#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PTCHD3	374308	hgsc.bcm.edu	37	10	27702894	27702923	+	In_Frame_Del	DEL	GGGGTGCATCGTCCAGCTCCAGCGGCAGGC	GGGGTGCATCGTCCAGCTCCAGCGGCAGGC	-	rs34349277|rs371045387|rs201821343	byFrequency	TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	GGGGTGCATCGTCCAGCTCCAGCGGCAGGC	GGGGTGCATCGTCCAGCTCCAGCGGCAGGC	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr10:27702894_27702923delGGGGTGCATCGTCCAGCTCCAGCGGCAGGC	ENST00000438700.3	-	1	374_403	c.257_286delGCCTGCCGCTGGAGCTGGACGATGCACCCC	c.(256-288)cgcctgccgctggagctggacgatgcacccctg>ctg	p.RLPLELDDAP86del		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	86					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)	p.P88P(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						TCCTCCGGCAGGGGTGCATCGTCCAGCTCCAGCGGCAGGCGGGGTGCATC	0.704																																					p.86_96del		.											.	.	.	1	Substitution - coding silent(1)	endometrium(1)	c.258_287del						.			7,4255		1,5,2125						-3.5	0.0			34	78,8172		8,62,4055	no	coding	PTCHD3	NM_001034842.3		9,67,6180	A1A1,A1R,RR		0.9455,0.1642,0.6793				85,12427				SO:0001651	inframe_deletion	374308	exon1			CCGGCAGGGGTGC	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.257_286delGCCTGCCGCTGGAGCTGGACGATGCACCCC	10.37:g.27702894_27702923delGGGGTGCATCGTCCAGCTCCAGCGGCAGGC	ENSP00000417658:p.Arg86_Pro95del	10	0		16	2	NM_001034842	I3L499|Q6ZU28	In_Frame_Del	DEL	ENST00000438700.3	37	CCDS31173.1																																																																																			.		0.704	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541	
TLR1	7096	hgsc.bcm.edu	37	4	38798585	38798585	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr4:38798585G>T	ENST00000502213.2	-	3	2097	c.1868C>A	c.(1867-1869)gCc>gAc	p.A623D	TLR1_ENST00000308979.2_Missense_Mutation_p.A623D|TLR1_ENST00000510552.1_5'Flank			Q15399	TLR1_HUMAN	toll-like receptor 1	623					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.A623D(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						TATGTTCCTGGCCCTGCGCCG	0.493																																					p.A623D	GBM(5;216 373 40795 46382)	.											TLR1,NS,carcinoma,0,1	TLR1	0	1	Substitution - Missense(1)	lung(1)	c.C1868A						.						85.0	91.0	89.0					4																	38798585		2203	4300	6503	SO:0001583	missense	7096	exon4			TTCCTGGCCCTGC	U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.1868C>A	4.37:g.38798585G>T	ENSP00000421259:p.Ala623Asp	35	0		30	2	NM_003263	D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Missense_Mutation	SNP	ENST00000502213.2	37	CCDS33973.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.864056	0.51482	.	.	ENSG00000174125	ENST00000308979;ENST00000502213	T;T	0.02067	4.47;4.47	5.5	5.5	0.81552	.	0.086178	0.49305	D	0.000154	T	0.13670	0.0331	M	0.85197	2.74	0.48830	D	0.999718	P	0.52061	0.95	D	0.64042	0.921	T	0.00007	-1.2503	10	0.87932	D	0	.	15.3868	0.74708	0.0:0.0:0.8602:0.1398	.	623	Q15399	TLR1_HUMAN	D	623	ENSP00000354932:A623D;ENSP00000421259:A623D	ENSP00000354932:A623D	A	-	2	0	TLR1	38474980	0.327000	0.24678	0.852000	0.33557	0.230000	0.25150	1.239000	0.32719	2.758000	0.94735	0.563000	0.77884	GCC	.		0.493	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360510.3		
GLI2	2736	hgsc.bcm.edu	37	2	121732608	121732608	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr2:121732608G>T	ENST00000452319.1	+	9	1351	c.1291G>T	c.(1291-1293)Gag>Tag	p.E431*	GLI2_ENST00000361492.4_Nonsense_Mutation_p.E431*|GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000314490.11_Nonsense_Mutation_p.E103*					GLI family zinc finger 2									p.E431Q(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				GCAGGAGGCTGAGGTGGTCAT	0.577																																					p.E431X		.											GLI2,bladder,carcinoma,0,1	GLI2	0	1	Substitution - Missense(1)	urinary_tract(1)	c.G1291T						.						91.0	81.0	84.0					2																	121732608		2203	4300	6503	SO:0001587	stop_gained	2736	exon8			GAGGCTGAGGTGG		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.1291G>T	2.37:g.121732608G>T	ENSP00000390436:p.Glu431*	12	0		18	2	NM_005270		Nonsense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	G	34	5.346041	0.95807	.	.	ENSG00000074047	ENST00000452319;ENST00000361492;ENST00000314490	.	.	.	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.9294	0.92558	0.0:0.0:1.0:0.0	.	.	.	.	X	431;431;103	.	ENSP00000312694:E103X	E	+	1	0	GLI2	121449078	1.000000	0.71417	0.950000	0.38849	0.931000	0.56810	9.601000	0.98297	2.711000	0.92665	0.655000	0.94253	GAG	.		0.577	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
PTPN13	5783	hgsc.bcm.edu	37	4	87643569	87643569	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr4:87643569G>T	ENST00000411767.2	+	10	1653	c.1590G>T	c.(1588-1590)atG>atT	p.M530I	PTPN13_ENST00000427191.2_Missense_Mutation_p.M530I|PTPN13_ENST00000316707.6_Missense_Mutation_p.M530I|PTPN13_ENST00000511467.1_Missense_Mutation_p.M530I|PTPN13_ENST00000436978.1_Missense_Mutation_p.M530I			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	530					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)	p.M530I(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		AAACAGCCATGACTCAAAGAA	0.438																																					p.M530I		.											PTPN13,NS,carcinoma,0,1	PTPN13	0	1	Substitution - Missense(1)	cervix(1)	c.G1590T						.						110.0	106.0	107.0					4																	87643569		1898	4122	6020	SO:0001583	missense	5783	exon10			AGCCATGACTCAA		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.1590G>T	4.37:g.87643569G>T	ENSP00000407249:p.Met530Ile	45	0		48	2	NM_006264	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	37	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	G	13.93	2.384674	0.42308	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	4.92	4.92	0.64577	.	0.000000	0.56097	D	0.000029	T	0.30324	0.0761	M	0.63428	1.95	0.43439	D	0.995619	B;B;B;B	0.31077	0.04;0.307;0.126;0.2	B;B;B;B	0.25405	0.06;0.047;0.021;0.047	T	0.07908	-1.0748	10	0.38643	T	0.18	.	13.4538	0.61187	0.0:0.0:0.8433:0.1567	.	530;530;530;530	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	I	530;530;530;530;530;498	ENSP00000408368:M530I;ENSP00000394794:M530I;ENSP00000322675:M530I;ENSP00000407249:M530I;ENSP00000426626:M530I	ENSP00000322675:M530I	M	+	3	0	PTPN13	87862593	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	4.036000	0.57304	2.444000	0.82710	0.655000	0.94253	ATG	.		0.438	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
WDR33	55339	hgsc.bcm.edu	37	2	128522061	128522061	+	Intron	SNP	C	C	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr2:128522061C>T	ENST00000322313.4	-	6	785				WDR33_ENST00000409658.3_Missense_Mutation_p.E323K|WDR33_ENST00000393006.1_Intron	NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33						mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		AGACTGAATTCTTTATTTGGA	0.294																																					p.E323K		.											WDR33_ENST00000409658,NS,carcinoma,0,2	WDR33_ENST00000409658	0	0			c.G967A						.						26.0	21.0	23.0					2																	128522061		925	2075	3000	SO:0001627	intron_variant	55339	exon6			TGAATTCTTTATT		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.626+340G>A	2.37:g.128522061C>T		37	0		49	2	NM_001006622	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Missense_Mutation	SNP	ENST00000322313.4	37	CCDS2150.1	.	.	.	.	.	.	.	.	.	.	C	15.05	2.717369	0.48622	.	.	ENSG00000136709	ENST00000409658	T	0.37915	1.17	5.91	5.91	0.95273	.	.	.	.	.	T	0.58637	0.2136	.	.	.	0.33254	D	0.558846	D	0.56287	0.975	P	0.58130	0.833	T	0.67225	-0.5724	8	0.87932	D	0	.	20.3053	0.98627	0.0:1.0:0.0:0.0	.	323	Q9C0J8-2	.	K	323	ENSP00000387186:E323K	ENSP00000387186:E323K	E	-	1	0	WDR33	128238531	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.677000	0.68142	2.808000	0.96608	0.655000	0.94253	GAA	.		0.294	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	
VNN2	8875	hgsc.bcm.edu	37	6	133070863	133070863	+	Nonsense_Mutation	SNP	C	C	A			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr6:133070863C>A	ENST00000326499.6	-	6	1466	c.1342G>T	c.(1342-1344)Gaa>Taa	p.E448*	VNN2_ENST00000525289.1_Nonsense_Mutation_p.E227*|RP1-55C23.7_ENST00000430895.1_RNA|VNN2_ENST00000525270.1_Nonsense_Mutation_p.E395*	NM_004665.2	NP_004656	O95498	VNN2_HUMAN	vanin 2	448					cellular component movement (GO:0006928)|pantothenate metabolic process (GO:0015939)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)	p.E448K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		AGATGAATTTCGGTAAGTAGC	0.373																																					p.E448X		.											VNN2,face,carcinoma,0,2	VNN2	0	1	Substitution - Missense(1)	skin(1)	c.G1342T						.						65.0	61.0	62.0					6																	133070863		2203	4300	6503	SO:0001587	stop_gained	8875	exon6			GAATTTCGGTAAG	AB026705	CCDS5161.1, CCDS5162.1, CCDS56451.1	6q23-q24	2013-02-13			ENSG00000112303	ENSG00000112303	3.5.1.92	"""Vanins"""	12706	protein-coding gene	gene with protein product	"""pantetheinase"""	603571				9790769, 11491533	Standard	NM_078488		Approved	FOAP-4, GPI-80	uc003qdt.3	O95498	OTTHUMG00000015588	ENST00000326499.6:c.1342G>T	6.37:g.133070863C>A	ENSP00000322276:p.Glu448*	69	0		48	2	NM_004665	A0AUZ3|A6NDY1|A8K4E3|A8K7W0|B2DFZ0|B2DFZ1|B2DFZ2|B2DFZ3|F6XL73|Q2XUN1|Q9UJF3|Q9UMW2	Nonsense_Mutation	SNP	ENST00000326499.6	37	CCDS5161.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.844010	0.71488	.	.	ENSG00000112303	ENST00000326499;ENST00000525270;ENST00000525289	.	.	.	5.29	-1.6	0.08426	.	0.852623	0.10092	N	0.716989	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-0.068	6.3761	0.21509	0.1161:0.479:0.0:0.405	.	.	.	.	X	448;395;227	.	ENSP00000322276:E448X	E	-	1	0	VNN2	133112556	0.000000	0.05858	0.000000	0.03702	0.414000	0.31173	-0.258000	0.08733	-0.773000	0.04596	-0.136000	0.14681	GAA	.		0.373	VNN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042264.2		
RPS21	6227	hgsc.bcm.edu	37	20	60962906	60962906	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr20:60962906A>G	ENST00000343986.4	+	4	161	c.122A>G	c.(121-123)aAg>aGg	p.K41R	RPS21_ENST00000450116.2_Missense_Mutation_p.K41R|RPS21_ENST00000492356.2_3'UTR|RPS21_ENST00000370562.1_3'UTR	NM_001024.3	NP_001015.1	P63220	RS21_HUMAN	ribosomal protein S21	41					cellular protein metabolic process (GO:0044267)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 3'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000461)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|structural constituent of ribosome (GO:0003735)			endometrium(2)|lung(1)|prostate(1)	4	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			TAGGTTGACAAGGTCACAGGC	0.522																																					p.K41R		.											RPS21,NS,carcinoma,0,1	RPS21	0	0			c.A122G						.						100.0	100.0	100.0					20																	60962906		2203	4300	6503	SO:0001583	missense	6227	exon4			TTGACAAGGTCAC	L04483	CCDS13497.1	20q13.3	2011-04-05			ENSG00000171858	ENSG00000171858		"""S ribosomal proteins"""	10409	protein-coding gene	gene with protein product	"""8.2 kDa differentiation factor"""	180477				8332502, 9582194	Standard	NM_001024		Approved	S21	uc002ycr.3	P63220	OTTHUMG00000032915	ENST00000343986.4:c.122A>G	20.37:g.60962906A>G	ENSP00000345957:p.Lys41Arg	26	0		14	2	NM_001024	P35265	Missense_Mutation	SNP	ENST00000343986.4	37	CCDS13497.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.07|14.07	2.425623|2.425623	0.43020|0.43020	.|.	.|.	ENSG00000171858|ENSG00000171858	ENST00000317311;ENST00000370592;ENST00000343986;ENST00000450116|ENST00000337102	.|.	.|.	.|.	5.11|5.11	2.84|2.84	0.33178|0.33178	.|.	.|0.241194	.|0.39985	.|N	.|0.001220	T|T	0.61476|0.61476	0.2350|0.2350	.|.	.|.	.|.	0.38854|0.38854	D|D	0.956332|0.956332	B;B|.	0.23806|.	0.091;0.001|.	B;B|.	0.25140|.	0.058;0.005|.	T|T	0.61158|0.61158	-0.7119|-0.7119	7|6	0.38643|0.59425	T|D	0.18|0.04	-6.3825|-6.3825	7.4746|7.4746	0.27368|0.27368	0.8129:0.0:0.1871:0.0|0.8129:0.0:0.1871:0.0	.|.	41;41|.	Q9BYK1;P63220|.	.;RS21_HUMAN|.	R|G	41|41	.|.	ENSP00000324438:K41R|ENSP00000337019:R41G	K|R	+|+	2|1	0|2	RPS21|RPS21	60396301|60396301	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.809000|0.809000	0.45718|0.45718	4.940000|4.940000	0.63533|0.63533	0.291000|0.291000	0.22468|0.22468	0.455000|0.455000	0.32223|0.32223	AAG|AGG	.		0.522	RPS21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080031.2	NM_001024	
OR2M1P	388762	hgsc.bcm.edu	37	1	248285841	248285841	+	IGR	SNP	C	C	G			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr1:248285841C>G								OR2L13 (21617 upstream) : OR2M5 (22608 downstream)																							TTCATTTGCTCTATAGTAATG	0.423																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	388762	.			TTTGCTCTATAGT																													1.37:g.248285841C>G		49	0		68	5	.		RNA	SNP		37																																																																																				.	0	0.423								
NDEL1	81565	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	8350192	8350192	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr17:8350192G>A	ENST00000334527.7	+	4	558	c.361G>A	c.(361-363)Gcc>Acc	p.A121T	NDEL1_ENST00000299734.7_Missense_Mutation_p.A121T|NDEL1_ENST00000380025.4_Missense_Mutation_p.A121T|NDEL1_ENST00000402554.3_Missense_Mutation_p.A121T|NDEL1_ENST00000585098.1_Intron	NM_030808.4	NP_110435.1	Q9GZM8	NDEL1_HUMAN	nudE neurodevelopment protein 1-like 1	121	Interaction with KATNB1. {ECO:0000250}.|Required for interaction with PAFAH1B1.|Self-association. {ECO:0000250}.				activation of Cdc42 GTPase activity (GO:0032864)|central nervous system neuron axonogenesis (GO:0021955)|centrosome localization (GO:0051642)|cerebral cortex radially oriented cell migration (GO:0021799)|chromosome segregation (GO:0007059)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|neurofilament cytoskeleton organization (GO:0060052)|neuron migration (GO:0001764)|neuron projection extension (GO:1990138)|nuclear envelope disassembly (GO:0051081)|positive regulation of axon extension (GO:0045773)|positive regulation of axon regeneration (GO:0048680)|retrograde axon cargo transport (GO:0008090)|vesicle transport along microtubule (GO:0047496)	axon hillock (GO:0043203)|cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|neurofilament cytoskeleton (GO:0060053)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)	oligopeptidase activity (GO:0070012)			large_intestine(6)|lung(4)|skin(3)	13						GCTGGAGCAGGCCAACGACGA	0.428																																					p.A121T		.											.	.	.	0			c.G361A						.						93.0	88.0	89.0					17																	8350192		2203	4300	6503	SO:0001583	missense	81565	exon4			GAGCAGGCCAACG	AF182078	CCDS11143.1, CCDS32564.1	17p13.1	2013-08-06	2013-08-06	2003-04-16	ENSG00000166579	ENSG00000166579			17620	protein-coding gene	gene with protein product		607538	"""nudE nuclear distribution gene E homolog (A. nidulans)-like 1"", ""nudE nuclear distribution E homolog (A. nidulans)-like 1"""			11163260, 11163259	Standard	NM_001025579		Approved	NUDEL, MITAP1, NDE1L1, NDE2	uc002glj.4	Q9GZM8	OTTHUMG00000108193	ENST00000334527.7:c.361G>A	17.37:g.8350192G>A	ENSP00000333982:p.Ala121Thr	65	0		55	5	NM_001025579	B3KP93|D3DTS0|J3QT32|Q86T80|Q8TAR7|Q9UH50	Missense_Mutation	SNP	ENST00000334527.7	37	CCDS11143.1	.	.	.	.	.	.	.	.	.	.	G	18.93	3.727027	0.69074	.	.	ENSG00000166579	ENST00000299734;ENST00000380025;ENST00000402554;ENST00000334527	.	.	.	5.12	5.12	0.69794	.	0.105499	0.64402	D	0.000005	T	0.67468	0.2896	M	0.75777	2.31	0.80722	D	1	B;B	0.25390	0.125;0.06	B;B	0.20184	0.028;0.012	T	0.64334	-0.6432	9	0.25751	T	0.34	-2.3041	18.7659	0.91873	0.0:0.0:1.0:0.0	.	121;121	Q9GZM8;A6NIZ0	NDEL1_HUMAN;.	T	121;121;176;121	.	ENSP00000299734:A121T	A	+	1	0	NDEL1	8290917	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.980000	0.56895	2.677000	0.91161	0.561000	0.74099	GCC	.		0.428	NDEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226999.2	NM_030808	
GEMIN5	25929	hgsc.bcm.edu	37	5	154270801	154270801	+	Splice_Site	SNP	C	C	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr5:154270801C>T	ENST00000285873.7	-	26	4337	c.4262G>A	c.(4261-4263)tGt>tAt	p.C1421Y		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	1421					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)	p.C1421F(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CAGTACTTACCACTGGCTCTG	0.483																																					p.C1421Y		.											GEMIN5,NS,carcinoma,0,1	GEMIN5	0	1	Substitution - Missense(1)	lung(1)	c.G4262A						.						133.0	129.0	130.0					5																	154270801		2203	4300	6503	SO:0001630	splice_region_variant	25929	exon26			ACTTACCACTGGC	AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.4262+1G>A	5.37:g.154270801C>T		14	0		16	2	NM_015465	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Missense_Mutation	SNP	ENST00000285873.7	37	CCDS4330.1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.830012	0.00584	.	.	ENSG00000082516	ENST00000285873	T	0.70749	-0.51	5.5	1.6	0.23607	.	1.876250	0.01645	N	0.024287	T	0.53110	0.1776	N	0.22421	0.69	0.18873	N	0.999989	B;B	0.29955	0.263;0.263	B;B	0.24541	0.054;0.054	T	0.37776	-0.9691	9	.	.	.	2.6483	1.9785	0.03421	0.2704:0.4357:0.1398:0.1541	.	1420;1421	B7ZLC9;Q8TEQ6	.;GEMI5_HUMAN	Y	1421	ENSP00000285873:C1421Y	.	C	-	2	0	GEMIN5	154250994	0.613000	0.27009	0.378000	0.26068	0.252000	0.25951	0.870000	0.28010	0.342000	0.23796	0.655000	0.94253	TGT	.		0.483	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1		Missense_Mutation
