#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB4	5244	genome.wustl.edu	37	7	87035650	87035650	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr7:87035650G>A	ENST00000265723.4	-	26	3572	c.3461C>T	c.(3460-3462)gCa>gTa	p.A1154V	ABCB4_ENST00000545634.1_Missense_Mutation_p.A1147V|ABCB4_ENST00000453593.1_Missense_Mutation_p.A1100V|ABCB4_ENST00000359206.3_Missense_Mutation_p.A1147V|ABCB4_ENST00000358400.3_Missense_Mutation_p.A1100V	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	1154	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	AGCTTTGGCTGCACTCACAAT	0.448																																						dbGAP											0													175.0	168.0	170.0					7																	87035650		2203	4300	6503	-	-	-	SO:0001583	missense	0			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.3461C>T	7.37:g.87035650G>A	ENSP00000265723:p.Ala1154Val		A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,pfam_Zeta_toxin_domain,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.A1154V	ENST00000265723.4	37	c.3461	CCDS5606.1	7	.	.	.	.	.	.	.	.	.	.	G	20.3	3.975084	0.74360	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.91945	-2.94;-2.94;-2.94;-2.94;-2.94	5.81	5.81	0.92471	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.107006	0.64402	D	0.000006	D	0.92506	0.7620	L	0.41236	1.265	0.80722	D	1	P;B;B	0.52316	0.952;0.358;0.411	P;B;P	0.57152	0.814;0.351;0.483	D	0.91978	0.5592	10	0.48119	T	0.1	-15.2517	14.2656	0.66116	0.0707:0.0:0.9293:0.0	.	1100;1147;1154	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	V	1147;1100;1154;1100;1147	ENSP00000352135:A1147V;ENSP00000351172:A1100V;ENSP00000265723:A1154V;ENSP00000392983:A1100V;ENSP00000437465:A1147V	ENSP00000265723:A1154V	A	-	2	0	ABCB4	86873586	1.000000	0.71417	0.987000	0.45799	0.740000	0.42216	7.918000	0.87506	2.756000	0.94617	0.557000	0.71058	GCA	ABCB4	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000005471		0.448	ABCB4-002	KNOWN	basic|CCDS	protein_coding	ABCB4	HGNC	protein_coding	OTTHUMT00000336083.1	77	0.00	0	G	NM_000443		87035650	87035650	-1	no_errors	ENST00000265723	ensembl	human	known	69_37n	missense	53	11.67	7	SNP	1.000	A
ABCD1	215	genome.wustl.edu	37	X	152994737	152994737	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chrX:152994737C>G	ENST00000218104.3	+	2	1350	c.951C>G	c.(949-951)atC>atG	p.I317M	ABCD1_ENST00000370129.4_Missense_Mutation_p.I132M	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	317	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCTCGCAGATCAACCTCATCC	0.612																																						dbGAP											0													156.0	101.0	119.0					X																	152994737		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.951C>G	X.37:g.152994737C>G	ENSP00000218104:p.Ile317Met		Q6GTZ2	Missense_Mutation	SNP	pfam_ABC_Ald_N,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_FA_transporter	p.I317M	ENST00000218104.3	37	c.951	CCDS14728.1	X	.	.	.	.	.	.	.	.	.	.	c	0.654	-0.808547	0.02819	.	.	ENSG00000101986	ENST00000218104;ENST00000370129	D;D	0.99563	-6.17;-6.17	5.44	2.13	0.27403	ABC transporter, N-terminal (1);ABC transporter, integral membrane type 1 (1);	0.000000	0.85682	D	0.000000	D	0.94542	0.8242	N	0.01152	-0.98	0.44956	D	0.997971	B	0.20261	0.043	B	0.23716	0.048	D	0.91267	0.5041	10	0.02654	T	1	-28.5414	5.2699	0.15618	0.2787:0.528:0.0:0.1933	.	317	P33897	ABCD1_HUMAN	M	317;132	ENSP00000218104:I317M;ENSP00000359147:I132M	ENSP00000218104:I317M	I	+	3	3	ABCD1	152647931	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	0.831000	0.27476	0.437000	0.26423	-0.333000	0.08304	ATC	ABCD1	-	pfam_ABC_Ald_N,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1,tigrfam_FA_transporter	ENSG00000101986		0.612	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD1	HGNC	protein_coding	OTTHUMT00000061041.1	65	0.00	0	C	NM_000033		152994737	152994737	+1	no_errors	ENST00000218104	ensembl	human	known	69_37n	missense	71	16.47	14	SNP	0.990	G
ACR	49	genome.wustl.edu	37	22	51177892	51177892	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr22:51177892G>A	ENST00000216139.5	+	2	311	c.271G>A	c.(271-273)Gtc>Atc	p.V91I	AC002056.5_ENST00000532913.1_RNA|AC000036.4_ENST00000449652.1_RNA|ACR_ENST00000529621.1_Missense_Mutation_p.V91I	NM_001097.2	NP_001088.2	P10323	ACRO_HUMAN	acrosin	91	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acrosome matrix dispersal (GO:0002077)|acrosome reaction (GO:0007340)|activation of adenylate cyclase activity (GO:0007190)|binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|response to steroid hormone (GO:0048545)|single fertilization (GO:0007338)	acrosomal matrix (GO:0043159)|extracellular region (GO:0005576)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|protein complex (GO:0043234)	amidase activity (GO:0004040)|copper ion binding (GO:0005507)|DNA binding (GO:0003677)|drug binding (GO:0008144)|fucose binding (GO:0042806)|mannose binding (GO:0005537)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	7		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;1.1e-06)|LUAD - Lung adenocarcinoma(64;0.247)		TCACTGCTTCGTCGGCAAAAA	0.577																																						dbGAP											0													87.0	64.0	72.0					22																	51177892		2203	4300	6503	-	-	-	SO:0001583	missense	0			CR456366	CCDS14101.1	22q13.33	2012-10-23	2012-10-23		ENSG00000100312	ENSG00000100312	3.4.21.10		126	protein-coding gene	gene with protein product	"""preproacrosin"", ""acrosin light and heavy chain prepropeptide"""	102480				2298447, 12398221	Standard	NM_001097		Approved		uc003bnh.4	P10323	OTTHUMG00000150155	ENST00000216139.5:c.271G>A	22.37:g.51177892G>A	ENSP00000216139:p.Val91Ile		Q6ICK2	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pirsf_Pept_S1A_acrosin,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.V91I	ENST00000216139.5	37	c.271	CCDS14101.1	22	.	.	.	.	.	.	.	.	.	.	g	10.41	1.343168	0.24339	.	.	ENSG00000100312	ENST00000216139;ENST00000529621	D;D	0.88741	-2.42;-2.42	4.43	-6.04	0.02178	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	4.753400	0.00702	N	0.000783	T	0.76622	0.4013	N	0.10809	0.05	0.09310	N	1	P;B	0.38642	0.641;0.212	B;B	0.39503	0.301;0.131	T	0.70594	-0.4829	10	0.25106	T	0.35	0.1349	6.5522	0.22440	0.552:0.2225:0.2255:0.0	.	91;91	E9PLV5;P10323	.;ACRO_HUMAN	I	91	ENSP00000216139:V91I;ENSP00000435120:V91I	ENSP00000216139:V91I	V	+	1	0	ACR	49524758	.	.	0.002000	0.10522	0.009000	0.06853	.	.	-1.328000	0.02261	-1.402000	0.01139	GTC	ACR	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pirsf_Pept_S1A_acrosin,pfscan_Peptidase_S1_S6	ENSG00000100312		0.577	ACR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ACR	HGNC	protein_coding	OTTHUMT00000316605.2	45	0.00	0	G	NM_001097		51177892	51177892	+1	no_errors	ENST00000216139	ensembl	human	known	69_37n	missense	57	16.18	11	SNP	0.002	A
AKNA	80709	genome.wustl.edu	37	9	117099426	117099426	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr9:117099426C>T	ENST00000307564.4	-	22	4389	c.4228G>A	c.(4228-4230)Gag>Aag	p.E1410K	AKNA_ENST00000492875.1_5'UTR|AKNA_ENST00000374075.5_Missense_Mutation_p.E1329K|AKNA_ENST00000223791.3_Missense_Mutation_p.E870K|AKNA_ENST00000374079.4_Missense_Mutation_p.E355K|AKNA_ENST00000374088.3_Missense_Mutation_p.E1410K	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	1410					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						CGGACGCTCTCGGCAGCCTGC	0.672																																						dbGAP											0													24.0	28.0	26.0					9																	117099426		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.4228G>A	9.37:g.117099426C>T	ENSP00000303769:p.Glu1410Lys		Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	pfam_TF_AT-hook	p.E1410K	ENST00000307564.4	37	c.4228	CCDS6805.1	9	.	.	.	.	.	.	.	.	.	.	C	14.26	2.481135	0.44147	.	.	ENSG00000106948	ENST00000307564;ENST00000374079;ENST00000374088;ENST00000223791;ENST00000374075	T;T;T;T;T	0.18338	2.69;2.22;2.69;2.47;2.69	5.13	1.81	0.25067	.	.	.	.	.	T	0.08935	0.0221	N	0.19112	0.55	0.09310	N	1	B;B	0.14012	0.005;0.009	B;B	0.12837	0.003;0.008	T	0.37911	-0.9685	9	0.26408	T	0.33	0.2102	2.7577	0.05297	0.0:0.2869:0.2555:0.4576	.	1410;1329	Q7Z591;Q7Z591-2	AKNA_HUMAN;.	K	1410;355;1410;870;1329	ENSP00000303769:E1410K;ENSP00000363192:E355K;ENSP00000363201:E1410K;ENSP00000223791:E870K;ENSP00000363188:E1329K	ENSP00000223791:E870K	E	-	1	0	AKNA	116139247	0.061000	0.20836	0.020000	0.16555	0.284000	0.27059	0.694000	0.25512	0.098000	0.17522	0.563000	0.77884	GAG	AKNA	-	NULL	ENSG00000106948		0.672	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNA	HGNC	protein_coding	OTTHUMT00000053767.2	36	0.00	0	C	NM_030767		117099426	117099426	-1	no_errors	ENST00000307564	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.008	T
ANKFN1	162282	genome.wustl.edu	37	17	54403701	54403701	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr17:54403701C>G	ENST00000318698.2	+	3	217	c.182C>G	c.(181-183)tCg>tGg	p.S61W	ANKFN1_ENST00000566473.2_Missense_Mutation_p.S61W	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	61										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						TCTGCTGCCTCGAACAGCATA	0.373																																						dbGAP											0													129.0	116.0	121.0					17																	54403701		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.182C>G	17.37:g.54403701C>G	ENSP00000321627:p.Ser61Trp			Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Fibronectin_type3,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Fibronectin_type3	p.S61W	ENST00000318698.2	37	c.182	CCDS32686.1	17	.	.	.	.	.	.	.	.	.	.	C	16.67	3.187401	0.57909	.	.	ENSG00000153930	ENST00000318698	T	0.26223	1.75	6.07	6.07	0.98685	.	0.109197	0.41823	D	0.000802	T	0.24236	0.0587	L	0.36672	1.1	0.43439	D	0.995617	D	0.57257	0.979	P	0.44990	0.466	T	0.01013	-1.1481	10	0.87932	D	0	.	10.8225	0.46612	0.0:0.9115:0.0:0.0885	.	61	Q8N957	ANKF1_HUMAN	W	61	ENSP00000321627:S61W	ENSP00000321627:S61W	S	+	2	0	ANKFN1	51758700	0.497000	0.26067	0.974000	0.42286	0.887000	0.51463	0.738000	0.26158	2.885000	0.99019	0.655000	0.94253	TCG	ANKFN1	-	NULL	ENSG00000153930		0.373	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKFN1	HGNC	protein_coding	OTTHUMT00000338043.1	75	0.00	0	C	NM_153228		54403701	54403701	+1	no_errors	ENST00000318698	ensembl	human	known	69_37n	missense	49	20.97	13	SNP	0.974	G
ANKRD12	23253	genome.wustl.edu	37	18	9211737	9211737	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr18:9211737G>A	ENST00000262126.4	+	6	847	c.607G>A	c.(607-609)Gaa>Aaa	p.E203K	ANKRD12_ENST00000383440.2_Missense_Mutation_p.E180K|ANKRD12_ENST00000540578.2_3'UTR|ANKRD12_ENST00000400020.3_Missense_Mutation_p.E180K	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	203						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						ACAAGTTAAAGAATTAATAAG	0.333																																						dbGAP											0													85.0	87.0	86.0					18																	9211737		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.607G>A	18.37:g.9211737G>A	ENSP00000262126:p.Glu203Lys		O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E203K	ENST00000262126.4	37	c.607	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	G	18.57	3.651790	0.67472	.	.	ENSG00000101745	ENST00000383440;ENST00000546007;ENST00000262126;ENST00000540578	T;T	0.63417	-0.04;-0.04	5.97	5.97	0.96955	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.69106	0.3074	N	0.16790	0.44	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.83275	0.995;0.994;0.996	T	0.71031	-0.4710	10	0.51188	T	0.08	-22.6229	20.4387	0.99107	0.0:0.0:1.0:0.0	.	203;180;203	Q6PG48;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	K	180;180;203;203	ENSP00000372932:E180K;ENSP00000262126:E203K	ENSP00000262126:E203K	E	+	1	0	ANKRD12	9201737	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.836000	0.97738	0.655000	0.94253	GAA	ANKRD12	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000101745		0.333	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	83	0.00	0	G	NM_015208		9211737	9211737	+1	no_errors	ENST00000262126	ensembl	human	known	69_37n	missense	58	12.12	8	SNP	1.000	A
APBB1IP	54518	genome.wustl.edu	37	10	26851337	26851337	+	Silent	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr10:26851337G>A	ENST00000376236.4	+	14	1907	c.1452G>A	c.(1450-1452)caG>caA	p.Q484Q	APBB1IP_ENST00000493857.1_3'UTR	NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	484					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						AAGAGGCCCAGAGACATGCTG	0.468																																						dbGAP											0													165.0	163.0	164.0					10																	26851337		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.1452G>A	10.37:g.26851337G>A			Q8IWS8|Q8IYL7|Q8IZZ7	Silent	SNP	pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Ras-assoc	p.Q484	ENST00000376236.4	37	c.1452	CCDS31167.1	10																																																																																			APBB1IP	-	NULL	ENSG00000077420		0.468	APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	APBB1IP	HGNC	protein_coding	OTTHUMT00000047270.1	53	0.00	0	G	NM_019043		26851337	26851337	+1	no_errors	ENST00000376236	ensembl	human	known	69_37n	silent	44	12.00	6	SNP	0.004	A
APLN	8862	genome.wustl.edu	37	X	128782606	128782606	+	Silent	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chrX:128782606G>A	ENST00000307484.6	-	2	556	c.231C>T	c.(229-231)ttC>ttT	p.F77F	APLN_ENST00000429967.1_Missense_Mutation_p.S40F|APLN_ENST00000427399.1_Missense_Mutation_p.S40F	NM_017413.4	NP_059109.3	Q9ULZ1	APEL_HUMAN	apelin	77					immune response (GO:0006955)|lactation (GO:0007595)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	receptor binding (GO:0005102)										ACCTGCTTCAGAAAGGCATGG	0.622																																						dbGAP											0													14.0	15.0	15.0					X																	128782606		1971	4123	6094	-	-	-	SO:0001819	synonymous_variant	0			AF179680		Xq25	2013-02-25	2008-04-21		ENSG00000171388	ENSG00000171388		"""Endogenous ligands"""	16665	protein-coding gene	gene with protein product		300297	"""apelin, AGTRL1 ligand"""			9792798, 10525157	Standard	NM_017413		Approved	apelin, XNPEP2	uc004eus.3	Q9ULZ1	OTTHUMG00000022371	ENST00000307484.6:c.231C>T	X.37:g.128782606G>A			Q4VY08|Q8WU89	Missense_Mutation	SNP	NULL	p.S40F	ENST00000307484.6	37	c.119	CCDS48165.1	X	.	.	.	.	.	.	.	.	.	.	g	15.60	2.882511	0.51908	.	.	ENSG00000171388	ENST00000429967;ENST00000427399	.	.	.	5.63	4.77	0.60923	.	0.220866	0.23281	N	0.049905	T	0.60209	0.2251	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56992	-0.7887	5	.	.	.	-1.2377	9.4689	0.38831	0.0998:0.0:0.9002:0.0	.	.	.	.	F	40	.	.	S	-	2	0	APLN	128610287	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.458000	0.53014	1.136000	0.42199	0.553000	0.69018	TCT	APLN	-	NULL	ENSG00000171388		0.622	APLN-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APLN	HGNC	protein_coding		29	0.00	0	G	NM_017413		128782606	128782606	-1	no_errors	ENST00000427399	ensembl	human	known	69_37n	missense	16	23.81	5	SNP	1.000	A
ARHGEF18	23370	genome.wustl.edu	37	19	7509313	7509313	+	Silent	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr19:7509313G>A	ENST00000359920.6	+	4	1273	c.1020G>A	c.(1018-1020)caG>caA	p.Q340Q	ARHGEF18_ENST00000319670.9_Silent_p.Q182Q|CTD-2207O23.3_ENST00000593531.1_Missense_Mutation_p.R298K	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	340	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				ATGTCATCCAGAAAATCGGCG	0.562																																						dbGAP											0													52.0	54.0	53.0					19																	7509313		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.1020G>A	19.37:g.7509313G>A			A8MV62|B5ME81|O60274|Q6DD92	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.Q340	ENST00000359920.6	37	c.1020	CCDS45946.1	19																																																																																			ARHGEF18	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000104880		0.562	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF18	HGNC	protein_coding	OTTHUMT00000436340.1	48	0.00	0	G	NM_015318		7509313	7509313	+1	no_errors	ENST00000359920	ensembl	human	known	69_37n	silent	49	14.04	8	SNP	1.000	A
BCKDK	10295	genome.wustl.edu	37	16	31123511	31123511	+	Silent	SNP	C	C	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr16:31123511C>A	ENST00000394951.1	+	13	1787	c.1164C>A	c.(1162-1164)tcC>tcA	p.S388S	BCKDK_ENST00000219794.6_Silent_p.S388S|BCKDK_ENST00000394950.3_3'UTR|AC135050.1_ENST00000517000.2_RNA|BCKDK_ENST00000287507.3_3'UTR			O14874	BCKD_HUMAN	branched chain ketoacid dehydrogenase kinase	388	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				branched-chain amino acid catabolic process (GO:0009083)|cellular amino acid catabolic process (GO:0009063)|phosphorylation (GO:0016310)|protein phosphorylation (GO:0006468)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrion (GO:0005739)	[3-methyl-2-oxobutanoate dehydrogenase (acetyl-transferring)] kinase activity (GO:0047323)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|stomach(1)	2						AGCTGCAGTCCCTGCAGGGCA	0.667																																						dbGAP											0													66.0	64.0	65.0					16																	31123511		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF026548	CCDS10705.1, CCDS45467.1, CCDS61917.1	16p11.2	2008-05-14			ENSG00000103507	ENSG00000103507			16902	protein-coding gene	gene with protein product		614901				1889817	Standard	NM_005881		Approved		uc002eaw.5	O14874	OTTHUMG00000047356	ENST00000394951.1:c.1164C>A	16.37:g.31123511C>A			A8MY43|Q6FGL4|Q96G95|Q96IN5	Silent	SNP	pfam_BCDHK/PDK_N,pfam_ATPase-like_ATP-bd,superfamily_BCDHK/PDK_N,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pfscan_Sig_transdc_His_kinase_core,prints_Sig_transdc_His_kin-like_C	p.S388	ENST00000394951.1	37	c.1164	CCDS10705.1	16																																																																																			BCKDK	-	pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pfscan_Sig_transdc_His_kinase_core,prints_Sig_transdc_His_kin-like_C	ENSG00000103507		0.667	BCKDK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BCKDK	HGNC	protein_coding	OTTHUMT00000108514.1	45	0.00	0	C	NM_005881		31123511	31123511	+1	no_errors	ENST00000219794	ensembl	human	known	69_37n	silent	38	19.15	9	SNP	1.000	A
BLVRA	644	genome.wustl.edu	37	7	43843326	43843326	+	Missense_Mutation	SNP	C	C	A	rs566565833		TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr7:43843326C>A	ENST00000402924.1	+	8	675	c.512C>A	c.(511-513)tCt>tAt	p.S171Y	BLVRA_ENST00000265523.4_Missense_Mutation_p.S171Y	NM_001253823.1	NP_001240752.1	P53004	BIEA_HUMAN	biliverdin reductase A	171					heme catabolic process (GO:0042167)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	biliverdin reductase activity (GO:0004074)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(2)	12						AGCGGCATCTCTCGCCTGACC	0.522																																						dbGAP											0													166.0	170.0	169.0					7																	43843326		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008456	CCDS5472.1	7p13	2012-10-02			ENSG00000106605	ENSG00000106605	1.3.1.24		1062	protein-coding gene	gene with protein product		109750		BLVR			Standard	NM_001253823		Approved		uc003tir.3	P53004	OTTHUMG00000128953	ENST00000402924.1:c.512C>A	7.37:g.43843326C>A	ENSP00000385757:p.Ser171Tyr		A8K747|O95019|Q86UX0|Q96QL4|Q9BRW8	Missense_Mutation	SNP	pfam_Biliverdin_Rdtase_cat,pfam_Oxidoreductase_N,pirsf_Biliverdin_Rdtase_A	p.S171Y	ENST00000402924.1	37	c.512	CCDS5472.1	7	.	.	.	.	.	.	.	.	.	.	C	20.6	4.017862	0.75161	.	.	ENSG00000106605	ENST00000265523;ENST00000402924	T;T	0.27256	1.68;1.68	4.32	4.32	0.51571	Biliverdin reductase, catalytic (2);	0.051368	0.85682	D	0.000000	T	0.41858	0.1177	L	0.50333	1.59	0.39271	D	0.964386	D	0.89917	1.0	D	0.76071	0.987	T	0.22765	-1.0207	10	0.30854	T	0.27	.	12.6995	0.57024	0.0:1.0:0.0:0.0	.	171	P53004	BIEA_HUMAN	Y	171	ENSP00000265523:S171Y;ENSP00000385757:S171Y	ENSP00000265523:S171Y	S	+	2	0	BLVRA	43809851	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.963000	0.63694	2.115000	0.64714	0.561000	0.74099	TCT	BLVRA	-	pfam_Biliverdin_Rdtase_cat,pirsf_Biliverdin_Rdtase_A	ENSG00000106605		0.522	BLVRA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BLVRA	HGNC	protein_coding	OTTHUMT00000339006.1	41	0.00	0	C	NM_000712		43843326	43843326	+1	no_errors	ENST00000265523	ensembl	human	known	69_37n	missense	43	12.24	6	SNP	1.000	A
BPIFA2	140683	genome.wustl.edu	37	20	31760835	31760835	+	Silent	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr20:31760835G>A	ENST00000253362.2	+	3	401	c.255G>A	c.(253-255)ctG>ctA	p.L85L	BPIFA2_ENST00000354932.5_Silent_p.L85L			Q96DR5	BPIA2_HUMAN	BPI fold containing family A, member 2	85						extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)										AGAAATTGCTGAACAATGTCA	0.473																																						dbGAP											0													116.0	104.0	108.0					20																	31760835		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF432917	CCDS13214.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131050	ENSG00000131050		"""BPI fold containing"""	16203	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 70"""	C20orf70		11971875	Standard	NM_080574		Approved	bA49G10.1, SPLUNC2, PSP	uc002wyo.1	Q96DR5	OTTHUMG00000032244	ENST00000253362.2:c.255G>A	20.37:g.31760835G>A			Q9BQQ0	Silent	SNP	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom	p.L85	ENST00000253362.2	37	c.255	CCDS13214.1	20																																																																																			BPIFA2	-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom	ENSG00000131050		0.473	BPIFA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BPIFA2	HGNC	protein_coding	OTTHUMT00000257117.1	82	0.00	0	G	NM_080574		31760835	31760835	+1	no_errors	ENST00000253362	ensembl	human	known	69_37n	silent	59	11.94	8	SNP	0.000	A
