#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCC3	8714	genome.wustl.edu	37	17	48761448	48761448	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr17:48761448C>T	ENST00000285238.8	+	28	4173	c.4093C>T	c.(4093-4095)Cag>Tag	p.Q1365*		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	1365	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.		Q -> R (in dbSNP:rs11568590).		bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.Q1365E(2)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	CCTGCGCTCTCAGCTGACCAT	0.602																																																	2	Substitution - Missense(2)	lung(2)											50.0	41.0	44.0					17																	48761448		2203	4300	6503	SO:0001587	stop_gained	8714			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.4093C>T	17.37:g.48761448C>T	ENSP00000285238:p.Gln1365*		B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Nonsense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	p.Q1365*	ENST00000285238.8	37	c.4093	CCDS32681.1	17	.	.	.	.	.	.	.	.	.	.	C	42	9.536058	0.99198	.	.	ENSG00000108846	ENST00000285238	.	.	.	5.24	-0.787	0.10943	.	0.315286	0.32357	N	0.006217	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	-10.5377	10.995	0.47571	0.6819:0.2183:0.0998:0.0	.	.	.	.	X	1365	.	ENSP00000285238:Q1365X	Q	+	1	0	ABCC3	46116447	0.599000	0.26891	0.187000	0.23214	0.932000	0.56968	2.495000	0.45337	0.265000	0.21872	-0.181000	0.13052	CAG	ABCC3	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Multidrug-R_assoc		0.602	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC3	HGNC	protein_coding	OTTHUMT00000368083.2	C	NM_020038		48761448	+1	no_errors	ENST00000285238	ensembl	human	known	70_37	nonsense	SNP	0.739	T
ACAP2	23527	genome.wustl.edu	37	3	195022341	195022341	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr3:195022341G>C	ENST00000326793.6	-	15	1588	c.1358C>G	c.(1357-1359)tCt>tGt	p.S453C		NM_012287.5	NP_036419.3	Q15057	ACAP2_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2	453	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				cellular response to nerve growth factor stimulus (GO:1990090)|protein localization to endosome (GO:0036010)|regulation of ARF GTPase activity (GO:0032312)	endosome membrane (GO:0010008)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	27						TAAAGTTAAAGATCGTACTTT	0.323																																																	0													48.0	52.0	51.0					3																	195022341		2200	4299	6499	SO:0001583	missense	23527				CCDS33924.1	3q29	2013-01-10	2008-09-22	2008-09-22	ENSG00000114331	ENSG00000114331		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16469	protein-coding gene	gene with protein product		607766	"""centaurin, beta 2"""	CENTB2		11050434, 11062263	Standard	NM_012287		Approved	KIAA0041, CNT-B2	uc003fun.4	Q15057	OTTHUMG00000155885	ENST00000326793.6:c.1358C>G	3.37:g.195022341G>C	ENSP00000324287:p.Ser453Cys		A8K2V4|Q8N5Z8|Q9UQR3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.S453C	ENST00000326793.6	37	c.1358	CCDS33924.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.2|28.2	4.899625|4.899625	0.91962|0.91962	.|.	.|.	ENSG00000114331|ENSG00000114331	ENST00000450200|ENST00000326793	.|T	.|0.62941	.|-0.01	5.89|5.89	5.89|5.89	0.94794|0.94794	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.87849|0.87849	0.6281|0.6281	H|H	0.98068|0.98068	4.14|4.14	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.91702|0.91702	0.5374|0.5374	5|10	.|0.87932	.|D	.|0	.|.	19.2458|19.2458	0.93902|0.93902	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|453	.|Q15057	.|ACAP2_HUMAN	M|C	11|453	.|ENSP00000324287:S453C	.|ENSP00000324287:S453C	I|S	-|-	3|2	3|0	ACAP2|ACAP2	196503630|196503630	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	9.813000|9.813000	0.99286|0.99286	2.783000|2.783000	0.95769|0.95769	0.655000|0.655000	0.94253|0.94253	ATC|TCT	ACAP2	-	pfam_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP		0.323	ACAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAP2	HGNC	protein_coding	OTTHUMT00000342126.2	G	NM_012287		195022341	-1	no_errors	ENST00000326793	ensembl	human	known	70_37	missense	SNP	1.000	C
ADAMTS2	9509	genome.wustl.edu	37	5	178579207	178579207	+	Missense_Mutation	SNP	T	T	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr5:178579207T>A	ENST00000251582.7	-	10	1666	c.1565A>T	c.(1564-1566)aAc>aTc	p.N522I	ADAMTS2_ENST00000274609.5_Missense_Mutation_p.N522I	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	522	Disintegrin.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		AAAGTAGGGGTTGTCAGGATG	0.607																																																	0													79.0	71.0	73.0					5																	178579207		2203	4300	6503	SO:0001583	missense	9509			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.1565A>T	5.37:g.178579207T>A	ENSP00000251582:p.Asn522Ile			Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS2,prints_Peptidase_M12B_ADAM-TS	p.N522I	ENST00000251582.7	37	c.1565	CCDS4444.1	5	.	.	.	.	.	.	.	.	.	.	T	25.7	4.660237	0.88154	.	.	ENSG00000087116	ENST00000251582;ENST00000274609	T;T	0.66280	-0.2;-0.2	5.35	5.35	0.76521	.	0.000000	0.64402	D	0.000008	T	0.77246	0.4102	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80020	-0.1557	10	0.87932	D	0	.	14.5676	0.68188	0.0:0.0:0.0:1.0	.	522;522	O95450-2;O95450	.;ATS2_HUMAN	I	522	ENSP00000251582:N522I;ENSP00000274609:N522I	ENSP00000251582:N522I	N	-	2	0	ADAMTS2	178511813	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.832000	0.86757	2.033000	0.60031	0.454000	0.30748	AAC	ADAMTS2	-	NULL		0.607	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS2	HGNC	protein_coding	OTTHUMT00000253507.1	T	NM_014244		178579207	-1	no_errors	ENST00000251582	ensembl	human	known	70_37	missense	SNP	1.000	A
AKIRIN2	55122	genome.wustl.edu	37	6	88391343	88391343	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr6:88391343G>A	ENST00000257787.5	-	2	898	c.374C>T	c.(373-375)tCa>tTa	p.S125L		NM_018064.3	NP_060534.1	Q53H80	AKIR2_HUMAN	akirin 2	125					embryo development (GO:0009790)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to lipopolysaccharide (GO:0032496)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)			large_intestine(4)	4						ATTACCTGGTGAAGCTGGTCC	0.383																																																	0													136.0	113.0	121.0					6																	88391343		2203	4300	6503	SO:0001583	missense	55122			BC000764	CCDS5013.1	6q15	2009-04-17	2008-06-23	2008-06-23	ENSG00000135334	ENSG00000135334			21407	protein-coding gene	gene with protein product		615165	"""chromosome 6 open reading frame 166"""	C6orf166			Standard	NM_018064		Approved	FLJ10342, dJ486L4.2	uc003pmk.3	Q53H80	OTTHUMG00000015180	ENST00000257787.5:c.374C>T	6.37:g.88391343G>A	ENSP00000257787:p.Ser125Leu		Q9BQB1	Missense_Mutation	SNP	NULL	p.S125L	ENST00000257787.5	37	c.374	CCDS5013.1	6	.	.	.	.	.	.	.	.	.	.	G	14.09	2.432713	0.43224	.	.	ENSG00000135334	ENST00000257787	T	0.37752	1.18	5.93	5.93	0.95920	.	0.400304	0.25783	N	0.028321	T	0.12390	0.0301	N	0.25957	0.775	0.47994	D	0.999562	B	0.02656	0.0	B	0.01281	0.0	T	0.08086	-1.0739	10	0.37606	T	0.19	-11.9373	7.7864	0.29095	0.189:0.0:0.811:0.0	.	125	Q53H80	AKIR2_HUMAN	L	125	ENSP00000257787:S125L	ENSP00000257787:S125L	S	-	2	0	AKIRIN2	88448062	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	5.615000	0.67702	2.805000	0.96524	0.655000	0.94253	TCA	AKIRIN2	-	NULL		0.383	AKIRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKIRIN2	HGNC	protein_coding	OTTHUMT00000041455.1	G	NM_018064		88391343	-1	no_errors	ENST00000257787	ensembl	human	known	70_37	missense	SNP	1.000	A
ANKRD26	22852	genome.wustl.edu	37	10	27382726	27382726	+	Missense_Mutation	SNP	G	G	A	rs373943537		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr10:27382726G>A	ENST00000376087.4	-	2	410	c.245C>T	c.(244-246)aCg>aTg	p.T82M	ANKRD26_ENST00000436985.2_Missense_Mutation_p.T82M	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	82					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						ATGTAGAGCCGTCCTATGAGA	0.398																																																	0								G	MET/THR	0,3948		0,0,1974	82.0	77.0	78.0		245	3.2	0.1	10		78	1,8431		0,1,4215	no	missense	ANKRD26	NM_014915.2	81	0,1,6189	AA,AG,GG		0.0119,0.0,0.0081	probably-damaging	82/1711	27382726	1,12379	1974	4216	6190	SO:0001583	missense	22852			AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.245C>T	10.37:g.27382726G>A	ENSP00000365255:p.Thr82Met		A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Polyketide_synth_docking,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.T82M	ENST00000376087.4	37	c.245	CCDS41499.1	10	.	.	.	.	.	.	.	.	.	.	G	17.57	3.423769	0.62733	0.0	1.19E-4	ENSG00000107890	ENST00000376087;ENST00000436985	T;T	0.63417	-0.04;-0.04	4.16	3.24	0.37175	Ankyrin repeat-containing domain (4);	.	.	.	.	D	0.82628	0.5078	H	0.94462	3.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.977;0.987	D	0.85663	0.1290	9	0.87932	D	0	.	11.137	0.48381	0.0:0.0:0.8151:0.1849	.	82;82	Q9UPS8-3;Q9UPS8	.;ANR26_HUMAN	M	82	ENSP00000365255:T82M;ENSP00000405112:T82M	ENSP00000365255:T82M	T	-	2	0	ANKRD26	27422732	1.000000	0.71417	0.140000	0.22221	0.156000	0.22039	5.711000	0.68400	0.940000	0.37473	0.491000	0.48974	ACG	ANKRD26	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt		0.398	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD26	HGNC	protein_coding	OTTHUMT00000047296.1	G			27382726	-1	no_errors	ENST00000436985	ensembl	human	known	70_37	missense	SNP	0.996	A
ANKRD27	84079	genome.wustl.edu	37	19	33096837	33096837	+	Silent	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr19:33096837C>T	ENST00000306065.4	-	24	2555	c.2397G>A	c.(2395-2397)tcG>tcA	p.S799S	SNORA68_ENST00000364518.1_RNA	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	799					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					GTTTTGCATTCGAATCTAACA	0.458																																																	0													149.0	144.0	146.0					19																	33096837		2203	4300	6503	SO:0001819	synonymous_variant	84079			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.2397G>A	19.37:g.33096837C>T			Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Silent	SNP	pfam_Ankyrin_rpt,pfam_VPS9,superfamily_Ankyrin_rpt-contain_dom,smart_VPS9_subgr,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_VPS9,prints_Ankyrin_rpt	p.S799	ENST00000306065.4	37	c.2397	CCDS32986.1	19																																																																																			ANKRD27	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.458	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD27	HGNC	protein_coding	OTTHUMT00000450329.1	C	NM_032139		33096837	-1	no_errors	ENST00000306065	ensembl	human	known	70_37	silent	SNP	0.000	T
ANXA6	309	genome.wustl.edu	37	5	150497334	150497334	+	Silent	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr5:150497334G>A	ENST00000354546.5	-	19	1730	c.1503C>T	c.(1501-1503)ctC>ctT	p.L501L	ANXA6_ENST00000377751.5_Silent_p.L158L|ANXA6_ENST00000356496.5_Silent_p.L501L|ANXA6_ENST00000521512.1_Silent_p.L294L|ANXA6_ENST00000523714.1_Silent_p.L469L	NM_001155.4	NP_001146.2	P08133	ANXA6_HUMAN	annexin A6	501					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|protein homooligomerization (GO:0051260)|regulation of muscle contraction (GO:0006937)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|cholesterol binding (GO:0015485)|GTP binding (GO:0005525)|ligand-gated ion channel activity (GO:0015276)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|lung(9)	12		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCAGAGAAATGAGGATCCTCC	0.592																																																	0													48.0	53.0	51.0					5																	150497334		1928	4135	6063	SO:0001819	synonymous_variant	309			J03578	CCDS47315.1, CCDS54941.1	5q33.1	2008-02-05			ENSG00000197043	ENSG00000197043		"""Annexins"""	544	protein-coding gene	gene with protein product		114070		ANX6		3258820	Standard	NM_001155		Approved		uc003ltl.2	P08133	OTTHUMG00000164179	ENST00000354546.5:c.1503C>T	5.37:g.150497334G>A			B7Z8A7|D3DQH4|E9PGK1|Q6ZT79	Silent	SNP	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinVI,prints_AnnexinIV	p.L501	ENST00000354546.5	37	c.1503	CCDS47315.1	5																																																																																			ANXA6	-	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat		0.592	ANXA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANXA6	HGNC	protein_coding	OTTHUMT00000377668.2	G	NM_001155		150497334	-1	no_errors	ENST00000354546	ensembl	human	known	70_37	silent	SNP	0.566	A
AQP2	359	genome.wustl.edu	37	12	50348450	50348450	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr12:50348450C>T	ENST00000199280.3	+	3	648	c.563C>T	c.(562-564)tCc>tTc	p.S188F	RP11-469H8.6_ENST00000552379.1_RNA|RP11-469H8.8_ENST00000552806.1_RNA|RP11-469H8.6_ENST00000550530.1_RNA	NM_000486.5	NP_000477.1	P41181	AQP2_HUMAN	aquaporin 2 (collecting duct)	188					actin filament depolymerization (GO:0030042)|aging (GO:0007568)|apoptotic process (GO:0006915)|cell volume homeostasis (GO:0006884)|cellular response to copper ion (GO:0071280)|cellular response to mercury ion (GO:0071288)|cellular response to water deprivation (GO:0042631)|excretion (GO:0007588)|female pregnancy (GO:0007565)|glycerol transport (GO:0015793)|hyperosmotic response (GO:0006972)|metanephric collecting duct development (GO:0072205)|positive regulation of calcium ion transport (GO:0051928)|renal water transport (GO:0003097)|response to calcium ion (GO:0051592)|response to glucagon (GO:0033762)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to salt stress (GO:0009651)|response to starvation (GO:0042594)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|exocytic vesicle (GO:0070382)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|recycling endosome (GO:0055037)|rough endoplasmic reticulum (GO:0005791)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	glycerol transmembrane transporter activity (GO:0015168)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(4)|ovary(2)	10						CCTGCCCGCTCCCTGGCTCCA	0.552																																																	0													143.0	124.0	131.0					12																	50348450		2203	4300	6503	SO:0001583	missense	359				CCDS8792.1	12q12-q13	2014-09-17				ENSG00000167580		"""Ion channels / Aquaporins"""	634	protein-coding gene	gene with protein product		107777				7512890	Standard	NM_000486		Approved		uc001rvn.3	P41181		ENST00000199280.3:c.563C>T	12.37:g.50348450C>T	ENSP00000199280:p.Ser188Phe		Q9UD68	Missense_Mutation	SNP	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,tigrfam_MIP	p.S188F	ENST00000199280.3	37	c.563	CCDS8792.1	12	.	.	.	.	.	.	.	.	.	.	c	29.2	4.982958	0.93044	.	.	ENSG00000167580	ENST00000199280;ENST00000550862	D;T	0.94417	-3.42;0.69	5.3	5.3	0.74995	Aquaporin-like (2);	0.000000	0.64402	D	0.000004	D	0.98717	0.9569	H	0.99770	4.765	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	D	0.99320	1.0906	10	0.87932	D	0	-30.9018	16.8254	0.85929	0.0:1.0:0.0:0.0	.	188	P41181	AQP2_HUMAN	F	188;230	ENSP00000199280:S188F;ENSP00000450022:S230F	ENSP00000199280:S188F	S	+	2	0	AQP2	48634717	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.450000	0.80656	2.653000	0.90120	0.556000	0.70494	TCC	AQP2	-	pfam_MIP,superfamily_Aquaporin-like,tigrfam_MIP		0.552	AQP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP2	HGNC	protein_coding	OTTHUMT00000405540.1	C	NM_000486		50348450	+1	no_errors	ENST00000199280	ensembl	human	known	70_37	missense	SNP	1.000	T
ARMC6	93436	genome.wustl.edu	37	19	19166203	19166203	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr19:19166203C>A	ENST00000535612.1	+	7	1585	c.1153C>A	c.(1153-1155)Cag>Aag	p.Q385K	ARMC6_ENST00000546344.1_Missense_Mutation_p.Q292K|ARMC6_ENST00000392335.2_Missense_Mutation_p.Q360K|ARMC6_ENST00000392336.3_Missense_Mutation_p.Q385K|ARMC6_ENST00000269932.6_Missense_Mutation_p.Q360K	NM_001199196.1	NP_001186125.1	Q6NXE6	ARMC6_HUMAN	armadillo repeat containing 6	385					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(5)|ovary(1)|prostate(1)	14			OV - Ovarian serous cystadenocarcinoma(5;5.66e-06)|Epithelial(12;0.000391)			GACCAGCCCCCAGGTACCCAC	0.602																																																	0													71.0	58.0	62.0					19																	19166203		2203	4300	6503	SO:0001583	missense	93436			BX648486	CCDS32965.1, CCDS56089.1	19p13	2013-02-14				ENSG00000105676		"""Armadillo repeat containing"""	25049	protein-coding gene	gene with protein product						12477932	Standard	NM_033415		Approved	MGC19595	uc002nlc.3	Q6NXE6		ENST00000535612.1:c.1153C>A	19.37:g.19166203C>A	ENSP00000444156:p.Gln385Lys		B4DI98|O94999|Q9BTH5	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.Q385K	ENST00000535612.1	37	c.1153	CCDS56089.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.96|14.96	2.690681|2.690681	0.48097|0.48097	.|.	.|.	ENSG00000105676|ENSG00000105676	ENST00000535478;ENST00000535795|ENST00000392335;ENST00000535612;ENST00000269932;ENST00000546344;ENST00000379532;ENST00000392336	T;T|T;T;T;T;T	0.52754|0.46819	0.75;0.65|0.86;0.86;0.86;0.86;0.86	4.88|4.88	4.88|4.88	0.63580|0.63580	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.230563	.|0.36972	.|N	.|0.002319	T|T	0.46964|0.46964	0.1420|0.1420	L|L	0.54323|0.54323	1.7|1.7	0.47584|0.47584	D|D	0.999464|0.999464	.|D	.|0.58970	.|0.984	.|P	.|0.46110	.|0.504	T|T	0.41124|0.41124	-0.9526|-0.9526	7|10	0.35671|0.12103	T|T	0.21|0.63	-28.5352|-28.5352	17.0086|17.0086	0.86400|0.86400	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|385	.|Q6NXE6	.|ARMC6_HUMAN	Q|K	74;48|360;385;360;292;296;385	ENSP00000446234:P74Q;ENSP00000444265:P48Q|ENSP00000376147:Q360K;ENSP00000444156:Q385K;ENSP00000269932:Q360K;ENSP00000444341:Q292K;ENSP00000376148:Q385K	ENSP00000446234:P74Q|ENSP00000269932:Q360K	P|Q	+|+	2|1	0|0	ARMC6|ARMC6	19027203|19027203	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.142000|0.142000	0.21351|0.21351	4.938000|4.938000	0.63519|0.63519	2.271000|2.271000	0.75665|0.75665	0.563000|0.563000	0.77884|0.77884	CCA|CAG	ARMC6	-	superfamily_ARM-type_fold,smart_Armadillo		0.602	ARMC6-001	KNOWN	basic|CCDS	protein_coding	ARMC6	HGNC	protein_coding	OTTHUMT00000403226.1	C	NM_033415		19166203	+1	no_errors	ENST00000392336	ensembl	human	known	70_37	missense	SNP	1.000	A
ATAD2	29028	genome.wustl.edu	37	8	124359381	124359381	+	Silent	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr8:124359381C>T	ENST00000287394.5	-	16	2270	c.2163G>A	c.(2161-2163)caG>caA	p.Q721Q	MIR548AA1_ENST00000384971.2_RNA|ATAD2_ENST00000521903.1_Silent_p.Q39Q	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	721					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GAAATACTCTCTGCAGGGCTT	0.403																																																	0													109.0	110.0	109.0					8																	124359381		2203	4300	6503	SO:0001819	synonymous_variant	29028			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.2163G>A	8.37:g.124359381C>T			Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Silent	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.Q721	ENST00000287394.5	37	c.2163	CCDS6343.1	8																																																																																			ATAD2	-	NULL		0.403	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2	C	NM_014109		124359381	-1	no_errors	ENST00000287394	ensembl	human	known	70_37	silent	SNP	0.992	T
ATP10D	57205	genome.wustl.edu	37	4	47565612	47565612	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr4:47565612G>A	ENST00000273859.3	+	15	2952	c.2683G>A	c.(2683-2685)Gaa>Aaa	p.E895K		NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	895					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						TACTGGCATTGAAGACCGTCT	0.463																																																	0													95.0	85.0	88.0					4																	47565612		2203	4300	6503	SO:0001583	missense	57205			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.2683G>A	4.37:g.47565612G>A	ENSP00000273859:p.Glu895Lys		A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.E895K	ENST00000273859.3	37	c.2683	CCDS3476.1	4	.	.	.	.	.	.	.	.	.	.	G	26.3	4.726719	0.89298	.	.	ENSG00000145246	ENST00000273859	T	0.68479	-0.33	5.22	5.22	0.72569	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.113958	0.64402	D	0.000018	D	0.85716	0.5761	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.88629	0.3168	10	0.87932	D	0	-22.3901	17.9434	0.89032	0.0:0.0:1.0:0.0	.	895	Q9P241	AT10D_HUMAN	K	895	ENSP00000273859:E895K	ENSP00000273859:E895K	E	+	1	0	ATP10D	47260369	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.123000	0.77176	2.716000	0.92895	0.591000	0.81541	GAA	ATP10D	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr		0.463	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	HGNC	protein_coding	OTTHUMT00000216900.1	G	NM_020453		47565612	+1	no_errors	ENST00000273859	ensembl	human	known	70_37	missense	SNP	1.000	A
C16orf70	80262	genome.wustl.edu	37	16	67179511	67179511	+	Silent	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr16:67179511G>A	ENST00000219139.3	+	14	1277	c.1089G>A	c.(1087-1089)gaG>gaA	p.E363E	C16orf70_ENST00000569600.1_Silent_p.E363E	NM_025187.3	NP_079463.2	Q9BSU1	CP070_HUMAN	chromosome 16 open reading frame 70	363										cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|skin(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		ACCCTGTGGAGAAGCCTGTTG	0.597																																																	0													74.0	63.0	67.0					16																	67179511		2199	4300	6499	SO:0001819	synonymous_variant	80262			AK022138	CCDS10828.1	16q22.1	2011-01-25	2006-04-12	2006-04-12	ENSG00000125149	ENSG00000125149			29564	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 6"""	C16orf6, LIN10		12477932	Standard	NM_025187		Approved	lin-10, FLJ12076	uc002erd.3	Q9BSU1	OTTHUMG00000137510	ENST00000219139.3:c.1089G>A	16.37:g.67179511G>A			Q9HA86	Silent	SNP	pfam_UPF0183	p.E363	ENST00000219139.3	37	c.1089	CCDS10828.1	16																																																																																			C16orf70	-	pfam_UPF0183		0.597	C16orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf70	HGNC	protein_coding	OTTHUMT00000268829.2	G	NM_025187		67179511	+1	no_errors	ENST00000219139	ensembl	human	known	70_37	silent	SNP	1.000	A
C2CD3	26005	genome.wustl.edu	37	11	73785628	73785628	+	Missense_Mutation	SNP	C	C	T	rs111402521		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr11:73785628C>T	ENST00000334126.7	-	24	4847	c.4621G>A	c.(4621-4623)Gga>Aga	p.G1541R	C2CD3_ENST00000313663.7_Missense_Mutation_p.G1541R			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1541					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					GCATTTCGTCCAAACAGAGGA	0.488																																																	0													39.0	37.0	38.0					11																	73785628		2200	4293	6493	SO:0001583	missense	26005			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.4621G>A	11.37:g.73785628C>T	ENSP00000334379:p.Gly1541Arg		C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	p.G1541R	ENST00000334126.7	37	c.4621		11	.	.	.	.	.	.	.	.	.	.	C	8.941	0.965814	0.18583	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681;ENST00000414160	D;D;D	0.89270	-2.49;-2.49;-2.49	5.51	4.59	0.56863	.	0.173879	0.50627	D	0.000114	T	0.73860	0.3641	N	0.20401	0.57	0.35676	D	0.813714	P	0.37914	0.611	B	0.35550	0.205	T	0.73107	-0.4087	10	0.07482	T	0.82	-14.1874	4.6015	0.12356	0.0:0.6101:0.1885:0.2014	.	1541	Q4AC94-1	.	R	1541;1541;1522;349	ENSP00000334379:G1541R;ENSP00000323339:G1541R;ENSP00000388750:G349R	ENSP00000323339:G1541R	G	-	1	0	C2CD3	73463276	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.473000	0.45145	2.756000	0.94617	0.655000	0.94253	GGA	C2CD3	-	NULL		0.488	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	C2CD3	HGNC	protein_coding		C	NM_015531		73785628	-1	no_errors	ENST00000334126	ensembl	human	known	70_37	missense	SNP	1.000	T
C8orf44	56260	genome.wustl.edu	37	8	67592258	67592258	+	3'UTR	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr8:67592258G>C	ENST00000519561.1	+	0	700				C8orf44-SGK3_ENST00000519289.1_5'UTR|C8orf44-SGK3_ENST00000520044.1_3'UTR|C8orf44_ENST00000390159.3_3'UTR|C8orf44_ENST00000518860.1_3'UTR	NM_019607.2	NP_062553.1	Q96CB5	CH044_HUMAN	chromosome 8 open reading frame 44							nucleus (GO:0005634)				endometrium(1)|kidney(1)|lung(2)	4	Breast(64;0.186)		Epithelial(68;0.000959)|OV - Ovarian serous cystadenocarcinoma(28;0.00318)|all cancers(69;0.00363)|BRCA - Breast invasive adenocarcinoma(89;0.149)			CGGGAGTGTTGAGTAAGTGAA	0.398																																																	0																																										SO:0001624	3_prime_UTR_variant	56260			AK002129	CCDS6193.1	8q13.1	2012-05-16		2005-08-09	ENSG00000213865	ENSG00000213865			25646	protein-coding gene	gene with protein product						12477932	Standard	NM_019607		Approved	FLJ11267	uc003xwo.2	Q96CB5	OTTHUMG00000164562	ENST00000519561.1:c.*69G>C	8.37:g.67592258G>C			Q9NUM6	RNA	SNP	-	NULL	ENST00000519561.1	37	NULL	CCDS6193.1	8																																																																																			C8orf44	-	-		0.398	C8orf44-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C8orf44	HGNC	protein_coding	OTTHUMT00000379242.2	G	NM_019607		67592258	+1	no_errors	ENST00000518860	ensembl	human	known	70_37	rna	SNP	0.340	C
CCDC50	152137	genome.wustl.edu	37	3	191047505	191047505	+	Silent	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr3:191047505C>G	ENST00000392455.3	+	1	640	c.42C>G	c.(40-42)gtC>gtG	p.V14V	CCDC50_ENST00000392456.3_Silent_p.V14V|UTS2B_ENST00000340524.5_Intron|UTS2B_ENST00000490825.1_5'Flank	NM_174908.3	NP_777568.1	Q8IVM0	CCD50_HUMAN	coiled-coil domain containing 50	14						cytoplasm (GO:0005737)	ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|stomach(1)	23	all_cancers(143;8.88e-09)|Ovarian(172;0.103)|Breast(254;0.221)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000136)		TGCCTGGAGTCAAGGAAGGTA	0.692																																																	0													25.0	27.0	27.0					3																	191047505		2201	4296	6497	SO:0001819	synonymous_variant	152137			AJ416916	CCDS33912.1, CCDS33913.1	3q28	2010-12-24		2005-12-23	ENSG00000152492	ENSG00000152492			18111	protein-coding gene	gene with protein product		611051	"""deafness, autosomal dominant 44"""	C3orf6, DFNA44		16803894, 17503326	Standard	NM_178335		Approved	Ymer	uc003fsv.3	Q8IVM0	OTTHUMG00000156177	ENST00000392455.3:c.42C>G	3.37:g.191047505C>G			Q86VH7	Silent	SNP	NULL	p.V14	ENST00000392455.3	37	c.42	CCDS33913.1	3																																																																																			CCDC50	-	NULL		0.692	CCDC50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC50	HGNC	protein_coding	OTTHUMT00000343315.1	C	NM_174908		191047505	+1	no_errors	ENST00000392456	ensembl	human	known	70_37	silent	SNP	0.991	G
CDKN2AIP	55602	genome.wustl.edu	37	4	184367811	184367811	+	Missense_Mutation	SNP	C	C	T	rs368122042		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr4:184367811C>T	ENST00000504169.1	+	3	1181	c.974C>T	c.(973-975)tCa>tTa	p.S325L	CDKN2AIP_ENST00000506835.1_3'UTR|CDKN2AIP_ENST00000302350.4_3'UTR	NM_017632.2	NP_060102.1	Q9NXV6	CARF_HUMAN	CDKN2A interacting protein	325	Ser-rich.				negative regulation of cell growth (GO:0030308)|positive regulation of signal transduction (GO:0009967)|regulation of protein stability (GO:0031647)	cytoplasm (GO:0005737)|granular component (GO:0001652)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	p53 binding (GO:0002039)|RNA binding (GO:0003723)			endometrium(1)|kidney(2)|large_intestine(2)|lung(1)	6		all_lung(41;6.9e-12)|Lung NSC(41;1.28e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		AAAACTAGTTCAGAGGCAAGT	0.443																																																	0								C	LEU/SER	0,4406		0,0,2203	89.0	89.0	89.0		974	4.6	1.0	4		89	1,8599	1.2+/-3.3	0,1,4299	no	missense	CDKN2AIP	NM_017632.2	145	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	325/581	184367811	1,13005	2203	4300	6503	SO:0001583	missense	55602			AK000043	CCDS34110.1	4q35.1	2008-02-05			ENSG00000168564	ENSG00000168564			24325	protein-coding gene	gene with protein product	"""collaborates/cooperates with ARF (alternate reading frame) protein"""	615914				12154087, 16803988	Standard	NM_017632		Approved	FLJ20036, CARF	uc003ivp.1	Q9NXV6	OTTHUMG00000160626	ENST00000504169.1:c.974C>T	4.37:g.184367811C>T	ENSP00000427108:p.Ser325Leu		Q8TBM5|Q9NYH0	Missense_Mutation	SNP	pfam_DUF3469,pfscan_Ds-RNA-bd	p.S325L	ENST00000504169.1	37	c.974	CCDS34110.1	4	.	.	.	.	.	.	.	.	.	.	C	13.73	2.324781	0.41197	0.0	1.16E-4	ENSG00000168564	ENST00000504169	.	.	.	5.49	4.63	0.57726	.	0.000000	0.47852	D	0.000212	T	0.59115	0.2170	M	0.64404	1.975	0.80722	D	1	B	0.12630	0.006	B	0.09377	0.004	T	0.59815	-0.7383	9	0.62326	D	0.03	-8.3655	13.1994	0.59758	0.0:0.9252:0.0:0.0748	.	325	Q9NXV6	CARF_HUMAN	L	325	.	ENSP00000427108:S325L	S	+	2	0	CDKN2AIP	184604805	0.949000	0.32298	1.000000	0.80357	0.996000	0.88848	2.419000	0.44671	2.865000	0.98341	0.655000	0.94253	TCA	CDKN2AIP	-	NULL		0.443	CDKN2AIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKN2AIP	HGNC	protein_coding	OTTHUMT00000361488.1	C	NM_017632		184367811	+1	no_errors	ENST00000504169	ensembl	human	known	70_37	missense	SNP	1.000	T
CEP128	145508	genome.wustl.edu	37	14	80997191	80997191	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr14:80997191C>G	ENST00000555265.1	-	22	3295	c.2920G>C	c.(2920-2922)Gag>Cag	p.E974Q	CEP128_ENST00000281129.3_Missense_Mutation_p.E974Q|CEP128_ENST00000553717.1_5'UTR			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	974						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						CTCAGTTTCTCAGGCACAGAC	0.378																																																	0													90.0	85.0	86.0					14																	80997191		2203	4300	6503	SO:0001583	missense	145508			AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.2920G>C	14.37:g.80997191C>G	ENSP00000451162:p.Glu974Gln		B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	NULL	p.E974Q	ENST00000555265.1	37	c.2920	CCDS32130.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.8|23.8	4.464024|4.464024	0.84425|0.84425	.|.	.|.	ENSG00000100629|ENSG00000100629	ENST00000281129;ENST00000555265;ENST00000393619|ENST00000556061	T;T|.	0.42131|.	0.98;0.98|.	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	0.068672|.	0.56097|.	D|.	0.000031|.	T|.	0.73659|.	0.3615|.	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.74023|.	0.982|.	T|.	0.69518|.	-0.5124|.	10|.	0.42905|.	T|.	0.14|.	.|.	20.0303|20.0303	0.97534|0.97534	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	974|.	Q6ZU80|.	CE128_HUMAN|.	Q|S	974|39	ENSP00000281129:E974Q;ENSP00000451162:E974Q|.	ENSP00000281129:E974Q|.	E|X	-|-	1|2	0|2	CEP128|CEP128	80066944|80066944	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.368000|4.368000	0.59505|0.59505	2.794000|2.794000	0.96219|0.96219	0.650000|0.650000	0.86243|0.86243	GAG|TGA	CEP128	-	NULL		0.378	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP128	HGNC	protein_coding	OTTHUMT00000413415.1	C	NM_152446		80997191	-1	no_errors	ENST00000281129	ensembl	human	known	70_37	missense	SNP	1.000	G
CHST11	50515	genome.wustl.edu	37	12	105151050	105151050	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr12:105151050G>C	ENST00000303694.5	+	3	967	c.528G>C	c.(526-528)ttG>ttC	p.L176F	CHST11_ENST00000549260.1_Missense_Mutation_p.L171F	NM_018413.5	NP_060883.1	Q9NPF2	CHSTB_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 11	176					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondrocyte development (GO:0002063)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|developmental growth (GO:0048589)|embryonic digit morphogenesis (GO:0042733)|embryonic viscerocranium morphogenesis (GO:0048703)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|polysaccharide localization (GO:0033037)|post-anal tail morphogenesis (GO:0036342)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)	18						ACCACCGCTTGAAAAGCTACA	0.547																																																	0													75.0	68.0	70.0					12																	105151050		2203	4300	6503	SO:0001583	missense	50515			AB042326	CCDS9099.1, CCDS55878.1	12q23.3	2008-02-05				ENSG00000171310	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17422	protein-coding gene	gene with protein product		610128				10781601	Standard	NM_018413		Approved	C4ST1, C4St-1, C4ST, HSA269537	uc001tkz.3	Q9NPF2	OTTHUMG00000169803	ENST00000303694.5:c.528G>C	12.37:g.105151050G>C	ENSP00000305725:p.Leu176Phe		A8K4F8|Q9NXY6|Q9NY36	Missense_Mutation	SNP	pfam_Sulfotransferase	p.L176F	ENST00000303694.5	37	c.528	CCDS9099.1	12	.	.	.	.	.	.	.	.	.	.	G	17.06	3.292155	0.59976	.	.	ENSG00000171310	ENST00000549260;ENST00000303694;ENST00000549016	T;T;T	0.77489	-1.1;-1.1;-1.1	5.42	3.52	0.40303	.	0.000000	0.85682	D	0.000000	D	0.90000	0.6878	M	0.92026	3.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.91362	0.5112	10	0.59425	D	0.04	-15.1687	15.5233	0.75881	0.0:0.2626:0.7374:0.0	.	171;176	Q9NPF2-2;Q9NPF2	.;CHSTB_HUMAN	F	171;176;136	ENSP00000450004:L171F;ENSP00000305725:L176F;ENSP00000449095:L136F	ENSP00000305725:L176F	L	+	3	2	CHST11	103675180	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.888000	0.39708	0.613000	0.30089	0.655000	0.94253	TTG	CHST11	-	pfam_Sulfotransferase		0.547	CHST11-001	KNOWN	basic|CCDS	protein_coding	CHST11	HGNC	protein_coding	OTTHUMT00000405960.2	G	NM_018413		105151050	+1	no_errors	ENST00000303694	ensembl	human	known	70_37	missense	SNP	1.000	C
CLEC11A	6320	genome.wustl.edu	37	19	51228562	51228562	+	Silent	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr19:51228562C>T	ENST00000250340.4	+	4	1007	c.810C>T	c.(808-810)ccC>ccT	p.P270P	CLEC11A_ENST00000599973.1_Nonsense_Mutation_p.R287*	NM_002975.2	NP_002966.1	Q9Y240	CLC11_HUMAN	C-type lectin domain family 11, member A	270	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|growth factor activity (GO:0008083)			kidney(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	7		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CACCCCGCCCCGAGCTCGGCG	0.721																																																	0													11.0	14.0	13.0					19																	51228562		2176	4246	6422	SO:0001819	synonymous_variant	6320			AF087658	CCDS12800.1	19q13.3	2010-04-27	2005-02-09	2005-02-11		ENSG00000105472		"""C-type lectin domain containing"""	10576	protein-coding gene	gene with protein product		604713	"""stem cell growth factor; lymphocyte secreted C-type lectin"""	SCGF		9207134, 9442024	Standard	NM_002975		Approved	P47, LSLCL, CLECSF3	uc002psy.3	Q9Y240		ENST00000250340.4:c.810C>T	19.37:g.51228562C>T			B2RAD4	Nonsense_Mutation	SNP	NULL	p.R287*	ENST00000250340.4	37	c.859	CCDS12800.1	19																																																																																			CLEC11A	-	NULL		0.721	CLEC11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC11A	HGNC	protein_coding	OTTHUMT00000464062.1	C	NM_002975		51228562	+1	no_errors	ENST00000599973	ensembl	human	novel	70_37	nonsense	SNP	0.006	T
