein catabolic process (GO:0006511)	spliceosomal complex (GO:0005681)	ubiquitinyl hydrolase activity (GO:0036459)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	19						GAGGATATCACGGTGTGTGTC	0.507																																						dbGAP											0													200.0	175.0	183.0					2																	85850904		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF132955	CCDS33234.1, CCDS58716.1, CCDS58717.1, CCDS74534.1	2p11.2	2009-01-06	2005-08-08		ENSG00000168883	ENSG00000168883		"""Ubiquitin-specific peptidases"""	20071	protein-coding gene	gene with protein product	"""snRNP assembly defective 1 homolog (S.cerevisiae)"", ""small nuclear ribonucleoprotein 65kDa (U4/U6.U5)"""	611594	"""ubiquitin specific protease 39"""			12838346	Standard	NM_006590		Approved	SAD1, CGI-21, SNRNP65	uc002sqg.4	Q53GS9	OTTHUMG00000153090	ENST00000323701.6:c.570+1C>T	2.37:g.85850904C>T			A8K086|B3KM40|B4DHT4|D6W5L4|G5E9H0|Q6NX47|Q96RK9|Q9BV89|Q9H381|Q9P050|Q9Y310	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.T190M	ENST00000323701.6	37	c.569	CCDS33234.1	2	.	.	.	.	.	.	.	.	.	.	C	24.2	4.501599	0.85176	.	.	ENSG00000168883	ENST00000448971;ENST00000442708;ENST00000450066;ENST00000409268;ENST00000409025;ENST00000409470;ENST00000323701;ENST00000409766	T;T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56;1.56	5.54	5.54	0.83059	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.47395	0.1443	L	0.47716	1.5	0.80722	D	1	D;B;D;D;D;P	0.71674	0.989;0.15;0.996;0.997;0.998;0.913	P;B;P;P;P;B	0.61275	0.648;0.081;0.886;0.864;0.871;0.134	T	0.38887	-0.9640	10	0.72032	D	0.01	0.1627	17.326	0.87248	0.0:1.0:0.0:0.0	.	87;112;190;190;190;190	B4DHT4;B7Z7L9;G5E9H0;B3KM40;B9A018;Q53GS9	.;.;.;.;.;SNUT2_HUMAN	M	112;87;87;190;190;190;190;190	ENSP00000396854:T112M;ENSP00000392911:T87M;ENSP00000396133:T87M;ENSP00000386572:T190M;ENSP00000386864:T190M;ENSP00000312981:T190M;ENSP00000386803:T190M	ENSP00000312981:T190M	T	+	2	0	USP39	85704415	1.000000	0.71417	1.000000	0.80357	0.755000	0.42902	7.314000	0.78988	2.767000	0.95098	0.591000	0.81541	ACG	USP39	-	NULL	ENSG00000168883		0.507	USP39-009	NOVEL	basic|appris_principal|CCDS	protein_coding	USP39	HGNC	protein_coding	OTTHUMT00000329892.1	62	0.00	0	C	NM_006590	Missense_Mutation	85850904	85850904	+1	no_errors	ENST00000409470	ensembl	human	known	69_37n	missense	40	16.67	8	SNP	1.000	T
ZBED1	9189	genome.wustl.edu	37	X	2408349	2408349	+	Silent	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chrX:2408349G>A	ENST00000381223.4	-	2	615	c.412C>T	c.(412-414)Ctg>Ttg	p.L138L	DHRSX_ENST00000334651.5_Intron|ZBED1_ENST00000515319.1_5'Flank|ZBED1_ENST00000381222.2_Silent_p.L138L|ZBED1_ENST00000381218.3_Silent_p.L138L	NM_001171135.1|NM_001171136.1|NM_004729.3	NP_001164606.1|NP_001164607.1|NP_004720.1	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	138					metabolic process (GO:0008152)	nuclear chromosome (GO:0000228)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transposase activity (GO:0004803)			endometrium(8)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	25		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCTGGGTACAGCCCCTCGCAG	0.672																																						dbGAP											0													60.0	62.0	61.0					X																	2408349		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			AB018328	CCDS14118.1	Xp22.33 and Yp11	2013-05-03	2004-01-14	2004-01-16	ENSG00000214717	ENSG00000214717		"""Pseudoautosomal regions / PAR1"", ""Zinc fingers, BED-type"""	447	