BTF3	689	genome.wustl.edu	37	5	72798840	72798840	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr5:72798840G>C	ENST00000335895.8	+	4	434	c.283G>C	c.(283-285)Gag>Cag	p.E95Q	BTF3_ENST00000514505.2_3'UTR|BTF3_ENST00000380591.3_Missense_Mutation_p.E139Q	NM_001207.4	NP_001198.2	O00478	BT3A3_HUMAN	basic transcription factor 3	297	Ig-like V-type 1.				T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(2)|lung(2)	5		Lung NSC(167;0.00405)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;2.73e-54)		AGGCCATGCTGAGACAAAGCA	0.468																																						dbGAP											0													83.0	84.0	84.0					5																	72798840		2203	4300	6503	-	-	-	SO:0001583	missense	0			M90352	CCDS4019.1, CCDS34185.1	5q13.3	2010-06-17			ENSG00000145741	ENSG00000145741			1125	protein-coding gene	gene with protein product		602542	"""nascent-polypeptide-associated complex beta polypeptide"""	NACB		2320128, 1386332, 15716105	Standard	NM_001207		Approved	BTF3a, BTF3b	uc003kcr.1	P20290	OTTHUMG00000102031	ENST00000335895.8:c.283G>C	5.37:g.72798840G>C	ENSP00000338516:p.Glu95Gln		B4DWI7|E9PCP5	Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx,pfscan_Nas_poly-pep-assoc_cplx	p.E139Q	ENST00000335895.8	37	c.415	CCDS4019.1	5	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474870	0.84640	.	.	ENSG00000145741	ENST00000335895;ENST00000380591;ENST00000507081;ENST00000509708	.	.	.	5.28	5.28	0.74379	Nascent polypeptide-associated complex NAC (2);	0.000000	0.85682	U	0.000000	T	0.60625	0.2283	L	0.39326	1.205	0.80722	D	1	P	0.45902	0.868	P	0.51415	0.669	T	0.52139	-0.8615	9	0.17832	T	0.49	-13.6017	19.2707	0.94008	0.0:0.0:1.0:0.0	.	139	P20290	BTF3_HUMAN	Q	95;139;57;37	.	ENSP00000338516:E95Q	E	+	1	0	BTF3	72834596	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.418000	0.80167	2.620000	0.88729	0.650000	0.86243	GAG	BTF3	-	pfam_Nas_poly-pep-assoc_cplx,pfscan_Nas_poly-pep-assoc_cplx	ENSG00000145741		0.468	BTF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTF3	HGNC	protein_coding	OTTHUMT00000219815.2	40	0.00	0	G	NM_001207		72798840	72798840	+1	no_errors	ENST00000380591	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	1.000	C
C14orf37	145407	genome.wustl.edu	37	14	58471475	58471475	+	Silent	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr14:58471475G>A	ENST00000267485.7	-	8	2498	c.2304C>T	c.(2302-2304)gaC>gaT	p.D768D		NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37	768						integral component of membrane (GO:0016021)				breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						CTTCAGAGCTGTCGGCTAAGA	0.358																																						dbGAP											0													135.0	141.0	139.0					14																	58471475		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.2304C>T	14.37:g.58471475G>A			A8K8Z8|Q6P5Q1|Q86TY1	Silent	SNP	NULL	p.D768	ENST00000267485.7	37	c.2304	CCDS32089.1	14																																																																																			C14orf37	-	NULL	ENSG00000139971		0.358	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf37	HGNC	protein_coding	OTTHUMT00000412059.1	65	0.00	0	G	NM_001001872		58471475	58471475	-1	no_errors	ENST00000267485	ensembl	human	known	69_37n	silent	49	14.04	8	SNP	1.000	A
C17orf80	55028	genome.wustl.edu	37	17	71232151	71232151	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr17:71232151C>T	ENST00000535032.2	+	2	643	c.530C>T	c.(529-531)tCa>tTa	p.S177L	C17orf80_ENST00000255557.4_Missense_Mutation_p.S177L|C17orf80_ENST00000268942.8_Missense_Mutation_p.S177L|C17orf80_ENST00000582793.1_Intron|C17orf80_ENST00000426147.2_Missense_Mutation_p.S177L|C17orf80_ENST00000577615.1_Missense_Mutation_p.S177L|FAM104A_ENST00000583178.1_Intron|C17orf80_ENST00000359042.2_Missense_Mutation_p.S177L			Q9BSJ5	CQ080_HUMAN	chromosome 17 open reading frame 80	177						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(2)|skin(2)|stomach(2)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(166;0.197)			CTGGTTGGCTCAATAGAACCT	0.378																																						dbGAP											0													77.0	81.0	80.0					17																	71232151		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY163812	CCDS11694.1, CCDS42377.1, CCDS45767.1, CCDS74145.1	17q25.1	2012-02-24	2012-02-24	2012-02-24	ENSG00000141219	ENSG00000141219			29601	protein-coding gene	gene with protein product	"""sperm-expressed protein 1"", ""migration-inducing protein 3"""					12477932	Standard	NM_017941		Approved	HLC-8, MIG3, FLJ20721, SPEP1	uc002jjl.4	Q9BSJ5		ENST00000535032.2:c.530C>T	17.37:g.71232151C>T	ENSP00000440551:p.Ser177Leu		A8K9X3|Q5JB45|Q6YAU3|Q9H0L9|Q9H5E6|Q9NWN5	Missense_Mutation	SNP	NULL	p.S177L	ENST00000535032.2	37	c.530	CCDS11694.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.073459	0.94000	.	.	ENSG00000141219	ENST00000255557;ENST00000359042;ENST00000268942;ENST00000426147;ENST00000535032	T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58	4.81	4.81	0.61882	.	0.667620	0.13391	N	0.391427	T	0.38825	0.1055	L	0.38175	1.15	0.25570	N	0.986902	P;P;D;D	0.57899	0.949;0.949;0.976;0.981	P;P;P;P	0.54174	0.52;0.6;0.743;0.744	T	0.20672	-1.0268	10	0.72032	D	0.01	-6.4758	13.7689	0.63012	0.0:1.0:0.0:0.0	.	177;177;177;177	B7Z7E5;Q9BSJ5;Q9BSJ5-2;Q9BSJ5-3	.;CQ080_HUMAN;.;.	L	177	ENSP00000255557:S177L;ENSP00000351937:S177L;ENSP00000268942:S177L;ENSP00000396970:S177L;ENSP00000440551:S177L	ENSP00000255557:S177L	S	+	2	0	C17orf80	68743746	0.000000	0.05858	0.065000	0.19835	0.891000	0.51852	0.383000	0.20651	2.376000	0.81061	0.561000	0.74099	TCA	C17orf80	-	NULL	ENSG00000141219		0.378	C17orf80-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf80	HGNC	protein_coding	OTTHUMT00000441893.1	39	0.00	0	C	NM_017941		71232151	71232151	+1	no_errors	ENST00000359042	ensembl	human	known	69_37n	missense	39	13.33	6	SNP	0.514	T
CDH1	999	genome.wustl.edu	37	16	68845616	68845616	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr16:68845616G>A	ENST00000261769.5	+	7	1053	c.862G>A	c.(862-864)Gac>Aac	p.D288N	RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000422392.2_Missense_Mutation_p.D288N|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	288	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.E283fs*4(1)|p.D288fs*3(1)|p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CACAGCCACAGACGCGGACGA	0.488			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	3	Unknown(1)|Complex - frameshift(1)|Deletion - Frameshift(1)	breast(3)											114.0	99.0	104.0					16																	68845616		2198	4300	6498	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.862G>A	16.37:g.68845616G>A	ENSP00000261769:p.Asp288Asn		A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D288N	ENST00000261769.5	37	c.862	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	G	34	5.319716	0.95682	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	T;T	0.74526	-0.85;-0.85	5.19	5.19	0.71726	Cadherin (5);Cadherin-like (1);	0.000000	0.52532	D	0.000066	D	0.92854	0.7727	H	0.99590	4.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.95944	0.8949	10	0.87932	D	0	.	18.7077	0.91644	0.0:0.0:1.0:0.0	.	288;288	Q9UII8;P12830	.;CADH1_HUMAN	N	288	ENSP00000261769:D288N;ENSP00000414946:D288N	ENSP00000261769:D288N	D	+	1	0	CDH1	67403117	1.000000	0.71417	0.168000	0.22838	0.859000	0.49053	9.476000	0.97823	2.583000	0.87209	0.561000	0.74099	GAC	CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000039068		0.488	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	57	0.00	0	G	NM_004360		68845616	68845616	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	missense	46	13.21	7	SNP	0.993	A
CEP192	55125	genome.wustl.edu	37	18	13049027	13049027	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr18:13049027G>C	ENST00000325971.8	+	14	2042	c.449G>C	c.(448-450)aGa>aCa	p.R150T	CEP192_ENST00000430049.2_Missense_Mutation_p.R271T|CEP192_ENST00000506447.1_Missense_Mutation_p.R746T			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	150					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						AATAAAACCAGAGACAAGACT	0.388																																						dbGAP											0													97.0	94.0	95.0					18																	13049027		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.449G>C	18.37:g.13049027G>C	ENSP00000317156:p.Arg150Thr		A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	NULL	p.R746T	ENST00000325971.8	37	c.2237		18	.	.	.	.	.	.	.	.	.	.	G	17.03	3.285043	0.59867	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.10960	2.82;2.89;2.91	5.03	3.9	0.45041	.	0.194358	0.25540	N	0.029966	T	0.14056	0.0340	L	0.29908	0.895	0.31067	N	0.713497	P;P;D	0.63880	0.908;0.908;0.993	P;P;P	0.59288	0.52;0.52;0.855	T	0.01874	-1.1256	10	0.42905	T	0.14	-8.0862	6.3489	0.21365	0.3128:0.0:0.6872:0.0	.	271;746;150	C9JT09;E9PF99;Q8TEP8	.;.;CE192_HUMAN	T	746;150;150;271	ENSP00000427550:R746T;ENSP00000317156:R150T;ENSP00000389190:R271T	ENSP00000317156:R150T	R	+	2	0	CEP192	13039027	0.068000	0.21057	0.955000	0.39395	0.938000	0.57974	0.752000	0.26362	2.487000	0.83934	0.650000	0.86243	AGA	CEP192	-	NULL	ENSG00000101639		0.388	CEP192-201	KNOWN	basic	protein_coding	CEP192	HGNC	protein_coding		33	0.00	0	G	NM_032142		13049027	13049027	+1	no_errors	ENST00000506447	ensembl	human	known	69_37n	missense	29	14.71	5	SNP	0.709	C
CHD6	84181	genome.wustl.edu	37	20	40127968	40127968	+	Missense_Mutation	SNP	A	A	C			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr20:40127968A>C	ENST00000373233.3	-	6	1059	c.882T>G	c.(880-882)atT>atG	p.I294M	CHD6_ENST00000373222.3_Missense_Mutation_p.I329M|CHD6_ENST00000309279.7_Missense_Mutation_p.I294M	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	294	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.|Required for DNA-dependent ATPase activity.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				GGATCTTCTCAATGATGTTTG	0.378																																						dbGAP											0													74.0	61.0	65.0					20																	40127968		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.882T>G	20.37:g.40127968A>C	ENSP00000362330:p.Ile294Met		Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_BRK_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.I294M	ENST00000373233.3	37	c.882	CCDS13317.1	20	.	.	.	.	.	.	.	.	.	.	A	17.46	3.395518	0.62066	.	.	ENSG00000124177	ENST00000373233;ENST00000309279;ENST00000373222	T;T;T	0.74209	-0.82;-0.82;0.43	4.59	4.59	0.56863	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (1);	0.097937	0.45126	D	0.000394	D	0.82651	0.5083	M	0.74881	2.28	0.49483	D	0.999795	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.986	D	0.83475	0.0061	10	0.72032	D	0.01	-11.6552	5.9892	0.19452	0.7736:0.0:0.0805:0.1459	.	329;294	Q8TD26-2;Q8TD26	.;CHD6_HUMAN	M	294;294;329	ENSP00000362330:I294M;ENSP00000308684:I294M;ENSP00000362319:I329M	ENSP00000308684:I294M	I	-	3	3	CHD6	39561382	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	0.699000	0.25586	2.052000	0.61016	0.402000	0.26972	ATT	CHD6	-	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow	ENSG00000124177		0.378	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	HGNC	protein_coding	OTTHUMT00000079270.1	81	0.00	0	A			40127968	40127968	-1	no_errors	ENST00000373233	ensembl	human	known	69_37n	missense	41	12.77	6	SNP	1.000	C
CLSPN	63967	genome.wustl.edu	37	1	36202188	36202188	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr1:36202188G>C	ENST00000318121.3	-	25	3986	c.3929C>G	c.(3928-3930)tCt>tGt	p.S1310C	CLSPN_ENST00000466308.1_5'UTR|CLSPN_ENST00000373220.3_Missense_Mutation_p.S1246C|CLSPN_ENST00000520551.1_Missense_Mutation_p.S1257C|RP11-435D7.3_ENST00000373226.2_RNA|CLSPN_ENST00000251195.5_Intron	NM_022111.3	NP_071394.2	Q9HAW4	CLSPN_HUMAN	claspin	1310					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|mitotic DNA replication checkpoint (GO:0033314)|peptidyl-serine phosphorylation (GO:0018105)	nucleoplasm (GO:0005654)	anaphase-promoting complex binding (GO:0010997)|DNA binding (GO:0003677)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AGTCATGAAAGATGGACCCCT	0.428																																						dbGAP											0													118.0	111.0	113.0					1																	36202188		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF297866	CCDS396.1, CCDS53297.1	1p34.3	2010-06-24	2010-06-24		ENSG00000092853	ENSG00000092853			19715	protein-coding gene	gene with protein product		605434	"""claspin homolog (Xenopus laevis)"""			11090622, 12766152	Standard	NM_022111		Approved		uc001bzi.3	Q9HAW4	OTTHUMG00000004168	ENST00000318121.3:c.3929C>G	1.37:g.36202188G>C	ENSP00000312995:p.Ser1310Cys		A6NFL4|Q1RMC6|Q2KHM3|Q5VYG0|Q6P6H5|Q8IWI1	Missense_Mutation	SNP	NULL	p.S1310C	ENST00000318121.3	37	c.3929	CCDS396.1	1	.	.	.	.	.	.	.	.	.	.	G	13.99	2.401916	0.42613	.	.	ENSG00000092853	ENST00000318121;ENST00000373220;ENST00000520551	T;T;T	0.24723	1.84;1.85;1.85	5.96	5.0	0.66597	.	0.387672	0.27491	N	0.019121	T	0.30293	0.0760	L	0.54323	1.7	0.09310	N	1	P;P	0.44946	0.846;0.797	P;B	0.47162	0.54;0.428	T	0.20571	-1.0271	10	0.54805	T	0.06	-3.6131	9.4256	0.38578	0.0747:0.1449:0.7804:0.0	.	1246;1310	Q9HAW4-2;Q9HAW4	.;CLSPN_HUMAN	C	1310;1246;1257	ENSP00000312995:S1310C;ENSP00000362317:S1246C;ENSP00000428848:S1257C	ENSP00000312995:S1310C	S	-	2	0	CLSPN	35974775	0.191000	0.23288	0.203000	0.23512	0.637000	0.38172	2.624000	0.46444	2.832000	0.97577	0.655000	0.94253	TCT	CLSPN	-	NULL	ENSG00000092853		0.428	CLSPN-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSPN	HGNC	protein_coding	OTTHUMT00000377857.1	86	0.00	0	G	NM_022111		36202188	36202188	-1	no_errors	ENST00000318121	ensembl	human	known	69_37n	missense	85	14.14	14	SNP	0.013	C
CNPY4	245812	genome.wustl.edu	37	7	99719923	99719923	+	Missense_Mutation	SNP	C	C	G	rs139327006		TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr7:99719923C>G	ENST00000262932.3	+	2	292	c.160C>G	c.(160-162)Cgc>Ggc	p.R54G	TAF6_ENST00000452041.1_5'Flank|CNPY4_ENST00000480692.1_3'UTR|TAF6_ENST00000497233.1_5'Flank|TAF6_ENST00000453269.2_5'Flank|RP11-506M12.1_ENST00000494221.1_RNA|TAF6_ENST00000344095.4_5'Flank|TAF6_ENST00000418432.2_5'Flank|TAF6_ENST00000437822.2_5'Flank	NM_152755.1	NP_689968.1	Q8N129	CNPY4_HUMAN	canopy FGF signaling regulator 4	54						extracellular region (GO:0005576)				breast(2)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGAACTGAGTCGCACCGGTCG	0.572																																						dbGAP											0													103.0	95.0	98.0					7																	99719923		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075537	CCDS34701.1	7q22.1	2013-07-23	2013-07-23		ENSG00000166997	ENSG00000166997			28631	protein-coding gene	gene with protein product	"""protein associated with TLR4"""	610047	"""canopy 4 homolog (zebrafish)"""			12975309	Standard	NM_152755		Approved	MGC40499, PRAT4B	uc003uto.3	Q8N129	OTTHUMG00000154817	ENST00000262932.3:c.160C>G	7.37:g.99719923C>G	ENSP00000262932:p.Arg54Gly		Q8WUN9	Missense_Mutation	SNP	pfam_DUF3456	p.R54G	ENST00000262932.3	37	c.160	CCDS34701.1	7	.	.	.	.	.	.	.	.	.	.	C	13.85	2.361454	0.41801	.	.	ENSG00000166997	ENST00000262932	T	0.36157	1.27	5.16	5.16	0.70880	.	0.129222	0.52532	D	0.000068	T	0.40145	0.1105	L	0.57536	1.79	0.39575	D	0.969348	P	0.38992	0.653	B	0.41619	0.361	T	0.39121	-0.9629	10	0.48119	T	0.1	-3.787	14.1426	0.65329	0.0:1.0:0.0:0.0	.	54	Q8N129	CNPY4_HUMAN	G	54	ENSP00000262932:R54G	ENSP00000262932:R54G	R	+	1	0	CNPY4	99557859	1.000000	0.71417	0.992000	0.48379	0.268000	0.26511	4.395000	0.59678	2.392000	0.81423	0.462000	0.41574	CGC	CNPY4	-	pfam_DUF3456	ENSG00000166997		0.572	CNPY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNPY4	HGNC	protein_coding	OTTHUMT00000337224.4	62	0.00	0	C	NM_152755		99719923	99719923	+1	no_errors	ENST00000262932	ensembl	human	known	69_37n	missense	52	10.34	6	SNP	0.995	G
DUOX1	53905	genome.wustl.edu	37	15	45433515	45433515	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr15:45433515G>C	ENST00000321429.4	+	15	1998	c.1591G>C	c.(1591-1593)Gaa>Caa	p.E531Q	DUOX1_ENST00000389037.3_Missense_Mutation_p.E531Q|DUOX1_ENST00000561166.1_Missense_Mutation_p.E177Q	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	531	Peroxidase-like; mediates peroxidase activity.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		GGAGATTGAAGAAATCCGAAA	0.532																																						dbGAP											0													113.0	104.0	107.0					15																	45433515		2198	4298	6496	-	-	-	SO:0001583	missense	0			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.1591G>C	15.37:g.45433515G>C	ENSP00000317997:p.Glu531Gln		A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF-hand,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_Ca-bd,prints_Haem_peroxidase_animal_subgr,prints_Recoverin,pfscan_EF_HAND_2,pfscan_Haem_peroxidase_animal	p.E531Q	ENST00000321429.4	37	c.1591	CCDS32221.1	15	.	.	.	.	.	.	.	.	.	.	G	9.777	1.174260	0.21704	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	T;T	0.70869	-0.52;-0.52	4.53	3.6	0.41247	.	0.392698	0.31612	N	0.007347	T	0.63780	0.2540	L	0.52126	1.63	0.39441	D	0.967242	P	0.42337	0.776	P	0.45794	0.493	T	0.60224	-0.7305	10	0.24483	T	0.36	-34.3354	6.1589	0.20354	0.1989:0.0:0.8011:0.0	.	531	Q9NRD9	DUOX1_HUMAN	Q	531	ENSP00000317997:E531Q;ENSP00000373689:E531Q	ENSP00000317997:E531Q	E	+	1	0	DUOX1	43220807	0.661000	0.27430	0.999000	0.59377	0.025000	0.11179	1.551000	0.36233	2.498000	0.84270	0.650000	0.86243	GAA	DUOX1	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000137857		0.532	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUOX1	HGNC	protein_coding	OTTHUMT00000416251.1	83	0.00	0	G	NM_017434		45433515	45433515	+1	no_errors	ENST00000321429	ensembl	human	known	69_37n	missense	73	14.12	12	SNP	0.948	C
EPS15L1	58513	genome.wustl.edu	37	19	16548608	16548608	+	Silent	SNP	C	C	T			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr19:16548608C>T	ENST00000248070.6	-	5	421	c.282G>A	c.(280-282)ctG>ctA	p.L94L	EPS15L1_ENST00000597937.1_Silent_p.L94L|EPS15L1_ENST00000455140.2_Silent_p.L94L|EPS15L1_ENST00000535753.2_Silent_p.L94L|EPS15L1_ENST00000602009.1_5'Flank|EPS15L1_ENST00000594975.1_Silent_p.L94L	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	94	EH 1. {ECO:0000255|PROSITE- ProRule:PRU00077}.|Interaction with DAB2. {ECO:0000250}.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						TGCTCAAATTCAGATTGCTCA	0.453																																						dbGAP											0													130.0	111.0	117.0					19																	16548608		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.282G>A	19.37:g.16548608C>T			A2RRF3|A5PL29|B4DKA3	Silent	SNP	superfamily_Prefoldin,smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_Ubiquitin-int_motif,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_Ubiquitin-int_motif	p.L94	ENST00000248070.6	37	c.282	CCDS32944.1	19																																																																																			EPS15L1	-	smart_EPS15_homology,pfscan_EPS15_homology	ENSG00000127527		0.453	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	EPS15L1	HGNC	protein_coding	OTTHUMT00000461040.1	77	0.00	0	C	NM_021235		16548608	16548608	-1	no_errors	ENST00000455140	ensembl	human	known	69_37n	silent	44	15.38	8	SNP	0.755	T
FAM222B	55731	genome.wustl.edu	37	17	27086726	27086726	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr17:27086726G>A	ENST00000341217.5	-	3	466	c.251C>T	c.(250-252)tCa>tTa	p.S84L	FAM222B_ENST00000581381.1_3'UTR|FAM222B_ENST00000581407.1_Missense_Mutation_p.S84L|FAM222B_ENST00000583953.1_3'UTR|FAM222B_ENST00000582266.1_3'UTR|FAM222B_ENST00000577682.1_3'UTR|FAM222B_ENST00000583522.1_3'UTR|FAM222B_ENST00000582059.1_3'UTR|FAM222B_ENST00000452648.3_Missense_Mutation_p.S84L	NM_018182.2	NP_060652.2	Q8WU58	F222B_HUMAN	family with sequence similarity 222, member B	84																	GCGCTGGGCTGATGTGTCGAG	0.542																																						dbGAP											0													68.0	72.0	70.0					17																	27086726		2112	4243	6355	-	-	-	SO:0001583	missense	0			AK001562	CCDS45637.1, CCDS74022.1	17q11.2	2012-04-27	2012-04-27	2012-04-27	ENSG00000173065	ENSG00000173065			25563	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 63"""	C17orf63			Standard	NM_001288631		Approved	FLJ10700	uc010way.1	Q8WU58		ENST00000341217.5:c.251C>T	17.37:g.27086726G>A	ENSP00000343115:p.Ser84Leu		Q9H6F3|Q9NVJ4|Q9NXN6	Missense_Mutation	SNP	NULL	p.S84L	ENST00000341217.5	37	c.251	CCDS45637.1	17	.	.	.	.	.	.	.	.	.	.	G	11.99	1.804274	0.31869	.	.	ENSG00000173065	ENST00000341217;ENST00000452648	T;T	0.39592	1.07;1.07	4.97	4.0	0.46444	.	0.072554	0.64402	D	0.000019	T	0.40015	0.1100	L	0.53249	1.67	0.80722	D	1	P	0.35745	0.518	B	0.36418	0.224	T	0.43556	-0.9384	10	0.87932	D	0	-5.4972	12.5811	0.56391	0.08:0.0:0.92:0.0	.	84	Q8WU58	CQ063_HUMAN	L	84	ENSP00000343115:S84L;ENSP00000413645:S84L	ENSP00000343115:S84L	S	-	2	0	C17orf63	24110852	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.247000	0.95444	1.324000	0.45282	0.561000	0.74099	TCA	FAM222B	-	NULL	ENSG00000173065		0.542	FAM222B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM222B	HGNC	protein_coding	OTTHUMT00000446703.1	89	0.00	0	G	NM_018182		27086726	27086726	-1	no_errors	ENST00000341217	ensembl	human	known	69_37n	missense	79	13.04	12	SNP	1.000	A