CPN1	1369	genome.wustl.edu	37	10	101835718	101835718	+	Missense_Mutation	SNP	G	G	C	rs374761550		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr10:101835718G>C	ENST00000370418.3	-	2	621	c.370C>G	c.(370-372)Cac>Gac	p.H124D		NM_001308.2	NP_001299.1	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1	124	Catalytic.				response to glucocorticoid (GO:0051384)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	33		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		GGCAGGATGTGAATGCGCGTG	0.607																																																	0													132.0	108.0	116.0					10																	101835718		2203	4300	6503	SO:0001583	missense	1369			X14329	CCDS7486.1	10q24.2	2012-02-10	2007-02-23		ENSG00000120054	ENSG00000120054	3.4.17.3		2312	protein-coding gene	gene with protein product	"""anaphylatoxin inactivator"", ""arginine carboxypeptidase"", ""carboxypeptidase K"", ""kininase I"", ""lysine carboxypeptidase"""	603103	"""carboxypeptidase N, polypeptide 1, 50kD"""			9628828, 2912725	Standard	NM_001308		Approved		uc001kql.2	P15169	OTTHUMG00000018896	ENST00000370418.3:c.370C>G	10.37:g.101835718G>C	ENSP00000359446:p.His124Asp		B1AP59	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_DUF2817,superfamily_CarboxyPept-like_regulatory,smart_Peptidase_M14,prints_Peptidase_M14	p.H124D	ENST00000370418.3	37	c.370	CCDS7486.1	10	.	.	.	.	.	.	.	.	.	.	G	22.5	4.298637	0.81025	.	.	ENSG00000120054	ENST00000370418	T	0.11821	2.74	5.74	5.74	0.90152	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.47728	0.1461	M	0.88241	2.94	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	T	0.54050	-0.8351	10	0.87932	D	0	-31.9828	19.9352	0.97137	0.0:0.0:1.0:0.0	.	124	P15169	CBPN_HUMAN	D	124	ENSP00000359446:H124D	ENSP00000359446:H124D	H	-	1	0	CPN1	101825708	1.000000	0.71417	0.997000	0.53966	0.324000	0.28378	9.866000	0.99616	2.724000	0.93272	0.655000	0.94253	CAC	CPN1	-	pfam_Peptidase_M14,smart_Peptidase_M14		0.607	CPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPN1	HGNC	protein_coding	OTTHUMT00000049828.1	G	NM_001308		101835718	-1	no_errors	ENST00000370418	ensembl	human	known	70_37	missense	SNP	1.000	C
CPNE6	9362	genome.wustl.edu	37	14	24545480	24545480	+	Silent	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr14:24545480G>A	ENST00000397016.2	+	12	1358	c.1047G>A	c.(1045-1047)caG>caA	p.Q349Q	CPNE6_ENST00000216775.2_Silent_p.Q349Q|CPNE6_ENST00000537691.1_Silent_p.Q404Q	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	349	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		GCATCTGCCAGGACTATGACA	0.622																																																	0													76.0	76.0	76.0					14																	24545480		2203	4300	6503	SO:0001819	synonymous_variant	9362			AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.1047G>A	14.37:g.24545480G>A			B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Silent	SNP	pfam_Copine,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_VWF_A,pfscan_C2_membr_targeting,pfscan_VWF_A	p.Q404	ENST00000397016.2	37	c.1212	CCDS9607.1	14																																																																																			CPNE6	-	pfam_Copine,smart_VWF_A,pfscan_VWF_A		0.622	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE6	HGNC	protein_coding	OTTHUMT00000071869.5	G			24545480	+1	no_errors	ENST00000537691	ensembl	human	known	70_37	silent	SNP	1.000	A
CRYBG3	131544	genome.wustl.edu	37	3	97596165	97596165	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr3:97596165G>C	ENST00000182096.4	+	1	347	c.283G>C	c.(283-285)Gag>Cag	p.E95Q		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2043							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						TGAAAGGTCTGAGAGTAGAAC	0.433																																																	0													58.0	57.0	57.0					3																	97596165		1929	4138	6067	SO:0001583	missense	131544					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.283G>C	3.37:g.97596165G>C	ENSP00000182096:p.Glu95Gln		B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.E95Q	ENST00000182096.4	37	c.283		3	.	.	.	.	.	.	.	.	.	.	G	13.74	2.327351	0.41197	.	.	ENSG00000080200	ENST00000182096	T	0.75050	-0.9	5.84	4.96	0.65561	.	0.120682	0.40818	N	0.001014	T	0.60843	0.2300	L	0.32530	0.975	0.80722	D	1	P	0.44734	0.842	B	0.37731	0.257	T	0.65492	-0.6155	10	0.62326	D	0.03	.	9.6349	0.39802	0.1451:0.0:0.8549:0.0	.	95	Q68DQ2	CRBG3_HUMAN	Q	95	ENSP00000182096:E95Q	ENSP00000182096:E95Q	E	+	1	0	CRYBG3	99078855	1.000000	0.71417	1.000000	0.80357	0.641000	0.38312	2.924000	0.48876	2.777000	0.95525	0.650000	0.86243	GAG	CRYBG3	-	NULL		0.433	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	CRYBG3	HGNC	protein_coding	OTTHUMT00000353751.1	G	NM_153605		97596165	+1	no_errors	ENST00000182096	ensembl	human	known	70_37	missense	SNP	0.997	C
CTNND1	1500	genome.wustl.edu	37	11	57569478	57569478	+	Silent	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr11:57569478C>T	ENST00000399050.4	+	7	1766	c.1230C>T	c.(1228-1230)atC>atT	p.I410I	CTNND1_ENST00000529873.1_Silent_p.I356I|CTNND1_ENST00000525902.1_Silent_p.I87I|CTNND1_ENST00000530748.1_Silent_p.I356I|CTNND1_ENST00000532463.1_Silent_p.I309I|CTNND1_ENST00000529986.1_Silent_p.I309I|CTNND1_ENST00000361796.4_Silent_p.I410I|CTNND1_ENST00000361391.6_Silent_p.I410I|CTNND1_ENST00000531014.1_Silent_p.I87I|CTNND1_ENST00000527467.1_Silent_p.I87I|CTNND1_ENST00000528232.1_Silent_p.I309I|CTNND1_ENST00000358694.6_Silent_p.I410I|CTNND1_ENST00000399039.4_Silent_p.I410I|CTNND1_ENST00000524630.1_Silent_p.I410I|CTNND1_ENST00000532649.1_Silent_p.I356I|CTNND1_ENST00000526772.1_Silent_p.I87I|CTNND1_ENST00000426142.2_Silent_p.I309I|CTNND1_ENST00000533667.1_Silent_p.I87I|CTNND1_ENST00000415361.2_Silent_p.I309I|CTNND1_ENST00000360682.6_Silent_p.I410I|CTNND1_ENST00000526938.1_Silent_p.I410I|CTNND1_ENST00000528621.1_Silent_p.I356I|CTNND1_ENST00000428599.2_Silent_p.I410I|CTNND1_ENST00000529919.1_Silent_p.I410I|CTNND1_ENST00000532245.1_Silent_p.I309I|CTNND1_ENST00000361332.4_Silent_p.I410I|CTNND1_ENST00000530094.1_Silent_p.I309I|CTNND1_ENST00000534579.1_Silent_p.I356I|CTNND1_ENST00000529526.1_Silent_p.I356I|CTNND1_ENST00000526357.1_Silent_p.I356I|CTNND1_ENST00000532787.1_Silent_p.I309I|CTNND1_ENST00000532844.1_Silent_p.I356I	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	410					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)			breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				TCAAGGGCATCCCAGTACTGG	0.502																																																	0													141.0	142.0	142.0					11																	57569478		1995	4178	6173	SO:0001819	synonymous_variant	1500			AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.1230C>T	11.37:g.57569478C>T			A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.I410	ENST00000399050.4	37	c.1230	CCDS44604.1	11																																																																																			CTNND1	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo		0.502	CTNND1-006	KNOWN	basic|CCDS	protein_coding	CTNND1	HGNC	protein_coding	OTTHUMT00000393944.1	C	NM_001331		57569478	+1	no_errors	ENST00000399050	ensembl	human	known	70_37	silent	SNP	1.000	T
CTSH	1512	genome.wustl.edu	37	15	79217722	79217722	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr15:79217722C>G	ENST00000220166.5	-	10	869	c.760G>C	c.(760-762)Gag>Cag	p.E254Q	CTSH_ENST00000534533.1_5'UTR	NM_004390.3	NP_004381.2	P09668	CATH_HUMAN	cathepsin H	254					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|bradykinin catabolic process (GO:0010815)|cellular response to thyroid hormone stimulus (GO:0097067)|dichotomous subdivision of terminal units involved in lung branching (GO:0060448)|ERK1 and ERK2 cascade (GO:0070371)|immune response-regulating signaling pathway (GO:0002764)|membrane protein proteolysis (GO:0033619)|metanephros development (GO:0001656)|negative regulation of apoptotic process (GO:0043066)|neuropeptide catabolic process (GO:0010813)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidase activity (GO:0010952)|protein destabilization (GO:0031648)|proteolysis (GO:0006508)|response to retinoic acid (GO:0032526)|spermatogenesis (GO:0007283)|surfactant homeostasis (GO:0043129)|T cell mediated cytotoxicity (GO:0001913)|zymogen activation (GO:0031638)	acrosomal vesicle (GO:0001669)|alveolar lamellar body (GO:0097208)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|outer dense fiber (GO:0001520)	aminopeptidase activity (GO:0004177)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|endopeptidase activity (GO:0004175)|HLA-A specific activating MHC class I receptor activity (GO:0030108)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|thyroid hormone binding (GO:0070324)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)	10						TGAGTCACCTCAAAGGCAAAG	0.572																																																	0													106.0	81.0	90.0					15																	79217722		2196	4293	6489	SO:0001583	missense	1512			X07549	CCDS10308.1	15q25.1	2014-01-28			ENSG00000103811	ENSG00000103811	3.4.22.16	"""Cathepsins"""	2535	protein-coding gene	gene with protein product		116820		CPSB		2849458	Standard	NM_004390		Approved	ACC-4, ACC-5	uc021srk.1	P09668	OTTHUMG00000144171	ENST00000220166.5:c.760G>C	15.37:g.79217722C>G	ENSP00000220166:p.Glu254Gln		B2RBK0|Q96NY6|Q9BUM7	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,pfam_Prot_inhib_I29,smart_Prot_inhib_I29,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.E254Q	ENST00000220166.5	37	c.760	CCDS10308.1	15	.	.	.	.	.	.	.	.	.	.	C	15.56	2.869752	0.51588	.	.	ENSG00000103811	ENST00000220166;ENST00000394758	T	0.22743	1.94	5.25	5.25	0.73442	Peptidase C1A, papain C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.26231	0.0640	N	0.21324	0.655	0.53005	D	0.999964	D;D	0.63046	0.992;0.977	P;P	0.54965	0.765;0.765	T	0.02009	-1.1230	10	0.72032	D	0.01	.	14.3354	0.66586	0.0:1.0:0.0:0.0	.	254;242	P09668;E9PBP2	CATH_HUMAN;.	Q	254;242	ENSP00000220166:E254Q	ENSP00000220166:E254Q	E	-	1	0	CTSH	77004777	0.993000	0.37304	0.999000	0.59377	0.541000	0.35023	2.885000	0.48570	2.465000	0.83290	0.467000	0.42956	GAG	CTSH	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C		0.572	CTSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSH	HGNC	protein_coding	OTTHUMT00000291370.1	C	NM_004390		79217722	-1	no_errors	ENST00000220166	ensembl	human	known	70_37	missense	SNP	1.000	G
CUL5	8065	genome.wustl.edu	37	11	107943062	107943062	+	Nonsense_Mutation	SNP	T	T	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr11:107943062T>G	ENST00000393094.2	+	9	1494	c.878T>G	c.(877-879)tTa>tGa	p.L293*		NM_003478.3	NP_003469.2	Q93034	CUL5_HUMAN	cullin 5	293					calcium ion transmembrane transport (GO:0070588)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cytosolic calcium ion homeostasis (GO:0051480)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|response to osmotic stress (GO:0006970)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul5-RING ubiquitin ligase complex (GO:0031466)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|receptor activity (GO:0004872)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		CTTCCAGAATTACATTTAATG	0.333																																																	0													93.0	90.0	91.0					11																	107943062		2201	4298	6499	SO:0001587	stop_gained	8065			X81882	CCDS31668.1	11q22.3	2011-05-24			ENSG00000166266	ENSG00000166266			2556	protein-coding gene	gene with protein product		601741				8681378, 9037604	Standard	XM_005271682		Approved	VACM-1	uc001pjv.3	Q93034	OTTHUMG00000166369	ENST00000393094.2:c.878T>G	11.37:g.107943062T>G	ENSP00000376808:p.Leu293*		A8K960|O14766|Q9BZC6	Nonsense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.L293*	ENST00000393094.2	37	c.878	CCDS31668.1	11	.	.	.	.	.	.	.	.	.	.	T	36	5.739049	0.96873	.	.	ENSG00000166266	ENST00000393094	.	.	.	5.23	5.23	0.72850	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.6417	15.1134	0.72380	0.0:0.0:0.0:1.0	.	.	.	.	X	293	.	ENSP00000376808:L293X	L	+	2	0	CUL5	107448272	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	8.008000	0.88588	1.980000	0.57719	0.533000	0.62120	TTA	CUL5	-	pfam_Cullin_N,superfamily_Cullin_repeat-like_dom		0.333	CUL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL5	HGNC	protein_coding	OTTHUMT00000389429.1	T			107943062	+1	no_errors	ENST00000393094	ensembl	human	known	70_37	nonsense	SNP	1.000	G
CYP4F2	8529	genome.wustl.edu	37	19	15989730	15989730	+	Missense_Mutation	SNP	T	T	C	rs4020346		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr19:15989730T>C	ENST00000221700.6	-	13	1509	c.1414A>G	c.(1414-1416)Acg>Gcg	p.T472A		NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2									p.T472A(1)		NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						ATCGCGAACGTCTGCCCGATG	0.672																																																	1	Substitution - Missense(1)	NS(1)											46.0	44.0	45.0					19																	15989730		2203	4300	6503	SO:0001583	missense	8529			U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.1414A>G	19.37:g.15989730T>C	ENSP00000221700:p.Thr472Ala			Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.T472A	ENST00000221700.6	37	c.1414	CCDS12336.1	19	.	.	.	.	.	.	.	.	.	.	t	0.826	-0.747040	0.03065	.	.	ENSG00000186115	ENST00000221700;ENST00000392846	T	0.67523	-0.27	2.47	0.198	0.15168	.	0.309092	0.23380	N	0.048811	T	0.45657	0.1353	L	0.29908	0.895	0.80722	D	1	B	0.02656	0.0	B	0.12156	0.007	T	0.09751	-1.0660	10	0.18710	T	0.47	.	5.6526	0.17625	0.0:0.2821:0.0:0.7179	rs4020346	472	P78329	CP4F2_HUMAN	A	472;323	ENSP00000221700:T472A	ENSP00000221700:T472A	T	-	1	0	CYP4F2	15850730	0.842000	0.29525	0.511000	0.27724	0.029000	0.11900	0.350000	0.20079	-0.177000	0.10690	-0.604000	0.04097	ACG	CYP4F2	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450		0.672	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4F2	HGNC	protein_coding	OTTHUMT00000460372.3	T	NM_001082		15989730	-1	no_errors	ENST00000221700	ensembl	human	known	70_37	missense	SNP	0.989	C
CYP4F11	57834	genome.wustl.edu	37	19	16045204	16045204	+	Silent	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr19:16045204G>A	ENST00000402119.4	-	1	441	c.15C>T	c.(13-15)agC>agT	p.S5S	CYP4F11_ENST00000326742.8_Silent_p.S5S|CYP4F11_ENST00000248041.8_Silent_p.S5S	NM_021187.3	NP_067010.3			cytochrome P450, family 4, subfamily F, polypeptide 11											NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						GCCAGGACAGGCTCAGCTGCG	0.692																																																	0													22.0	24.0	23.0					19																	16045204		2201	4294	6495	SO:0001819	synonymous_variant	57834			AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.15C>T	19.37:g.16045204G>A				Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.S5	ENST00000402119.4	37	c.15	CCDS12337.1	19																																																																																			CYP4F11	-	NULL		0.692	CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP4F11	HGNC	protein_coding	OTTHUMT00000460385.2	G	NM_021187		16045204	-1	no_errors	ENST00000248041	ensembl	human	known	70_37	silent	SNP	0.511	A
DNAH2	146754	genome.wustl.edu	37	17	7690336	7690336	+	Silent	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr17:7690336C>T	ENST00000572933.1	+	42	8048	c.6588C>T	c.(6586-6588)atC>atT	p.I2196I	DNAH2_ENST00000389173.2_Silent_p.I2196I			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2196	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GCGAGCGCATCGCGATGCCCG	0.637																																																	0													59.0	40.0	46.0					17																	7690336		2203	4300	6503	SO:0001819	synonymous_variant	146754			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.6588C>T	17.37:g.7690336C>T			A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.I2196	ENST00000572933.1	37	c.6588	CCDS32551.1	17																																																																																			DNAH2	-	pfam_ATPase_dyneun-rel_AAA		0.637	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	C	NM_020877		7690336	+1	no_errors	ENST00000389173	ensembl	human	known	70_37	silent	SNP	0.472	T
DNAH6	1768	genome.wustl.edu	37	2	84806723	84806723	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr2:84806723G>A	ENST00000237449.6	+	13	2157	c.2149G>A	c.(2149-2151)Gag>Aag	p.E717K	DNAH6_ENST00000389394.3_Missense_Mutation_p.E717K|DNAH6_ENST00000398278.2_Missense_Mutation_p.E717K			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	717	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						ACAAGATGCAGAGTATAAACT	0.353																																																	0													129.0	124.0	126.0					2																	84806723		2203	4300	6503	SO:0001583	missense	1768			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.2149G>A	2.37:g.84806723G>A	ENSP00000237449:p.Glu717Lys		A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.E717K	ENST00000237449.6	37	c.2149	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	G	13.62	2.291354	0.40494	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.23950	1.88;2.01;1.88	5.6	3.69	0.42338	.	0.000000	0.41194	D	0.000925	T	0.17916	0.0430	L	0.47716	1.5	0.30782	N	0.741898	B;B	0.21147	0.001;0.052	B;B	0.15052	0.003;0.012	T	0.09530	-1.0670	10	0.24483	T	0.36	.	4.2686	0.10775	0.0808:0.2807:0.4874:0.1511	.	717;296	Q9C0G6;Q9C0G6-3	DYH6_HUMAN;.	K	717	ENSP00000374045:E717K;ENSP00000381326:E717K;ENSP00000237449:E717K	ENSP00000237449:E717K	E	+	1	0	DNAH6	84660234	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.352000	0.52239	1.374000	0.46228	0.655000	0.94253	GAG	DNAH6	-	NULL		0.353	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	G	NM_001370		84806723	+1	no_errors	ENST00000237449	ensembl	human	known	70_37	missense	SNP	1.000	A
DNAH6	1768	genome.wustl.edu	37	2	84806735	84806735	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr2:84806735G>A	ENST00000237449.6	+	13	2169	c.2161G>A	c.(2161-2163)Gag>Aag	p.E721K	DNAH6_ENST00000389394.3_Missense_Mutation_p.E721K|DNAH6_ENST00000398278.2_Missense_Mutation_p.E721K			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	721	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GTATAAACTTGAGTTTGTTCC	0.348																																																	0													130.0	123.0	125.0					2																	84806735		2203	4300	6503	SO:0001583	missense	1768			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.2161G>A	2.37:g.84806735G>A	ENSP00000237449:p.Glu721Lys		A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.E721K	ENST00000237449.6	37	c.2161	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	G	12.34	1.908628	0.33721	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.24151	1.87;2.0;1.87	5.6	4.7	0.59300	.	0.000000	0.41194	D	0.000939	T	0.33556	0.0867	L	0.49350	1.555	0.32872	D	0.509406	B;D	0.56521	0.016;0.976	B;P	0.56398	0.01;0.797	T	0.24941	-1.0146	10	0.06365	T	0.9	.	13.8345	0.63402	0.0:0.2924:0.7076:0.0	.	721;300	Q9C0G6;Q9C0G6-3	DYH6_HUMAN;.	K	721	ENSP00000374045:E721K;ENSP00000381326:E721K;ENSP00000237449:E721K	ENSP00000237449:E721K	E	+	1	0	DNAH6	84660246	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.291000	0.65667	1.338000	0.45544	0.655000	0.94253	GAG	DNAH6	-	NULL		0.348	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	G	NM_001370		84806735	+1	no_errors	ENST00000237449	ensembl	human	known	70_37	missense	SNP	1.000	A
DSP	1832	genome.wustl.edu	37	6	7580551	7580552	+	Frame_Shift_Ins	INS	-	-	AG			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr6:7580551_7580552insAG	ENST00000379802.3	+	23	4469_4470	c.4128_4129insAG	c.(4129-4131)atcfs	p.I1377fs	DSP_ENST00000418664.2_Intron	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	1377	Central fibrous rod domain.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		CCAAGACCACCATCCACCAGCT	0.411																																																	0																																										SO:0001589	frameshift_variant	1832			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	Exception_encountered	6.37:g.7580551_7580552insAG	ENSP00000369129:p.Ile1377fs		B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Frame_Shift_Ins	INS	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.I1376fs	ENST00000379802.3	37	c.4128_4129	CCDS4501.1	6																																																																																			DSP	-	NULL		0.411	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSP	HGNC	protein_coding	OTTHUMT00000039786.2	-	NM_004415		7580552	+1	no_errors	ENST00000379802	ensembl	human	known	70_37	frame_shift_ins	INS	1.000:1.000	AG
DYNC1H1	1778	genome.wustl.edu	37	14	102466695	102466695	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr14:102466695C>T	ENST00000360184.4	+	18	4197	c.4033C>T	c.(4033-4035)Cag>Tag	p.Q1345*		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	1345	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GCAAATCGATCAGATGAAGGA	0.413																																																	0													126.0	127.0	127.0					14																	102466695		2203	4300	6503	SO:0001587	stop_gained	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.4033C>T	14.37:g.102466695C>T	ENSP00000348965:p.Gln1345*		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.Q1345*	ENST00000360184.4	37	c.4033	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	C	46	12.119425	0.99638	.	.	ENSG00000197102	ENST00000360184	.	.	.	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	20.5632	0.99335	0.0:1.0:0.0:0.0	.	.	.	.	X	1345	.	ENSP00000348965:Q1345X	Q	+	1	0	DYNC1H1	101536448	1.000000	0.71417	0.984000	0.44739	0.991000	0.79684	7.770000	0.85390	2.937000	0.99478	0.650000	0.86243	CAG	DYNC1H1	-	pfam_Dynein_heavy_dom-2		0.413	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	C	NM_001376		102466695	+1	no_errors	ENST00000360184	ensembl	human	known	70_37	nonsense	SNP	1.000	T
EDEM1	9695	genome.wustl.edu	37	3	5251877	5251877	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr3:5251877C>G	ENST00000256497.4	+	9	1660	c.1527C>G	c.(1525-1527)ttC>ttG	p.F509L	EDEM1_ENST00000445686.1_Missense_Mutation_p.F314L	NM_014674.2	NP_055489.1	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like 1	509					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	calcium ion binding (GO:0005509)|misfolded protein binding (GO:0051787)	p.F509L(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		AGAATCCCTTCTACCTCCATG	0.448																																																	1	Substitution - Missense(1)	urinary_tract(1)											136.0	122.0	127.0					3																	5251877		2203	4300	6503	SO:0001583	missense	9695			D86967	CCDS33686.1	3p26.1	2008-02-05			ENSG00000134109	ENSG00000134109			18967	protein-coding gene	gene with protein product		607673				12610306	Standard	NM_014674		Approved	KIAA0212, EDEM	uc003bqi.3	Q92611	OTTHUMG00000154896	ENST00000256497.4:c.1527C>G	3.37:g.5251877C>G	ENSP00000256497:p.Phe509Leu		A8K9C8|B4DXP3	Missense_Mutation	SNP	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.F509L	ENST00000256497.4	37	c.1527	CCDS33686.1	3	.	.	.	.	.	.	.	.	.	.	C	19.83	3.899981	0.72754	.	.	ENSG00000134109	ENST00000256497;ENST00000445686	T;T	0.71461	-0.57;-0.57	5.36	4.37	0.52481	.	0.000000	0.85682	D	0.000000	T	0.75206	0.3818	M	0.66297	2.02	0.80722	D	1	D	0.56287	0.975	P	0.60541	0.876	T	0.71497	-0.4575	10	0.22109	T	0.4	-31.4728	6.3808	0.21533	0.0:0.7845:0.0:0.2155	.	509	Q92611	EDEM1_HUMAN	L	509;314	ENSP00000256497:F509L;ENSP00000394099:F314L	ENSP00000256497:F509L	F	+	3	2	EDEM1	5226877	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.868000	0.39509	2.516000	0.84829	0.655000	0.94253	TTC	EDEM1	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47		0.448	EDEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDEM1	HGNC	protein_coding	OTTHUMT00000337566.2	C	NM_014674		5251877	+1	no_errors	ENST00000256497	ensembl	human	known	70_37	missense	SNP	1.000	G
EEF2	1938	genome.wustl.edu	37	19	3977937	3977937	+	Silent	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr19:3977937G>A	ENST00000309311.6	-	12	2035	c.1947C>T	c.(1945-1947)atC>atT	p.I649I		NM_001961.3	NP_001952.1	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2	649					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|positive regulation of gene expression (GO:0010628)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation activator activity (GO:0008494)|translation elongation factor activity (GO:0003746)			endometrium(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		CAAAGCACCAGATCTTGCGGG	0.632																																					Colon(165;1804 1908 4071 6587 18799)												0													75.0	69.0	71.0					19																	3977937		2203	4300	6503	SO:0001819	synonymous_variant	1938			Z11692	CCDS12117.1	19p13.3	2012-09-20			ENSG00000167658	ENSG00000167658			3214	protein-coding gene	gene with protein product	"""polypeptidyl-tRNA translocase"""	130610		EF2		2610926, 6427766	Standard	NM_001961		Approved	EEF-2	uc002lze.3	P13639		ENST00000309311.6:c.1947C>T	19.37:g.3977937G>A			B2RMP5|D6W618|Q58J86	Silent	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFG/EF2_IV,pfam_Transl_elong_EFG/EF2_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_elong_init/rib_B-barrel,superfamily_Elongation_fac_G/III/V,smart_Transl_elong_EFG/EF2_IV,smart_Transl_elong_EFG/EF2_C,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.I649	ENST00000309311.6	37	c.1947	CCDS12117.1	19																																																																																			EEF2	-	pfam_Transl_elong_EFG/EF2_IV,superfamily_Ribosomal_S5_D2-typ_fold,smart_Transl_elong_EFG/EF2_IV		0.632	EEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF2	HGNC	protein_coding	OTTHUMT00000457615.2	G	NM_001961		3977937	-1	no_errors	ENST00000309311	ensembl	human	known	70_37	silent	SNP	1.000	A
EIF2B3	8891	genome.wustl.edu	37	1	45363062	45363062	+	Silent	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:45363062C>T	ENST00000360403.2	-	6	747	c.621G>A	c.(619-621)ttG>ttA	p.L207L	EIF2B3_ENST00000372183.3_Silent_p.L207L	NM_001261418.1|NM_020365.4	NP_001248347.1|NP_065098.1	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa	207					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	guanyl-nucleotide exchange factor activity (GO:0005085)|nucleotidyltransferase activity (GO:0016779)|translation initiation factor activity (GO:0003743)			endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	17	Acute lymphoblastic leukemia(166;0.155)					TGTATTTTTTCAAACAGTAGA	0.368																																					Colon(26;357 658 2581 11857 12657)												0													70.0	67.0	68.0					1																	45363062		2203	4300	6503	SO:0001819	synonymous_variant	8891			AF257077	CCDS517.1, CCDS53313.1, CCDS72775.1	1p34.1	2008-02-05	2002-08-29		ENSG00000070785	ENSG00000070785			3259	protein-coding gene	gene with protein product		606273	"""eukaryotic translation initiation factor 2B, subunit 3 (gamma, 58kD)"""			10900014	Standard	NM_020365		Approved	EIF2Bgamma, EIF-2B	uc001cmt.3	Q9NR50	OTTHUMG00000008585	ENST00000360403.2:c.621G>A	1.37:g.45363062C>T			B2RBH8|D3DPZ2|Q5QP89|Q5QP90|Q8NDB5|Q8WV57|Q9H850	Silent	SNP	pfam_NTP_transferase	p.L207	ENST00000360403.2	37	c.621	CCDS517.1	1																																																																																			EIF2B3	-	NULL		0.368	EIF2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2B3	HGNC	protein_coding	OTTHUMT00000023724.1	C	NM_020365		45363062	-1	no_errors	ENST00000360403	ensembl	human	known	70_37	silent	SNP	1.000	T
EMC9	51016	genome.wustl.edu	37	14	24608392	24608392	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr14:24608392C>T	ENST00000419198.2	-	5	734	c.454G>A	c.(454-456)Gac>Aac	p.D152N	EMC9_ENST00000558200.1_5'Flank|EMC9_ENST00000560403.1_Missense_Mutation_p.D78N|RP11-468E2.5_ENST00000558478.1_lincRNA|EMC9_ENST00000216799.4_Missense_Mutation_p.D152N			Q9Y3B6	EMC9_HUMAN	ER membrane protein complex subunit 9	152						cytoplasm (GO:0005737)|ER membrane protein complex (GO:0072546)											TCTTCCCAGTCCCTCCACATC	0.532																																																	0													92.0	92.0	92.0					14																	24608392		2203	4300	6503	SO:0001583	missense	51016			BF346999	CCDS9613.1	14q12	2012-05-30	2012-05-30	2012-05-30	ENSG00000100908	ENSG00000100908			20273	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 122"", ""family with sequence similarity 158, member A"""	C14orf122, FAM158A		22119785	Standard	NM_016049		Approved	CGI-112	uc001wmi.3	Q9Y3B6	OTTHUMG00000028796	ENST00000419198.2:c.454G>A	14.37:g.24608392C>T	ENSP00000403210:p.Asp152Asn		D3DS60|Q9BUM3	Missense_Mutation	SNP	pfam_UPF0172	p.D152N	ENST00000419198.2	37	c.454	CCDS9613.1	14	.	.	.	.	.	.	.	.	.	.	c	18.75	3.691558	0.68271	.	.	ENSG00000100908	ENST00000419198;ENST00000216799	T;T	0.43688	0.94;0.94	5.18	4.29	0.51040	.	0.234160	0.43579	N	0.000551	T	0.30386	0.0763	L	0.41573	1.285	0.38632	D	0.951397	B	0.02656	0.0	B	0.08055	0.003	T	0.15178	-1.0446	10	0.30078	T	0.28	-15.9075	7.1778	0.25755	0.0:0.7376:0.1721:0.0903	.	152	Q9Y3B6	F158A_HUMAN	N	152	ENSP00000403210:D152N;ENSP00000216799:D152N	ENSP00000216799:D152N	D	-	1	0	FAM158A	23678232	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.129000	0.42055	1.397000	0.46682	0.655000	0.94253	GAC	EMC9	-	pfam_UPF0172		0.532	EMC9-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EMC9	HGNC	protein_coding	OTTHUMT00000071917.4	C	NM_016049		24608392	-1	no_errors	ENST00000216799	ensembl	human	known	70_37	missense	SNP	1.000	T
ENOX2	10495	genome.wustl.edu	37	X	129799721	129799721	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chrX:129799721C>G	ENST00000370927.1	-	7	1018	c.997G>C	c.(997-999)Gag>Cag	p.E333Q	ENOX2_ENST00000338144.3_Missense_Mutation_p.E333Q|ENOX2_ENST00000370935.1_Missense_Mutation_p.E304Q|ENOX2_ENST00000394363.1_Missense_Mutation_p.E304Q			Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2	333					cell growth (GO:0016049)|oxidation-reduction process (GO:0055114)|regulation of growth (GO:0040008)|ultradian rhythm (GO:0007624)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|protein disulfide oxidoreductase activity (GO:0015035)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(3)	33						ACTATCTGCTCAACTGCAGCA	0.488																																					Ovarian(101;828 1506 2951 9500 35258)												0													65.0	43.0	51.0					X																	129799721		2203	4300	6503	SO:0001583	missense	10495			AF207881	CCDS14626.1, CCDS14627.1	Xq25	2013-02-12	2007-03-23	2007-03-23	ENSG00000165675	ENSG00000165675		"""RNA binding motif (RRM) containing"""	2259	protein-coding gene	gene with protein product		300282	"""cytosolic ovarian carcinoma antigen 1"""	COVA1		8150545, 11888291	Standard	NM_006375		Approved	APK1, tNOX	uc004evw.3	Q16206	OTTHUMG00000022401	ENST00000370927.1:c.997G>C	X.37:g.129799721C>G	ENSP00000359965:p.Glu333Gln		A8K197|A8K1C2|Q5VTJ1|Q5VTJ2|Q8WUX0|Q9NTP6|Q9UH82	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E333Q	ENST00000370927.1	37	c.997	CCDS14626.1	X	.	.	.	.	.	.	.	.	.	.	C	23.4	4.408529	0.83340	.	.	ENSG00000165675	ENST00000538435;ENST00000370935;ENST00000338144;ENST00000394363;ENST00000350369;ENST00000370927;ENST00000432489	T;T	0.29917	1.55;1.55	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.50171	0.1600	L	0.59436	1.845	0.52501	D	0.99995	D;D	0.76494	0.999;0.999	D;D	0.69142	0.962;0.962	T	0.41928	-0.9481	9	.	.	.	-15.9116	15.1766	0.72916	0.0:1.0:0.0:0.0	.	333;361	Q16206;A4QPE1	ENOX2_HUMAN;.	Q	304;304;333;304;361;333;304	ENSP00000337146:E333Q;ENSP00000359965:E333Q	.	E	-	1	0	ENOX2	129627402	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.320000	0.79064	2.467000	0.83353	0.594000	0.82650	GAG	ENOX2	-	NULL		0.488	ENOX2-004	KNOWN	basic|CCDS	protein_coding	ENOX2	HGNC	protein_coding	OTTHUMT00000058277.1	C	NM_182314		129799721	-1	no_errors	ENST00000338144	ensembl	human	known	70_37	missense	SNP	1.000	G
EMD	2010	genome.wustl.edu	37	X	153608140	153608140	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chrX:153608140C>G	ENST00000369842.4	+	2	461	c.173C>G	c.(172-174)tCt>tGt	p.S58C	EMD_ENST00000369835.3_Intron|EMD_ENST00000492448.1_3'UTR	NM_000117.2	NP_000108.1	P50402	EMD_HUMAN	emerin	58	Interaction with F-actin. {ECO:0000305}.				cellular response to growth factor stimulus (GO:0071363)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of fibroblast proliferation (GO:0048147)|positive regulation of protein export from nucleus (GO:0046827)|regulation of canonical Wnt signaling pathway (GO:0060828)|skeletal muscle cell differentiation (GO:0035914)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule (GO:0005874)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	actin binding (GO:0003779)|beta-tubulin binding (GO:0048487)			lung(5)	5	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCCGCCTCCTCTTATAGCTTC	0.667																																																	0													19.0	24.0	22.0					X																	153608140		2049	4061	6110	SO:0001583	missense	2010			X82434	CCDS14745.1	Xq27.3-q28	2014-09-17	2008-07-29		ENSG00000102119	ENSG00000102119			3331	protein-coding gene	gene with protein product	"""LEM domain containing 5"""	300384	"""Emery-Dreifuss muscular dystrophy"""				Standard	NM_000117		Approved	STA, LEMD5	uc004fkl.3	P50402	OTTHUMG00000033186	ENST00000369842.4:c.173C>G	X.37:g.153608140C>G	ENSP00000358857:p.Ser58Cys		Q6FI02	Missense_Mutation	SNP	pfam_LEM,superfamily_LEM-like_dom,smart_LEM,pfscan_LEM	p.S58C	ENST00000369842.4	37	c.173	CCDS14745.1	X	.	.	.	.	.	.	.	.	.	.	C	9.445	1.089041	0.20390	.	.	ENSG00000102119	ENST00000369842	D	0.85702	-2.02	3.92	3.05	0.35203	.	0.371281	0.23351	N	0.049135	D	0.82683	0.5090	L	0.36672	1.1	0.21740	N	0.999561	D	0.67145	0.996	P	0.54372	0.75	T	0.73248	-0.4043	10	0.56958	D	0.05	-2.8329	7.0598	0.25119	0.0:0.8624:0.0:0.1376	.	58	P50402	EMD_HUMAN	C	58	ENSP00000358857:S58C	ENSP00000358857:S58C	S	+	2	0	EMD	153261334	0.352000	0.24895	0.024000	0.17045	0.005000	0.04900	1.923000	0.40055	0.765000	0.33221	0.436000	0.28706	TCT	EMD	-	NULL		0.667	EMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMD	HGNC	protein_coding	OTTHUMT00000080921.1	C			153608140	+1	no_errors	ENST00000369842	ensembl	human	known	70_37	missense	SNP	0.046	G
ENPP2	5168	genome.wustl.edu	37	8	120650743	120650743	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr8:120650743C>T	ENST00000075322.6	-	2	116	c.58G>A	c.(58-60)Gtt>Att	p.V20I	ENPP2_ENST00000427067.2_Missense_Mutation_p.V16I|ENPP2_ENST00000259486.6_Missense_Mutation_p.V20I|ENPP2_ENST00000522826.1_Missense_Mutation_p.V20I	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	20					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TTGACTCCAACGGCAAAAGTG	0.388																																					Melanoma(20;305 879 2501 4818 31020)												0													138.0	139.0	138.0					8																	120650743		2203	4300	6503	SO:0001583	missense	5168			D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.58G>A	8.37:g.120650743C>T	ENSP00000075322:p.Val20Ile		A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.V20I	ENST00000075322.6	37	c.58	CCDS34936.1	8	.	.	.	.	.	.	.	.	.	.	C	0.067	-1.209991	0.01555	.	.	ENSG00000136960	ENST00000259486;ENST00000427067;ENST00000522826;ENST00000075322;ENST00000520066	T;T;T;T;T	0.71817	-0.6;-0.6;-0.6;-0.59;-0.58	6.17	-7.21	0.01490	.	1.210850	0.05534	N	0.564446	T	0.35856	0.0946	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.01281	0.0;0.0;0.0	T	0.42531	-0.9446	10	0.02654	T	1	.	6.2403	0.20787	0.099:0.4946:0.1021:0.3043	.	20;20;20	E9PHP7;Q13822;Q13822-2	.;ENPP2_HUMAN;.	I	20;16;20;20;20	ENSP00000259486:V20I;ENSP00000403315:V16I;ENSP00000428291:V20I;ENSP00000075322:V20I;ENSP00000428304:V20I	ENSP00000075322:V20I	V	-	1	0	ENPP2	120719924	0.327000	0.24678	0.000000	0.03702	0.203000	0.24098	-0.378000	0.07446	-1.469000	0.01890	-0.940000	0.02684	GTT	ENPP2	-	NULL		0.388	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENPP2	HGNC	protein_coding	OTTHUMT00000381390.1	C			120650743	-1	no_errors	ENST00000259486	ensembl	human	known	70_37	missense	SNP	0.010	T