CDCA2	157313	hgsc.bcm.edu	37	8	25317954	25317954	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr8:25317954C>T	ENST00000330560.3	+	3	593	c.116C>T	c.(115-117)gCc>gTc	p.A39V	KCTD9_ENST00000518067.1_5'Flank|KCTD9_ENST00000221200.4_5'Flank|CDCA2_ENST00000380665.3_Missense_Mutation_p.A24V	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	39					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A39V(1)		breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		CAGAAGCATGCCGAATTACCT	0.428																																					p.A39V		.											CDCA2,NS,carcinoma,0,1	CDCA2	0	1	Substitution - Missense(1)	kidney(1)	c.C116T						.						237.0	231.0	233.0					8																	25317954		2203	4300	6503	SO:0001583	missense	157313	exon3			AGCATGCCGAATT	BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.116C>T	8.37:g.25317954C>T	ENSP00000328228:p.Ala39Val	47	0		33	2	NM_152562	Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Missense_Mutation	SNP	ENST00000330560.3	37	CCDS6049.1	.	.	.	.	.	.	.	.	.	.	C	16.79	3.221746	0.58560	.	.	ENSG00000184661	ENST00000330560;ENST00000380665;ENST00000435898	T;T	0.36340	1.26;1.26	5.19	4.32	0.51571	.	0.306968	0.23768	N	0.044756	T	0.44414	0.1292	L	0.53249	1.67	0.09310	N	1	P;P;P	0.50272	0.933;0.933;0.933	P;P;P	0.51324	0.461;0.666;0.666	T	0.35251	-0.9796	10	0.72032	D	0.01	-8.3448	11.8981	0.52667	0.0:0.8243:0.1756:0.0	.	39;24;39	B7Z5Q5;E9PEI0;Q69YH5	.;.;CDCA2_HUMAN	V	39;24;39	ENSP00000328228:A39V;ENSP00000370040:A24V	ENSP00000328228:A39V	A	+	2	0	CDCA2	25373871	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	0.603000	0.24149	1.165000	0.42670	-0.273000	0.10243	GCC	.		0.428	CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216891.3	NM_152562	
ZNF683	257101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	26691514	26691514	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr1:26691514A>G	ENST00000436292.1	-	4	643	c.523T>C	c.(523-525)Tgt>Cgt	p.C175R	ZNF683_ENST00000349618.3_Missense_Mutation_p.C175R|ZNF683_ENST00000403843.1_Missense_Mutation_p.C175R|ZNF683_ENST00000374204.1_Missense_Mutation_p.C175R			Q8IZ20	ZN683_HUMAN	zinc finger protein 683	175					natural killer cell differentiation (GO:0001779)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(1)	15		all_cancers(24;2.39e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.76e-26)|Colorectal(126;1.38e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00793)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.159)|LUSC - Lung squamous cell carcinoma(448;0.233)		ACAGGGGGACAGGGGCAGAAA	0.612																																					p.C175R		.											.	.	.	0			c.T523C						.						43.0	45.0	44.0					1																	26691514		2203	4300	6503	SO:0001583	missense	257101	exon4			GGGGACAGGGGCA	BC029505	CCDS279.2	1p36.11	2013-01-08			ENSG00000176083	ENSG00000176083		"""Zinc fingers, C2H2-type"""	28495	protein-coding gene	gene with protein product	"""hypothetical protein MGC33414"""					12477932	Standard	NM_173574		Approved	MGC33414	uc009vsj.1	Q8IZ20	OTTHUMG00000003521	ENST00000436292.1:c.523T>C	1.37:g.26691514A>G	ENSP00000388792:p.Cys175Arg	28	0		31	4	NM_173574	Q5T141|Q5T146|Q5T147|Q5T149|Q8NEN4	Missense_Mutation	SNP	ENST00000436292.1	37		.	.	.	.	.	.	.	.	.	.	A	17.18	3.324284	0.60634	.	.	ENSG00000176083	ENST00000403843;ENST00000436292;ENST00000374204;ENST00000349618;ENST00000455900;ENST00000451801;ENST00000454975;ENST00000423508;ENST00000416125	T;T;T;T;T;T;T;T;T	0.32023	3.15;3.15;3.09;3.09;2.21;2.22;1.47;1.87;1.88	4.49	2.03	0.26663	.	0.337941	0.21938	N	0.066927	T	0.17023	0.0409	L	0.29908	0.895	0.29510	N	0.854275	B;B	0.30146	0.27;0.176	B;B	0.25506	0.061;0.028	T	0.11567	-1.0582	10	0.59425	D	0.04	-1.2676	3.0159	0.06059	0.653:0.0:0.1162:0.2308	.	175;175	Q8IZ20-2;Q8IZ20	.;ZN683_HUMAN	R	175;175;175;175;183;175;125;183;175	ENSP00000384782:C175R;ENSP00000388792:C175R;ENSP00000363320:C175R;ENSP00000344095:C175R;ENSP00000411289:C183R;ENSP00000411290:C175R;ENSP00000412881:C125R;ENSP00000391584:C183R;ENSP00000401961:C175R	ENSP00000344095:C175R	C	-	1	0	ZNF683	26564101	0.335000	0.24748	0.782000	0.31804	0.448000	0.32197	0.152000	0.16302	0.788000	0.33755	0.459000	0.35465	TGT	.		0.612	ZNF683-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000009794.2	NM_173574	
ICA1	3382	hgsc.bcm.edu	37	7	8268281	8268281	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr7:8268281G>T	ENST00000402384.3	-	4	472	c.206C>A	c.(205-207)aCc>aAc	p.T69N	ICA1_ENST00000401396.1_Missense_Mutation_p.T57N|ICA1_ENST00000406470.2_Missense_Mutation_p.T69N|ICA1_ENST00000265577.7_Missense_Mutation_p.T68N|ICA1_ENST00000422063.2_Missense_Mutation_p.T69N|ICA1_ENST00000396675.3_Missense_Mutation_p.T69N|ICA1_ENST00000407906.1_Missense_Mutation_p.T69N			Q05084	ICA69_HUMAN	islet cell autoantigen 1, 69kDa	69	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|secretory granule membrane (GO:0030667)|synaptic vesicle membrane (GO:0030672)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	23		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		GTCCAGACAGGTTCTCTGAAT	0.303																																					p.T69N		.											ICA1,rectum,carcinoma,0,1	ICA1	0	0			c.C206A						.						89.0	84.0	86.0					7																	8268281		2202	4297	6499	SO:0001583	missense	3382	exon4			AGACAGGTTCTCT		CCDS34602.1, CCDS64595.1	7p22	2006-12-13	2002-08-29		ENSG00000003147	ENSG00000003147			5343	protein-coding gene	gene with protein product		147625	"""islet cell autoantigen 1 (69kD)"""			7918678, 8777998	Standard	NM_001276478		Approved	ICAp69	uc003srm.3	Q05084	OTTHUMG00000152008	ENST00000402384.3:c.206C>A	7.37:g.8268281G>T	ENSP00000385570:p.Thr69Asn	10	0		23	2	NM_022307	A8K7U1|B3FTQ2|P78506|Q13824|Q96HG3	Missense_Mutation	SNP	ENST00000402384.3	37	CCDS34602.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.049382	0.93740	.	.	ENSG00000003147	ENST00000402384;ENST00000406470;ENST00000265577;ENST00000396675;ENST00000401396;ENST00000422063;ENST00000407906;ENST00000317367;ENST00000447326;ENST00000430867;ENST00000446305	T;T;T;T;T;T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17	5.96	5.96	0.96718	Arfaptin-like (3);	0.000000	0.85682	D	0.000000	D	0.88782	0.6530	M	0.76170	2.325	0.80722	D	1	P;D;D;D;D	0.89917	0.933;1.0;0.999;0.999;1.0	P;D;D;D;D	0.87578	0.718;0.99;0.976;0.976;0.998	D	0.88592	0.3144	10	0.72032	D	0.01	-16.0965	20.422	0.99049	0.0:0.0:1.0:0.0	.	69;69;68;69;57	B3FTQ2;E7ENI6;Q96HG3;Q05084;E9PDL4	.;.;.;ICA69_HUMAN;.	N	69;69;68;69;57;69;69;57;69;68;68	ENSP00000385570:T69N;ENSP00000385651:T69N;ENSP00000265577:T68N;ENSP00000379908:T69N;ENSP00000385305:T57N;ENSP00000403982:T69N;ENSP00000386021:T69N;ENSP00000316074:T57N;ENSP00000398435:T69N;ENSP00000397496:T68N;ENSP00000406722:T68N	ENSP00000265577:T68N	T	-	2	0	ICA1	8234806	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.965000	0.93393	2.832000	0.97577	0.655000	0.94253	ACC	.		0.303	ICA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324793.1	NM_004968	
UPP1	7378	hgsc.bcm.edu;bcgsc.ca	37	7	48139352	48139352	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr7:48139352C>A	ENST00000331803.4	+	5	753	c.130C>A	c.(130-132)Cac>Aac	p.H44N	UPP1_ENST00000341253.4_Missense_Mutation_p.H44N|UPP1_ENST00000482015.1_Intron|UPP1_ENST00000395564.4_Missense_Mutation_p.H44N|UPP1_ENST00000429491.2_Intron			Q16831	UPP1_HUMAN	uridine phosphorylase 1	44					cellular response to glucose starvation (GO:0042149)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)	uridine phosphorylase activity (GO:0004850)			breast(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	18					Fluorouracil(DB00544)	CACTAGCAGACACAATTTCCC	0.393																																					p.H44N		.											.	.	.	0			c.C130A						.						146.0	147.0	147.0					7																	48139352		2203	4300	6503	SO:0001583	missense	7378	exon4			AGCAGACACAATT	AK096167	CCDS5507.1	7p12.3	2012-10-02	2003-08-28	2003-08-29	ENSG00000183696	ENSG00000183696	2.4.2.3		12576	protein-coding gene	gene with protein product		191730	"""uridine phosphorylase"""	UP		752472, 11807789	Standard	NM_003364		Approved	UPASE, UPP, UDRPASE	uc003toj.3	Q16831	OTTHUMG00000129253	ENST00000331803.4:c.130C>A	7.37:g.48139352C>A	ENSP00000330032:p.His44Asn	62	0		60	4	NM_003364	D3DVM4|Q15362	Missense_Mutation	SNP	ENST00000331803.4	37	CCDS5507.1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.658624	0.67586	.	.	ENSG00000183696	ENST00000416681;ENST00000331803;ENST00000341253;ENST00000395564;ENST00000436673	T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.64382	0.2593	M	0.72479	2.2	0.80722	D	1	D;B	0.89917	1.0;0.444	D;B	0.87578	0.998;0.253	T	0.59053	-0.7526	10	0.27785	T	0.31	-34.8995	18.5485	0.91055	0.0:1.0:0.0:0.0	.	44;44	B4DND0;Q16831	.;UPP1_HUMAN	N	44	ENSP00000405209:H44N;ENSP00000330032:H44N;ENSP00000342878:H44N;ENSP00000378931:H44N;ENSP00000390118:H44N	ENSP00000330032:H44N	H	+	1	0	UPP1	48105877	1.000000	0.71417	0.104000	0.21259	0.902000	0.53008	5.627000	0.67784	2.611000	0.88343	0.563000	0.77884	CAC	.		0.393	UPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251360.1	NM_003364	
PEX1	5189	hgsc.bcm.edu	37	7	92122368	92122368	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr7:92122368C>A	ENST00000248633.4	-	20	3201	c.3106G>T	c.(3106-3108)Gca>Tca	p.A1036S	PEX1_ENST00000428214.1_Missense_Mutation_p.A979S|AC007566.10_ENST00000427458.1_RNA|AC007566.10_ENST00000441539.1_RNA|PEX1_ENST00000438045.1_Missense_Mutation_p.A714S	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	1036					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			GTTACTGATGCTACATGCTGA	0.423																																					p.A1036S		.											.	.	.	0			c.G3106T						.						128.0	123.0	125.0					7																	92122368		2203	4300	6503	SO:0001583	missense	5189	exon20			CTGATGCTACATG	AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.3106G>T	7.37:g.92122368C>A	ENSP00000248633:p.Ala1036Ser	57	0		57	4	NM_000466	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Missense_Mutation	SNP	ENST00000248633.4	37	CCDS5627.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.232167	0.79688	.	.	ENSG00000127980	ENST00000438045;ENST00000248633;ENST00000428214	D;D;D	0.96200	-3.94;-3.94;-3.94	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.97002	0.9021	M	0.64676	1.99	0.80722	D	1	D;D;P	0.63880	0.977;0.993;0.874	P;P;P	0.61070	0.883;0.869;0.621	D	0.97024	0.9745	10	0.66056	D	0.02	-17.5887	20.0011	0.97409	0.0:1.0:0.0:0.0	.	714;828;1036	E9PE75;B4DER6;O43933	.;.;PEX1_HUMAN	S	714;1036;979	ENSP00000410438:A714S;ENSP00000248633:A1036S;ENSP00000394413:A979S	ENSP00000248633:A1036S	A	-	1	0	PEX1	91960304	1.000000	0.71417	0.996000	0.52242	0.080000	0.17528	7.606000	0.82863	2.727000	0.93392	0.585000	0.79938	GCA	.		0.423	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254066.3	NM_000466	
TEK	7010	hgsc.bcm.edu	37	9	27202967	27202967	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr9:27202967G>T	ENST00000380036.4	+	13	2501	c.2059G>T	c.(2059-2061)Gtg>Ttg	p.V687L	TEK_ENST00000406359.4_Missense_Mutation_p.V644L|TEK_ENST00000519097.1_Missense_Mutation_p.V540L	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	687	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	GCACGTTGATGTGAAGATAAA	0.428																																					p.V687L		.											TEK_ENST00000380036,colon,carcinoma,0,2	TEK_ENST00000380036	0	0			c.G2059T						.						172.0	146.0	155.0					9																	27202967		2203	4300	6503	SO:0001583	missense	7010	exon13			GTTGATGTGAAGA	L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.2059G>T	9.37:g.27202967G>T	ENSP00000369375:p.Val687Leu	24	0		45	3	NM_000459	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	37	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	G	14.20	2.463262	0.43736	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000406359	T;T;T	0.17054	2.3;2.3;2.3	5.48	5.48	0.80851	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.161017	0.29767	N	0.011257	T	0.09113	0.0225	N	0.12182	0.205	0.32321	N	0.562375	P;B;P;P	0.42409	0.552;0.09;0.779;0.76	B;B;B;B	0.38985	0.187;0.158;0.287;0.253	T	0.09930	-1.0652	10	0.20046	T	0.44	.	9.9685	0.41738	0.156:0.0:0.844:0.0	.	540;720;644;687	E7EWI2;Q59HG2;B4DHD3;Q02763	.;.;.;TIE2_HUMAN	L	540;687;644	ENSP00000430686:V540L;ENSP00000369375:V687L;ENSP00000383977:V644L	ENSP00000369375:V687L	V	+	1	0	TEK	27192967	0.998000	0.40836	1.000000	0.80357	0.984000	0.73092	2.387000	0.44389	2.732000	0.93576	0.637000	0.83480	GTG	.		0.428	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3		
MRPL22	29093	hgsc.bcm.edu	37	5	154336753	154336753	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr5:154336753G>T	ENST00000523037.1	+	5	361	c.320G>T	c.(319-321)gGg>gTg	p.G107V	MRPL22_ENST00000522038.1_Missense_Mutation_p.G113V|MRPL22_ENST00000439747.3_Missense_Mutation_p.G133V|MRPL22_ENST00000265229.8_Missense_Mutation_p.G27V	NM_014180.3	NP_054899.2	Q9NWU5	RM22_HUMAN	mitochondrial ribosomal protein L22	107					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GACAAAAAAGGGGCCAAAATA	0.383																																					p.G107V		.											.	.	.	0			c.G320T						.						97.0	107.0	103.0					5																	154336753		2203	4300	6503	SO:0001583	missense	29093	exon5			AAAAAGGGGCCAA	AB051622	CCDS4331.1, CCDS43391.1	5q33.2	2012-09-13			ENSG00000082515	ENSG00000082515		"""Mitochondrial ribosomal proteins / large subunits"""	14480	protein-coding gene	gene with protein product		611835					Standard	NM_014180		Approved	MRP-L25, RPML25, HSPC158	uc003lvy.4	Q9NWU5	OTTHUMG00000130190	ENST00000523037.1:c.320G>T	5.37:g.154336753G>T	ENSP00000431040:p.Gly107Val	68	0		99	4	NM_014180	A6NGJ8|Q5H9Q1|Q96Q51|Q9P006	Missense_Mutation	SNP	ENST00000523037.1	37	CCDS4331.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.912476	0.92178	.	.	ENSG00000082515	ENST00000523037;ENST00000265229;ENST00000439747;ENST00000522038	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.59101	0.2169	L	0.56340	1.77	0.80722	D	1	P	0.41080	0.737	P	0.57152	0.814	T	0.52990	-0.8501	10	0.39692	T	0.17	-12.9374	19.276	0.94031	0.0:0.0:1.0:0.0	.	107	Q9NWU5	RM22_HUMAN	V	107;27;133;113	ENSP00000431040:G107V;ENSP00000265229:G27V;ENSP00000411177:G133V;ENSP00000429039:G113V	ENSP00000265229:G27V	G	+	2	0	MRPL22	154316946	1.000000	0.71417	0.933000	0.37362	0.939000	0.58152	9.088000	0.94132	2.549000	0.85964	0.591000	0.81541	GGG	.		0.383	MRPL22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252508.2		
GPR125	166647	hgsc.bcm.edu	37	4	22390066	22390066	+	Silent	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr4:22390066G>T	ENST00000334304.5	-	19	3497	c.3228C>A	c.(3226-3228)ccC>ccA	p.P1076P	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	1076					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				TAGAGTTGGGGGGCTGGACGT	0.498																																					p.P1076P		.											GPR125,right_upper_lobe,carcinoma,0,1	GPR125	0	0			c.C3228A						.						66.0	55.0	59.0					4																	22390066		2203	4300	6503	SO:0001819	synonymous_variant	166647	exon19			GTTGGGGGGCTGG	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.3228C>A	4.37:g.22390066G>T		26	0		39	2	NM_145290	Q6UXK9|Q86SQ5|Q8TC55	Silent	SNP	ENST00000334304.5	37	CCDS33964.1																																																																																			.		0.498	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3		
CPED1	79974	hgsc.bcm.edu;bcgsc.ca	37	7	120773877	120773877	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr7:120773877G>T	ENST00000310396.5	+	13	2045	c.1578G>T	c.(1576-1578)tgG>tgT	p.W526C	CPED1_ENST00000423795.1_Splice_Site_p.W306C|CPED1_ENST00000450913.2_Splice_Site_p.W526C	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	526						endoplasmic reticulum (GO:0005783)											GCATTTGCAGGAATTCTTTCA	0.323																																					p.W526C		.											.	.	.	0			c.G1578T						.						94.0	98.0	96.0					7																	120773877		2203	4300	6503	SO:0001630	splice_region_variant	79974	exon12			TTGCAGGAATTCT		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.1578-1G>T	7.37:g.120773877G>T		39	0		58	4	NM_001105533	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	ENST00000310396.5	37	CCDS34739.1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.571198	0.45798	.	.	ENSG00000106034	ENST00000310396;ENST00000428526;ENST00000450913;ENST00000423795;ENST00000443817	T;T;T;T;T	0.56444	2.07;0.46;1.74;1.74;1.15	5.44	5.44	0.79542	.	0.606923	0.17951	N	0.156485	T	0.70527	0.3234	M	0.71581	2.175	0.80722	D	1	B;D;B	0.89917	0.026;1.0;0.01	B;D;B	0.66351	0.025;0.943;0.013	T	0.69038	-0.5251	9	.	.	.	.	16.4088	0.83699	0.0:0.0:1.0:0.0	.	306;526;526	G5E9U2;A4D0V7-2;A4D0V7	.;.;CG058_HUMAN	C	526;526;526;306;306	ENSP00000309772:W526C;ENSP00000398082:W526C;ENSP00000406122:W526C;ENSP00000415573:W306C;ENSP00000391952:W306C	.	W	+	3	0	C7orf58	120561113	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.246000	0.65411	2.718000	0.92993	0.650000	0.86243	TGG	.		0.323	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913	Missense_Mutation