FANCI	55215	genome.wustl.edu	37	15	89836012	89836012	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr15:89836012G>A	ENST00000310775.7	+	21	2172	c.2086G>A	c.(2086-2088)Gag>Aag	p.E696K	FANCI_ENST00000300027.8_Missense_Mutation_p.E696K	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	696					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					ggaggaggaagaggCATTCTA	0.423								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP											0													133.0	130.0	131.0					15																	89836012		2200	4299	6499	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.2086G>A	15.37:g.89836012G>A	ENSP00000310842:p.Glu696Lys		A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	NULL	p.E696K	ENST00000310775.7	37	c.2086	CCDS45346.1	15	.	.	.	.	.	.	.	.	.	.	G	15.43	2.832109	0.50845	.	.	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611	T;T;T	0.32023	1.47;1.47;1.47	5.83	5.83	0.93111	.	0.243941	0.32081	U	0.006609	T	0.24967	0.0606	L	0.43152	1.355	0.80722	D	1	B;P;P	0.35401	0.135;0.499;0.499	B;B;B	0.30179	0.037;0.112;0.112	T	0.02983	-1.1086	10	0.23302	T	0.38	-12.0977	14.2887	0.66263	0.0706:0.0:0.9294:0.0	.	696;696;696	Q9NVI1;Q9NVI1-2;Q9NVI1-1	FANCI_HUMAN;.;.	K	696	ENSP00000300027:E696K;ENSP00000310842:E696K;ENSP00000413249:E696K	ENSP00000300027:E696K	E	+	1	0	FANCI	87637016	1.000000	0.71417	0.984000	0.44739	0.897000	0.52465	6.020000	0.70826	2.756000	0.94617	0.655000	0.94253	GAG	FANCI	-	NULL	ENSG00000140525		0.423	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCI	HGNC	protein_coding	OTTHUMT00000421140.1	104	0.00	0	G	NM_018193		89836012	89836012	+1	no_errors	ENST00000310775	ensembl	human	known	69_37n	missense	85	14.14	14	SNP	0.996	A
GATA3	2625	genome.wustl.edu	37	10	8100449	8100449	+	Silent	SNP	G	G	A	rs545553575		TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr10:8100449G>A	ENST00000346208.3	+	3	878	c.423G>A	c.(421-423)ttG>ttA	p.L141L	GATA3_ENST00000379328.3_Silent_p.L141L|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	141	Poly-Ser.				anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						CCTCCTCCTTGTCGGGGGGCC	0.726			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	0													38.0	49.0	45.0					10																	8100449		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.423G>A	10.37:g.8100449G>A			Q5VWG7|Q5VWG8|Q96J16	Silent	SNP	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.L141	ENST00000346208.3	37	c.423	CCDS7083.1	10																																																																																			GATA3	-	pirsf_TF_GATA-1/2/3	ENSG00000107485		0.726	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	28	0.00	0	G	NM_001002295		8100449	8100449	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	silent	28	15.15	5	SNP	1.000	A
FRMD4A	55691	genome.wustl.edu	37	10	13705478	13705478	+	Silent	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr10:13705478G>A	ENST00000357447.2	-	19	2003	c.1635C>T	c.(1633-1635)ctC>ctT	p.L545L	FRMD4A_ENST00000358621.4_Silent_p.L530L|FRMD4A_ENST00000378503.1_Silent_p.L545L	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	545					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						GGGCATCTGAGAGGGAGCTGT	0.423																																						dbGAP											0													132.0	111.0	118.0					10																	13705478		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.1635C>T	10.37:g.13705478G>A			A7E2Y3|Q5T377	Silent	SNP	pfam_DUF3338,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.L545	ENST00000357447.2	37	c.1635	CCDS7101.1	10																																																																																			FRMD4A	-	NULL	ENSG00000151474		0.423	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD4A	HGNC	protein_coding	OTTHUMT00000046889.1	66	0.00	0	G	NM_018027		13705478	13705478	-1	no_errors	ENST00000357447	ensembl	human	known	69_37n	silent	59	15.71	11	SNP	1.000	A
GLI3	2737	genome.wustl.edu	37	7	42065886	42065886	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr7:42065886G>A	ENST00000395925.3	-	8	1238	c.1154C>T	c.(1153-1155)cCa>cTa	p.P385L	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	385					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						TGGAAAAGTTGGGGCAGGGTG	0.582									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																													dbGAP											0													114.0	105.0	108.0					7																	42065886		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	;		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.1154C>T	7.37:g.42065886G>A	ENSP00000379258:p.Pro385Leu		A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P385L	ENST00000395925.3	37	c.1154	CCDS5465.1	7	.	.	.	.	.	.	.	.	.	.	G	24.2	4.503136	0.85176	.	.	ENSG00000106571	ENST00000395925	T	0.18657	2.2	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.33527	0.0866	M	0.77313	2.365	0.80722	D	1	B	0.28233	0.204	B	0.29176	0.099	T	0.10776	-1.0615	10	0.62326	D	0.03	.	20.2789	0.98501	0.0:0.0:1.0:0.0	.	385	P10071	GLI3_HUMAN	L	385	ENSP00000379258:P385L	ENSP00000379258:P385L	P	-	2	0	GLI3	42032411	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.188000	0.94921	2.788000	0.95919	0.650000	0.86243	CCA	GLI3	-	NULL	ENSG00000106571		0.582	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI3	HGNC	protein_coding	OTTHUMT00000250806.3	154	0.00	0	G	NM_000168		42065886	42065886	-1	no_errors	ENST00000395925	ensembl	human	known	69_37n	missense	119	15.00	21	SNP	1.000	A
GPATCH1	55094	genome.wustl.edu	37	19	33587206	33587206	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr19:33587206C>G	ENST00000170564.2	+	7	1020	c.706C>G	c.(706-708)Cta>Gta	p.L236V		NM_018025.2	NP_060495.2	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	236					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|prostate(4)|skin(4)	40	Esophageal squamous(110;0.137)					TGTGCATGGTCTAGCTTACAA	0.463																																					Pancreas(67;88 1713 4567 18227)	dbGAP											0													149.0	145.0	146.0					19																	33587206		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF434677	CCDS12428.1	19q13.12	2013-01-28		2006-12-13		ENSG00000076650		"""G patch domain containing"""	24658	protein-coding gene	gene with protein product	"""evolutionarily conserved G patch domain containing"""			GPATC1		12477932	Standard	NM_018025		Approved	ECGP, FLJ10206, FLJ38686	uc002nug.1	Q9BRR8		ENST00000170564.2:c.706C>G	19.37:g.33587206C>G	ENSP00000170564:p.Leu236Val		Q8IZV6|Q8N3B7|Q9NW94	Missense_Mutation	SNP	pfam_DUF1604,pfam_G_patch_dom,superfamily_C-type_lectin_fold,pfscan_G_patch_dom	p.L236V	ENST00000170564.2	37	c.706	CCDS12428.1	19	.	.	.	.	.	.	.	.	.	.	C	13.13	2.144507	0.37825	.	.	ENSG00000076650	ENST00000170564	T	0.21543	2.0	5.55	2.28	0.28536	.	0.000000	0.85682	D	0.000000	T	0.35307	0.0927	M	0.73319	2.225	0.80722	D	1	D	0.61080	0.989	P	0.58970	0.849	T	0.03761	-1.1006	10	0.49607	T	0.09	-8.9961	7.976	0.30155	0.0:0.6809:0.0:0.3191	.	236	Q9BRR8	GPTC1_HUMAN	V	236	ENSP00000170564:L236V	ENSP00000170564:L236V	L	+	1	2	GPATCH1	38279046	0.969000	0.33509	0.863000	0.33907	0.144000	0.21451	2.271000	0.43364	0.292000	0.22492	0.655000	0.94253	CTA	GPATCH1	-	NULL	ENSG00000076650		0.463	GPATCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH1	HGNC	protein_coding	OTTHUMT00000450834.1	56	0.00	0	C	NM_018025		33587206	33587206	+1	no_errors	ENST00000170564	ensembl	human	known	69_37n	missense	71	13.25	11	SNP	1.000	G
GREM2	64388	genome.wustl.edu	37	1	240656380	240656380	+	Silent	SNP	G	G	C	rs369785768		TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr1:240656380G>C	ENST00000318160.4	-	2	662	c.396C>G	c.(394-396)ctC>ctG	p.L132L		NM_022469.3	NP_071914.3	Q9H772	GREM2_HUMAN	gremlin 2, DAN family BMP antagonist	132	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.				BMP signaling pathway (GO:0030509)|cytokine-mediated signaling pathway (GO:0019221)|determination of dorsal identity (GO:0048263)|embryonic body morphogenesis (GO:0010172)|regulation of cytokine activity (GO:0060300)|sequestering of BMP from receptor via BMP binding (GO:0038098)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	heparin binding (GO:0008201)			endometrium(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	10		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)			CGAGCTCCACGAGGACGGAGG	0.627																																						dbGAP											0													60.0	64.0	62.0					1																	240656380		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK024848	CCDS31070.1	1q43	2013-02-26	2013-02-26		ENSG00000180875	ENSG00000180875			17655	protein-coding gene	gene with protein product	"""protein related to DAN and cerberus"""	608832	"""gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis)"", ""gremlin 2"""			15039429	Standard	XM_005273226		Approved	Prdc, FLJ21195, CKTSF1B2, DAND3	uc001hys.3	Q9H772	OTTHUMG00000039909	ENST00000318160.4:c.396C>G	1.37:g.240656380G>C			Q86UD9	Silent	SNP	pfam_DAN,pfam_Cys_knot,smart_Cys_knot_C,pirsf_Gremlin_precursor,pfscan_Cys_knot_C	p.L132	ENST00000318160.4	37	c.396	CCDS31070.1	1																																																																																			GREM2	-	pfam_DAN,pfam_Cys_knot,smart_Cys_knot_C,pirsf_Gremlin_precursor,pfscan_Cys_knot_C	ENSG00000180875		0.627	GREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREM2	HGNC	protein_coding	OTTHUMT00000096286.1	29	0.00	0	G	NM_022469		240656380	240656380	-1	no_errors	ENST00000318160	ensembl	human	known	69_37n	silent	27	12.90	4	SNP	0.083	C
GRIN2C	2905	genome.wustl.edu	37	17	72840607	72840607	+	Silent	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr17:72840607G>A	ENST00000293190.5	-	12	2537	c.2391C>T	c.(2389-2391)atC>atT	p.I797I	GRIN2C_ENST00000347612.4_Silent_p.I797I	NM_000835.3	NP_000826.2	Q14957	NMDE3_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	797					directional locomotion (GO:0033058)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of protein catabolic process (GO:0042177)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	33	all_lung(278;0.172)|Lung NSC(278;0.207)				Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CATTCTGGCAGATCCCTGAGA	0.572																																						dbGAP											0													127.0	111.0	116.0					17																	72840607		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32724.1, CCDS62330.1	17q25.1	2012-08-29			ENSG00000161509	ENSG00000161509		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4587	protein-coding gene	gene with protein product		138254		NMDAR2C		9480759	Standard	NM_001278553		Approved	GluN2C	uc002jlt.1	Q14957	OTTHUMG00000044524	ENST00000293190.5:c.2391C>T	17.37:g.72840607G>A			B2RTT1	Silent	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,pfam_NMDAR2_C,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.I797	ENST00000293190.5	37	c.2391	CCDS32724.1	17																																																																																			GRIN2C	-	pfam_Iontro_glu_rcpt	ENSG00000161509		0.572	GRIN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2C	HGNC	protein_coding	OTTHUMT00000103824.1	96	0.00	0	G			72840607	72840607	-1	no_errors	ENST00000293190	ensembl	human	known	69_37n	silent	74	13.79	12	SNP	1.000	A
HCCS	3052	genome.wustl.edu	37	X	11136674	11136674	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chrX:11136674G>A	ENST00000321143.4	+	5	657	c.455G>A	c.(454-456)aGa>aAa	p.R152K	Y_RNA_ENST00000384422.1_RNA|ARHGAP6_ENST00000534860.1_Intron|HCCS_ENST00000380762.4_Missense_Mutation_p.R152K|HCCS_ENST00000380763.3_Missense_Mutation_p.R152K	NM_001122608.2|NM_001171991.2|NM_005333.4	NP_001116080.1|NP_001165462.1|NP_005324.3	P53701	CCHL_HUMAN	holocytochrome c synthase	152					organ morphogenesis (GO:0009887)|oxidation-reduction process (GO:0055114)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	holocytochrome-c synthase activity (GO:0004408)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(3)	7						AATATCATTAGAATTCACAAT	0.373																																					Ovarian(86;1338 1347 1462 10340 37882)	dbGAP											0													121.0	114.0	116.0					X																	11136674		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14139.1	Xp22	2014-01-31	2010-05-11		ENSG00000004961	ENSG00000004961	4.4.1.17		4837	protein-coding gene	gene with protein product	"""cytochrome c heme-lyase"""	300056	"""holocytochrome c synthase (cytochrome c heme-lyase)"", ""microphthalamia with linear skin defects"""	MLS		8364577, 12444108	Standard	NM_001122608		Approved	CCHL	uc004cuj.3	P53701	OTTHUMG00000021128	ENST00000321143.4:c.455G>A	X.37:g.11136674G>A	ENSP00000326579:p.Arg152Lys		B3KUS1|Q502X8	Missense_Mutation	SNP	pfam_Cyt_C/C1_haem_lyase	p.R152K	ENST00000321143.4	37	c.455	CCDS14139.1	X	.	.	.	.	.	.	.	.	.	.	g	4.524	0.097179	0.08681	.	.	ENSG00000004961	ENST00000321143;ENST00000380763;ENST00000380762	D;D;D	0.81579	-1.51;-1.51;-1.51	5.6	-5.18	0.02840	.	0.424639	0.30293	N	0.009952	T	0.49372	0.1553	N	0.02296	-0.605	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.45498	-0.9257	10	0.06625	T	0.88	-2.1821	14.8531	0.70313	0.7285:0.0:0.2715:0.0	.	152	P53701	CCHL_HUMAN	K	152	ENSP00000326579:R152K;ENSP00000370140:R152K;ENSP00000370139:R152K	ENSP00000326579:R152K	R	+	2	0	HCCS	11046595	1.000000	0.71417	0.008000	0.14137	0.996000	0.88848	1.977000	0.40589	-1.304000	0.02329	0.597000	0.82753	AGA	HCCS	-	pfam_Cyt_C/C1_haem_lyase	ENSG00000004961		0.373	HCCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCCS	HGNC	protein_coding	OTTHUMT00000055742.1	100	0.00	0	G			11136674	11136674	+1	no_errors	ENST00000321143	ensembl	human	known	69_37n	missense	79	17.71	17	SNP	0.002	A
HMG20B	10362	genome.wustl.edu	37	19	3574548	3574548	+	Silent	SNP	C	C	T			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr19:3574548C>T	ENST00000333651.6	+	4	390	c.315C>T	c.(313-315)ggC>ggT	p.G105G	MFSD12_ENST00000591878.1_5'Flank	NM_006339.2	NP_006330.2	Q9P0W2	HM20B_HUMAN	high mobility group 20B	105					blood coagulation (GO:0007596)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of protein sumoylation (GO:0033234)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0025)|STAD - Stomach adenocarcinoma(1328;0.18)		AGATGCTGGGCGCCGAGTGGA	0.701																																						dbGAP											0													12.0	14.0	13.0					19																	3574548		1934	4120	6054	-	-	-	SO:0001819	synonymous_variant	0			BC003505	CCDS45919.1	19p13.3	2011-07-01	2011-04-05		ENSG00000064961	ENSG00000064961		"""High mobility group / Non-canonical"""	5002	protein-coding gene	gene with protein product	"""HMG box domain containing 2"""	605535	"""high-mobility group 20B"""			10773667	Standard	NM_006339		Approved	SOXL, HMGX2, BRAF35, SMARCE1r, BRAF25, HMGXB2	uc002lya.3	Q9P0W2	OTTHUMG00000150437	ENST00000333651.6:c.315C>T	19.37:g.3574548C>T			A6NMS5|D6W616|Q6IBP8|Q8NBD5|Q9HD21|Q9Y491|Q9Y4A2	Missense_Mutation	SNP	NULL	p.R110C	ENST00000333651.6	37	c.328	CCDS45919.1	19	.	.	.	.	.	.	.	.	.	.	C	20.2	3.953292	0.73902	.	.	ENSG00000064961	ENST00000262949	.	.	.	4.39	-7.67	0.01272	.	.	.	.	.	T	0.50051	0.1593	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62501	-0.6841	5	0.87932	D	0	-26.2699	2.4384	0.04488	0.1728:0.1547:0.1428:0.5297	.	.	.	.	C	110	.	ENSP00000262949:R110C	R	+	1	0	HMG20B	3525548	0.001000	0.12720	0.983000	0.44433	0.996000	0.88848	-1.153000	0.03169	-0.641000	0.05487	0.491000	0.48974	CGC	HMG20B	-	NULL	ENSG00000064961		0.701	HMG20B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMG20B	HGNC	protein_coding	OTTHUMT00000318088.1	12	0.00	0	C	NM_006339		3574548	3574548	+1	no_errors	ENST00000435022	ensembl	human	known	69_37n	missense	9	30.77	4	SNP	0.049	T
IBTK	25998	genome.wustl.edu	37	6	82923947	82923947	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr6:82923947C>T	ENST00000306270.7	-	12	2750	c.2201G>A	c.(2200-2202)aGt>aAt	p.S734N	IBTK_ENST00000510291.1_Missense_Mutation_p.S734N|IBTK_ENST00000503631.1_Intron	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	734					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		ATCATACCTACTACTCAAATT	0.328																																						dbGAP											0													87.0	92.0	90.0					6																	82923947		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.2201G>A	6.37:g.82923947C>T	ENSP00000305721:p.Ser734Asn		Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like,pfscan_Reg_chr_condens	p.S734N	ENST00000306270.7	37	c.2201	CCDS34490.1	6	.	.	.	.	.	.	.	.	.	.	C	10.82	1.457932	0.26161	.	.	ENSG00000005700	ENST00000306270;ENST00000510291	T;T	0.22539	1.95;1.95	5.27	5.27	0.74061	BTB/POZ-like (1);	0.153378	0.56097	D	0.000024	T	0.14657	0.0354	M	0.64997	1.995	0.28585	N	0.909911	P;P;P	0.44627	0.704;0.799;0.839	B;P;P	0.44990	0.365;0.466;0.448	T	0.11616	-1.0580	10	0.21540	T	0.41	.	14.2411	0.65956	0.0:0.7272:0.2728:0.0	.	734;734;734	E7EPI0;Q9P2D0-2;Q9P2D0	.;.;IBTK_HUMAN	N	734	ENSP00000305721:S734N;ENSP00000426405:S734N	ENSP00000305721:S734N	S	-	2	0	IBTK	82980666	1.000000	0.71417	1.000000	0.80357	0.688000	0.40055	0.893000	0.28336	2.640000	0.89533	0.655000	0.94253	AGT	IBTK	-	smart_BTB/POZ-like	ENSG00000005700		0.328	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IBTK	HGNC	protein_coding	OTTHUMT00000041337.2	61	0.00	0	C	NM_015525		82923947	82923947	-1	no_errors	ENST00000306270	ensembl	human	known	69_37n	missense	58	13.43	9	SNP	1.000	T
IFNA16	3449	genome.wustl.edu	37	9	21217072	21217072	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr9:21217072G>A	ENST00000380216.1	-	1	238	c.233C>T	c.(232-234)tCt>tTt	p.S78F		NM_002173.2	NP_002164.1	P05015	IFN16_HUMAN	interferon, alpha 16	78					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	13				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		ATGGAAGGCAGAGATGGCTTG	0.473																																						dbGAP											0													122.0	116.0	118.0					9																	21217072		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34996.1	9p22	2010-12-10			ENSG00000147885	ENSG00000147885		"""Interferons"""	5421	protein-coding gene	gene with protein product		147580				1385305	Standard	NM_002173		Approved	IFN-alphaO	uc003zor.1	P05015	OTTHUMG00000019663	ENST00000380216.1:c.233C>T	9.37:g.21217072G>A	ENSP00000369564:p.Ser78Phe		Q5VV12	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.S78F	ENST00000380216.1	37	c.233	CCDS34996.1	9	.	.	.	.	.	.	.	.	.	.	-	8.077	0.771539	0.16051	.	.	ENSG00000147885	ENST00000380216	T	0.03689	3.84	2.62	1.69	0.24217	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.886642	0.09726	N	0.763738	T	0.04724	0.0128	L	0.55017	1.72	0.09310	N	1	B	0.23937	0.094	B	0.26094	0.066	T	0.37454	-0.9705	10	0.56958	D	0.05	.	3.8616	0.08998	0.3053:0.0:0.6947:0.0	.	78	P05015	IFN16_HUMAN	F	78	ENSP00000369564:S78F	ENSP00000369564:S78F	S	-	2	0	IFNA16	21207072	0.000000	0.05858	0.016000	0.15963	0.035000	0.12851	-0.199000	0.09491	1.471000	0.48121	0.184000	0.17185	TCT	IFNA16	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta	ENSG00000147885		0.473	IFNA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA16	HGNC	protein_coding	OTTHUMT00000051892.1	100	0.00	0	G	NM_002173		21217072	21217072	-1	no_errors	ENST00000380216	ensembl	human	known	69_37n	missense	57	24.00	18	SNP	0.014	A
IGFALS	3483	genome.wustl.edu	37	16	1841614	1841614	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr16:1841614G>A	ENST00000215539.3	-	2	915	c.805C>T	c.(805-807)Cga>Tga	p.R269*	IGFALS_ENST00000415638.3_Nonsense_Mutation_p.R307*			P35858	ALS_HUMAN	insulin-like growth factor binding protein, acid labile subunit	269					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)			endometrium(2)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	8						TCCAGCCATCGCAGCGCCTTC	0.677																																						dbGAP											0													24.0	24.0	24.0					16																	1841614		2163	4262	6425	-	-	-	SO:0001587	stop_gained	0			M86826	CCDS10446.1, CCDS53982.1	16p13.3	2008-07-28			ENSG00000099769	ENSG00000099769			5468	protein-coding gene	gene with protein product		601489				1379671, 16114275	Standard	NM_004970		Approved	ALS	uc010uvn.2	P35858	OTTHUMG00000128638	ENST00000215539.3:c.805C>T	16.37:g.1841614G>A	ENSP00000215539:p.Arg269*		B4DZY8|E9PGU3	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.R307*	ENST00000215539.3	37	c.919	CCDS10446.1	16	.	.	.	.	.	.	.	.	.	.	G	16.60	3.169722	0.57584	.	.	ENSG00000099769	ENST00000215539;ENST00000415638	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	.	17.4172	0.87504	0.0:0.0:1.0:0.0	.	.	.	.	X	269;307	.	ENSP00000215539:R269X	R	-	1	2	IGFALS	1781615	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	2.624000	0.46444	2.462000	0.83206	0.561000	0.74099	CGA	IGFALS	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000099769		0.677	IGFALS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFALS	HGNC	protein_coding	OTTHUMT00000250509.2	51	0.00	0	G			1841614	1841614	-1	no_errors	ENST00000415638	ensembl	human	known	69_37n	nonsense	30	16.67	6	SNP	1.000	A
IL22RA2	116379	genome.wustl.edu	37	6	137476183	137476183	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr6:137476183C>A	ENST00000296980.2	-	5	667	c.367G>T	c.(367-369)Gaa>Taa	p.E123*	IL22RA2_ENST00000339602.3_Nonsense_Mutation_p.E91*|IL22RA2_ENST00000349184.4_Nonsense_Mutation_p.E91*	NM_052962.2	NP_443194.1	Q969J5	I22R2_HUMAN	interleukin 22 receptor, alpha 2	123	Fibronectin type-III 2.				cytokine-mediated signaling pathway (GO:0019221)|negative regulation of inflammatory response (GO:0050728)|regulation of tyrosine phosphorylation of Stat3 protein (GO:0042516)	cytosol (GO:0005829)|extracellular space (GO:0005615)	interleukin-22 binding (GO:0042017)|interleukin-22 receptor activity (GO:0042018)			endometrium(1)|large_intestine(1)|lung(3)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000313)|OV - Ovarian serous cystadenocarcinoma(155;0.00407)		TCTGAGGTTTCACTGGTAAGG	0.507																																						dbGAP											0													169.0	162.0	165.0					6																	137476183		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY044429	CCDS5182.1, CCDS5183.1, CCDS5184.1	6q24.1-q24.2	2008-02-05			ENSG00000164485	ENSG00000164485		"""Interleukins and interleukin receptors"""	14901	protein-coding gene	gene with protein product		606648				11481447, 11390454	Standard	NM_181309		Approved	CRF2-S1, IL-22BP	uc003qhl.3	Q969J5	OTTHUMG00000015655	ENST00000296980.2:c.367G>T	6.37:g.137476183C>A	ENSP00000296980:p.Glu123*		Q08AH7|Q6UWM1|Q96A41|Q96QR0	Nonsense_Mutation	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3	p.E123*	ENST00000296980.2	37	c.367	CCDS5182.1	6	.	.	.	.	.	.	.	.	.	.	C	38	7.278164	0.98182	.	.	ENSG00000164485	ENST00000349184;ENST00000296980;ENST00000339602	.	.	.	5.77	5.77	0.91146	.	0.055130	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	15.8531	0.78952	0.0:1.0:0.0:0.0	.	.	.	.	X	91;123;91	.	ENSP00000296980:E123X	E	-	1	0	IL22RA2	137517876	0.994000	0.37717	0.997000	0.53966	0.908000	0.53690	3.168000	0.50801	2.885000	0.99019	0.655000	0.94253	GAA	IL22RA2	-	superfamily_Fibronectin_type3	ENSG00000164485		0.507	IL22RA2-002	KNOWN	basic|CCDS	protein_coding	IL22RA2	HGNC	protein_coding	OTTHUMT00000042399.1	75	0.00	0	C			137476183	137476183	-1	no_errors	ENST00000296980	ensembl	human	known	69_37n	nonsense	62	10.14	7	SNP	1.000	A