EXOSC9	5393	genome.wustl.edu	37	4	122724120	122724120	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr4:122724120G>C	ENST00000243498.5	+	4	440	c.332G>C	c.(331-333)aGa>aCa	p.R111T	EXOSC9_ENST00000512454.1_Missense_Mutation_p.R95T|EXOSC9_ENST00000379663.3_Missense_Mutation_p.R111T|EXOSC9_ENST00000509980.1_3'UTR	NM_005033.2	NP_005024.2	Q06265	EXOS9_HUMAN	exosome component 9	111	ARE binding.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|immune response (GO:0006955)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|intermediate filament cytoskeleton (GO:0045111)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|urinary_tract(1)	16						AGATGTCTAAGAAATTCGAAG	0.388																																																	0													129.0	122.0	124.0					4																	122724120		2203	4300	6503	SO:0001583	missense	5393			M58460	CCDS3722.2, CCDS34057.1	4q27	2010-05-07	2004-06-16	2004-06-18	ENSG00000123737	ENSG00000123737	3.1.13.-		9137	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 1 (75kD)"""	606180	"""polymyositis/scleroderma autoantigen 1, 75kDa"""	PMSCL1			Standard	XR_427545		Approved	PM/Scl-75, Rrp45p, RRP45, p5, p6	uc003idz.3	Q06265	OTTHUMG00000128783	ENST00000243498.5:c.332G>C	4.37:g.122724120G>C	ENSP00000243498:p.Arg111Thr		Q12883|Q4W5P5|Q86Y41|Q86Y48	Missense_Mutation	SNP	pfam_ExoRNase_PH_dom1,pfam_ExoRNase_PH_dom2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_ExoRNase_PH_dom2	p.R111T	ENST00000243498.5	37	c.332	CCDS3722.2	4	.	.	.	.	.	.	.	.	.	.	G	28.2	4.901333	0.92035	.	.	ENSG00000123737	ENST00000243498;ENST00000379663;ENST00000509800;ENST00000512454	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.95	5.11	0.69529	Ribosomal protein S5 domain 2-type fold (1);Exoribonuclease, phosphorolytic domain 1 (1);	0.041341	0.85682	D	0.000000	T	0.82098	0.4963	M	0.83774	2.66	0.80722	D	1	D;D;D	0.76494	0.999;0.995;0.993	D;P;D	0.67231	0.95;0.893;0.913	D	0.85146	0.0983	10	0.72032	D	0.01	-19.6281	15.1454	0.72647	0.0676:0.0:0.9324:0.0	.	95;111;111	D6RIY6;Q06265;Q06265-2	.;EXOS9_HUMAN;.	T	111;111;111;95	ENSP00000243498:R111T;ENSP00000368984:R111T;ENSP00000422205:R111T;ENSP00000425782:R95T	ENSP00000243498:R111T	R	+	2	0	EXOSC9	122943570	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.750000	0.98875	1.519000	0.48950	0.650000	0.86243	AGA	EXOSC9	-	pfam_ExoRNase_PH_dom1,superfamily_Ribosomal_S5_D2-typ_fold		0.388	EXOSC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOSC9	HGNC	protein_coding	OTTHUMT00000250708.2	G	NM_005033		122724120	+1	no_errors	ENST00000379663	ensembl	human	known	70_37	missense	SNP	1.000	C
F5	2153	genome.wustl.edu	37	1	169525907	169525907	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:169525907G>C	ENST00000367797.3	-	6	1130	c.929C>G	c.(928-930)tCt>tGt	p.S310C	F5_ENST00000367796.3_Missense_Mutation_p.S310C|F5_ENST00000546081.1_Missense_Mutation_p.S173C	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	310	F5/8 type A 1.|Plastocyanin-like 2.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	TGGGGTGAGAGAAGATATGAT	0.478																																																	0													152.0	137.0	142.0					1																	169525907		2203	4300	6503	SO:0001583	missense	2153			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.929C>G	1.37:g.169525907G>C	ENSP00000356771:p.Ser310Cys		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.S310C	ENST00000367797.3	37	c.929	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.010274	0.75046	.	.	ENSG00000198734	ENST00000367797;ENST00000367796;ENST00000546081	D;D;D	0.99688	-6.41;-6.41;-6.41	6.07	6.07	0.98685	Cupredoxin (2);	0.049670	0.85682	D	0.000000	D	0.98729	0.9573	N	0.11154	0.105	0.42351	D	0.992376	D	0.89917	1.0	D	0.87578	0.998	D	0.96055	0.9034	9	0.02654	T	1	-22.1418	20.6439	0.99570	0.0:0.0:1.0:0.0	.	310	P12259	FA5_HUMAN	C	310;310;173	ENSP00000356771:S310C;ENSP00000356770:S310C;ENSP00000439664:S173C	ENSP00000356770:S310C	S	-	2	0	F5	167792531	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	9.434000	0.97515	2.890000	0.99128	0.650000	0.86243	TCT	F5	-	superfamily_Cupredoxin		0.478	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	G	NM_000130		169525907	-1	no_errors	ENST00000367796	ensembl	human	known	70_37	missense	SNP	1.000	C
BRINP2	57795	genome.wustl.edu	37	1	177250575	177250575	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:177250575G>C	ENST00000361539.4	+	8	2575	c.2263G>C	c.(2263-2265)Gag>Cag	p.E755Q	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	755					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											GGCCAACAATGAGGTGGGCAG	0.557																																																	0													75.0	73.0	74.0					1																	177250575		2203	4300	6503	SO:0001583	missense	57795				CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.2263G>C	1.37:g.177250575G>C	ENSP00000354481:p.Glu755Gln		O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.E755Q	ENST00000361539.4	37	c.2263	CCDS1320.1	1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.029083	0.75504	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	T	0.21191	2.02	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.46190	0.1380	M	0.66939	2.045	0.80722	D	1	D;D	0.76494	0.999;0.994	D;P	0.70487	0.969;0.709	T	0.47459	-0.9116	10	0.87932	D	0	-18.058	17.9969	0.89187	0.0:0.0:1.0:0.0	.	650;755	Q9C0B6-2;Q9C0B6	.;FAM5B_HUMAN	Q	508;755	ENSP00000354481:E755Q	ENSP00000354481:E755Q	E	+	1	0	FAM5B	175517198	1.000000	0.71417	0.992000	0.48379	0.963000	0.63663	9.731000	0.98807	2.346000	0.79739	0.313000	0.20887	GAG	FAM5B	-	NULL		0.557	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM5B	HGNC	protein_coding	OTTHUMT00000084599.1	G	NM_021165		177250575	+1	no_errors	ENST00000361539	ensembl	human	known	70_37	missense	SNP	1.000	C
FGF9	2254	genome.wustl.edu	37	13	22246199	22246199	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr13:22246199G>C	ENST00000382353.5	+	1	678	c.148G>C	c.(148-150)Gca>Cca	p.A50P		NM_002010.2	NP_002001.1	P31371	FGF9_HUMAN	fibroblast growth factor 9	50					angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic digestive tract development (GO:0048566)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein import into nucleus (GO:0006606)|regulation of timing of cell differentiation (GO:0048505)|signal transduction (GO:0007165)|substantia nigra development (GO:0021762)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|skin(2)	9		all_cancers(29;1.23e-20)|all_epithelial(30;9.83e-19)|all_lung(29;9.64e-17)|Lung SC(185;0.0262)|Breast(139;0.106)		all cancers(112;3.92e-05)|Epithelial(112;0.000166)|OV - Ovarian serous cystadenocarcinoma(117;0.00314)|Lung(94;0.163)		CAGGGGACCCGCAGTCACGGA	0.557																																					Melanoma(195;1939 2127 12623 13963 52730)												0													62.0	69.0	67.0					13																	22246199		2203	4300	6503	SO:0001583	missense	2254			D14838	CCDS9298.1	13q11-q12	2014-01-30	2013-06-18		ENSG00000102678	ENSG00000102678		"""Endogenous ligands"""	3687	protein-coding gene	gene with protein product	"""glia-activating factor"""	600921	"""fibroblast growth factor 9 (glia-activating factor)"""			8321227	Standard	NM_002010		Approved		uc001uog.2	P31371	OTTHUMG00000017412	ENST00000382353.5:c.148G>C	13.37:g.22246199G>C	ENSP00000371790:p.Ala50Pro		A8K427|Q3SY32	Missense_Mutation	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_GF_heparin-bd,prints_IL1_HBGF	p.A50P	ENST00000382353.5	37	c.148	CCDS9298.1	13	.	.	.	.	.	.	.	.	.	.	G	13.64	2.297539	0.40694	.	.	ENSG00000102678	ENST00000382353	T	0.76060	-0.99	5.28	4.41	0.53225	.	0.070988	0.64402	N	0.000018	T	0.58250	0.2109	N	0.14661	0.345	0.49130	D	0.999758	P	0.51933	0.949	B	0.40477	0.33	T	0.60495	-0.7252	10	0.36615	T	0.2	.	14.9825	0.71321	0.0:0.0:0.8563:0.1437	.	50	P31371	FGF9_HUMAN	P	50	ENSP00000371790:A50P	ENSP00000371790:A50P	A	+	1	0	FGF9	21144199	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.579000	0.60936	1.172000	0.42781	0.561000	0.74099	GCA	FGF9	-	NULL		0.557	FGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF9	HGNC	protein_coding	OTTHUMT00000046002.2	G			22246199	+1	no_errors	ENST00000382353	ensembl	human	known	70_37	missense	SNP	1.000	C
FOXD4	2298	genome.wustl.edu	37	9	117888	117888	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr9:117888C>T	ENST00000382500.2	-	1	529	c.232G>A	c.(232-234)Gac>Aac	p.D78N		NM_207305.4	NP_997188.2	Q12950	FOXD4_HUMAN	forkhead box D4	78					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	14	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		TCTGAGGGGTCGCTCGGGCCG	0.711																																																	0													37.0	63.0	54.0					9																	117888		2193	4290	6483	SO:0001583	missense	2298			U13223	CCDS34975.1	9p24.3	2014-09-17			ENSG00000170122	ENSG00000170122		"""Forkhead boxes"""	3805	protein-coding gene	gene with protein product		601092		FKHL9		7957066, 8825632, 12234674	Standard	NM_207305		Approved	FREAC5, FOXD4a	uc003zfz.4	Q12950	OTTHUMG00000021015	ENST00000382500.2:c.232G>A	9.37:g.117888C>T	ENSP00000371940:p.Asp78Asn		B2RN05|B9EGL7|Q5VVK1|Q8WXT6	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.D78N	ENST00000382500.2	37	c.232	CCDS34975.1	9	.	.	.	.	.	.	.	.	.	.	.	8.141	0.785271	0.16189	.	.	ENSG00000170122	ENST00000382500	D	0.94687	-3.49	2.31	-1.23	0.09465	.	1.225120	0.06524	N	0.740258	D	0.84070	0.5391	N	0.08118	0	0.09310	N	1	B	0.18166	0.026	B	0.08055	0.003	T	0.71672	-0.4522	10	0.22109	T	0.4	.	3.6133	0.08069	0.1915:0.5523:0.0:0.2562	.	78	Q12950	FOXD4_HUMAN	N	78	ENSP00000371940:D78N	ENSP00000371940:D78N	D	-	1	0	FOXD4	107888	0.000000	0.05858	0.000000	0.03702	0.097000	0.18754	-1.575000	0.02131	-0.503000	0.06586	0.291000	0.19559	GAC	FOXD4	-	NULL		0.711	FOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD4	HGNC	protein_coding	OTTHUMT00000055433.1	C	NM_207305		117888	-1	no_errors	ENST00000382500	ensembl	human	known	70_37	missense	SNP	0.001	T
FOXJ2	55810	genome.wustl.edu	37	12	8195264	8195264	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr12:8195264G>A	ENST00000162391.3	+	3	1489	c.344G>A	c.(343-345)cGg>cAg	p.R115Q	FOXJ2_ENST00000428177.2_Missense_Mutation_p.R115Q	NM_018416.2	NP_060886.1	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	115					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	16				Kidney(36;0.0944)		AATTCAATACGGCACAACCTT	0.458																																																	0													108.0	85.0	93.0					12																	8195264		2203	4300	6503	SO:0001583	missense	55810			AF155132	CCDS8587.1	12p13.31	2006-12-15				ENSG00000065970		"""Forkhead boxes"""	24818	protein-coding gene	gene with protein product						10777590, 10966786	Standard	NM_018416		Approved	FHX	uc001qtu.3	Q9P0K8		ENST00000162391.3:c.344G>A	12.37:g.8195264G>A	ENSP00000162391:p.Arg115Gln		A0AVK4|B2RMP3|Q96PS9|Q9NSN5	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.R115Q	ENST00000162391.3	37	c.344	CCDS8587.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.403003	0.96030	.	.	ENSG00000065970	ENST00000162391;ENST00000428177	D;D	0.98060	-4.69;-4.69	5.28	5.28	0.74379	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);Transcription factor, fork head, conserved site (1);	0.191486	0.36482	N	0.002570	D	0.99149	0.9706	H	0.96208	3.785	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.99	D	0.99191	1.0870	10	0.87932	D	0	.	16.4458	0.83932	0.0:0.0:1.0:0.0	.	115;115	Q9P0K8;Q9P0K8-2	FOXJ2_HUMAN;.	Q	115	ENSP00000162391:R115Q;ENSP00000403411:R115Q	ENSP00000162391:R115Q	R	+	2	0	FOXJ2	8086531	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.384000	0.97219	2.473000	0.83533	0.561000	0.74099	CGG	FOXJ2	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head		0.458	FOXJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXJ2	HGNC	protein_coding	OTTHUMT00000400088.1	G	NM_018416		8195264	+1	no_errors	ENST00000162391	ensembl	human	known	70_37	missense	SNP	1.000	A
FRMPD2	143162	genome.wustl.edu	37	10	49459669	49459669	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr10:49459669C>A	ENST00000374201.3	-	2	393	c.91G>T	c.(91-93)Gag>Tag	p.E31*	FRMPD2_ENST00000407470.4_Nonsense_Mutation_p.E22*|FRMPD2_ENST00000305531.3_Nonsense_Mutation_p.E29*	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	31	KIND. {ECO:0000255|PROSITE- ProRule:PRU00709}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		CAGATTTCCTCCTCAGACAGA	0.577																																																	0													84.0	73.0	77.0					10																	49459669		2203	4300	6503	SO:0001587	stop_gained	143162			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.91G>T	10.37:g.49459669C>A	ENSP00000363317:p.Glu31*		B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Nonsense_Mutation	SNP	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.E31*	ENST00000374201.3	37	c.91	CCDS31195.1	10	.	.	.	.	.	.	.	.	.	.	C	41	8.577814	0.98870	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.644	0.68745	0.0:1.0:0.0:0.0	.	.	.	.	X	31;29;22	.	ENSP00000307079:E29X	E	-	1	0	FRMPD2	49129675	0.983000	0.35010	0.941000	0.38009	0.941000	0.58515	2.389000	0.44407	2.551000	0.86045	0.563000	0.77884	GAG	FRMPD2	-	smart_KIND		0.577	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3	C	NM_152428		49459669	-1	no_errors	ENST00000374201	ensembl	human	known	70_37	nonsense	SNP	0.997	A
FYCO1	79443	genome.wustl.edu	37	3	46008968	46008968	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr3:46008968C>T	ENST00000296137.2	-	8	2063	c.1858G>A	c.(1858-1860)Gag>Aag	p.E620K	FYCO1_ENST00000535325.1_Missense_Mutation_p.E620K	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	620					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		TTCTCCAGCTCCCTGTTGGCC	0.622																																																	0													68.0	76.0	73.0					3																	46008968		2203	4299	6502	SO:0001583	missense	79443			AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.1858G>A	3.37:g.46008968C>T	ENSP00000296137:p.Glu620Lys		B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	pfam_Znf_FYVE,pfam_Run,superfamily_GOLD,superfamily_Znf_FYVE_PHD,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Znf_FYVE,pfscan_GOLD,pfscan_Run,pfscan_Znf_FYVE-rel	p.E620K	ENST00000296137.2	37	c.1858	CCDS2734.1	3	.	.	.	.	.	.	.	.	.	.	C	10.33	1.321320	0.23994	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.20881	2.04;2.04	5.7	4.82	0.62117	.	0.338259	0.34802	N	0.003665	T	0.20414	0.0491	M	0.64997	1.995	0.20563	N	0.999888	B;B	0.13594	0.008;0.002	B;B	0.13407	0.009;0.003	T	0.20207	-1.0282	10	0.19590	T	0.45	-17.4857	9.1495	0.36953	0.0:0.7307:0.1877:0.0816	.	620;620	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	K	620	ENSP00000296137:E620K;ENSP00000441178:E620K	ENSP00000296137:E620K	E	-	1	0	FYCO1	45983972	0.567000	0.26626	0.895000	0.35142	0.878000	0.50629	1.240000	0.32731	1.390000	0.46547	0.655000	0.94253	GAG	FYCO1	-	NULL		0.622	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FYCO1	HGNC	protein_coding	OTTHUMT00000257320.2	C	NM_024513		46008968	-1	no_errors	ENST00000535325	ensembl	human	known	70_37	missense	SNP	0.714	T
GCG	2641	genome.wustl.edu	37	2	163002156	163002156	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr2:163002156C>G	ENST00000418842.2	-	4	540	c.286G>C	c.(286-288)Gag>Cag	p.E96Q	GCG_ENST00000375497.3_Missense_Mutation_p.E96Q	NM_002054.4	NP_002045.1	P01275	GLUC_HUMAN	glucagon	96					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|protein kinase A signaling (GO:0010737)|regulation of insulin secretion (GO:0050796)|response to starvation (GO:0042594)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|secretory granule lumen (GO:0034774)	glucagon receptor binding (GO:0031769)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|large_intestine(3)|lung(9)	14						GCATGTCTCTCAAATTCATCG	0.418																																																	0													220.0	216.0	217.0					2																	163002156		1891	4116	6007	SO:0001583	missense	2641				CCDS46439.1	2q36-q37	2013-02-26			ENSG00000115263	ENSG00000115263		"""Endogenous ligands"""	4191	protein-coding gene	gene with protein product	"""glicentin-related polypeptide"", ""glucagon-like peptide 1"", ""glucagon-like peptide 2"", ""preproglucagon"""	138030				2753890, 3725587	Standard	NM_002054		Approved	GLP1, GLP2, GRPP	uc002ucc.4	P01275	OTTHUMG00000153892	ENST00000418842.2:c.286G>C	2.37:g.163002156C>G	ENSP00000387662:p.Glu96Gln		A6NN65|Q53TP6	Missense_Mutation	SNP	pfam_Glucagon_GIP_secretin_VIP,smart_Glucagon_GIP_secretin_VIP,prints_Glucagon_GIP_secretin_VIP	p.E96Q	ENST00000418842.2	37	c.286	CCDS46439.1	2	.	.	.	.	.	.	.	.	.	.	C	23.0	4.359019	0.82353	.	.	ENSG00000115263	ENST00000418842;ENST00000375497	T;T	0.47177	0.85;0.85	4.79	4.79	0.61399	Glucagon/GIP/secretin/VIP (1);	0.426382	0.27759	N	0.017975	T	0.65460	0.2693	M	0.72894	2.215	0.47214	D	0.999355	D	0.63046	0.992	P	0.58970	0.849	T	0.70890	-0.4749	10	0.87932	D	0	-19.819	18.1809	0.89777	0.0:1.0:0.0:0.0	.	96	P01275	GLUC_HUMAN	Q	96	ENSP00000387662:E96Q;ENSP00000364647:E96Q	ENSP00000364647:E96Q	E	-	1	0	GCG	162710402	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.849000	0.62882	2.361000	0.80049	0.591000	0.81541	GAG	GCG	-	NULL		0.418	GCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCG	HGNC	protein_coding	OTTHUMT00000332860.1	C	NM_002054		163002156	-1	no_errors	ENST00000375497	ensembl	human	known	70_37	missense	SNP	1.000	G
GNAT1	2779	genome.wustl.edu	37	3	50231257	50231257	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr3:50231257G>A	ENST00000433068.1	+	5	577	c.521G>A	c.(520-522)cGa>cAa	p.R174Q	GNAT1_ENST00000232461.3_Missense_Mutation_p.R174Q|GNAT1_ENST00000481246.1_3'UTR	NM_000172.3	NP_000163.2	P11488	GNAT1_HUMAN	guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1	174					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell proliferation (GO:0008283)|cellular response to electrical stimulus (GO:0071257)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|phototransduction, visible light (GO:0007603)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to light intensity (GO:0009642)|response to light stimulus (GO:0009416)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	acyl binding (GO:0000035)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		CTGCGCTCGCGAGTCAAGACC	0.652																																																	0													67.0	60.0	62.0					3																	50231257		2203	4300	6503	SO:0001583	missense	2779				CCDS2812.1	3p21	2014-01-28			ENSG00000114349	ENSG00000114349			4393	protein-coding gene	gene with protein product		139330					Standard	NM_000172		Approved	CSNBAD3	uc003cyl.2	P11488	OTTHUMG00000156808	ENST00000433068.1:c.521G>A	3.37:g.50231257G>A	ENSP00000387555:p.Arg174Gln		Q4VBN2	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_I	p.R174Q	ENST00000433068.1	37	c.521	CCDS2812.1	3	.	.	.	.	.	.	.	.	.	.	G	37	6.055851	0.97241	.	.	ENSG00000114349	ENST00000232461;ENST00000433068;ENST00000440836	T;T;T	0.65364	-0.15;-0.15;-0.15	5.7	5.7	0.88788	G protein alpha subunit, helical insertion (1);	0.000000	0.85682	D	0.000000	D	0.85596	0.5733	H	0.95260	3.645	0.80722	D	1	D	0.89917	1.0	D	0.70716	0.97	D	0.89445	0.3726	10	0.87932	D	0	.	18.6092	0.91277	0.0:0.0:1.0:0.0	.	174	P11488	GNAT1_HUMAN	Q	174;174;126	ENSP00000232461:R174Q;ENSP00000387555:R174Q;ENSP00000403537:R126Q	ENSP00000232461:R174Q	R	+	2	0	GNAT1	50206261	1.000000	0.71417	0.960000	0.40013	0.929000	0.56500	9.668000	0.98619	2.711000	0.92665	0.561000	0.74099	CGA	GNAT1	-	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su		0.652	GNAT1-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	GNAT1	HGNC	protein_coding	OTTHUMT00000345957.1	G	NM_000172		50231257	+1	no_errors	ENST00000232461	ensembl	human	known	70_37	missense	SNP	0.973	A
GOLGB1	2804	genome.wustl.edu	37	3	121414503	121414503	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr3:121414503G>C	ENST00000340645.5	-	13	4977	c.4852C>G	c.(4852-4854)Ctt>Gtt	p.L1618V	GOLGB1_ENST00000393667.3_Missense_Mutation_p.L1623V	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1618					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.L1618I(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		GACTGCAGAAGAATTTCATAC	0.378																																																	1	Substitution - Missense(1)	large_intestine(1)											111.0	114.0	113.0					3																	121414503		2203	4300	6503	SO:0001583	missense	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.4852C>G	3.37:g.121414503G>C	ENSP00000341848:p.Leu1618Val		B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.L1618V	ENST00000340645.5	37	c.4852	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	G	13.79	2.341556	0.41498	.	.	ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517	T;T;T	0.72942	0.96;0.94;-0.7	5.68	5.68	0.88126	.	0.000000	0.53938	D	0.000044	D	0.83571	0.5283	M	0.75264	2.295	0.53005	D	0.999969	D;D;D;D;D	0.89917	0.998;1.0;0.998;1.0;1.0	D;D;D;D;D	0.91635	0.996;0.997;0.996;0.997;0.999	T	0.81760	-0.0785	10	0.34782	T	0.22	.	17.2816	0.87130	0.0:0.0:1.0:0.0	.	1543;1582;1623;1623;1618	F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.;.;.;.;GOGB1_HUMAN	V	1618;1623;1582	ENSP00000341848:L1618V;ENSP00000377275:L1623V;ENSP00000418231:L1582V	ENSP00000341848:L1618V	L	-	1	0	GOLGB1	122897193	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	7.628000	0.83189	2.670000	0.90874	0.561000	0.74099	CTT	GOLGB1	-	NULL		0.378	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	G	NM_004487		121414503	-1	no_errors	ENST00000340645	ensembl	human	known	70_37	missense	SNP	1.000	C
GRIPAP1	56850	genome.wustl.edu	37	X	48840190	48840190	+	Silent	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chrX:48840190C>T	ENST00000376441.1	-	15	1303	c.1269G>A	c.(1267-1269)cgG>cgA	p.R423R	GRIPAP1_ENST00000376425.3_Silent_p.R392R|GRIPAP1_ENST00000473581.1_5'UTR|GRIPAP1_ENST00000376444.3_Silent_p.R378R|GRIPAP1_ENST00000376423.4_Silent_p.R370R	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	423						blood microparticle (GO:0072562)|endosome (GO:0005768)				breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						CCCCTACCTTCCGAGCCTCCT	0.517																																																	0													227.0	164.0	185.0					X																	48840190		2203	4300	6503	SO:0001819	synonymous_variant	56850			AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.1269G>A	X.37:g.48840190C>T			A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Silent	SNP	superfamily_Prefoldin	p.R423	ENST00000376441.1	37	c.1269	CCDS35248.1	X																																																																																			GRIPAP1	-	NULL		0.517	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIPAP1	HGNC	protein_coding	OTTHUMT00000080970.2	C	NM_207672		48840190	-1	no_errors	ENST00000376441	ensembl	human	known	70_37	silent	SNP	1.000	T
GRN	2896	genome.wustl.edu	37	17	42427876	42427876	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr17:42427876C>T	ENST00000053867.3	+	6	591	c.529C>T	c.(529-531)Cgc>Tgc	p.R177C	GRN_ENST00000589265.1_Intron	NM_002087.2	NP_002078.1	P28799	GRN_HUMAN	granulin	177					blastocyst hatching (GO:0001835)|cell death (GO:0008219)|embryo implantation (GO:0007566)|positive regulation of epithelial cell proliferation (GO:0050679)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	growth factor activity (GO:0008083)|poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GGTTCACACCCGCTGCATCAC	0.622											OREG0024459	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													114.0	110.0	111.0					17																	42427876		2203	4300	6503	SO:0001583	missense	2896			M75161	CCDS11483.1	17q21.32	2014-09-17				ENSG00000030582			4601	protein-coding gene	gene with protein product	"""progranulin"""	138945				1417868, 9826678	Standard	XM_005257253		Approved	PCDGF, PGRN, CLN11	uc002igp.1	P28799		ENST00000053867.3:c.529C>T	17.37:g.42427876C>T	ENSP00000053867:p.Arg177Cys	908	D3DX55|P23781|P23782|P23783|P23784|Q53HQ8|Q53Y88|Q540U8|Q9BWE7|Q9H8S1|Q9UCH0	Missense_Mutation	SNP	pfam_Granulin,smart_Granulin	p.R177C	ENST00000053867.3	37	c.529	CCDS11483.1	17	.	.	.	.	.	.	.	.	.	.	C	13.55	2.269788	0.40095	.	.	ENSG00000030582	ENST00000053867;ENST00000357351	T	0.72835	-0.69	4.43	4.43	0.53597	Granulin (2);	0.690305	0.12806	N	0.437562	D	0.83635	0.5297	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.80832	-0.1206	10	0.33141	T	0.24	-36.8245	12.4176	0.55502	0.0:1.0:0.0:0.0	.	177	P28799	GRN_HUMAN	C	177	ENSP00000053867:R177C	ENSP00000053867:R177C	R	+	1	0	GRN	39783402	0.007000	0.16637	0.479000	0.27329	0.022000	0.10575	0.917000	0.28665	2.289000	0.77006	0.462000	0.41574	CGC	GRN	-	pfam_Granulin,smart_Granulin		0.622	GRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRN	HGNC	protein_coding	OTTHUMT00000457766.1	C	NM_002087		42427876	+1	no_errors	ENST00000053867	ensembl	human	known	70_37	missense	SNP	0.901	T
HORMAD1	84072	genome.wustl.edu	37	1	150671335	150671335	+	Intron	SNP	A	A	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:150671335A>G	ENST00000361824.2	-	15	1210				GOLPH3L_ENST00000271732.3_5'Flank|GOLPH3L_ENST00000540514.1_5'Flank|HORMAD1_ENST00000368995.4_Intron|HORMAD1_ENST00000368993.2_Intron|GOLPH3L_ENST00000479757.1_5'Flank|HORMAD1_ENST00000322343.7_Intron	NM_032132.4	NP_115508.2	Q86X24	HORM1_HUMAN	HORMA domain containing 1						blastocyst development (GO:0001824)|meiotic DNA double-strand break formation (GO:0042138)|meiotic nuclear division (GO:0007126)|meiotic recombination checkpoint (GO:0051598)|meiotic sister chromatid cohesion (GO:0051177)|oogenesis (GO:0048477)|regulation of homologous chromosome segregation (GO:0060629)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(3)	16	all_cancers(9;3.23e-52)|all_epithelial(9;4.68e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.0009)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;2.32e-23)|all cancers(9;5.21e-23)|OV - Ovarian serous cystadenocarcinoma(6;6.72e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			CATACCTAGCATAACTATATC	0.274																																																	0																																										SO:0001627	intron_variant	84072			AL136755	CCDS967.1, CCDS55633.1	1q21.2	2009-03-09			ENSG00000143452	ENSG00000143452			25245	protein-coding gene	gene with protein product	"""cancer/testis antigen 46"""	609824				11230166, 15999985	Standard	NM_032132		Approved	DKFZP434A1315, CT46	uc001evk.2	Q86X24	OTTHUMG00000035005	ENST00000361824.2:c.1105-125T>C	1.37:g.150671335A>G			A6NMK2|B3KUK1|Q4G114|Q5T5I3|Q5T5I4|Q5T5I5|Q6FIC1|Q9H0K8	RNA	SNP	-	NULL	ENST00000361824.2	37	NULL	CCDS967.1	1																																																																																			HORMAD1	-	-		0.274	HORMAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HORMAD1	HGNC	protein_coding	OTTHUMT00000084722.1	A	NM_032132		150671335	-1	no_errors	ENST00000470397	ensembl	human	known	70_37	rna	SNP	0.000	G
H3F3A	3020	genome.wustl.edu	37	1	226252059	226252059	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:226252059C>T	ENST00000366813.1	+	1	382	c.7C>T	c.(7-9)Cgt>Tgt	p.R3C	H3F3A_ENST00000366816.1_Missense_Mutation_p.R3C|H3F3A_ENST00000366815.3_Missense_Mutation_p.R3C|RP11-396C23.4_ENST00000609423.1_RNA|H3F3A_ENST00000366814.3_Missense_Mutation_p.R3C			P84243	H33_HUMAN	H3 histone, family 3A	3					blood coagulation (GO:0007596)|brain development (GO:0007420)|DNA replication-independent nucleosome assembly (GO:0006336)|positive regulation of cell growth (GO:0030307)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nuclear nucleosome (GO:0000788)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	nucleosomal DNA binding (GO:0031492)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)	p.R3C(1)		central_nervous_system(116)|endometrium(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	123	Breast(184;0.179)			GBM - Glioblastoma multiforme(131;0.203)		TACCATGGCTCGTACAAAGCA	0.498			Mis		glioma						OREG0014293	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																												Dom	yes		1	1q42.12	3020	"""H3 histone, family 3A"""		O	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											31.0	33.0	32.0					1																	226252059		2202	4300	6502	SO:0001583	missense	3020			BC029405	CCDS1550.1	1q42.12	2011-01-27			ENSG00000163041	ENSG00000163041		"""Histones / Replication-independent"""	4764	protein-coding gene	gene with protein product		601128		H3F3		3031613	Standard	NM_002107		Approved	H3.3A	uc001hpw.3	P84243	OTTHUMG00000037507	ENST00000366813.1:c.7C>T	1.37:g.226252059C>T	ENSP00000355778:p.Arg3Cys	2311	P06351|P33155|Q5VV55|Q5VV56|Q66I33|Q9V3W4	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.R3C	ENST00000366813.1	37	c.7	CCDS1550.1	1	.	.	.	.	.	.	.	.	.	.	C	10.39	1.335723	0.24253	.	.	ENSG00000163041	ENST00000366816;ENST00000366815;ENST00000366814;ENST00000366813	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	4.32	4.32	0.51571	Histone-fold (2);	0.000000	0.85682	D	0.000000	T	0.69459	0.3113	.	.	.	0.80722	D	1	D;B	0.89917	1.0;0.001	D;B	0.79784	0.993;0.001	T	0.75382	-0.3337	9	0.72032	D	0.01	.	16.7598	0.85509	0.0:1.0:0.0:0.0	.	3;3	B4DEB1;P84243	.;H33_HUMAN	C	3	ENSP00000355781:R3C;ENSP00000355780:R3C;ENSP00000355779:R3C;ENSP00000355778:R3C	ENSP00000355778:R3C	R	+	1	0	H3F3A	224318682	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.535000	0.60629	2.106000	0.64143	0.655000	0.94253	CGT	H3F3A	-	superfamily_Histone-fold,prints_Histone_H3		0.498	H3F3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	H3F3A	HGNC	protein_coding	OTTHUMT00000091324.1	C	NM_002107		226252059	+1	no_errors	ENST00000366813	ensembl	human	known	70_37	missense	SNP	1.000	T
IQSEC1	9922	genome.wustl.edu	37	3	12983327	12983327	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr3:12983327G>A	ENST00000273221.4	-	2	320	c.104C>T	c.(103-105)tCc>tTc	p.S35F	IQSEC1_ENST00000473088.1_5'UTR	NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	35					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GCTGTCCAGGGATGTGCCAGT	0.647																																																	0													17.0	18.0	17.0					3																	12983327		2202	4299	6501	SO:0001583	missense	9922			BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.104C>T	3.37:g.12983327G>A	ENSP00000273221:p.Ser35Phe		O94863|Q96D85	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.S35F	ENST00000273221.4	37	c.104	CCDS33703.1	3	.	.	.	.	.	.	.	.	.	.	G	14.88	2.666286	0.47677	.	.	ENSG00000144711	ENST00000273221;ENST00000435445;ENST00000429247	D;D	0.82711	-1.64;-1.64	4.48	4.48	0.54585	.	0.000000	0.64402	D	0.000001	D	0.88100	0.6346	.	.	.	0.45139	D	0.998159	D;D	0.71674	0.996;0.998	P;D	0.63488	0.862;0.915	D	0.87793	0.2620	9	0.48119	T	0.1	.	10.924	0.47182	0.086:0.0:0.914:0.0	.	21;35	E9PG60;Q6DN90	.;IQEC1_HUMAN	F	35;21;21	ENSP00000273221:S35F;ENSP00000402299:S21F	ENSP00000273221:S35F	S	-	2	0	IQSEC1	12958327	1.000000	0.71417	0.402000	0.26371	0.341000	0.28922	5.339000	0.65953	2.312000	0.78011	0.655000	0.94253	TCC	IQSEC1	-	NULL		0.647	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQSEC1	HGNC	protein_coding	OTTHUMT00000339865.2	G	NM_014869		12983327	-1	no_errors	ENST00000273221	ensembl	human	known	70_37	missense	SNP	0.766	A
ITGA8	8516	genome.wustl.edu	37	10	15649714	15649714	+	Nonsense_Mutation	SNP	T	T	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr10:15649714T>A	ENST00000378076.3	-	17	2079	c.1726A>T	c.(1726-1728)Aaa>Taa	p.K576*		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	576					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						TGGTGGGATTTCTGCCTTTTT	0.433																																																	0													199.0	205.0	203.0					10																	15649714		2203	4300	6503	SO:0001587	stop_gained	8516			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.1726A>T	10.37:g.15649714T>A	ENSP00000367316:p.Lys576*		B0YJ31|Q5VX94	Nonsense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.K576*	ENST00000378076.3	37	c.1726	CCDS31155.1	10	.	.	.	.	.	.	.	.	.	.	T	37	6.542247	0.97650	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	.	.	.	5.84	1.86	0.25419	.	0.614382	0.19581	N	0.110845	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.5977	0.39584	0.0:0.0649:0.2326:0.7024	.	.	.	.	X	576;561	.	ENSP00000367316:K576X	K	-	1	0	ITGA8	15689720	0.999000	0.42202	0.043000	0.18650	0.023000	0.10783	2.775000	0.47702	0.452000	0.26830	0.482000	0.46254	AAA	ITGA8	-	pfam_Integrin_alpha-2		0.433	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA8	HGNC	protein_coding	OTTHUMT00000046987.1	T	NM_003638		15649714	-1	no_errors	ENST00000378076	ensembl	human	known	70_37	nonsense	SNP	0.007	A
IZUMO1	284359	genome.wustl.edu	37	19	49248480	49248480	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr19:49248480C>T	ENST00000332955.2	-	3	848	c.301G>A	c.(301-303)Gat>Aat	p.D101N		NM_182575.2	NP_872381.2	Q8IYV9	IZUM1_HUMAN	izumo sperm-egg fusion 1	101					cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			endometrium(4)|kidney(3)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	17		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		CCTTTTACATCACTGTCTGTG	0.502																																																	0													161.0	127.0	139.0					19																	49248480		2203	4300	6503	SO:0001583	missense	284359			BC034769	CCDS12732.1	19q13.33	2014-07-23			ENSG00000182264	ENSG00000182264		"""-"""	28539	protein-coding gene	gene with protein product	"""oocyte binding/fusion factor"""	609278				15759005, 18952059, 19658160, 22957301	Standard	NM_182575		Approved	IZUMO, MGC34799, OBF	uc002pkj.3	Q8IYV9	OTTHUMG00000183324	ENST00000332955.2:c.301G>A	19.37:g.49248480C>T	ENSP00000327786:p.Asp101Asn		Q6Q8P6|Q6Q8P7	Missense_Mutation	SNP	NULL	p.D101N	ENST00000332955.2	37	c.301	CCDS12732.1	19	.	.	.	.	.	.	.	.	.	.	C	16.81	3.226689	0.58668	.	.	ENSG00000182264	ENST00000332955	T	0.22945	1.93	5.1	4.06	0.47325	.	1.277300	0.05345	N	0.530903	T	0.25419	0.0618	L	0.42245	1.32	0.09310	N	1	B	0.23891	0.093	B	0.19666	0.026	T	0.23084	-1.0198	10	0.31617	T	0.26	-4.3769	9.7434	0.40431	0.0:0.9033:0.0:0.0967	.	101	Q8IYV9	IZUM1_HUMAN	N	101	ENSP00000327786:D101N	ENSP00000327786:D101N	D	-	1	0	IZUMO1	53940292	0.000000	0.05858	0.044000	0.18714	0.921000	0.55340	0.225000	0.17757	1.292000	0.44672	0.491000	0.48974	GAT	IZUMO1	-	NULL		0.502	IZUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IZUMO1	HGNC	protein_coding	OTTHUMT00000466189.1	C	NM_182575		49248480	-1	no_errors	ENST00000332955	ensembl	human	known	70_37	missense	SNP	0.026	T
JAK1	3716	genome.wustl.edu	37	1	65305416	65305416	+	Silent	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:65305416C>T	ENST00000342505.4	-	20	2960	c.2712G>A	c.(2710-2712)caG>caA	p.Q904Q	JAK1_ENST00000465376.1_5'Flank	NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	904	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TAACAGCCACCTGCTCCCCTG	0.493			Mis		ALL																																			Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	0													128.0	117.0	121.0					1																	65305416		1917	4144	6061	SO:0001819	synonymous_variant	3716			M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.2712G>A	1.37:g.65305416C>T			Q59GQ2|Q9UD26	Silent	SNP	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak1,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_SH2,pfscan_Prot_kinase_cat_dom	p.Q904	ENST00000342505.4	37	c.2712	CCDS41346.1	1																																																																																			JAK1	-	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.493	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK1	HGNC	protein_coding	OTTHUMT00000025791.1	C	NM_002227		65305416	-1	no_errors	ENST00000342505	ensembl	human	known	70_37	silent	SNP	1.000	T