RBBP6	5930	hgsc.bcm.edu	37	16	24582226	24582226	+	Missense_Mutation	SNP	G	G	T	rs561499621		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr16:24582226G>T	ENST00000319715.4	+	18	4271	c.3839G>T	c.(3838-3840)cGg>cTg	p.R1280L	RBBP6_ENST00000381039.3_Missense_Mutation_p.R440L|RBBP6_ENST00000348022.2_Missense_Mutation_p.R1246L	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1280					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		AGTCCTGTGCGGAAATCTGAA	0.303																																					p.R1280L		.											.	.	.	0			c.G3839T						.						35.0	35.0	35.0					16																	24582226		2197	4300	6497	SO:0001583	missense	5930	exon18			CTGTGCGGAAATC		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.3839G>T	16.37:g.24582226G>T	ENSP00000317872:p.Arg1280Leu	77	0		92	4	NM_006910	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	ENST00000319715.4	37	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954029	0.53293	.	.	ENSG00000122257	ENST00000381039;ENST00000319715;ENST00000348022	T;T;T	0.24538	1.85;2.18;2.13	5.6	4.64	0.57946	.	0.233058	0.33235	N	0.005126	T	0.24084	0.0583	L	0.32530	0.975	0.35609	D	0.808485	P;B;B	0.39480	0.675;0.447;0.319	B;B;B	0.42882	0.401;0.312;0.165	T	0.30475	-0.9977	10	0.48119	T	0.1	-8.9894	11.8653	0.52490	0.1409:0.0:0.8591:0.0	.	440;1246;1280	Q7Z6E9-4;Q7Z6E9-2;Q7Z6E9	.;.;RBBP6_HUMAN	L	440;1280;1246	ENSP00000370427:R440L;ENSP00000317872:R1280L;ENSP00000316291:R1246L	ENSP00000317872:R1280L	R	+	2	0	RBBP6	24489727	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	4.627000	0.61276	1.500000	0.48636	0.563000	0.77884	CGG	.		0.303	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
GRASP	160622	hgsc.bcm.edu	37	12	52407671	52407671	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr12:52407671C>A	ENST00000293662.4	+	6	639	c.559C>A	c.(559-561)Cta>Ata	p.L187I	GRASP_ENST00000552049.1_Missense_Mutation_p.L44I|GRASP_ENST00000380039.2_Missense_Mutation_p.L44I|GRASP_ENST00000552963.1_3'UTR	NM_181711.2	NP_859062.1	Q7Z6J2	GRASP_HUMAN	GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein	187	Interaction with PSCD3. {ECO:0000250}.|PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein localization (GO:0008104)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				central_nervous_system(1)|large_intestine(1)|lung(1)|skin(2)	5				BRCA - Breast invasive adenocarcinoma(357;0.0967)		ACTGGAAACTCTATATGGGAC	0.542																																					p.L187I		.											GRASP,lower_third,carcinoma,0,1	GRASP	0	0			c.C559A						.						182.0	188.0	186.0					12																	52407671		2203	4300	6503	SO:0001583	missense	160622	exon6			GAAACTCTATATG	AC019244	CCDS8817.1, CCDS61124.1	12q13.13	2011-09-02			ENSG00000161835	ENSG00000161835			18707	protein-coding gene	gene with protein product		612027				10828067	Standard	NM_001271856		Approved		uc001rzo.2	Q7Z6J2	OTTHUMG00000169595	ENST00000293662.4:c.559C>A	12.37:g.52407671C>A	ENSP00000293662:p.Leu187Ile	20	0		27	2	NM_181711	Q6PIF8|Q7Z741	Missense_Mutation	SNP	ENST00000293662.4	37	CCDS8817.1	.	.	.	.	.	.	.	.	.	.	C	10.90	1.482641	0.26598	.	.	ENSG00000161835	ENST00000293662;ENST00000552049;ENST00000546756;ENST00000380039	T;T;T;T	0.41400	2.24;1.0;1.0;1.0	5.1	2.15	0.27550	PDZ/DHR/GLGF (3);	0.068686	0.56097	D	0.000027	T	0.21509	0.0518	N	0.20483	0.58	0.32597	N	0.526474	P;B	0.37207	0.587;0.309	B;B	0.33620	0.146;0.167	T	0.20840	-1.0263	10	0.48119	T	0.1	-8.391	4.2701	0.10782	0.0:0.5289:0.1837:0.2875	.	44;187	Q7Z6J2-2;Q7Z6J2	.;GRASP_HUMAN	I	187;44;57;44	ENSP00000293662:L187I;ENSP00000449492:L44I;ENSP00000448476:L57I;ENSP00000369378:L44I	ENSP00000293662:L187I	L	+	1	2	GRASP	50693938	0.975000	0.34042	0.944000	0.38274	0.083000	0.17756	1.852000	0.39348	0.734000	0.32515	0.467000	0.42956	CTA	.		0.542	GRASP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404972.1		
FBXO2	26232	hgsc.bcm.edu	37	1	11710798	11710798	+	Missense_Mutation	SNP	T	T	G			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr1:11710798T>G	ENST00000354287.4	-	2	457	c.116A>C	c.(115-117)gAg>gCg	p.E39A	FBXO2_ENST00000475961.1_5'UTR	NM_012168.5	NP_036300.2	Q9UK22	FBX2_HUMAN	F-box protein 2	39					cellular protein modification process (GO:0006464)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of protein ubiquitination (GO:0031396)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|SCF ubiquitin ligase complex (GO:0019005)	beta-amyloid binding (GO:0001540)|carbohydrate binding (GO:0030246)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|large_intestine(1)|lung(4)	6	Ovarian(185;0.249)	Lung NSC(185;9.37e-06)|all_lung(284;1.39e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|BRCA - Breast invasive adenocarcinoma(304;1.88e-06)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|Lung(427;0.0146)|LUSC - Lung squamous cell carcinoma(448;0.0228)|READ - Rectum adenocarcinoma(331;0.0649)		GGccgccgcctcctcctcctg	0.761																																					p.E39A		.											FBXO2,NS,carcinoma,0,1	FBXO2	0	0			c.A116C						.						2.0	2.0	2.0					1																	11710798		1686	3300	4986	SO:0001583	missense	26232	exon2			GCCGCCTCCTCCT	AF174594	CCDS130.1	1p36.21	2010-04-21	2004-06-15		ENSG00000116661	ENSG00000116661		"""F-boxes /  ""other"""""	13581	protein-coding gene	gene with protein product		607112	"""F-box only protein 2"", ""organ of Corti protein 1"""	OCP1		10531035, 10531037	Standard	NM_012168		Approved	FBX2, Nfb42, Fbs1, Fbg1	uc001asj.3	Q9UK22	OTTHUMG00000002072	ENST00000354287.4:c.116A>C	1.37:g.11710798T>G	ENSP00000346240:p.Glu39Ala	8	1		8	3	NM_012168	B2R7K7|Q5TGY0|Q6FGJ7|Q8TB29|Q9UKC6	Missense_Mutation	SNP	ENST00000354287.4	37	CCDS130.1	.	.	.	.	.	.	.	.	.	.	T	7.272	0.607315	0.14002	.	.	ENSG00000116661	ENST00000354287;ENST00000452872	T	0.25579	1.79	4.36	-8.72	0.00845	F-box domain, Skp2-like (1);	0.961229	0.08522	N	0.933284	T	0.08670	0.0215	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35450	-0.9788	10	0.14252	T	0.57	-18.8732	7.4313	0.27128	0.1044:0.0755:0.6098:0.2103	.	39;39	A6NNP0;Q9UK22	.;FBX2_HUMAN	A	39	ENSP00000346240:E39A	ENSP00000346240:E39A	E	-	2	0	FBXO2	11633385	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	-0.403000	0.07214	-1.473000	0.01881	0.454000	0.30748	GAG	.		0.761	FBXO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005764.1	NM_012168	
SEMA6D	80031	hgsc.bcm.edu;bcgsc.ca	37	15	48052508	48052508	+	Silent	SNP	G	G	A	rs140647776		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr15:48052508G>A	ENST00000316364.5	+	3	556	c.117G>A	c.(115-117)agG>agA	p.R39R	SEMA6D_ENST00000558816.1_Silent_p.R39R|SEMA6D_ENST00000354744.4_Silent_p.R39R|SEMA6D_ENST00000389433.2_Silent_p.R39R|SEMA6D_ENST00000389428.3_Silent_p.R39R|SEMA6D_ENST00000537942.1_Silent_p.R39R|SEMA6D_ENST00000389425.3_Silent_p.R39R|SEMA6D_ENST00000358066.4_Silent_p.R39R|SEMA6D_ENST00000355997.3_Silent_p.R39R|SEMA6D_ENST00000536845.2_Silent_p.R39R|SEMA6D_ENST00000558014.1_Silent_p.R39R|SEMA6D_ENST00000389432.2_Silent_p.R39R	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	39	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		CAGATTCAAGGCAATATCCGG	0.408																																					p.R39R		.											.	.	.	0			c.G117A						.	G	,,,,,,	3,4393	6.2+/-15.9	0,3,2195	98.0	87.0	91.0		117,117,117,117,117,117,117	4.8	1.0	15	dbSNP_134	91	0,8594		0,0,4297	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SEMA6D	NM_001198999.1,NM_020858.1,NM_024966.2,NM_153616.1,NM_153617.1,NM_153618.1,NM_153619.1	,,,,,,	0,3,6492	AA,AG,GG		0.0,0.0682,0.0231	,,,,,,	39/1012,39/1012,39/477,39/999,39/1018,39/1074,39/598	48052508	3,12987	2198	4297	6495	SO:0001819	synonymous_variant	80031	exon3			TTCAAGGCAATAT	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.117G>A	15.37:g.48052508G>A		36	0		46	4	NM_153617	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Silent	SNP	ENST00000316364.5	37	CCDS32225.1																																																																																			0.000		0.408	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
ACKR1	2532	hgsc.bcm.edu	37	1	159175339	159175339	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr1:159175339C>T	ENST00000368122.2	+	2	789	c.110C>T	c.(109-111)cCa>cTa	p.P37L	CTA-134P22.2_ENST00000609696.1_RNA|DARC_ENST00000368121.2_Missense_Mutation_p.P39L|DARC_ENST00000537147.1_Missense_Mutation_p.P37L	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		37					chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.P39Q(1)		large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					GATTCCTTCCCAGATGGAGAC	0.532																																					p.P39L		.											DARC_ENST00000368121,NS,neuroblastoma,0,1	DARC_ENST00000368121	0	1	Substitution - Missense(1)	autonomic_ganglia(1)	c.C116T						.						94.0	89.0	91.0					1																	159175339		2203	4300	6503	SO:0001583	missense	2532	exon1			CCTTCCCAGATGG																												ENST00000368122.2:c.110C>T	1.37:g.159175339C>T	ENSP00000357104:p.Pro37Leu	18	0		27	2	NM_001122951	A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Missense_Mutation	SNP	ENST00000368122.2	37	CCDS1183.1	.	.	.	.	.	.	.	.	.	.	C	13.16	2.152749	0.38021	.	.	ENSG00000213088	ENST00000368122;ENST00000537147;ENST00000359381;ENST00000435307;ENST00000368121	T;T;T;T	0.22134	4.43;4.43;1.97;4.42	3.88	-0.0076	0.14008	.	.	.	.	.	T	0.04318	0.0119	N	0.24115	0.695	0.09310	N	1	P;P	0.43352	0.804;0.804	B;B	0.40375	0.327;0.327	T	0.32798	-0.9893	9	0.31617	T	0.26	-10.7496	6.0717	0.19893	0.3255:0.555:0.1195:0.0	.	39;37	Q5Y7A1;Q16570	.;DUFFY_HUMAN	L	37;37;37;39;39	ENSP00000357104:P37L;ENSP00000441985:P37L;ENSP00000398406:P39L;ENSP00000357103:P39L	ENSP00000352341:P37L	P	+	2	0	DARC	157441963	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.590000	0.05760	-0.060000	0.13132	-0.521000	0.04368	CCA	.		0.532	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090338.2		
FAM86DP	692099	hgsc.bcm.edu	37	3	75476061	75476061	+	RNA	SNP	C	C	A			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr3:75476061C>A	ENST00000459803.1	-	0	779					NR_024241.1				family with sequence similarity 86, member D, pseudogene																		CTGCCGTGAACTTCGTGTTTC	0.547																																					.		.											.	.	.	0			.						.																																					692099	.			CGTGAACTTCGTG	BC016686		3p12.3	2010-06-04	2010-06-04	2010-06-04	ENSG00000244026	ENSG00000244026			32659	pseudogene	pseudogene			"""family with sequence similarity 86, member D"""	FAM86D			Standard	NR_024241		Approved		uc003dpp.4		OTTHUMG00000158855		3.37:g.75476061C>A		16	0		19	4	.		RNA	SNP	ENST00000459803.1	37																																																																																				.		0.547	FAM86DP-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000352425.1	NR_024241	
ZNF263	10127	hgsc.bcm.edu	37	16	3339426	3339426	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr16:3339426C>A	ENST00000219069.5	+	6	1796	c.920C>A	c.(919-921)cCg>cAg	p.P307Q	ZNF263_ENST00000538765.1_5'UTR|ZNF263_ENST00000574253.1_Missense_Mutation_p.R141S	NM_005741.4	NP_005732.2	O14978	ZN263_HUMAN	zinc finger protein 263	307					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(4)|urinary_tract(3)	20						GAAGGTGTTCCGTCTGTATGC	0.522																																					p.P307Q		.											ZNF263,NS,carcinoma,0,1	ZNF263	0	0			c.C920A						.						86.0	97.0	93.0					16																	3339426		2197	4300	6497	SO:0001583	missense	10127	exon6			GTGTTCCGTCTGT	AC004232	CCDS10499.1	16p13.3	2013-01-09			ENSG00000006194	ENSG00000006194		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13056	protein-coding gene	gene with protein product		604191				9256059	Standard	NM_005741		Approved	FPM315, ZKSCAN12, ZSCAN44	uc002cuq.3	O14978	OTTHUMG00000129323	ENST00000219069.5:c.920C>A	16.37:g.3339426C>A	ENSP00000219069:p.Pro307Gln	35	0		36	2	NM_005741	B2R634|O43387|Q96H95	Missense_Mutation	SNP	ENST00000219069.5	37	CCDS10499.1	.	.	.	.	.	.	.	.	.	.	C	1.274	-0.612359	0.03690	.	.	ENSG00000006194	ENST00000219069	T	0.04706	3.57	5.17	-3.13	0.05266	.	0.640213	0.13951	N	0.351521	T	0.01870	0.0059	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47315	-0.9127	10	0.13470	T	0.59	.	5.1367	0.14937	0.2551:0.5424:0.0792:0.1233	.	307	O14978	ZN263_HUMAN	Q	307	ENSP00000219069:P307Q	ENSP00000219069:P307Q	P	+	2	0	ZNF263	3279427	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	-0.506000	0.06359	-0.331000	0.08501	-0.976000	0.02587	CCG	.		0.522	ZNF263-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251463.2		
SPTA1	6708	hgsc.bcm.edu	37	1	158618388	158618388	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr1:158618388C>T	ENST00000368147.4	-	26	3805	c.3625G>A	c.(3625-3627)Gca>Aca	p.A1209T		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1209					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CCAGGGTCTGCAGCACTGAGG	0.502																																					p.A1209T		.											.	.	.	0			c.G3625A						.						122.0	120.0	121.0					1																	158618388		1961	4160	6121	SO:0001583	missense	6708	exon26			GGTCTGCAGCACT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3625G>A	1.37:g.158618388C>T	ENSP00000357129:p.Ala1209Thr	23	0		34	4	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	35	5.469654	0.96274	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.49720	0.77;0.77	5.5	5.5	0.81552	.	0.000000	0.32120	N	0.006555	T	0.41789	0.1174	L	0.58428	1.81	0.50313	D	0.999868	B	0.33299	0.407	B	0.42959	0.403	T	0.20571	-1.0271	10	0.20046	T	0.44	.	18.1469	0.89661	0.0:1.0:0.0:0.0	.	1209	P02549	SPTA1_HUMAN	T	1209	ENSP00000357130:A1209T;ENSP00000357129:A1209T	ENSP00000357129:A1209T	A	-	1	0	SPTA1	156885012	1.000000	0.71417	0.937000	0.37676	0.985000	0.73830	5.429000	0.66495	2.861000	0.98227	0.655000	0.94253	GCA	.		0.502	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
KCNH8	131096	hgsc.bcm.edu	37	3	19436644	19436644	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr3:19436644C>T	ENST00000328405.2	+	7	1284	c.1018C>T	c.(1018-1020)Cgt>Tgt	p.R340C	KCNH8_ENST00000537696.1_5'UTR|KCNH8_ENST00000475063.1_3'UTR	NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	340					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.R340C(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						GCGTCTTTTGCGTCTGCTGCA	0.488																																					p.R340C	NSCLC(124;1625 1765 8018 24930 42026)	.											KCNH8,NS,carcinoma,-1,2	KCNH8	-1	1	Substitution - Missense(1)	lung(1)	c.C1018T						.						196.0	162.0	174.0					3																	19436644		2203	4300	6503	SO:0001583	missense	131096	exon7			CTTTTGCGTCTGC	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.1018C>T	3.37:g.19436644C>T	ENSP00000328813:p.Arg340Cys	31	1		47	2	NM_144633	B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	37	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.672024	0.88348	.	.	ENSG00000183960	ENST00000328405	D	0.99523	-6.08	5.78	5.78	0.91487	Ion transport (1);	0.000000	0.32416	U	0.006131	D	0.99722	0.9892	H	0.95679	3.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.97601	1.0123	9	.	.	.	.	20.0118	0.97458	0.0:1.0:0.0:0.0	.	340;340	B7Z398;Q96L42	.;KCNH8_HUMAN	C	340	ENSP00000328813:R340C	.	R	+	1	0	KCNH8	19411648	1.000000	0.71417	0.999000	0.59377	0.789000	0.44602	4.787000	0.62432	2.742000	0.94016	0.650000	0.86243	CGT	.		0.488	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	
SON	6651	hgsc.bcm.edu	37	21	34948697	34948697	+	Silent	SNP	A	A	G	rs199930883|rs34373121		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr21:34948697A>G	ENST00000356577.4	+	12	7723	c.7248A>G	c.(7246-7248)agA>agG	p.R2416R	SON_ENST00000381692.2_Silent_p.R444R|SON_ENST00000470533.1_Intron|AP000304.1_ENST00000595468.1_5'Flank|DONSON_ENST00000303113.6_Intron|SON_ENST00000290239.6_3'UTR	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	2416	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.			ALTR -> SPYQ (in Ref. 2; AAK07692). {ECO:0000305}.	cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CCCTTACCAGACCCAATTGTA	0.363																																					p.R2416R		.											.,4	.	343	0			c.A7248G						.						9.0	10.0	10.0					21																	34948697		1712	3586	5298	SO:0001819	synonymous_variant	6651	exon12			TACCAGACCCAAT	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.7248A>G	21.37:g.34948697A>G		40	1		74	4	NM_138927	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Silent	SNP	ENST00000356577.4	37	CCDS13629.1																																																																																			.		0.363	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