IQSEC3	440073	genome.wustl.edu	37	12	275032	275032	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr12:275032G>A	ENST00000538872.1	+	11	3065	c.2947G>A	c.(2947-2949)Gag>Aag	p.E983K	IQSEC3_ENST00000326261.4_Missense_Mutation_p.E983K|IQSEC3_ENST00000382841.2_Missense_Mutation_p.E680K|RP11-598F7.5_ENST00000540136.1_RNA|RP11-598F7.6_ENST00000537295.1_lincRNA			Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	983	PH.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		TGAGGTGACGGAGCTGGAGCA	0.592																																						dbGAP											0													83.0	76.0	79.0					12																	275032		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB029033	CCDS31725.1, CCDS53728.1	12p13.33	2014-03-18			ENSG00000120645	ENSG00000120645			29193	protein-coding gene	gene with protein product		612118				10470851	Standard	NM_001170738		Approved	KIAA1110, MGC30156	uc001qhw.2	Q9UPP2	OTTHUMG00000167975	ENST00000538872.1:c.2947G>A	12.37:g.275032G>A	ENSP00000437554:p.Glu983Lys		A6NIF2|A6NKV9|Q8TB43	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.E983K	ENST00000538872.1	37	c.2947	CCDS53728.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.030124	0.97216	.	.	ENSG00000120645	ENST00000538872;ENST00000326261;ENST00000382841	T;T;T	0.49432	0.78;0.78;0.78	5.39	5.39	0.77823	.	0.158984	0.56097	D	0.000035	T	0.69708	0.3141	M	0.73598	2.24	0.80722	D	1	D;D	0.71674	0.998;0.989	D;D	0.69142	0.962;0.944	T	0.71764	-0.4494	10	0.62326	D	0.03	.	19.5308	0.95228	0.0:0.0:1.0:0.0	.	983;680	Q9UPP2;Q9UPP2-2	IQEC3_HUMAN;.	K	983;983;680	ENSP00000437554:E983K;ENSP00000315662:E983K;ENSP00000372292:E680K	ENSP00000315662:E983K	E	+	1	0	IQSEC3	145293	1.000000	0.71417	0.980000	0.43619	0.957000	0.61999	9.805000	0.99149	2.684000	0.91462	0.650000	0.86243	GAG	IQSEC3	-	NULL	ENSG00000120645		0.592	IQSEC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IQSEC3	HGNC	protein_coding	OTTHUMT00000397382.3	66	0.00	0	G	XM_495902		275032	275032	+1	no_errors	ENST00000326261	ensembl	human	known	69_37n	missense	54	12.90	8	SNP	1.000	A
KHDRBS1	10657	genome.wustl.edu	37	1	32495999	32495999	+	Silent	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr1:32495999G>A	ENST00000327300.7	+	2	650	c.483G>A	c.(481-483)ctG>ctA	p.L161L	KHDRBS1_ENST00000492989.1_Silent_p.L161L|KHDRBS1_ENST00000307714.8_3'UTR	NM_006559.1	NP_006550.1			KH domain containing, RNA binding, signal transduction associated 1											endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				AGCGAGTGCTGATACCTGTCA	0.363																																					Ovarian(173;401 1982 12359 31110 42403)	dbGAP											0													75.0	72.0	73.0					1																	32495999		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U78971	CCDS350.1, CCDS60067.1	1p32	2008-07-18			ENSG00000121774	ENSG00000121774			18116	protein-coding gene	gene with protein product	"""GAP-associated tyrosine phosphoprotein p62 (Sam68)"""	602489				1374686, 10564820	Standard	NM_006559		Approved	Sam68, p62, FLJ34027	uc001bub.4	Q07666	OTTHUMG00000003921	ENST00000327300.7:c.483G>A	1.37:g.32495999G>A				Silent	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.L161	ENST00000327300.7	37	c.483	CCDS350.1	1																																																																																			KHDRBS1	-	pfam_KH_dom_type_1,smart_KH_dom	ENSG00000121774		0.363	KHDRBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS1	HGNC	protein_coding	OTTHUMT00000011199.4	56	0.00	0	G	NM_006559		32495999	32495999	+1	no_errors	ENST00000327300	ensembl	human	known	69_37n	silent	43	12.24	6	SNP	1.000	A
SPIDR	23514	genome.wustl.edu	37	8	48586495	48586495	+	Silent	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr8:48586495C>G	ENST00000297423.4	+	11	2061	c.1677C>G	c.(1675-1677)acC>acG	p.T559T	SPIDR_ENST00000518074.1_Silent_p.T499T|SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000541342.1_Silent_p.T489T|SPIDR_ENST00000517693.1_Silent_p.T34T	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	559					cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											AGAAAGTCACCAGAGGAAGGT	0.413																																						dbGAP											0													88.0	89.0	89.0					8																	48586495		1935	4128	6063	-	-	-	SO:0001819	synonymous_variant	0			AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.1677C>G	8.37:g.48586495C>G			B4DFV2|B4E0Y6|Q96BI5	Missense_Mutation	SNP	NULL	p.P241R	ENST00000297423.4	37	c.722	CCDS43737.1	8	.	.	.	.	.	.	.	.	.	.	C	7.981	0.751120	0.15778	.	.	ENSG00000164808	ENST00000519401	.	.	.	5.34	1.22	0.21188	.	.	.	.	.	T	0.53690	0.1812	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40117	-0.9580	4	.	.	.	.	6.387	0.21566	0.4664:0.4472:0.0:0.0863	.	.	.	.	R	241	.	.	P	+	2	0	KIAA0146	48749048	0.227000	0.23707	0.993000	0.49108	0.803000	0.45373	-1.057000	0.03486	-0.063000	0.13065	0.591000	0.81541	CCA	KIAA0146	-	NULL	ENSG00000164808		0.413	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0146	HGNC	protein_coding	OTTHUMT00000377611.1	45	0.00	0	C	NM_001080394		48586495	48586495	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000519401	ensembl	human	putative	69_37n	missense	28	20.00	7	SNP	0.999	G
KIF4A	24137	genome.wustl.edu	37	X	69623811	69623811	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chrX:69623811G>A	ENST00000374403.3	+	24	2799	c.2717G>A	c.(2716-2718)cGa>cAa	p.R906Q	KIF4A_ENST00000374388.3_Missense_Mutation_p.R906Q	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	906	Interaction with PRC1.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						TTTGAGGAACGAAATCATTTT	0.463																																						dbGAP											0													103.0	84.0	90.0					X																	69623811		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.2717G>A	X.37:g.69623811G>A	ENSP00000363524:p.Arg906Gln		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R906Q	ENST00000374403.3	37	c.2717	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	G	11.69	1.714507	0.30413	.	.	ENSG00000090889	ENST00000374388;ENST00000374403;ENST00000544650	T;T	0.69040	-0.37;-0.31	4.73	2.88	0.33553	.	0.158302	0.29814	N	0.011137	T	0.46132	0.1377	N	0.20401	0.57	0.44067	D	0.996815	B	0.12013	0.005	B	0.09377	0.004	T	0.24621	-1.0155	9	.	.	.	.	9.2237	0.37393	0.1882:0.0:0.8118:0.0	.	906	O95239	KIF4A_HUMAN	Q	906;906;208	ENSP00000363509:R906Q;ENSP00000363524:R906Q	.	R	+	2	0	KIF4A	69540536	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	2.071000	0.41500	0.958000	0.37956	0.594000	0.82650	CGA	KIF4A	-	NULL	ENSG00000090889		0.463	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	64	0.00	0	G	NM_012310		69623811	69623811	+1	no_errors	ENST00000374403	ensembl	human	known	69_37n	missense	52	16.13	10	SNP	0.997	A
LEKR1	389170	genome.wustl.edu	37	3	156763253	156763253	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr3:156763253C>T	ENST00000470811.1	+	14	2216	c.881C>T	c.(880-882)tCa>tTa	p.S294L	LEKR1_ENST00000356539.4_Missense_Mutation_p.S598L			Q6ZMV7	LEKR1_HUMAN	leucine, glutamate and lysine rich 1	294										breast(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	11			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TTACCATTCTCACCGTGTTCC	0.498																																						dbGAP											0													93.0	93.0	93.0					3																	156763253		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK131473	CCDS54660.1	3q25.31	2014-02-12	2008-02-21		ENSG00000197980	ENSG00000197980			33765	protein-coding gene	gene with protein product		613536					Standard	NM_001004316		Approved	FLJ16641	uc021xgh.1	Q6ZMV7	OTTHUMG00000160130	ENST00000470811.1:c.881C>T	3.37:g.156763253C>T	ENSP00000418214:p.Ser294Leu			Missense_Mutation	SNP	superfamily_Ribosomal_L29	p.S598L	ENST00000470811.1	37	c.1793		3	.	.	.	.	.	.	.	.	.	.	C	12.56	1.975255	0.34848	.	.	ENSG00000178110	ENST00000470811;ENST00000356539	T;T	0.57752	0.42;0.38	4.57	4.57	0.56435	.	0.287837	0.25081	N	0.033300	T	0.61590	0.2359	M	0.64997	1.995	0.09310	N	0.999995	D	0.53312	0.959	P	0.51615	0.675	T	0.57619	-0.7780	10	0.39692	T	0.17	-0.1304	16.9609	0.86272	0.0:1.0:0.0:0.0	.	294	Q6ZMV7	LEKR1_HUMAN	L	294;598	ENSP00000418214:S294L;ENSP00000348936:S598L	ENSP00000348936:S598L	S	+	2	0	LEKR1	158245947	0.963000	0.33076	0.020000	0.16555	0.350000	0.29205	5.213000	0.65230	2.077000	0.62373	0.655000	0.94253	TCA	LEKR1	-	NULL	ENSG00000178110		0.498	LEKR1-010	KNOWN	upstream_ATG|basic	protein_coding	LEKR1	HGNC	protein_coding	OTTHUMT00000351625.3	50	0.00	0	C	NM_001004316		156763253	156763253	+1	no_errors	ENST00000356539	ensembl	human	known	69_37n	missense	38	11.63	5	SNP	0.291	T
LIG1	3978	genome.wustl.edu	37	19	48640791	48640791	+	Silent	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr19:48640791G>A	ENST00000263274.7	-	13	1661	c.1242C>T	c.(1240-1242)ctC>ctT	p.L414L	LIG1_ENST00000427526.2_Silent_p.L383L|LIG1_ENST00000536218.1_Silent_p.L346L	NM_000234.1	NP_000225.1	P18858	DNLI1_HUMAN	ligase I, DNA, ATP-dependent	414					anatomical structure morphogenesis (GO:0009653)|base-excision repair (GO:0006284)|cell division (GO:0051301)|DNA biosynthetic process (GO:0071897)|DNA ligation involved in DNA repair (GO:0051103)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to hydrogen peroxide (GO:0042542)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(22)|prostate(2)|skin(1)	44		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	CACTGCCAGTGAGCCTGGCGA	0.657								Nucleotide excision repair (NER)																														dbGAP											0													44.0	42.0	42.0					19																	48640791		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS12711.1, CCDS74409.1, CCDS74410.1	19q13.2-q13.3	2014-09-17				ENSG00000105486	6.5.1.1		6598	protein-coding gene	gene with protein product		126391					Standard	XM_005258934		Approved		uc002pia.1	P18858		ENST00000263274.7:c.1242C>T	19.37:g.48640791G>A			B2RAI8|Q2TB12|Q32P23	Missense_Mutation	SNP	pfam_DNA_ligase_ATP-dep_N,superfamily_DNA_ligase_ATP-dep_N	p.S406L	ENST00000263274.7	37	c.1217	CCDS12711.1	19	.	.	.	.	.	.	.	.	.	.	G	16.69	3.193019	0.58017	.	.	ENSG00000105486	ENST00000542460	T	0.10860	2.83	5.06	-1.7	0.08159	.	.	.	.	.	T	0.10895	0.0266	.	.	.	0.24906	N	0.992072	.	.	.	.	.	.	T	0.38415	-0.9662	5	.	.	.	-22.8653	12.61	0.56546	0.0822:0.6693:0.2484:0.0	.	.	.	.	L	406	ENSP00000445928:S406L	.	S	-	2	0	LIG1	53332603	1.000000	0.71417	0.182000	0.23118	0.840000	0.47671	1.374000	0.34283	-0.004000	0.14419	0.655000	0.94253	TCA	LIG1	-	NULL	ENSG00000105486		0.657	LIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG1	HGNC	protein_coding	OTTHUMT00000465575.1	33	0.00	0	G	NM_000234		48640791	48640791	-1	no_errors	ENST00000542460	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	0.838	A
MAMDC2	256691	genome.wustl.edu	37	9	72746489	72746489	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr9:72746489G>A	ENST00000377182.4	+	7	1572	c.955G>A	c.(955-957)Gat>Aat	p.D319N	MAMDC2-AS1_ENST00000591368.1_RNA	NM_153267.4	NP_694999.3	Q7Z304	MAMC2_HUMAN	MAM domain containing 2	319	MAM 2. {ECO:0000255|PROSITE- ProRule:PRU00128}.				peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)	endoplasmic reticulum (GO:0005783)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	glycosaminoglycan binding (GO:0005539)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	14						TGCCCTGGATGATATTTCATT	0.413																																						dbGAP											0													288.0	249.0	262.0					9																	72746489		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC040299	CCDS6631.1	9q21.2	2008-02-05			ENSG00000165072	ENSG00000165072			23673	protein-coding gene	gene with protein product		612879					Standard	NM_153267		Approved	MGC21981	uc004ahm.2	Q7Z304	OTTHUMG00000019990	ENST00000377182.4:c.955G>A	9.37:g.72746489G>A	ENSP00000366387:p.Asp319Asn		Q5VW47|Q8WX43|Q96BM4	Missense_Mutation	SNP	pfam_MAM_dom,superfamily_ConA-like_lec_gl,smart_MAM_dom,prints_MAM_dom,pfscan_MAM_dom	p.D319N	ENST00000377182.4	37	c.955	CCDS6631.1	9	.	.	.	.	.	.	.	.	.	.	G	32	5.119959	0.94385	.	.	ENSG00000165072	ENST00000377182	T	0.03553	3.89	5.36	5.36	0.76844	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.000000	0.85682	D	0.000000	T	0.22360	0.0539	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00647	-1.1628	10	0.72032	D	0.01	-19.1919	19.1265	0.93386	0.0:0.0:1.0:0.0	.	319	Q7Z304	MAMC2_HUMAN	N	319	ENSP00000366387:D319N	ENSP00000366387:D319N	D	+	1	0	MAMDC2	71936309	1.000000	0.71417	1.000000	0.80357	0.727000	0.41649	9.230000	0.95299	2.523000	0.85059	0.655000	0.94253	GAT	MAMDC2	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl,smart_MAM_dom,pfscan_MAM_dom	ENSG00000165072		0.413	MAMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAMDC2	HGNC	protein_coding	OTTHUMT00000052600.1	180	0.00	0	G	NM_153267		72746489	72746489	+1	no_errors	ENST00000377182	ensembl	human	known	69_37n	missense	99	10.71	12	SNP	1.000	A
MATN2	4147	genome.wustl.edu	37	8	99006790	99006790	+	Silent	SNP	G	G	C			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr8:99006790G>C	ENST00000520016.1	+	6	1288	c.1164G>C	c.(1162-1164)ctG>ctC	p.L388L	MATN2_ENST00000254898.5_Silent_p.L388L|MATN2_ENST00000521689.1_Silent_p.L388L|MATN2_ENST00000524308.1_Intron|MATN2_ENST00000522025.2_Silent_p.L104L			O00339	MATN2_HUMAN	matrilin 2	388	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			GCCACTGCCTGAAAGGCTTTA	0.438																																						dbGAP											0													124.0	121.0	122.0					8																	99006790		1917	4122	6039	-	-	-	SO:0001819	synonymous_variant	0			U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.1164G>C	8.37:g.99006790G>C			A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Missense_Mutation	SNP	pfam_VWF_A,pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_Matrilin_coiled-coil_trimer,smart_EGF-like,smart_EGF-like_Ca-bd,smart_VWF_A,pfscan_EG-like_dom,pfscan_VWF_A	p.E171Q	ENST00000520016.1	37	c.511	CCDS55264.1	8	.	.	.	.	.	.	.	.	.	.	G	8.706	0.910904	0.17833	.	.	ENSG00000132561	ENST00000518154;ENST00000521041	.	.	.	5.73	1.59	0.23543	.	.	.	.	.	T	0.54951	0.1890	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42699	-0.9436	4	.	.	.	-14.0447	7.6645	0.28423	0.1015:0.115:0.7834:0.0	.	.	.	.	Q	171;143	.	.	E	+	1	0	MATN2	99075966	0.994000	0.37717	0.998000	0.56505	0.917000	0.54804	0.134000	0.15932	-0.003000	0.14444	0.467000	0.42956	GAA	MATN2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000132561		0.438	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	MATN2	HGNC	protein_coding	OTTHUMT00000380332.1	71	0.00	0	G			99006790	99006790	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000518154	ensembl	human	novel	69_37n	missense	51	17.74	11	SNP	1.000	C
MCCC2	64087	genome.wustl.edu	37	5	70930839	70930839	+	Silent	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr5:70930839G>A	ENST00000340941.6	+	9	1002	c.873G>A	c.(871-873)gtG>gtA	p.V291V	MCCC2_ENST00000510895.2_3'UTR|MCCC2_ENST00000323375.8_Silent_p.V253V|MCCC2_ENST00000509358.2_Silent_p.V291V	NM_022132.4	NP_071415.1	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-CoA carboxylase 2 (beta)	291	Carboxyltransferase.				biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|coenzyme A metabolic process (GO:0015936)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			endometrium(2)|kidney(15)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	30		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	GGAAGGTTGTGAGGAATCTAA	0.363																																						dbGAP											0													122.0	118.0	119.0					5																	70930839		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF310971	CCDS34184.1	5q12-q13	2010-04-30	2010-04-30		ENSG00000131844	ENSG00000131844	6.4.1.4		6937	protein-coding gene	gene with protein product		609014	"""methylcrotonoyl-Coenzyme A carboxylase 2 (beta)"""				Standard	NM_022132		Approved	MCCB	uc003kbs.4	Q9HCC0	OTTHUMG00000162505	ENST00000340941.6:c.873G>A	5.37:g.70930839G>A			A6NIY9|Q96C27|Q9Y4L7	Silent	SNP	pfam_Carboxyl_trans,pfscan_COA_CT_N,pfscan_COA_CT_C	p.V291	ENST00000340941.6	37	c.873	CCDS34184.1	5																																																																																			MCCC2	-	pfam_Carboxyl_trans,pfscan_COA_CT_C	ENSG00000131844		0.363	MCCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCCC2	HGNC	protein_coding	OTTHUMT00000369243.4	115	0.00	0	G			70930839	70930839	+1	no_errors	ENST00000340941	ensembl	human	known	69_37n	silent	78	12.36	11	SNP	1.000	A
MIA3	375056	genome.wustl.edu	37	1	222827736	222827736	+	Silent	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr1:222827736G>A	ENST00000344922.5	+	17	4408	c.4383G>A	c.(4381-4383)caG>caA	p.Q1461Q	MIA3_ENST00000344441.6_Silent_p.Q1461Q|MIA3_ENST00000344507.1_Intron|MIA3_ENST00000340535.7_Silent_p.Q339Q	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1461					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		TTTAGACACAGACTGCAATAT	0.393																																						dbGAP											0													164.0	146.0	151.0					1																	222827736		1849	4097	5946	-	-	-	SO:0001819	synonymous_variant	0				CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.4383G>A	1.37:g.222827736G>A			A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	NULL	p.D985N	ENST00000344922.5	37	c.2953	CCDS41470.1	1	.	.	.	.	.	.	.	.	.	.	G	7.386	0.629768	0.14257	.	.	ENSG00000154305	ENST00000354906	.	.	.	5.79	-2.65	0.06095	.	.	.	.	.	T	0.50000	0.1590	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40850	-0.9541	4	.	.	.	.	6.2549	0.20867	0.5409:0.0:0.3469:0.1121	.	.	.	.	N	985	.	.	D	+	1	0	MIA3	220894359	0.998000	0.40836	0.927000	0.36925	0.880000	0.50808	0.520000	0.22878	-0.783000	0.04534	-0.302000	0.09304	GAC	MIA3	-	NULL	ENSG00000154305		0.393	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MIA3	HGNC	protein_coding	OTTHUMT00000091489.4	150	0.00	0	G	NM_198551		222827736	222827736	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000354906	ensembl	human	known	69_37n	missense	105	11.67	14	SNP	0.989	A
MLH3	27030	genome.wustl.edu	37	14	75515438	75515438	+	Silent	SNP	T	T	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr14:75515438T>G	ENST00000556740.1	-	1	956	c.921A>C	c.(919-921)gtA>gtC	p.V307V	MLH3_ENST00000355774.2_Silent_p.V307V|MLH3_ENST00000555671.1_5'Flank|MLH3_ENST00000380968.2_5'UTR|MLH3_ENST00000238662.7_Silent_p.V307V|MLH3_ENST00000556257.1_Silent_p.V307V|MLH3_ENST00000544985.1_5'Flank			Q9UHC1	MLH3_HUMAN	mutL homolog 3	307					ATP catabolic process (GO:0006200)|female meiosis I (GO:0007144)|male meiosis (GO:0007140)|mismatch repair (GO:0006298)|protein localization (GO:0008104)|reciprocal meiotic recombination (GO:0007131)|synaptonemal complex assembly (GO:0007130)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|mismatch repair complex (GO:0032300)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|mismatched DNA binding (GO:0030983)|satellite DNA binding (GO:0003696)|single-stranded DNA binding (GO:0003697)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	44				BRCA - Breast invasive adenocarcinoma(234;0.00688)		GCACATTAATTACATATATGC	0.423								Mismatch excision repair (MMR)																														dbGAP											0													94.0	100.0	98.0					14																	75515438		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF195657	CCDS9837.1, CCDS32123.1	14q24.3	2014-09-17	2013-09-12			ENSG00000119684			7128	protein-coding gene	gene with protein product		604395	"""mutL (E. coli) homolog 3"", ""mutL homolog 3 (E. coli)"""			10615123	Standard	XR_245681		Approved		uc001xrd.1	Q9UHC1		ENST00000556740.1:c.921A>C	14.37:g.75515438T>G			P49751|Q56DK9|Q9P292|Q9UHC0	Silent	SNP	pfam_MutL_C,pfam_DNA_mismatch_repair_C,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_WW_Rsp5_WWP,smart_MutL_C	p.V307	ENST00000556740.1	37	c.921	CCDS32123.1	14																																																																																			MLH3	-	pfam_DNA_mismatch_repair_C,superfamily_Ribosomal_S5_D2-typ_fold	ENSG00000119684		0.423	MLH3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MLH3	HGNC	protein_coding	OTTHUMT00000415006.1	36	0.00	0	T	NM_014381		75515438	75515438	-1	no_errors	ENST00000355774	ensembl	human	known	69_37n	silent	38	11.63	5	SNP	0.008	G