protein-coding gene	gene with protein product		300178	"""Ac-like transposable element"""	ALTE		9872452, 9887332, 23533661	Standard	NM_001171135		Approved	TRAMP, KIAA0785, DREF, hDREF	uc004cqh.2	O96006	OTTHUMG00000021069	ENST00000381223.4:c.412C>T	X.37:g.2408349G>A			Q96BY4	Silent	SNP	pfam_HATC,pfam_Znf_BED_prd,superfamily_RNaseH-like_dom,smart_Znf_BED_prd,pfscan_Znf_BED_prd	p.L138	ENST00000381223.4	37	c.412	CCDS14118.1	X																																																																																			ZBED1	-	NULL	ENSG00000214717		0.672	ZBED1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED1	HGNC	protein_coding	OTTHUMT00000144310.3	58	0.00	0	G	NM_004729		2408349	2408349	-1	no_errors	ENST00000381218	ensembl	human	known	69_37n	silent	42	26.32	15	SNP	0.869	A
ZFP64	55734	genome.wustl.edu	37	20	50701237	50701237	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr20:50701237C>G	ENST00000361387.2	-	9	1857	c.1797G>C	c.(1795-1797)aaG>aaC	p.K599N	ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000371523.4_Missense_Mutation_p.K380N	NM_199427.2	NP_955459.2	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	444					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						TGTGCTGCTTCTTGTGGCATC	0.607																																						dbGAP											0													59.0	53.0	55.0					20																	50701237		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000361387.2:c.1797G>C	20.37:g.50701237C>G	ENSP00000355179:p.Lys599Asn		Q9NTS7|Q9NVH4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K599N	ENST00000361387.2	37	c.1797	CCDS13439.1	20	.	.	.	.	.	.	.	.	.	.	C	15.57	2.871481	0.51695	.	.	ENSG00000020256	ENST00000371523;ENST00000361387	T;T	0.70399	-0.48;-0.48	4.5	3.56	0.40772	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.67720	0.2923	L	0.56124	1.755	0.80722	D	1	P;P	0.49783	0.782;0.928	B;B	0.44085	0.351;0.44	T	0.72007	-0.4420	9	0.66056	D	0.02	.	12.8452	0.57825	0.0:0.9208:0.0:0.0792	.	599;380	Q9NTW7;Q9NTW7-2	ZF64B_HUMAN;.	N	380;599	ENSP00000360578:K380N;ENSP00000355179:K599N	ENSP00000355179:K599N	K	-	3	2	ZFP64	50134644	1.000000	0.71417	0.873000	0.34254	0.976000	0.68499	2.435000	0.44811	1.247000	0.43917	0.655000	0.94253	AAG	ZFP64	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000020256		0.607	ZFP64-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP64	HGNC	protein_coding	OTTHUMT00000079743.2	25	0.00	0	C	NM_018197		50701237	50701237	-1	no_errors	ENST00000361387	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	1.000	G
ZIC5	85416	genome.wustl.edu	37	13	100623858	100623858	+	Silent	SNP	C	C	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr13:100623858C>G	ENST00000267294.4	-	1	305	c.72G>C	c.(70-72)ctG>ctC	p.L24L		NM_033132.3	NP_149123.2	Q96T25	ZIC5_HUMAN	Zic family member 5	24					cell differentiation (GO:0030154)|forebrain development (GO:0030900)|neural tube closure (GO:0001843)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(1)|lung(2)|prostate(1)|skin(2)	9	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GGGGCTCCATCAGAACTACAC	0.532																																						dbGAP											0													9.0	9.0	9.0					13																	100623858		2194	4275	6469	-	-	-	SO:0001819	synonymous_variant	0			AF378304	CCDS9494.2	13q32.2	2013-01-08	2011-05-19		ENSG00000139800	ENSG00000139800		"""Zinc fingers, C2H2-type"""	20322	protein-coding gene	gene with protein product			"""Zic family member 5 (odd-paired homolog, Drosophila)"""				Standard	NM_033132		Approved		