SCYL1	57410	hgsc.bcm.edu	37	11	65303776	65303776	+	Missense_Mutation	SNP	C	C	T	rs377549319		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr11:65303776C>T	ENST00000270176.5	+	12	1699	c.1622C>T	c.(1621-1623)tCg>tTg	p.S541L	SCYL1_ENST00000524944.1_Missense_Mutation_p.S541L|SCYL1_ENST00000527009.1_Missense_Mutation_p.S398L|SCYL1_ENST00000279270.6_Missense_Mutation_p.S541L|SCYL1_ENST00000420247.2_Missense_Mutation_p.S541L|SCYL1_ENST00000525364.1_Missense_Mutation_p.S541L|SCYL1_ENST00000533862.1_Missense_Mutation_p.S541L	NM_020680.3	NP_065731.3	Q96KG9	NTKL_HUMAN	SCY1-like 1 (S. cerevisiae)	541					peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|protein tyrosine kinase activity (GO:0004713)	p.S541L(1)		ovary(1)|skin(1)	2						GAGTCTGTGTCGGAGGACCCG	0.582																																					p.S541L		.											SCYL1_ENST00000270176,caecum,carcinoma,0,1	SCYL1_ENST00000270176	0	1	Substitution - Missense(1)	large_intestine(1)	c.C1622T						.	C	LEU/SER,LEU/SER	1,4057		0,1,2028	66.0	73.0	71.0		1622,1622	5.5	1.0	11		71	1,8327		0,1,4163	no	missense,missense	SCYL1	NM_001048218.1,NM_020680.3	145,145	0,2,6191	TT,TC,CC		0.012,0.0246,0.0161	probably-damaging,probably-damaging	541/792,541/809	65303776	2,12384	2029	4164	6193	SO:0001583	missense	57410	exon12			CTGTGTCGGAGGA	AF225424	CCDS41672.1, CCDS44646.1	11q11-q12	2008-07-21	2002-11-26	2002-11-29	ENSG00000142186	ENSG00000142186			14372	protein-coding gene	gene with protein product	"""teratoma-associated tyrosine kinase"", ""telomerase transcriptional elements-interacting factor"", ""telomerase regulation-associated protein"""	607982	"""N-terminal kinase-like"""	NTKL		11118629	Standard	NM_020680		Approved	HT019, P105, GKLP, NKTL, TAPK, TRAP, TEIF, MGC78454	uc001oea.1	Q96KG9	OTTHUMG00000166325	ENST00000270176.5:c.1622C>T	11.37:g.65303776C>T	ENSP00000270176:p.Ser541Leu	17	0		17	2	NM_020680	A6NJF1|Q96G50|Q96KG8|Q96KH1|Q9HAW5|Q9HBL3|Q9NR53	Missense_Mutation	SNP	ENST00000270176.5	37	CCDS41672.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.993808	0.93167	2.46E-4	1.2E-4	ENSG00000142186	ENST00000270176;ENST00000525364;ENST00000420247;ENST00000533862;ENST00000527630;ENST00000349495;ENST00000279270;ENST00000524944;ENST00000527009;ENST00000528545	T;T;T;T;T;T;T;T;T	0.61859	1.48;1.48;1.48;1.48;1.48;1.48;1.48;1.48;0.07	5.46	5.46	0.80206	Armadillo-type fold (1);	0.319538	0.30093	N	0.010422	T	0.78464	0.4287	M	0.82823	2.61	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.83275	0.97;0.996;0.987;0.992;0.991	T	0.81274	-0.1007	10	0.72032	D	0.01	-4.2363	16.7806	0.85562	0.0:1.0:0.0:0.0	.	541;541;541;541;541	E9PS17;Q96KG9-4;Q96KG9-6;Q96KG9-2;Q96KG9	.;.;.;.;NTKL_HUMAN	L	541;541;541;541;541;541;541;541;398;14	ENSP00000270176:S541L;ENSP00000431635:S541L;ENSP00000408192:S541L;ENSP00000437254:S541L;ENSP00000433450:S541L;ENSP00000279270:S541L;ENSP00000432175:S541L;ENSP00000436993:S398L;ENSP00000433604:S14L	ENSP00000270176:S541L	S	+	2	0	SCYL1	65060352	0.998000	0.40836	0.998000	0.56505	0.887000	0.51463	3.943000	0.56621	2.577000	0.86979	0.462000	0.41574	TCG	.		0.582	SCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389159.2	NM_020680	
MUC7	4589	hgsc.bcm.edu	37	4	71346978	71346978	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr4:71346978T>C	ENST00000304887.5	+	3	707	c.517T>C	c.(517-519)Tct>Cct	p.S173P	MUC7_ENST00000413702.1_Missense_Mutation_p.S173P|MUC7_ENST00000456088.1_Missense_Mutation_p.S173P|MUC7_ENST00000514512.1_3'UTR	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	173	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.S173P(3)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			ACCCACACCTTCTGCAACTAC	0.522																																					p.S173P		.											MUC7,NS,carcinoma,0,5	MUC7	0	3	Substitution - Missense(3)	lung(2)|kidney(1)	c.T517C						.						341.0	284.0	303.0					4																	71346978		2203	4300	6503	SO:0001583	missense	4589	exon4			ACACCTTCTGCAA	BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.517T>C	4.37:g.71346978T>C	ENSP00000302021:p.Ser173Pro	49	0		47	2	NM_001145007	Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	T	8.294	0.818323	0.16607	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.52754	0.65;0.65;0.65	2.59	-1.83	0.07833	.	.	.	.	.	T	0.22360	0.0539	N	0.12182	0.205	0.09310	N	1	B	0.14805	0.011	B	0.10450	0.005	T	0.19451	-1.0305	8	.	.	.	-1.8981	3.858	0.08984	0.0:0.2646:0.3931:0.3423	.	173	Q8TAX7	MUC7_HUMAN	P	173	ENSP00000407422:S173P;ENSP00000400585:S173P;ENSP00000302021:S173P	.	S	+	1	0	MUC7	71381567	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.097000	0.01348	-0.350000	0.08262	-0.605000	0.04089	TCT	.		0.522	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291	
JAG2	3714	hgsc.bcm.edu	37	14	105609199	105609199	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr14:105609199C>T	ENST00000331782.3	-	26	3953	c.3550G>A	c.(3550-3552)Ggc>Agc	p.G1184S	JAG2_ENST00000347004.2_Missense_Mutation_p.G1146S	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	1184					auditory receptor cell fate commitment (GO:0009912)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|epithelial cell apoptotic process involved in palatal shelf morphogenesis (GO:1990134)|gamma-delta T cell differentiation (GO:0042492)|in utero embryonic development (GO:0001701)|morphogenesis of embryonic epithelium (GO:0016331)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|respiratory system process (GO:0003016)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|thymic T cell selection (GO:0045061)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)			breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		TCACCGCGGCCCAGATCCTCG	0.711																																					p.G1184S		.											.	.	.	0			c.G3550A						.						27.0	25.0	26.0					14																	105609199		2196	4299	6495	SO:0001583	missense	3714	exon26			CGCGGCCCAGATC	AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916			6189	protein-coding gene	gene with protein product		602570				9315665, 10662552	Standard	NM_002226		Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.3550G>A	14.37:g.105609199C>T	ENSP00000328169:p.Gly1184Ser	34	0		29	4	NM_002226	Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	Missense_Mutation	SNP	ENST00000331782.3	37	CCDS9998.1	.	.	.	.	.	.	.	.	.	.	C	2.771	-0.255720	0.05829	.	.	ENSG00000184916	ENST00000331782;ENST00000347004	D;D	0.85629	-2.01;-2.01	3.63	0.663	0.17885	.	1.381320	0.04636	N	0.404451	T	0.71367	0.3331	N	0.16478	0.41	0.09310	N	1	B;B	0.12630	0.001;0.006	B;B	0.15484	0.007;0.013	T	0.54906	-0.8223	10	0.10902	T	0.67	.	5.4126	0.16356	0.0:0.6012:0.0:0.3988	.	1146;1184	Q9Y219-2;Q9Y219	.;JAG2_HUMAN	S	1184;1146	ENSP00000328169:G1184S;ENSP00000328566:G1146S	ENSP00000328169:G1184S	G	-	1	0	JAG2	104680244	0.023000	0.18921	0.012000	0.15200	0.038000	0.13279	0.872000	0.28037	0.024000	0.15214	0.491000	0.48974	GGC	.		0.711	JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276506.2		
TBP	6908	hgsc.bcm.edu	37	6	170871016	170871016	+	Silent	SNP	G	G	A	rs542031948		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr6:170871016G>A	ENST00000392092.2	+	3	471	c.192G>A	c.(190-192)caG>caA	p.Q64Q	TBP_ENST00000230354.6_Silent_p.Q64Q|TBP_ENST00000540980.1_Silent_p.Q44Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	64	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		aacaacaacagcagcagcagc	0.557													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14897	0.0		0.0	False		,,,				2504	0.0				p.Q64Q		.											TBP,NS,carcinoma,0,2	TBP	0	0			c.G192A						.						31.0	35.0	33.0					6																	170871016		2202	4292	6494	SO:0001819	synonymous_variant	6908	exon3			ACAACAGCAGCAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.192G>A	6.37:g.170871016G>A		27	1		28	3	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			.		0.557	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
TRAF5	7188	hgsc.bcm.edu	37	1	211533365	211533365	+	Nonsense_Mutation	SNP	C	C	T	rs200980823		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr1:211533365C>T	ENST00000261464.5	+	5	544	c.490C>T	c.(490-492)Cga>Tga	p.R164*	TRAF5_ENST00000427925.2_Intron|TRAF5_ENST00000367004.3_Nonsense_Mutation_p.R164*|TRAF5_ENST00000336184.2_Nonsense_Mutation_p.R164*|TRAF5_ENST00000462410.1_3'UTR	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	164					apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		CTGTCAGTTTCGAAAGGAAAA	0.413																																					p.R164X		.											TRAF5,NS,carcinoma,0,2	TRAF5	0	0			c.C490T						.						133.0	124.0	127.0					1																	211533365		2203	4300	6503	SO:0001587	stop_gained	7188	exon5			CAGTTTCGAAAGG	AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.490C>T	1.37:g.211533365C>T	ENSP00000261464:p.Arg164*	43	0		44	2	NM_004619	B4DIS9|B4E0A2|Q6FHY1	Nonsense_Mutation	SNP	ENST00000261464.5	37	CCDS1497.1	.	.	.	.	.	.	.	.	.	.	C	34	5.397698	0.96009	.	.	ENSG00000082512	ENST00000336184;ENST00000261464;ENST00000367004	.	.	.	4.97	4.04	0.47022	.	0.214099	0.40818	N	0.001014	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.3055	12.3718	0.55260	0.3064:0.6935:0.0:0.0	.	.	.	.	X	164	.	ENSP00000261464:R164X	R	+	1	2	TRAF5	209599988	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	1.836000	0.39191	1.040000	0.40099	0.591000	0.81541	CGA	0.001		0.413	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089825.1	NM_004619	
SLC22A12	116085	hgsc.bcm.edu	37	11	64367324	64367324	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr11:64367324C>T	ENST00000377574.1	+	7	1994	c.1247C>T	c.(1246-1248)gCa>gTa	p.A416V	SLC22A12_ENST00000377572.1_Missense_Mutation_p.A308V|SLC22A12_ENST00000377567.2_Missense_Mutation_p.A308V|SLC22A12_ENST00000336464.7_Missense_Mutation_p.A382V|SLC22A12_ENST00000473690.1_Missense_Mutation_p.A195V	NM_144585.2	NP_653186.2	Q96S37	S22AC_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 12	416					cellular homeostasis (GO:0019725)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|urate transmembrane transporter activity (GO:0015143)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27					Losartan(DB00678)|Probenecid(DB01032)	CTGTTGCTGGCAGGGCTCTGC	0.657																																					p.A416V		.											SLC22A12,caecum,carcinoma,0,1	SLC22A12	0	0			c.C1247T						.						26.0	25.0	26.0					11																	64367324		2199	4294	6493	SO:0001583	missense	116085	exon7			TGCTGGCAGGGCT	AB071863	CCDS8075.1, CCDS60835.1, CCDS60836.1	11q13.1	2013-05-22	2008-01-11		ENSG00000197891	ENSG00000197891		"""Solute carriers"""	17989	protein-coding gene	gene with protein product		607096	"""solute carrier family 22 (organic anion/cation transporter), member 12"""			12024214	Standard	NM_144585		Approved	OAT4L, RST, URAT1	uc009yps.2	Q96S37	OTTHUMG00000045213	ENST00000377574.1:c.1247C>T	11.37:g.64367324C>T	ENSP00000366797:p.Ala416Val	14	0		12	2	NM_144585	B7WPG1|G3XAN7|Q19PF7|Q19PF8|Q19PF9|Q19PG0|Q6UXW3|Q96DT2	Missense_Mutation	SNP	ENST00000377574.1	37	CCDS8075.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.166493	0.57476	.	.	ENSG00000197891	ENST00000377567;ENST00000377574;ENST00000377572;ENST00000473690;ENST00000336464	T;T;T;T;T	0.74421	-0.84;0.27;-0.84;-0.84;-0.84	4.73	4.73	0.59995	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.280435	0.33650	N	0.004684	T	0.75671	0.3881	L	0.58969	1.84	0.23515	N	0.997515	P;P;P	0.47762	0.549;0.9;0.549	B;P;B	0.47645	0.259;0.553;0.364	T	0.70088	-0.4968	10	0.42905	T	0.14	.	15.1841	0.72986	0.0:1.0:0.0:0.0	.	382;308;416	B5ME56;Q96S37-2;Q96S37	.;.;S22AC_HUMAN	V	308;416;308;195;382	ENSP00000366790:A308V;ENSP00000366797:A416V;ENSP00000366795:A308V;ENSP00000438437:A195V;ENSP00000336836:A382V	ENSP00000336836:A382V	A	+	2	0	SLC22A12	64123900	0.066000	0.20996	0.265000	0.24526	0.004000	0.04260	3.547000	0.53663	2.169000	0.68431	0.511000	0.50034	GCA	.		0.657	SLC22A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104966.2	NM_144585	
MAP3K4	4216	hgsc.bcm.edu	37	6	161519381	161519381	+	Missense_Mutation	SNP	C	C	T	rs146403419	byFrequency	TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr6:161519381C>T	ENST00000392142.4	+	17	3744	c.3596C>T	c.(3595-3597)gCt>gTt	p.A1199V	MAP3K4_ENST00000366920.2_Missense_Mutation_p.A1195V|MAP3K4_ENST00000348824.7_Intron|MAP3K4_ENST00000366919.2_Intron	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1199	Poly-Ala.			Missing (in Ref. 1; AAB68804). {ECO:0000305}.	activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		gctgctgctgctgttgctgcC	0.602													C|||	3	0.000599042	0.0023	0.0	5008	,	,		12144	0.0		0.0	False		,,,				2504	0.0				p.A1199V		.											MAP3K4_ENST00000392142,colon,carcinoma,0,12	MAP3K4_ENST00000392142	0	0			c.C3596T						.	-	VAL/ALA,	3,4403	4.2+/-10.8	0,3,2200	96.0	93.0	94.0		3596,	3.0	0.1	6	dbSNP_134	94	0,8600		0,0,4300	yes	missense,intron	MAP3K4	NM_005922.2,NM_006724.2	64,	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	benign,	1199/1609,	161519381	3,13003	2203	4300	6503	SO:0001583	missense	4216	exon17			CTGCTGCTGTTGC	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.3596C>T	6.37:g.161519381C>T	ENSP00000375986:p.Ala1199Val	35	2		24	2	NM_005922	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	37	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	C	7.803	0.714124	0.15306	6.81E-4	0.0	ENSG00000085511	ENST00000392142;ENST00000366920	T;T	0.71341	-0.56;-0.56	3.04	3.04	0.35103	.	0.581661	0.14365	N	0.324150	T	0.32010	0.0815	N	0.14661	0.345	0.38002	D	0.934254	B;B	0.23249	0.082;0.015	B;B	0.21708	0.036;0.011	T	0.10543	-1.0625	10	0.13470	T	0.59	-3.3456	10.1934	0.43041	0.0:1.0:0.0:0.0	.	1195;1199	F5H538;Q9Y6R4	.;M3K4_HUMAN	V	1199;1195	ENSP00000375986:A1199V;ENSP00000355887:A1195V	ENSP00000355887:A1195V	A	+	2	0	MAP3K4	161439371	0.008000	0.16893	0.115000	0.21578	0.390000	0.30446	0.116000	0.15561	2.093000	0.63338	0.366000	0.22137	GCT	0.000		0.602	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
HEATR6	63897	hgsc.bcm.edu	37	17	58156223	58156223	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr17:58156223G>A	ENST00000184956.6	-	1	69	c.53C>T	c.(52-54)gCa>gTa	p.A18V	HEATR6_ENST00000585976.1_Missense_Mutation_p.A18V|HEATR6_ENST00000585712.1_5'UTR|CTD-2319I12.2_ENST00000589740.1_lincRNA	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	18							poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			TTCCCGCGGTGCCTCCCGCGG	0.662																																					p.A18V		.											.	.	.	0			c.C53T						.						23.0	20.0	21.0					17																	58156223		2202	4298	6500	SO:0001583	missense	63897	exon1			CGCGGTGCCTCCC	BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.53C>T	17.37:g.58156223G>A	ENSP00000184956:p.Ala18Val	30	0		46	4	NM_022070	B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Missense_Mutation	SNP	ENST00000184956.6	37	CCDS11623.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.695788	0.30052	.	.	ENSG00000068097	ENST00000184956	T	0.46451	0.87	5.08	3.02	0.34903	.	1.199780	0.05733	N	0.599832	T	0.30039	0.0752	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22103	-1.0226	10	0.25751	T	0.34	0.0649	7.8083	0.29215	0.206:0.0:0.794:0.0	.	18	Q6AI08	HEAT6_HUMAN	V	18	ENSP00000184956:A18V	ENSP00000184956:A18V	A	-	2	0	HEATR6	55511005	0.040000	0.19996	0.000000	0.03702	0.001000	0.01503	0.967000	0.29344	0.750000	0.32877	0.650000	0.86243	GCA	.		0.662	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1	NM_022070	
GBP7	388646	hgsc.bcm.edu;bcgsc.ca	37	1	89616212	89616212	+	Silent	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr1:89616212G>T	ENST00000294671.2	-	6	810	c.672C>A	c.(670-672)atC>atA	p.I224I		NM_207398.2	NP_997281.2	Q8N8V2	GBP7_HUMAN	guanylate binding protein 7	224	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		AGAAATGCCTGATCCACTCCC	0.413																																					p.I224I		.											.	.	.	0			c.C672A						.						111.0	108.0	109.0					1																	89616212		2203	4300	6503	SO:0001819	synonymous_variant	388646	exon6			ATGCCTGATCCAC	AK096141	CCDS720.1	1p22.2	2008-02-05			ENSG00000213512	ENSG00000213512			29606	protein-coding gene	gene with protein product		612468					Standard	NM_207398		Approved	FLJ38822, GBP4L	uc001dna.2	Q8N8V2	OTTHUMG00000010659	ENST00000294671.2:c.672C>A	1.37:g.89616212G>T		55	0		68	4	NM_207398		Silent	SNP	ENST00000294671.2	37	CCDS720.1																																																																																			.		0.413	GBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029401.1	NM_207398	
DPRX	503834	hgsc.bcm.edu	37	19	54140174	54140174	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr19:54140174C>A	ENST00000376650.1	+	3	559	c.508C>A	c.(508-510)Caa>Aaa	p.Q170K		NM_001012728.1	NP_001012746.1	A6NFQ7	DPRX_HUMAN	divergent-paired related homeobox	170					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.Q170K(1)		endometrium(4)|large_intestine(1)|lung(7)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.013)		TTTGGAATCCCAAGTTTGCGC	0.443																																					p.Q170K		.											DPRX,NS,carcinoma,0,1	DPRX	0	1	Substitution - Missense(1)	lung(1)	c.C508A						.						115.0	113.0	114.0					19																	54140174		2203	4300	6503	SO:0001583	missense	503834	exon3			GAATCCCAAGTTT		CCDS33103.1	19q13.42	2011-06-20			ENSG00000204595	ENSG00000204595		"""Homeoboxes / PRD class"""	32166	protein-coding gene	gene with protein product		611165					Standard	NM_001012728		Approved		uc002qcf.1	A6NFQ7		ENST00000376650.1:c.508C>A	19.37:g.54140174C>A	ENSP00000365838:p.Gln170Lys	33	0		32	2	NM_001012728		Missense_Mutation	SNP	ENST00000376650.1	37	CCDS33103.1	.	.	.	.	.	.	.	.	.	.	c	5.823	0.336059	0.11013	.	.	ENSG00000204595	ENST00000376650	D	0.94330	-3.4	1.45	0.392	0.16288	.	.	.	.	.	T	0.78679	0.4321	N	0.14661	0.345	0.09310	N	1	P	0.45531	0.86	B	0.28385	0.089	T	0.72327	-0.4327	9	0.19590	T	0.45	.	3.6811	0.08310	0.0:0.7502:0.0:0.2498	.	170	A6NFQ7	DPRX_HUMAN	K	170	ENSP00000365838:Q170K	ENSP00000365838:Q170K	Q	+	1	0	DPRX	58831986	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	0.281000	0.18810	0.178000	0.19917	0.561000	0.74099	CAA	.		0.443	DPRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409880.1	NM_001012728	