MURC	347273	genome.wustl.edu	37	9	103348411	103348411	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr9:103348411C>G	ENST00000307584.5	+	2	838	c.773C>G	c.(772-774)tCt>tGt	p.S258C		NM_001018116.1	NP_001018126.1	Q5BKX8	MURC_HUMAN	muscle-related coiled-coil protein	258					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Z disc (GO:0030018)				endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)	16		Acute lymphoblastic leukemia(62;0.0461)				TTTAAGAAATCTATTTCTAAT	0.527																																						dbGAP											0													92.0	100.0	98.0					9																	103348411		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC090888	CCDS35083.1	9q31.1	2014-09-17			ENSG00000170681	ENSG00000170681			33742	protein-coding gene	gene with protein product	"""muscle-restricted coiled-coil protein"""					18508909, 18332105	Standard	NM_001018116		Approved	cavin-4, CAVIN4	uc004bba.3	Q5BKX8	OTTHUMG00000020368	ENST00000307584.5:c.773C>G	9.37:g.103348411C>G	ENSP00000418668:p.Ser258Cys		B1PRL3|B4DT88	Missense_Mutation	SNP	NULL	p.S258C	ENST00000307584.5	37	c.773	CCDS35083.1	9	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026822	0.54683	.	.	ENSG00000170681	ENST00000307584	T	0.62941	-0.01	5.44	5.44	0.79542	.	0.176432	0.49305	D	0.000141	T	0.72431	0.3459	L	0.44542	1.39	0.37327	D	0.909812	D	0.76494	0.999	D	0.65874	0.939	T	0.77046	-0.2733	10	0.72032	D	0.01	-6.4183	17.1085	0.86669	0.0:1.0:0.0:0.0	.	258	Q5BKX8	MURC_HUMAN	C	258	ENSP00000418668:S258C	ENSP00000418668:S258C	S	+	2	0	MURC	102388232	0.804000	0.28969	0.988000	0.46212	0.441000	0.31987	1.567000	0.36407	2.715000	0.92844	0.561000	0.74099	TCT	MURC	-	NULL	ENSG00000170681		0.527	MURC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MURC	HGNC	protein_coding	OTTHUMT00000053419.2	41	0.00	0	C	NM_001018116		103348411	103348411	+1	no_errors	ENST00000307584	ensembl	human	known	69_37n	missense	36	14.29	6	SNP	0.998	G
MYCBP2	23077	genome.wustl.edu	37	13	77667317	77667317	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr13:77667317C>T	ENST00000544440.2	-	59	10253	c.10236G>A	c.(10234-10236)atG>atA	p.M3412I	MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2_ENST00000357337.6_Missense_Mutation_p.M3412I|MYCBP2_ENST00000407578.2_Missense_Mutation_p.M3450I					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GCATAGACTTCATATTGCTCT	0.393																																						dbGAP											0													170.0	163.0	165.0					13																	77667317		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.10236G>A	13.37:g.77667317C>T	ENSP00000444596:p.Met3412Ile			Missense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,prints_Reg_chr_condens,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens	p.M3450I	ENST00000544440.2	37	c.10350		13	.	.	.	.	.	.	.	.	.	.	C	14.31	2.497127	0.44352	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.26810	1.71;1.71;1.71	5.49	5.49	0.81192	.	0.047560	0.85682	D	0.000000	T	0.17789	0.0427	N	0.22421	0.69	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.08743	-1.0707	10	0.02654	T	1	.	19.3726	0.94495	0.0:1.0:0.0:0.0	.	3412	O75592	MYCB2_HUMAN	I	3412;3450;3412	ENSP00000349892:M3412I;ENSP00000384288:M3450I;ENSP00000444596:M3412I	ENSP00000349892:M3412I	M	-	3	0	MYCBP2	76565318	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.485000	0.81204	2.561000	0.86390	0.557000	0.71058	ATG	MYCBP2	-	superfamily_ARM-type_fold	ENSG00000005810		0.393	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	97	0.00	0	C	NM_015057		77667317	77667317	-1	no_errors	ENST00000407578	ensembl	human	known	69_37n	missense	46	13.21	7	SNP	1.000	T
MYH11	4629	genome.wustl.edu	37	16	15931974	15931974	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr16:15931974C>G	ENST00000300036.5	-	2	245	c.136G>C	c.(136-138)Gag>Cag	p.E46Q	MYH11_ENST00000576790.2_Missense_Mutation_p.E46Q|MYH11_ENST00000452625.2_Missense_Mutation_p.E46Q|MYH11_ENST00000396324.3_Missense_Mutation_p.E46Q	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	46					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CTGGCTGCCTCGAAGCCCTGC	0.562			T	CBFB	AML																																	dbGAP		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0													175.0	164.0	167.0					16																	15931974		2197	4300	6497	-	-	-	SO:0001583	missense	0			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.136G>C	16.37:g.15931974C>G	ENSP00000300036:p.Glu46Gln		D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E46Q	ENST00000300036.5	37	c.136	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911778	0.72983	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58	5.95	4.99	0.66335	Myosin, N-terminal, SH3-like (1);	0.000000	0.85682	D	0.000000	D	0.88284	0.6395	M	0.67397	2.05	0.80722	D	1	P;P;P;P;P	0.48911	0.489;0.917;0.917;0.917;0.917	B;P;P;P;P	0.55824	0.131;0.727;0.727;0.727;0.785	D	0.89364	0.3670	10	0.66056	D	0.02	.	16.2694	0.82607	0.0:0.8673:0.1327:0.0	.	46;46;46;46;46	Q4G140;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	Q	46	ENSP00000300036:E46Q;ENSP00000345136:E46Q;ENSP00000379616:E46Q;ENSP00000407821:E46Q	ENSP00000300036:E46Q	E	-	1	0	MYH11	15839475	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	5.867000	0.69597	1.509000	0.48786	-0.175000	0.13238	GAG	MYH11	-	pfam_Myosin_N	ENSG00000133392		0.562	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	136	0.00	0	C	NM_001040113		15931974	15931974	-1	no_errors	ENST00000396324	ensembl	human	known	69_37n	missense	130	10.34	15	SNP	1.000	G
MYH4	4622	genome.wustl.edu	37	17	10358364	10358364	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr17:10358364G>C	ENST00000255381.2	-	21	2439	c.2329C>G	c.(2329-2331)Cta>Gta	p.L777V	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	777	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						ATTTCCTCTAGAGTTCCCAGC	0.408																																						dbGAP											0													229.0	128.0	162.0					17																	10358364		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.2329C>G	17.37:g.10358364G>C	ENSP00000255381:p.Leu777Val			Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L777V	ENST00000255381.2	37	c.2329	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	G	20.2	3.948074	0.73787	.	.	ENSG00000141048	ENST00000255381	T	0.76578	-1.03	5.04	4.05	0.47172	Myosin head, motor domain (1);	0.000000	0.29730	U	0.011346	D	0.91603	0.7347	H	0.98996	4.395	0.54753	D	0.999986	D	0.63046	0.992	P	0.60117	0.869	D	0.94489	0.7700	10	0.87932	D	0	.	14.3336	0.66574	0.0759:0.0:0.9241:0.0	.	777	Q9Y623	MYH4_HUMAN	V	777	ENSP00000255381:L777V	ENSP00000255381:L777V	L	-	1	2	MYH4	10299089	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.795000	0.85887	2.497000	0.84241	0.313000	0.20887	CTA	MYH4	-	smart_Myosin_head_motor_dom	ENSG00000264424		0.408	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	HGNC	protein_coding	OTTHUMT00000252731.1	53	0.00	0	G	NM_017533		10358364	10358364	-1	no_errors	ENST00000255381	ensembl	human	known	69_37n	missense	49	14.04	8	SNP	1.000	C
MYO5B	4645	genome.wustl.edu	37	18	47563360	47563360	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr18:47563360G>C	ENST00000285039.7	-	4	614	c.315C>G	c.(313-315)atC>atG	p.I105M		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	105	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		CAACAAGTACGATACCTGCAA	0.458																																						dbGAP											0													109.0	101.0	104.0					18																	47563360		2026	4185	6211	-	-	-	SO:0001583	missense	0			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.315C>G	18.37:g.47563360G>C	ENSP00000285039:p.Ile105Met		B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.I105M	ENST00000285039.7	37	c.315	CCDS42436.1	18	.	.	.	.	.	.	.	.	.	.	G	17.74	3.464765	0.63513	.	.	ENSG00000167306	ENST00000285039;ENST00000356732	D	0.87491	-2.26	5.52	-11.0	0.00169	Myosin head, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.93288	0.7861	H	0.95187	3.635	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.974	D	0.96115	0.9080	10	0.62326	D	0.03	.	16.0409	0.80680	0.5087:0.0:0.4913:0.0	.	104;105	Q7Z7A5;Q9ULV0	.;MYO5B_HUMAN	M	105;104	ENSP00000285039:I105M	ENSP00000285039:I105M	I	-	3	3	MYO5B	45817358	0.000000	0.05858	0.441000	0.26858	0.899000	0.52679	-1.193000	0.03049	-2.347000	0.00620	-1.731000	0.00696	ATC	MYO5B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000167306		0.458	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	HGNC	protein_coding	OTTHUMT00000448515.2	81	0.00	0	G			47563360	47563360	-1	no_errors	ENST00000285039	ensembl	human	known	69_37n	missense	49	10.91	6	SNP	0.925	C
MYO6	4646	genome.wustl.edu	37	6	76566933	76566933	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr6:76566933C>T	ENST00000369977.3	+	13	1482	c.1343C>T	c.(1342-1344)tCa>tTa	p.S448L	MYO6_ENST00000369975.1_Missense_Mutation_p.S448L|MYO6_ENST00000369985.4_Missense_Mutation_p.S448L|MYO6_ENST00000369981.3_Missense_Mutation_p.S448L	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	448	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		TTTGAAACATCATCCTATTTT	0.338																																						dbGAP											0													202.0	186.0	192.0					6																	76566933		2203	4300	6503	-	-	-	SO:0001583	missense	0			U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.1343C>T	6.37:g.76566933C>T	ENSP00000358994:p.Ser448Leu		A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.S448L	ENST00000369977.3	37	c.1343	CCDS34487.1	6	.	.	.	.	.	.	.	.	.	.	C	33	5.290623	0.95546	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.93854	0.8034	M	0.85945	2.785	0.80722	D	1	D;D	0.89917	1.0;0.995	D;D	0.72338	0.964;0.977	D	0.93860	0.7153	10	0.72032	D	0.01	.	19.9764	0.97312	0.0:1.0:0.0:0.0	.	448;448	Q9UM54-2;Q9UM54-1	.;.	L	448	ENSP00000358998:S448L;ENSP00000359002:S448L;ENSP00000358994:S448L;ENSP00000358992:S448L	ENSP00000358992:S448L	S	+	2	0	MYO6	76623653	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	7.487000	0.81328	2.727000	0.93392	0.585000	0.79938	TCA	MYO6	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000196586		0.338	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO6	HGNC	protein_coding	OTTHUMT00000041279.2	151	0.00	0	C	NM_004999		76566933	76566933	+1	no_errors	ENST00000369981	ensembl	human	known	69_37n	missense	121	12.95	18	SNP	1.000	T
NEB	4703	genome.wustl.edu	37	2	152474912	152474912	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr2:152474912C>G	ENST00000172853.10	-	70	10371	c.10224G>C	c.(10222-10224)aaG>aaC	p.K3408N	NEB_ENST00000397345.3_Missense_Mutation_p.K3651N|NEB_ENST00000604864.1_Missense_Mutation_p.K3651N|NEB_ENST00000603639.1_Missense_Mutation_p.K3651N|NEB_ENST00000409198.1_Missense_Mutation_p.K3408N|NEB_ENST00000427231.2_Missense_Mutation_p.K3651N			P20929	NEBU_HUMAN	nebulin	3408					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CTCCAGCTCTCTTGGCCCTAA	0.443																																						dbGAP											0													121.0	116.0	118.0					2																	152474912		1917	4135	6052	-	-	-	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.10224G>C	2.37:g.152474912C>G	ENSP00000172853:p.Lys3408Asn		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.K3651N	ENST00000172853.10	37	c.10953		2	.	.	.	.	.	.	.	.	.	.	C	19.30	3.801809	0.70682	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.13420	2.59;2.77;2.7;2.61	5.68	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.45115	0.1326	M	0.90198	3.095	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.57266	-0.7841	10	0.72032	D	0.01	.	15.0353	0.71741	0.0:0.9318:0.0:0.0682	.	3408	P20929	NEBU_HUMAN	N	3408;3651;3651;3408	ENSP00000386259:K3408N;ENSP00000380505:K3651N;ENSP00000416578:K3651N;ENSP00000172853:K3408N	ENSP00000172853:K3408N	K	-	3	2	NEB	152183158	0.978000	0.34361	1.000000	0.80357	0.446000	0.32137	0.699000	0.25586	1.545000	0.49373	0.650000	0.86243	AAG	NEB	-	smart_Nebulin_35r-motif	ENSG00000183091		0.443	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		80	0.00	0	C	NM_004543		152474912	152474912	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	missense	48	21.31	13	SNP	1.000	G
NRL	4901	genome.wustl.edu	37	14	24551994	24551994	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr14:24551994C>G	ENST00000561028.1	-	2	383	c.64G>C	c.(64-66)Gag>Cag	p.E22Q	NRL_ENST00000560550.1_5'Flank|NRL_ENST00000396997.1_Missense_Mutation_p.E22Q|NRL_ENST00000396995.1_5'Flank|NRL_ENST00000397002.2_Missense_Mutation_p.E22Q			P54845	NRL_HUMAN	neural retina leucine zipper	22					positive regulation of rhodopsin gene expression (GO:0045872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of rhodopsin gene expression (GO:0007468)|response to stimulus (GO:0050896)|retinal rod cell development (GO:0046548)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(2)	2				GBM - Glioblastoma multiforme(265;0.0181)		CGCTTTACCTCAAACTTCATC	0.592																																						dbGAP											0													45.0	46.0	46.0					14																	24551994		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9608.1	14q11.1-q11.2	2013-01-08			ENSG00000129535	ENSG00000129535			8002	protein-coding gene	gene with protein product		162080				1427865, 10192380	Standard	NM_006177		Approved	D14S46E, RP27, NRL-MAF	uc021rrk.1	P54845	OTTHUMG00000028789	ENST00000561028.1:c.64G>C	14.37:g.24551994C>G	ENSP00000454062:p.Glu22Gln		A8MX14|Q53XD0	Missense_Mutation	SNP	pfam_bZIP_Maf,pfam_Maf_TF_N,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.E22Q	ENST00000561028.1	37	c.64	CCDS9608.1	14	.	.	.	.	.	.	.	.	.	.	C	31	5.077116	0.94000	.	.	ENSG00000129535	ENST00000397002;ENST00000396997	D;D	0.98419	-4.92;-4.92	5.18	5.18	0.71444	.	0.000000	0.64402	D	0.000002	D	0.98425	0.9476	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	D	0.66084	0.941	D	0.98274	1.0505	10	0.41790	T	0.15	-27.4852	16.2468	0.82449	0.0:1.0:0.0:0.0	.	22	P54845	NRL_HUMAN	Q	22	ENSP00000380197:E22Q;ENSP00000380193:E22Q	ENSP00000337023:E22Q	E	-	1	0	NRL	23621834	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.651000	0.83577	2.694000	0.91930	0.655000	0.94253	GAG	NRL	-	NULL	ENSG00000129535		0.592	NRL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NRL	HGNC	protein_coding	OTTHUMT00000415595.1	42	0.00	0	C			24551994	24551994	-1	no_errors	ENST00000396997	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	1.000	G
NT5C3A	51251	genome.wustl.edu	37	7	33066431	33066431	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr7:33066431G>A	ENST00000242210.7	-	2	326	c.250C>T	c.(250-252)Cag>Tag	p.Q84*	NT5C3A_ENST00000409467.1_Nonsense_Mutation_p.Q33*|NT5C3A_ENST00000396152.2_Nonsense_Mutation_p.Q45*|NT5C3A_ENST00000610140.1_Nonsense_Mutation_p.Q79*|NT5C3A_ENST00000405342.1_Nonsense_Mutation_p.Q45*|AVL9_ENST00000404479.1_Intron|NT5C3A_ENST00000409787.1_Nonsense_Mutation_p.Q45*|NT5C3A_ENST00000381626.2_Nonsense_Mutation_p.Q33*	NM_001002009.2|NM_001002010.2	NP_001002009.1|NP_001002010.1	Q9H0P0	5NT3A_HUMAN	5'-nucleotidase, cytosolic IIIA	84					dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside metabolic process (GO:0006213)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	2'-phosphotransferase activity (GO:0008665)|5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)										TTATTCACCTGAAGTTTGGCA	0.443																																						dbGAP											0													99.0	94.0	96.0					7																	33066431		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF312735	CCDS34616.1, CCDS34617.1, CCDS55101.1	7p14.3	2013-03-06	2013-03-06	2013-03-06	ENSG00000122643	ENSG00000122643	3.1.3.5		17820	protein-coding gene	gene with protein product	"""lupin"""	606224	"""5'-nucleotidase, cytosolic III"""	NT5C3		11042152, 10942414	Standard	NM_001002010		Approved	UMPH1, PSN1, PN-I, UMPH, P5'N-1, cN-III, p36, POMP, hUMP1	uc003tdk.4	Q9H0P0	OTTHUMG00000152983	ENST00000242210.7:c.250C>T	7.37:g.33066431G>A	ENSP00000242210:p.Gln84*		A8K253|B2RAA5|B8ZZC4|Q6IPZ1|Q6NXS6|Q7L3G6|Q9P0P5|Q9UC42|Q9UC43|Q9UC44|Q9UC45	Nonsense_Mutation	SNP	pfam_Pyrimidine_nucleotidase_eu,superfamily_HAD-like_dom,tigrfam_Pyrimidine_nucleotidase_eu	p.Q84*	ENST00000242210.7	37	c.250	CCDS34616.1	7	.	.	.	.	.	.	.	.	.	.	G	37	6.014935	0.97205	.	.	ENSG00000122643	ENST00000381626;ENST00000396152;ENST00000242210;ENST00000405342;ENST00000409467;ENST00000409787;ENST00000449201	.	.	.	5.51	5.51	0.81932	.	0.054802	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	19.4207	0.94720	0.0:0.0:1.0:0.0	.	.	.	.	X	33;45;84;45;33;45;33	.	ENSP00000242210:Q84X	Q	-	1	0	NT5C3	33032956	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.864000	0.99589	2.601000	0.87937	0.585000	0.79938	CAG	NT5C3	-	superfamily_HAD-like_dom,tigrfam_Pyrimidine_nucleotidase_eu	ENSG00000122643		0.443	NT5C3A-001	KNOWN	basic|CCDS	protein_coding	NT5C3	HGNC	protein_coding	OTTHUMT00000328880.1	82	0.00	0	G	NM_016489		33066431	33066431	-1	no_errors	ENST00000242210	ensembl	human	known	69_37n	nonsense	81	10.99	10	SNP	1.000	A
OR13C9	286362	genome.wustl.edu	37	9	107380084	107380084	+	Silent	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr9:107380084G>A	ENST00000259362.1	-	1	401	c.402C>T	c.(400-402)atC>atT	p.I134I		NM_001001956.1	NP_001001956.1	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C, member 9	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(9)|prostate(1)|skin(4)	22						TGCTCATGATGATGGGATATC	0.488																																						dbGAP											0													134.0	126.0	128.0					9																	107380084		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS35093.1	9q31.1	2013-09-24			ENSG00000136839	ENSG00000136839		"""GPCR / Class A : Olfactory receptors"""	15104	protein-coding gene	gene with protein product							Standard	NM_001001956		Approved		uc011lvr.2	Q8NGT0	OTTHUMG00000020416	ENST00000259362.1:c.402C>T	9.37:g.107380084G>A			Q6IFL2	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I134	ENST00000259362.1	37	c.402	CCDS35093.1	9																																																																																			OR13C9	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000136839		0.488	OR13C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C9	HGNC	protein_coding	OTTHUMT00000053490.1	101	0.00	0	G			107380084	107380084	-1	no_errors	ENST00000259362	ensembl	human	known	69_37n	silent	56	13.85	9	SNP	0.000	A
OR2J2	26707	genome.wustl.edu	37	6	29142120	29142120	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr6:29142120G>C	ENST00000377167.2	+	1	810	c.708G>C	c.(706-708)caG>caC	p.Q236H		NM_030905.2	NP_112167.2	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J, member 2	236						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(17)|ovary(1)|upper_aerodigestive_tract(1)	25						CTGGGCTTCAGAAAGTGTTTA	0.453																																						dbGAP											0													135.0	118.0	123.0					6																	29142120		1924	4138	6062	-	-	-	SO:0001583	missense	0				CCDS43434.1	6p22.2-p21.31	2012-08-09			ENSG00000204700	ENSG00000204700		"""GPCR / Class A : Olfactory receptors"""	8260	protein-coding gene	gene with protein product							Standard	NM_030905		Approved	OR6-8, hs6M1-6, dJ80I19.4	uc011dlm.2	O76002	OTTHUMG00000031091	ENST00000377167.2:c.708G>C	6.37:g.29142120G>C	ENSP00000366372:p.Gln236His		A6NCU9|A6NLD0|B0UY53|Q32N09|Q5ST39|Q5SUJ6|Q6IF24|Q9GZK2|Q9GZL3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Q236H	ENST00000377167.2	37	c.708	CCDS43434.1	6	.	.	.	.	.	.	.	.	.	.	G	2.430	-0.331102	0.05314	.	.	ENSG00000204700	ENST00000377167	T	0.00028	8.92	2.0	-0.39	0.12450	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	N	0.10782	0.045	0.23577	N	0.997377	P	0.41978	0.767	P	0.57960	0.83	T	0.02437	-1.1159	9	0.44086	T	0.13	.	5.086	0.14682	0.1649:0.2982:0.5369:0.0	.	236	O76002	OR2J2_HUMAN	H	236	ENSP00000366372:Q236H	ENSP00000366372:Q236H	Q	+	3	2	OR2J2	29250099	0.001000	0.12720	0.598000	0.28837	0.568000	0.35870	-0.579000	0.05834	0.163000	0.19507	0.205000	0.17691	CAG	OR2J2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000204700		0.453	OR2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2J2	HGNC	protein_coding	OTTHUMT00000076131.2	64	0.00	0	G			29142120	29142120	+1	no_errors	ENST00000377167	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	0.211	C
OR4A15	81328	genome.wustl.edu	37	11	55136013	55136013	+	Silent	SNP	C	C	T			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr11:55136013C>T	ENST00000314706.3	+	1	654	c.654C>T	c.(652-654)acC>acT	p.T218T		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	218						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						TTGCTTGCACCAATACCTATG	0.413																																						dbGAP											0													126.0	116.0	119.0					11																	55136013		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.654C>T	11.37:g.55136013C>T			Q6IFL4|Q96R65	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.T218	ENST00000314706.3	37	c.654	CCDS31500.1	11																																																																																			OR4A15	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181958		0.413	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A15	HGNC	protein_coding	OTTHUMT00000391161.1	120	0.00	0	C	NM_001005275		55136013	55136013	+1	no_errors	ENST00000314706	ensembl	human	known	69_37n	silent	35	23.91	11	SNP	0.000	T
PCDHA8	56140	genome.wustl.edu	37	5	140220923	140220923	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr5:140220923G>A	ENST00000531613.1	+	1	17	c.17G>A	c.(16-18)cGa>cAa	p.R6Q	PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.R6Q|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	6					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TATCACTGGCGAGGAGAGCTG	0.483																																						dbGAP											0													80.0	84.0	83.0					5																	140220923		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.17G>A	5.37:g.140220923G>A	ENSP00000434655:p.Arg6Gln		B9EGT7|O75281	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R6Q	ENST00000531613.1	37	c.17	CCDS54919.1	5	.	.	.	.	.	.	.	.	.	.	G	6.946	0.544291	0.13312	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.50548	0.74;0.74	3.42	-1.17	0.09648	.	1.274340	0.06203	U	0.683732	T	0.32526	0.0832	L	0.31120	0.905	0.09310	N	1	B;B	0.14438	0.001;0.01	B;B	0.13407	0.002;0.009	T	0.21930	-1.0231	10	0.29301	T	0.29	.	5.9238	0.19096	0.2984:0.2257:0.476:0.0	.	6;6	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	Q	6	ENSP00000434655:R6Q;ENSP00000367363:R6Q	ENSP00000367363:R6Q	R	+	2	0	PCDHA8	140201107	0.029000	0.19370	0.020000	0.16555	0.016000	0.09150	-0.367000	0.07553	-0.175000	0.10725	0.460000	0.39030	CGA	PCDHA8	-	NULL	ENSG00000204962		0.483	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	HGNC	protein_coding	OTTHUMT00000372830.2	48	0.00	0	G	NM_018911		140220923	140220923	+1	no_errors	ENST00000531613	ensembl	human	known	69_37n	missense	54	12.90	8	SNP	0.000	A