AREL1	9870	genome.wustl.edu	37	14	75151318	75151318	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr14:75151318G>T	ENST00000356357.4	-	4	597	c.82C>A	c.(82-84)Cgt>Agt	p.R28S	AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1	28					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CTGACTACACGTGCGGCAAGC	0.517																																																	0													52.0	51.0	51.0					14																	75151318		1981	4172	6153	SO:0001583	missense	9870			AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.82C>A	14.37:g.75151318G>T	ENSP00000348714:p.Arg28Ser		B4E2C7|Q7LDY1|Q8IYY9	Missense_Mutation	SNP	pfam_HECT,pfam_Filamin/ABP280_repeat-like,superfamily_HECT,superfamily_Ig_E-set,smart_HECT,pfscan_Filamin/ABP280_repeat-like,pfscan_HECT	p.R28S	ENST00000356357.4	37	c.82	CCDS41971.1	14	.	.	.	.	.	.	.	.	.	.	G	16.17	3.046571	0.55110	.	.	ENSG00000119682	ENST00000356357;ENST00000555249	T;T	0.51817	0.69;0.69	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.48926	0.1527	N	0.08118	0	0.80722	D	1	D;D	0.67145	0.996;0.987	D;D	0.76575	0.988;0.931	T	0.44937	-0.9295	10	0.12103	T	0.63	.	20.0203	0.97492	0.0:0.0:1.0:0.0	.	28;28	O15033-2;O15033	.;K0317_HUMAN	S	28	ENSP00000348714:R28S;ENSP00000450458:R28S	ENSP00000348714:R28S	R	-	1	0	KIAA0317	74221071	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.281000	0.78621	2.730000	0.93505	0.655000	0.94253	CGT	KIAA0317	-	NULL		0.517	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0317	HGNC	protein_coding	OTTHUMT00000335517.2	G	NM_014821		75151318	-1	no_errors	ENST00000356357	ensembl	human	known	70_37	missense	SNP	1.000	T
KIAA1033	23325	genome.wustl.edu	37	12	105538628	105538628	+	Missense_Mutation	SNP	T	T	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr12:105538628T>A	ENST00000332180.5	+	22	2399	c.2312T>A	c.(2311-2313)cTt>cAt	p.L771H		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						GAGGCACATCTTCCCAGTCAG	0.383																																																	0													153.0	145.0	148.0					12																	105538628		1913	4130	6043	SO:0001583	missense	23325			AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.2312T>A	12.37:g.105538628T>A	ENSP00000328062:p.Leu771His			Missense_Mutation	SNP	NULL	p.L771H	ENST00000332180.5	37	c.2312	CCDS41826.1	12	.	.	.	.	.	.	.	.	.	.	T	27.0	4.788791	0.90367	.	.	ENSG00000136051	ENST00000332180	T	0.64438	-0.1	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.82504	0.5051	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86111	0.1562	10	0.87932	D	0	.	15.9674	0.79985	0.0:0.0:0.0:1.0	.	772;771	B7ZKT9;Q2M389	.;WASH7_HUMAN	H	771	ENSP00000328062:L771H	ENSP00000328062:L771H	L	+	2	0	KIAA1033	104062758	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.994000	0.88315	2.170000	0.68504	0.477000	0.44152	CTT	KIAA1033	-	NULL		0.383	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1033	HGNC	protein_coding	OTTHUMT00000406138.4	T	NM_015275		105538628	+1	no_errors	ENST00000332180	ensembl	human	known	70_37	missense	SNP	1.000	A
KIAA1211L	343990	genome.wustl.edu	37	2	99439361	99439361	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr2:99439361C>G	ENST00000397899.2	-	7	1706	c.1375G>C	c.(1375-1377)Gag>Cag	p.E459Q		NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	459	Pro-rich.																CTCTCGGGCTCAGGCGCCGGC	0.741																																																	0													12.0	15.0	14.0					2																	99439361		1794	4029	5823	SO:0001583	missense	343990			BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.1375G>C	2.37:g.99439361C>G	ENSP00000380996:p.Glu459Gln			Missense_Mutation	SNP	NULL	p.E459Q	ENST00000397899.2	37	c.1375	CCDS42720.1	2	.	.	.	.	.	.	.	.	.	.	C	6.867	0.529237	0.13127	.	.	ENSG00000196872	ENST00000397899	T	0.45668	0.89	0.235	0.235	0.15431	.	.	.	.	.	T	0.38081	0.1027	L	0.40543	1.245	0.09310	N	1	P	0.42039	0.769	P	0.49332	0.607	T	0.27872	-1.0061	8	0.19147	T	0.46	.	.	.	.	.	459	Q6NV74	CB055_HUMAN	Q	459	ENSP00000380996:E459Q	ENSP00000380996:E459Q	E	-	1	0	C2orf55	98805793	0.001000	0.12720	0.161000	0.22692	0.150000	0.21749	0.011000	0.13264	0.308000	0.22923	0.313000	0.20887	GAG	KIAA1211L	-	NULL		0.741	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211L	HGNC	protein_coding	OTTHUMT00000329933.1	C	NM_207362		99439361	-1	no_errors	ENST00000397899	ensembl	human	known	70_37	missense	SNP	0.489	G
KIAA1244	57221	genome.wustl.edu	37	6	138583935	138583935	+	Missense_Mutation	SNP	G	G	A	rs138456342	byFrequency	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr6:138583935G>A	ENST00000251691.4	+	12	1481	c.1315G>A	c.(1315-1317)Gag>Aag	p.E439K		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		TGCCCTGGATGAGCTCAGCCA	0.582																																																	0								G	LYS/GLU	0,4406		0,0,2203	99.0	89.0	93.0		1315	5.6	1.0	6	dbSNP_134	93	2,8598	2.2+/-6.3	0,2,4298	no	missense	KIAA1244	NM_020340.4	56	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	439/2178	138583935	2,13004	2203	4300	6503	SO:0001583	missense	57221			AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.1315G>A	6.37:g.138583935G>A	ENSP00000251691:p.Glu439Lys			Missense_Mutation	SNP	pfam_DUF1981_SEC7_assoc,superfamily_ARM-type_fold,superfamily_Sec7,smart_Sec7	p.E439K	ENST00000251691.4	37	c.1315	CCDS5189.2	6	.	.	.	.	.	.	.	.	.	.	G	20.4	3.986048	0.74589	0.0	2.33E-4	ENSG00000112379	ENST00000251691	T	0.04194	3.68	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.13372	0.0324	M	0.62723	1.935	0.52099	D	0.999949	D	0.69078	0.997	D	0.73380	0.98	T	0.00441	-1.1737	10	0.62326	D	0.03	-34.2594	17.8491	0.88739	0.0:0.0:1.0:0.0	.	439	Q5TH69	BIG3_HUMAN	K	439	ENSP00000251691:E439K	ENSP00000251691:E439K	E	+	1	0	KIAA1244	138625628	1.000000	0.71417	0.959000	0.39883	0.702000	0.40608	4.882000	0.63121	2.639000	0.89480	0.655000	0.94253	GAG	KIAA1244	-	superfamily_ARM-type_fold		0.582	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1244	HGNC	protein_coding	OTTHUMT00000042425.4	G	NM_020340		138583935	+1	no_errors	ENST00000251691	ensembl	human	known	70_37	missense	SNP	0.997	A
KPNA6	23633	genome.wustl.edu	37	1	32620238	32620238	+	Frame_Shift_Del	DEL	G	G	-			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:32620238delG	ENST00000373625.3	+	2	147	c.54delG	c.(52-54)aagfs	p.K18fs	KPNA6_ENST00000469790.1_3'UTR|KPNA6_ENST00000537234.1_Frame_Shift_Del_p.K15fs|KPNA6_ENST00000545542.1_Frame_Shift_Del_p.K23fs	NM_012316.4	NP_036448.1	O60684	IMA7_HUMAN	karyopherin alpha 6 (importin alpha 7)	18	IBB. {ECO:0000255|PROSITE- ProRule:PRU00561}.				maternal process involved in female pregnancy (GO:0060135)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			large_intestine(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				AGAGCTATAAGAACAATGCTC	0.453																																																	0													84.0	81.0	82.0					1																	32620238		2203	4300	6503	SO:0001589	frameshift_variant	23633			AF060543	CCDS352.1	1p35.1	2013-02-14			ENSG00000025800	ENSG00000025800		"""Importins"", ""Armadillo repeat containing"""	6399	protein-coding gene	gene with protein product		610563				10523667	Standard	NM_012316		Approved	IPOA7, KPNA7, MGC17918, FLJ11249	uc001bug.3	O60684	OTTHUMG00000004333	ENST00000373625.3:c.54delG	1.37:g.32620238delG	ENSP00000362728:p.Lys18fs		B2RDC7|D3DPP5|Q5VVU3	Frame_Shift_Del	DEL	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.N24fs	ENST00000373625.3	37	c.69	CCDS352.1	1																																																																																			KPNA6	-	pfam_Importin-a_IBB,superfamily_ARM-type_fold,pfscan_Importin-a_IBB		0.453	KPNA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KPNA6	HGNC	protein_coding	OTTHUMT00000012527.4	G	NM_012316		32620238	+1	no_errors	ENST00000545542	ensembl	human	known	70_37	frame_shift_del	DEL	1.000	-
KPNA6	23633	genome.wustl.edu	37	1	32620244	32620245	+	Missense_Mutation	DNP	TG	TG	AT			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	T|G	T|G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:32620244_32620245TG>AT	ENST00000373625.3	+	2	153_154	c.60_61TG>AT	c.(58-63)aaTGct>aaATct	p.20_21NA>KS	KPNA6_ENST00000469790.1_3'UTR|KPNA6_ENST00000537234.1_Missense_Mutation_p.17_18NA>KS|KPNA6_ENST00000545542.1_Missense_Mutation_p.25_26NA>KS	NM_012316.4	NP_036448.1	O60684	IMA7_HUMAN	karyopherin alpha 6 (importin alpha 7)	20	IBB. {ECO:0000255|PROSITE- ProRule:PRU00561}.				maternal process involved in female pregnancy (GO:0060135)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			large_intestine(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				ATAAGAACAATGCTCTAAACCC	0.45																																																	0																																										SO:0001583	missense	23633			AF060543	CCDS352.1	1p35.1	2013-02-14			ENSG00000025800	ENSG00000025800		"""Importins"", ""Armadillo repeat containing"""	6399	protein-coding gene	gene with protein product		610563				10523667	Standard	NM_012316		Approved	IPOA7, KPNA7, MGC17918, FLJ11249	uc001bug.3	O60684	OTTHUMG00000004333	Exception_encountered	1.37:g.32620244_32620245delinsAT	ENSP00000362728:p.N20_A21delinsKS		B2RDC7|D3DPP5|Q5VVU3	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.N25K|p.A26S	ENST00000373625.3	37	c.75|c.76	CCDS352.1	1																																																																																			KPNA6	-	pfam_Importin-a_IBB,superfamily_ARM-type_fold,pfscan_Importin-a_IBB		0.450	KPNA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KPNA6	HGNC	protein_coding	OTTHUMT00000012527.4	T|G	NM_012316		32620244|32620245	+1	no_errors	ENST00000545542	ensembl	human	known	70_37	missense	SNP	1.000	A|T
KRT6B	3854	genome.wustl.edu	37	12	52843273	52843273	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr12:52843273C>G	ENST00000252252.3	-	5	1104	c.1057G>C	c.(1057-1059)Gag>Cag	p.E353Q		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	353	Coil 2.|Rod.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		TACCAGGACTCAGCCTCAGCC	0.562																																																	0													213.0	189.0	197.0					12																	52843273		2203	4300	6503	SO:0001583	missense	3854			BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.1057G>C	12.37:g.52843273C>G	ENSP00000252252:p.Glu353Gln		P48669	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.E353Q	ENST00000252252.3	37	c.1057	CCDS8828.1	12	.	.	.	.	.	.	.	.	.	.	C	15.55	2.867659	0.51588	.	.	ENSG00000185479	ENST00000252252;ENST00000544607	D	0.93906	-3.31	3.05	1.11	0.20524	Filament (1);	0.000000	0.64402	D	0.000011	D	0.96116	0.8734	M	0.92691	3.335	0.40057	D	0.975851	D	0.60575	0.988	P	0.61722	0.893	D	0.94735	0.7913	10	0.87932	D	0	.	7.6473	0.28327	0.162:0.7469:0.0:0.0911	.	353	P04259	K2C6B_HUMAN	Q	353;313	ENSP00000252252:E353Q	ENSP00000252252:E353Q	E	-	1	0	KRT6B	51129540	0.984000	0.35163	0.945000	0.38365	0.575000	0.36095	2.872000	0.48467	0.313000	0.23062	0.298000	0.19748	GAG	KRT6B	-	pfam_F,superfamily_Prefoldin		0.562	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6B	HGNC	protein_coding	OTTHUMT00000404969.1	C	NM_005555		52843273	-1	no_errors	ENST00000252252	ensembl	human	known	70_37	missense	SNP	0.996	G
LAMP1	3916	genome.wustl.edu	37	13	113975993	113975993	+	Missense_Mutation	SNP	C	C	G	rs372370740		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr13:113975993C>G	ENST00000332556.4	+	8	1259	c.1065C>G	c.(1063-1065)ttC>ttG	p.F355L	LAMP1_ENST00000397181.3_Missense_Mutation_p.F302L	NM_005561.3	NP_005552.3	P11279	LAMP1_HUMAN	lysosomal-associated membrane protein 1	355	Second lumenal domain.				autophagic cell death (GO:0048102)|autophagy (GO:0006914)|establishment of protein localization to organelle (GO:0072594)|Golgi to lysosome transport (GO:0090160)|granzyme-mediated apoptotic signaling pathway (GO:0008626)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|protein stabilization (GO:0050821)|regulation of organelle transport along microtubule (GO:1902513)	alveolar lamellar body (GO:0097208)|cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|phagolysosome membrane (GO:0061474)|sarcolemma (GO:0042383)	enzyme binding (GO:0019899)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(2)|prostate(1)|skin(1)|stomach(2)	16	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			TCAATATATTCAAAGTGTGGG	0.587																																																	0													98.0	108.0	105.0					13																	113975993		2126	4216	6342	SO:0001583	missense	3916			J03263	CCDS41909.1	13q34	2011-11-24			ENSG00000185896	ENSG00000185896		"""CD molecules"""	6499	protein-coding gene	gene with protein product		153330					Standard	NM_005561		Approved	CD107a	uc001vtm.1	P11279	OTTHUMG00000017380	ENST00000332556.4:c.1065C>G	13.37:g.113975993C>G	ENSP00000333298:p.Phe355Leu		B4DWL3|Q8WU33|Q96I40|Q9BRD2|Q9NP13	Missense_Mutation	SNP	pfam_Lysosome-assoc_membr_glycop,prints_Lysosome-assoc_membr_glycop	p.F355L	ENST00000332556.4	37	c.1065	CCDS41909.1	13	.	.	.	.	.	.	.	.	.	.	C	17.06	3.291269	0.59976	.	.	ENSG00000185896	ENST00000332556;ENST00000397181	T;T	0.34275	1.37;1.37	5.27	5.27	0.74061	.	0.094831	0.85682	D	0.000000	T	0.57975	0.2090	M	0.85197	2.74	0.54753	D	0.999988	P;P	0.45531	0.798;0.86	P;P	0.56127	0.552;0.792	T	0.61734	-0.7002	10	0.51188	T	0.08	-34.5392	12.699	0.57020	0.0:0.9142:0.0:0.0858	.	302;355	B4DWL3;P11279	.;LAMP1_HUMAN	L	355;302	ENSP00000333298:F355L;ENSP00000415354:F302L	ENSP00000333298:F355L	F	+	3	2	LAMP1	113023994	0.376000	0.25098	0.149000	0.22428	0.166000	0.22503	0.915000	0.28638	2.471000	0.83476	0.549000	0.68633	TTC	LAMP1	-	pfam_Lysosome-assoc_membr_glycop		0.587	LAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMP1	HGNC	protein_coding	OTTHUMT00000045876.2	C			113975993	+1	no_errors	ENST00000332556	ensembl	human	known	70_37	missense	SNP	0.983	G
LETMD1	25875	genome.wustl.edu	37	12	51442848	51442848	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr12:51442848G>A	ENST00000262055.4	+	2	193	c.154G>A	c.(154-156)Gat>Aat	p.D52N	LETMD1_ENST00000548516.1_3'UTR|LETMD1_ENST00000380123.2_Missense_Mutation_p.D52N|LETMD1_ENST00000547008.1_Missense_Mutation_p.D52N|LETMD1_ENST00000550929.1_De_novo_Start_OutOfFrame|LETMD1_ENST00000418425.2_Missense_Mutation_p.D52N|LETMD1_ENST00000552739.1_Intron	NM_015416.4	NP_056231.3	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1	52	Required and sufficient for mitochondrial import.					integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)				central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(3)	16						TCCAAAGGCAGATGTGAAGAA	0.448																																																	0													117.0	106.0	109.0					12																	51442848		2203	4300	6503	SO:0001583	missense	25875			AF195651	CCDS8806.1, CCDS58231.1, CCDS73469.1	12q13.13	2006-04-12				ENSG00000050426			24241	protein-coding gene	gene with protein product	"""cervical cancer 1 protooncogene"""					12879013, 12061725	Standard	NM_015416		Approved	HCCR1	uc009zlw.3	Q6P1Q0	OTTHUMG00000169538	ENST00000262055.4:c.154G>A	12.37:g.51442848G>A	ENSP00000262055:p.Asp52Asn		A6NER7|B3KXK7|Q6X2E4|Q6X2E5|Q7L2G9|Q7L690|Q8WXW6|Q96PK7|Q9BY59|Q9Y3X3	Missense_Mutation	SNP	pfam_LETM1	p.D52N	ENST00000262055.4	37	c.154	CCDS8806.1	12	.	.	.	.	.	.	.	.	.	.	G	15.10	2.732113	0.48939	.	.	ENSG00000050426	ENST00000551477;ENST00000262055;ENST00000550442;ENST00000549340;ENST00000548209;ENST00000548251;ENST00000380123;ENST00000548401;ENST00000418425;ENST00000448283;ENST00000547008	T;T;T;T;T;T;T;T;T;T	0.48201	0.85;0.86;0.88;0.82;0.84;0.83;0.85;0.88;0.87;0.84	4.86	3.97	0.46021	.	0.332477	0.31566	N	0.007440	T	0.29126	0.0724	N	0.24115	0.695	0.30388	N	0.781291	B;B;B;B;B;B	0.21753	0.033;0.006;0.06;0.006;0.001;0.06	B;B;B;B;B;B	0.22601	0.04;0.012;0.027;0.008;0.004;0.027	T	0.18587	-1.0332	10	0.18276	T	0.48	-4.4582	7.4592	0.27285	0.1906:0.0:0.8094:0.0	.	52;52;52;52;52;52	B7Z9A7;F8VVQ3;B3KXK7;F8W6J0;F8W1Z2;Q6P1Q0	.;.;.;.;.;LTMD1_HUMAN	N	19;52;52;52;52;52;52;59;52;52;52	ENSP00000446862:D19N;ENSP00000262055:D52N;ENSP00000448110:D52N;ENSP00000449896:D52N;ENSP00000450275:D52N;ENSP00000447166:D52N;ENSP00000369466:D52N;ENSP00000450082:D59N;ENSP00000389903:D52N;ENSP00000447419:D52N	ENSP00000262055:D52N	D	+	1	0	LETMD1	49729115	1.000000	0.71417	0.913000	0.36048	0.965000	0.64279	2.998000	0.49465	1.406000	0.46857	0.655000	0.94253	GAT	LETMD1	-	NULL		0.448	LETMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LETMD1	HGNC	protein_coding	OTTHUMT00000404710.1	G	NM_015416		51442848	+1	no_errors	ENST00000262055	ensembl	human	known	70_37	missense	SNP	0.907	A
LRPPRC	10128	genome.wustl.edu	37	2	44123818	44123818	+	Silent	SNP	C	C	T	rs571550652		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr2:44123818C>T	ENST00000260665.7	-	35	3912	c.3855G>A	c.(3853-3855)ccG>ccA	p.P1285P		NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	1285	RNA-binding.				mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ACAACAAAATCGGGGTTTGTT	0.363																																																	0													112.0	109.0	110.0					2																	44123818		2203	4300	6503	SO:0001819	synonymous_variant	10128			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.3855G>A	2.37:g.44123818C>T			A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Silent	SNP	pfam_Pentatricopeptide_repeat,tigrfam_Pentatricopeptide_repeat	p.P1285	ENST00000260665.7	37	c.3855	CCDS33189.1	2																																																																																			LRPPRC	-	NULL		0.363	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRPPRC	HGNC	protein_coding	OTTHUMT00000327823.1	C	NM_133259		44123818	-1	no_errors	ENST00000260665	ensembl	human	known	70_37	silent	SNP	0.000	T
LRPPRC	10128	genome.wustl.edu	37	2	44190816	44190816	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr2:44190816C>A	ENST00000260665.7	-	12	1456	c.1399G>T	c.(1399-1401)Gaa>Taa	p.E467*	LRPPRC_ENST00000409946.1_Nonsense_Mutation_p.E467*|LRPPRC_ENST00000409659.1_Nonsense_Mutation_p.E467*	NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	467					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ACTCCCAATTCTTGCATTCCT	0.363																																																	0													136.0	132.0	134.0					2																	44190816		2203	4300	6503	SO:0001587	stop_gained	10128			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.1399G>T	2.37:g.44190816C>A	ENSP00000260665:p.Glu467*		A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Nonsense_Mutation	SNP	pfam_Pentatricopeptide_repeat,tigrfam_Pentatricopeptide_repeat	p.E467*	ENST00000260665.7	37	c.1399	CCDS33189.1	2	.	.	.	.	.	.	.	.	.	.	C	18.85	3.711281	0.68730	.	.	ENSG00000138095	ENST00000465633;ENST00000260665;ENST00000409946;ENST00000409659	.	.	.	5.47	4.58	0.56647	.	0.158211	0.53938	D	0.000043	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-7.8431	12.6498	0.56755	0.0:0.8596:0.0:0.1404	.	.	.	.	X	367;467;467;467	.	ENSP00000260665:E467X	E	-	1	0	LRPPRC	44044320	0.736000	0.28164	0.033000	0.17914	0.021000	0.10359	1.967000	0.40491	1.270000	0.44297	0.563000	0.77884	GAA	LRPPRC	-	NULL		0.363	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRPPRC	HGNC	protein_coding	OTTHUMT00000327823.1	C	NM_133259		44190816	-1	no_errors	ENST00000260665	ensembl	human	known	70_37	nonsense	SNP	0.275	A
LYPD3	27076	genome.wustl.edu	37	19	43968495	43968495	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr19:43968495C>T	ENST00000244333.3	-	2	281	c.193G>A	c.(193-195)Gtg>Atg	p.V65M		NM_014400.2	NP_055215.2	O95274	LYPD3_HUMAN	LY6/PLAUR domain containing 3	65	UPAR/Ly6 1.				cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|pancreas(1)|upper_aerodigestive_tract(2)	11		Prostate(69;0.0153)				ACCGCCCCCACGGCCTCGGTG	0.652																																																	0													36.0	30.0	32.0					19																	43968495		2202	4300	6502	SO:0001583	missense	27076			AF082889	CCDS12620.1	19q13.31	2008-02-05				ENSG00000124466			24880	protein-coding gene	gene with protein product		609484				11179665, 11245483	Standard	NM_014400		Approved	C4.4A	uc002owl.1	O95274		ENST00000244333.3:c.193G>A	19.37:g.43968495C>T	ENSP00000244333:p.Val65Met		Q9UJ74	Missense_Mutation	SNP	pfam_LY6_UPAR,smart_LY6_UPA_recep-like	p.V65M	ENST00000244333.3	37	c.193	CCDS12620.1	19	.	.	.	.	.	.	.	.	.	.	C	23.2	4.392748	0.83011	.	.	ENSG00000124466	ENST00000244333;ENST00000377995	T	0.39997	1.05	4.88	4.88	0.63580	Ly-6 antigen / uPA receptor -like (1);CD59 antigen (1);	0.165289	0.27289	N	0.020056	T	0.44307	0.1287	N	0.08118	0	0.36198	D	0.850545	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.60167	-0.7316	10	0.72032	D	0.01	.	13.9639	0.64196	0.0:1.0:0.0:0.0	.	65;65	B2RBR3;O95274	.;LYPD3_HUMAN	M	65	ENSP00000244333:V65M	ENSP00000244333:V65M	V	-	1	0	LYPD3	48660335	0.992000	0.36948	0.994000	0.49952	0.931000	0.56810	3.834000	0.55798	2.437000	0.82529	0.456000	0.33151	GTG	LYPD3	-	pfam_LY6_UPAR,smart_LY6_UPA_recep-like		0.652	LYPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYPD3	HGNC	protein_coding	OTTHUMT00000463177.1	C	NM_014400		43968495	-1	no_errors	ENST00000244333	ensembl	human	known	70_37	missense	SNP	0.991	T
MAPK8IP3	23162	genome.wustl.edu	37	16	1793357	1793357	+	Silent	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr16:1793357G>A	ENST00000250894.4	+	5	781	c.624G>A	c.(622-624)ctG>ctA	p.L208L	MAPK8IP3_ENST00000356010.5_Silent_p.L208L	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	208					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						CCACCTCCCTGAACGTGTTCC	0.657																																																	0													41.0	45.0	44.0					16																	1793357		2039	4166	6205	SO:0001819	synonymous_variant	23162			AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.624G>A	16.37:g.1793357G>A			A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Silent	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.L208	ENST00000250894.4	37	c.624	CCDS10442.2	16																																																																																			MAPK8IP3	-	NULL		0.657	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK8IP3	HGNC	protein_coding	OTTHUMT00000250508.2	G	NM_001040439		1793357	+1	no_errors	ENST00000250894	ensembl	human	known	70_37	silent	SNP	1.000	A
MARCH6	10299	genome.wustl.edu	37	5	10417496	10417496	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr5:10417496C>G	ENST00000274140.5	+	22	2395	c.2263C>G	c.(2263-2265)Cct>Gct	p.P755A	MARCH6_ENST00000503788.1_Missense_Mutation_p.P650A|MARCH6_ENST00000510792.1_Missense_Mutation_p.P453A|MARCH6_ENST00000449913.2_Missense_Mutation_p.P707A	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	755					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						GGATCAGACTCCTCTTTTTTA	0.473																																																	0													185.0	180.0	182.0					5																	10417496		2203	4300	6503	SO:0001583	missense	10299			AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.2263C>G	5.37:g.10417496C>G	ENSP00000274140:p.Pro755Ala		A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.P755A	ENST00000274140.5	37	c.2263	CCDS34135.1	5	.	.	.	.	.	.	.	.	.	.	C	17.53	3.413046	0.62511	.	.	ENSG00000145495	ENST00000449913;ENST00000503788;ENST00000274140;ENST00000510792	T;T;T;T	0.51325	1.73;0.71;1.74;0.71	5.48	5.48	0.80851	.	0.107842	0.64402	D	0.000004	T	0.60261	0.2255	M	0.62723	1.935	0.80722	D	1	B;D;P;P	0.59357	0.332;0.985;0.837;0.908	B;P;P;P	0.54965	0.298;0.765;0.475;0.527	T	0.57335	-0.7829	10	0.35671	T	0.21	-20.917	17.5484	0.87869	0.0:1.0:0.0:0.0	.	650;707;335;755	B4DKJ2;B4DT33;B2RBJ1;O60337	.;.;.;MARH6_HUMAN	A	707;650;755;453	ENSP00000414643:P707A;ENSP00000425930:P650A;ENSP00000274140:P755A;ENSP00000424512:P453A	ENSP00000274140:P755A	P	+	1	0	MARCH6	10470496	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.419000	0.80179	2.584000	0.87258	0.650000	0.86243	CCT	MARCH6	-	NULL		0.473	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH6	HGNC	protein_coding	OTTHUMT00000366919.2	C	NM_005885		10417496	+1	no_errors	ENST00000274140	ensembl	human	known	70_37	missense	SNP	1.000	G
MARK1	4139	genome.wustl.edu	37	1	220804416	220804416	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:220804416G>C	ENST00000366917.4	+	10	1215	c.949G>C	c.(949-951)Gag>Cag	p.E317Q	MARK1_ENST00000402574.1_Missense_Mutation_p.E182Q|MARK1_ENST00000366918.4_Missense_Mutation_p.E295Q					MAP/microtubule affinity-regulating kinase 1									p.E317K(1)		central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		TGGTCATGAAGAGGAAGAACT	0.368																																																	1	Substitution - Missense(1)	skin(1)											126.0	121.0	122.0					1																	220804416		2203	4300	6503	SO:0001583	missense	4139			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.949G>C	1.37:g.220804416G>C	ENSP00000355884:p.Glu317Gln			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase-assoc_KA1,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E317Q	ENST00000366917.4	37	c.949	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.703207	0.88924	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.73681	-0.65;-0.44;-0.77	5.78	4.87	0.63330	.	0.053696	0.64402	D	0.000001	T	0.74351	0.3705	M	0.73372	2.23	0.80722	D	1	B;B;P;P	0.47253	0.109;0.158;0.492;0.892	B;B;B;B	0.42030	0.036;0.073;0.036;0.373	T	0.76929	-0.2777	10	0.45353	T	0.12	.	15.2203	0.73306	0.0675:0.0:0.9325:0.0	.	317;182;317;295	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	Q	182;295;317	ENSP00000386017:E182Q;ENSP00000355885:E295Q;ENSP00000355884:E317Q	ENSP00000355884:E317Q	E	+	1	0	MARK1	218871039	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	9.571000	0.98176	1.595000	0.50050	0.655000	0.94253	GAG	MARK1	-	NULL		0.368	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1	G			220804416	+1	no_errors	ENST00000366917	ensembl	human	known	70_37	missense	SNP	1.000	C
MAST4	375449	genome.wustl.edu	37	5	66427716	66427716	+	Missense_Mutation	SNP	C	C	T	rs375581688		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr5:66427716C>T	ENST00000403625.2	+	16	2325	c.2030C>T	c.(2029-2031)aCg>aTg	p.T677M	MAST4_ENST00000405643.1_Missense_Mutation_p.T498M|MAST4_ENST00000404260.3_Missense_Mutation_p.T680M|MAST4_ENST00000261569.7_Missense_Mutation_p.T483M|MAST4_ENST00000403666.1_Missense_Mutation_p.T488M	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	680	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.			FAETV -> YIVKL (in Ref. 4; BAB71532). {ECO:0000305}.		cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TTTGCTGAGACGGTCTTGGCC	0.393																																																	0								C	MET/THR,MET/THR	0,3742		0,0,1871	150.0	149.0	149.0		2030,1463	6.1	1.0	5		149	1,8211		0,1,4105	no	missense,missense	MAST4	NM_001164664.1,NM_015183.2	81,81	0,1,5976	TT,TC,CC		0.0122,0.0,0.0084	probably-damaging,probably-damaging	677/2624,488/2435	66427716	1,11953	1871	4106	5977	SO:0001583	missense	375449			AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.2030C>T	5.37:g.66427716C>T	ENSP00000385727:p.Thr677Met		A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.T680M	ENST00000403625.2	37	c.2039	CCDS54861.1	5	.	.	.	.	.	.	.	.	.	.	C	28.3	4.909860	0.92107	0.0	1.22E-4	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000432399	T;T;T;T;T	0.24538	1.85;1.85;1.85;1.85;1.85	6.07	6.07	0.98685	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.26919	0.0659	N	0.01048	-1.04	0.80722	D	1	D;D;D;D	0.89917	0.996;1.0;1.0;0.998	D;D;D;D	0.97110	0.965;0.999;1.0;0.974	T	0.61806	-0.6987	10	0.72032	D	0.01	-17.868	20.6593	0.99626	0.0:1.0:0.0:0.0	.	498;680;483;488	E7EWQ5;O15021;O15021-2;O15021-3	.;MAST4_HUMAN;.;.	M	680;677;488;498;498;483;483	ENSP00000385048:T680M;ENSP00000385727:T677M;ENSP00000384313:T488M;ENSP00000384099:T498M;ENSP00000261569:T483M	ENSP00000261569:T483M	T	+	2	0	MAST4	66463472	1.000000	0.71417	0.971000	0.41717	0.849000	0.48306	7.818000	0.86416	2.885000	0.99019	0.655000	0.94253	ACG	MAST4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.393	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	MAST4	HGNC	protein_coding	OTTHUMT00000326324.2	C			66427716	+1	no_errors	ENST00000404260	ensembl	human	known	70_37	missense	SNP	1.000	T
METTL25	84190	genome.wustl.edu	37	12	82793053	82793053	+	Silent	SNP	T	T	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr12:82793053T>A	ENST00000248306.3	+	4	1080	c.1011T>A	c.(1009-1011)tcT>tcA	p.S337S	METTL25_ENST00000547357.1_3'UTR	NM_032230.2	NP_115606.2	Q8N6Q8	MET25_HUMAN	methyltransferase like 25	337							methyltransferase activity (GO:0008168)										GAGAAACATCTGAAGCCAATA	0.328																																																	0													49.0	51.0	51.0					12																	82793053		2203	4296	6499	SO:0001819	synonymous_variant	84190			BC029120	CCDS9024.1	12q21.31	2012-08-13	2012-08-13	2012-08-13	ENSG00000127720	ENSG00000127720			26228	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 26"""	C12orf26			Standard	NM_032230		Approved	FLJ22789	uc001szq.3	Q8N6Q8	OTTHUMG00000170252	ENST00000248306.3:c.1011T>A	12.37:g.82793053T>A			Q9H5Y3	Silent	SNP	NULL	p.S337	ENST00000248306.3	37	c.1011	CCDS9024.1	12																																																																																			METTL25	-	NULL		0.328	METTL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL25	HGNC	protein_coding	OTTHUMT00000408192.1	T	NM_032230		82793053	+1	no_errors	ENST00000248306	ensembl	human	known	70_37	silent	SNP	0.939	A
MICA	100507436	genome.wustl.edu	37	6	31380161	31380162	+	Frame_Shift_Ins	INS	-	-	CT	rs41293539|rs547446871|rs138201170	byFrequency	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr6:31380161_31380162insCT	ENST00000449934.2	+	5	1006_1007	c.952_953insCT	c.(952-954)ggcfs	p.G318fs	HCP5_ENST00000414046.2_RNA	NM_001177519.1	NP_001170990.1			MHC class I polypeptide-related sequence A											breast(1)|endometrium(3)|kidney(1)	5		Ovarian(999;0.0253)				TGTTGCTGCTGGCTGCTGCTAT	0.45														1171	0.233826	0.2882	0.2579	5008	,	,		18959	0.127		0.2157	False		,,,				2504	0.272																0																																										SO:0001589	frameshift_variant	100507436			L14848	CCDS56412.1, CCDS75421.1	6p21.3	2013-01-11			ENSG00000204520	ENSG00000204520		"""Immunoglobulin superfamily / C1-set domain containing"""	7090	protein-coding gene	gene with protein product		600169				8022771	Standard	NM_000247		Approved	PERB11.1	uc003ntk.1	Q29983	OTTHUMG00000031073	Exception_encountered	6.37:g.31380161_31380162insCT	ENSP00000413079:p.Gly318fs			Frame_Shift_Ins	INS	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like	p.G318fs	ENST00000449934.2	37	c.952_953	CCDS56412.1	6																																																																																			MICA	-	NULL		0.450	MICA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	MICA	HGNC	protein_coding	OTTHUMT00000076101.7	-	NM_001177519		31380162	+1	no_errors	ENST00000364810	ensembl	human	known	70_37	frame_shift_ins	INS	0.000:0.001	CT
MTMR9	66036	genome.wustl.edu	37	8	11180146	11180146	+	Missense_Mutation	SNP	G	G	A	rs375789918		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr8:11180146G>A	ENST00000221086.3	+	10	1972	c.1499G>A	c.(1498-1500)cGt>cAt	p.R500H	AF131216.6_ENST00000498997.2_RNA|MTMR9_ENST00000526292.1_Missense_Mutation_p.R415H	NM_015458.3	NP_056273.2	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	500						cytoplasm (GO:0005737)	enzyme regulator activity (GO:0030234)|phosphatase activity (GO:0016791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	16			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		ATTTTCCTACGTTGGAATAGA	0.294																																																	0								G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	55.0	60.0	59.0		1499	5.5	1.0	8		59	1,8599	1.2+/-3.3	0,1,4299	no	missense	MTMR9	NM_015458.3	29	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	500/550	11180146	2,13004	2203	4300	6503	SO:0001583	missense	66036			AJ297823	CCDS5979.1	8p23-p22	2011-06-09	2002-09-05	2002-09-06	ENSG00000104643	ENSG00000104643		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	14596	protein-coding gene	gene with protein product		606260	"""myotubularin related protein 8"""	C8orf9, MTMR8		11472061, 11896452, 12890864	Standard	NM_015458		Approved	DKFZp434K171, LIP-STYX	uc003wtm.3	Q96QG7	OTTHUMG00000090647	ENST00000221086.3:c.1499G>A	8.37:g.11180146G>A	ENSP00000221086:p.Arg500His		B7Z291|Q52LU3|Q8WW11|Q96QG6|Q9NX50	Missense_Mutation	SNP	pfam_Myotub-related	p.R500H	ENST00000221086.3	37	c.1499	CCDS5979.1	8	.	.	.	.	.	.	.	.	.	.	G	17.80	3.478961	0.63849	2.27E-4	1.16E-4	ENSG00000104643	ENST00000221086;ENST00000526292	D;D	0.91843	-2.92;-2.92	5.46	5.46	0.80206	.	0.050859	0.85682	D	0.000000	D	0.93242	0.7847	M	0.81942	2.565	0.80722	D	1	D	0.60575	0.988	P	0.45232	0.474	D	0.94240	0.7484	10	0.72032	D	0.01	.	18.2845	0.90110	0.0:0.0:1.0:0.0	.	500	Q96QG7	MTMR9_HUMAN	H	500;415	ENSP00000221086:R500H;ENSP00000433239:R415H	ENSP00000221086:R500H	R	+	2	0	MTMR9	11217556	1.000000	0.71417	0.983000	0.44433	0.602000	0.36980	9.247000	0.95444	2.562000	0.86427	0.655000	0.94253	CGT	MTMR9	-	NULL		0.294	MTMR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR9	HGNC	protein_coding	OTTHUMT00000207307.2	G	NM_015458		11180146	+1	no_errors	ENST00000221086	ensembl	human	known	70_37	missense	SNP	0.999	A
MYH1	4619	genome.wustl.edu	37	17	10400712	10400712	+	Missense_Mutation	SNP	G	G	C	rs139132394		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr17:10400712G>C	ENST00000226207.5	-	32	4517	c.4423C>G	c.(4423-4425)Caa>Gaa	p.Q1475E	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1475					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GATTCCTTTTGAGAAGCTTCA	0.378																																																	0													79.0	76.0	77.0					17																	10400712		2203	4300	6503	SO:0001583	missense	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.4423C>G	17.37:g.10400712G>C	ENSP00000226207:p.Gln1475Glu		Q14CA4|Q9Y622	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q1475E	ENST00000226207.5	37	c.4423	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	G	23.8	4.454039	0.84209	.	.	ENSG00000109061	ENST00000226207;ENST00000379814	T	0.79653	-1.29	5.76	5.76	0.90799	Myosin tail (1);	0.000000	0.41097	U	0.000959	D	0.90092	0.6905	M	0.82056	2.57	0.80722	D	1	P	0.46512	0.879	P	0.61003	0.882	D	0.90125	0.4202	10	0.87932	D	0	.	20.3316	0.98722	0.0:0.0:1.0:0.0	.	1475	P12882	MYH1_HUMAN	E	1475;564	ENSP00000226207:Q1475E	ENSP00000226207:Q1475E	Q	-	1	0	MYH1	10341437	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.970000	0.88000	2.871000	0.98454	0.655000	0.94253	CAA	MYH1	-	pfam_Myosin_tail,superfamily_Prefoldin		0.378	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	G	NM_005963		10400712	-1	no_errors	ENST00000226207	ensembl	human	known	70_37	missense	SNP	1.000	C
NECAP2	55707	genome.wustl.edu	37	1	16767245	16767245	+	5'UTR	SNP	C	C	T	rs149798654	byFrequency	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:16767245C>T	ENST00000337132.5	+	0	79				NECAP2_ENST00000457722.2_5'UTR|NECAP2_ENST00000504551.2_5'UTR|NECAP2_ENST00000486390.1_3'UTR|NECAP2_ENST00000406746.1_5'UTR|NECAP2_ENST00000443980.2_5'UTR	NM_001145278.1|NM_018090.4	NP_001138750.1|NP_060560.1	Q9NVZ3	NECP2_HUMAN	NECAP endocytosis associated 2						endocytosis (GO:0006897)|protein transport (GO:0015031)	clathrin vesicle coat (GO:0030125)|coated pit (GO:0005905)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|Kidney(64;0.000181)|KIRC - Kidney renal clear cell carcinoma(64;0.00268)|STAD - Stomach adenocarcinoma(196;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		TCGGTGGGCTCCAGGCGTCGC	0.657											OREG0013136	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													105.0	90.0	95.0					1																	16767245		2203	4300	6503	SO:0001623	5_prime_UTR_variant	55707			AK021938	CCDS173.1, CCDS44066.1, CCDS44067.1	1p36.13	2008-02-05			ENSG00000157191	ENSG00000157191			25528	protein-coding gene	gene with protein product		611624				14555962, 15494011	Standard	NM_001145277		Approved	FLJ10420	uc001ayq.3	Q9NVZ3	OTTHUMG00000002313	ENST00000337132.5:c.-12C>T	1.37:g.16767245C>T		712	B4DY19|E9PGQ8|Q5VSU4|Q5VSU5|Q9H7L1|Q9H8L1	RNA	SNP	-	NULL	ENST00000337132.5	37	NULL	CCDS173.1	1																																																																																			NECAP2	-	-		0.657	NECAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NECAP2	HGNC	protein_coding	OTTHUMT00000006680.2	C	NM_018090		16767245	+1	no_errors	ENST00000486390	ensembl	human	known	70_37	rna	SNP	0.003	T