FAIM3	9214	hgsc.bcm.edu	37	1	207087180	207087180	+	Silent	SNP	G	G	A	rs371358524		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr1:207087180G>A	ENST00000367091.3	-	2	440	c.297C>T	c.(295-297)agC>agT	p.S99S	FAIM3_ENST00000528654.1_Intron|FAIM3_ENST00000442471.2_Intron|FAIM3_ENST00000420007.2_Silent_p.S99S	NM_005449.4	NP_005440.1	O60667	FAIM3_HUMAN	Fas apoptotic inhibitory molecule 3	99	Ig-like.				cellular defense response (GO:0006968)|immune system process (GO:0002376)|negative regulation of apoptotic process (GO:0043066)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(84;0.201)					CATAGACTCCGCTGTCACTTT	0.527																																					p.S99S		.											FAIM3,NS,carcinoma,0,2	FAIM3	0	0			c.C297T						.	G	,,	0,4406		0,0,2203	117.0	112.0	113.0		,297,297	-10.6	0.2	1		113	1,8599	1.2+/-3.3	0,1,4299	no	intron,coding-synonymous,coding-synonymous	FAIM3	NM_001142473.1,NM_001193338.1,NM_005449.4	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	,99/307,99/391	207087180	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9214	exon2			GACTCCGCTGTCA	AF057557	CCDS1473.1, CCDS44304.1	1q32.1	2013-01-11			ENSG00000162894	ENSG00000162894		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14315	protein-coding gene	gene with protein product		606015				9586636, 1563211	Standard	NM_005449		Approved	TOSO	uc001hey.3	O60667	OTTHUMG00000036457	ENST00000367091.3:c.297C>T	1.37:g.207087180G>A		29	0		25	2	NM_005449	A8K7J2|B7Z6Z0|D9MWM3	Silent	SNP	ENST00000367091.3	37	CCDS1473.1																																																																																			.		0.527	FAIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088677.1	NM_005449	
DICER1	23405	hgsc.bcm.edu;bcgsc.ca	37	14	95562824	95562824	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr14:95562824G>A	ENST00000526495.1	-	25	4724	c.4433C>T	c.(4432-4434)gCa>gTa	p.A1478V	DICER1_ENST00000527414.1_Missense_Mutation_p.A1478V|DICER1_ENST00000556045.1_Missense_Mutation_p.A376V|DICER1_ENST00000343455.3_Missense_Mutation_p.A1478V|DICER1_ENST00000541352.1_Missense_Mutation_p.A1478V|DICER1_ENST00000393063.1_Missense_Mutation_p.A1478V			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1478					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		CCATTCATATGCAGAATCAGT	0.353			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																												p.A1478V		.	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	.	.	.	0			c.C4433T						.						65.0	67.0	66.0					14																	95562824		2203	4300	6503	SO:0001583	missense	23405	exon24	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	TCATATGCAGAAT	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.4433C>T	14.37:g.95562824G>A	ENSP00000437256:p.Ala1478Val	76	0		64	4	NM_030621	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	ENST00000526495.1	37	CCDS9931.1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.307056	0.23821	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000556045;ENST00000541352	T;T;T;T;D;T	0.86865	0.35;0.35;0.35;0.35;-2.18;0.66	5.59	4.58	0.56647	Ribonuclease III (3);	0.367696	0.31156	N	0.008148	T	0.70868	0.3273	N	0.08118	0	0.09310	N	1	B;P;B	0.36354	0.175;0.549;0.055	B;B;B	0.37780	0.174;0.258;0.081	T	0.60934	-0.7164	10	0.11182	T	0.66	-21.9466	8.172	0.31260	0.0:0.1173:0.5468:0.3359	.	376;1478;1478	B3KRG4;E0AD28;Q9UPY3	.;.;DICER_HUMAN	V	1478;1478;1478;1478;376;1478	ENSP00000343745:A1478V;ENSP00000437256:A1478V;ENSP00000376783:A1478V;ENSP00000435681:A1478V;ENSP00000451041:A376V;ENSP00000444719:A1478V	ENSP00000343745:A1478V	A	-	2	0	DICER1	94632577	0.211000	0.23529	0.233000	0.24025	0.961000	0.63080	1.824000	0.39072	2.793000	0.96121	0.561000	0.74099	GCA	.		0.353	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1		
AQR	9716	hgsc.bcm.edu;bcgsc.ca	37	15	35155082	35155082	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr15:35155082G>T	ENST00000156471.5	-	33	4240	c.4015C>A	c.(4015-4017)Cca>Aca	p.P1339T		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	1339					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		CTAGTAGTTGGGAAAGGTTCT	0.408																																					p.P1339T		.											AQR,NS,carcinoma,0,1	AQR	0	0			c.C4015A						.						71.0	70.0	70.0					15																	35155082		1881	4122	6003	SO:0001583	missense	9716	exon33			TAGTTGGGAAAGG	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.4015C>A	15.37:g.35155082G>T	ENSP00000156471:p.Pro1339Thr	43	0		59	4	NM_014691	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	37	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.742546	0.49151	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.94184	-3.37	5.82	5.82	0.92795	.	0.194618	0.53938	D	0.000048	D	0.93536	0.7937	M	0.77313	2.365	0.58432	D	0.999994	B	0.24368	0.102	B	0.19391	0.025	D	0.90449	0.4437	10	0.51188	T	0.08	-11.1745	20.099	0.97865	0.0:0.0:1.0:0.0	.	1339	O60306	AQR_HUMAN	T	1339	ENSP00000156471:P1339T	ENSP00000156471:P1339T	P	-	1	0	AQR	32942374	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	7.452000	0.80683	2.752000	0.94435	0.655000	0.94253	CCA	.		0.408	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691	
OR2M2	391194	hgsc.bcm.edu;bcgsc.ca	37	1	248344069	248344069	+	Missense_Mutation	SNP	G	G	T	rs368462994		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr1:248344069G>T	ENST00000359682.2	+	1	782	c.782G>T	c.(781-783)cGg>cTg	p.R261L		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ATGTACATACGGCCCACATCT	0.517																																					p.R261L		.											.	.	.	0			c.G782T						.						221.0	196.0	205.0					1																	248344069		2203	4300	6503	SO:0001583	missense	391194	exon1			ACATACGGCCCAC	AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.782G>T	1.37:g.248344069G>T	ENSP00000352710:p.Arg261Leu	45	0		71	4	NM_001004688	A3KFT4	Missense_Mutation	SNP	ENST00000359682.2	37	CCDS31106.1	.	.	.	.	.	.	.	.	.	.	g	6.424	0.446358	0.12223	.	.	ENSG00000198601	ENST00000359682	T	0.36699	1.24	2.03	-4.06	0.03986	GPCR, rhodopsin-like superfamily (1);	0.786555	0.09970	U	0.732317	T	0.31327	0.0793	L	0.45352	1.415	0.09310	N	1	P	0.47604	0.898	P	0.53760	0.734	T	0.17440	-1.0369	10	0.09590	T	0.72	.	3.9399	0.09323	0.4553:0.0:0.2833:0.2614	.	261	Q96R28	OR2M2_HUMAN	L	261	ENSP00000352710:R261L	ENSP00000352710:R261L	R	+	2	0	OR2M2	246410692	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.605000	0.00889	-1.291000	0.02368	-0.391000	0.06502	CGG	.		0.517	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688	
KIAA1549L	25758	hgsc.bcm.edu	37	11	33689544	33689544	+	Silent	SNP	G	G	A			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr11:33689544G>A	ENST00000321505.4	+	20	5574	c.5394G>A	c.(5392-5394)gcG>gcA	p.A1798A	RP4-541C22.5_ENST00000534431.1_RNA|KIAA1549L_ENST00000389726.3_Silent_p.A1804A			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1798						integral component of membrane (GO:0016021)											AGGCCCCGGCGCCCTCCACAG	0.677																																					p.A1798A		.											C11orf41_ENST00000321505,caecum,carcinoma,0,1	C11orf41_ENST00000321505	0	0			c.G5394A						.						32.0	39.0	37.0					11																	33689544		2026	4187	6213	SO:0001819	synonymous_variant	25758	exon20			CCCGGCGCCCTCC	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.5394G>A	11.37:g.33689544G>A		17	0		19	2	NM_012194	B0QYU0	Silent	SNP	ENST00000321505.4	37	CCDS44565.2																																																																																			.		0.677	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
ECM1	1893	hgsc.bcm.edu	37	1	150484858	150484858	+	Missense_Mutation	SNP	C	C	T	rs587651183		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr1:150484858C>T	ENST00000369047.4	+	8	1239	c.1114C>T	c.(1114-1116)Cgg>Tgg	p.R372W	ECM1_ENST00000346569.6_Missense_Mutation_p.R247W|ECM1_ENST00000369049.4_Missense_Mutation_p.R399W|ECM1_ENST00000470432.1_3'UTR	NM_004425.3	NP_004416.2	Q16610	ECM1_HUMAN	extracellular matrix protein 1	372	2 X approximate repeats.				angiogenesis (GO:0001525)|biomineral tissue development (GO:0031214)|inflammatory response (GO:0006954)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of peptidase activity (GO:0010466)|ossification (GO:0001503)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of T cell migration (GO:2000404)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type 2 immune response (GO:0002828)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	enzyme binding (GO:0019899)|laminin binding (GO:0043236)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)	p.R372W(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|urinary_tract(1)	22	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			ATACTGTGACCGGGAGTATGC	0.577													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19130	0.0		0.0	False		,,,				2504	0.0				p.R399W	Melanoma(156;1696 2560 11093 19685)	.											ECM1,colon,carcinoma,0,1	ECM1	0	1	Substitution - Missense(1)	large_intestine(1)	c.C1195T						.						107.0	92.0	97.0					1																	150484858		2203	4300	6503	SO:0001583	missense	1893	exon8			TGTGACCGGGAGT	U68186	CCDS953.1, CCDS954.1, CCDS55632.1	1q21	2008-02-05			ENSG00000143369	ENSG00000143369			3153	protein-coding gene	gene with protein product		602201				9367673, 9501329	Standard	NM_004425		Approved		uc001eus.3	Q16610	OTTHUMG00000012806	ENST00000369047.4:c.1114C>T	1.37:g.150484858C>T	ENSP00000358043:p.Arg372Trp	29	0		50	2	NM_001202858	A8K8S0|B4DW49|B4DY60|O43266|Q5T5G4|Q5T5G5|Q5T5G6|Q8IZ60	Missense_Mutation	SNP	ENST00000369047.4	37	CCDS953.1	.	.	.	.	.	.	.	.	.	.	C	4.590	0.109674	0.08780	.	.	ENSG00000143369	ENST00000369049;ENST00000369047;ENST00000346569	D;D;D	0.86297	-2.1;-2.1;-2.1	4.49	1.24	0.21308	.	1.114540	0.06774	N	0.784095	T	0.61924	0.2386	L	0.27053	0.805	0.09310	N	1	B;B;B;B	0.18310	0.027;0.019;0.027;0.024	B;B;B;B	0.18561	0.006;0.022;0.011;0.017	T	0.55661	-0.8106	10	0.72032	D	0.01	0.0088	2.2584	0.04060	0.2252:0.4949:0.1703:0.1095	.	399;372;247;372	Q16610-4;C8CHS3;Q16610-2;Q16610	.;.;.;ECM1_HUMAN	W	399;372;247	ENSP00000358045:R399W;ENSP00000358043:R372W;ENSP00000271630:R247W	ENSP00000271630:R247W	R	+	1	2	ECM1	148751482	0.000000	0.05858	0.010000	0.14722	0.240000	0.25518	-0.494000	0.06451	0.560000	0.29169	0.563000	0.77884	CGG	.		0.577	ECM1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035832.2	NM_004425	
LOXHD1	125336	hgsc.bcm.edu	37	18	44173638	44173638	+	Silent	SNP	C	C	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr18:44173638C>T	ENST00000398722.4	-	3	521	c.522G>A	c.(520-522)caG>caA	p.Q174Q	LOXHD1_ENST00000536736.1_Silent_p.Q452Q|LOXHD1_ENST00000441551.2_Silent_p.Q452Q			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	174	PLAT 2. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TCCGCCCCTTCTGCCCATAAA	0.488																																					p.Q452Q		.											LOXHD1_ENST00000398722,colon,carcinoma,0,2	LOXHD1_ENST00000398722	0	0			c.G1356A						.						137.0	117.0	123.0					18																	44173638		692	1591	2283	SO:0001819	synonymous_variant	125336	exon10			CCCCTTCTGCCCA	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.522G>A	18.37:g.44173638C>T		35	0		36	2	NM_144612	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Silent	SNP	ENST00000398722.4	37		.	.	.	.	.	.	.	.	.	.	C	2.993	-0.207840	0.06180	.	.	ENSG00000167210	ENST00000441551	.	.	.	5.8	4.92	0.64577	.	.	.	.	.	T	0.56949	0.2020	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55679	-0.8103	4	.	.	.	.	6.9866	0.24731	0.1157:0.641:0.1736:0.0697	.	.	.	.	K	433	.	.	E	-	1	0	LOXHD1	42427636	0.995000	0.38212	1.000000	0.80357	0.314000	0.28054	0.438000	0.21559	1.435000	0.47434	0.563000	0.77884	GAA	.		0.488	LOXHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_144612	
FRG1B	284802	hgsc.bcm.edu	37	20	29627955	29627955	+	Intron	SNP	C	C	G			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr20:29627955C>G	ENST00000278882.3	+	6	608				FRG1B_ENST00000439954.2_Intron|FRG1B_ENST00000358464.4_Intron			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AGAACTAAATCAGTTTTATCT	0.259																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	284802	.			CTAAATCAGTTTT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.229-272C>G	20.37:g.29627955C>G		16	0		16	4	.	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																				.		0.259	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
UTP15	84135	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	72874933	72874933	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr5:72874933G>T	ENST00000296792.4	+	11	1493	c.1238G>T	c.(1237-1239)cGg>cTg	p.R413L	UTP15_ENST00000508491.1_Missense_Mutation_p.R394L|UTP15_ENST00000543251.1_Missense_Mutation_p.R223L	NM_001284431.1|NM_032175.2	NP_001271360.1|NP_115551.2	Q8TED0	UTP15_HUMAN	UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)	413					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	15		Lung NSC(167;0.00405)|Ovarian(174;0.0129)		OV - Ovarian serous cystadenocarcinoma(47;7.76e-55)		CTTGCAGGTCGGGATGAGAAG	0.378																																					p.R413L		.											.	.	.	0			c.G1238T						.						121.0	129.0	126.0					5																	72874933		2203	4300	6503	SO:0001583	missense	84135	exon11			CAGGTCGGGATGA	AL831972	CCDS34186.1, CCDS68893.1, CCDS68894.1	5q13.2	2013-01-10	2006-04-20		ENSG00000164338	ENSG00000164338		"""WD repeat domain containing"""	25758	protein-coding gene	gene with protein product			"""UTP15, U3 small nucleolar ribonucleoprotein, homolog (yeast)"""			12477932	Standard	NM_032175		Approved	FLJ12787, NET21, FLJ23637	uc003kcw.1	Q8TED0	OTTHUMG00000162453	ENST00000296792.4:c.1238G>T	5.37:g.72874933G>T	ENSP00000296792:p.Arg413Leu	41	0		62	4	NM_032175	B4DU75|B4DXK8|Q6IA60|Q96E08|Q9H9F8	Missense_Mutation	SNP	ENST00000296792.4	37	CCDS34186.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.298574|5.298574	0.95574|0.95574	.|.	.|.	ENSG00000164338|ENSG00000164338	ENST00000509005|ENST00000296792;ENST00000543251;ENST00000508491	.|T;T;T	.|0.56941	.|0.43;0.43;0.43	5.68|5.68	5.68|5.68	0.88126|0.88126	.|U3 small nucleolar RNA-associated protein 15, C-terminal (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.79446|0.79446	0.4447|0.4447	M|M	0.91818|0.91818	3.245|3.245	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	T|T	0.79533|0.79533	-0.1764|-0.1764	5|10	.|0.37606	.|T	.|0.19	.|.	20.1467|20.1467	0.98079|0.98079	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|394;413	.|B4DXK8;Q8TED0	.|.;UTP15_HUMAN	W|L	440|413;223;394	.|ENSP00000296792:R413L;ENSP00000440796:R223L;ENSP00000424609:R394L	.|ENSP00000296792:R413L	G|R	+|+	1|2	0|0	UTP15|UTP15	72910689|72910689	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	8.810000|8.810000	0.91950|0.91950	2.838000|2.838000	0.97847|0.97847	0.655000|0.655000	0.94253|0.94253	GGG|CGG	.		0.378	UTP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368965.1	NM_032175	
SDHA	6389	hgsc.bcm.edu	37	5	251468	251468	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr5:251468C>G	ENST00000264932.6	+	13	1794	c.1679C>G	c.(1678-1680)aCg>aGg	p.T560R	SDHA_ENST00000507522.1_3'UTR|SDHA_ENST00000504309.1_Intron|SDHA_ENST00000510361.1_Missense_Mutation_p.T512R	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	560					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)	p.T560R(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	GTCTGGAACACGGACCTGGTG	0.632									Familial Paragangliomas																												p.T560R		.											SDHA,NS,malignant_melanoma,0,1	SDHA	0	1	Substitution - Missense(1)	NS(1)	c.C1679G						.						17.0	23.0	21.0					5																	251468		2202	4290	6492	SO:0001583	missense	6389	exon13	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	GGAACACGGACCT	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1679C>G	5.37:g.251468C>G	ENSP00000264932:p.Thr560Arg	60	0		62	3	NM_004168	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	.	.	.	.	.	.	.	.	.	.	N	18.53	3.644888	0.67358	.	.	ENSG00000073578	ENST00000264932;ENST00000327872;ENST00000510361;ENST00000509564	T;T;T	0.80994	-1.44;-1.44;-1.44	3.62	3.62	0.41486	Fumarate reductase/succinate dehydrogenase flavoprotein-like, C-terminal (2);Fumarate reductase/succinate dehydrogenase flavoprotein, C-terminal (1);	0.000000	0.85682	U	0.000000	D	0.91717	0.7381	H	0.94462	3.54	0.80722	D	1	D;D;D;D	0.89917	0.995;0.999;1.0;0.999	D;D;D;D	0.87578	0.981;0.994;0.998;0.994	D	0.93691	0.7007	10	0.87932	D	0	.	13.133	0.59393	0.0:1.0:0.0:0.0	.	512;560;154;560	E9PBJ5;B4DYN5;B3KYA5;P31040	.;.;.;DHSA_HUMAN	R	560;415;512;6	ENSP00000264932:T560R;ENSP00000427703:T512R;ENSP00000421911:T6R	ENSP00000264932:T560R	T	+	2	0	SDHA	304468	1.000000	0.71417	0.886000	0.34754	0.946000	0.59487	7.104000	0.77024	1.757000	0.51966	0.195000	0.17529	ACG	.		0.632	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