uc001vom.1	Q96T25	OTTHUMG00000017280	ENST00000267294.4:c.72G>C	13.37:g.100623858C>G			Q5VYB0	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L24	ENST00000267294.4	37	c.72	CCDS9494.2	13																																																																																			ZIC5	-	NULL	ENSG00000139800		0.532	ZIC5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ZIC5	HGNC	protein_coding	OTTHUMT00000045623.3	41	0.00	0	C	NM_033132		100623858	100623858	-1	no_errors	ENST00000267294	ensembl	human	novel	69_37n	silent	32	13.51	5	SNP	0.963	G
ZNF136	7695	genome.wustl.edu	37	19	12297991	12297991	+	Silent	SNP	A	A	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr19:12297991A>T	ENST00000343979.4	+	4	938	c.798A>T	c.(796-798)tcA>tcT	p.S266S	ZNF136_ENST00000398616.2_Silent_p.S200S	NM_003437.3	NP_003428.1	P52737	ZN136_HUMAN	zinc finger protein 136	266					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|biliary_tract(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	18						CTCTGAGTTCATTTCAAGTGC	0.383																																						dbGAP											0													69.0	66.0	67.0					19																	12297991		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			U09367	CCDS32916.1	19p13.2	2013-01-08	2006-06-13		ENSG00000196646	ENSG00000196646		"""Zinc fingers, C2H2-type"", ""-"""	12920	protein-coding gene	gene with protein product		604078	"""zinc finger protein 136 (clone pHZ-20)"""			7557990	Standard	NM_003437		Approved	pHZ-20	uc002mti.3	P52737	OTTHUMG00000156429	ENST00000343979.4:c.798A>T	19.37:g.12297991A>T				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S266	ENST00000343979.4	37	c.798	CCDS32916.1	19																																																																																			ZNF136	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196646		0.383	ZNF136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF136	HGNC	protein_coding	OTTHUMT00000344151.2	33	0.00	0	A	NM_003437		12297991	12297991	+1	no_errors	ENST00000343979	ensembl	human	known	69_37n	silent	16	15.79	3	SNP	0.003	T
ZNF17	7565	genome.wustl.edu	37	19	57929403	57929403	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr19:57929403G>A	ENST00000601808.1	+	2	352	c.139G>A	c.(139-141)Gta>Ata	p.V47I	AC004076.7_ENST00000597410.1_Intron|AC003002.6_ENST00000596400.1_Missense_Mutation_p.V59I|ZNF17_ENST00000307658.7_Missense_Mutation_p.V49I|ZNF17_ENST00000595206.1_Intron	NM_006959.2	NP_008890.2	P17021	ZNF17_HUMAN	zinc finger protein 17	47	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		TTTGTCCTCAGTAGGTAAGGC	0.498																																					Melanoma(149;1637 1853 29914 42869 44988)	dbGAP											0													169.0	162.0	164.0					19																	57929403		2203	4300	6503	-	-	-	SO:0001583	missense	0			X52341	CCDS42636.1	19q13.43	2013-01-08	2006-05-10			ENSG00000186272		"""Zinc fingers, C2H2-type"", ""-"""	12958	protein-coding gene	gene with protein product			"""zinc finger protein 17 (HPF3, KOX 10)"""			2115127, 2014798	Standard	NM_006959		Approved	HPF3, KOX10, KIAA1947, FLJ40864, FLJ46058, FLJ46615	uc002qoo.1	P17021		ENST00000601808.1:c.139G>A	19.37:g.57929403G>A	ENSP00000471905:p.Val47Ile		B3KXU2|B3KY20|Q8N7M1|Q8N893|Q8TF54	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V47I	ENST00000601808.1	37	c.139	CCDS42636.1	19	.	.	.	.	.	.	.	.	.	.	G	7.499	0.652185	0.14580	.	.	ENSG00000186272	ENST00000307658	.	.	.	1.44	-2.88	0.05682	Krueppel-associated box (4);	.	.	.	.	