NBPF1	55672	genome.wustl.edu	37	1	16890647	16890647	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:16890647C>T	ENST00000430580.2	-	29	4098	c.3211G>A	c.(3211-3213)Gaa>Aaa	p.E1071K		NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	1051	NBPF 7. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TGCAAGACTTCAGGCTCTTCC	0.463																																																	0													447.0	360.0	390.0					1																	16890647		2203	4299	6502	SO:0001583	missense	55672			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.3211G>A	1.37:g.16890647C>T	ENSP00000474456:p.Glu1071Lys		Q8N4E8|Q9C0H0	RNA	SNP	-	NULL	ENST00000430580.2	37	NULL		1																																																																																			NBPF1	-	-		0.463	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	NBPF1	HGNC	protein_coding	OTTHUMT00000106436.3	C	NM_017940		16890647	-1	no_errors	ENST00000401007	ensembl	human	known	70_37	rna	SNP	0.007	T
NFE2L3	9603	genome.wustl.edu	37	7	26224536	26224536	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr7:26224536C>G	ENST00000056233.3	+	4	1477	c.1218C>G	c.(1216-1218)atC>atG	p.I406M		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	406					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						TTGATCCAATCGATGTTTCTC	0.363																																																	0													96.0	102.0	100.0					7																	26224536		2203	4299	6502	SO:0001583	missense	9603			AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1218C>G	7.37:g.26224536C>G	ENSP00000056233:p.Ile406Met		Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Missense_Mutation	SNP	pfam_bZIP,pfam_bZIP_Maf,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.I406M	ENST00000056233.3	37	c.1218	CCDS5396.1	7	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.504473	0.00992	.	.	ENSG00000050344	ENST00000056233;ENST00000398175	T	0.31247	1.5	5.23	3.34	0.38264	.	0.635019	0.17304	N	0.179156	T	0.10637	0.0260	N	0.02736	-0.51	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.21793	-1.0235	10	0.24483	T	0.36	0.087	3.2009	0.06649	0.1619:0.1408:0.5629:0.1344	.	406	Q9Y4A8	NF2L3_HUMAN	M	406;112	ENSP00000056233:I406M	ENSP00000056233:I406M	I	+	3	3	NFE2L3	26191061	0.852000	0.29690	0.005000	0.12908	0.040000	0.13550	0.306000	0.19279	0.642000	0.30620	-0.340000	0.08031	ATC	NFE2L3	-	NULL		0.363	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L3	HGNC	protein_coding	OTTHUMT00000214088.1	C			26224536	+1	no_errors	ENST00000056233	ensembl	human	known	70_37	missense	SNP	0.153	G
NLRP3	114548	genome.wustl.edu	37	1	247588394	247588394	+	Missense_Mutation	SNP	G	G	A	rs200258061		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:247588394G>A	ENST00000336119.3	+	3	2395	c.1649G>A	c.(1648-1650)cGt>cAt	p.R550H	NLRP3_ENST00000366496.2_Missense_Mutation_p.R550H|NLRP3_ENST00000391828.3_Missense_Mutation_p.R550H|NLRP3_ENST00000366497.2_Missense_Mutation_p.R550H|NLRP3_ENST00000348069.2_Missense_Mutation_p.R550H|NLRP3_ENST00000391827.2_Missense_Mutation_p.R550H|NLRP3_ENST00000474792.1_3'UTR	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	550					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CCAGGGAGTCGTTTGAAGCTT	0.473																																																	0													52.0	47.0	49.0					1																	247588394		2203	4300	6503	SO:0001583	missense	114548			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1649G>A	1.37:g.247588394G>A	ENSP00000337383:p.Arg550His		B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.R550H	ENST00000336119.3	37	c.1649	CCDS1632.1	1	.	.	.	.	.	.	.	.	.	.	G	0.500	-0.871299	0.02570	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.87729	-2.29;-2.29;-2.29;-2.29;-2.29;-2.29	3.93	1.03	0.20045	.	1.562030	0.03275	N	0.185366	T	0.77329	0.4114	L	0.29908	0.895	0.09310	N	1	B;B;B;B;B	0.09022	0.0;0.002;0.001;0.001;0.0	B;B;B;B;B	0.08055	0.0;0.002;0.003;0.003;0.001	T	0.58188	-0.7680	10	0.12766	T	0.61	.	2.651	0.04999	0.1034:0.186:0.5181:0.1925	.	550;550;550;550;550	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	H	550	ENSP00000375704:R550H;ENSP00000355453:R550H;ENSP00000337383:R550H;ENSP00000294752:R550H;ENSP00000355452:R550H;ENSP00000375703:R550H	ENSP00000337383:R550H	R	+	2	0	NLRP3	245655017	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.357000	0.07651	0.247000	0.21414	-0.127000	0.14921	CGT	NLRP3	-	NULL		0.473	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP3	HGNC	protein_coding	OTTHUMT00000097740.1	G	NM_004895		247588394	+1	no_errors	ENST00000336119	ensembl	human	known	70_37	missense	SNP	0.000	A
NLRP9	338321	genome.wustl.edu	37	19	56244845	56244845	+	Missense_Mutation	SNP	G	G	A	rs376663019		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr19:56244845G>A	ENST00000332836.2	-	2	379	c.352C>T	c.(352-354)Cac>Tac	p.H118Y		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	118						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		TCAGGGACGTGAAGACAGGTT	0.393																																																	0													127.0	126.0	126.0					19																	56244845		2203	4300	6503	SO:0001583	missense	338321			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.352C>T	19.37:g.56244845G>A	ENSP00000331857:p.His118Tyr		B2RN12|Q86W27	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.H118Y	ENST00000332836.2	37	c.352	CCDS12934.1	19	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.732947	0.00687	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.73047	-0.71	3.4	-4.44	0.03557	.	.	.	.	.	T	0.47838	0.1467	L	0.34521	1.04	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.45775	-0.9238	9	0.02654	T	1	.	7.1744	0.25736	0.0:0.4551:0.2371:0.3078	.	118	Q7RTR0	NALP9_HUMAN	Y	118	ENSP00000331857:H118Y	ENSP00000331857:H118Y	H	-	1	0	NLRP9	60936657	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.334000	0.07883	-0.343000	0.08351	-0.195000	0.12781	CAC	NLRP9	-	NULL		0.393	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP9	HGNC	protein_coding	OTTHUMT00000453653.1	G	NM_176820		56244845	-1	no_errors	ENST00000332836	ensembl	human	known	70_37	missense	SNP	0.000	A
NUDT1	4521	genome.wustl.edu	37	7	2284330	2284330	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr7:2284330G>C	ENST00000397046.1	+	3	218	c.121G>C	c.(121-123)Gaa>Caa	p.E41Q	NUDT1_ENST00000397048.1_Missense_Mutation_p.E64Q|NUDT1_ENST00000339737.2_Missense_Mutation_p.E41Q|NUDT1_ENST00000343985.4_Missense_Mutation_p.E64Q|FTSJ2_ENST00000486040.1_5'Flank|NUDT1_ENST00000397049.1_Missense_Mutation_p.E64Q|FTSJ2_ENST00000242257.8_5'Flank|FTSJ2_ENST00000440306.2_5'Flank|NUDT1_ENST00000356714.1_Missense_Mutation_p.E41Q	NM_198950.1	NP_945188.1	P36639	8ODP_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 1	82					ATP catabolic process (GO:0006200)|dATP catabolic process (GO:0046061)|dGTP catabolic process (GO:0006203)|DNA protection (GO:0042262)|DNA repair (GO:0006281)|GTP catabolic process (GO:0006184)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleotide catabolic process (GO:0006195)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	8-oxo-7,8-dihydrodeoxyguanosine triphosphate pyrophosphatase activity (GO:0035539)|8-oxo-7,8-dihydroguanosine triphosphate pyrophosphatase activity (GO:0008413)|ATP diphosphatase activity (GO:0047693)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|snoRNA binding (GO:0030515)			large_intestine(3)|lung(8)|urinary_tract(1)	12		Ovarian(82;0.0253)|Melanoma(862;0.155)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0822)|OV - Ovarian serous cystadenocarcinoma(56;2.8e-14)|BRCA - Breast invasive adenocarcinoma(126;0.15)		CAAAGTGCAAGAAGGAGAGAC	0.617								Modulation of nucleotide pools																																									0													43.0	43.0	43.0					7																	2284330		2203	4300	6503	SO:0001583	missense	4521			D16581	CCDS5329.1, CCDS5330.1	7p22	2008-07-18			ENSG00000106268	ENSG00000106268		"""Nudix motif containing"""	8048	protein-coding gene	gene with protein product	"""mutT human homolog 1"", ""nudix motif 1"", ""8-oxo-7,8-dihydrodeoxyguanosine triphosphatase"", ""8-oxo-dGTPase"", ""7,8-dihydro-8-oxoguanine triphosphatase"", ""8-oxo-7,8-dihydroguanosine triphosphatase"", ""nucleoside diphosphate-linked moiety X-type motif 1"""	600312		MTH1		7713494, 8226881	Standard	NM_002452		Approved		uc003slp.1	P36639	OTTHUMG00000023072	ENST00000397046.1:c.121G>C	7.37:g.2284330G>C	ENSP00000380239:p.Glu41Gln		A4D205|Q6LES7|Q6P0Y6|Q7Z7N6|Q8IV95|Q9UBM0|Q9UBM9	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,prints_OxG-triPHTase,prints_Nudix_hydrolase	p.E64Q	ENST00000397046.1	37	c.190	CCDS5330.1	7	.	.	.	.	.	.	.	.	.	.	G	6.437	0.448849	0.12223	.	.	ENSG00000106268	ENST00000356714;ENST00000397049;ENST00000397046;ENST00000397048;ENST00000343985;ENST00000339737	T;T;T;T;T;T	0.08896	3.04;3.04;3.04;3.04;3.04;3.04	3.8	3.8	0.43715	NUDIX hydrolase (1);NUDIX hydrolase domain (3);NUDIX hydrolase, conserved site (1);NUDIX hydrolase domain-like (1);	0.792616	0.11873	N	0.521203	T	0.06462	0.0166	N	0.21545	0.675	0.26010	N	0.982002	P	0.37573	0.6	B	0.39771	0.309	T	0.31668	-0.9935	10	0.25106	T	0.35	-4.6872	6.5607	0.22485	0.1075:0.2567:0.6358:0.0	.	82	P36639	8ODP_HUMAN	Q	41;64;41;64;64;41	ENSP00000349148:E41Q;ENSP00000380242:E64Q;ENSP00000380239:E41Q;ENSP00000380241:E64Q;ENSP00000339503:E64Q;ENSP00000343439:E41Q	ENSP00000343439:E41Q	E	+	1	0	NUDT1	2250856	0.867000	0.29959	0.926000	0.36857	0.600000	0.36913	0.747000	0.26290	1.816000	0.52996	0.462000	0.41574	GAA	NUDT1	-	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,prints_Nudix_hydrolase		0.617	NUDT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NUDT1	HGNC	protein_coding	OTTHUMT00000206922.1	G	NM_002452		2284330	+1	no_errors	ENST00000343985	ensembl	human	known	70_37	missense	SNP	0.968	C
NUTF2	10204	genome.wustl.edu	37	16	67902253	67902253	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr16:67902253C>T	ENST00000219169.4	+	3	393	c.110C>T	c.(109-111)tCa>tTa	p.S37L	NUTF2_ENST00000569436.2_Missense_Mutation_p.S37L|NUTF2_ENST00000568396.2_Missense_Mutation_p.S37L	NM_005796.1	NP_005787.1	P61970	NTF2_HUMAN	nuclear transport factor 2	37	NTF2. {ECO:0000255|PROSITE- ProRule:PRU00137}.				protein export from nucleus (GO:0006611)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear pore (GO:0005643)	transporter activity (GO:0005215)			kidney(1)|lung(2)|upper_aerodigestive_tract(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00443)|Epithelial(162;0.0199)|all cancers(182;0.129)		ATTGACGCGTCATGCCTTACG	0.522																																																	0													109.0	108.0	108.0					16																	67902253		2198	4300	6498	SO:0001583	missense	10204			U43939	CCDS10848.1	16q22.1	2008-02-05			ENSG00000102898	ENSG00000102898			13722	protein-coding gene	gene with protein product		605813				7744965, 3380696	Standard	NM_005796		Approved	NTF2, PP15	uc002eup.3	P61970	OTTHUMG00000137540	ENST00000219169.4:c.110C>T	16.37:g.67902253C>T	ENSP00000219169:p.Ser37Leu		B2R4G7|P13662|Q6IB67	Missense_Mutation	SNP	pfam_NTF2,pfscan_Nuclear_transport_factor_2_euk	p.S37L	ENST00000219169.4	37	c.110	CCDS10848.1	16	.	.	.	.	.	.	.	.	.	.	C	35	5.461289	0.96240	.	.	ENSG00000102898	ENST00000219169	.	.	.	6.17	6.17	0.99709	Nuclear transport factor 2, Eukaryote (1);Nuclear transport factor 2 (1);	0.000000	0.85682	D	0.000000	D	0.89694	0.6789	H	0.95679	3.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.954	D	0.91539	0.5248	9	0.87932	D	0	-3.1133	19.6509	0.95805	0.0:1.0:0.0:0.0	.	37;37	B4DEQ2;P61970	.;NTF2_HUMAN	L	37	.	ENSP00000219169:S37L	S	+	2	0	NUTF2	66459754	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.163000	0.77524	2.941000	0.99782	0.655000	0.94253	TCA	NUTF2	-	pfam_NTF2,pfscan_Nuclear_transport_factor_2_euk		0.522	NUTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUTF2	HGNC	protein_coding	OTTHUMT00000268871.1	C			67902253	+1	no_errors	ENST00000219169	ensembl	human	known	70_37	missense	SNP	1.000	T
NUTF2	10204	genome.wustl.edu	37	16	67902436	67902436	+	Silent	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr16:67902436C>T	ENST00000219169.4	+	4	487	c.204C>T	c.(202-204)atC>atT	p.I68I	NUTF2_ENST00000569436.2_Silent_p.I68I|NUTF2_ENST00000568396.2_Silent_p.I68I	NM_005796.1	NP_005787.1	P61970	NTF2_HUMAN	nuclear transport factor 2	68	NTF2. {ECO:0000255|PROSITE- ProRule:PRU00137}.				protein export from nucleus (GO:0006611)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear pore (GO:0005643)	transporter activity (GO:0005215)			kidney(1)|lung(2)|upper_aerodigestive_tract(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00443)|Epithelial(162;0.0199)|all cancers(182;0.129)		AGCACAGCATCACCGCGCAGG	0.572																																																	0													211.0	210.0	210.0					16																	67902436		2198	4300	6498	SO:0001819	synonymous_variant	10204			U43939	CCDS10848.1	16q22.1	2008-02-05			ENSG00000102898	ENSG00000102898			13722	protein-coding gene	gene with protein product		605813				7744965, 3380696	Standard	NM_005796		Approved	NTF2, PP15	uc002eup.3	P61970	OTTHUMG00000137540	ENST00000219169.4:c.204C>T	16.37:g.67902436C>T			B2R4G7|P13662|Q6IB67	Silent	SNP	pfam_NTF2,pfscan_Nuclear_transport_factor_2_euk	p.I68	ENST00000219169.4	37	c.204	CCDS10848.1	16																																																																																			NUTF2	-	pfam_NTF2,pfscan_Nuclear_transport_factor_2_euk		0.572	NUTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUTF2	HGNC	protein_coding	OTTHUMT00000268871.1	C			67902436	+1	no_errors	ENST00000219169	ensembl	human	known	70_37	silent	SNP	1.000	T
OPA1	4976	genome.wustl.edu	37	3	193380646	193380646	+	Silent	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr3:193380646G>A	ENST00000392438.3	+	24	2625	c.2391G>A	c.(2389-2391)aaG>aaA	p.K797K	OPA1_ENST00000361715.2_Silent_p.K816K|OPA1_ENST00000361908.3_Silent_p.K834K|OPA1_ENST00000361510.2_Silent_p.K852K|OPA1_ENST00000361828.2_Silent_p.K815K|OPA1_ENST00000361150.2_Silent_p.K798K	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	797					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		AATTGGAGAAGATGTTGAAAT	0.373																																																	0													84.0	78.0	80.0					3																	193380646		2203	4300	6503	SO:0001819	synonymous_variant	4976			AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.2391G>A	3.37:g.193380646G>A			D3DNW4	Silent	SNP	pfam_Dynamin_GTPase,smart_Dynamin_GTPase,prints_Dynamin	p.K852	ENST00000392438.3	37	c.2556	CCDS43186.1	3																																																																																			OPA1	-	NULL		0.373	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OPA1	HGNC	protein_coding	OTTHUMT00000313812.2	G	NM_130837		193380646	+1	no_errors	ENST00000361510	ensembl	human	known	70_37	silent	SNP	0.999	A
OR1N1	138883	genome.wustl.edu	37	9	125288641	125288641	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr9:125288641G>A	ENST00000304880.2	-	1	931	c.932C>T	c.(931-933)tCt>tTt	p.S311F		NM_012363.1	NP_036495.1	Q8NGS0	OR1N1_HUMAN	olfactory receptor, family 1, subfamily N, member 1	311						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|large_intestine(2)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						CCACATCTAAGAGGAAACAAT	0.443																																																	0													60.0	65.0	63.0					9																	125288641		2203	4300	6503	SO:0001583	missense	138883			U86216	CCDS6844.1	9q34.11	2012-08-09			ENSG00000171505	ENSG00000171505		"""GPCR / Class A : Olfactory receptors"""	8221	protein-coding gene	gene with protein product				OR1N3		9500546	Standard	NM_012363		Approved	OR1-26	uc004bmn.1	Q8NGS0	OTTHUMG00000020608	ENST00000304880.2:c.932C>T	9.37:g.125288641G>A	ENSP00000306974:p.Ser311Phe		A3KFM1|O43870|Q6IF16|Q96R93	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S311F	ENST00000304880.2	37	c.932	CCDS6844.1	9	.	.	.	.	.	.	.	.	.	.	G	8.517	0.867874	0.17250	.	.	ENSG00000171505	ENST00000304880	T	0.11495	2.77	2.13	1.23	0.21249	.	.	.	.	.	T	0.05227	0.0139	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.36016	-0.9765	9	0.87932	D	0	.	4.7796	0.13195	0.1835:0.0:0.8165:0.0	.	311	Q8NGS0	OR1N1_HUMAN	F	311	ENSP00000306974:S311F	ENSP00000306974:S311F	S	-	2	0	OR1N1	124328462	0.046000	0.20272	0.195000	0.23364	0.059000	0.15707	-0.193000	0.09573	0.506000	0.28125	0.447000	0.29281	TCT	OR1N1	-	NULL		0.443	OR1N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1N1	HGNC	protein_coding	OTTHUMT00000053938.1	G			125288641	-1	no_errors	ENST00000304880	ensembl	human	known	70_37	missense	SNP	0.053	A
OXNAD1	92106	genome.wustl.edu	37	3	16345057	16345057	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr3:16345057G>T	ENST00000285083.5	+	9	1392	c.927G>T	c.(925-927)gaG>gaT	p.E309D	OXNAD1_ENST00000435829.2_Missense_Mutation_p.E327D|OXNAD1_ENST00000544043.1_Missense_Mutation_p.E327D|OXNAD1_ENST00000605932.1_Missense_Mutation_p.E309D|OXNAD1_ENST00000606098.1_Missense_Mutation_p.E308D	NM_138381.3	NP_612390.1	Q96HP4	OXND1_HUMAN	oxidoreductase NAD-binding domain containing 1	309						mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|skin(2)	13						TTTGCTTTGAGAAGTGGTGGT	0.408																																																	0													59.0	55.0	57.0					3																	16345057		2203	4300	6503	SO:0001583	missense	92106			AL832787	CCDS2630.1	3p25-p24	2010-03-19			ENSG00000154814	ENSG00000154814			25128	protein-coding gene	gene with protein product						12477932	Standard	NM_138381		Approved	MGC15763	uc003caw.3	Q96HP4	OTTHUMG00000129867	ENST00000285083.5:c.927G>T	3.37:g.16345057G>T	ENSP00000285083:p.Glu309Asp		Q2HYC7|Q59FA4	Missense_Mutation	SNP	pfam_OxRdtase_FAD/NAD-bd,pfam_Fe_red_NAD-bd_6,superfamily_Riboflavin_synthase-like_b-brl,prints_Phe_hydroxylase,prints_NADH-Cyt_B5_reductase	p.E327D	ENST00000285083.5	37	c.981	CCDS2630.1	3	.	.	.	.	.	.	.	.	.	.	G	18.86	3.713700	0.68730	.	.	ENSG00000154814	ENST00000285083;ENST00000544043	T;T	0.35973	1.39;1.28	5.03	4.15	0.48705	.	0.000000	0.85682	D	0.000000	T	0.50171	0.1600	L	0.53561	1.675	0.58432	D	0.999996	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.991	T	0.44483	-0.9325	10	0.44086	T	0.13	-17.8528	8.8515	0.35203	0.2269:0.0:0.7731:0.0	.	327;309	F5H620;Q96HP4	.;OXND1_HUMAN	D	309;327	ENSP00000285083:E309D;ENSP00000437967:E327D	ENSP00000285083:E309D	E	+	3	2	OXNAD1	16320061	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	3.622000	0.54217	2.340000	0.79590	0.455000	0.32223	GAG	OXNAD1	-	NULL		0.408	OXNAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OXNAD1	HGNC	protein_coding	OTTHUMT00000252109.1	G	NM_138381		16345057	+1	no_errors	ENST00000544043	ensembl	human	known	70_37	missense	SNP	1.000	T
PBRM1	55193	genome.wustl.edu	37	3	52651372	52651372	+	Missense_Mutation	SNP	A	A	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr3:52651372A>T	ENST00000296302.7	-	14	1725	c.1724T>A	c.(1723-1725)aTc>aAc	p.I575N	PBRM1_ENST00000409767.1_Missense_Mutation_p.I590N|PBRM1_ENST00000409057.1_Missense_Mutation_p.I575N|PBRM1_ENST00000410007.1_Missense_Mutation_p.I575N|PBRM1_ENST00000337303.4_Missense_Mutation_p.I575N|PBRM1_ENST00000394830.3_Missense_Mutation_p.I575N|PBRM1_ENST00000356770.4_Missense_Mutation_p.I543N|PBRM1_ENST00000409114.3_Missense_Mutation_p.I590N			Q86U86	PB1_HUMAN	polybromo 1	575	Bromo 4. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GTCATTGCGGATGTTATGCTC	0.403			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													123.0	117.0	119.0					3																	52651372		2203	4300	6503	SO:0001583	missense	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1724T>A	3.37:g.52651372A>T	ENSP00000296302:p.Ile575Asn		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	pfam_Bromodomain,pfam_BAH_dom,pfam_HMG_superfamily,superfamily_Bromodomain,superfamily_HMG_superfamily,smart_Bromodomain,smart_BAH_dom,smart_HMG_superfamily,pfscan_BAH_dom,pfscan_HMG_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.I575N	ENST00000296302.7	37	c.1724		3	.	.	.	.	.	.	.	.	.	.	A	26.2	4.714965	0.89112	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	T;T;T;T;T;T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22	5.84	5.84	0.93424	Bromodomain (5);Bromodomain, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.67211	0.2869	M	0.88775	2.98	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	0.999;0.992;0.995;0.999;0.997;1.0;1.0;0.998;0.998	T	0.74325	-0.3702	10	0.87932	D	0	-21.6054	16.2167	0.82231	1.0:0.0:0.0:0.0	.	575;575;575;575;590;590;575;543;575	Q86U86-9;Q86U86-6;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;.;PB1_HUMAN;.;.	N	543;575;575;575;575;575;590;590;575;534	ENSP00000349213:I543N;ENSP00000378307:I575N;ENSP00000296302:I575N;ENSP00000338302:I575N;ENSP00000386593:I575N;ENSP00000386529:I575N;ENSP00000386643:I590N;ENSP00000386601:I590N;ENSP00000387775:I575N;ENSP00000397662:I534N	ENSP00000296302:I575N	I	-	2	0	PBRM1	52626412	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.231000	0.72958	0.533000	0.62120	ATC	PBRM1	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain		0.403	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	PBRM1	HGNC	protein_coding	OTTHUMT00000327232.1	A	NM_018165		52651372	-1	no_errors	ENST00000296302	ensembl	human	known	70_37	missense	SNP	1.000	T
PCDHB2	56133	genome.wustl.edu	37	5	140476487	140476487	+	Missense_Mutation	SNP	T	T	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr5:140476487T>C	ENST00000194155.4	+	1	2261	c.2113T>C	c.(2113-2115)Ttc>Ctc	p.F705L		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	705					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTCTTCCTCTTCTCGGTGCT	0.697																																																	0													40.0	43.0	42.0					5																	140476487		2159	4193	6352	SO:0001583	missense	56133			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.2113T>C	5.37:g.140476487T>C	ENSP00000194155:p.Phe705Leu		Q4KMU1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F705L	ENST00000194155.4	37	c.2113	CCDS4244.1	5	.	.	.	.	.	.	.	.	.	.	T	0.007	-2.007075	0.00426	.	.	ENSG00000112852	ENST00000194155	T	0.07444	3.19	4.12	-5.25	0.02781	.	.	.	.	.	T	0.02848	0.0085	N	0.11756	0.17	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45469	-0.9259	9	0.02654	T	1	.	5.2106	0.15314	0.0977:0.4913:0.152:0.2591	.	705	Q9Y5E7	PCDB2_HUMAN	L	705	ENSP00000194155:F705L	ENSP00000194155:F705L	F	+	1	0	PCDHB2	140456671	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-4.341000	0.00250	-0.809000	0.04381	-0.379000	0.06801	TTC	PCDHB2	-	NULL		0.697	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2	T	NM_018936		140476487	+1	no_errors	ENST00000194155	ensembl	human	known	70_37	missense	SNP	0.000	C
PCYT1B	9468	genome.wustl.edu	37	X	24593430	24593430	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chrX:24593430C>G	ENST00000379144.2	-	7	844	c.714G>C	c.(712-714)aaG>aaC	p.K238N	PCYT1B_ENST00000379145.1_Missense_Mutation_p.K220N|PCYT1B_ENST00000356768.4_Missense_Mutation_p.K238N	NM_004845.4	NP_004836.2	Q9Y5K3	PCY1B_HUMAN	phosphate cytidylyltransferase 1, choline, beta	238					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|ovarian follicle development (GO:0001541)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	choline-phosphate cytidylyltransferase activity (GO:0004105)			breast(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	17					Choline(DB00122)	AACGGTACCTCTTCTCCTGGT	0.358																																																	0													115.0	96.0	102.0					X																	24593430		2203	4300	6503	SO:0001583	missense	9468			AF052510	CCDS14213.1, CCDS55391.1, CCDS55392.1	Xp22	2008-02-05	2005-09-05		ENSG00000102230	ENSG00000102230	2.7.7.15		8755	protein-coding gene	gene with protein product		604926	"""phosphate cytidylyltransferase 1, choline, beta isoform"""			9593753	Standard	NM_004845		Approved	CCT-beta, CTB	uc004dbi.3	Q9Y5K3	OTTHUMG00000021270	ENST00000379144.2:c.714G>C	X.37:g.24593430C>G	ENSP00000368439:p.Lys238Asn		A8IX00|B2RCX8|B4DK10|E9PD84|O60621|Q86XC9	Missense_Mutation	SNP	pfam_Cytidylyltransf,tigrfam_Cyt_trans-like	p.K238N	ENST00000379144.2	37	c.714	CCDS14213.1	X	.	.	.	.	.	.	.	.	.	.	C	13.74	2.328197	0.41197	.	.	ENSG00000102230	ENST00000379145;ENST00000379144;ENST00000356768	.	.	.	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	T	0.47322	0.1439	L	0.47078	1.49	0.80722	D	1	B;B;B	0.28605	0.162;0.217;0.217	B;B;B	0.31495	0.131;0.074;0.074	T	0.34502	-0.9826	9	0.13470	T	0.59	-4.9253	10.3376	0.43858	0.0:0.9077:0.0:0.0923	.	238;220;238	Q9Y5K3-2;E9PD84;Q9Y5K3	.;.;PCY1B_HUMAN	N	220;238;238	.	ENSP00000349211:K238N	K	-	3	2	PCYT1B	24503351	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	5.624000	0.67764	2.095000	0.63458	0.513000	0.50165	AAG	PCYT1B	-	NULL		0.358	PCYT1B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYT1B	HGNC	protein_coding	OTTHUMT00000056103.1	C	NM_004845		24593430	-1	no_errors	ENST00000379144	ensembl	human	known	70_37	missense	SNP	1.000	G
PHACTR4	65979	genome.wustl.edu	37	1	28823241	28823241	+	3'UTR	SNP	G	G	A	rs549351517		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:28823241G>A	ENST00000373839.3	+	0	2550				PHACTR4_ENST00000493669.1_3'UTR|PHACTR4_ENST00000373836.3_3'UTR	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4						actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		GTGCTGCACCGGGGGCAAAAC	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		22086	0.0		0.0	False		,,,				2504	0.001																0																																										SO:0001624	3_prime_UTR_variant	65979			AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.*180G>A	1.37:g.28823241G>A			A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	RNA	SNP	-	NULL	ENST00000373839.3	37	NULL	CCDS41293.1	1																																																																																			PHACTR4	-	-		0.463	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHACTR4	HGNC	protein_coding	OTTHUMT00000009868.4	G	NM_023923		28823241	+1	no_errors	ENST00000493669	ensembl	human	known	70_37	rna	SNP	0.000	A
PLA1A	51365	genome.wustl.edu	37	3	119344010	119344010	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr3:119344010G>C	ENST00000273371.4	+	9	1124	c.1052G>C	c.(1051-1053)aGa>aCa	p.R351T	PLA1A_ENST00000488919.1_Missense_Mutation_p.R178T|PLA1A_ENST00000495992.1_Missense_Mutation_p.R335T|PLA1A_ENST00000494440.1_Missense_Mutation_p.R335T	NM_015900.3	NP_056984.1	Q53H76	PLA1A_HUMAN	phospholipase A1 member A	351					lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|phosphatidylserine metabolic process (GO:0006658)	extracellular vesicular exosome (GO:0070062)	phosphatidylcholine 1-acylhydrolase activity (GO:0008970)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						AAGGAACTGAGAAACAAGGAC	0.488																																																	0													197.0	152.0	167.0					3																	119344010		2203	4300	6503	SO:0001583	missense	51365			AF035268	CCDS2991.1, CCDS56268.1, CCDS56269.1	3q13.13-q13.2	2002-11-28			ENSG00000144837	ENSG00000144837			17661	protein-coding gene	gene with protein product		607460				10196188	Standard	NM_015900		Approved	ps-PLA1	uc003ecu.3	Q53H76	OTTHUMG00000159425	ENST00000273371.4:c.1052G>C	3.37:g.119344010G>C	ENSP00000273371:p.Arg351Thr		B2R8V2|B4DXA2|O95991|Q86WX6|Q9UPD2	Missense_Mutation	SNP	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase	p.R351T	ENST00000273371.4	37	c.1052	CCDS2991.1	3	.	.	.	.	.	.	.	.	.	.	G	9.187	1.025099	0.19433	.	.	ENSG00000144837	ENST00000273371;ENST00000488919;ENST00000495992;ENST00000494440	D;D;D;D	0.93366	-2.62;-3.21;-2.61;-2.71	4.56	4.56	0.56223	.	1.071890	0.07345	N	0.881493	D	0.88258	0.6388	L	0.36672	1.1	0.35098	D	0.764943	B;P	0.38535	0.319;0.635	B;B	0.30855	0.121;0.091	T	0.82428	-0.0462	10	0.16896	T	0.51	-20.1336	12.4337	0.55588	0.0:0.1691:0.8309:0.0	.	335;351	Q53H76-3;Q53H76	.;PLA1A_HUMAN	T	351;178;335;335	ENSP00000273371:R351T;ENSP00000420625:R178T;ENSP00000417326:R335T;ENSP00000418793:R335T	ENSP00000273371:R351T	R	+	2	0	PLA1A	120826700	0.999000	0.42202	0.979000	0.43373	0.005000	0.04900	2.852000	0.48310	2.545000	0.85829	0.655000	0.94253	AGA	PLA1A	-	pirsf_Lipoprotein_lipase_LIPH		0.488	PLA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA1A	HGNC	protein_coding	OTTHUMT00000355252.2	G			119344010	+1	no_errors	ENST00000273371	ensembl	human	known	70_37	missense	SNP	0.995	C
POU3F2	5454	genome.wustl.edu	37	6	99283888	99283888	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr6:99283888C>A	ENST00000328345.5	+	1	1309	c.1139C>A	c.(1138-1140)tCg>tAg	p.S380*		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	380					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		CCCAAGCCCTCGGCCCAGGAG	0.567																																																	0													56.0	63.0	61.0					6																	99283888		2203	4300	6503	SO:0001587	stop_gained	5454			Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.1139C>A	6.37:g.99283888C>A	ENSP00000329170:p.Ser380*		Q14960|Q86V54|Q9UJL0	Nonsense_Mutation	SNP	pirsf_Transcription_factor_POU,pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,prints_POU,pfscan_Homeodomain,pfscan_POU_specific	p.S380*	ENST00000328345.5	37	c.1139	CCDS5040.1	6	.	.	.	.	.	.	.	.	.	.	C	37	6.498192	0.97616	.	.	ENSG00000184486	ENST00000328345;ENST00000425116	.	.	.	4.66	4.66	0.58398	.	0.471174	0.17569	U	0.169522	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.4792	0.84153	0.0:1.0:0.0:0.0	.	.	.	.	X	380;313	.	ENSP00000329170:S380X	S	+	2	0	POU3F2	99390609	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.861000	0.69553	2.407000	0.81776	0.555000	0.69702	TCG	POU3F2	-	pirsf_Transcription_factor_POU,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain		0.567	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU3F2	HGNC	protein_coding	OTTHUMT00000041586.2	C			99283888	+1	no_errors	ENST00000328345	ensembl	human	known	70_37	nonsense	SNP	1.000	A
PPIP5K1	9677	genome.wustl.edu	37	15	43873496	43873496	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr15:43873496C>G	ENST00000396923.3	-	8	989	c.868G>C	c.(868-870)Gag>Cag	p.E290Q	PPIP5K1_ENST00000432870.3_5'UTR|PPIP5K1_ENST00000348806.6_Missense_Mutation_p.E290Q|PPIP5K1_ENST00000360301.4_Missense_Mutation_p.E290Q|PPIP5K1_ENST00000381879.4_Missense_Mutation_p.E290Q|PPIP5K1_ENST00000334933.4_Missense_Mutation_p.E290Q|PPIP5K1_ENST00000381885.1_Missense_Mutation_p.E290Q|PPIP5K1_ENST00000420765.1_Missense_Mutation_p.E290Q|PPIP5K1_ENST00000360135.4_Missense_Mutation_p.E290Q			Q6PFW1	VIP1_HUMAN	diphosphoinositol pentakisphosphate kinase 1	290					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			large_intestine(1)	1						TATCGAATCTCTTTCCCCTCA	0.512																																																	0													181.0	156.0	164.0					15																	43873496		2198	4296	6494	SO:0001583	missense	9677			AF502586	CCDS32215.1, CCDS45252.1, CCDS53937.1	15q15.3	2010-01-27	2010-01-26	2010-01-26	ENSG00000168781	ENSG00000168781	2.7.4.24		29023	protein-coding gene	gene with protein product		610979	"""histidine acid phosphatase domain containing 2A"""	HISPPD2A		17412958, 17690096, 18981179	Standard	NM_001190214		Approved	KIAA0377, IPS1, VIP1	uc001zrw.3	Q6PFW1	OTTHUMG00000059758	ENST00000396923.3:c.868G>C	15.37:g.43873496C>G	ENSP00000380129:p.Glu290Gln		O15082|Q5HYF8|Q7Z3A7|Q86TE7|Q86UV3|Q86UV4|Q86XW8|Q8IZN0	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-2,superfamily_MTCP1	p.E290Q	ENST00000396923.3	37	c.868	CCDS45252.1	15	.	.	.	.	.	.	.	.	.	.	C	22.7	4.326862	0.81690	.	.	ENSG00000168781	ENST00000381885;ENST00000360301;ENST00000360135;ENST00000334933;ENST00000396923;ENST00000304953;ENST00000381878;ENST00000420765;ENST00000381879;ENST00000348806;ENST00000335092	T;T;T;T;T;T;T;T	0.56103	0.48;0.56;1.17;0.56;0.48;0.48;0.53;1.17	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.80737	0.4680	H	0.94886	3.595	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.99;0.996;0.996	D	0.86812	0.1999	10	0.87932	D	0	-16.6048	17.9907	0.89168	0.0:1.0:0.0:0.0	.	290;290;290;290	Q6PFW1-7;Q6PFW1;Q6PFW1-2;Q6PFW1-3	.;VIP1_HUMAN;.;.	Q	290;290;290;290;290;290;290;290;290;290;291	ENSP00000371309:E290Q;ENSP00000353446:E290Q;ENSP00000353253:E290Q;ENSP00000334779:E290Q;ENSP00000380129:E290Q;ENSP00000400887:E290Q;ENSP00000371303:E290Q;ENSP00000308773:E290Q	ENSP00000304750:E290Q	E	-	1	0	PPIP5K1	41660788	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.636000	0.83301	2.444000	0.82710	0.644000	0.83932	GAG	PPIP5K1	-	NULL		0.512	PPIP5K1-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PPIP5K1	HGNC	protein_coding	OTTHUMT00000132907.1	C	NM_014659		43873496	-1	no_errors	ENST00000420765	ensembl	human	known	70_37	missense	SNP	1.000	G
PRKG2	5593	genome.wustl.edu	37	4	82088333	82088333	+	Silent	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr4:82088333G>A	ENST00000395578.1	-	6	1010	c.894C>T	c.(892-894)atC>atT	p.I298I	PRKG2_ENST00000264399.1_Silent_p.I298I|PRKG2_ENST00000418486.2_Silent_p.I298I|RP11-100N20.1_ENST00000512502.1_RNA			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	298					blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						AGCAGTCAATGATCTTGGTTA	0.239																																																	0													27.0	29.0	29.0					4																	82088333		2187	4276	6463	SO:0001819	synonymous_variant	5593			X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.894C>T	4.37:g.82088333G>A			B4DMX3|E7EPE6|O00125|O60916	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_cNMP-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_cGMP-dependent_protein_kinase,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_cat_dom,prints_cGMP_dep_kinase,prints_cAMP/cGMP_kin	p.I298	ENST00000395578.1	37	c.894	CCDS3589.1	4																																																																																			PRKG2	-	superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pirsf_cGMP-dependent_protein_kinase,pfscan_cNMP-bd_dom,prints_cGMP_dep_kinase		0.239	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG2	HGNC	protein_coding	OTTHUMT00000252639.1	G	NM_006259		82088333	-1	no_errors	ENST00000264399	ensembl	human	known	70_37	silent	SNP	1.000	A