APC	324	hgsc.bcm.edu	37	5	112176192	112176192	+	Missense_Mutation	SNP	C	C	A	rs370433763		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr5:112176192C>A	ENST00000457016.1	+	16	5281	c.4901C>A	c.(4900-4902)cCg>cAg	p.P1634Q	APC_ENST00000508376.2_Missense_Mutation_p.P1634Q|APC_ENST00000257430.4_Missense_Mutation_p.P1634Q|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1634	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.P1634L(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGTTTTACACCGGGGGATGAT	0.448		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.P1634Q	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,NS,carcinoma,0,2	APC	0	3	Substitution - Missense(1)|Unknown(1)|Deletion - Frameshift(1)	large_intestine(1)|soft_tissue(1)|skin(1)	c.C4901A						.						108.0	109.0	108.0					5																	112176192		2202	4300	6502	SO:0001583	missense	324	exon17	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	TTACACCGGGGGA	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4901C>A	5.37:g.112176192C>A	ENSP00000413133:p.Pro1634Gln	38	0		49	2	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	11.98	1.801662	0.31869	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.89123	-2.47;-2.47;-2.47	5.61	5.61	0.85477	.	0.101742	0.64402	D	0.000002	D	0.83806	0.5334	N	0.14661	0.345	0.37087	D	0.899253	D;D	0.55800	0.973;0.973	P;P	0.49561	0.615;0.615	D	0.84786	0.0776	9	.	.	.	-16.2812	14.4837	0.67599	0.1468:0.8532:0.0:0.0	.	1636;1634	Q4LE70;P25054	.;APC_HUMAN	Q	1634	ENSP00000413133:P1634Q;ENSP00000257430:P1634Q;ENSP00000427089:P1634Q	.	P	+	2	0	APC	112204091	0.959000	0.32827	1.000000	0.80357	0.976000	0.68499	2.142000	0.42177	2.668000	0.90789	0.650000	0.86243	CCG	.		0.448	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
ARID1B	57492	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	157522560	157522560	+	Missense_Mutation	SNP	G	G	A	rs3210165		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr6:157522560G>A	ENST00000350026.5	+	17	4794	c.4793G>A	c.(4792-4794)gGc>gAc	p.G1598D	ARID1B_ENST00000275248.4_Missense_Mutation_p.G1593D|ARID1B_ENST00000346085.5_Missense_Mutation_p.G1611D|ARID1B_ENST00000367148.1_Missense_Mutation_p.G1651D	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1598					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		TTTCCTCCTGGCTCAGTAGAA	0.493																																					p.G1611D		.											.	.	.	0			c.G4832A						.						115.0	113.0	114.0					6																	157522560		2203	4296	6499	SO:0001583	missense	57492	exon18			CTCCTGGCTCAGT	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.4793G>A	6.37:g.157522560G>A	ENSP00000055163:p.Gly1598Asp	39	0		41	4	NM_020732	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	ENST00000350026.5	37	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	G	15.79	2.936170	0.52972	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000414678	T;T;T;T;T	0.01963	4.78;4.7;4.8;4.77;4.53	4.94	4.94	0.65067	.	0.052800	0.85682	D	0.000000	T	0.01835	0.0058	L	0.35593	1.075	0.80722	D	1	P;P;P	0.46327	0.803;0.876;0.876	B;P;P	0.48166	0.365;0.569;0.569	T	0.72080	-0.4398	10	0.18710	T	0.47	.	18.5459	0.91045	0.0:0.0:1.0:0.0	.	1598;1611;1593	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	D	1611;1598;1651;1593;1120	ENSP00000344546:G1611D;ENSP00000055163:G1598D;ENSP00000356116:G1651D;ENSP00000275248:G1593D;ENSP00000412835:G1120D	ENSP00000275248:G1593D	G	+	2	0	ARID1B	157564252	1.000000	0.71417	0.999000	0.59377	0.970000	0.65996	7.558000	0.82253	2.459000	0.83118	0.655000	0.94253	GGC	.		0.493	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
SLC7A7	9056	hgsc.bcm.edu	37	14	23242838	23242838	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr14:23242838C>T	ENST00000397532.3	-	10	2042	c.1517G>A	c.(1516-1518)cGg>cAg	p.R506Q	SLC7A7_ENST00000555702.1_Missense_Mutation_p.R506Q|SLC7A7_ENST00000554061.1_5'UTR|SLC7A7_ENST00000554517.1_Missense_Mutation_p.R240Q|SLC7A7_ENST00000285850.7_Missense_Mutation_p.R506Q|SLC7A7_ENST00000397528.4_Missense_Mutation_p.R506Q|SLC7A7_ENST00000397529.2_Missense_Mutation_p.R506Q			Q9UM01	YLAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, y+L system), member 7	506					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		TTTGGGATCCCGTTGCTTGGG	0.478																																					p.R506Q		.											SLC7A7,NS,haematopoietic_neoplasm,0,1	SLC7A7	0	0			c.G1517A						.						151.0	125.0	134.0					14																	23242838		2203	4300	6503	SO:0001583	missense	9056	exon11			GGATCCCGTTGCT	AF092032	CCDS9574.1	14q11.2	2014-09-17	2011-07-12		ENSG00000155465	ENSG00000155465		"""Solute carriers"""	11065	protein-coding gene	gene with protein product		603593		LPI		9829974	Standard	NM_001126106		Approved	y+LAT-1	uc001wgs.4	Q9UM01	OTTHUMG00000028692	ENST00000397532.3:c.1517G>A	14.37:g.23242838C>T	ENSP00000380666:p.Arg506Gln	19	0		23	2	NM_001126105	B2RAU0|D3DS26|O95984|Q53XC1|Q86U07|Q9P2V5	Missense_Mutation	SNP	ENST00000397532.3	37	CCDS9574.1	.	.	.	.	.	.	.	.	.	.	C	0.338	-0.952371	0.02285	.	.	ENSG00000155465	ENST00000285850;ENST00000555702;ENST00000397532;ENST00000404278;ENST00000397529;ENST00000397528;ENST00000554517	D;D;D;D;D;D	0.90844	-2.64;-2.64;-2.64;-2.64;-2.64;-2.74	5.52	-8.7	0.00851	.	4.168150	0.00424	N	0.000065	T	0.69024	0.3065	N	0.00926	-1.1	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.69910	-0.5017	10	0.06625	T	0.88	.	10.6569	0.45680	0.0:0.5827:0.1265:0.2908	.	506	Q9UM01	YLAT1_HUMAN	Q	506;506;506;479;506;506;240	ENSP00000285850:R506Q;ENSP00000451881:R506Q;ENSP00000380666:R506Q;ENSP00000380663:R506Q;ENSP00000380662:R506Q;ENSP00000452083:R240Q	ENSP00000285850:R506Q	R	-	2	0	SLC7A7	22312678	0.000000	0.05858	0.059000	0.19551	0.294000	0.27393	-1.031000	0.03578	-1.499000	0.01821	-1.008000	0.02478	CGG	.		0.478	SLC7A7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071636.3		
ZNF791	163049	hgsc.bcm.edu	37	19	12739912	12739912	+	Silent	SNP	C	C	A			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr19:12739912C>A	ENST00000343325.4	+	4	1731	c.1569C>A	c.(1567-1569)ccC>ccA	p.P523P	ZNF791_ENST00000540038.1_Silent_p.P414P|AC010422.1_ENST00000408416.1_RNA|ZNF791_ENST00000458122.3_Silent_p.P491P|ZNF791_ENST00000446165.1_3'UTR|ZNF490_ENST00000465656.1_Intron	NM_153358.2	NP_699189.2	Q3KP31	ZN791_HUMAN	zinc finger protein 791	523					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P523P(1)		endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)	19						GAGAGAAACCCTATAAATGTA	0.388																																					p.P523P		.											ZNF791,NS,carcinoma,0,2	ZNF791	0	1	Substitution - coding silent(1)	lung(1)	c.C1569A						.						86.0	90.0	88.0					19																	12739912		2203	4300	6503	SO:0001819	synonymous_variant	163049	exon4			GAAACCCTATAAA	AK074877	CCDS12273.1	19p13.2-p13.13	2013-01-08			ENSG00000173875	ENSG00000173875		"""Zinc fingers, C2H2-type"", ""-"""	26895	protein-coding gene	gene with protein product							Standard	NM_153358		Approved	FLJ90396	uc002mua.2	Q3KP31	OTTHUMG00000156426	ENST00000343325.4:c.1569C>A	19.37:g.12739912C>A		27	0		38	2	NM_153358	B7Z586|Q8NC99	Silent	SNP	ENST00000343325.4	37	CCDS12273.1																																																																																			.		0.388	ZNF791-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344140.1	NM_153358	
CCDC61	729440	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	46511419	46511419	+	Silent	SNP	C	C	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr19:46511419C>T	ENST00000595358.1	+	5	460	c.411C>T	c.(409-411)ctC>ctT	p.L137L	CCDC61_ENST00000536603.1_Silent_p.L137L|CCDC61_ENST00000594087.1_Silent_p.L137L|CCDC61_ENST00000263284.2_Silent_p.L194L	NM_001267723.1	NP_001254652.1	Q9Y6R9	CCD61_HUMAN	coiled-coil domain containing 61	137						centrosome (GO:0005813)				endometrium(3)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00221)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.164)		CGCTGCCCCTCCCGTACCAGG	0.602																																					p.L137L		.											.	.	.	0			c.C411T						.						19.0	22.0	21.0					19																	46511419		1943	4136	6079	SO:0001819	synonymous_variant	729440	exon5			GCCCCTCCCGTAC		CCDS46120.1, CCDS46120.2	19q13.32	2014-09-04			ENSG00000104983	ENSG00000104983			33629	protein-coding gene	gene with protein product							Standard	NM_001267723		Approved		uc031rlj.1	Q9Y6R9	OTTHUMG00000182488	ENST00000595358.1:c.411C>T	19.37:g.46511419C>T		52	0		64	5	NM_001267723	C8CAP4|Q9HDB6	Silent	SNP	ENST00000595358.1	37	CCDS46120.2																																																																																			.		0.602	CCDC61-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461689.1	NM_001080402	
BAIAP2L2	80115	hgsc.bcm.edu;bcgsc.ca	37	22	38504287	38504287	+	Silent	SNP	C	C	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr22:38504287C>T	ENST00000381669.3	-	3	333	c.189G>A	c.(187-189)ctG>ctA	p.L63L	BAIAP2L2_ENST00000332536.5_Silent_p.L63L	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	63	IMD. {ECO:0000255|PROSITE- ProRule:PRU00668}.				filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)			large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					TGGGGCTCTGCAGGGCACGCT	0.627																																					p.L63L		.											.	.	.	0			c.G189A						.						31.0	38.0	36.0					22																	38504287		1965	4135	6100	SO:0001819	synonymous_variant	80115	exon3			GCTCTGCAGGGCA	BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.189G>A	22.37:g.38504287C>T		35	0		45	4	NM_025045	B0QYE2|Q96BG7	Silent	SNP	ENST00000381669.3	37	CCDS43018.1																																																																																			.		0.627	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321727.1	NM_025045	
MIA3	375056	hgsc.bcm.edu	37	1	222825333	222825333	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr1:222825333G>T	ENST00000344922.5	+	12	3949	c.3924G>T	c.(3922-3924)aaG>aaT	p.K1308N	MIA3_ENST00000340535.7_Missense_Mutation_p.K186N|MIA3_ENST00000344507.1_Intron|MIA3_ENST00000344441.6_Missense_Mutation_p.K1308N	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1308					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		CAGAAAACAAGAAATCTATAG	0.313																																					p.K1308N		.											MIA3,NS,carcinoma,0,1	MIA3	0	0			c.G3924T						.						79.0	75.0	77.0					1																	222825333		1813	4077	5890	SO:0001583	missense	375056	exon12			AAACAAGAAATCT		CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.3924G>T	1.37:g.222825333G>T	ENSP00000340900:p.Lys1308Asn	27	0		42	2	NM_198551	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	ENST00000344922.5	37	CCDS41470.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.944713	0.73672	.	.	ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000340535;ENST00000284471	T;T;T	0.70869	-0.52;-0.52;-0.52	5.59	4.67	0.58626	.	.	.	.	.	T	0.73976	0.3656	L	0.57536	1.79	0.34669	D	0.723511	P;D	0.58970	0.835;0.984	P;P	0.52672	0.466;0.706	T	0.78783	-0.2069	9	0.25751	T	0.34	.	13.617	0.62115	0.0749:0.0:0.9251:0.0	.	186;1308	Q5JRA6-4;Q5JRA6	.;MIA3_HUMAN	N	1308;1308;186;186	ENSP00000340900:K1308N;ENSP00000340587:K1308N;ENSP00000345866:K186N	ENSP00000284471:K186N	K	+	3	2	MIA3	220891956	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.033000	0.41136	1.486000	0.48398	0.655000	0.94253	AAG	.		0.313	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551	
PHIP	55023	hgsc.bcm.edu	37	6	79707219	79707219	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr6:79707219C>T	ENST00000275034.4	-	19	2280	c.2113G>A	c.(2113-2115)Gca>Aca	p.A705T		NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	705					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)	p.A705T(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		CTTCTTGGTGCGTTGCTGTGC	0.498																																					p.A705T		.											PHIP,colon,carcinoma,0,2	PHIP	0	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G2113A						.						247.0	212.0	224.0					6																	79707219		2203	4300	6503	SO:0001583	missense	55023	exon19			TTGGTGCGTTGCT	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.2113G>A	6.37:g.79707219C>T	ENSP00000275034:p.Ala705Thr	50	0		38	3	NM_017934	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000275034.4	37	CCDS4987.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.780506	0.90195	.	.	ENSG00000146247	ENST00000275034	T	0.29917	1.55	4.96	4.96	0.65561	.	0.000000	0.64402	D	0.000003	T	0.45637	0.1352	M	0.68593	2.085	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.75020	0.985;0.985	T	0.38887	-0.9640	9	.	.	.	-14.6205	17.1852	0.86865	0.0:1.0:0.0:0.0	.	705;705	A7J992;Q8WWQ0	.;PHIP_HUMAN	T	705	ENSP00000275034:A705T	.	A	-	1	0	PHIP	79763938	1.000000	0.71417	0.999000	0.59377	0.887000	0.51463	7.487000	0.81328	2.264000	0.75181	0.655000	0.94253	GCA	.		0.498	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2		
MATN4	8785	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	20	43932932	43932932	+	Silent	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr20:43932932G>T	ENST00000372754.1	-	2	587	c.579C>A	c.(577-579)gtC>gtA	p.V193V	RBPJL_ENST00000372743.1_5'Flank|RBPJL_ENST00000372741.3_5'Flank|MATN4_ENST00000353917.5_Silent_p.V193V|MATN4_ENST00000360607.6_Silent_p.V193V|MATN4_ENST00000372751.4_Intron|MATN4_ENST00000537548.1_Silent_p.V193V|RBPJL_ENST00000343694.3_5'Flank|MATN4_ENST00000342716.4_Silent_p.V193V|MATN4_ENST00000372756.1_Silent_p.V193V			O95460	MATN4_HUMAN	matrilin 4	193	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				CTACGAGGAAGACGTGCTCGT	0.657																																					p.V193V		.											.	.	.	0			c.C579A						.						45.0	44.0	44.0					20																	43932932		2203	4299	6502	SO:0001819	synonymous_variant	8785	exon3			GAGGAAGACGTGC	AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.579C>A	20.37:g.43932932G>T		19	0		23	4	NM_030592	A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Silent	SNP	ENST00000372754.1	37																																																																																				.		0.657	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000080335.1		
ATG16L1	55054	hgsc.bcm.edu	37	2	234191392	234191392	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr2:234191392G>T	ENST00000392017.4	+	12	1453	c.1196G>T	c.(1195-1197)cGa>cTa	p.R399L	ATG16L1_ENST00000347464.5_Missense_Mutation_p.R236L|ATG16L1_ENST00000498620.1_3'UTR|ATG16L1_ENST00000392018.1_Missense_Mutation_p.R416L|ATG16L1_ENST00000392020.4_Missense_Mutation_p.R380L|ATG16L1_ENST00000373525.5_Missense_Mutation_p.R220L	NM_001190266.1|NM_001190267.1|NM_030803.6	NP_001177195.1|NP_001177196.1|NP_110430.5	Q676U5	A16L1_HUMAN	autophagy related 16-like 1 (S. cerevisiae)	399					autophagic vacuole assembly (GO:0000045)|negative stranded viral RNA replication (GO:0039689)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(7)|prostate(3)|skin(1)	25		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		GATGATTATCGATTACGGGTA	0.413																																					p.R399L		.											ATG16L1_ENST00000334050,NS,carcinoma,+1,2	ATG16L1_ENST00000334050	+1	0			c.G1196T						.						132.0	124.0	127.0					2																	234191392		2203	4300	6503	SO:0001583	missense	55054	exon12			ATTATCGATTACG	AK000897	CCDS2502.2, CCDS2503.2, CCDS54438.1	2q37.1	2014-02-12	2012-06-06	2005-09-13	ENSG00000085978	ENSG00000085978		"""WD repeat domain containing"""	21498	protein-coding gene	gene with protein product		610767	"""APG16 autophagy 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like 1 (S. cerevisiae)"""	APG16L, ATG16L			Standard	NM_017974		Approved	WDR30, FLJ10035, ATG16A	uc002vty.3	Q676U5	OTTHUMG00000133619	ENST00000392017.4:c.1196G>T	2.37:g.234191392G>T	ENSP00000375872:p.Arg399Leu	33	0		31	2	NM_030803	A3EXK9|A3EXL0|B6ZDH0|Q6IPN1|Q6UXW4|Q6ZVZ5|Q8NCY2|Q96JV5|Q9H619	Missense_Mutation	SNP	ENST00000392017.4	37	CCDS2503.2	.	.	.	.	.	.	.	.	.	.	G	24.7	4.564265	0.86335	.	.	ENSG00000085978	ENST00000392017;ENST00000347464;ENST00000373525;ENST00000392020;ENST00000392018;ENST00000334050	T;T;T;T;T	0.19105	2.17;2.17;2.17;2.17;2.17	5.82	4.95	0.65309	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.114896	0.56097	D	0.000029	T	0.43986	0.1272	M	0.81942	2.565	0.80722	D	1	D;P;P;P;P	0.55800	0.973;0.66;0.882;0.708;0.903	P;B;P;B;P	0.60286	0.872;0.169;0.58;0.26;0.705	T	0.41822	-0.9487	10	0.44086	T	0.13	.	13.1516	0.59492	0.0739:0.0:0.9261:0.0	.	353;380;220;399;236	B7ZLM5;Q676U5-2;Q676U5-4;Q676U5;A3EXL0	.;.;.;A16L1_HUMAN;.	L	399;236;220;380;416;58	ENSP00000375872:R399L;ENSP00000318259:R236L;ENSP00000362625:R220L;ENSP00000375875:R380L;ENSP00000375873:R416L	ENSP00000334016:R58L	R	+	2	0	ATG16L1	233856131	1.000000	0.71417	0.991000	0.47740	0.969000	0.65631	8.423000	0.90264	1.463000	0.47967	0.655000	0.94253	CGA	.		0.413	ATG16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257069.2	NM_017974	