PCDHA8	56140	genome.wustl.edu	37	5	140222831	140222831	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr5:140222831C>G	ENST00000531613.1	+	1	1925	c.1925C>G	c.(1924-1926)tCt>tGt	p.S642C	PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.S642C|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	642	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S642C(4)		NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAGCGGACTCTCCGCGCCAC	0.657																																						dbGAP											4	Substitution - Missense(4)	lung(2)|breast(2)											106.0	105.0	105.0					5																	140222831		2197	4266	6463	-	-	-	SO:0001583	missense	0			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1925C>G	5.37:g.140222831C>G	ENSP00000434655:p.Ser642Cys		B9EGT7|O75281	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S642C	ENST00000531613.1	37	c.1925	CCDS54919.1	5	.	.	.	.	.	.	.	.	.	.	C	7.011	0.556714	0.13436	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.53206	0.63;0.63	2.93	0.85	0.18980	Cadherin (4);Cadherin-like (1);	0.496290	0.14270	U	0.330185	T	0.38665	0.1049	L	0.53249	1.67	0.09310	N	1	B;B	0.26809	0.149;0.16	B;B	0.24974	0.057;0.021	T	0.38972	-0.9636	10	0.87932	D	0	.	5.9794	0.19399	0.0:0.3912:0.4704:0.1385	.	642;642	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	C	642	ENSP00000434655:S642C;ENSP00000367363:S642C	ENSP00000367363:S642C	S	+	2	0	PCDHA8	140203015	0.000000	0.05858	0.004000	0.12327	0.411000	0.31082	-1.126000	0.03254	0.550000	0.28991	0.313000	0.20887	TCT	PCDHA8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204962		0.657	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	HGNC	protein_coding	OTTHUMT00000372830.2	75	0.00	0	C	NM_018911		140222831	140222831	+1	no_errors	ENST00000531613	ensembl	human	known	69_37n	missense	51	13.56	8	SNP	0.000	G
PCDHGB3	56102	genome.wustl.edu	37	5	140752311	140752311	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr5:140752311G>A	ENST00000576222.1	+	1	2481	c.2350G>A	c.(2350-2352)Gaa>Aaa	p.E784K	PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	784					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTATGTGATGAAGCCTCTTG	0.378																																						dbGAP											0													59.0	54.0	55.0					5																	140752311		1863	4109	5972	-	-	-	SO:0001583	missense	0			AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2350G>A	5.37:g.140752311G>A	ENSP00000461862:p.Glu784Lys		A7E229|Q9Y5C7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.E784K	ENST00000576222.1	37	c.2350	CCDS58980.1	5																																																																																			PCDHGB3	-	NULL	ENSG00000262209		0.378	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB3	HGNC	protein_coding	OTTHUMT00000437094.1	53	0.00	0	G	NM_018924		140752311	140752311	+1	no_errors	ENST00000576222	ensembl	human	known	69_37n	missense	64	12.33	9	SNP	0.026	A
PCDH12	51294	genome.wustl.edu	37	5	141336485	141336485	+	Missense_Mutation	SNP	T	T	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr5:141336485T>A	ENST00000231484.3	-	1	2142	c.932A>T	c.(931-933)gAc>gTc	p.D311V	PCDH12_ENST00000512221.1_5'Flank	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	311	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTTCATAGTCTAGAGGTCG	0.522																																						dbGAP											0													70.0	63.0	66.0					5																	141336485		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.932A>T	5.37:g.141336485T>A	ENSP00000231484:p.Asp311Val		Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D311V	ENST00000231484.3	37	c.932	CCDS4269.1	5	.	.	.	.	.	.	.	.	.	.	T	14.95	2.689515	0.48097	.	.	ENSG00000113555	ENST00000231484	T	0.65364	-0.15	5.26	5.26	0.73747	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.87030	0.6076	H	0.98754	4.32	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91595	0.5290	10	0.87932	D	0	.	13.1577	0.59527	0.0:0.0:0.0:1.0	.	311	Q9NPG4	PCD12_HUMAN	V	311	ENSP00000231484:D311V	ENSP00000231484:D311V	D	-	2	0	PCDH12	141316669	1.000000	0.71417	0.997000	0.53966	0.242000	0.25591	7.868000	0.87116	2.205000	0.71048	0.533000	0.62120	GAC	PCDH12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113555		0.522	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH12	HGNC	protein_coding	OTTHUMT00000251858.1	62	0.00	0	T	NM_016580		141336485	141336485	-1	no_errors	ENST00000231484	ensembl	human	known	69_37n	missense	40	29.82	17	SNP	1.000	A
PIK3C3	5289	genome.wustl.edu	37	18	39576617	39576617	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr18:39576617C>T	ENST00000262039.4	+	9	993	c.907C>T	c.(907-909)Cca>Tca	p.P303S	PIK3C3_ENST00000398870.3_Missense_Mutation_p.P240S	NM_002647.2	NP_002638.2	Q8NEB9	PK3C3_HUMAN	phosphatidylinositol 3-kinase, catalytic subunit type 3	303	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				autophagic vacuole assembly (GO:0000045)|cytokinesis (GO:0000910)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein processing (GO:0016485)|regulation of protein secretion (GO:0050708)|response to leucine (GO:0043201)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)|midbody (GO:0030496)|phagocytic vesicle (GO:0045335)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(25)|ovary(1)|skin(2)|urinary_tract(1)	49						TGTGAGTTATCCACCAACCAA	0.259										TSP Lung(28;0.18)																											NSCLC(37;552 1060 2683 16430 37914)	dbGAP											0													76.0	82.0	80.0					18																	39576617		2202	4277	6479	-	-	-	SO:0001583	missense	0			Z46973	CCDS11920.1	18q12.3	2012-07-13	2012-07-13		ENSG00000078142	ENSG00000078142	2.7.1.137		8974	protein-coding gene	gene with protein product		602609	"""phosphoinositide-3-kinase, class 3"""			7628435	Standard	NM_002647		Approved	Vps34	uc002lap.3	Q8NEB9	OTTHUMG00000132593	ENST00000262039.4:c.907C>T	18.37:g.39576617C>T	ENSP00000262039:p.Pro303Ser		Q15134	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pirsf_PI3K_Vps34,pfscan_PI3/4_kinase_cat_dom	p.P303S	ENST00000262039.4	37	c.907	CCDS11920.1	18	.	.	.	.	.	.	.	.	.	.	C	20.9	4.069090	0.76301	.	.	ENSG00000078142	ENST00000262039;ENST00000398870	T;T	0.68025	-0.3;-0.3	5.36	5.36	0.76844	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.049931	0.85682	N	0.000000	T	0.76271	0.3964	L	0.54965	1.715	0.80722	D	1	D;D	0.62365	0.991;0.979	P;P	0.59171	0.594;0.853	T	0.74830	-0.3531	9	.	.	.	.	19.0733	0.93148	0.0:1.0:0.0:0.0	.	240;303	A8MYT4;Q8NEB9	.;PK3C3_HUMAN	S	303;240	ENSP00000262039:P303S;ENSP00000381845:P240S	.	P	+	1	0	PIK3C3	37830615	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.545000	0.67237	2.507000	0.84556	0.467000	0.42956	CCA	PIK3C3	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom,pirsf_PI3K_Vps34	ENSG00000078142		0.259	PIK3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C3	HGNC	protein_coding	OTTHUMT00000255804.1	63	0.00	0	C	NM_002647		39576617	39576617	+1	no_errors	ENST00000262039	ensembl	human	known	69_37n	missense	43	15.69	8	SNP	1.000	T
PIWIL1	9271	genome.wustl.edu	37	12	130834421	130834421	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr12:130834421G>C	ENST00000245255.3	+	9	1225	c.953G>C	c.(952-954)aGa>aCa	p.R318T		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	318	PAZ. {ECO:0000255|PROSITE- ProRule:PRU00142}.|Required for binding 2'-O-methylated 3'- end of piRNAs.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		AAGACATACAGAGTGGATGAT	0.398																																						dbGAP											0													87.0	88.0	87.0					12																	130834421		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.953G>C	12.37:g.130834421G>C	ENSP00000245255:p.Arg318Thr		A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.R318T	ENST00000245255.3	37	c.953	CCDS9268.1	12	.	.	.	.	.	.	.	.	.	.	G	19.57	3.852893	0.71719	.	.	ENSG00000125207	ENST00000245255	T	0.13538	2.58	5.57	5.57	0.84162	Argonaute/Dicer protein, PAZ (4);	0.000000	0.85682	D	0.000000	T	0.39489	0.1080	M	0.70842	2.15	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.967	T	0.08743	-1.0707	10	0.59425	D	0.04	-25.912	18.5299	0.90987	0.0:0.0:1.0:0.0	.	318;318	Q96J94;Q96J94-2	PIWL1_HUMAN;.	T	318	ENSP00000245255:R318T	ENSP00000245255:R318T	R	+	2	0	PIWIL1	129400374	1.000000	0.71417	0.585000	0.28666	0.260000	0.26232	9.125000	0.94402	2.608000	0.88229	0.563000	0.77884	AGA	PIWIL1	-	pfam_PAZ,superfamily_PAZ,smart_PAZ,pfscan_PAZ	ENSG00000125207		0.398	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	HGNC	protein_coding	OTTHUMT00000399510.1	54	0.00	0	G			130834421	130834421	+1	no_errors	ENST00000245255	ensembl	human	known	69_37n	missense	43	13.73	7	SNP	1.000	C
PLIN5	440503	genome.wustl.edu	37	19	4525794	4525794	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr19:4525794G>A	ENST00000381848.3	-	6	651	c.571C>T	c.(571-573)Cag>Tag	p.Q191*		NM_001013706.2	NP_001013728.2	Q00G26	PLIN5_HUMAN	perilipin 5	191	Interaction with PNPLA2 and ABHD5. {ECO:0000250}.				lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|mitochondrion localization (GO:0051646)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of lipase activity (GO:0060192)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of triglyceride catabolic process (GO:0010897)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of lipase activity (GO:0060193)|positive regulation of lipid storage (GO:0010884)|positive regulation of sequestering of triglyceride (GO:0010890)|positive regulation of triglyceride biosynthetic process (GO:0010867)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)				endometrium(4)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10						TGTCTCCTCTGATCCTCCACC	0.637																																						dbGAP											0													33.0	40.0	38.0					19																	4525794		2074	4186	6260	-	-	-	SO:0001587	stop_gained	0			DQ839131	CCDS42473.1	19p13.3	2009-08-12			ENSG00000214456	ENSG00000214456		"""Perilipins"""	33196	protein-coding gene	gene with protein product	"""lipid storage droplet protein 5"""	613248				17234449, 19638644	Standard	NM_001013706		Approved	LSDP5, LSDA5, OXPAT, MLDP	uc002mas.3	Q00G26		ENST00000381848.3:c.571C>T	19.37:g.4525794G>A	ENSP00000371272:p.Gln191*		A2RRC1|Q6ZS68	Nonsense_Mutation	SNP	pfam_Perilipin,pirsf_Perilipin	p.Q191*	ENST00000381848.3	37	c.571	CCDS42473.1	19	.	.	.	.	.	.	.	.	.	.	.	32	5.160554	0.94727	.	.	ENSG00000214456	ENST00000381848	.	.	.	4.92	4.92	0.64577	.	1.446320	0.04688	U	0.413656	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-24.5585	15.9612	0.79930	0.0:0.0:1.0:0.0	.	.	.	.	X	191	.	ENSP00000371272:Q191X	Q	-	1	0	PLIN5	4476794	1.000000	0.71417	0.998000	0.56505	0.599000	0.36880	6.570000	0.73996	2.447000	0.82792	0.561000	0.74099	CAG	PLIN5	-	pfam_Perilipin,pirsf_Perilipin	ENSG00000214456		0.637	PLIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLIN5	HGNC	protein_coding	OTTHUMT00000458647.1	34	0.00	0	G	NM_001013706		4525794	4525794	-1	no_errors	ENST00000381848	ensembl	human	known	69_37n	nonsense	35	12.20	5	SNP	1.000	A
PPL	5493	genome.wustl.edu	37	16	4987026	4987026	+	Silent	SNP	C	C	T			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr16:4987026C>T	ENST00000345988.2	-	1	110	c.21G>A	c.(19-21)aaG>aaA	p.K7K	PPL_ENST00000590782.2_Silent_p.K7K	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	7					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						CTTTGTTTCTCTTCCTGAAGA	0.716																																						dbGAP											0													57.0	51.0	53.0					16																	4987026		2196	4300	6496	-	-	-	SO:0001819	synonymous_variant	0			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.21G>A	16.37:g.4987026C>T			O60314|O60454|Q14C98	Silent	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.K7	ENST00000345988.2	37	c.21	CCDS10526.1	16																																																																																			PPL	-	NULL	ENSG00000118898		0.716	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPL	HGNC	protein_coding	OTTHUMT00000251715.1	29	0.00	0	C	NM_002705		4987026	4987026	-1	no_errors	ENST00000345988	ensembl	human	known	69_37n	silent	37	21.28	10	SNP	1.000	T
PRPF8	10594	genome.wustl.edu	37	17	1561836	1561836	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr17:1561836C>G	ENST00000572621.1	-	32	5625	c.5360G>C	c.(5359-5361)aGa>aCa	p.R1787T	PRPF8_ENST00000304992.6_Missense_Mutation_p.R1787T			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1787	Involved in interaction with pre-mRNA 5' splice site.|RNase H homology domain.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		AATAGTCACTCTGTAGACGTT	0.468																																						dbGAP											0													141.0	121.0	128.0					17																	1561836		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.5360G>C	17.37:g.1561836C>G	ENSP00000460348:p.Arg1787Thr		O14547|O75965	Missense_Mutation	SNP	pfam_PROCN,pfam_PRP8_domainIV,pfam_Prp8_U6-snRNA-bd,pfam_Pre-mRNA-splicing_factor-8,pfam_Prp8_U5-snRNA-bd,pfam_PRO_C,pfam_RRM_spliceosomal_PrP8,pfam_JAB1_Mov34_MPN_PAD1,superfamily_Cupredoxin,superfamily_Histone-fold,smart_JAB1_Mov34_MPN_PAD1	p.R1787T	ENST00000572621.1	37	c.5360	CCDS11010.1	17	.	.	.	.	.	.	.	.	.	.	c	28.1	4.894865	0.91962	.	.	ENSG00000174231	ENST00000304992;ENST00000540177	D	0.82803	-1.65	5.91	5.91	0.95273	PRP8 domain IV core (1);	0.000000	0.85682	D	0.000000	D	0.93959	0.8066	M	0.93594	3.435	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94618	0.7810	10	0.87932	D	0	0.108	20.2946	0.98546	0.0:1.0:0.0:0.0	.	1787	Q6P2Q9	PRP8_HUMAN	T	1787;312	ENSP00000304350:R1787T	ENSP00000304350:R1787T	R	-	2	0	PRPF8	1508586	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.818000	0.86416	2.804000	0.96469	0.462000	0.41574	AGA	PRPF8	-	pfam_PRP8_domainIV	ENSG00000174231		0.468	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRPF8	HGNC	protein_coding	OTTHUMT00000438412.2	81	0.00	0	C			1561836	1561836	-1	no_errors	ENST00000304992	ensembl	human	known	69_37n	missense	65	15.58	12	SNP	1.000	G
PTPN9	5780	genome.wustl.edu	37	15	75762184	75762184	+	Missense_Mutation	SNP	A	A	C			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr15:75762184A>C	ENST00000306726.2	-	12	2028	c.1516T>G	c.(1516-1518)Tgc>Ggc	p.C506G		NM_002833.2	NP_002824.1	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type 9	506	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGCTCAGGGCACTGCCCTTTG	0.572																																						dbGAP											0													146.0	129.0	135.0					15																	75762184		2197	4294	6491	-	-	-	SO:0001583	missense	0				CCDS10280.1	15q23	2011-06-09			ENSG00000169410	ENSG00000169410		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9661	protein-coding gene	gene with protein product		600768				1557404	Standard	NM_002833		Approved	MEG2	uc002bal.3	P43378	OTTHUMG00000142838	ENST00000306726.2:c.1516T>G	15.37:g.75762184A>C	ENSP00000303554:p.Cys506Gly		Q53XR9	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_CRAL-TRIO_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_CRAL-bd_toc_tran	p.C506G	ENST00000306726.2	37	c.1516	CCDS10280.1	15	.	.	.	.	.	.	.	.	.	.	A	8.067	0.769344	0.15983	.	.	ENSG00000169410	ENST00000306726;ENST00000544966	D	0.82619	-1.63	5.84	-1.24	0.09435	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.325647	0.37219	N	0.002200	T	0.57286	0.2043	N	0.02213	-0.635	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.53620	-0.8413	10	0.62326	D	0.03	.	7.513	0.27585	0.1986:0.5958:0.2056:0.0	.	506	P43378	PTN9_HUMAN	G	506;496	ENSP00000303554:C506G	ENSP00000303554:C506G	C	-	1	0	PTPN9	73549237	0.998000	0.40836	0.247000	0.24249	0.783000	0.44284	1.743000	0.38258	-0.148000	0.11234	0.533000	0.62120	TGC	PTPN9	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000169410		0.572	PTPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN9	HGNC	protein_coding	OTTHUMT00000286474.1	48	0.00	0	A			75762184	75762184	-1	no_errors	ENST00000306726	ensembl	human	known	69_37n	missense	53	14.52	9	SNP	0.098	C
RBFOX3	146713	genome.wustl.edu	37	17	77111642	77111642	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr17:77111642C>G	ENST00000453134.2	-	5	668	c.156G>C	c.(154-156)caG>caC	p.Q52H	RBFOX3_ENST00000583458.1_Missense_Mutation_p.Q52H|RBFOX3_ENST00000584778.1_Missense_Mutation_p.Q52H|RBFOX3_ENST00000415831.1_Missense_Mutation_p.Q52H|RBFOX3_ENST00000580155.1_Missense_Mutation_p.Q52H|RBFOX3_ENST00000582043.1_Missense_Mutation_p.Q52H			A6NFN3	RFOX3_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 3	52					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perikaryon (GO:0043204)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)	2						CGGGGTGGGTCTGTGCTGGTG	0.716																																						dbGAP											0													100.0	92.0	95.0					17																	77111642		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS45805.1	17q25.3	2013-02-12			ENSG00000167281	ENSG00000167281		"""RNA binding motif (RRM) containing"""	27097	protein-coding gene	gene with protein product	"""neuronal nuclei"", ""hexaribonucleotide binding protein 3"""					16260614	Standard	NM_001082575		Approved	FOX-3, NeuN, HRNBP3	uc010dhs.4	A6NFN3	OTTHUMG00000150183	ENST00000453134.2:c.156G>C	17.37:g.77111642C>G	ENSP00000393262:p.Gln52His		B4DEG6|B4DF29	Missense_Mutation	SNP	pfam_Fox-1_C_dom,pfam_RRM_dom,smart_RRM_dom,pirsf_RNA-bd_Fox-1,pfscan_RRM_dom	p.Q52H	ENST00000453134.2	37	c.156	CCDS45805.1	17	.	.	.	.	.	.	.	.	.	.	C	11.73	1.724843	0.30593	.	.	ENSG00000167281	ENST00000338834;ENST00000415831;ENST00000453134	T;T	0.23552	1.9;1.9	3.83	3.83	0.44106	.	0.077168	0.53938	D	0.000059	T	0.21881	0.0527	L	0.45051	1.395	0.51012	D	0.9999	B;B	0.10296	0.002;0.003	B;B	0.10450	0.005;0.001	T	0.06789	-1.0807	10	0.59425	D	0.04	-11.1171	10.108	0.42546	0.2008:0.7991:0.0:0.0	.	52;52	B4DF29;A6NFN3	.;RFOX3_HUMAN	H	52	ENSP00000408395:Q52H;ENSP00000393262:Q52H	ENSP00000344726:Q52H	Q	-	3	2	RBFOX3	74623237	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.912000	0.48782	1.973000	0.57446	0.313000	0.20887	CAG	RBFOX3	-	pirsf_RNA-bd_Fox-1	ENSG00000167281		0.716	RBFOX3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RBFOX3	HGNC	protein_coding	OTTHUMT00000437658.1	92	0.00	0	C	NM_001082575		77111642	77111642	-1	no_errors	ENST00000415831	ensembl	human	known	69_37n	missense	90	10.89	11	SNP	1.000	G
RBL1	5933	genome.wustl.edu	37	20	35693877	35693877	+	Splice_Site	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr20:35693877C>G	ENST00000373664.3	-	7	913		c.e7-1		RBL1_ENST00000344359.3_Splice_Site	NM_002895.2	NP_002886.2	P28749	RBL1_HUMAN	retinoblastoma-like 1						chromatin modification (GO:0016568)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription factor binding (GO:0008134)	p.?(1)		NS(1)|breast(1)|endometrium(7)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	42		Myeloproliferative disorder(115;0.00878)				CTTTTAATATCTGTGAACAAA	0.308																																						dbGAP											1	Unknown(1)	endometrium(1)											89.0	94.0	92.0					20																	35693877		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			L14812	CCDS13289.1, CCDS13290.1	20q11.23	2014-03-11	2014-03-11		ENSG00000080839	ENSG00000080839			9893	protein-coding gene	gene with protein product		116957				1833063	Standard	NM_183404		Approved	p107, cp107, PRB1	uc002xgi.3	P28749	OTTHUMG00000032406	ENST00000373664.3:c.847-1G>C	20.37:g.35693877C>G			A8K2W5|Q4VXA0|Q8N5K6|Q9H1L5|Q9H1M1	Splice_Site	SNP	-	e7-1	ENST00000373664.3	37	c.847-1	CCDS13289.1	20	.	.	.	.	.	.	.	.	.	.	C	14.75	2.628214	0.46944	.	.	ENSG00000080839	ENST00000373664;ENST00000344359;ENST00000525052	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6933	0.85327	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RBL1	35127291	1.000000	0.71417	0.999000	0.59377	0.591000	0.36615	4.806000	0.62569	2.596000	0.87737	0.655000	0.94253	.	RBL1	-	-	ENSG00000080839		0.308	RBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBL1	HGNC	protein_coding	OTTHUMT00000079067.2	58	0.00	0	C	NM_002895	Intron	35693877	35693877	-1	no_errors	ENST00000373664	ensembl	human	known	69_37n	splice_site	46	14.81	8	SNP	1.000	G
RHBDF2	79651	genome.wustl.edu	37	17	74470500	74470500	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr17:74470500C>G	ENST00000313080.4	-	12	1779	c.1506G>C	c.(1504-1506)caG>caC	p.Q502H	RHBDF2_ENST00000591885.1_Missense_Mutation_p.Q473H|RHBDF2_ENST00000389760.4_Missense_Mutation_p.Q473H	NM_024599.5	NP_078875.4	Q6PJF5	RHDF2_HUMAN	rhomboid 5 homolog 2 (Drosophila)	502					negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(4)|skin(1)	27						AGTGGTCATTCTGGACACAGC	0.667																																						dbGAP											0													61.0	58.0	59.0					17																	74470500		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016034	CCDS32743.1, CCDS32744.1	17q25.3	2014-09-17	2006-02-22	2006-02-22		ENSG00000129667			20788	protein-coding gene	gene with protein product		614404	"""rhomboid, veinlet-like 6 (Drosophila)"", ""tylosis with oesophageal cancer"""	RHBDL6, TOC		12838346, 22265016	Standard	NM_024599		Approved	FLJ22341, RHBDL5, TOCG	uc002jrq.2	Q6PJF5		ENST00000313080.4:c.1506G>C	17.37:g.74470500C>G	ENSP00000322775:p.Gln502His		A6NEM3|A8K801|Q5U607|Q5YGQ8|Q9H6E9	Missense_Mutation	SNP	pfam_Rhomboid_SP,pfam_Peptidase_S54_rhomboid_dom	p.Q502H	ENST00000313080.4	37	c.1506	CCDS32743.1	17	.	.	.	.	.	.	.	.	.	.	C	13.51	2.260066	0.39995	.	.	ENSG00000129667	ENST00000313080;ENST00000389760;ENST00000389762	T;T	0.40756	1.02;1.02	4.82	3.85	0.44370	.	0.000000	0.85682	D	0.000000	T	0.36496	0.0969	L	0.54323	1.7	0.51012	D	0.999903	B;B;B	0.31968	0.349;0.105;0.049	B;B;B	0.29176	0.099;0.023;0.021	T	0.26292	-1.0107	10	0.52906	T	0.07	-35.6012	10.6711	0.45760	0.0:0.8432:0.0:0.1568	.	448;502;473	Q6ZWP8;Q6PJF5;Q6PJF5-2	.;RHDF2_HUMAN;.	H	502;473;448	ENSP00000322775:Q502H;ENSP00000374410:Q473H	ENSP00000322775:Q502H	Q	-	3	2	RHBDF2	71982095	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	1.184000	0.32053	1.163000	0.42636	0.442000	0.29010	CAG	RHBDF2	-	NULL	ENSG00000129667		0.667	RHBDF2-001	KNOWN	basic|CCDS	protein_coding	RHBDF2	HGNC	protein_coding	OTTHUMT00000450134.1	45	0.00	0	C	NM_024599		74470500	74470500	-1	no_errors	ENST00000313080	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	1.000	G