PRRX1	5396	genome.wustl.edu	37	1	170705270	170705270	+	Silent	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:170705270G>C	ENST00000239461.6	+	4	994	c.681G>C	c.(679-681)ctG>ctC	p.L227L	PRRX1_ENST00000367760.3_3'UTR|PRRX1_ENST00000476867.2_3'UTR	NM_022716.2	NP_073207.1	P54821	PRRX1_HUMAN	paired related homeobox 1	227					artery morphogenesis (GO:0048844)|cartilage development (GO:0051216)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)	nucleolus (GO:0005730)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			large_intestine(2)|ovary(1)	3	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TTGCCAACCTGAGACTGAAGG	0.458																																																	0													136.0	136.0	136.0					1																	170705270		2203	4300	6503	SO:0001819	synonymous_variant	5396			M95929	CCDS1290.1, CCDS1291.1	1q24.3	2011-06-20	2003-11-12	2003-11-14	ENSG00000116132	ENSG00000116132		"""Homeoboxes / PRD class"""	9142	protein-coding gene	gene with protein product		167420	"""paired mesoderm homeo box 1"""	PMX1		1509260	Standard	NM_006902		Approved	PHOX1	uc001ghf.3	P54821	OTTHUMG00000035231	ENST00000239461.6:c.681G>C	1.37:g.170705270G>C			B5BUM7|O60807	Silent	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_OAR_dom,pfscan_Homeodomain	p.L227	ENST00000239461.6	37	c.681	CCDS1290.1	1																																																																																			PRRX1	-	pfam_OAR_dom,pfscan_OAR_dom		0.458	PRRX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRX1	HGNC	protein_coding	OTTHUMT00000085236.3	G	NM_006902		170705270	+1	no_errors	ENST00000239461	ensembl	human	known	70_37	silent	SNP	1.000	C
PRSS37	136242	genome.wustl.edu	37	7	141539208	141539208	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr7:141539208G>A	ENST00000350549.3	-	2	477	c.106C>T	c.(106-108)Cac>Tac	p.H36Y	PRSS37_ENST00000438520.1_Missense_Mutation_p.H36Y	NM_001008270.2|NM_001171951.1	NP_001008271.2|NP_001165422.1	A4D1T9	PRS37_HUMAN	protease, serine, 37	36	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				binding of sperm to zona pellucida (GO:0007339)|cell migration (GO:0016477)|protein maturation (GO:0051604)	extracellular region (GO:0005576)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(3)	15						GGGTTGAAGTGAGACTTGAGG	0.473																																																	0													68.0	66.0	66.0					7																	141539208		2203	4300	6503	SO:0001583	missense	136242				CCDS34764.1	7q34	2010-05-07			ENSG00000165076	ENSG00000165076		"""Serine peptidases / Serine peptidases"""	29211	protein-coding gene	gene with protein product							Standard	NM_001008270		Approved		uc003vws.2	A4D1T9	OTTHUMG00000157174	ENST00000350549.3:c.106C>T	7.37:g.141539208G>A	ENSP00000297767:p.His36Tyr		B2RPB5	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.H36Y	ENST00000350549.3	37	c.106	CCDS34764.1	7	.	.	.	.	.	.	.	.	.	.	G	15.71	2.912760	0.52439	.	.	ENSG00000165076	ENST00000350549;ENST00000438520	T;T	0.42131	0.98;0.98	5.48	3.61	0.41365	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.189145	0.38381	N	0.001702	T	0.32912	0.0845	N	0.17312	0.475	0.28508	N	0.913707	B;B	0.31227	0.184;0.314	B;B	0.41412	0.356;0.356	T	0.34477	-0.9827	10	0.87932	D	0	.	8.7057	0.34354	0.0:0.3029:0.529:0.168	.	36;36	B7ZMK3;A4D1T9	.;PRS37_HUMAN	Y	36	ENSP00000297767:H36Y;ENSP00000414461:H36Y	ENSP00000297767:H36Y	H	-	1	0	PRSS37	141185677	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	1.455000	0.35190	0.810000	0.34279	0.585000	0.79938	CAC	PRSS37	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6		0.473	PRSS37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS37	HGNC	protein_coding	OTTHUMT00000347763.1	G	NM_001008270		141539208	-1	no_errors	ENST00000350549	ensembl	human	known	70_37	missense	SNP	1.000	A
PSMA3	5684	genome.wustl.edu	37	14	58711623	58711623	+	5'UTR	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr14:58711623C>G	ENST00000216455.4	+	0	75				PSMA3_ENST00000557508.1_5'UTR|PSMA3_ENST00000554456.1_3'UTR|PSMA3_ENST00000412908.2_5'UTR	NM_002788.3|NM_152132.2	NP_002779.1|NP_687033.1	P25788	PSA3_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 3						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(2)	12						CTACGCGTCCCTTTGGGTTTA	0.542																																																	0													111.0	104.0	106.0					14																	58711623		2203	4300	6503	SO:0001623	5_prime_UTR_variant	5684				CCDS9731.1, CCDS45113.1	14q23	2008-08-29			ENSG00000100567	ENSG00000100567		"""Proteasome (prosome, macropain) subunits"""	9532	protein-coding gene	gene with protein product		176843				2025653, 8811196	Standard	NM_002788		Approved	HC8	uc001xdj.2	P25788	OTTHUMG00000140319	ENST00000216455.4:c.-16C>G	14.37:g.58711623C>G			B2RCK6|Q86U83|Q8N1D8|Q9BS70	RNA	SNP	-	NULL	ENST00000216455.4	37	NULL	CCDS9731.1	14																																																																																			PSMA3	-	-		0.542	PSMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMA3	HGNC	protein_coding	OTTHUMT00000276923.1	C	NM_002788		58711623	+1	no_errors	ENST00000554456	ensembl	human	known	70_37	rna	SNP	0.000	G
PTPRN2	5799	genome.wustl.edu	37	7	158109594	158109594	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr7:158109594G>A	ENST00000389418.4	-	3	203	c.194C>T	c.(193-195)cCg>cTg	p.P65L	PTPRN2_ENST00000409483.1_Intron|PTPRN2_ENST00000389416.4_Missense_Mutation_p.P48L|PTPRN2_ENST00000404321.2_Missense_Mutation_p.P88L|PTPRN2_ENST00000389413.3_Missense_Mutation_p.P65L	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	65					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		GTCCATTGCCGGAACCTTCTG	0.582																																																	0													73.0	62.0	66.0					7																	158109594		2202	4300	6502	SO:0001583	missense	5799			AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.194C>T	7.37:g.158109594G>A	ENSP00000374069:p.Pro65Leu		E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.P88L	ENST00000389418.4	37	c.263	CCDS5947.1	7	.	.	.	.	.	.	.	.	.	.	G	17.49	3.403532	0.62288	.	.	ENSG00000155093	ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	T;T;T;T	0.03094	4.1;4.05;4.11;4.11	4.82	4.82	0.62117	.	.	.	.	.	T	0.12347	0.0300	L	0.39898	1.24	0.50467	D	0.999872	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.997;0.997	T	0.07654	-1.0761	9	0.40728	T	0.16	.	17.0825	0.86602	0.0:0.0:1.0:0.0	.	88;65;48;65	Q92932-3;Q92932-2;E9PC57;Q92932	.;.;.;PTPR2_HUMAN	L	65;48;65;88	ENSP00000374064:P65L;ENSP00000374067:P48L;ENSP00000374069:P65L;ENSP00000385464:P88L	ENSP00000374064:P65L	P	-	2	0	PTPRN2	157802355	1.000000	0.71417	0.382000	0.26119	0.293000	0.27360	6.655000	0.74392	2.260000	0.74910	0.644000	0.83932	CCG	PTPRN2	-	NULL		0.582	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTPRN2	HGNC	protein_coding	OTTHUMT00000353214.1	G			158109594	-1	no_errors	ENST00000404321	ensembl	human	known	70_37	missense	SNP	0.801	A
RCC1	1104	genome.wustl.edu	37	1	28861792	28861792	+	Silent	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:28861792G>A	ENST00000373833.6	+	9	846	c.561G>A	c.(559-561)ctG>ctA	p.L187L	RCC1_ENST00000373831.3_Silent_p.L218L|RCC1_ENST00000373832.1_Silent_p.L187L|RCC1_ENST00000398958.2_Silent_p.L187L|RCC1_ENST00000429051.1_3'UTR			P18754	RCC1_HUMAN	regulator of chromosome condensation 1	187					chromosome segregation (GO:0007059)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of Ran GTPase activity (GO:0032853)|regulation of mitosis (GO:0007088)|spindle assembly (GO:0051225)|viral process (GO:0016032)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosomal DNA binding (GO:0031492)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)		TGGTGATGCTGACAGCTGATG	0.587																																																	0													111.0	100.0	104.0					1																	28861792		2203	4300	6503	SO:0001819	synonymous_variant	1104			X12654	CCDS323.1, CCDS41295.1	1p35.3	2008-08-18	2005-05-09	2005-05-09	ENSG00000180198	ENSG00000180198			1913	protein-coding gene	gene with protein product		179710	"""chromosome condensation 1"""	CHC1		7851910	Standard	NM_001048199		Approved		uc001bqf.2	P18754	OTTHUMG00000003645	ENST00000373833.6:c.561G>A	1.37:g.28861792G>A			Q16269|Q6NT97	Silent	SNP	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.L218	ENST00000373833.6	37	c.654	CCDS323.1	1																																																																																			RCC1	-	superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens		0.587	RCC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RCC1	HGNC	protein_coding	OTTHUMT00000010323.3	G	NM_001269		28861792	+1	no_errors	ENST00000373831	ensembl	human	known	70_37	silent	SNP	1.000	A
REXO1	57455	genome.wustl.edu	37	19	1827430	1827430	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr19:1827430C>T	ENST00000170168.4	-	2	1452	c.1358G>A	c.(1357-1359)cGg>cAg	p.R453Q	REXO1_ENST00000587524.1_5'Flank|CTB-31O20.4_ENST00000587741.1_RNA|CTB-31O20.4_ENST00000593201.1_RNA	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	453						nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGCGCTGGCCGGTCAGGCCT	0.731																																																	0													8.0	9.0	9.0					19																	1827430		2087	4084	6171	SO:0001583	missense	57455			AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.1358G>A	19.37:g.1827430C>T	ENSP00000170168:p.Arg453Gln		Q9ULT2	Missense_Mutation	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.R453Q	ENST00000170168.4	37	c.1358	CCDS32866.1	19	.	.	.	.	.	.	.	.	.	.	C	5.700	0.313689	0.10789	.	.	ENSG00000079313	ENST00000170168	T	0.11495	2.77	3.39	-0.184	0.13280	.	0.788356	0.11384	N	0.569557	T	0.05364	0.0142	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.46470	-0.9189	10	0.12103	T	0.63	-1.7761	8.4107	0.32642	0.0:0.6237:0.0:0.3763	.	453	Q8N1G1	REXO1_HUMAN	Q	453	ENSP00000170168:R453Q	ENSP00000170168:R453Q	R	-	2	0	REXO1	1778430	0.000000	0.05858	0.000000	0.03702	0.090000	0.18270	-0.377000	0.07456	-0.125000	0.11703	0.555000	0.69702	CGG	REXO1	-	NULL		0.731	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REXO1	HGNC	protein_coding	OTTHUMT00000449200.1	C	NM_020695		1827430	-1	no_errors	ENST00000170168	ensembl	human	known	70_37	missense	SNP	0.000	T
RNF113A	7737	genome.wustl.edu	37	X	119005291	119005291	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chrX:119005291G>C	ENST00000371442.2	-	1	500	c.286C>G	c.(286-288)Ctc>Gtc	p.L96V	NDUFA1_ENST00000371437.4_5'Flank	NM_006978.2	NP_008909.1	O15541	R113A_HUMAN	ring finger protein 113A	96							zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(6)	15						ACCACGCCGAGACTCTCGGGC	0.542																																																	0													162.0	162.0	162.0					X																	119005291		2203	4300	6503	SO:0001583	missense	7737			X98253	CCDS14589.1	Xq24	2013-10-22	2005-03-22	2005-03-22	ENSG00000125352	ENSG00000125352		"""RING-type (C3HC4) zinc fingers"""	12974	protein-coding gene	gene with protein product			"""zinc finger protein 183 (RING finger, C3HC4 type)"""	ZNF183		9224902	Standard	NM_006978		Approved	RNF113, Cwc24	uc004esb.3	O15541	OTTHUMG00000022283	ENST00000371442.2:c.286C>G	X.37:g.119005291G>C	ENSP00000360497:p.Leu96Val		B2RBR7	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.L96V	ENST00000371442.2	37	c.286	CCDS14589.1	X	.	.	.	.	.	.	.	.	.	.	G	3.222	-0.159347	0.06544	.	.	ENSG00000125352	ENST00000371442	T	0.30448	1.53	5.49	1.18	0.20946	.	0.207522	0.40469	N	0.001098	T	0.14787	0.0357	N	0.12502	0.225	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.29336	-1.0015	10	0.12766	T	0.61	-25.165	11.2602	0.49078	0.0:0.4643:0.421:0.1147	.	96	O15541	R113A_HUMAN	V	96	ENSP00000360497:L96V	ENSP00000360497:L96V	L	-	1	0	RNF113A	118889319	0.698000	0.27777	0.006000	0.13384	0.811000	0.45836	1.342000	0.33919	0.129000	0.18514	0.600000	0.82982	CTC	RNF113A	-	NULL		0.542	RNF113A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF113A	HGNC	protein_coding	OTTHUMT00000058071.1	G	NM_006978		119005291	-1	no_errors	ENST00000371442	ensembl	human	known	70_37	missense	SNP	0.000	C
RNF135	84282	genome.wustl.edu	37	17	29314963	29314963	+	Splice_Site	SNP	C	C	G	rs141191751	byFrequency	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr17:29314963C>G	ENST00000328381.5	+	3	1391	c.518C>G	c.(517-519)gCt>gGt	p.A173G	RNF135_ENST00000443677.2_Intron|RNF135_ENST00000535306.2_Splice_Site_p.A173G|RNF135_ENST00000324689.4_Intron	NM_032322.3	NP_115698.3	Q8IUD6	RN135_HUMAN	ring finger protein 135	173					innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-beta production (GO:0032728)|protein ubiquitination (GO:0016567)|regulation of innate immune response (GO:0045088)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A173G(1)|p.?(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	10		all_cancers(10;8.65e-08)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Myeloproliferative disorder(56;0.0255)				TATCAATAGGCTTTTTCTTCT	0.363																																																	2	Substitution - Missense(1)|Unknown(1)	breast(1)|central_nervous_system(1)						C	GLY/ALA,GLY/ALA,	2,4404	4.2+/-10.8	0,2,2201	86.0	86.0	86.0		518,518,	-0.4	0.0	17	dbSNP_134	86	1,8599	1.2+/-3.3	0,1,4299	yes	missense-near-splice,missense-near-splice,intron	RNF135	NM_001184992.1,NM_032322.3,NM_197939.1	60,60,	0,3,6500	GG,GC,CC		0.0116,0.0454,0.0231	benign,benign,	173/287,173/433,	29314963	3,13003	2203	4300	6503	SO:0001630	splice_region_variant	84282			AJ496729	CCDS11262.1, CCDS11263.1, CCDS54104.1	17q11.2	2013-01-09			ENSG00000181481	ENSG00000181481		"""RING-type (C3HC4) zinc fingers"""	21158	protein-coding gene	gene with protein product	"""riplet"""	611358				11468690, 19017631	Standard	NM_001184992		Approved	MGC13061	uc002hfz.3	Q8IUD6	OTTHUMG00000132867	ENST00000328381.5:c.517-1C>G	17.37:g.29314963C>G			A0AVM5|B2R7G9|B6ZLM5|F5GX60|Q9BSE9	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.A173G	ENST00000328381.5	37	c.518	CCDS11262.1	17	.	.	.	.	.	.	.	.	.	.	C	3.451	-0.111925	0.06881	4.54E-4	1.16E-4	ENSG00000181481	ENST00000328381;ENST00000535306	T;T	0.57273	0.41;2.63	4.26	-0.443	0.12249	.	1.004380	0.08025	N	0.992656	T	0.35128	0.0921	N	0.25647	0.755	0.09310	N	1	B;B	0.34290	0.447;0.002	B;B	0.32583	0.148;0.001	T	0.18713	-1.0328	10	0.29301	T	0.29	-0.0367	6.9844	0.24721	0.4225:0.4887:0.0:0.0888	.	173;173	F5GX60;Q8IUD6	.;RN135_HUMAN	G	173	ENSP00000328340:A173G;ENSP00000440470:A173G	ENSP00000328340:A173G	A	+	2	0	RNF135	26339089	0.057000	0.20700	0.000000	0.03702	0.002000	0.02628	0.229000	0.17833	-0.221000	0.09973	-0.797000	0.03246	GCT	RNF135	-	NULL		0.363	RNF135-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF135	HGNC	protein_coding	OTTHUMT00000256342.3	C	NM_032322	Missense_Mutation	29314963	+1	no_errors	ENST00000328381	ensembl	human	known	70_37	missense	SNP	0.001	G
RNF39	80352	genome.wustl.edu	37	6	30043424	30043424	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr6:30043424G>C	ENST00000244360.6	-	1	240	c.143C>G	c.(142-144)tCt>tGt	p.S48C	RNF39_ENST00000376751.3_Missense_Mutation_p.S48C	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	48						cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										CGAGCGCGCAGATGGCGGGCC	0.667																																					NSCLC(8;188 360 1520 20207 31481)												0													25.0	28.0	27.0					6																	30043424		2200	4298	6498	SO:0001583	missense	80352			AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.143C>G	6.37:g.30043424G>C	ENSP00000244360:p.Ser48Cys		A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.S48C	ENST00000244360.6	37	c.143	CCDS4673.1	6	.	.	.	.	.	.	.	.	.	.	g	19.42	3.825027	0.71143	.	.	ENSG00000204618	ENST00000376751;ENST00000244360;ENST00000376746	T;T	0.72615	-0.19;-0.67	3.79	0.574	0.17368	.	.	.	.	.	T	0.25717	0.0626	N	0.08118	0	0.09310	N	1	P;P	0.49447	0.79;0.924	B;B	0.40285	0.173;0.325	T	0.08953	-1.0697	9	0.49607	T	0.09	.	4.8647	0.13602	0.2375:0.2897:0.4728:0.0	.	48;48	Q9H2S5;Q9H2S5-2	RNF39_HUMAN;.	C	48	ENSP00000365942:S48C;ENSP00000244360:S48C	ENSP00000244360:S48C	S	-	2	0	RNF39	30151403	0.000000	0.05858	0.010000	0.14722	0.864000	0.49448	0.259000	0.18405	0.200000	0.20447	0.436000	0.28706	TCT	RNF39	-	NULL		0.667	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF39	HGNC	protein_coding	OTTHUMT00000076625.3	G	NM_170769		30043424	-1	no_errors	ENST00000244360	ensembl	human	known	70_37	missense	SNP	0.002	C
ROCK1	6093	genome.wustl.edu	37	18	18562727	18562727	+	Silent	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr18:18562727G>A	ENST00000399799.2	-	21	3496	c.2556C>T	c.(2554-2556)ttC>ttT	p.F852F		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	852	Glu-rich.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					CACTTACCGAGAAATATTGCT	0.343																																																	0													129.0	121.0	124.0					18																	18562727		2203	4300	6503	SO:0001819	synonymous_variant	6093				CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.2556C>T	18.37:g.18562727G>A			B0YJ91|Q2KHM4|Q59GZ4	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Rho-bd,pfam_HR1_rho-bd,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Rho-assoc_coiled-coil_kin,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.F852	ENST00000399799.2	37	c.2556	CCDS11870.2	18																																																																																			ROCK1	-	pirsf_Rho-assoc_coiled-coil_kin		0.343	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROCK1	HGNC	protein_coding	OTTHUMT00000254641.2	G	NM_005406		18562727	-1	no_errors	ENST00000399799	ensembl	human	known	70_37	silent	SNP	1.000	A
RPLP0P2	113157	genome.wustl.edu	37	11	61404313	61404313	+	RNA	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr11:61404313G>A	ENST00000496593.1	+	0	917					NR_002775.2				ribosomal protein, large, P0 pseudogene 2																		CCGTGGTGCTGATGGGCAAGA	0.562																																																	0																																												113157			BC010523		11q12.2	2014-08-07			ENSG00000243742	ENSG00000243742		"""L ribosomal proteins"""	17960	pseudogene	pseudogene						19123937, 25089627	Standard	NR_002775		Approved		uc001nrz.1		OTTHUMG00000158396		11.37:g.61404313G>A				RNA	SNP	-	NULL	ENST00000496593.1	37	NULL		11																																																																																			RPLP0P2	-	-		0.562	RPLP0P2-002	KNOWN	basic	processed_transcript	RPLP0P2	HGNC	pseudogene	OTTHUMT00000350911.1	G	NR_002775		61404313	+1	no_errors	ENST00000496593	ensembl	human	known	70_37	rna	SNP	1.000	A
RPLP0P2	113157	genome.wustl.edu	37	11	61404631	61404631	+	RNA	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr11:61404631G>A	ENST00000496593.1	+	0	1235					NR_002775.2				ribosomal protein, large, P0 pseudogene 2																		ATGCGCAGCTGATCAAGACGG	0.542																																																	0																																												113157			BC010523		11q12.2	2014-08-07			ENSG00000243742	ENSG00000243742		"""L ribosomal proteins"""	17960	pseudogene	pseudogene						19123937, 25089627	Standard	NR_002775		Approved		uc001nrz.1		OTTHUMG00000158396		11.37:g.61404631G>A				RNA	SNP	-	NULL	ENST00000496593.1	37	NULL		11																																																																																			RPLP0P2	-	-		0.542	RPLP0P2-002	KNOWN	basic	processed_transcript	RPLP0P2	HGNC	pseudogene	OTTHUMT00000350911.1	G	NR_002775		61404631	+1	no_errors	ENST00000496593	ensembl	human	known	70_37	rna	SNP	1.000	A
RRAGC	64121	genome.wustl.edu	37	1	39318163	39318163	+	Intron	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:39318163G>A	ENST00000373001.3	-	4	818					NM_022157.2	NP_071440.1			Ras-related GTP binding C											endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)	10	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)				GATAAAAGCTGAAAAACACAA	0.303																																																	0													88.0	93.0	91.0					1																	39318163		2203	4299	6502	SO:0001627	intron_variant	64121			AF323609	CCDS430.1	1p34	2008-02-05			ENSG00000116954	ENSG00000116954			19902	protein-coding gene	gene with protein product		608267				11073942	Standard	NM_022157		Approved	GTR2, FLJ13311	uc001ccq.3	Q9HB90	OTTHUMG00000000490	ENST00000373001.3:c.642-3C>T	1.37:g.39318163G>A				RNA	SNP	-	NULL	ENST00000373001.3	37	NULL	CCDS430.1	1																																																																																			RRAGC	-	-		0.303	RRAGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRAGC	HGNC	protein_coding	OTTHUMT00000001222.2	G	NM_022157		39318163	-1	no_errors	ENST00000496778	ensembl	human	known	70_37	rna	SNP	1.000	A
S1PR1	1901	genome.wustl.edu	37	1	101704600	101704600	+	Silent	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:101704600C>T	ENST00000305352.6	+	2	435	c.60C>T	c.(58-60)gtC>gtT	p.V20V	S1PR1_ENST00000475821.1_3'UTR|RP4-575N6.4_ENST00000432195.1_RNA	NM_001400.4	NP_001391.2	P21453	S1PR1_HUMAN	sphingosine-1-phosphate receptor 1	20					actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|brain development (GO:0007420)|cardiac muscle tissue growth involved in heart morphogenesis (GO:0003245)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|chemotaxis (GO:0006935)|endothelial cell differentiation (GO:0045446)|G-protein coupled receptor signaling pathway (GO:0007186)|heart trabecula morphogenesis (GO:0061384)|lamellipodium assembly (GO:0030032)|negative regulation of stress fiber assembly (GO:0051497)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bone mineralization (GO:0030500)|regulation of bone resorption (GO:0045124)|regulation of cell adhesion (GO:0030155)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell migration (GO:0072678)|transmission of nerve impulse (GO:0019226)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|sphingolipid binding (GO:0046625)|sphingosine-1-phosphate receptor activity (GO:0038036)			NS(1)|autonomic_ganglia(1)|breast(1)|large_intestine(7)|lung(23)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	43						CTGACTACGTCAACTATGATA	0.577											OREG0013620	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													61.0	59.0	60.0					1																	101704600		2203	4300	6503	SO:0001819	synonymous_variant	1901			M31210	CCDS777.1	1p21	2012-08-08	2008-04-30	2008-04-30	ENSG00000170989	ENSG00000170989		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"", ""CD molecules"""	3165	protein-coding gene	gene with protein product		601974	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 1"""	EDG1		2160972, 9488656	Standard	NM_001400		Approved	edg-1, D1S3362, CD363	uc001dud.2	P21453	OTTHUMG00000010835	ENST00000305352.6:c.60C>T	1.37:g.101704600C>T		1360	D3DT66|Q9BYY4|Q9NYN8	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_EDG1_rcpt,prints_S1P_rcpt,prints_GPCR_Rhodpsn,prints_Melcrt_ACTH_rcpt	p.V20	ENST00000305352.6	37	c.60	CCDS777.1	1																																																																																			S1PR1	-	prints_S1P_rcpt		0.577	S1PR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S1PR1	HGNC	protein_coding	OTTHUMT00000029908.1	C	NM_001400		101704600	+1	no_errors	ENST00000305352	ensembl	human	known	70_37	silent	SNP	1.000	T
SALL4	57167	genome.wustl.edu	37	20	50407563	50407563	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr20:50407563G>A	ENST00000217086.4	-	2	1570	c.1459C>T	c.(1459-1461)Cag>Tag	p.Q487*	SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000371539.3_Intron|SALL4_ENST00000395997.3_Intron	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	487					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GAAAGATTCTGAGGTAGCCCT	0.552																																																	0													99.0	106.0	104.0					20																	50407563		2203	4300	6503	SO:0001587	stop_gained	57167			AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.1459C>T	20.37:g.50407563G>A	ENSP00000217086:p.Gln487*		A2A2D8|Q540H3|Q6Y8G6	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q487*	ENST00000217086.4	37	c.1459	CCDS13438.1	20	.	.	.	.	.	.	.	.	.	.	G	37	6.476758	0.97598	.	.	ENSG00000101115	ENST00000217086	.	.	.	5.1	5.1	0.69264	.	0.205286	0.25299	N	0.031680	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-7.5433	17.0521	0.86521	0.0:0.0:1.0:0.0	.	.	.	.	X	487	.	ENSP00000217086:Q487X	Q	-	1	0	SALL4	49840970	1.000000	0.71417	0.972000	0.41901	0.985000	0.73830	4.692000	0.61746	2.517000	0.84864	0.650000	0.86243	CAG	SALL4	-	NULL		0.552	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL4	HGNC	protein_coding	OTTHUMT00000079738.3	G			50407563	-1	no_errors	ENST00000217086	ensembl	human	known	70_37	nonsense	SNP	0.993	A
SGK223	157285	genome.wustl.edu	37	8	8235381	8235381	+	Missense_Mutation	SNP	C	C	T	rs376262756		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr8:8235381C>T	ENST00000520004.1	-	3	802	c.538G>A	c.(538-540)Gtg>Atg	p.V180M	SGK223_ENST00000330777.4_Missense_Mutation_p.V180M			Q86YV5	SG223_HUMAN		180							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										GGGAAGCTCACCGGGTGGAAG	0.597																																					GBM(34;731 755 10259 33573 33867)												0								C	MET/VAL	2,3984		0,2,1991	88.0	96.0	93.0		538	-0.2	0.0	8		93	0,8288		0,0,4144	no	missense	SGK223	NM_001080826.1	21	0,2,6135	TT,TC,CC		0.0,0.0502,0.0163	probably-damaging	180/1403	8235381	2,12272	1993	4144	6137	SO:0001583	missense	157285																														ENST00000520004.1:c.538G>A	8.37:g.8235381C>T	ENSP00000428054:p.Val180Met		Q8N3N5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.V180M	ENST00000520004.1	37	c.538	CCDS43706.1	8	.	.	.	.	.	.	.	.	.	.	C	7.361	0.624914	0.14193	5.02E-4	0.0	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.60040	0.22;0.22	4.98	-0.22	0.13130	.	1.655790	0.03709	N	0.249855	T	0.41236	0.1150	L	0.29908	0.895	0.09310	N	1	B	0.26195	0.144	B	0.18263	0.021	T	0.27191	-1.0081	10	0.62326	D	0.03	.	0.7665	0.01016	0.2529:0.3666:0.1385:0.242	.	180	Q86YV5	SG223_HUMAN	M	180	ENSP00000330930:V180M;ENSP00000428054:V180M	ENSP00000330930:V180M	V	-	1	0	AC068353.1	8272791	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-1.480000	0.02325	-0.159000	0.11021	0.655000	0.94253	GTG	SGK223	-	NULL		0.597	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK223	Uniprot_genename	protein_coding	OTTHUMT00000374864.1	C			8235381	-1	no_errors	ENST00000330777	ensembl	human	known	70_37	missense	SNP	0.000	T
SLC5A1	6523	genome.wustl.edu	37	22	32495249	32495249	+	Missense_Mutation	SNP	G	G	A	rs202145392		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr22:32495249G>A	ENST00000266088.4	+	12	1610	c.1360G>A	c.(1360-1362)Gat>Aat	p.D454N	SLC5A1_ENST00000543737.1_Missense_Mutation_p.D327N	NM_000343.3	NP_000334.1	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 1	454					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intestinal absorption (GO:0050892)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucose:sodium symporter activity (GO:0005412)			NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	37					Canagliflozin(DB08907)	GCAACTCTTCGATTACATCCA	0.493																																																	0								G	ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	243.0	224.0	230.0		1360	5.3	1.0	22		230	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC5A1	NM_000343.3	23	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	454/665	32495249	2,13004	2203	4300	6503	SO:0001583	missense	6523				CCDS13902.1, CCDS58805.1	22q12.3	2013-05-22			ENSG00000100170	ENSG00000100170		"""Solute carriers"""	11036	protein-coding gene	gene with protein product	"""sodium/glucose cotransporter 1"""	182380		SGLT1		8195156	Standard	NM_000343		Approved	D22S675, NAGT	uc003amc.3	P13866	OTTHUMG00000030768	ENST00000266088.4:c.1360G>A	22.37:g.32495249G>A	ENSP00000266088:p.Asp454Asn		B2R7E2|B7Z4Q9|B7ZA69	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.D454N	ENST00000266088.4	37	c.1360	CCDS13902.1	22	.	.	.	.	.	.	.	.	.	.	G	32	5.140814	0.94560	2.27E-4	1.16E-4	ENSG00000100170	ENST00000266088;ENST00000543737	D;D	0.88046	-2.33;-2.33	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.87826	0.6275	L	0.45137	1.4	0.80722	D	1	D	0.55800	0.973	P	0.52481	0.7	D	0.85835	0.1394	10	0.27785	T	0.31	.	17.9422	0.89028	0.0:0.0:1.0:0.0	.	454	P13866	SC5A1_HUMAN	N	454;327	ENSP00000266088:D454N;ENSP00000444898:D327N	ENSP00000266088:D454N	D	+	1	0	SLC5A1	30825249	1.000000	0.71417	0.965000	0.40720	0.990000	0.78478	7.808000	0.86044	2.474000	0.83562	0.557000	0.71058	GAT	SLC5A1	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr		0.493	SLC5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A1	HGNC	protein_coding	OTTHUMT00000075656.3	G	NM_000343		32495249	+1	no_errors	ENST00000266088	ensembl	human	known	70_37	missense	SNP	1.000	A
SMAD5	4090	genome.wustl.edu	37	5	135513103	135513103	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr5:135513103C>T	ENST00000545279.1	+	9	1690	c.1330C>T	c.(1330-1332)Cag>Tag	p.Q444*	SMAD5_ENST00000545620.1_Nonsense_Mutation_p.Q444*|SMAD5_ENST00000514641.2_3'UTR	NM_001001419.1|NM_005903.5	NP_001001419.1|NP_005894.3	Q99717	SMAD5_HUMAN	SMAD family member 5	445	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cardiac muscle contraction (GO:0060048)|cartilage development (GO:0051216)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|embryonic pattern specification (GO:0009880)|erythrocyte differentiation (GO:0030218)|germ cell development (GO:0007281)|intracellular signal transduction (GO:0035556)|Mullerian duct regression (GO:0001880)|osteoblast fate commitment (GO:0002051)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|large_intestine(4)|lung(3)	8			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TGGGCCTCTTCAGTGGCTGGA	0.428																																																	0													69.0	79.0	76.0					5																	135513103		2153	4287	6440	SO:0001587	stop_gained	4090			U59913	CCDS75308.1	5q31	2008-02-05	2006-11-06	2004-05-26		ENSG00000113658		"""SMADs"""	6771	protein-coding gene	gene with protein product		603110	"""MAD, mothers against decapentaplegic homolog 5 (Drosophila)"", ""SMAD, mothers against DPP homolog 5 (Drosophila)"""	MADH5		8673135	Standard	NM_005903		Approved	Dwfc, JV5-1	uc003lbl.1	Q99717		ENST00000545279.1:c.1330C>T	5.37:g.135513103C>T	ENSP00000441954:p.Gln444*		O14688|Q15798|Q9UQA1	Nonsense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.Q444*	ENST00000545279.1	37	c.1330		5	.	.	.	.	.	.	.	.	.	.	C	37	6.152107	0.97329	.	.	ENSG00000113658	ENST00000545279;ENST00000545620	.	.	.	5.83	4.97	0.65823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	15.1045	0.72310	0.0:0.9322:0.0:0.0678	.	.	.	.	X	444	.	ENSP00000441954:Q444X	Q	+	1	0	SMAD5	135541002	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	7.818000	0.86416	1.482000	0.48325	-0.150000	0.13652	CAG	SMAD5	-	superfamily_SMAD_FHA_domain,pfscan_SMAD_dom_Dwarfin-type		0.428	SMAD5-201	KNOWN	basic|appris_principal	protein_coding	SMAD5	HGNC	protein_coding		C	NM_005903		135513103	+1	no_errors	ENST00000545279	ensembl	human	known	70_37	nonsense	SNP	1.000	T
SNORD3C	780853	genome.wustl.edu	37	17	19091431	19091431	+	lincRNA	SNP	C	C	T	rs566845934	byFrequency	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr17:19091431C>T	ENST00000362428.1	-	0	432				SNORD3A_ENST00000365494.1_lincRNA					small nucleolar RNA, C/D box 3C																		agcgttttctcctgagcgtga	0.493													c|||	27	0.00539137	0.0174	0.0014	5008	,	,		51708	0.0		0.003	False		,,,				2504	0.0																0													35.0	20.0	24.0					17																	19091431		874	1977	2851			780851					17p11.2	2013-09-05			ENSG00000199298	ENSG00000264940			33191	non-coding RNA	RNA, small nucleolar						9365252	Standard	NR_006881		Approved	U3-3					17.37:g.19091431C>T				RNA	SNP	-	NULL	ENST00000362428.1	37	NULL		17																																																																																			SNORD3A	-	-		0.493	SNORD3C-201	KNOWN	basic	snoRNA	SNORD3A	HGNC	lincRNA		C	NR_006881		19091431	+1	no_errors	ENST00000365494	ensembl	human	known	70_37	rna	SNP	0.785	T
SOX3	6658	genome.wustl.edu	37	X	139586893	139586893	+	Silent	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chrX:139586893C>T	ENST00000370536.2	-	1	332	c.333G>A	c.(331-333)gcG>gcA	p.A111A		NM_005634.2	NP_005625.2	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	111					central nervous system development (GO:0007417)|face development (GO:0060324)|hypothalamus development (GO:0021854)|negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|sensory organ development (GO:0007423)|Sertoli cell development (GO:0060009)|sex determination (GO:0007530)|spermatid differentiation (GO:0048515)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	10	Acute lymphoblastic leukemia(192;7.65e-05)					CGGCTGCGTTCGCACTACTCT	0.706																																																	0													11.0	11.0	11.0					X																	139586893		2179	4223	6402	SO:0001819	synonymous_variant	6658				CCDS14669.1	Xq27.1	2013-10-17			ENSG00000134595	ENSG00000134595		"""SRY (sex determining region Y)-boxes"""	11199	protein-coding gene	gene with protein product		313430	"""panhypopituitarism"""	PHP		15800844	Standard	NM_005634		Approved		uc004fbd.1	P41225	OTTHUMG00000022544	ENST00000370536.2:c.333G>A	X.37:g.139586893C>T			P35714|Q5JWI3|Q9NP49	Silent	SNP	pfam_HMG_superfamily,pfam_TF_SOX,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.A111	ENST00000370536.2	37	c.333	CCDS14669.1	X																																																																																			SOX3	-	NULL		0.706	SOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX3	HGNC	protein_coding	OTTHUMT00000058577.1	C			139586893	-1	no_errors	ENST00000370536	ensembl	human	known	70_37	silent	SNP	0.908	T
SPAG9	9043	genome.wustl.edu	37	17	49054561	49054561	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr17:49054561G>C	ENST00000262013.7	-	27	3639	c.3431C>G	c.(3430-3432)tCt>tGt	p.S1144C	SPAG9_ENST00000357122.4_Missense_Mutation_p.S1130C|SPAG9_ENST00000510283.1_Missense_Mutation_p.S987C|SPAG9_ENST00000505279.1_Missense_Mutation_p.S1134C	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	1144					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			TCTCACAAAAGAGAAGCCCAG	0.403																																																	0													119.0	109.0	112.0					17																	49054561		2203	4300	6503	SO:0001583	missense	9043			AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.3431C>G	17.37:g.49054561G>C	ENSP00000262013:p.Ser1144Cys		A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Missense_Mutation	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.S1144C	ENST00000262013.7	37	c.3431	CCDS45740.1	17	.	.	.	.	.	.	.	.	.	.	G	24.1	4.488123	0.84854	.	.	ENSG00000008294	ENST00000262013;ENST00000376407;ENST00000357804;ENST00000510283;ENST00000505279;ENST00000357122;ENST00000535445	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	5.59	4.62	0.57501	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.59756	0.2217	M	0.85859	2.78	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	T	0.67628	-0.5622	10	0.87932	D	0	-9.8259	14.4409	0.67318	0.0709:0.0:0.9291:0.0	.	1134;1144;1130;987	O60271-2;O60271;O60271-4;E7ENU2	.;JIP4_HUMAN;.;.	C	1144;901;891;987;1134;1130;742	ENSP00000262013:S1144C;ENSP00000423165:S987C;ENSP00000426900:S1134C;ENSP00000349636:S1130C	ENSP00000262013:S1144C	S	-	2	0	SPAG9	46409560	1.000000	0.71417	0.993000	0.49108	0.994000	0.84299	9.409000	0.97331	1.361000	0.45981	0.460000	0.39030	TCT	SPAG9	-	superfamily_WD40_repeat_dom		0.403	SPAG9-001	KNOWN	basic|CCDS	protein_coding	SPAG9	HGNC	protein_coding	OTTHUMT00000368543.2	G	NM_003971		49054561	-1	no_errors	ENST00000262013	ensembl	human	known	70_37	missense	SNP	1.000	C