NLRX1	79671	hgsc.bcm.edu	37	11	119043116	119043116	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr11:119043116G>A	ENST00000409109.1	+	3	709	c.122G>A	c.(121-123)cGt>cAt	p.R41H	NLRX1_ENST00000292199.2_Missense_Mutation_p.R41H|NLRX1_ENST00000474751.2_Intron|NLRX1_ENST00000525863.1_Missense_Mutation_p.R41H|NLRX1_ENST00000409991.1_Missense_Mutation_p.R41H|NLRX1_ENST00000409265.4_Missense_Mutation_p.R41H	NM_001282144.1	NP_001269073.1	Q86UT6	NLRX1_HUMAN	NLR family member X1	41					innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|viral process (GO:0016032)	mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)	p.R41H(1)		cervix(1)|endometrium(2)|kidney(2)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	22	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CAAGGGGAGCGTCCCTTTGGG	0.547																																					p.R41H		.											NLRX1,mouth,carcinoma,0,1	NLRX1	0	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G122A						.						143.0	127.0	132.0					11																	119043116		2200	4295	6495	SO:0001583	missense	79671	exon3			GGGAGCGTCCCTT	AB094095	CCDS8416.1	11q23.3	2007-02-07			ENSG00000160703	ENSG00000160703		"""Nucleotide-binding domain and leucine rich repeat containing"""	29890	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat containing X1"", ""NOD-like receptor X1"", ""NLR family, X1"""	611947				12766759	Standard	XM_005271669		Approved	NOD9, CLR11.3	uc001pvw.3	Q86UT6	OTTHUMG00000154476	ENST00000409109.1:c.122G>A	11.37:g.119043116G>A	ENSP00000387334:p.Arg41His	49	0		61	3	NM_024618	A8K6Q1|B3KPK2|B3KTA2|Q7RTR3|Q96D51|Q9H724	Missense_Mutation	SNP	ENST00000409109.1	37	CCDS8416.1	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.509888	0.00984	.	.	ENSG00000160703	ENST00000454811;ENST00000449394;ENST00000422249;ENST00000409991;ENST00000292199;ENST00000409265;ENST00000409109;ENST00000525863	T;T;T;T;T;T;T;T	0.71222	1.49;1.49;1.49;-0.43;-0.43;-0.55;-0.43;-0.55	4.88	-3.32	0.04973	.	1.275670	0.05352	N	0.532126	T	0.43299	0.1241	N	0.04508	-0.205	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.16482	-1.0401	10	0.23891	T	0.37	.	5.6314	0.17512	0.5575:0.0:0.2989:0.1435	.	41;41	Q86UT6-2;Q86UT6	.;NLRX1_HUMAN	H	41	ENSP00000400268:R41H;ENSP00000402801:R41H;ENSP00000402381:R41H;ENSP00000386851:R41H;ENSP00000292199:R41H;ENSP00000386858:R41H;ENSP00000387334:R41H;ENSP00000433442:R41H	ENSP00000292199:R41H	R	+	2	0	NLRX1	118548326	0.000000	0.05858	0.000000	0.03702	0.101000	0.19017	-0.682000	0.05185	-0.776000	0.04578	-1.292000	0.01352	CGT	.		0.547	NLRX1-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335403.1	NM_170722	
CLCC1	23155	hgsc.bcm.edu	37	1	109493041	109493041	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr1:109493041G>T	ENST00000369971.2	-	2	148	c.19C>A	c.(19-21)Ctt>Att	p.L7I	CLCC1_ENST00000369969.2_Missense_Mutation_p.L7I|CLCC1_ENST00000369968.2_Missense_Mutation_p.L7I|AKNAD1_ENST00000357393.4_Intron|CLCC1_ENST00000302500.4_Missense_Mutation_p.L7I|CLCC1_ENST00000356970.2_Missense_Mutation_p.L7I|CLCC1_ENST00000369976.1_Missense_Mutation_p.L7I|CLCC1_ENST00000348264.2_Missense_Mutation_p.L7I|CLCC1_ENST00000369970.3_Missense_Mutation_p.L7I|CLCC1_ENST00000415331.1_Missense_Mutation_p.L7I	NM_001048210.1	NP_001041675.1	Q96S66	CLCC1_HUMAN	chloride channel CLIC-like 1	7						chloride channel complex (GO:0034707)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|liver(1)|skin(1)	14		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.231)		CATTCACAAAGGAGCAAAGAA	0.338																																					p.L7I		.											CLCC1_ENST00000369971,right_upper_lobe,carcinoma,0,2	CLCC1_ENST00000369971	0	0			c.C19A						.						83.0	71.0	75.0					1																	109493041		2203	4300	6503	SO:0001583	missense	23155	exon2			CACAAAGGAGCAA	AB018304	CCDS793.1, CCDS41362.1, CCDS60214.1, CCDS60215.1	1p13.3	2008-02-05			ENSG00000121940	ENSG00000121940			29675	protein-coding gene	gene with protein product	"""Mid1-related chloride channel (yeast)"""					9872452, 11279057	Standard	NM_001048210		Approved	MCLC	uc001dwf.2	Q96S66	OTTHUMG00000011732	ENST00000369971.2:c.19C>A	1.37:g.109493041G>T	ENSP00000358988:p.Leu7Ile	14	0		24	2	NM_001048210	O94861|Q8WYP8|Q8WYP9|Q9BU25	Missense_Mutation	SNP	ENST00000369971.2	37	CCDS41362.1	.	.	.	.	.	.	.	.	.	.	G	9.813	1.183590	0.21870	.	.	ENSG00000121940	ENST00000356970;ENST00000369971;ENST00000415331;ENST00000369969;ENST00000369968;ENST00000369976;ENST00000369970;ENST00000348264;ENST00000302500	T;T;T;T;T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34	5.5	3.64	0.41730	.	0.220574	0.39407	N	0.001378	T	0.47116	0.1428	M	0.72118	2.19	0.20764	N	0.999854	D;D;D;P	0.55385	0.971;0.971;0.971;0.955	P;P;P;P	0.52424	0.651;0.651;0.572;0.698	T	0.43798	-0.9369	10	0.87932	D	0	-11.5011	10.7633	0.46277	0.213:0.0:0.787:0.0	.	7;7;7;7	Q96S66-4;Q96S66-3;Q96S66-2;Q96S66	.;.;.;CLCC1_HUMAN	I	7	ENSP00000349456:L7I;ENSP00000358988:L7I;ENSP00000411591:L7I;ENSP00000358986:L7I;ENSP00000358985:L7I;ENSP00000358993:L7I;ENSP00000358987:L7I;ENSP00000337243:L7I;ENSP00000306552:L7I	ENSP00000306552:L7I	L	-	1	0	CLCC1	109294564	0.762000	0.28451	0.996000	0.52242	0.044000	0.14063	0.200000	0.17257	0.814000	0.34374	0.591000	0.81541	CTT	.		0.338	CLCC1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032405.1	NM_015127	
GPR123	84435	hgsc.bcm.edu;bcgsc.ca	37	10	134916323	134916323	+	Silent	SNP	G	G	A	rs368145789		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr10:134916323G>A	ENST00000392607.3	+	5	814	c.378G>A	c.(376-378)ccG>ccA	p.P126P	GPR123_ENST00000607359.1_Silent_p.P846P|GPR123_ENST00000392606.2_Silent_p.P29P	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	126					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		ACCAGCCACCGTACCCCAGGC	0.627																																					p.P126P		.											.	.	.	0			c.G378A						.	G		1,4405	2.1+/-5.4	0,1,2202	61.0	47.0	51.0		378	-5.5	0.0	10		51	0,8600		0,0,4300	no	coding-synonymous	GPR123	NM_001083909.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		126/561	134916323	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	84435	exon5			GCCACCGTACCCC	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.378G>A	10.37:g.134916323G>A		52	0		58	4	NM_001083909	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Silent	SNP	ENST00000392607.3	37	CCDS41580.1																																																																																			.		0.627	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051113.2		
ABCB7	22	hgsc.bcm.edu	37	X	74375943	74375943	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chrX:74375943G>T	ENST00000373394.3	-	1	172	c.165C>A	c.(163-165)taC>taA	p.Y55*	ABCB7_ENST00000339447.4_Nonsense_Mutation_p.Y55*|ABCB7_ENST00000253577.3_Nonsense_Mutation_p.Y55*			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	55					cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)			breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						ATCTCACCTGGTAGGCTCGAG	0.597											OREG0019879	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y55X		.											.	.	.	0			c.C165A						.						44.0	30.0	34.0					X																	74375943		2203	4300	6503	SO:0001587	stop_gained	22	exon1			CACCTGGTAGGCT	AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.165C>A	X.37:g.74375943G>T	ENSP00000362492:p.Tyr55*	100	0	1152	97	3	NM_001271697	G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Nonsense_Mutation	SNP	ENST00000373394.3	37		.	.	.	.	.	.	.	.	.	.	G	15.84	2.951734	0.53186	.	.	ENSG00000131269	ENST00000535115;ENST00000253577;ENST00000339447;ENST00000373394;ENST00000529949;ENST00000534524;ENST00000526404	.	.	.	4.5	0.625	0.17665	.	5.201040	0.00166	N	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	21.0376	3.6507	0.08202	0.3188:0.1896:0.4917:0.0	.	.	.	.	X	55;55;55;55;55;55;67	.	ENSP00000253577:Y55X	Y	-	3	2	ABCB7	74292668	0.680000	0.27605	0.180000	0.23079	0.030000	0.12068	0.693000	0.25497	0.098000	0.17522	0.513000	0.50165	TAC	.		0.597	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000057274.1	NM_004299	
ABCA3	21	hgsc.bcm.edu	37	16	2347794	2347794	+	Silent	SNP	G	G	A			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr16:2347794G>A	ENST00000301732.5	-	16	2725	c.2025C>T	c.(2023-2025)atC>atT	p.I675I	ABCA3_ENST00000382381.3_Silent_p.I617I	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	675	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	GGGCGATGCCGATGGAGAGCT	0.647																																					p.I675I		.											ABCA3,colon,carcinoma,0,1	ABCA3	0	0			c.C2025T						.						82.0	73.0	76.0					16																	2347794		2198	4300	6498	SO:0001819	synonymous_variant	21	exon16			GATGCCGATGGAG	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2025C>T	16.37:g.2347794G>A		21	0		61	3	NM_001089	B2RU09|Q54A95|Q6P5P9|Q92473	Silent	SNP	ENST00000301732.5	37	CCDS10466.1																																																																																			.		0.647	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089	
ADAMTSL2	9719	hgsc.bcm.edu	37	9	136404934	136404934	+	Silent	SNP	C	C	T	rs558563166	byFrequency	TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr9:136404934C>T	ENST00000354484.4	+	5	908	c.351C>T	c.(349-351)tgC>tgT	p.C117C	ADAMTSL2_ENST00000393060.1_Silent_p.C117C|ADAMTSL2_ENST00000393061.3_Silent_p.C226C	NM_001145320.1	NP_001138792.1	Q86TH1	ATL2_HUMAN	ADAMTS-like 2	117					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		AGGAGCAGTGCGTCTCCTTCA	0.652													C|||	2	0.000399361	0.0	0.0	5008	,	,		16099	0.0		0.0	False		,,,				2504	0.002				p.C117C		.											.	.	.	0			c.C351T						.						44.0	37.0	40.0					9																	136404934		1928	3728	5656	SO:0001819	synonymous_variant	9719	exon5			GCAGTGCGTCTCC	AB011177	CCDS6976.1	9q34.3	2005-01-12			ENSG00000197859	ENSG00000197859			14631	protein-coding gene	gene with protein product		612277				9628581, 14667842	Standard	NM_014694		Approved	KIAA0605	uc004cei.3	Q86TH1	OTTHUMG00000131706	ENST00000354484.4:c.351C>T	9.37:g.136404934C>T		61	0		68	4	NM_014694	B1B0D5|O60345	Silent	SNP	ENST00000354484.4	37	CCDS6976.1																																																																																			.		0.652	ADAMTSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254619.1	NM_014694	
TBXA2R	6915	hgsc.bcm.edu	37	19	3600542	3600542	+	Missense_Mutation	SNP	C	C	T	rs201738444		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr19:3600542C>T	ENST00000375190.4	-	2	484	c.91G>A	c.(91-93)Gcc>Acc	p.A31T	TBXA2R_ENST00000589966.1_Missense_Mutation_p.A31T|TBXA2R_ENST00000411851.3_Missense_Mutation_p.A31T|TBXA2R_ENST00000587717.1_5'Flank	NM_001060.5|NM_201636.2	NP_001051.1|NP_963998.2	P21731	TA2R_HUMAN	thromboxane A2 receptor	31					blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|second-messenger-mediated signaling (GO:0019932)|thromboxane A2 signaling pathway (GO:0038193)	acrosomal vesicle (GO:0001669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|thromboxane A2 receptor activity (GO:0004961)	p.A31T(1)		kidney(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)	AAGGAGGCGGCGAACCAGGGC	0.697																																					p.A31T		.											TBXA2R,NS,carcinoma,0,1	TBXA2R	0	1	Substitution - Missense(1)	prostate(1)	c.G91A						.						22.0	29.0	26.0					19																	3600542		2104	4196	6300	SO:0001583	missense	6915	exon2			AGGCGGCGAACCA		CCDS42467.1, CCDS54198.1	19p13.3	2014-09-17						"""GPCR / Class A : Prostanoid receptors"""	11608	protein-coding gene	gene with protein product		188070				1825698	Standard	NM_001060		Approved		uc021umv.1	P21731		ENST00000375190.4:c.91G>A	19.37:g.3600542C>T	ENSP00000364336:p.Ala31Thr	47	1		59	3	NM_201636	O75228|Q6DK52|Q9UCY1|Q9UCY2	Missense_Mutation	SNP	ENST00000375190.4	37	CCDS42467.1	.	.	.	.	.	.	.	.	.	.	C	16.83	3.230395	0.58777	.	.	ENSG00000006638	ENST00000411851;ENST00000375190	T;T	0.36699	1.24;1.24	4.55	-0.769	0.11009	.	0.152670	0.43747	D	0.000533	T	0.16300	0.0392	L	0.27053	0.805	0.35243	D	0.77803	B;P	0.39352	0.046;0.669	B;B	0.27076	0.004;0.076	T	0.26710	-1.0095	10	0.24483	T	0.36	-11.956	8.4517	0.32875	0.4913:0.2645:0.2442:0.0	.	31;31	P21731;E2QRJ2	TA2R_HUMAN;.	T	31	ENSP00000393333:A31T;ENSP00000364336:A31T	ENSP00000364336:A31T	A	-	1	0	TBXA2R	3551542	0.924000	0.31332	0.808000	0.32385	0.738000	0.42128	0.343000	0.19944	-0.195000	0.10382	0.305000	0.20034	GCC	.		0.697	TBXA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453081.2		
USP8	9101	hgsc.bcm.edu;ucsc.edu	37	15	50785054	50785054	+	Silent	SNP	C	C	T	rs199814360		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr15:50785054C>T	ENST00000396444.3	+	15	2729	c.2391C>T	c.(2389-2391)aaC>aaT	p.N797N	USP8_ENST00000425032.3_Silent_p.N691N|USP8_ENST00000433963.1_Silent_p.N797N|RP11-562A8.5_ENST00000560159.1_lincRNA|USP8_ENST00000307179.4_Silent_p.N797N	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	797	USP.				cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		GCCTATGTAACGCTCCACATT	0.363																																					p.N797N		.											.	.	.	0			c.C2391T						.						105.0	96.0	99.0					15																	50785054		2196	4293	6489	SO:0001819	synonymous_variant	9101	exon15			ATGTAACGCTCCA	D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.2391C>T	15.37:g.50785054C>T		23	0		40	6	NM_001128610	B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Silent	SNP	ENST00000396444.3	37	CCDS10137.1																																																																																			.		0.363	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254541.1	NM_005154	
CAMTA1	23261	hgsc.bcm.edu	37	1	7737779	7737779	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr1:7737779G>T	ENST00000303635.7	+	11	3107	c.2900G>T	c.(2899-2901)tGg>tTg	p.W967L	CAMTA1_ENST00000439411.2_Missense_Mutation_p.W967L	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	967					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CAGCACGACTGGCTGTCGTTG	0.552			T	WWTR1	epitheliod hemangioendothelioma																																p.W967L		.		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	CAMTA1,colon,carcinoma,0,1	CAMTA1	0	0			c.G2900T						.						85.0	77.0	80.0					1																	7737779		2203	4300	6503	SO:0001583	missense	23261	exon11			ACGACTGGCTGTC	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.2900G>T	1.37:g.7737779G>T	ENSP00000306522:p.Trp967Leu	29	0		29	2	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	37	CCDS30576.1	.	.	.	.	.	.	.	.	.	.	g	28.7	4.946697	0.92593	.	.	ENSG00000171735	ENST00000303635;ENST00000439411;ENST00000414738	T;T	0.22539	1.96;1.95	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.43590	0.1254	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.986	T	0.11817	-1.0572	10	0.27785	T	0.31	-10.396	18.5301	0.90989	0.0:0.0:1.0:0.0	.	967;967	Q9Y6Y1-2;Q9Y6Y1	.;CMTA1_HUMAN	L	967;967;54	ENSP00000306522:W967L;ENSP00000402561:W967L	ENSP00000306522:W967L	W	+	2	0	CAMTA1	7660366	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.807000	0.99171	2.382000	0.81193	0.555000	0.69702	TGG	.		0.552	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
IFT172	26160	hgsc.bcm.edu;ucsc.edu	37	2	27670404	27670404	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr2:27670404G>A	ENST00000260570.3	-	42	4740	c.4637C>T	c.(4636-4638)gCa>gTa	p.A1546V		NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	1546					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					ACTCTGGGCTGCAGAGCGCGT	0.498																																					p.A1546V		.											.	.	.	0			c.C4637T						.						147.0	137.0	140.0					2																	27670404		2203	4300	6503	SO:0001583	missense	26160	exon42			TGGGCTGCAGAGC	AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.4637C>T	2.37:g.27670404G>A	ENSP00000260570:p.Ala1546Val	12	0		23	4	NM_015662	A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Missense_Mutation	SNP	ENST00000260570.3	37	CCDS1755.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.241404	0.79912	.	.	ENSG00000138002	ENST00000260570	T	0.48522	0.81	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.61261	0.2333	M	0.66939	2.045	0.80722	D	1	D	0.58970	0.984	P	0.55824	0.785	T	0.61182	-0.7114	10	0.44086	T	0.13	-11.8015	15.9265	0.79621	0.0:0.0:1.0:0.0	.	1546	Q9UG01	IF172_HUMAN	V	1546	ENSP00000260570:A1546V	ENSP00000260570:A1546V	A	-	2	0	IFT172	27523908	1.000000	0.71417	0.480000	0.27341	0.305000	0.27757	9.340000	0.97038	2.558000	0.86282	0.561000	0.74099	GCA	.		0.498	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250213.2	NM_015662	