T	0.21509	0.0518	L	0.39633	1.23	0.09310	N	1	P;B	0.35527	0.507;0.217	B;B	0.34038	0.174;0.06	T	0.07328	-1.0778	8	0.44086	T	0.13	.	1.1839	0.01851	0.1766:0.2896:0.353:0.1808	.	49;47	P17021-2;P17021	.;ZNF17_HUMAN	I	47	.	ENSP00000302455:V47I	V	+	1	0	ZNF17	62621215	0.000000	0.05858	0.002000	0.10522	0.810000	0.45777	-1.212000	0.02994	-1.914000	0.01078	-0.384000	0.06662	GTA	ZNF17	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000186272		0.498	ZNF17-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF17	HGNC	protein_coding	OTTHUMT00000466384.1	40	0.00	0	G	NM_006959		57929403	57929403	+1	no_errors	ENST00000307658	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	0.003	A
ZNF182	7569	genome.wustl.edu	37	X	47842725	47842725	+	Silent	SNP	T	T	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chrX:47842725T>C	ENST00000396965.1	-	5	509	c.159A>G	c.(157-159)agA>agG	p.R53R	ZNF182_ENST00000305127.6_Silent_p.R53R|ZNF182_ENST00000376943.3_Silent_p.R34R	NM_001178099.1	NP_001171570.1	P17025	ZN182_HUMAN	zinc finger protein 182	53	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)	22						GCATCACGTCTCTGTACAGGG	0.463																																						dbGAP											0													129.0	109.0	115.0					X																	47842725		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK122874, R98366	CCDS35235.1, CCDS35236.1	Xp11.23	2013-01-08	2006-05-10	2006-05-10	ENSG00000147118	ENSG00000147118		"""Zinc fingers, C2H2-type"", ""-"""	13001	protein-coding gene	gene with protein product		314993	"""zinc finger protein 182 (HHZ150)"", ""zinc finger protein 21 (KOX 14)"""	ZNF21		8088786, 2014798, 8914609	Standard	NM_001178099		Approved	KOX14, HHZ150, Zfp182	uc004dit.3	P17025	OTTHUMG00000021460	ENST00000396965.1:c.159A>G	X.37:g.47842725T>C			A2IDD7|Q3KP67|Q96QH7	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R53	ENST00000396965.1	37	c.159	CCDS35236.1	X																																																																																			ZNF182	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000147118		0.463	ZNF182-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF182	HGNC	protein_coding	OTTHUMT00000277055.1	54	0.00	0	T	NM_006962		47842725	47842725	-1	no_errors	ENST00000305127	ensembl	human	known	69_37n	silent	35	50.00	35	SNP	1.000	C
ZNF205	7755	genome.wustl.edu	37	16	3169627	3169627	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr16:3169627C>G	ENST00000382192.3	+	7	1171	c.966C>G	c.(964-966)caC>caG	p.H322Q	ZNF205_ENST00000219091.4_Missense_Mutation_p.H322Q|RP11-473M20.14_ENST00000576490.1_RNA|RP11-473M20.14_ENST00000575139.1_RNA	NM_001278158.1|NM_003456.2	NP_001265087.1|NP_003447.2	O95201	ZN205_HUMAN	zinc finger protein 205	322					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hydrogen peroxide biosynthetic process (GO:0010729)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20						GGCACTCGCACCTGGTGACGC	0.692																																						dbGAP											0													38.0	41.0	40.0					16																	3169627		2196	4298	6494	-	-	-	SO:0001583	missense	0			AF060865	CCDS10494.2	16p13.3	2013-01-08			ENSG00000122386	ENSG00000122386		"""Zinc fingers, C2H2-type"", ""-"""	12996	protein-coding gene	gene with protein product		603436		ZNF210		9787081	Standard	NM_003456		Approved	Zfp13	uc002cub.3	O95201	OTTHUMG00000148676	ENST00000382192.3:c.966C>G	16.37:g.3169627C>G	ENSP00000371627:p.His322Gln		A8MZK0|D3DUB4|Q9BU95	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H322Q	ENST00000382192.3	37	c.966	CCDS10494.2	16	.	