SPATA12	353324	genome.wustl.edu	37	3	57108134	57108134	+	Missense_Mutation	SNP	G	G	A	rs201843696		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr3:57108134G>A	ENST00000334325.1	+	2	1087	c.412G>A	c.(412-414)Gag>Aag	p.E138K	ARHGEF3_ENST00000338458.4_Intron	NM_181727.1	NP_859078.1	Q7Z6I5	SPT12_HUMAN	spermatogenesis associated 12	138										large_intestine(2)|lung(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.0111)|Kidney(284;0.0129)		tggggataatgagaggaccac	0.488																																																	0								G	,LYS/GLU	0,4406		0,0,2203	72.0	72.0	72.0		,412	-2.2	0.0	3		72	1,8599	1.2+/-3.3	0,1,4299	yes	intron,missense	ARHGEF3,SPATA12	NM_001128615.1,NM_181727.1	,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,benign	,138/191	57108134	1,13005	2203	4300	6503	SO:0001583	missense	353324			AY221117	CCDS2879.1	3p21.2	2012-09-19			ENSG00000186451	ENSG00000186451			23221	protein-coding gene	gene with protein product		609869				22981541, 17251597	Standard	NM_181727		Approved		uc003dij.1	Q7Z6I5	OTTHUMG00000158862	ENST00000334325.1:c.412G>A	3.37:g.57108134G>A	ENSP00000335392:p.Glu138Lys		A0AVA8|B2RMW1	Missense_Mutation	SNP	NULL	p.E138K	ENST00000334325.1	37	c.412	CCDS2879.1	3	.	.	.	.	.	.	.	.	.	.	G	9.500	1.102998	0.20632	0.0	1.16E-4	ENSG00000186451	ENST00000334325	.	.	.	1.98	-2.21	0.06973	.	.	.	.	.	T	0.16938	0.0407	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.20042	-1.0287	8	0.87932	D	0	.	6.3729	0.21491	0.3915:0.0:0.6085:0.0	.	138	Q7Z6I5	SPT12_HUMAN	K	138	.	ENSP00000335392:E138K	E	+	1	0	SPATA12	57083174	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-1.243000	0.02905	-0.619000	0.05648	-0.253000	0.11424	GAG	SPATA12	-	NULL		0.488	SPATA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA12	HGNC	protein_coding	OTTHUMT00000352457.2	G	NM_181727		57108134	+1	no_errors	ENST00000334325	ensembl	human	known	70_37	missense	SNP	0.000	A
SPATA31D1	389763	genome.wustl.edu	37	9	84608577	84608577	+	Silent	SNP	G	G	C	rs142745921	byFrequency	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr9:84608577G>C	ENST00000344803.2	+	4	3239	c.3192G>C	c.(3190-3192)ctG>ctC	p.L1064L		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1064					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AGGGGACCCTGAGAAGAGAAT	0.458																																																	0													87.0	90.0	89.0					9																	84608577		1851	4096	5947	SO:0001819	synonymous_variant	389763				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3192G>C	9.37:g.84608577G>C				Silent	SNP	NULL	p.L1064	ENST00000344803.2	37	c.3192	CCDS47986.1	9																																																																																			SPATA31D1	-	NULL		0.458	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	HGNC	protein_coding	OTTHUMT00000402325.1	G	NM_001001670		84608577	+1	no_errors	ENST00000344803	ensembl	human	known	70_37	silent	SNP	0.000	C
SRCAP	10847	genome.wustl.edu	37	16	30721367	30721367	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr16:30721367C>G	ENST00000262518.4	+	8	1437	c.1052C>G	c.(1051-1053)tCt>tGt	p.S351C	SRCAP_ENST00000344771.4_Missense_Mutation_p.S351C|SNORA30_ENST00000384028.1_RNA|SRCAP_ENST00000395059.2_Missense_Mutation_p.S351C	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	351	Glu-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			TCCAGCCCCTCTCAAACCCCC	0.577																																																	0													57.0	52.0	54.0					16																	30721367		2197	4300	6497	SO:0001583	missense	10847			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.1052C>G	16.37:g.30721367C>G	ENSP00000262518:p.Ser351Cys		B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.S351C	ENST00000262518.4	37	c.1052	CCDS10689.2	16	.	.	.	.	.	.	.	.	.	.	C	10.78	1.446383	0.25987	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.91577	-2.87;-2.84;-2.84	5.39	4.44	0.53790	.	0.394954	0.22132	N	0.064174	D	0.89863	0.6838	L	0.40543	1.245	0.35300	D	0.782963	D;P	0.54964	0.969;0.947	P;P	0.53146	0.719;0.527	D	0.92408	0.5935	10	0.56958	D	0.05	-4.3316	11.3601	0.49638	0.0:0.9157:0.0:0.0843	.	351;351	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	C	351	ENSP00000262518:S351C;ENSP00000378499:S351C;ENSP00000343042:S351C	ENSP00000262518:S351C	S	+	2	0	SRCAP	30628868	0.178000	0.23122	0.882000	0.34594	0.977000	0.68977	0.633000	0.24598	1.520000	0.48965	0.655000	0.94253	TCT	SRCAP	-	NULL		0.577	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	C	NM_006662		30721367	+1	no_errors	ENST00000262518	ensembl	human	known	70_37	missense	SNP	0.971	G
SRD5A3	79644	genome.wustl.edu	37	4	56212638	56212638	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr4:56212638C>G	ENST00000264228.4	+	1	363	c.135C>G	c.(133-135)atC>atG	p.I45M		NM_024592.4	NP_078868.1	Q9H8P0	PORED_HUMAN	steroid 5 alpha-reductase 3	45					androgen biosynthetic process (GO:0006702)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|polyprenol catabolic process (GO:0016095)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)			cervix(1)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	12	all_cancers(7;0.0308)|all_lung(4;0.00195)|Lung NSC(11;0.00431)|all_epithelial(27;0.0425)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.0179)		Spironolactone(DB00421)	GCTGCGCGATCTTCCAGGACC	0.697																																																	0													11.0	14.0	13.0					4																	56212638		2180	4258	6438	SO:0001583	missense	79644			AK023414	CCDS3498.1	4q12	2009-07-21			ENSG00000128039	ENSG00000128039			25812	protein-coding gene	gene with protein product		611715				17986282	Standard	NM_024592		Approved	FLJ13352, SRD5A2L, SRD5A2L1	uc003hau.3	Q9H8P0	OTTHUMG00000128733	ENST00000264228.4:c.135C>G	4.37:g.56212638C>G	ENSP00000264228:p.Ile45Met		Q4W5Q6	Missense_Mutation	SNP	pfam_3-oxo-5_a-steroid_4-DH_C,pfscan_3-oxo-5_a-steroid_4-DH_C	p.I45M	ENST00000264228.4	37	c.135	CCDS3498.1	4	.	.	.	.	.	.	.	.	.	.	C	9.799	1.179931	0.21787	.	.	ENSG00000128039	ENST00000264228;ENST00000505210	T;T	0.37411	1.2;2.1	3.95	0.939	0.19506	.	0.690923	0.14503	N	0.315594	T	0.16514	0.0397	N	0.08118	0	0.25118	N	0.990666	B	0.26400	0.148	B	0.24541	0.054	T	0.16897	-1.0387	10	0.40728	T	0.16	.	6.4304	0.21794	0.0:0.4853:0.0:0.5147	.	45	Q9H8P0	PORED_HUMAN	M	45;20	ENSP00000264228:I45M;ENSP00000424714:I20M	ENSP00000264228:I45M	I	+	3	3	SRD5A3	55907395	0.983000	0.35010	0.997000	0.53966	0.338000	0.28826	0.172000	0.16704	0.261000	0.21753	0.313000	0.20887	ATC	SRD5A3	-	NULL		0.697	SRD5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRD5A3	HGNC	protein_coding	OTTHUMT00000250644.2	C	NM_024592		56212638	+1	no_errors	ENST00000264228	ensembl	human	known	70_37	missense	SNP	0.973	G
SRRT	51593	genome.wustl.edu	37	7	100485384	100485384	+	Missense_Mutation	SNP	A	A	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr7:100485384A>G	ENST00000347433.4	+	17	2388	c.2230A>G	c.(2230-2232)Aaa>Gaa	p.K744E	SRRT_ENST00000388793.4_Missense_Mutation_p.K743E|SRRT_ENST00000432932.1_Missense_Mutation_p.K743E|SRRT_ENST00000457580.2_Missense_Mutation_p.K744E			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	744				K -> R (in Ref. 3; CAB46374). {ECO:0000305}.	cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						TGAGGAAGTGAAAAAGGAAGT	0.522																																																	0													114.0	121.0	119.0					7																	100485384		2203	4300	6503	SO:0001583	missense	51593				CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.2230A>G	7.37:g.100485384A>G	ENSP00000314491:p.Lys744Glu		A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	pfam_Arsenite-R_2,pfam_DUF3546	p.K743E	ENST00000347433.4	37	c.2227	CCDS34709.1	7	.	.	.	.	.	.	.	.	.	.	A	16.89	3.247219	0.59103	.	.	ENSG00000087087	ENST00000457580;ENST00000388793;ENST00000342198;ENST00000432932;ENST00000347433;ENST00000448764;ENST00000445337	.	.	.	4.85	4.85	0.62838	Arsenite-resistance protein 2 (1);	0.000000	0.85682	D	0.000000	T	0.67173	0.2865	L	0.61387	1.9	0.53688	D	0.999976	B;P;P;D	0.56287	0.356;0.928;0.928;0.975	B;P;P;P	0.59012	0.115;0.632;0.632;0.85	T	0.65340	-0.6192	9	0.30854	T	0.27	.	12.388	0.55343	1.0:0.0:0.0:0.0	.	743;743;744;744	Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.;.;.;SRRT_HUMAN	E	744;743;109;743;744;374;21	.	ENSP00000344670:K109E	K	+	1	0	SRRT	100323320	1.000000	0.71417	0.989000	0.46669	0.456000	0.32438	5.048000	0.64238	2.028000	0.59812	0.260000	0.18958	AAA	SRRT	-	pfam_Arsenite-R_2		0.522	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	SRRT	HGNC	protein_coding	OTTHUMT00000347168.1	A	NM_015908		100485384	+1	no_errors	ENST00000388793	ensembl	human	known	70_37	missense	SNP	1.000	G
SSPO	23145	genome.wustl.edu	37	7	149494368	149494368	+	RNA	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr7:149494368C>G	ENST00000378016.2	+	0	6839							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGATTCCATTCCACAGCCAAG	0.647																																																	0													71.0	79.0	76.0					7																	149494368		1952	4147	6099			23145			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149494368C>G			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-		0.647	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		C			149494368	+1	no_errors	ENST00000378016	ensembl	human	known	70_37	rna	SNP	0.228	G
SULT1C3	442038	genome.wustl.edu	37	2	108881768	108881768	+	Silent	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr2:108881768G>A	ENST00000329106.2	+	7	876	c.876G>A	c.(874-876)aaG>aaA	p.K292K		NM_001008743.1	NP_001008743.1	Q6IMI6	ST1C3_HUMAN	sulfotransferase family, cytosolic, 1C, member 3	292					sulfur compound metabolic process (GO:0006790)	cytoplasm (GO:0005737)	alcohol sulfotransferase activity (GO:0004027)|aryl sulfotransferase activity (GO:0004062)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(4)	16						ACCAGAAGAAGATGGCAGGAA	0.448																																																	0													116.0	109.0	112.0					2																	108881768		2203	4300	6503	SO:0001819	synonymous_variant	442038			BC146362	CCDS33267.1	2q12.3	2007-07-26			ENSG00000196228	ENSG00000196228		"""Sulfotransferases, cytosolic"""	33543	protein-coding gene	gene with protein product						14676822, 17425406	Standard	NM_001008743		Approved		uc010ywo.2	Q6IMI6	OTTHUMG00000153227	ENST00000329106.2:c.876G>A	2.37:g.108881768G>A			Q6IMI5	Silent	SNP	pfam_Sulfotransferase_dom	p.K292	ENST00000329106.2	37	c.876	CCDS33267.1	2																																																																																			SULT1C3	-	pfam_Sulfotransferase_dom		0.448	SULT1C3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SULT1C3	HGNC	protein_coding	OTTHUMT00000330255.1	G	NM_001008743		108881768	+1	no_errors	ENST00000329106	ensembl	human	known	70_37	silent	SNP	0.999	A
TADA2A	6871	genome.wustl.edu	37	17	35804840	35804840	+	Missense_Mutation	SNP	T	T	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr17:35804840T>G	ENST00000394395.2	+	8	747	c.574T>G	c.(574-576)Ttt>Gtt	p.F192V	TADA2A_ENST00000586023.1_Missense_Mutation_p.F192V|TADA2A_ENST00000591992.1_3'UTR|TADA2A_ENST00000225396.6_Missense_Mutation_p.F192V|TADA2A_ENST00000417170.1_Missense_Mutation_p.F192V	NM_001166105.1	NP_001159577.1	O75478	TAD2A_HUMAN	transcriptional adaptor 2A	192					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)|skin(1)	13						AGACATTGATTTTGTTGAAGA	0.403																																																	0													238.0	225.0	230.0					17																	35804840		2203	4300	6503	SO:0001583	missense	6871			AK022767	CCDS11319.1, CCDS45656.1	17q12-q21	2014-04-10	2009-10-02	2009-10-02	ENSG00000108264	ENSG00000276234			11531	protein-coding gene	gene with protein product		602276	"""transcriptional adaptor 2 (ADA2 homolog, yeast)-like"""	TADA2L		8552087	Standard	XM_006722043		Approved	ADA2, hADA2, ADA2A	uc002hnt.3	O75478	OTTHUMG00000188469	ENST00000394395.2:c.574T>G	17.37:g.35804840T>G	ENSP00000377918:p.Phe192Val		A8MVD0|B3KMU9|Q9BVJ0|Q9UCW2|Q9UP49	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pirsf_Transcriptional_adaptor_2,pfscan_SWIRM,pfscan_Myb-like_dom	p.F192V	ENST00000394395.2	37	c.574	CCDS11319.1	17	.	.	.	.	.	.	.	.	.	.	T	28.9	4.958296	0.92726	.	.	ENSG00000108264	ENST00000394395;ENST00000428846;ENST00000225396;ENST00000417170	T;T;T	0.42513	0.97;0.97;0.97	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.54759	0.1878	M	0.78456	2.415	0.80722	D	1	D;P	0.53885	0.963;0.905	P;B	0.48921	0.595;0.38	T	0.58423	-0.7639	10	0.44086	T	0.13	-17.3615	16.3943	0.83563	0.0:0.0:0.0:1.0	.	192;192	O75478-2;O75478	.;TAD2A_HUMAN	V	192;91;192;192	ENSP00000377918:F192V;ENSP00000225396:F192V;ENSP00000406699:F192V	ENSP00000225396:F192V	F	+	1	0	TADA2A	32878953	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.281000	0.76405	0.533000	0.62120	TTT	TADA2A	-	pirsf_Transcriptional_adaptor_2		0.403	TADA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA2A	HGNC	protein_coding	OTTHUMT00000256677.3	T	NM_001488		35804840	+1	no_errors	ENST00000225396	ensembl	human	known	70_37	missense	SNP	1.000	G
TBX4	9496	genome.wustl.edu	37	17	59557640	59557640	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr17:59557640G>C	ENST00000240335.1	+	7	1026	c.981G>C	c.(979-981)caG>caC	p.Q327H	TBX4_ENST00000393853.4_Missense_Mutation_p.Q327H|TBX4_ENST00000589449.1_3'UTR	NM_018488.2	NP_060958.2	P57082	TBX4_HUMAN	T-box 4	327					angiogenesis (GO:0001525)|embryonic limb morphogenesis (GO:0030326)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q327Q(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(15)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						TTCCCACCCAGAGGGACTCAA	0.617																																																	1	Substitution - coding silent(1)	prostate(1)											48.0	41.0	43.0					17																	59557640		2203	4300	6503	SO:0001583	missense	9496			AF188703	CCDS11629.1	17q21-q22	2005-10-11				ENSG00000121075		"""T-boxes"""	11603	protein-coding gene	gene with protein product		601719				10945475	Standard	NM_018488		Approved		uc002izi.3	P57082		ENST00000240335.1:c.981G>C	17.37:g.59557640G>C	ENSP00000240335:p.Gln327His		A5PKU7|B2RMT1|B7ZLV3	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,prints_TF_T-box,pfscan_TF_T-box	p.Q327H	ENST00000240335.1	37	c.981	CCDS11629.1	17	.	.	.	.	.	.	.	.	.	.	G	21.6	4.169752	0.78452	.	.	ENSG00000121075	ENST00000393853;ENST00000240335	D;D	0.81499	-1.5;-1.5	5.84	5.84	0.93424	.	0.110909	0.64402	D	0.000003	D	0.87313	0.6146	L	0.51422	1.61	0.46542	D	0.999099	D;D	0.63046	0.992;0.992	D;D	0.72075	0.976;0.976	D	0.85208	0.1019	9	.	.	.	.	19.1261	0.93384	0.0:0.0:1.0:0.0	.	327;327	A5PKU7;P57082	.;TBX4_HUMAN	H	327	ENSP00000377435:Q327H;ENSP00000240335:Q327H	.	Q	+	3	2	TBX4	56912422	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.753000	0.62183	2.779000	0.95612	0.655000	0.94253	CAG	TBX4	-	NULL		0.617	TBX4-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	TBX4	HGNC	protein_coding	OTTHUMT00000449649.1	G	NM_018488		59557640	+1	no_errors	ENST00000393853	ensembl	human	known	70_37	missense	SNP	1.000	C
TEKT4	150483	genome.wustl.edu	37	2	95542476	95542476	+	Missense_Mutation	SNP	C	C	T	rs1052809		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr2:95542476C>T	ENST00000295201.4	+	6	1407	c.1270C>T	c.(1270-1272)Cgc>Tgc	p.R424C	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	424					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						CCATCGTACTCGCTACCCCAC	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		19845	0.0		0.0	False		,,,				2504	0.001																0													77.0	53.0	61.0					2																	95542476		2203	4300	6503	SO:0001583	missense	150483			AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.1270C>T	2.37:g.95542476C>T	ENSP00000295201:p.Arg424Cys			Missense_Mutation	SNP	pfam_Tektin,prints_Tektin	p.R424C	ENST00000295201.4	37	c.1270	CCDS2005.1	2	.	.	.	.	.	.	.	.	.	.	.	12.76	2.033512	0.35893	.	.	ENSG00000163060	ENST00000295201	T	0.02916	4.11	2.43	2.43	0.29744	.	0.261531	0.37623	N	0.002019	T	0.03651	0.0104	L	0.60455	1.87	0.80722	D	1	P	0.36874	0.572	B	0.32583	0.148	T	0.50792	-0.8786	10	0.44086	T	0.13	-7.0137	10.5484	0.45072	0.0:1.0:0.0:0.0	rs1052809;rs3193279	424	Q8WW24	TEKT4_HUMAN	C	424	ENSP00000295201:R424C	ENSP00000295201:R424C	R	+	1	0	TEKT4	94906203	0.031000	0.19500	0.725000	0.30721	0.755000	0.42902	0.890000	0.28295	1.049000	0.40321	0.281000	0.19383	CGC	TEKT4	-	pfam_Tektin		0.592	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT4	HGNC	protein_coding	OTTHUMT00000252777.1	C	NM_144705		95542476	+1	no_errors	ENST00000295201	ensembl	human	known	70_37	missense	SNP	0.689	T
TIAM1	7074	genome.wustl.edu	37	21	32598165	32598165	+	Silent	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr21:32598165G>C	ENST00000286827.3	-	8	2157	c.1686C>G	c.(1684-1686)ctC>ctG	p.L562L	TIAM1_ENST00000469412.1_5'UTR|TIAM1_ENST00000541036.1_Silent_p.L562L	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	562					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CTGATTTCAGGAGTCGGAGCG	0.502																																																	0													162.0	143.0	150.0					21																	32598165		2203	4300	6503	SO:0001819	synonymous_variant	7074				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1686C>G	21.37:g.32598165G>C			B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Raf-like_ras-bd,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.L562	ENST00000286827.3	37	c.1686	CCDS13609.1	21																																																																																			TIAM1	-	NULL		0.502	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	HGNC	protein_coding	OTTHUMT00000192552.1	G	NM_003253		32598165	-1	no_errors	ENST00000286827	ensembl	human	known	70_37	silent	SNP	0.998	C
TLN2	83660	genome.wustl.edu	37	15	62942299	62942299	+	Silent	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr15:62942299C>T	ENST00000561311.1	+	4	383	c.153C>T	c.(151-153)ctC>ctT	p.L51L	TLN2_ENST00000306829.6_Silent_p.L51L			Q9Y4G6	TLN2_HUMAN	talin 2	51					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						ACTATGGACTCTTTCTTTCGG	0.488																																																	0													135.0	130.0	132.0					15																	62942299		2203	4300	6503	SO:0001819	synonymous_variant	83660			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.153C>T	15.37:g.62942299C>T			A6NLB8	Silent	SNP	pfam_Talin_cent,pfam_ILWEQ,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ,pfscan_FERM_domain,pfscan_ILWEQ	p.L51	ENST00000561311.1	37	c.153	CCDS32261.1	15																																																																																			TLN2	-	NULL		0.488	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	HGNC	protein_coding	OTTHUMT00000257878.2	C			62942299	+1	no_errors	ENST00000306829	ensembl	human	known	70_37	silent	SNP	0.996	T
TP53	7157	genome.wustl.edu	37	17	7578382	7578382	+	Nonsense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr17:7578382G>C	ENST00000269305.4	-	5	737	c.548C>G	c.(547-549)tCa>tGa	p.S183*	TP53_ENST00000359597.4_Nonsense_Mutation_p.S183*|TP53_ENST00000455263.2_Nonsense_Mutation_p.S183*|TP53_ENST00000445888.2_Nonsense_Mutation_p.S183*|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Nonsense_Mutation_p.S183*|TP53_ENST00000413465.2_Nonsense_Mutation_p.S183*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	183	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		S -> L (in sporadic cancers; somatic mutation).|S -> P (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S183*(29)|p.0?(8)|p.H178_S183delHHERCS(3)|p.R174fs*24(3)|p.?(2)|p.S183L(2)|p.S51*(2)|p.S90*(2)|p.V173fs*59(2)|p.H85_S90delHHERCS(1)|p.E180_S183del(1)|p.H46_S51delHHERCS(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R81fs*24(1)|p.D184fs*4(1)|p.R42fs*24(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATCGCTATCTGAGCAGCGCTC	0.647		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	61	Substitution - Nonsense(33)|Deletion - Frameshift(9)|Whole gene deletion(8)|Deletion - In frame(6)|Unknown(2)|Substitution - Missense(2)|Insertion - In frame(1)	lung(14)|upper_aerodigestive_tract(10)|large_intestine(9)|urinary_tract(7)|central_nervous_system(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|stomach(1)|oesophagus(1)|prostate(1)|liver(1)											47.0	46.0	47.0					17																	7578382		2203	4300	6503	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.548C>G	17.37:g.7578382G>C	ENSP00000269305:p.Ser183*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.S183*	ENST00000269305.4	37	c.548	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	17.01	3.279499	0.59758	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.47	4.49	0.54785	.	0.792587	0.11610	N	0.546873	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-5.9105	8.094	0.30818	0.084:0.1611:0.7549:0.0	.	.	.	.	X	183;183;183;183;183;183;172;90;51;90;51	.	ENSP00000269305:S183X	S	-	2	0	TP53	7519107	0.001000	0.12720	0.516000	0.27786	0.577000	0.36160	0.920000	0.28705	1.440000	0.47531	0.563000	0.77884	TCA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd		0.647	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7578382	-1	no_errors	ENST00000269305	ensembl	human	known	70_37	nonsense	SNP	0.011	C
TOM1L2	146691	genome.wustl.edu	37	17	17772740	17772740	+	Silent	SNP	G	G	A	rs369013597	byFrequency	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr17:17772740G>A	ENST00000379504.3	-	8	908	c.825C>T	c.(823-825)ctC>ctT	p.L275L	TOM1L2_ENST00000540946.1_Silent_p.L177L|TOM1L2_ENST00000535933.1_Silent_p.L222L|TOM1L2_ENST00000581396.1_Silent_p.L225L|TOM1L2_ENST00000542206.1_Silent_p.L127L|TOM1L2_ENST00000577517.1_5'UTR|TOM1L2_ENST00000478943.1_Silent_p.L8L|TOM1L2_ENST00000318094.10_Silent_p.L230L|TOM1L2_ENST00000395739.4_Silent_p.L230L	NM_001082968.1	NP_001076437.1	Q6ZVM7	TM1L2_HUMAN	target of myb1-like 2 (chicken)	275	GAT. {ECO:0000255|PROSITE- ProRule:PRU00373}.				intracellular protein transport (GO:0006886)|negative regulation of mitosis (GO:0045839)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	clathrin binding (GO:0030276)|protein kinase binding (GO:0019901)			endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(2)	10	all_neural(463;0.228)					CGCGGGAGATGAGCTCCACGA	0.577																																					Melanoma(192;2505 2909 14455 25269)												0													81.0	70.0	73.0					17																	17772740		2203	4300	6503	SO:0001819	synonymous_variant	146691			AJ230803	CCDS32584.1, CCDS42270.1, CCDS74000.1, CCDS74001.1, CCDS74002.1, CCDS74003.1	17p11.2	2008-07-03	2001-11-28		ENSG00000175662	ENSG00000175662			11984	protein-coding gene	gene with protein product		615519	"""target of myb1 (chicken) homolog-like 1"""			10036180	Standard	NM_001082968		Approved		uc002grz.4	Q6ZVM7	OTTHUMG00000059353	ENST00000379504.3:c.825C>T	17.37:g.17772740G>A			B7Z2L7|B7Z7F4|Q86V61|Q8TDE7|Q96M88	Silent	SNP	pfam_VHS,pfam_GAT,superfamily_ENTH_VHS,smart_VHS_subgr,pirsf_TOM1,pfscan_GAT,pfscan_VHS	p.L275	ENST00000379504.3	37	c.825	CCDS42270.1	17																																																																																			TOM1L2	-	pfam_GAT,pirsf_TOM1,pfscan_GAT		0.577	TOM1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOM1L2	HGNC	protein_coding	OTTHUMT00000131928.1	G			17772740	-1	no_errors	ENST00000379504	ensembl	human	known	70_37	silent	SNP	1.000	A
TRAK1	22906	genome.wustl.edu	37	3	42132994	42132994	+	Silent	SNP	C	C	T	rs201790561	byFrequency	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr3:42132994C>T	ENST00000327628.5	+	1	433	c.33C>T	c.(31-33)gtC>gtT	p.V11V	TRAK1_ENST00000487159.1_Intron	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	11					endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						GGCAGCCCGTCAGGGCTCAGC	0.537																																					GBM(44;195 884 22595 31865 41850)												0													82.0	78.0	79.0					3																	42132994		1898	4117	6015	SO:0001819	synonymous_variant	22906				CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.33C>T	3.37:g.42132994C>T			E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Silent	SNP	pfam_HAP1_N,pfam_Traffickng_kinesin-bd_prot_dom	p.V11	ENST00000327628.5	37	c.33	CCDS43072.1	3																																																																																			TRAK1	-	NULL		0.537	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TRAK1	HGNC	protein_coding	OTTHUMT00000343413.1	C	NM_014965		42132994	+1	no_errors	ENST00000327628	ensembl	human	putative	70_37	silent	SNP	0.000	T
TRIM47	91107	genome.wustl.edu	37	17	73871532	73871532	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr17:73871532C>G	ENST00000254816.2	-	5	1251	c.1225G>C	c.(1225-1227)Gag>Cag	p.E409Q	RP11-552F3.9_ENST00000586076.1_RNA|TRIM47_ENST00000587339.1_Missense_Mutation_p.E171Q	NM_033452.2	NP_258411.2	Q96LD4	TRI47_HUMAN	tripartite motif containing 47	409						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.E409K(1)		autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	22			Epithelial(20;4.23e-06)|all cancers(21;5.24e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			TTCGTACTCTCGAGGTCTTGG	0.597																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											82.0	76.0	78.0					17																	73871532		2203	4300	6503	SO:0001583	missense	91107			AY026763	CCDS32737.1	17q25	2013-01-09	2011-01-25			ENSG00000132481		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19020	protein-coding gene	gene with protein product		611041	"""tripartite motif-containing 47"""				Standard	NM_033452		Approved	GOA, RNF100	uc002jpw.3	Q96LD4		ENST00000254816.2:c.1225G>C	17.37:g.73871532C>G	ENSP00000254816:p.Glu409Gln		Q96AD0|Q96GU5|Q9BRN7	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.E409Q	ENST00000254816.2	37	c.1225	CCDS32737.1	17	.	.	.	.	.	.	.	.	.	.	C	5.481	0.273756	0.10403	.	.	ENSG00000132481	ENST00000254816	T	0.42131	0.98	4.86	4.86	0.63082	.	0.203527	0.34460	N	0.003945	T	0.23766	0.0575	N	0.08118	0	0.22412	N	0.999125	B	0.28082	0.2	B	0.24155	0.051	T	0.15694	-1.0428	10	0.36615	T	0.2	.	13.8194	0.63311	0.0:1.0:0.0:0.0	.	409	Q96LD4	TRI47_HUMAN	Q	409	ENSP00000254816:E409Q	ENSP00000254816:E409Q	E	-	1	0	TRIM47	71383127	0.011000	0.17503	0.051000	0.19133	0.011000	0.07611	1.180000	0.32005	2.423000	0.82170	0.511000	0.50034	GAG	TRIM47	-	NULL		0.597	TRIM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM47	HGNC	protein_coding	OTTHUMT00000448934.1	C			73871532	-1	no_errors	ENST00000254816	ensembl	human	known	70_37	missense	SNP	0.891	G
TSHZ3	57616	genome.wustl.edu	37	19	31770291	31770291	+	Silent	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr19:31770291G>A	ENST00000240587.4	-	2	735	c.408C>T	c.(406-408)ctC>ctT	p.L136L		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	136					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GGTGCAGGTTGAGGTTGAGGT	0.592																																																	0													120.0	122.0	121.0					19																	31770291		2198	4293	6491	SO:0001819	synonymous_variant	57616			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.408C>T	19.37:g.31770291G>A			Q9H0G6|Q9P254	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.L136	ENST00000240587.4	37	c.408	CCDS12421.2	19																																																																																			TSHZ3	-	NULL		0.592	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2	G	NM_020856		31770291	-1	no_errors	ENST00000240587	ensembl	human	known	70_37	silent	SNP	1.000	A
TSSC2	650368	genome.wustl.edu	37	11	3427845	3427845	+	RNA	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr11:3427845C>T	ENST00000529482.1	+	0	962									tumor suppressing subtransferable candidate 2 pseudogene																		CTTCAAGTGGCAGGAGCAGAA	0.587																																																	0																																												7261					11p15.4	2014-06-05	2008-06-30		ENSG00000223756	ENSG00000223756			12384	pseudogene	pseudogene	"""tumor-supressing STF cDNA 2"", ""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase) (ALG1) pseudogene"""	608999	"""tumor suppressing subtransferable candidate 2"""			9403053	Standard	NR_024248		Approved				OTTHUMG00000011705		11.37:g.3427845C>T				RNA	SNP	-	NULL	ENST00000529482.1	37	NULL		11																																																																																			TSSC2	-	-		0.587	TSSC2-003	KNOWN	basic	processed_transcript	TSSC2	HGNC	pseudogene	OTTHUMT00000392020.1	C			3427845	+1	no_errors	ENST00000529482	ensembl	human	known	70_37	rna	SNP	1.000	T
TTLL12	23170	genome.wustl.edu	37	22	43565562	43565562	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr22:43565562C>G	ENST00000216129.6	-	12	1651	c.1588G>C	c.(1588-1590)Gag>Cag	p.E530Q	TTLL12_ENST00000494035.1_5'UTR	NM_015140.3	NP_055955.1	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	530	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)					central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	13		Ovarian(80;0.221)|Glioma(61;0.222)				GGGATGAACTCTTCACAGTGC	0.612																																																	0													63.0	54.0	57.0					22																	43565562		2202	4300	6502	SO:0001583	missense	23170			D63487	CCDS14047.1	22q13.31	2013-02-14	2006-02-02		ENSG00000100304	ENSG00000100304		"""Tubulin tyrosine ligase-like family"""	28974	protein-coding gene	gene with protein product						15890843	Standard	NM_015140		Approved	KIAA0153	uc003bdp.3	Q14166	OTTHUMG00000150682	ENST00000216129.6:c.1588G>C	22.37:g.43565562C>G	ENSP00000216129:p.Glu530Gln		Q20WK5|Q9UGU3	Missense_Mutation	SNP	pfam_Tub_tyr_ligase	p.E530Q	ENST00000216129.6	37	c.1588	CCDS14047.1	22	.	.	.	.	.	.	.	.	.	.	C	14.88	2.668527	0.47677	.	.	ENSG00000100304	ENST00000216129;ENST00000423379	T	0.05649	3.41	5.12	5.12	0.69794	.	0.154798	0.56097	D	0.000025	T	0.16471	0.0396	M	0.70842	2.15	0.80722	D	1	B;B	0.29627	0.252;0.252	B;B	0.41917	0.37;0.37	T	0.03807	-1.1002	10	0.30078	T	0.28	-23.9998	18.5635	0.91110	0.0:1.0:0.0:0.0	.	530;530	B1AH89;Q14166	.;TTL12_HUMAN	Q	530	ENSP00000216129:E530Q	ENSP00000216129:E530Q	E	-	1	0	TTLL12	41895506	0.997000	0.39634	0.910000	0.35882	0.115000	0.19883	3.635000	0.54309	2.381000	0.81170	0.555000	0.69702	GAG	TTLL12	-	pfam_Tub_tyr_ligase		0.612	TTLL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL12	HGNC	protein_coding	OTTHUMT00000319611.1	C	NM_015140		43565562	-1	no_errors	ENST00000216129	ensembl	human	known	70_37	missense	SNP	1.000	G
TUBD1	51174	genome.wustl.edu	37	17	57958298	57958298	+	Nonsense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr17:57958298G>C	ENST00000592426.1	-	3	494	c.494C>G	c.(493-495)tCa>tGa	p.S165*	TUBD1_ENST00000340993.6_Nonsense_Mutation_p.S165*|TUBD1_ENST00000325752.3_Nonsense_Mutation_p.S165*|TUBD1_ENST00000394239.3_Nonsense_Mutation_p.S165*|TUBD1_ENST00000346141.6_Intron|TUBD1_ENST00000591611.1_Intron|TUBD1_ENST00000376094.4_Nonsense_Mutation_p.S165*|TUBD1_ENST00000539018.1_Intron			Q9UJT1	TBD_HUMAN	tubulin, delta 1	165					cell differentiation (GO:0030154)|microtubule-based process (GO:0007017)|multicellular organismal development (GO:0007275)|protein polymerization (GO:0051258)|spermatogenesis (GO:0007283)	centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|skin(1)|stomach(2)	21	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)		Vinblastine(DB00570)	CATTTTCAATGAGTTTGAGTA	0.343																																																	0													204.0	191.0	195.0					17																	57958298		2203	4300	6503	SO:0001587	stop_gained	51174			AF201333	CCDS11620.1, CCDS54151.1, CCDS54152.1, CCDS54153.1, CCDS54154.1	17q23.1	2007-03-16						"""Tubulins"""	16811	protein-coding gene	gene with protein product		607344				10620804	Standard	NM_016261		Approved	FLJ12709, TUBD	uc002ixw.2	Q9UJT1		ENST00000592426.1:c.494C>G	17.37:g.57958298G>C	ENSP00000468518:p.Ser165*		B4DPT8|B4DW01|D3DU02|E9PCA7|E9PCQ8|Q5KU36|Q9BWG9|Q9H7Z8	Nonsense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,prints_Delta_tubulin,prints_Tubulin,prints_Epsilon_tubulin	p.S165*	ENST00000592426.1	37	c.494	CCDS11620.1	17	.	.	.	.	.	.	.	.	.	.	G	32	5.172545	0.94807	.	.	ENSG00000108423	ENST00000325752;ENST00000340993;ENST00000394239;ENST00000376094	.	.	.	6.08	6.08	0.98989	.	0.101207	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-10.4421	20.6721	0.99693	0.0:0.0:1.0:0.0	.	.	.	.	X	165	.	ENSP00000320797:S165X	S	-	2	0	TUBD1	55313080	1.000000	0.71417	0.996000	0.52242	0.934000	0.57294	7.319000	0.79040	2.894000	0.99253	0.591000	0.81541	TCA	TUBD1	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Delta_tubulin,prints_Tubulin,prints_Epsilon_tubulin		0.343	TUBD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBD1	HGNC	protein_coding	OTTHUMT00000448815.1	G	NM_016261		57958298	-1	no_errors	ENST00000325752	ensembl	human	known	70_37	nonsense	SNP	1.000	C
UBFD1	56061	genome.wustl.edu	37	16	23573950	23573950	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr16:23573950G>A	ENST00000395878.3	+	5	1016	c.635G>A	c.(634-636)cGc>cAc	p.R212H	UBFD1_ENST00000219638.4_Missense_Mutation_p.R436H|UBFD1_ENST00000567212.1_Missense_Mutation_p.R203H|UBFD1_ENST00000571064.1_3'UTR	NM_019116.2	NP_061989.2	O14562	UBFD1_HUMAN	ubiquitin family domain containing 1	212							poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7				GBM - Glioblastoma multiforme(48;0.0331)		CTTCAGGAGCGCCTGCCAACG	0.517																																					Melanoma(22;290 1069 22358 48158)												0													44.0	47.0	46.0					16																	23573950		2121	4236	6357	SO:0001583	missense	56061			AK124139	CCDS10613.2	16p12.1	2008-11-05			ENSG00000103353	ENSG00000103353			30565	protein-coding gene	gene with protein product	"""ubiquitin-binding protein homolog"""					10493829	Standard	XM_006721064		Approved	FLJ42145, FLJ38870, UBPH	uc002dlv.3	O14562	OTTHUMG00000128855	ENST00000395878.3:c.635G>A	16.37:g.23573950G>A	ENSP00000379217:p.Arg212His		A8MW58|D3DWF2	Missense_Mutation	SNP	pfam_Ubiquitin,smart_Ubiquitin,pfscan_Ubiquitin_supergroup	p.R436H	ENST00000395878.3	37	c.1307	CCDS10613.2	16	.	.	.	.	.	.	.	.	.	.	G	15.78	2.934207	0.52866	.	.	ENSG00000103353	ENST00000219638;ENST00000395878;ENST00000399462	.	.	.	5.78	5.78	0.91487	.	0.055871	0.64402	D	0.000001	T	0.43100	0.1232	N	0.16478	0.41	0.58432	D	0.999994	B	0.10296	0.003	B	0.04013	0.001	T	0.28459	-1.0043	9	0.49607	T	0.09	-7.9567	14.2726	0.66159	0.073:0.0:0.927:0.0	.	212	O14562	UBFD1_HUMAN	H	436;212;89	.	ENSP00000219638:R436H	R	+	2	0	UBFD1	23481451	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	6.363000	0.73082	2.732000	0.93576	0.655000	0.94253	CGC	UBFD1	-	NULL		0.517	UBFD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBFD1	HGNC	protein_coding	OTTHUMT00000250795.2	G	NM_019116		23573950	+1	no_errors	ENST00000219638	ensembl	human	known	70_37	missense	SNP	1.000	A
UGT2B15	7366	genome.wustl.edu	37	4	69513036	69513036	+	Missense_Mutation	SNP	C	C	T	rs148054959		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr4:69513036C>T	ENST00000338206.5	-	6	1388	c.1379G>A	c.(1378-1380)cGa>cAa	p.R460Q		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	460					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)									Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	GAAGACTGCTCGATCCAGGGG	0.423													c|||	1	0.000199681	0.0	0.0	5008	,	,		18174	0.0		0.0	False		,,,				2504	0.001																0								C	GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	129.0	131.0	131.0		1379	2.1	0.1	4	dbSNP_134	131	2,8590	2.2+/-6.3	0,2,4294	no	missense	UGT2B15	NM_001076.2	43	0,4,6495	TT,TC,CC		0.0233,0.0454,0.0308	possibly-damaging	460/531	69513036	4,12994	2203	4296	6499	SO:0001583	missense	7366			AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.1379G>A	4.37:g.69513036C>T	ENSP00000341045:p.Arg460Gln		A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.R460Q	ENST00000338206.5	37	c.1379	CCDS3524.1	4	.	.	.	.	.	.	.	.	.	.	c	13.58	2.279810	0.40294	4.54E-4	2.33E-4	ENSG00000196620	ENST00000338206	T	0.62788	0.0	2.96	2.11	0.27256	.	0.333144	0.25250	U	0.032028	T	0.57681	0.2070	M	0.81179	2.53	0.21184	N	0.999768	P	0.35872	0.525	B	0.34180	0.177	T	0.48328	-0.9045	10	0.30078	T	0.28	.	7.6968	0.28600	0.0:0.8673:0.0:0.1327	.	460	P54855	UDB15_HUMAN	Q	460	ENSP00000341045:R460Q	ENSP00000341045:R460Q	R	-	2	0	UGT2B15	69195631	0.000000	0.05858	0.079000	0.20413	0.645000	0.38454	-0.539000	0.06113	0.448000	0.26722	0.552000	0.68991	CGA	UGT2B15	-	pfam_UDP_glucos_trans		0.423	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B15	HGNC	protein_coding	OTTHUMT00000365172.1	C	NM_001076		69513036	-1	no_errors	ENST00000338206	ensembl	human	known	70_37	missense	SNP	0.831	T