RNF213	57674	genome.wustl.edu	37	17	78263574	78263574	+	Silent	SNP	T	T	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr17:78263574T>G	ENST00000582970.1	+	6	1193	c.1050T>G	c.(1048-1050)gcT>gcG	p.A350A	RNF213_ENST00000456466.1_Silent_p.A350A|RNF213_ENST00000508628.2_Silent_p.A399A|RNF213_ENST00000319921.4_Silent_p.A350A	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	350					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GAAGTGCAGCTGCTGTGAAAA	0.532																																						dbGAP											0													77.0	77.0	77.0					17																	78263574		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.1050T>G	17.37:g.78263574T>G			C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.A350	ENST00000582970.1	37	c.1050	CCDS58606.1	17																																																																																			RNF213	-	NULL	ENSG00000173821		0.532	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	92	0.00	0	T	NM_020914		78263574	78263574	+1	no_errors	ENST00000582970	ensembl	human	known	69_37n	silent	84	18.45	19	SNP	0.000	G
SACS	26278	genome.wustl.edu	37	13	23910500	23910500	+	Silent	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr13:23910500G>A	ENST00000382292.3	-	9	7788	c.7515C>T	c.(7513-7515)gcC>gcT	p.A2505A	SACS_ENST00000402364.1_Silent_p.A1755A|SACS_ENST00000382298.3_Silent_p.A2505A			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2505					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		ATCTTTCTAAGGCTTTGTGTC	0.393																																						dbGAP											0													140.0	130.0	133.0					13																	23910500		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.7515C>T	13.37:g.23910500G>A			O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Silent	SNP	pfam_HEPN,pfam_Ubiquitin,superfamily_ATPase-like_ATP-bd,superfamily_DnaJ_N,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_N,pfscan_Ubiquitin_supergroup	p.A2505	ENST00000382292.3	37	c.7515	CCDS9300.2	13																																																																																			SACS	-	NULL	ENSG00000151835		0.393	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	75	0.00	0	G	NM_014363		23910500	23910500	-1	no_errors	ENST00000382292	ensembl	human	known	69_37n	silent	49	12.50	7	SNP	0.959	A
SART1	9092	genome.wustl.edu	37	11	65744186	65744186	+	Silent	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr11:65744186G>A	ENST00000312397.5	+	14	1898	c.1806G>A	c.(1804-1806)gaG>gaA	p.E602E		NM_005146.4	NP_005137.1	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T cells	602					cell cycle arrest (GO:0007050)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of cytotoxic T cell differentiation (GO:0045585)|spliceosomal snRNP assembly (GO:0000387)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						ACGGGGAGGAGAACATCGGCT	0.662																																						dbGAP											0													30.0	28.0	28.0					11																	65744186		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB006198	CCDS31611.1	11q13.1	2009-01-06	2006-12-07		ENSG00000175467	ENSG00000175467			10538	protein-coding gene	gene with protein product	"""small nuclear ribonucleoprotein 110kDa (U4/U6.U5)"""	605941	"""squamous cell carcinoma antigen recognised by T cells"""			9449708	Standard	NM_005146		Approved	Ara1, Snu66, SNRNP110	uc001ogl.3	O43290	OTTHUMG00000166771	ENST00000312397.5:c.1806G>A	11.37:g.65744186G>A			A6NDN1|Q53GB5	Silent	SNP	pfam_SART_1	p.E602	ENST00000312397.5	37	c.1806	CCDS31611.1	11																																																																																			SART1	-	pfam_SART_1	ENSG00000175467		0.662	SART1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SART1	HGNC	protein_coding	OTTHUMT00000391409.1	39	0.00	0	G			65744186	65744186	+1	no_errors	ENST00000312397	ensembl	human	known	69_37n	silent	26	13.33	4	SNP	1.000	A
SLCO2A1	6578	genome.wustl.edu	37	3	133654634	133654634	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr3:133654634C>T	ENST00000310926.4	-	13	2071	c.1798G>A	c.(1798-1800)Gat>Aat	p.D600N	SLCO2A1_ENST00000493729.1_Missense_Mutation_p.D524N	NM_005630.2	NP_005621.2	Q92959	SO2A1_HUMAN	solute carrier organic anion transporter family, member 2A1	600					lipid transport (GO:0006869)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid transporter activity (GO:0005319)|prostaglandin transmembrane transporter activity (GO:0015132)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(2)	30					Alprostadil(DB00770)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Furosemide(DB00695)|Iloprost(DB01088)|Phenobarbital(DB01174)|Pyruvic acid(DB00119)	CGGAGAGCATCGTTGTCATAG	0.597																																						dbGAP											0													79.0	68.0	71.0					3																	133654634		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3084.1	3q21	2013-05-22	2003-11-25	2003-11-26	ENSG00000174640	ENSG00000174640		"""Solute carriers"""	10955	protein-coding gene	gene with protein product		601460	"""solute carrier family 21 (prostaglandin transporter), member 2"", ""matrin F/G 1"""	SLC21A2, MATR1		8787677, 9618293	Standard	NM_005630		Approved	PGT, OATP2A1	uc003eqa.4	Q92959	OTTHUMG00000159745	ENST00000310926.4:c.1798G>A	3.37:g.133654634C>T	ENSP00000311291:p.Asp600Asn		Q86V98|Q8IUN2	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.D600N	ENST00000310926.4	37	c.1798	CCDS3084.1	3	.	.	.	.	.	.	.	.	.	.	C	7.517	0.655865	0.14580	.	.	ENSG00000174640	ENST00000310926;ENST00000493729	T;T	0.39787	1.06;1.06	5.4	0.433	0.16534	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.485499	0.23307	N	0.049620	T	0.19046	0.0457	N	0.13098	0.295	0.21290	N	0.99974	B;B	0.24882	0.037;0.113	B;B	0.21360	0.012;0.034	T	0.20174	-1.0283	10	0.13853	T	0.58	.	6.7912	0.23701	0.0:0.535:0.1205:0.3446	.	524;600	E7EU40;Q92959	.;SO2A1_HUMAN	N	600;524	ENSP00000311291:D600N;ENSP00000418893:D524N	ENSP00000311291:D600N	D	-	1	0	SLCO2A1	135137324	0.010000	0.17322	0.007000	0.13788	0.005000	0.04900	0.209000	0.17435	0.417000	0.25871	0.561000	0.74099	GAT	SLCO2A1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000174640		0.597	SLCO2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO2A1	HGNC	protein_coding	OTTHUMT00000357131.1	70	0.00	0	C	NM_005630		133654634	133654634	-1	no_errors	ENST00000310926	ensembl	human	known	69_37n	missense	52	10.34	6	SNP	0.031	T
SMARCC2	6601	genome.wustl.edu	37	12	56575305	56575305	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr12:56575305G>A	ENST00000267064.4	-	10	1003	c.917C>T	c.(916-918)tCa>tTa	p.S306L	SMARCC2_ENST00000550859.1_5'Flank|SMARCC2_ENST00000394023.3_Missense_Mutation_p.S306L|SMARCC2_ENST00000347471.4_Missense_Mutation_p.S306L|SMARCC2_ENST00000550164.1_Missense_Mutation_p.S306L|RP11-977G19.5_ENST00000553176.1_RNA	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	306					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			TGGGGTTGGTGAAGGAGAGGG	0.512																																						dbGAP											0													97.0	88.0	91.0					12																	56575305		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.917C>T	12.37:g.56575305G>A	ENSP00000267064:p.Ser306Leu		F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.S306L	ENST00000267064.4	37	c.917	CCDS8907.1	12	.	.	.	.	.	.	.	.	.	.	G	18.66	3.671037	0.67814	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T	0.46063	0.88;0.89;0.88	4.19	4.19	0.49359	.	0.075003	0.56097	D	0.000037	T	0.37758	0.1015	L	0.46157	1.445	0.50467	D	0.999871	B;P;B;B;P	0.36535	0.421;0.557;0.421;0.421;0.557	B;B;B;B;B	0.36092	0.108;0.217;0.108;0.108;0.217	T	0.20472	-1.0274	10	0.29301	T	0.29	-10.156	16.4956	0.84242	0.0:0.0:1.0:0.0	.	195;306;311;306;306	B4DF22;F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;.;SMRC2_HUMAN;.	L	306	ENSP00000449396:S306L;ENSP00000302919:S306L;ENSP00000267064:S306L	ENSP00000267064:S306L	S	-	2	0	SMARCC2	54861572	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.299000	0.96137	2.620000	0.88729	0.561000	0.74099	TCA	SMARCC2	-	superfamily_Chromodomain-like	ENSG00000139613		0.512	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCC2	HGNC	protein_coding	OTTHUMT00000408370.1	58	0.00	0	G			56575305	56575305	-1	no_errors	ENST00000267064	ensembl	human	known	69_37n	missense	45	11.76	6	SNP	1.000	A
SPG11	80208	genome.wustl.edu	37	15	44925744	44925744	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr15:44925744G>C	ENST00000261866.7	-	8	1710	c.1694C>G	c.(1693-1695)tCt>tGt	p.S565C	SPG11_ENST00000535302.2_Missense_Mutation_p.S565C|SPG11_ENST00000558319.1_Missense_Mutation_p.S565C|SPG11_ENST00000427534.2_Missense_Mutation_p.S565C|SPG11_ENST00000559193.1_Missense_Mutation_p.S565C	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	565					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		AAACTGATCAGATACAGAAGA	0.313																																						dbGAP											0													62.0	67.0	65.0					15																	44925744		2197	4297	6494	-	-	-	SO:0001583	missense	0				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.1694C>G	15.37:g.44925744G>C	ENSP00000261866:p.Ser565Cys		A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	NULL	p.S565C	ENST00000261866.7	37	c.1694	CCDS10112.1	15	.	.	.	.	.	.	.	.	.	.	G	12.94	2.089880	0.36855	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	T;T;T	0.78481	-1.18;-0.92;-0.92	5.28	2.04	0.26737	.	0.722094	0.13196	N	0.406339	T	0.59715	0.2214	N	0.14661	0.345	0.09310	N	0.999999	P;B;B;B	0.34892	0.474;0.431;0.373;0.199	B;B;B;B	0.39617	0.213;0.305;0.224;0.213	T	0.53606	-0.8415	10	0.56958	D	0.05	.	1.2662	0.02011	0.2081:0.1384:0.4443:0.2093	.	565;565;565;565	C4B7M2;F5H3N6;B9EK60;Q96JI7	.;.;.;SPTCS_HUMAN	C	565	ENSP00000261866:S565C;ENSP00000445278:S565C;ENSP00000396110:S565C	ENSP00000261866:S565C	S	-	2	0	SPG11	42713036	0.779000	0.28652	0.697000	0.30258	0.902000	0.53008	1.525000	0.35953	0.139000	0.18822	0.655000	0.94253	TCT	SPG11	-	NULL	ENSG00000104133		0.313	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPG11	HGNC	protein_coding	OTTHUMT00000253927.1	84	0.00	0	G			44925744	44925744	-1	no_errors	ENST00000261866	ensembl	human	known	69_37n	missense	79	14.13	13	SNP	0.260	C
SS18L1	26039	genome.wustl.edu	37	20	60733751	60733751	+	Silent	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr20:60733751G>A	ENST00000331758.3	+	2	119	c.93G>A	c.(91-93)ctG>ctA	p.L31L	SS18L1_ENST00000421564.1_Silent_p.L31L|SS18L1_ENST00000370848.4_5'Flank	NM_198935.1	NP_945173.1	O75177	CREST_HUMAN	synovial sarcoma translocation gene on chromosome 18-like 1	31	N-terminal auto-inhibitory domain; necessary for interaction with SMARCA4/BRG1. {ECO:0000250}.				chromatin modification (GO:0016568)|dendrite development (GO:0016358)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of dendrite development (GO:0050773)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)|kinetochore (GO:0000776)|nuclear body (GO:0016604)|nucleus (GO:0005634)			SS18L1/SSX1(2)	ovary(2)|skin(1)	3	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.92e-08)			ACCACCACCTGATCCAGTGCA	0.632			T	SSX1	synovial sarcoma																																	dbGAP		Dom	yes		20	20q13.3	26039	synovial sarcoma translocation gene on chromosome 18-like 1		M	0													83.0	59.0	67.0					20																	60733751		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AB014593	CCDS13491.1	20q13.3	2008-07-28			ENSG00000184402	ENSG00000184402			15592	protein-coding gene	gene with protein product		606472					Standard	XM_005260389		Approved	KIAA0693	uc002ycb.3	O75177	OTTHUMG00000032902	ENST00000331758.3:c.93G>A	20.37:g.60733751G>A			A6NNE3|A8K620|B3KWR8|E1P5H7|Q5JXJ3|Q6MZV9|Q6NTH3|Q6XYD9|Q8NE69|Q9BR55|Q9H4K6	Silent	SNP	pfam_SSXT	p.L31	ENST00000331758.3	37	c.93	CCDS13491.1	20																																																																																			SS18L1	-	pfam_SSXT	ENSG00000184402		0.632	SS18L1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SS18L1	HGNC	protein_coding	OTTHUMT00000080004.2	30	0.00	0	G			60733751	60733751	+1	no_errors	ENST00000331758	ensembl	human	known	69_37n	silent	26	18.75	6	SNP	0.976	A
ST3GAL3	6487	genome.wustl.edu	37	1	44365326	44365326	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr1:44365326C>A	ENST00000361392.4	+	9	848	c.671C>A	c.(670-672)tCt>tAt	p.S224Y	ST3GAL3_ENST00000533933.1_Missense_Mutation_p.S224Y|ST3GAL3_ENST00000347631.2_Missense_Mutation_p.S239Y|ST3GAL3_ENST00000332628.6_Missense_Mutation_p.S193Y|ST3GAL3_ENST00000528371.1_Intron|ST3GAL3_ENST00000545417.1_Intron|ST3GAL3_ENST00000372372.2_Missense_Mutation_p.S262Y|ST3GAL3_ENST00000372375.2_Missense_Mutation_p.S278Y|ST3GAL3_ENST00000372362.2_Intron|ST3GAL3_ENST00000372367.1_Intron|ST3GAL3_ENST00000372366.1_Intron|ST3GAL3_ENST00000372368.2_Missense_Mutation_p.S278Y|ST3GAL3_ENST00000353126.3_Missense_Mutation_p.S224Y|ST3GAL3_ENST00000372374.2_Missense_Mutation_p.S193Y|ST3GAL3_ENST00000372377.4_Intron|ST3GAL3_ENST00000531993.1_Missense_Mutation_p.S208Y|ST3GAL3_ENST00000461375.1_3'UTR|ST3GAL3_ENST00000361746.4_Missense_Mutation_p.S293Y|ST3GAL3_ENST00000361400.4_Missense_Mutation_p.S208Y|ST3GAL3_ENST00000531451.1_Intron|ST3GAL3_ENST00000330208.2_Intron|ST3GAL3_ENST00000372369.1_Missense_Mutation_p.S224Y|ST3GAL3_ENST00000335430.6_Intron|ST3GAL3_ENST00000262915.3_Missense_Mutation_p.S293Y|ST3GAL3_ENST00000361812.4_Intron|ST3GAL3_ENST00000531816.1_Intron|ST3GAL3_ENST00000372365.1_Intron|ST3GAL3_ENST00000351035.3_Missense_Mutation_p.S262Y	NM_001270459.1|NM_006279.3|NM_174964.2	NP_001257388.1|NP_006270.1|NP_777624.1	Q11203	SIAT6_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 3	224					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)|N-acetyllactosaminide alpha-2,3-sialyltransferase activity (GO:0008118)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(3)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)				GAGCGCGATTCTCTCTTTGTC	0.557																																						dbGAP											0													97.0	97.0	97.0					1																	44365326		2203	4300	6503	-	-	-	SO:0001583	missense	0			L23768	CCDS492.1, CCDS493.1, CCDS494.1, CCDS495.1, CCDS496.1, CCDS497.1, CCDS498.1, CCDS499.1, CCDS500.1, CCDS53310.1, CCDS57988.1, CCDS57989.1, CCDS57990.1, CCDS57991.1, CCDS57992.1, CCDS57993.1, CCDS57994.1	1p34.1	2014-01-31	2005-02-07	2005-02-07	ENSG00000126091	ENSG00000126091	2.4.99.6	"""Sialyltransferases"""	10866	protein-coding gene	gene with protein product	"""ST3Gal III"""	606494	"""sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase)"", ""mental retardation, non-syndromic, autosomal recessive, 12"""	SIAT6, MRT12		8333853, 21907012	Standard	NM_174963		Approved		uc001cjz.4	Q11203	OTTHUMG00000007561	ENST00000361392.4:c.671C>A	1.37:g.44365326C>A	ENSP00000355341:p.Ser224Tyr		A9Z1W2|D3DPX8|Q5T4W9|Q5T4X0|Q5T4X7|Q5T4X8|Q5T4X9|Q5T4Y0|Q5T4Y2|Q5T4Y3|Q5T4Y4|Q86UR6|Q86UR7|Q86UR8|Q86UR9|Q86US0|Q86US1|Q86US2|Q8IX41|Q8IX42|Q8IX43|Q8IX44|Q8IX45|Q8IX46|Q8IX47|Q8IX48|Q8IX49|Q8IX50|Q8IX51|Q8IX52|Q8IX53|Q8IX54|Q8IX55|Q8IX56|Q8IX57|Q8IX58	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.S293Y	ENST00000361392.4	37	c.878	CCDS492.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.7|27.7	4.854006|4.854006	0.91355|0.91355	.|.	.|.	ENSG00000126091|ENSG00000126091	ENST00000490502|ENST00000361392;ENST00000361400;ENST00000262915;ENST00000372375;ENST00000351035;ENST00000372374;ENST00000353126;ENST00000347631;ENST00000372369;ENST00000361746;ENST00000372368;ENST00000372372;ENST00000531993;ENST00000533933;ENST00000332628	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.31247	.|1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.53334|0.53334	0.1790|0.1790	M|M	0.74546|0.74546	2.27|2.27	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;0.999;0.999;1.0;0.999;1.0;0.996;1.0	.|D;D;D;D;D;D;D;D;D;D;D	.|0.97110	.|0.999;0.999;0.999;0.997;0.999;0.994;0.999;0.991;0.998;0.986;1.0	T|T	0.50874|0.50874	-0.8776|-0.8776	5|10	.|0.02654	.|T	.|1	.|.	19.8211|19.8211	0.96595|0.96595	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|224;177;208;193;224;262;208;278;224;293;239	.|Q11203-5;Q11203-21;Q11203-16;Q11203-7;Q11203-8;Q11203-19;Q11203-15;Q11203-13;Q11203;Q11203-4;Q5T4W8	.|.;.;.;.;.;.;.;.;SIAT6_HUMAN;.;.	I|Y	23|224;208;293;278;262;193;224;239;224;293;278;262;208;224;193	.|ENSP00000355341:S224Y;ENSP00000354748:S208Y;ENSP00000262915:S293Y;ENSP00000361450:S278Y;ENSP00000316999:S262Y;ENSP00000361449:S193Y;ENSP00000330463:S224Y;ENSP00000317192:S239Y;ENSP00000361444:S224Y;ENSP00000354657:S293Y;ENSP00000361443:S278Y;ENSP00000361447:S262Y;ENSP00000432682:S208Y;ENSP00000432965:S224Y;ENSP00000329755:S193Y	.|ENSP00000262915:S293Y	L|S	+|+	1|2	0|0	ST3GAL3|ST3GAL3	44137913|44137913	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.909000|0.909000	0.53808|0.53808	7.399000|7.399000	0.79935|0.79935	2.687000|2.687000	0.91594|0.91594	0.655000|0.655000	0.94253|0.94253	CTC|TCT	ST3GAL3	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000126091		0.557	ST3GAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST3GAL3	HGNC	protein_coding	OTTHUMT00000019964.1	81	0.00	0	C	NM_174963		44365326	44365326	+1	no_errors	ENST00000262915	ensembl	human	known	69_37n	missense	59	11.94	8	SNP	1.000	A
STK17B	9262	genome.wustl.edu	37	2	197010664	197010664	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr2:197010664G>A	ENST00000263955.4	-	4	737	c.451C>T	c.(451-453)Cag>Tag	p.Q151*	STK17B_ENST00000409228.1_Nonsense_Mutation_p.Q151*	NM_004226.3	NP_004217.1	O94768	ST17B_HUMAN	serine/threonine kinase 17b	151	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(10)	15			OV - Ovarian serous cystadenocarcinoma(117;0.141)			ATGTTATTCTGATGTAGATAA	0.333																																						dbGAP											0													86.0	78.0	81.0					2																	197010664		2202	4299	6501	-	-	-	SO:0001587	stop_gained	0			AB011421	CCDS2315.1	2q33.1	2008-02-05	2007-02-12		ENSG00000081320	ENSG00000081320			11396	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 2"""	604727	"""serine/threonine kinase 17b (apoptosis-inducing)"""			9786912	Standard	NM_004226		Approved	DRAK2	uc002utk.3	O94768	OTTHUMG00000132735	ENST00000263955.4:c.451C>T	2.37:g.197010664G>A	ENSP00000263955:p.Gln151*			Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q151*	ENST00000263955.4	37	c.451	CCDS2315.1	2	.	.	.	.	.	.	.	.	.	.	G	37	6.348958	0.97494	.	.	ENSG00000081320	ENST00000263955;ENST00000409228	.	.	.	4.99	4.99	0.66335	.	0.143217	0.32028	N	0.006693	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	15.5103	0.75776	0.0:0.1481:0.8519:0.0	.	.	.	.	X	151	.	ENSP00000263955:Q151X	Q	-	1	0	STK17B	196718909	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	5.547000	0.67249	2.767000	0.95098	0.655000	0.94253	CAG	STK17B	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000081320		0.333	STK17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK17B	HGNC	protein_coding	OTTHUMT00000256092.2	34	0.00	0	G			197010664	197010664	-1	no_errors	ENST00000263955	ensembl	human	known	69_37n	nonsense	40	18.37	9	SNP	1.000	A
STX16	8675	genome.wustl.edu	37	20	57246341	57246341	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr20:57246341G>A	ENST00000371141.4	+	7	1504	c.780G>A	c.(778-780)atG>atA	p.M260I	STX16_ENST00000371132.4_Missense_Mutation_p.M239I|STX16_ENST00000496003.1_Intron|STX16_ENST00000355957.5_Missense_Mutation_p.M243I|STX16_ENST00000361770.5_Missense_Mutation_p.M243I|STX16-NPEPL1_ENST00000530122.1_Missense_Mutation_p.M260I|STX16_ENST00000361830.3_Missense_Mutation_p.M260I|STX16_ENST00000359617.4_Missense_Mutation_p.M207I|STX16_ENST00000358029.4_Missense_Mutation_p.M256I	NM_001001433.2	NP_001001433.1	O14662	STX16_HUMAN	syntaxin 16	260	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			breast(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(1)	17	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			TAGGGGCGATGATTGTAGAAC	0.453																																						dbGAP											0													151.0	140.0	143.0					20																	57246341		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF038897	CCDS13468.1, CCDS13469.1, CCDS46619.1, CCDS46620.1, CCDS56199.1	20q13.32	2008-07-02			ENSG00000124222	ENSG00000124222			11431	protein-coding gene	gene with protein product		603666				9464276, 9587053, 15800843	Standard	NM_003763		Approved	hsyn16, SYN16	uc002xzi.3	O14662	OTTHUMG00000033084	ENST00000371141.4:c.780G>A	20.37:g.57246341G>A	ENSP00000360183:p.Met260Ile		A6NK32|A6NN69|A8MPP0|B7ZBN1|B7ZBN2|B7ZBN3|E1P5M0|E1P607|O14661|O14663|O60517|Q5W084|Q5W086|Q5W087|Q5XKI6|Q6GMS8|Q9H0Z0|Q9H1T7|Q9H1T8|Q9UIX5	Missense_Mutation	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.M260I	ENST00000371141.4	37	c.780	CCDS13468.1	20	.	.	.	.	.	.	.	.	.	.	G	23.5	4.418292	0.83449	.	.	ENSG00000124222	ENST00000355957;ENST00000361770;ENST00000359617;ENST00000371141;ENST00000371138;ENST00000371132;ENST00000358029;ENST00000361830;ENST00000435446	T;T;T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84;1.84;1.84	5.75	5.75	0.90469	t-SNARE (1);Syntaxin/epimorphin, conserved site (1);Target SNARE coiled-coil domain (3);	0.000000	0.85682	U	0.000000	T	0.40040	0.1101	L	0.49513	1.565	0.80722	D	1	B;P;B;B	0.34629	0.193;0.46;0.285;0.101	P;B;B;B	0.46885	0.53;0.395;0.155;0.326	T	0.08700	-1.0709	10	0.51188	T	0.08	.	19.0121	0.92877	0.0:0.0:1.0:0.0	.	256;243;239;260	Q6GMS8;O14662-4;O14662-2;O14662	.;.;.;STX16_HUMAN	I	243;243;207;260;207;239;256;260;74	ENSP00000348229:M243I;ENSP00000355408:M243I;ENSP00000352634:M207I;ENSP00000360183:M260I;ENSP00000360173:M239I;ENSP00000350723:M256I;ENSP00000354445:M260I	ENSP00000360180:M207I	M	+	3	0	STX16	56679747	1.000000	0.71417	0.997000	0.53966	0.931000	0.56810	9.472000	0.97709	2.727000	0.93392	0.644000	0.83932	ATG	STX16-NPEPL1	-	pfam_T_SNARE_dom,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	ENSG00000254995		0.453	STX16-002	KNOWN	basic|CCDS	protein_coding	STX16-NPEPL1	HGNC	protein_coding	OTTHUMT00000080517.2	54	0.00	0	G	NM_001001433		57246341	57246341	+1	no_errors	ENST00000530122	ensembl	human	known	69_37n	missense	45	10.00	5	SNP	1.000	A