.	.	.	.	.	.	.	.	.	C	11.57	1.678806	0.29783	.	.	ENSG00000122386	ENST00000382192;ENST00000219091	T;T	0.13196	2.61;2.61	5.08	1.77	0.24775	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.322758	0.23189	N	0.050935	T	0.08358	0.0208	N	0.20986	0.625	0.29622	N	0.846097	P	0.52170	0.951	B	0.42163	0.378	T	0.12372	-1.0550	10	0.48119	T	0.1	-9.5916	6.5633	0.22499	0.0:0.6718:0.1505:0.1777	.	322	O95201	ZN205_HUMAN	Q	322	ENSP00000371627:H322Q;ENSP00000219091:H322Q	ENSP00000219091:H322Q	H	+	3	2	ZNF205	3109628	0.086000	0.21541	0.997000	0.53966	0.947000	0.59692	0.066000	0.14489	1.143000	0.42306	0.462000	0.41574	CAC	ZNF205	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000122386		0.692	ZNF205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF205	HGNC	protein_coding	OTTHUMT00000309057.1	29	0.00	0	C	NM_003456		3169627	3169627	+1	no_errors	ENST00000219091	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	0.950	G
ZNF300P1	134466	genome.wustl.edu	37	5	150311185	150311185	+	RNA	SNP	T	T	C			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr5:150311185T>C	ENST00000520773.1	-	0	2136									zinc finger protein 300 pseudogene 1 (functional)																		TGATGTGCAATAAGGTGTGAC	0.383																																						dbGAP											0																																										-	-	-			0			AK096536		5q33.1	2014-09-11	2014-01-16		ENSG00000197083	ENSG00000197083		"""-"""	27032	pseudogene	pseudogene			"""zinc finger protein 300 pseudogene 1"""			24393131	Standard	NR_026867		Approved		uc003lsz.1		OTTHUMG00000154830		5.37:g.150311185T>C				RNA	SNP	-	NULL	ENST00000520773.1	37	NULL		5																																																																																			ZNF300P1	-	-	ENSG00000197083		0.383	ZNF300P1-002	KNOWN	basic	processed_transcript	ZNF300P1	HGNC	pseudogene	OTTHUMT00000374771.1	22	0.00	0	T	NR_026867		150311185	150311185	-1	no_errors	ENST00000520773	ensembl	human	known	69_37n	rna	2	75.00	6	SNP	0.013	C
ZNF480	147657	genome.wustl.edu	37	19	52824909	52824909	+	Silent	SNP	C	C	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr19:52824909C>T	ENST00000595962.1	+	5	472	c.406C>T	c.(406-408)Ctg>Ttg	p.L136L	ZNF480_ENST00000490272.1_Silent_p.I50I|ZNF480_ENST00000335090.6_Silent_p.L59L|ZNF480_ENST00000334564.7_Silent_p.L93L|CTD-2525I3.6_ENST00000594379.1_RNA	NM_144684.2	NP_653285.2	Q8WV37	ZN480_HUMAN	zinc finger protein 480	136					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	12				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)		TCACTTACATCTGTCTGAACT	0.373																																						dbGAP											0													79.0	73.0	75.0					19																	52824909		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY512662	CCDS12850.2, CCDS74437.1	19q13.41	2013-01-08			ENSG00000198464	ENSG00000198464		"""Zinc fingers, C2H2-type"", ""-"""	23305	protein-coding gene	gene with protein product		613910				15219843	Standard	XM_005258525		Approved	MGC32104	uc010ydl.2	Q8WV37	OTTHUMG00000157507	ENST00000595962.1:c.406C>T	19.37:g.52824909C>T			Q5JPG9|Q6P0Q4|Q8N1M5	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L136	ENST00000595962.1	37	c.406	CCDS12850.2	19																																																																																			ZNF480	-	NULL	ENSG00000198464		0.373	ZNF480-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF480	HGNC	protein_coding	OTTHUMT00000349001.3	41	0.00	0	C	NM_144684		52824909	52824909	+1	no_errors	ENST00000468240	ensembl	human	known	69_37n	silent	25	16.67	5	SNP	0.172	T