VPS13D	55187	genome.wustl.edu	37	1	12321050	12321050	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:12321050G>A	ENST00000358136.3	+	12	1388	c.1258G>A	c.(1258-1260)Gcc>Acc	p.A420T	VPS13D_ENST00000356315.4_Missense_Mutation_p.A420T	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CTGTCCGGGAGCCCCAGAACC	0.562																																																	0													80.0	94.0	89.0					1																	12321050		2203	4300	6503	SO:0001583	missense	55187			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.1258G>A	1.37:g.12321050G>A	ENSP00000350854:p.Ala420Thr			Missense_Mutation	SNP	pfam_VPSAP,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.A420T	ENST00000358136.3	37	c.1258	CCDS30588.1	1	.	.	.	.	.	.	.	.	.	.	G	4.902	0.167637	0.09339	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.41758	0.99;0.99	5.95	5.04	0.67666	.	0.728701	0.13145	N	0.410320	T	0.24812	0.0602	N	0.14661	0.345	0.21967	N	0.999443	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.0	T	0.19418	-1.0306	10	0.15066	T	0.55	.	9.6202	0.39716	0.0736:0.1525:0.7739:0.0	.	420;420	Q5THJ4-2;Q5THJ4	.;VP13D_HUMAN	T	420	ENSP00000348666:A420T;ENSP00000350854:A420T	ENSP00000348666:A420T	A	+	1	0	VPS13D	12243637	0.640000	0.27243	0.090000	0.20809	0.038000	0.13279	2.512000	0.45485	1.512000	0.48834	0.655000	0.94253	GCC	VPS13D	-	NULL		0.562	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	G	NM_015378		12321050	+1	no_errors	ENST00000358136	ensembl	human	known	70_37	missense	SNP	0.125	A
WDR49	151790	genome.wustl.edu	37	3	167293737	167293737	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr3:167293737G>A	ENST00000308378.3	-	4	760	c.455C>T	c.(454-456)aCt>aTt	p.T152I	WDR49_ENST00000453925.2_Missense_Mutation_p.T205I|WDR49_ENST00000476376.1_5'Flank|WDR49_ENST00000479765.1_Missense_Mutation_p.T493I	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	152										breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						AAGAACACAAGTGACTGCTTT	0.403																																																	0													157.0	157.0	157.0					3																	167293737		2203	4300	6503	SO:0001583	missense	151790			AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.455C>T	3.37:g.167293737G>A	ENSP00000311343:p.Thr152Ile		Q8N297	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.T152I	ENST00000308378.3	37	c.455	CCDS3201.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.089|6.089	0.384717|0.384717	0.11524|0.11524	.|.	.|.	ENSG00000174776|ENSG00000174776	ENST00000472600|ENST00000308378;ENST00000479765;ENST00000453925	.|T;T;T	.|0.34072	.|1.38;1.88;2.09	5.76|5.76	4.87|4.87	0.63330|0.63330	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.|0.366176	.|0.29699	.|N	.|0.011438	T|T	0.27205|0.27205	0.0667|0.0667	L|L	0.40543|0.40543	1.245|1.245	0.26454|0.26454	N|N	0.975566|0.975566	.|B;B;B	.|0.34372	.|0.264;0.451;0.361	.|B;B;B	.|0.26693	.|0.072;0.07;0.066	T|T	0.09596|0.09596	-1.0667|-1.0667	5|10	.|0.22109	.|T	.|0.4	.|.	14.1796|14.1796	0.65564|0.65564	0.0:0.2944:0.7056:0.0|0.0:0.2944:0.7056:0.0	.|.	.|205;493;152	.|E7EQK3;E9PDB0;Q8IV35	.|.;.;WDR49_HUMAN	F|I	217|152;493;205	.|ENSP00000311343:T152I;ENSP00000419749:T493I;ENSP00000410863:T205I	.|ENSP00000311343:T152I	L|T	-|-	1|2	0|0	WDR49|WDR49	168776431|168776431	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.049000|0.049000	0.14656|0.14656	2.532000|2.532000	0.45659|0.45659	1.419000|1.419000	0.47118|0.47118	0.650000|0.650000	0.86243|0.86243	CTT|ACT	WDR49	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.403	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR49	HGNC	protein_coding	OTTHUMT00000350592.3	G	NM_178824		167293737	-1	no_errors	ENST00000308378	ensembl	human	known	70_37	missense	SNP	1.000	A
CFAP57	149465	genome.wustl.edu	37	1	43650992	43650992	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:43650992G>A	ENST00000372492.4	+	5	1258	c.934G>A	c.(934-936)Gaa>Aaa	p.E312K	WDR65_ENST00000528956.1_Missense_Mutation_p.E312K	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		312										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GAAGATGGAAGAAAAGGATTT	0.483																																																	0													79.0	76.0	77.0					1																	43650992		2203	4300	6503	SO:0001583	missense	149465																														ENST00000372492.4:c.934G>A	1.37:g.43650992G>A	ENSP00000361570:p.Glu312Lys		A6NKQ3|Q17RI9|Q5TAI0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E312K	ENST00000372492.4	37	c.934		1	.	.	.	.	.	.	.	.	.	.	G	14.82	2.649858	0.47362	.	.	ENSG00000243710	ENST00000372492;ENST00000528956	T;T	0.07021	3.23;3.23	5.07	5.07	0.68467	Quinonprotein alcohol dehydrogenase-like (1);WD40 repeat-like-containing domain (1);	0.786550	0.12546	N	0.459486	T	0.12774	0.0310	M	0.64170	1.965	0.35934	D	0.832754	B;B	0.20368	0.005;0.044	B;B	0.28385	0.011;0.089	T	0.12811	-1.0533	10	0.16896	T	0.51	.	14.148	0.65362	0.0751:0.0:0.9249:0.0	.	312;312	Q96MR6;Q96MR6-2	WDR65_HUMAN;.	K	312	ENSP00000361570:E312K;ENSP00000435310:E312K	ENSP00000361570:E312K	E	+	1	0	WDR65	43423579	1.000000	0.71417	0.954000	0.39281	0.958000	0.62258	4.552000	0.60747	2.506000	0.84524	0.591000	0.81541	GAA	WDR65	-	superfamily_Quinonprotein_ADH-like,superfamily_WD40_repeat_dom		0.483	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	WDR65	HGNC	protein_coding	OTTHUMT00000384325.1	G			43650992	+1	no_errors	ENST00000528956	ensembl	human	known	70_37	missense	SNP	0.989	A
CFAP57	149465	genome.wustl.edu	37	1	43651019	43651019	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:43651019G>C	ENST00000372492.4	+	5	1285	c.961G>C	c.(961-963)Gaa>Caa	p.E321Q	WDR65_ENST00000528956.1_Missense_Mutation_p.E321Q	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		321										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGAGAGCAGAGAAATCAGGGT	0.473																																																	0													54.0	53.0	54.0					1																	43651019		2203	4300	6503	SO:0001583	missense	149465																														ENST00000372492.4:c.961G>C	1.37:g.43651019G>C	ENSP00000361570:p.Glu321Gln		A6NKQ3|Q17RI9|Q5TAI0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E321Q	ENST00000372492.4	37	c.961		1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628354	0.46944	.	.	ENSG00000243710	ENST00000372492;ENST00000528956	T;T	0.07216	4.98;3.21	5.53	4.61	0.57282	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40 repeat-like-containing domain (1);	0.331776	0.31233	N	0.008002	T	0.15565	0.0375	M	0.75264	2.295	0.34141	D	0.666445	B;P	0.38129	0.255;0.619	B;B	0.43052	0.075;0.406	T	0.19910	-1.0291	10	0.18276	T	0.48	.	14.5929	0.68383	0.0707:0.0:0.9293:0.0	.	321;321	Q96MR6;Q96MR6-2	WDR65_HUMAN;.	Q	321	ENSP00000361570:E321Q;ENSP00000435310:E321Q	ENSP00000361570:E321Q	E	+	1	0	WDR65	43423606	1.000000	0.71417	1.000000	0.80357	0.757000	0.42996	8.597000	0.90847	1.466000	0.48025	0.591000	0.81541	GAA	WDR65	-	superfamily_Quinonprotein_ADH-like,superfamily_WD40_repeat_dom		0.473	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	WDR65	HGNC	protein_coding	OTTHUMT00000384325.1	G			43651019	+1	no_errors	ENST00000528956	ensembl	human	known	70_37	missense	SNP	1.000	C
WDR74	54663	genome.wustl.edu	37	11	62601346	62601346	+	Nonsense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr11:62601346G>C	ENST00000525239.1	-	10	1376	c.839C>G	c.(838-840)tCa>tGa	p.S280*	WDR74_ENST00000525752.1_Nonsense_Mutation_p.S223*|WDR74_ENST00000529106.1_Nonsense_Mutation_p.S280*|WDR74_ENST00000540620.1_5'Flank|STX5_ENST00000377897.4_5'Flank|STX5_ENST00000541317.1_5'Flank|RP11-727F15.9_ENST00000535817.1_RNA|WDR74_ENST00000278856.4_Nonsense_Mutation_p.S280*|WDR74_ENST00000311713.7_Nonsense_Mutation_p.S280*|STX5_ENST00000294179.3_5'Flank|RP11-727F15.9_ENST00000535867.1_RNA|STX5_ENST00000394690.1_5'Flank			Q6RFH5	WDR74_HUMAN	WD repeat domain 74	280					blastocyst formation (GO:0001825)|RNA metabolic process (GO:0016070)	nucleolus (GO:0005730)|nucleus (GO:0005634)				kidney(2)|large_intestine(1)|liver(1)|lung(3)|ovary(1)	8						TAGAGGCTTTGAAGGGTGGCA	0.572																																																	0													83.0	88.0	86.0					11																	62601346		2008	4174	6182	SO:0001587	stop_gained	54663				CCDS44630.1	11q12.3	2013-01-09				ENSG00000133316		"""WD repeat domain containing"""	25529	protein-coding gene	gene with protein product							Standard	NM_018093		Approved	FLJ10439	uc001nvm.2	Q6RFH5		ENST00000525239.1:c.839C>G	11.37:g.62601346G>C	ENSP00000432119:p.Ser280*		A8K8G5|Q9BRC9|Q9H6X8|Q9NVY2	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.S280*	ENST00000525239.1	37	c.839	CCDS44630.1	11	.	.	.	.	.	.	.	.	.	.	G	40	8.171662	0.98688	.	.	ENSG00000133316	ENST00000311713;ENST00000529106;ENST00000525239;ENST00000278856;ENST00000525752	.	.	.	5.35	5.35	0.76521	.	0.209896	0.41500	D	0.000870	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-8.1724	14.6026	0.68450	0.0:0.0:1.0:0.0	.	.	.	.	X	280;280;280;280;223	.	ENSP00000278856:S280X	S	-	2	0	WDR74	62357922	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	7.713000	0.84693	2.503000	0.84419	0.563000	0.77884	TCA	WDR74	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat		0.572	WDR74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR74	HGNC	protein_coding	OTTHUMT00000395678.1	G	NM_018093		62601346	-1	no_errors	ENST00000278856	ensembl	human	known	70_37	nonsense	SNP	1.000	C
ZAN	7455	genome.wustl.edu	37	7	100355923	100355923	+	RNA	SNP	C	C	T	rs370689057		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr7:100355923C>T	ENST00000348028.3	+	0	3573				ZAN_ENST00000546292.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000443370.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GGACACACACCGTGTGCCAGC	0.622																																																	0								C	,	0,4230		0,0,2115	42.0	46.0	44.0		3408,3408	-8.4	0.0	7		44	1,8447		0,1,4223	no	coding-synonymous,coding-synonymous	ZAN	NM_003386.1,NM_173059.1	,	0,1,6338	TT,TC,CC		0.0118,0.0,0.0079	,	1136/2813,1136/2722	100355923	1,12677	2115	4224	6339			7455			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100355923C>T			A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Silent	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.T1136	ENST00000348028.3	37	c.3408		7																																																																																			ZAN	-	smart_VWC_out		0.622	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	C	NM_003386		100355923	+1	no_errors	ENST00000546292	ensembl	human	known	70_37	silent	SNP	0.000	T
ZBTB37	84614	genome.wustl.edu	37	1	173840150	173840150	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:173840150G>C	ENST00000367701.5	+	2	978	c.787G>C	c.(787-789)Gaa>Caa	p.E263Q	ZBTB37_ENST00000367702.1_Missense_Mutation_p.E263Q|ZBTB37_ENST00000432989.1_Missense_Mutation_p.E263Q|ZBTB37_ENST00000427304.1_Missense_Mutation_p.E263Q|ZBTB37_ENST00000367704.1_Missense_Mutation_p.E263Q			Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37	263					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(4)	13						GCCTTCTGGAGAAGATGGGAG	0.478																																																	0													79.0	78.0	79.0					1																	173840150		2203	4300	6503	SO:0001583	missense	84614			AK057310	CCDS1312.1, CCDS44278.1	1q24.2	2013-01-08			ENSG00000185278	ENSG00000185278		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	28365	protein-coding gene	gene with protein product						12477932	Standard	NM_032522		Approved	MGC2629, ZNF908	uc009wwp.1	Q5TC79	OTTHUMG00000037274	ENST00000367701.5:c.787G>C	1.37:g.173840150G>C	ENSP00000356674:p.Glu263Gln		Q5TC80|Q96M87|Q9BQ88	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E263Q	ENST00000367701.5	37	c.787	CCDS44278.1	1	.	.	.	.	.	.	.	.	.	.	G	19.28	3.797597	0.70567	.	.	ENSG00000185278	ENST00000367704;ENST00000427304;ENST00000432989;ENST00000367702;ENST00000367703;ENST00000367701	D;T;D;D;T	0.82711	-1.6;2.55;-1.64;-1.64;2.55	6.03	6.03	0.97812	.	0.092787	0.64402	D	0.000001	T	0.80065	0.4555	L	0.27053	0.805	0.53688	D	0.999977	D;D	0.62365	0.98;0.991	P;P	0.59115	0.611;0.852	T	0.74937	-0.3494	10	0.18276	T	0.48	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	263;263	Q5TC79;Q5TC79-2	ZBT37_HUMAN;.	Q	263;263;263;263;171;263	ENSP00000356677:E263Q;ENSP00000415293:E263Q;ENSP00000409408:E263Q;ENSP00000356675:E263Q;ENSP00000356674:E263Q	ENSP00000356674:E263Q	E	+	1	0	ZBTB37	172106773	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.434000	0.97515	2.861000	0.98227	0.655000	0.94253	GAA	ZBTB37	-	NULL		0.478	ZBTB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB37	HGNC	protein_coding	OTTHUMT00000090729.2	G	NM_032522		173840150	+1	no_errors	ENST00000367701	ensembl	human	known	70_37	missense	SNP	1.000	C
ZBTB37	84614	genome.wustl.edu	37	1	173840188	173840188	+	Silent	SNP	G	G	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:173840188G>T	ENST00000367701.5	+	2	1016	c.825G>T	c.(823-825)gtG>gtT	p.V275V	ZBTB37_ENST00000367702.1_Silent_p.V275V|ZBTB37_ENST00000432989.1_Silent_p.V275V|ZBTB37_ENST00000427304.1_Silent_p.V275V|ZBTB37_ENST00000367704.1_Silent_p.V275V			Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37	275					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(4)	13						CAGCCATGGTGATTGATACCA	0.488																																																	0													82.0	78.0	79.0					1																	173840188		2203	4300	6503	SO:0001819	synonymous_variant	84614			AK057310	CCDS1312.1, CCDS44278.1	1q24.2	2013-01-08			ENSG00000185278	ENSG00000185278		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	28365	protein-coding gene	gene with protein product						12477932	Standard	NM_032522		Approved	MGC2629, ZNF908	uc009wwp.1	Q5TC79	OTTHUMG00000037274	ENST00000367701.5:c.825G>T	1.37:g.173840188G>T			Q5TC80|Q96M87|Q9BQ88	Silent	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.V275	ENST00000367701.5	37	c.825	CCDS44278.1	1																																																																																			ZBTB37	-	NULL		0.488	ZBTB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB37	HGNC	protein_coding	OTTHUMT00000090729.2	G	NM_032522		173840188	+1	no_errors	ENST00000367701	ensembl	human	known	70_37	silent	SNP	0.998	T
ZFAND5	7763	genome.wustl.edu	37	9	74971875	74971875	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr9:74971875G>T	ENST00000237937.3	-	5	1022	c.465C>A	c.(463-465)ttC>ttA	p.F155L	ZFAND5_ENST00000343431.2_Missense_Mutation_p.F155L|ZFAND5_ENST00000376960.4_Missense_Mutation_p.F155L|ZFAND5_ENST00000488164.1_5'UTR|ZFAND5_ENST00000376962.5_Missense_Mutation_p.F155L	NM_001102421.1|NM_001278243.1|NM_001278244.1|NM_001278245.1|NM_006007.2	NP_001095891.1|NP_001265172.1|NP_001265173.1|NP_001265174.1|NP_005998.1	O76080	ZFAN5_HUMAN	zinc finger, AN1-type domain 5	155					face development (GO:0060324)|fibroblast migration (GO:0010761)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|respiratory system process (GO:0003016)|skeletal system morphogenesis (GO:0048705)|smooth muscle tissue development (GO:0048745)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|kidney(2)|lung(2)|prostate(1)	6						TTCTGCACATGAAACATCTGT	0.408																																																	0													139.0	121.0	127.0					9																	74971875		2203	4299	6502	SO:0001583	missense	7763			AF062072	CCDS6642.1	9q13-q21	2008-05-02	2006-07-07	2006-07-07	ENSG00000107372	ENSG00000107372		"""Zinc fingers, AN1-type domain containing"""	13008	protein-coding gene	gene with protein product		604761	"""zinc finger protein 216"", ""zinc finger, A20 domain containing 2"""	ZNF216, ZA20D2		9758550	Standard	NM_001278243		Approved	ZFAND5A	uc004aiy.2	O76080	OTTHUMG00000020008	ENST00000237937.3:c.465C>A	9.37:g.74971875G>T	ENSP00000237937:p.Phe155Leu		A8K484	Missense_Mutation	SNP	pfam_Znf_A20,pfam_Znf_AN1,smart_Znf_A20,smart_Znf_AN1,pfscan_Znf_A20,pfscan_Znf_AN1	p.F155L	ENST00000237937.3	37	c.465	CCDS6642.1	9	.	.	.	.	.	.	.	.	.	.	G	25.5	4.639992	0.87760	.	.	ENSG00000107372	ENST00000237937;ENST00000376960;ENST00000376962;ENST00000343431;ENST00000376956	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	6.17	3.27	0.37495	Zinc finger, AN1-type (4);	.	.	.	.	T	0.52821	0.1758	L	0.49126	1.545	0.53688	D	0.999977	D	0.76494	0.999	D	0.74023	0.982	T	0.44711	-0.9310	9	0.42905	T	0.14	-3.671	8.5736	0.33585	0.3699:0.0:0.6301:0.0	.	155	O76080	ZFAN5_HUMAN	L	155;155;155;155;207	ENSP00000237937:F155L;ENSP00000366159:F155L;ENSP00000366161:F155L;ENSP00000350586:F155L	ENSP00000237937:F155L	F	-	3	2	ZFAND5	74161695	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.770000	0.26618	0.428000	0.26173	0.655000	0.94253	TTC	ZFAND5	-	pfam_Znf_AN1,smart_Znf_AN1,pfscan_Znf_AN1		0.408	ZFAND5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAND5	HGNC	protein_coding	OTTHUMT00000052644.1	G			74971875	-1	no_errors	ENST00000237937	ensembl	human	known	70_37	missense	SNP	1.000	T
ZMPSTE24	10269	genome.wustl.edu	37	1	40726594	40726594	+	Silent	SNP	C	C	G	rs281875363		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr1:40726594C>G	ENST00000372759.3	+	2	372	c.207C>G	c.(205-207)ctC>ctG	p.L69L	ZMPSTE24_ENST00000479131.1_3'UTR|RP1-39G22.7_ENST00000567508.1_RNA	NM_005857.4	NP_005848.2	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	69					CAAX-box protein processing (GO:0071586)|nuclear envelope organization (GO:0006998)|prenylated protein catabolic process (GO:0030327)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metalloexopeptidase activity (GO:0008235)			endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	16	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			AATCTCGACTCTATCAACTGG	0.388																																																	0													136.0	136.0	136.0					1																	40726594		2203	4300	6503	SO:0001819	synonymous_variant	10269			Y13834	CCDS449.1	1p34	2014-09-17	2012-12-10		ENSG00000084073	ENSG00000084073	3.4.24.84		12877	protein-coding gene	gene with protein product	"""Hutchinson-Gilford progeria syndrome"", ""CAAX prenyl protease 1 homolog"""	606480	"""zinc metalloproteinase (STE24 homolog, yeast)"", ""zinc metallopeptidase (STE24 homolog, yeast)"", ""zinc metallopeptidase STE24 homolog (S. cerevisiae)"""			10373325, 9700155, 16671095	Standard	NM_005857		Approved	FACE-1, Ste24p, STE24, HGPS, PRO1	uc001cfg.4	O75844	OTTHUMG00000005762	ENST00000372759.3:c.207C>G	1.37:g.40726594C>G			B3KQI7|D3DPU7|Q8NDZ8|Q9UBQ2	Silent	SNP	pfam_Peptidase_M48	p.L69	ENST00000372759.3	37	c.207	CCDS449.1	1																																																																																			ZMPSTE24	-	NULL		0.388	ZMPSTE24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMPSTE24	HGNC	protein_coding	OTTHUMT00000015766.1	C			40726594	+1	no_errors	ENST00000372759	ensembl	human	known	70_37	silent	SNP	0.939	G
ZNF148	7707	genome.wustl.edu	37	3	124951197	124951197	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr3:124951197C>G	ENST00000360647.4	-	9	2858	c.2373G>C	c.(2371-2373)caG>caC	p.Q791H	ZNF148_ENST00000485866.1_Missense_Mutation_p.Q791H|ZNF148_ENST00000497929.1_5'UTR|ZNF148_ENST00000484491.1_Missense_Mutation_p.Q791H|ZNF148_ENST00000468369.1_Missense_Mutation_p.Q141H|ZNF148_ENST00000492394.1_Missense_Mutation_p.Q791H|ZNF148_ENST00000544464.1_Missense_Mutation_p.Q128H|SLC12A8_ENST00000423114.2_Intron	NM_021964.2	NP_068799.2	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	791					cellular defense response (GO:0006968)|gamete generation (GO:0007276)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein complex assembly (GO:0006461)|substantia nigra development (GO:0021762)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)	28						AGCCAAAAGTCTGGCCAGTTG	0.398																																																	0													30.0	31.0	31.0					3																	124951197		2185	4289	6474	SO:0001583	missense	7707			U09851	CCDS3031.1	3q21.2	2013-01-08	2006-06-13		ENSG00000163848	ENSG00000163848		"""Zinc fingers, C2H2-type"""	12933	protein-coding gene	gene with protein product		601897	"""zinc finger protein 148 (pHZ-52)"""			7557990, 9925940	Standard	NM_021964		Approved	BERF-1, ZBP-89, BFCOL1, HT-BETA, ZFP148, pHZ-52	uc003ehx.4	Q9UQR1	OTTHUMG00000159448	ENST00000360647.4:c.2373G>C	3.37:g.124951197C>G	ENSP00000353863:p.Gln791His		D3DN27|O00389|O43591|Q58EY5|Q6PJ98	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q791H	ENST00000360647.4	37	c.2373	CCDS3031.1	3	.	.	.	.	.	.	.	.	.	.	C	13.26	2.183331	0.38511	.	.	ENSG00000163848	ENST00000360647;ENST00000468369;ENST00000484491;ENST00000544464;ENST00000492394;ENST00000485866	T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96	5.88	5.0	0.66597	.	0.060682	0.64402	D	0.000003	T	0.43986	0.1272	N	0.24115	0.695	0.47037	D	0.999299	D;D	0.61080	0.987;0.989	P;P	0.55391	0.775;0.737	T	0.42447	-0.9451	10	0.87932	D	0	-8.7785	14.434	0.67268	0.0:0.9298:0.0:0.0702	.	141;791	G5E9X2;Q9UQR1	.;ZN148_HUMAN	H	791;141;791;128;791;791	ENSP00000353863:Q791H;ENSP00000420102:Q141H;ENSP00000420335:Q791H;ENSP00000437916:Q128H;ENSP00000419322:Q791H;ENSP00000420448:Q791H	ENSP00000353863:Q791H	Q	-	3	2	ZNF148	126433887	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.363000	0.44178	2.780000	0.95670	0.655000	0.94253	CAG	ZNF148	-	NULL		0.398	ZNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF148	HGNC	protein_coding	OTTHUMT00000355452.4	C	NM_021964		124951197	-1	no_errors	ENST00000360647	ensembl	human	known	70_37	missense	SNP	1.000	G
ZNF227	7770	genome.wustl.edu	37	19	44740134	44740134	+	Silent	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr19:44740134G>A	ENST00000313040.7	+	6	1756	c.1551G>A	c.(1549-1551)gaG>gaA	p.E517E	ZNF227_ENST00000391961.2_Silent_p.E466E|ZNF227_ENST00000589005.1_Silent_p.E466E	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	517					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				ACACTGGGGAGAAACGATTCA	0.473																																																	0													59.0	58.0	58.0					19																	44740134		2203	4300	6503	SO:0001819	synonymous_variant	7770			AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.1551G>A	19.37:g.44740134G>A			B3KRU7|B7Z5P9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E517	ENST00000313040.7	37	c.1551	CCDS12636.1	19																																																																																			ZNF227	-	pfscan_Znf_C2H2		0.473	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF227	HGNC	protein_coding	OTTHUMT00000460720.1	G	NM_182490		44740134	+1	no_errors	ENST00000313040	ensembl	human	known	70_37	silent	SNP	1.000	A
ZNF384	171017	genome.wustl.edu	37	12	6776900	6776900	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr12:6776900C>A	ENST00000396801.3	-	11	1921	c.1714G>T	c.(1714-1716)Gag>Tag	p.E572*	RP4-761J14.8_ENST00000586338.1_RNA|ZNF384_ENST00000355772.4_Nonsense_Mutation_p.E456*|ZNF384_ENST00000319770.3_Nonsense_Mutation_p.E495*|ZNF384_ENST00000396795.1_Nonsense_Mutation_p.E511*|RP4-761J14.8_ENST00000589924.1_RNA|ZNF384_ENST00000361959.3_Nonsense_Mutation_p.E572*|ZNF384_ENST00000396799.2_Nonsense_Mutation_p.E511*	NM_001135734.2	NP_001129206.1	Q8TF68	ZN384_HUMAN	zinc finger protein 384	572					nucleocytoplasmic transport (GO:0006913)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)		EWSR1/ZNF384(4)	breast(3)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	18						GCCAGGTGCTCCACCTGGATG	0.557			T	"""EWSR1, TAF15 """	ALL																																			Dom	yes		12	12p13	171017	zinc finger protein 384 (CIZ/NMP4)		L	0													157.0	157.0	157.0					12																	6776900		2203	4300	6503	SO:0001587	stop_gained	171017			U80738	CCDS8557.1, CCDS31732.1, CCDS44817.1	12p12	2013-01-08	2002-05-23	2002-05-24		ENSG00000126746		"""Zinc fingers, C2H2-type"""	11955	protein-coding gene	gene with protein product		609951	"""trinucleotide repeat containing 1"""	TNRC1		9225980, 11149472	Standard	NM_001135734		Approved	CAGH1A, CIZ, NMP4, NP	uc010sfh.2	Q8TF68		ENST00000396801.3:c.1714G>T	12.37:g.6776900C>A	ENSP00000380019:p.Glu572*		O15407|Q7Z722|Q8N938	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E572*	ENST00000396801.3	37	c.1714	CCDS44817.1	12	.	.	.	.	.	.	.	.	.	.	C	39	7.414134	0.98269	.	.	ENSG00000126746	ENST00000319770;ENST00000396795;ENST00000396801;ENST00000361959;ENST00000355772;ENST00000396799	.	.	.	5.83	5.83	0.93111	.	0.111469	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-20.9262	20.1141	0.97919	0.0:1.0:0.0:0.0	.	.	.	.	X	495;511;572;572;456;511	.	ENSP00000321650:E495X	E	-	1	0	ZNF384	6647161	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.390000	0.79816	2.757000	0.94681	0.591000	0.81541	GAG	ZNF384	-	NULL		0.557	ZNF384-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF384	HGNC	protein_coding	OTTHUMT00000400712.1	C			6776900	-1	no_errors	ENST00000361959	ensembl	human	known	70_37	nonsense	SNP	1.000	A
ZNF433	163059	genome.wustl.edu	37	19	12125757	12125757	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr19:12125757C>G	ENST00000344980.6	-	4	2095	c.1925G>C	c.(1924-1926)gGa>gCa	p.G642A	CTD-2006C1.2_ENST00000406892.2_RNA|CTD-2006C1.2_ENST00000495324.1_RNA|CTD-2006C1.2_ENST00000476474.1_RNA|ZNF433_ENST00000419886.2_Missense_Mutation_p.G607A	NM_001080411.1	NP_001073880.1	Q8N7K0	ZN433_HUMAN	zinc finger protein 433	642					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(1)|prostate(1)|skin(1)	14						GGGTTTCTCTCCAGTGTGAGT	0.448																																																	0													72.0	77.0	75.0					19																	12125757		2197	4299	6496	SO:0001583	missense	163059			AK098300	CCDS45983.1	19p13.13	2013-01-08			ENSG00000197647	ENSG00000197647		"""Zinc fingers, C2H2-type"", ""-"""	20811	protein-coding gene	gene with protein product							Standard	NM_001080411		Approved	FLJ40981	uc002msy.1	Q8N7K0	OTTHUMG00000156427	ENST00000344980.6:c.1925G>C	19.37:g.12125757C>G	ENSP00000339767:p.Gly642Ala		Q86VX3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G642A	ENST00000344980.6	37	c.1925	CCDS45983.1	19	.	.	.	.	.	.	.	.	.	.	C	16.50	3.140392	0.56936	.	.	ENSG00000197647	ENST00000419886;ENST00000344980	T;T	0.01505	4.82;4.82	1.42	1.42	0.22433	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06962	0.0177	M	0.73598	2.24	0.26579	N	0.973415	D	0.76494	0.999	D	0.67231	0.95	T	0.17289	-1.0374	9	0.72032	D	0.01	.	5.4375	0.16490	0.0:0.8102:0.0:0.1898	.	642	Q8N7K0	ZN433_HUMAN	A	607;642	ENSP00000393416:G607A;ENSP00000339767:G642A	ENSP00000339767:G642A	G	-	2	0	ZNF433	11986757	0.000000	0.05858	0.095000	0.20976	0.633000	0.38033	0.601000	0.24119	1.072000	0.40860	0.313000	0.20887	GGA	ZNF433	-	pfscan_Znf_C2H2		0.448	ZNF433-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF433	HGNC	protein_coding	OTTHUMT00000403716.1	C	NM_152602		12125757	-1	no_errors	ENST00000344980	ensembl	human	known	70_37	missense	SNP	1.000	G
PRAP1	118471	genome.wustl.edu	37	10	135165615	135165615	+	Missense_Mutation	SNP	G	G	A	rs140360205		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr10:135165615G>A	ENST00000433452.2	+	4	505	c.233G>A	c.(232-234)cGa>cAa	p.R78Q	PRAP1_ENST00000423766.1_Missense_Mutation_p.R79Q|ZNF511_ENST00000368554.4_Missense_Mutation_p.R237Q|PRAP1_ENST00000458230.1_Missense_Mutation_p.R78Q|PRAP1_ENST00000463201.1_3'UTR|RP11-122K13.7_ENST00000452591.1_RNA			Q96NZ9	PRAP1_HUMAN	proline-rich acidic protein 1	78						extracellular region (GO:0005576)				large_intestine(1)|lung(2)	3		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		all cancers(32;7.08e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.88e-06)|Epithelial(32;9.48e-06)		GAGAAGCCACGAGGTCAGGGC	0.637																																																	0									GLN/ARG,GLN/ARG	1,4405		0,1,2202	68.0	69.0	69.0		233,233	1.3	0.0	10	dbSNP_134	69	0,8600		0,0,4300	no	missense,missense	PRAP1	NM_001145201.1,NM_145202.4	43,43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	78/143,78/152	135165615	1,13005	2203	4300	6503	SO:0001583	missense	118472			AF421885	CCDS7679.1	10q26.3	2012-10-01			ENSG00000165828	ENSG00000165828			23304	protein-coding gene	gene with protein product		609776				14583459, 20674898	Standard	NM_001145201		Approved	UPA		Q96NZ9	OTTHUMG00000019312	ENST00000433452.2:c.233G>A	10.37:g.135165615G>A	ENSP00000416126:p.Arg78Gln		B7ZL57|B7ZL58|E9KL31|Q5VWY4|Q7Z4X5|Q8IWR3|Q8NCS2	Missense_Mutation	SNP	smart_Znf_C2H2-like	p.R237Q	ENST00000433452.2	37	c.710	CCDS7679.1	10	.	.	.	.	.	.	.	.	.	.	c	6.488	0.458171	0.12342	2.27E-4	0.0	ENSG00000198546;ENSG00000165828;ENSG00000165828;ENSG00000165828;ENSG00000165828	ENST00000368554;ENST00000433452;ENST00000423766;ENST00000458230;ENST00000415747	T;T;T;T	0.31510	1.51;1.5;1.49;1.62	3.24	1.29	0.21616	.	.	.	.	.	T	0.11750	0.0286	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.01281	0.0;0.0;0.0	T	0.30880	-0.9963	9	0.18276	T	0.48	-1.1804	1.4778	0.02430	0.2546:0.44:0.1751:0.1303	.	78;79;78	A6XND8;Q96NZ9-3;Q96NZ9	.;.;PRAP1_HUMAN	Q	237;78;79;78;78	ENSP00000357542:R237Q;ENSP00000416126:R78Q;ENSP00000409495:R79Q;ENSP00000402700:R78Q	ENSP00000403014:R78Q	R	+	2	0	ZNF511;PRAP1	135015605	0.003000	0.15002	0.003000	0.11579	0.002000	0.02628	-0.120000	0.10660	0.039000	0.15632	-0.753000	0.03488	CGA	ZNF511	-	NULL		0.637	PRAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF511	HGNC	protein_coding	OTTHUMT00000051132.1	G	NM_145202		135165615	+1	no_errors	ENST00000368554	ensembl	human	known	70_37	missense	SNP	0.003	A
ZNF607	84775	genome.wustl.edu	37	19	38200684	38200684	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr19:38200684G>C	ENST00000355202.4	-	3	644	c.49C>G	c.(49-51)Cat>Gat	p.H17D	ZNF607_ENST00000395835.3_Missense_Mutation_p.H17D|CTD-2528L19.4_ENST00000586606.2_Missense_Mutation_p.H17D	NM_032689.4	NP_116078.4	Q96SK3	ZN607_HUMAN	zinc finger protein 607	17	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|lung(8)|urinary_tract(1)	27			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)			CACTCCTGATGAGAGAAGTCT	0.463																																																	0													115.0	98.0	104.0					19																	38200684		2203	4300	6503	SO:0001583	missense	84775			AK127464	CCDS33006.1, CCDS54259.1	19q13.1	2013-01-08				ENSG00000198182		"""Zinc fingers, C2H2-type"", ""-"""	28192	protein-coding gene	gene with protein product						14702039	Standard	NM_032689		Approved	MGC13071, FLJ14802	uc002ohc.2	Q96SK3		ENST00000355202.4:c.49C>G	19.37:g.38200684G>C	ENSP00000347338:p.His17Asp		F5H141|Q6ZMN2|Q6ZMN4|Q96C40	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H17D	ENST00000355202.4	37	c.49	CCDS33006.1	19	.	.	.	.	.	.	.	.	.	.	G	13.69	2.311119	0.40895	.	.	ENSG00000198182	ENST00000355202;ENST00000395835	T;T	0.01665	4.7;4.7	2.6	2.6	0.31112	Krueppel-associated box (4);	.	.	.	.	T	0.01695	0.0054	L	0.29908	0.895	0.23524	N	0.997494	B;B	0.17852	0.024;0.007	B;B	0.12156	0.007;0.001	T	0.43702	-0.9375	9	0.59425	D	0.04	.	5.1546	0.15029	0.1673:0.0:0.8327:0.0	.	17;17	Q96SK3;F5H141	ZN607_HUMAN;.	D	17	ENSP00000347338:H17D;ENSP00000438015:H17D	ENSP00000347338:H17D	H	-	1	0	ZNF607	42892524	0.968000	0.33430	0.999000	0.59377	0.857000	0.48899	0.498000	0.22530	1.268000	0.44264	0.563000	0.77884	CAT	ZNF607	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.463	ZNF607-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF607	HGNC	protein_coding	OTTHUMT00000459502.2	G	NM_032689		38200684	-1	no_errors	ENST00000355202	ensembl	human	known	70_37	missense	SNP	0.987	C
ZNF812	729648	genome.wustl.edu	37	19	9801621	9801621	+	Silent	SNP	G	G	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr19:9801621G>A	ENST00000457674.2	-	5	1076	c.558C>T	c.(556-558)atC>atT	p.I186I	ZNF812_ENST00000536819.1_5'UTR	NM_001199814.1	NP_001186743.1	P0C7V5	ZN812_HUMAN	zinc finger protein 812	186					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(1)	1						CTCCAATGTGGATTCCCATGT	0.383																																																	0																																										SO:0001819	synonymous_variant	729648				CCDS54215.1	19p13.2	2014-04-02			ENSG00000224689	ENSG00000224689		"""Zinc fingers, C2H2-type"", ""-"""	33242	protein-coding gene	gene with protein product							Standard	NM_001199814		Approved		uc021uop.1	P0C7V5	OTTHUMG00000167867	ENST00000457674.2:c.558C>T	19.37:g.9801621G>A				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I186	ENST00000457674.2	37	c.558	CCDS54215.1	19																																																																																			ZNF812	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.383	ZNF812-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF812	HGNC	protein_coding	OTTHUMT00000396726.1	G			9801621	-1	no_errors	ENST00000457674	ensembl	human	known	70_37	silent	SNP	0.116	A
ZNF607	84775	genome.wustl.edu	37	19	38200719	38200719	+	Nonsense_Mutation	SNP	G	G	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr19:38200719G>C	ENST00000355202.4	-	3	609	c.14C>G	c.(13-15)tCa>tGa	p.S5*	ZNF607_ENST00000395835.3_Nonsense_Mutation_p.S5*|CTD-2528L19.4_ENST00000586606.2_Nonsense_Mutation_p.S5*	NM_032689.4	NP_116078.4	Q96SK3	ZN607_HUMAN	zinc finger protein 607	5					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|lung(8)|urinary_tract(1)	27			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)			GAATGTTATTGATCCCTGAAA	0.507																																																	0													94.0	84.0	87.0					19																	38200719		2203	4300	6503	SO:0001587	stop_gained	84775			AK127464	CCDS33006.1, CCDS54259.1	19q13.1	2013-01-08				ENSG00000198182		"""Zinc fingers, C2H2-type"", ""-"""	28192	protein-coding gene	gene with protein product						14702039	Standard	NM_032689		Approved	MGC13071, FLJ14802	uc002ohc.2	Q96SK3		ENST00000355202.4:c.14C>G	19.37:g.38200719G>C	ENSP00000347338:p.Ser5*		F5H141|Q6ZMN2|Q6ZMN4|Q96C40	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S5*	ENST00000355202.4	37	c.14	CCDS33006.1	19	.	.	.	.	.	.	.	.	.	.	G	16.97	3.269983	0.59540	.	.	ENSG00000198182	ENST00000355202;ENST00000395835	.	.	.	2.43	1.31	0.21738	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	7.0451	0.25040	0.1558:0.0:0.8442:0.0	.	.	.	.	X	5	.	ENSP00000347338:S5X	S	-	2	0	ZNF607	42892559	0.002000	0.14202	0.046000	0.18839	0.007000	0.05969	0.694000	0.25512	1.164000	0.42652	0.563000	0.77884	TCA	ZNF607	-	superfamily_Krueppel-associated_box		0.507	ZNF607-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF607	HGNC	protein_coding	OTTHUMT00000459502.2	G	NM_032689		38200719	-1	no_errors	ENST00000355202	ensembl	human	known	70_37	nonsense	SNP	0.003	C
ZNF876P	642280	genome.wustl.edu	37	4	247375	247375	+	RNA	SNP	C	C	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21b83870-9be0-44d2-9365-da0ac1eb44e6	c697db9d-0569-4f05-a3c3-b470633c5927	g.chr4:247375C>T	ENST00000356347.3	+	0	199					NR_027481.1		Q49A33	Z876P_HUMAN	zinc finger protein 876, pseudogene						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TACCCAAGATCTTTGGCCAGT	0.328																																																	0																																												642280			BC028359		4p16.3	2011-04-20	2010-08-03	2009-07-22	ENSG00000198155	ENSG00000198155			32472	pseudogene	pseudogene							Standard	NR_027481		Approved		uc010iba.4	Q49A33	OTTHUMG00000159874		4.37:g.247375C>T				RNA	SNP	-	NULL	ENST00000356347.3	37	NULL		4																																																																																			ZNF876P	-	-		0.328	ZNF876P-001	KNOWN	basic	processed_transcript	ZNF876P	HGNC	pseudogene	OTTHUMT00000357870.2	C	NR_027481		247375	+1	no_errors	ENST00000356347	ensembl	human	known	70_37	rna	SNP	0.001	T