SYNM	23336	genome.wustl.edu	37	15	99671148	99671148	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr15:99671148C>G	ENST00000560674.1	+	4	2194	c.1725C>G	c.(1723-1725)atC>atG	p.I575M	SYNM_ENST00000328642.7_Missense_Mutation_p.I860M|SYNM_ENST00000561323.1_3'UTR|RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000336292.6_Missense_Mutation_p.I860M			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	861	Tail.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						AATCCACCATCAGGTACTCTT	0.567																																					Pancreas(125;1071 1762 21750 40003 40381)	dbGAP											0													61.0	66.0	64.0					15																	99671148		2063	4199	6262	-	-	-	SO:0001583	missense	0			AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.1725C>G	15.37:g.99671148C>G	ENSP00000453040:p.Ile575Met		A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Missense_Mutation	SNP	pfam_F	p.I860M	ENST00000560674.1	37	c.2580		15	.	.	.	.	.	.	.	.	.	.	C	17.61	3.432541	0.62844	.	.	ENSG00000182253	ENST00000336292;ENST00000328642	D;D	0.84516	-1.86;-1.83	5.76	5.76	0.90799	.	.	.	.	.	D	0.90150	0.6922	.	.	.	0.31905	N	0.615458	D;D	0.76494	0.998;0.999	D;D	0.72625	0.945;0.978	D	0.90050	0.4148	8	0.87932	D	0	.	7.4586	0.27280	0.28:0.6431:0.0:0.0769	.	861;860	O15061;C9JIE4	SYNEM_HUMAN;.	M	860	ENSP00000336775:I860M;ENSP00000330469:I860M	ENSP00000330469:I860M	I	+	3	3	SYNM	97488671	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.016000	0.40971	2.713000	0.92767	0.655000	0.94253	ATC	SYNM	-	NULL	ENSG00000182253		0.567	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	SYNM	HGNC	protein_coding	OTTHUMT00000415698.2	77	0.00	0	C	NM_145728		99671148	99671148	+1	no_errors	ENST00000336292	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	1.000	G
TAS2R1	50834	genome.wustl.edu	37	5	9629959	9629959	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr5:9629959G>C	ENST00000382492.2	-	1	504	c.186C>G	c.(184-186)atC>atG	p.I62M	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	62					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						TAACGTAGAAGATGAACAACT	0.368																																						dbGAP											0													43.0	46.0	45.0					5																	9629959		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.186C>G	5.37:g.9629959G>C	ENSP00000371932:p.Ile62Met		Q646G8	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.I62M	ENST00000382492.2	37	c.186	CCDS3876.1	5	.	.	.	.	.	.	.	.	.	.	G	11.93	1.785767	0.31593	.	.	ENSG00000169777	ENST00000382492	T	0.00912	5.55	5.32	-0.155	0.13395	.	0.704916	0.13313	N	0.397324	T	0.01320	0.0043	L	0.50993	1.605	0.09310	N	1	P	0.45957	0.869	P	0.48425	0.577	T	0.47129	-0.9141	9	.	.	.	.	0.8979	0.01267	0.1715:0.2506:0.2805:0.2975	.	62	Q9NYW7	TA2R1_HUMAN	M	62	ENSP00000371932:I62M	.	I	-	3	3	TAS2R1	9682959	0.419000	0.25449	0.011000	0.14972	0.005000	0.04900	0.215000	0.17562	0.079000	0.16929	-0.150000	0.13652	ATC	TAS2R1	-	pfam_TAS2_rcpt	ENSG00000169777		0.368	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R1	HGNC	protein_coding	OTTHUMT00000206988.2	27	0.00	0	G			9629959	9629959	-1	no_errors	ENST00000382492	ensembl	human	known	69_37n	missense	21	27.59	8	SNP	0.006	C
TENC1	23371	genome.wustl.edu	37	12	53451451	53451451	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr12:53451451G>C	ENST00000314250.6	+	12	1236	c.946G>C	c.(946-948)Gaa>Caa	p.E316Q	TENC1_ENST00000546602.1_Missense_Mutation_p.E316Q|TENC1_ENST00000314276.3_Missense_Mutation_p.E326Q|TENC1_ENST00000379902.3_Missense_Mutation_p.E192Q|TENC1_ENST00000552570.1_Missense_Mutation_p.E316Q|TENC1_ENST00000451358.1_Missense_Mutation_p.E316Q|TENC1_ENST00000549700.1_Missense_Mutation_p.E316Q	NM_170754.2	NP_736610.2	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase (tensin 2)	316	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cellular homeostasis (GO:0019725)|collagen metabolic process (GO:0032963)|intracellular signal transduction (GO:0035556)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|response to muscle activity (GO:0014850)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(19)|ovary(1)|pancreas(1)|stomach(3)	34						GCCAGCCTTTGAACCTGGCAC	0.567																																						dbGAP											0													149.0	145.0	147.0					12																	53451451		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF518729	CCDS8842.1, CCDS8843.1, CCDS8844.1	12q13.13	2013-02-14	2004-03-05			ENSG00000111077		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	19737	protein-coding gene	gene with protein product	"""tensin 2"""	607717	"""tensin like C1 domain-containing phosphatase"""				Standard	NM_015319		Approved	KIAA1075, C1-TEN, TNS2	uc001sbp.3	Q63HR2	OTTHUMG00000169730	ENST00000314250.6:c.946G>C	12.37:g.53451451G>C	ENSP00000319684:p.Glu316Gln		A2VDF2|A2VDF3|A2VDI8|A5PKY4|Q2NL80|Q76MW6|Q7Z5T9|Q8NFF9|Q8NFG0|Q96P25|Q9NT29|Q9UPS7	Missense_Mutation	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.E326Q	ENST00000314250.6	37	c.976	CCDS8843.1	12	.	.	.	.	.	.	.	.	.	.	G	7.269	0.606844	0.14002	.	.	ENSG00000111077	ENST00000379902;ENST00000314276;ENST00000314250;ENST00000451358;ENST00000443113;ENST00000546602;ENST00000552570;ENST00000549700	D;D;D;D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01	4.62	4.62	0.57501	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.224693	0.37577	N	0.002034	T	0.71550	0.3353	N	0.04880	-0.145	0.37165	D	0.90278	B;B;B	0.28552	0.129;0.215;0.106	B;B;B	0.35859	0.212;0.09;0.135	T	0.71076	-0.4697	10	0.22109	T	0.4	-5.6007	11.6084	0.51045	0.0:0.1811:0.8189:0.0	.	316;316;326	Q63HR2;F8W661;Q63HR2-4	TENC1_HUMAN;.;.	Q	192;326;316;316;316;316;316;316	ENSP00000369232:E192Q;ENSP00000319756:E326Q;ENSP00000319684:E316Q;ENSP00000393362:E316Q;ENSP00000449363:E316Q;ENSP00000447021:E316Q;ENSP00000449361:E316Q	ENSP00000319684:E316Q	E	+	1	0	TENC1	51737718	1.000000	0.71417	1.000000	0.80357	0.069000	0.16628	3.816000	0.55658	2.516000	0.84829	0.467000	0.42956	GAA	TENC1	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pfscan_Tensin_phosphatase_C2-dom	ENSG00000111077		0.567	TENC1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	TENC1	HGNC	protein_coding	OTTHUMT00000405779.1	45	0.00	0	G	NM_170754		53451451	53451451	+1	no_errors	ENST00000314276	ensembl	human	known	69_37n	missense	35	14.63	6	SNP	1.000	C
TES	26136	genome.wustl.edu	37	7	115890508	115890508	+	Silent	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr7:115890508G>A	ENST00000358204.4	+	4	875	c.660G>A	c.(658-660)ggG>ggA	p.G220G	TES_ENST00000537767.1_Intron|TES_ENST00000393481.2_Silent_p.G211G|AC073130.3_ENST00000444244.1_RNA|AC002066.1_ENST00000446355.2_RNA	NM_015641.3	NP_056456.1	Q9UGI8	TES_HUMAN	testis derived transcript (3 LIM domains)	220					negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|protein complex (GO:0043234)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.G220G(1)		endometrium(4)|large_intestine(4)|lung(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	12	Lung NSC(10;0.0137)|all_lung(10;0.0148)	Breast(660;0.0602)	STAD - Stomach adenocarcinoma(10;0.00878)			CAGCAGTGGGGGCCATGGAGG	0.468																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											58.0	62.0	60.0					7																	115890508		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ250865	CCDS5763.1, CCDS5764.1	7q31.2	2004-04-20			ENSG00000135269	ENSG00000135269			14620	protein-coding gene	gene with protein product		606085				10950921	Standard	NM_015641		Approved	DKFZP586B2022, TESS-2, TESTIN	uc003vho.3	Q9UGI8	OTTHUMG00000023092	ENST00000358204.4:c.660G>A	7.37:g.115890508G>A			A4D0U6|Q9GZQ1|Q9HAJ9	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.G7E	ENST00000358204.4	37	c.20	CCDS5763.1	7	.	.	.	.	.	.	.	.	.	.	G	10.39	1.338223	0.24253	.	.	ENSG00000135269	ENST00000393484	T	0.63096	-0.02	5.39	1.39	0.22231	.	0.239284	0.36778	N	0.002420	T	0.60676	0.2287	.	.	.	0.32166	N	0.582248	.	.	.	.	.	.	T	0.65742	-0.6094	7	0.87932	D	0	-15.0326	5.462	0.16622	0.3261:0.0:0.5288:0.1451	.	.	.	.	E	7	ENSP00000377124:G7E	ENSP00000377124:G7E	G	+	2	0	TES	115677744	0.760000	0.28428	0.710000	0.30468	0.473000	0.32948	0.403000	0.20982	0.309000	0.22966	0.655000	0.94253	GGG	TES	-	NULL	ENSG00000135269		0.468	TES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TES	HGNC	protein_coding	OTTHUMT00000059413.2	54	0.00	0	G	NM_015641		115890508	115890508	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000393484	ensembl	human	putative	69_37n	missense	47	17.54	10	SNP	0.533	A
TGS1	96764	genome.wustl.edu	37	8	56711671	56711671	+	Nonsense_Mutation	SNP	G	G	T	rs151307206	byFrequency	TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr8:56711671G>T	ENST00000260129.5	+	8	2218	c.1741G>T	c.(1741-1743)Gaa>Taa	p.E581*		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	581					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			TTCAGCTGGTGAACTTGAAAC	0.438																																					Esophageal Squamous(34;275 823 4842 34837 48447)	dbGAP											0													109.0	102.0	104.0					8																	56711671		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.1741G>T	8.37:g.56711671G>T	ENSP00000260129:p.Glu581*		A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Nonsense_Mutation	SNP	pfam_RNA_cap_Gua-N2-MeTrfase,pfam_RNA_methylase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	p.E581*	ENST00000260129.5	37	c.1741	CCDS34894.1	8	.	.	.	.	.	.	.	.	.	.	G	40	8.296090	0.98747	.	.	ENSG00000137574	ENST00000260129	.	.	.	5.94	3.18	0.36537	.	0.495575	0.22014	N	0.065829	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-13.5717	5.9482	0.19232	0.2178:0.1385:0.6437:0.0	.	.	.	.	X	581	.	ENSP00000260129:E581X	E	+	1	0	TGS1	56874225	0.030000	0.19436	0.000000	0.03702	0.438000	0.31896	2.300000	0.43620	0.410000	0.25675	0.650000	0.86243	GAA	TGS1	-	NULL	ENSG00000137574		0.438	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGS1	HGNC	protein_coding	OTTHUMT00000378152.1	49	0.00	0	G	NM_024831		56711671	56711671	+1	no_errors	ENST00000260129	ensembl	human	known	69_37n	nonsense	54	10.00	6	SNP	0.000	T
WDR62	284403	genome.wustl.edu	37	19	36584985	36584985	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr19:36584985G>A	ENST00000270301.7	+	20	2386	c.2386G>A	c.(2386-2388)Gag>Aag	p.E796K	WDR62_ENST00000401500.2_Missense_Mutation_p.E796K			O43379	WDR62_HUMAN	WD repeat domain 62	796					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)				cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GAGCCCTGGAGAGCAAACAGA	0.502																																						dbGAP											0													158.0	147.0	151.0					19																	36584985		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.2386G>A	19.37:g.36584985G>A	ENSP00000270301:p.Glu796Lys		Q63HP9|Q659D7|Q8NBF7|Q96AD9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E796K	ENST00000270301.7	37	c.2386	CCDS33001.1	19	.	.	.	.	.	.	.	.	.	.	G	14.16	2.453656	0.43531	.	.	ENSG00000075702	ENST00000401500;ENST00000270301	T;T	0.45668	0.89;0.89	5.06	5.06	0.68205	.	0.074887	0.50627	D	0.000112	T	0.59595	0.2205	M	0.69823	2.125	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.91	T	0.53648	-0.8409	10	0.15499	T	0.54	-32.7755	13.7967	0.63175	0.0:0.0:1.0:0.0	.	796;796	O43379-4;O43379	.;WDR62_HUMAN	K	796	ENSP00000384792:E796K;ENSP00000270301:E796K	ENSP00000270301:E796K	E	+	1	0	WDR62	41276825	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	4.520000	0.60524	2.641000	0.89580	0.563000	0.77884	GAG	WDR62	-	NULL	ENSG00000075702		0.502	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	WDR62	HGNC	protein_coding	OTTHUMT00000457436.1	86	0.00	0	G	NM_015671		36584985	36584985	+1	no_errors	ENST00000401500	ensembl	human	known	69_37n	missense	83	17.00	17	SNP	1.000	A
WWP1	11059	genome.wustl.edu	37	8	87454969	87454969	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr8:87454969C>G	ENST00000517970.1	+	18	2267	c.1960C>G	c.(1960-1962)Ctt>Gtt	p.L654V	WWP1_ENST00000341922.2_Missense_Mutation_p.L524V|WWP1_ENST00000265428.4_Missense_Mutation_p.L654V|WWP1_ENST00000349423.2_Missense_Mutation_p.L436V	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	654	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						TCCAGACCATCTTTCATACTT	0.338																																						dbGAP											0													130.0	119.0	123.0					8																	87454969		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.1960C>G	8.37:g.87454969C>G	ENSP00000427793:p.Leu654Val		O00307|Q5YLC1|Q96BP4	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.L654V	ENST00000517970.1	37	c.1960	CCDS6242.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.1|25.1	4.603532|4.603532	0.87157|0.87157	.|.	.|.	ENSG00000123124|ENSG00000123124	ENST00000517970;ENST00000265428;ENST00000341922;ENST00000349423|ENST00000520453	T;T;T;T|.	0.61859|.	0.07;0.07;0.07;0.07|.	5.4|5.4	5.4|5.4	0.78164|0.78164	HECT (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83760|0.83760	0.5324|0.5324	M|M	0.87180|0.87180	2.865|2.865	0.80722|0.80722	D|D	1|1	P;D|.	0.63880|.	0.839;0.993|.	P;D|.	0.65874|.	0.557;0.939|.	D|D	0.85751|0.85751	0.1343|0.1343	10|5	0.87932|.	D|.	0|.	.|.	19.1599|19.1599	0.93526|0.93526	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	436;654|.	Q9H0M0-6;Q9H0M0|.	.;WWP1_HUMAN|.	V|C	654;654;524;436|154	ENSP00000427793:L654V;ENSP00000265428:L654V;ENSP00000340564:L524V;ENSP00000342665:L436V|.	ENSP00000265428:L654V|.	L|S	+|+	1|2	0|0	WWP1|WWP1	87524085|87524085	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	7.776000|7.776000	0.85560|0.85560	2.506000|2.506000	0.84524|0.84524	0.585000|0.585000	0.79938|0.79938	CTT|TCT	WWP1	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000123124		0.338	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWP1	HGNC	protein_coding	OTTHUMT00000374755.1	90	0.00	0	C	NM_007013		87454969	87454969	+1	no_errors	ENST00000265428	ensembl	human	known	69_37n	missense	80	10.99	10	SNP	1.000	G
ZNF286A	57335	genome.wustl.edu	37	17	15619791	15619791	+	Silent	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr17:15619791C>G	ENST00000464847.2	+	5	1306	c.753C>G	c.(751-753)ctC>ctG	p.L251L	ZNF286A_ENST00000593105.1_Silent_p.L241L|ZNF286A_ENST00000413242.2_Silent_p.L251L|ZNF286A_ENST00000395894.2_3'UTR|ZNF286A_ENST00000472486.1_3'UTR|ZNF286A_ENST00000583566.1_Silent_p.L251L|ZNF286A_ENST00000585171.1_Intron|ZNF286A_ENST00000421016.1_Silent_p.L251L			Q9HBT8	Z286A_HUMAN	zinc finger protein 286A	251					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L251L(1)		central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)		GTGGTGAACTCTTCACCTACC	0.358																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											49.0	48.0	48.0					17																	15619791		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF217226	CCDS11172.1, CCDS73997.1	17p11.2	2013-02-14	2007-01-05	2007-01-05		ENSG00000187607		"""Zinc fingers, C2H2-type"", ""-"""	13501	protein-coding gene	gene with protein product			"""zinc finger protein 286"""	ZNF286		11347906	Standard	NM_020652		Approved	KIAA1874	uc010cot.3	Q9HBT8	OTTHUMG00000166448	ENST00000464847.2:c.753C>G	17.37:g.15619791C>G			B4DKF9|Q96JF3	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L251	ENST00000464847.2	37	c.753	CCDS11172.1	17																																																																																			AC005324.8-001	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000255104		0.358	ZNF286A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF286A	Clone_based_vega_gene	protein_coding	OTTHUMT00000130696.4	35	0.00	0	C	NM_020652		15619791	15619791	+1	no_errors	ENST00000413242	ensembl	human	known	69_37n	silent	39	13.33	6	SNP	0.561	G
ZNF561	93134	genome.wustl.edu	37	19	9721637	9721637	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr19:9721637C>G	ENST00000302851.3	-	6	1063	c.700G>C	c.(700-702)Gtc>Ctc	p.V234L	ZNF561_ENST00000326044.5_3'UTR|ZNF561_ENST00000495503.1_5'UTR|ZNF561_ENST00000424629.1_Missense_Mutation_p.V165L|ZNF561_ENST00000354661.4_Missense_Mutation_p.V98L	NM_152289.2	NP_689502.2	Q8N587	ZN561_HUMAN	zinc finger protein 561	234					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	14						GAAGCTGTGACAGCTCTCCCA	0.383																																						dbGAP											0													65.0	62.0	63.0					19																	9721637		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074787	CCDS12216.2	19p13.2	2013-09-20			ENSG00000171469	ENSG00000171469		"""Zinc fingers, C2H2-type"", ""-"""	28684	protein-coding gene	gene with protein product						12477932	Standard	NM_152289		Approved	MGC45408	uc002mlu.3	Q8N587	OTTHUMG00000157054	ENST00000302851.3:c.700G>C	19.37:g.9721637C>G	ENSP00000303915:p.Val234Leu		B4E2Q8|Q6PJS0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V234L	ENST00000302851.3	37	c.700	CCDS12216.2	19	.	.	.	.	.	.	.	.	.	.	C	5.725	0.318273	0.10845	.	.	ENSG00000171469	ENST00000424629;ENST00000302851;ENST00000354661;ENST00000444611	T;T;T;T	0.27104	1.69;1.69;1.69;3.88	1.1	-2.19	0.07015	.	.	.	.	.	T	0.08447	0.0210	N	0.02334	-0.595	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.24693	-1.0153	9	0.72032	D	0.01	.	2.765	0.05317	0.5082:0.2406:0.0:0.2511	.	234	Q8N587	ZN561_HUMAN	L	165;234;98;240	ENSP00000393074:V165L;ENSP00000303915:V234L;ENSP00000346687:V98L;ENSP00000392013:V240L	ENSP00000303915:V234L	V	-	1	0	ZNF561	9582637	0.093000	0.21703	0.000000	0.03702	0.007000	0.05969	1.051000	0.30417	-0.700000	0.05070	-0.856000	0.03024	GTC	ZNF561	-	NULL	ENSG00000171469		0.383	ZNF561-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF561	HGNC	protein_coding	OTTHUMT00000347272.2	71	0.00	0	C	NM_152289		9721637	9721637	-1	no_errors	ENST00000302851	ensembl	human	known	69_37n	missense	38	11.63	5	SNP	0.000	G
ZNF831	128611	genome.wustl.edu	37	20	57829085	57829085	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chr20:57829085C>G	ENST00000371030.2	+	5	4321	c.4321C>G	c.(4321-4323)Ctt>Gtt	p.L1441V		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1441							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					TGGCAAAGGTCTTGACCTTGG	0.522																																						dbGAP											0													73.0	77.0	76.0					20																	57829085		2013	4188	6201	-	-	-	SO:0001583	missense	0			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.4321C>G	20.37:g.57829085C>G	ENSP00000360069:p.Leu1441Val		Q5TDR4|Q8TCP0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L1441V	ENST00000371030.2	37	c.4321	CCDS42894.1	20	.	.	.	.	.	.	.	.	.	.	C	17.72	3.458773	0.63401	.	.	ENSG00000124203	ENST00000371030	T	0.18960	2.18	5.34	5.34	0.76211	.	0.129275	0.35525	N	0.003156	T	0.40862	0.1134	M	0.66939	2.045	0.09310	N	1	D	0.71674	0.998	D	0.63877	0.919	T	0.25433	-1.0132	10	0.29301	T	0.29	-10.619	14.5676	0.68188	0.0:1.0:0.0:0.0	.	1441	Q5JPB2	ZN831_HUMAN	V	1441	ENSP00000360069:L1441V	ENSP00000360069:L1441V	L	+	1	0	ZNF831	57262480	0.017000	0.18338	0.144000	0.22314	0.052000	0.14988	1.267000	0.33050	2.518000	0.84900	0.650000	0.86243	CTT	ZNF831	-	NULL	ENSG00000124203		0.522	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	HGNC	protein_coding	OTTHUMT00000079916.2	30	0.00	0	C	NM_178457		57829085	57829085	+1	no_errors	ENST00000371030	ensembl	human	novel	69_37n	missense	32	13.51	5	SNP	0.049	G
ZXDB	158586	genome.wustl.edu	37	X	57619607	57619607	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GM-A2DO-01A-11D-A19Y-09	TCGA-GM-A2DO-10D-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc563803-d0e6-4b04-86b1-ff00ae342a12	c247eeab-2b71-4019-a24b-d4648fa38deb	g.chrX:57619607C>T	ENST00000374888.1	+	1	1339	c.1126C>T	c.(1126-1128)Cag>Tag	p.Q376*		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	376	Required for interaction with ZXDC. {ECO:0000250}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						CTTCCCCACGCAGGCCAAACT	0.562																																						dbGAP											0													105.0	88.0	94.0					X																	57619607		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.1126C>T	X.37:g.57619607C>T	ENSP00000364023:p.Gln376*		A8K151|Q9UBB3	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q376*	ENST00000374888.1	37	c.1126	CCDS35313.1	X	.	.	.	.	.	.	.	.	.	.	.	37	6.449495	0.97577	.	.	ENSG00000198455	ENST00000374888	.	.	.	3.35	3.35	0.38373	.	0.187763	0.42548	D	0.000700	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	.	8.0373	0.30499	0.0:0.753:0.247:0.0	.	.	.	.	X	376	.	ENSP00000364023:Q376X	Q	+	1	0	ZXDB	57636332	0.011000	0.17503	0.984000	0.44739	0.986000	0.74619	0.260000	0.18424	1.681000	0.50988	0.483000	0.47432	CAG	ZXDB	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198455		0.562	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZXDB	HGNC	protein_coding	OTTHUMT00000056922.1	116	0.00	0	C	NM_007157		57619607	57619607	+1	no_errors	ENST00000374888	ensembl	human	known	69_37n	nonsense	105	10.26	12	SNP	0.904	T