ZNF630	57232	genome.wustl.edu	37	X	47918374	47918374	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chrX:47918374G>T	ENST00000409324.3	-	5	1683	c.1457C>A	c.(1456-1458)cCt>cAt	p.P486H	ZNF630-AS1_ENST00000436124.1_RNA|ZNF630_ENST00000276054.4_Missense_Mutation_p.P362H|ZNF630_ENST00000442455.3_Missense_Mutation_p.P472H	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	486					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						ACACATATAAGGTTTCTCTCC	0.423																																						dbGAP											0													70.0	68.0	69.0					X																	47918374		2195	4289	6484	-	-	-	SO:0001583	missense	0			AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.1457C>A	X.37:g.47918374G>T	ENSP00000386393:p.Pro486His		F8WAG4|Q5H8Z5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P486H	ENST00000409324.3	37	c.1457	CCDS35237.2	X	.	.	.	.	.	.	.	.	.	.	.	10.97	1.502333	0.26949	.	.	ENSG00000221994	ENST00000442455;ENST00000276054;ENST00000409324	T;T;T	0.56941	2.27;0.43;2.27	2.31	1.41	0.22369	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.73923	0.3649	M	0.94063	3.49	0.26401	N	0.976426	D	0.69078	0.997	P	0.62813	0.907	T	0.63642	-0.6591	9	0.87932	D	0	.	8.3033	0.32027	0.0:0.2426:0.7574:0.0	.	486	Q2M218	ZN630_HUMAN	H	472;362;486	ENSP00000393163:P472H;ENSP00000354683:P362H;ENSP00000386393:P486H	ENSP00000354683:P362H	P	-	2	0	ZNF630	47803318	0.975000	0.34042	0.855000	0.33649	0.481000	0.33189	2.293000	0.43558	0.234000	0.21139	-0.279000	0.10071	CCT	ZNF630	-	pfscan_Znf_C2H2	ENSG00000221994		0.423	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF630	HGNC	protein_coding	OTTHUMT00000327254.1	27	0.00	0	G	NM_001037735		47918374	47918374	-1	no_errors	ENST00000409324	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	0.973	T
ZZZ3	26009	genome.wustl.edu	37	1	78098298	78098298	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A3U0-01A-11D-A228-09	TCGA-EW-A3U0-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0448206f-3ade-4087-b1a9-4fb2d14e1367	8fc3cfb0-e245-4089-a73c-8d93cb8fc5ee	g.chr1:78098298G>A	ENST00000370801.3	-	5	1217	c.742C>T	c.(742-744)Caa>Taa	p.Q248*	ZZZ3_ENST00000370798.1_Intron|ZZZ3_ENST00000476275.1_5'UTR	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	248					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						ATTGAAGTTTGGGTATCCGTA	0.428																																						dbGAP											0													172.0	164.0	167.0					1																	78098298		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.742C>T	1.37:g.78098298G>A	ENSP00000359837:p.Gln248*		B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Nonsense_Mutation	SNP	pfam_SANT/Myb,pfam_Znf_ZZ,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Znf_ZZ,pfscan_Myb-like_dom	p.Q248*	ENST00000370801.3	37	c.742	CCDS677.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.731018	0.96856	.	.	ENSG00000036549	ENST00000370801	.	.	.	5.42	3.49	0.39957	.	0.894334	0.09994	N	0.729378	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.338	0.32225	0.0703:0.0:0.6491:0.2806	.	.	.	.	X	248	.	.	Q	-	1	0	ZZZ3	77870886	0.998000	0.40836	0.958000	0.39756	0.731000	0.41821	2.150000	0.42254	0.720000	0.32209	0.650000	0.86243	CAA	ZZZ3	-	NULL	ENSG00000036549		0.428	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	HGNC	protein_coding	OTTHUMT00000026615.1	26	0.00	0	G	NM_015534		78098298	78098298	-1	no_errors	ENST00000370801	ensembl	human	known	69_37n	nonsense	39	15.22	7	SNP	0.007	A