SMG8	55181	hgsc.bcm.edu	37	17	57288786	57288786	+	Silent	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr17:57288786G>T	ENST00000543872.2	+	2	1638	c.1374G>T	c.(1372-1374)gtG>gtT	p.V458V	CTD-2510F5.6_ENST00000577660.1_Intron|SMG8_ENST00000578922.1_Silent_p.V458V|SMG8_ENST00000300917.5_Silent_p.V458V|SMG8_ENST00000580498.1_Intron			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	458					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						TGTATGAGGTGGCTATTGATG	0.433																																					p.V458V		.											SMG8,middle_lobe,carcinoma,0,1	SMG8	0	0			c.G1374T						.						58.0	60.0	59.0					17																	57288786		2203	4300	6503	SO:0001819	synonymous_variant	55181	exon1			TGAGGTGGCTATT	AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.1374G>T	17.37:g.57288786G>T		43	0		43	2	NM_018149	Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Silent	SNP	ENST00000543872.2	37	CCDS11615.1																																																																																			.		0.433	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445960.2	NM_018149	
LINC01225	149086	broad.mit.edu	37	1	31972885	31972885	+	lincRNA	DEL	T	T	-	rs550285812		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr1:31972885delT	ENST00000418618.1	+	0	167				RNU6-40P_ENST00000384254.1_RNA																							ctgtttcctctttggtaaaca	0.522																																					.													.	.	.	0			.						.																																					0	.			TTCCTCTTTGGTA																													1.37:g.31972885delT		4	0		12	4	.		RNA	DEL	ENST00000418618.1	37																																																																																				.		0.522	RP11-439L8.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000011054.1		
DDX11	1663	broad.mit.edu	37	12	31242073	31242073	+	Silent	SNP	T	T	C	rs201079030	byFrequency	TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr12:31242073T>C	ENST00000407793.2	+	7	1031	c.780T>C	c.(778-780)ctT>ctC	p.L260L	DDX11_ENST00000545668.1_Silent_p.L260L|DDX11_ENST00000228264.6_Silent_p.L234L|DDX11_ENST00000350437.4_Silent_p.L260L|DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000542838.1_Silent_p.L260L	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	260	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					TGGTCTCCCTTGGCTCCCGGC	0.562										Multiple Myeloma(12;0.14)																											p.L260L													.	DDX11	188	0			c.T780C						.						75.0	71.0	72.0					12																	31242073		2203	4300	6503	SO:0001819	synonymous_variant	1663	exon7			CTCCCTTGGCTCC	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.780T>C	12.37:g.31242073T>C		70	1		75	8	NM_030653	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Silent	SNP	ENST00000407793.2	37	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.595810	0.00857	.	.	ENSG00000013573	ENST00000404673	.	.	.	3.64	-7.27	0.01461	.	.	.	.	.	T	0.30262	0.0759	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.30149	-0.9988	5	0.15499	T	0.54	.	2.8556	0.05571	0.0888:0.2713:0.2659:0.374	.	.	.	.	R	15	.	ENSP00000385471:W15R	W	+	1	0	DDX11	31133340	0.390000	0.25213	0.014000	0.15608	0.005000	0.04900	-0.541000	0.06099	-2.689000	0.00404	-4.583000	0.00004	TGG	.		0.562	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	
LOC728715	728715	broad.mit.edu	37	12	9716824	9716824	+	RNA	SNP	T	T	C	rs372094857		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr12:9716824T>C	ENST00000520314.1	+	0	4019																											CTAATGGCTATAATCATGCAA	0.418																																					.													.	.	.	0			.						.																																					0	.			TGGCTATAATCAT																													12.37:g.9716824T>C		126	1		136	7	.		RNA	SNP	ENST00000520314.1	37																																																																																				.		0.418	RP11-726G1.1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000381543.1		
DDX11	1663	broad.mit.edu;ucsc.edu	37	12	31242081	31242081	+	Missense_Mutation	SNP	G	G	A	rs201968272		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr12:31242081G>A	ENST00000407793.2	+	7	1039	c.788G>A	c.(787-789)cGg>cAg	p.R263Q	DDX11_ENST00000545668.1_Missense_Mutation_p.R263Q|DDX11_ENST00000228264.6_Missense_Mutation_p.R237Q|DDX11_ENST00000350437.4_Missense_Mutation_p.R263Q|DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000542838.1_Missense_Mutation_p.R263Q	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	263	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.		R -> Q (in WBRS; impairs the enzyme helicase activity by perturbing its DNA binding and DNA-dependent ATP hydrolysis). {ECO:0000269|PubMed:23033317}.		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.R263Q(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CTTGGCTCCCGGCAGGTAAAC	0.572										Multiple Myeloma(12;0.14)																											p.R263Q													DDX11,extremity,malignant_melanoma,0,1	DDX11	188	1	Substitution - Missense(1)	skin(1)	c.G788A						.						59.0	57.0	58.0					12																	31242081		2203	4300	6503	SO:0001583	missense	1663	exon7			GCTCCCGGCAGGT	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.788G>A	12.37:g.31242081G>A	ENSP00000384703:p.Arg263Gln	59	0		66	8	NM_030653	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	37	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.647258	0.67358	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000228264;ENST00000438391;ENST00000545668;ENST00000350437	T;T;T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38;-1.38;-1.38	3.64	3.64	0.41730	DEAD2 (1);Helicase-like, DEXD box c2 type (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.122940	0.53938	N	0.000053	D	0.92678	0.7673	H	0.97682	4.055	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.971;0.999;0.998;0.999	D	0.94477	0.7690	10	0.66056	D	0.02	.	12.9062	0.58154	0.0:0.0:1.0:0.0	.	263;263;263;263	B4DZY1;Q96FC9;Q96FC9-4;Q96FC9-2	.;DDX11_HUMAN;.;.	Q	263;263;237;234;263;263	ENSP00000443426:R263Q;ENSP00000384703:R263Q;ENSP00000228264:R237Q;ENSP00000407646:R234Q;ENSP00000440402:R263Q;ENSP00000309965:R263Q	ENSP00000228264:R237Q	R	+	2	0	DDX11	31133348	1.000000	0.71417	0.994000	0.49952	0.079000	0.17450	6.830000	0.75319	1.858000	0.53909	0.505000	0.49811	CGG	G|0.994;A|0.006		0.572	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	
TMEM87A	25963	broad.mit.edu	37	15	42556290	42556290	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr15:42556290G>T	ENST00000389834.4	-	4	667	c.403C>A	c.(403-405)Cag>Aag	p.Q135K	TMEM87A_ENST00000568432.1_5'UTR|TMEM87A_ENST00000307216.6_Missense_Mutation_p.Q135K|TMEM87A_ENST00000448392.1_Missense_Mutation_p.Q74K	NM_015497.3	NP_056312.2	Q8NBN3	TM87A_HUMAN	transmembrane protein 87A	135						integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24		all_cancers(109;4.28e-16)|all_epithelial(112;1.04e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;1.03e-06)		AAGATTACCTGTGTTTTAAAG	0.323																																					p.Q135K													.	TMEM87A	56	0			c.C403A						.						118.0	118.0	118.0					15																	42556290		2202	4297	6499	SO:0001583	missense	25963	exon4			TTACCTGTGTTTT	AF132733	CCDS32205.1, CCDS45243.1, CCDS66742.1	15q15.1	2005-10-30				ENSG00000103978			24522	protein-coding gene	gene with protein product						12477932	Standard	XM_005254287		Approved	DKFZP564G2022	uc021sjr.1	Q8NBN3		ENST00000389834.4:c.403C>A	15.37:g.42556290G>T	ENSP00000374484:p.Gln135Lys	40	0		46	3	NM_001110503	Q6NT77|Q8NCA4|Q9BS46|Q9P103|Q9Y3Y7	Missense_Mutation	SNP	ENST00000389834.4	37	CCDS32205.1	.	.	.	.	.	.	.	.	.	.	G	19.25	3.791506	0.70452	.	.	ENSG00000103978	ENST00000389834;ENST00000448392;ENST00000535305;ENST00000307216	.	.	.	5.12	5.12	0.69794	.	0.220988	0.39544	N	0.001336	T	0.64538	0.2607	L	0.32530	0.975	0.36455	D	0.866337	B;B;D	0.58268	0.057;0.068;0.982	B;B;D	0.70227	0.023;0.014;0.968	T	0.67277	-0.5711	9	0.37606	T	0.19	-8.432	13.9408	0.64054	0.0:0.0:1.0:0.0	.	135;74;135	Q8NBN3;Q8NBN3-3;Q8NBN3-2	TM87A_HUMAN;.;.	K	135;74;111;135	.	ENSP00000305894:Q135K	Q	-	1	0	TMEM87A	40343582	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.235000	0.58666	2.646000	0.89796	0.655000	0.94253	CAG	.		0.323	TMEM87A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420482.2	NM_015497	
LRRC37A4P	55073	broad.mit.edu	37	17	43587569	43587569	+	RNA	SNP	G	G	C	rs202189074		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr17:43587569G>C	ENST00000579913.1	-	0	1444				RP11-798G7.5_ENST00000253803.2_RNA	NR_002940.2				leucine rich repeat containing 37, member A4, pseudogene																		aactccgtctgaaaagaaaag	0.443																																					.													.	.	.	0			.						.																																					0	.			CCGTCTGAAAAGA	AK000982		17q21.31	2014-04-01	2012-03-07	2012-03-07	ENSG00000214425	ENSG00000214425			25479	pseudogene	pseudogene			"""leucine rich repeat containing 37, member A4 (pseudogene)"""	LRRC37A4			Standard	NR_002940		Approved	FLJ10120	uc031rhd.1		OTTHUMG00000179212		17.37:g.43587569G>C		74	1		75	3	.		RNA	SNP	ENST00000579913.1	37																																																																																				G|1.000;|0.000		0.443	LRRC37A4P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000445300.1	NR_002940	
AC017002.1	0	broad.mit.edu	37	2	112252464	112252464	+	lincRNA	SNP	G	G	A	rs1128295		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr2:112252464G>A	ENST00000455309.1	+	0	390				AC017002.2_ENST00000432268.1_lincRNA																							ATACTCACCAGGGAGAGGCTG	0.537																																					.													.	.	.	0			.						.																																					0	.			TCACCAGGGAGAG																													2.37:g.112252464G>A		72	1		66	5	.		RNA	SNP	ENST00000455309.1	37																																																																																				G|0.500;A|0.500		0.537	AC017002.1-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000332149.1		
FRG1B	284802	broad.mit.edu;bcgsc.ca	37	20	29632680	29632680	+	Silent	SNP	G	G	A	rs4892355		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr20:29632680G>A	ENST00000278882.3	+	8	875	c.495G>A	c.(493-495)aaG>aaA	p.K165K	FRG1B_ENST00000358464.4_Silent_p.K165K			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	165										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TTCTTAAAAAGGCTCAGAAAG	0.313																																					.													.	FRG1B	181	0			.						.																																			SO:0001819	synonymous_variant	0	.			TAAAAAGGCTCAG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.495G>A	20.37:g.29632680G>A		259	3		325	16	.	C4AME5	Silent	SNP	ENST00000278882.3	37																																																																																				G|0.500;A|0.500		0.313	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
TPTE	7179	broad.mit.edu	37	21	10916473	10916473	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr21:10916473C>A	ENST00000361285.4	-	20	1502	c.1173G>T	c.(1171-1173)aaG>aaT	p.K391N	TPTE_ENST00000342420.5_Missense_Mutation_p.K353N|TPTE_ENST00000415664.2_Intron|TPTE_ENST00000298232.7_Missense_Mutation_p.K373N	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	391	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CAACATATCTCTTCTGAAAAG	0.338																																					p.K391N													.	TPTE	513	0			c.G1173T						.						106.0	99.0	101.0					21																	10916473		2203	4300	6503	SO:0001583	missense	7179	exon20			ATATCTCTTCTGA	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1173G>T	21.37:g.10916473C>A	ENSP00000355208:p.Lys391Asn	174	0		223	6	NM_199261	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	37	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.398316	0.00198	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.98585	-5.01;-5.01;-5.01	1.79	1.79	0.24919	Phosphatase tensin type (1);	0.135724	0.64402	N	0.000003	D	0.89795	0.6818	N	0.02412	-0.56	0.19300	N	0.999971	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.002;0.001	T	0.82331	-0.0510	10	0.12766	T	0.61	-9.0395	4.8086	0.13331	0.6724:0.3276:0.0:0.0	.	353;373;391	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	N	373;391;353	ENSP00000298232:K373N;ENSP00000355208:K391N;ENSP00000344441:K353N	ENSP00000298232:K373N	K	-	3	2	TPTE	9938344	0.322000	0.24634	0.981000	0.43875	0.164000	0.22412	0.135000	0.15952	0.160000	0.19432	-1.447000	0.01057	AAG	.		0.338	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1		
MUC4	4585	broad.mit.edu	37	3	195508133	195508133	+	Missense_Mutation	SNP	G	G	A	rs202065387		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr3:195508133G>A	ENST00000463781.3	-	2	10777	c.10318C>T	c.(10318-10320)Cct>Tct	p.P3440S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P3440S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P3440S(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAACAGGGGTGGCGTGA	0.592																																					p.P3440S													MUC4_ENST00000463781,NS,carcinoma,0,4	MUC4	1505	2	Substitution - Missense(2)	endometrium(2)	c.C10318T						.						30.0	24.0	26.0					3																	195508133		685	1583	2268	SO:0001583	missense	4585	exon2			GAACAGGGGTGGC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10318C>T	3.37:g.195508133G>A	ENSP00000417498:p.Pro3440Ser	75	0		99	8	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	3.286	-0.146045	0.06627	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29917	1.58;1.55	.	.	.	.	.	.	.	.	T	0.22003	0.0530	N	0.14661	0.345	0.09310	N	1	P	0.48350	0.909	P	0.50440	0.641	T	0.15809	-1.0424	6	.	.	.	.	.	.	.	.	3312	E7ESK3	.	S	3440	ENSP00000417498:P3440S;ENSP00000420243:P3440S	.	P	-	1	0	MUC4	196992912	0.016000	0.18221	0.006000	0.13384	0.005000	0.04900	-0.684000	0.05173	0.088000	0.17205	0.089000	0.15464	CCT	.		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
GUSBP1	728411	broad.mit.edu	37	5	21490977	21490978	+	RNA	DEL	TT	TT	-			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr5:21490977_21490978delTT	ENST00000607545.1	+	0	179					NR_027026.1		Q15486	GUSP1_HUMAN	glucuronidase, beta pseudogene 1						carbohydrate metabolic process (GO:0005975)|nervous system development (GO:0007399)|skeletal system development (GO:0001501)		hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)										aattaaaaaattaaattaaaaa	0.52																																					.													.	.	.	0			.						.																																					0	.			AAAAAATTAAATT	BC064850, X75940		5p14.3	2012-10-04			ENSG00000183666	ENSG00000183666			13670	pseudogene	pseudogene						8565635	Standard	NR_027026		Approved		uc010iub.3	Q15486	OTTHUMG00000162474		5.37:g.21490977_21490978delTT		8	0		17	3	.	A6NLY8|A8K1B7|Q969T8|Q9BUH2	RNA	DEL	ENST00000607545.1	37																																																																																				.		0.520	GUSBP1-006	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000470546.1	NG_008324	
FAM46A	55603	broad.mit.edu	37	6	82461728	82461742	+	In_Frame_Del	DEL	CCGCCGAAGTCGCCG	CCGCCGAAGTCGCCG	-	rs375746695	byFrequency	TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr6:82461728_82461742delCCGCCGAAGTCGCCG	ENST00000320172.6	-	2	431_445	c.117_131delCGGCGACTTCGGCGG	c.(115-132)ggcggcgacttcggcggt>ggt	p.39_44GGDFGG>G	FAM46A_ENST00000369756.3_In_Frame_Del_p.120_125GGDFGG>G|FAM46A_ENST00000369754.3_In_Frame_Del_p.58_63GGDFGG>G	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	39			Missing. {ECO:0000269|PubMed:12054608, ECO:0000269|PubMed:16545789}.		regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		gctgccgccaccgccgaagtcgccgccgccgaagt	0.67																																					p.39_44del													FAM46A,colon,carcinoma,+1,1	FAM46A	37	0			c.117_131del						.																																			SO:0001651	inframe_deletion	55603	exon2			CCGCCACCGCCGA	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.117_131delCGGCGACTTCGGCGG	6.37:g.82461728_82461742delCCGCCGAAGTCGCCG	ENSP00000318298:p.Gly39_Gly43del	4	0		5	1	NM_017633	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	In_Frame_Del	DEL	ENST00000320172.6	37	CCDS34489.1																																																																																			.		0.670	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
CCT6P1	643253	broad.mit.edu	37	7	65226641	65226641	+	RNA	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr7:65226641G>T	ENST00000442266.1	+	0	1167				SNORA15_ENST00000384058.1_RNA					chaperonin containing TCP1, subunit 6 (zeta) pseudogene 1																		AGGTTCTTGCGCAGAATTCTG	0.383																																					.													.	.	.	0			.						.																																					0	.			TCTTGCGCAGAAT	BC052238, BC073761		7q11.21	2010-06-29	2008-09-22	2008-09-22	ENSG00000228409	ENSG00000228409			33094	pseudogene	pseudogene			"""chaperonin containing TCP1, subunit 6A (zeta 1) pseudogene 1"""	CCT6AP1			Standard	NR_003110		Approved		uc003tug.3		OTTHUMG00000156733		7.37:g.65226641G>T		53	0		75	3	.		RNA	SNP	ENST00000442266.1	37																																																																																				.		0.383	CCT6P1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000345507.1	NR_003110	
NUDT10	170685	broad.mit.edu	37	X	51076024	51076024	+	Silent	SNP	G	G	A	rs143435240		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chrX:51076024G>A	ENST00000376006.3	+	2	427	c.207G>A	c.(205-207)gaG>gaA	p.E69E	NUDT10_ENST00000356450.2_Silent_p.E69E	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	234					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.E69E(8)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					TGTACGAAGAGGCGGGAGTCA	0.657																																					p.E69E	NSCLC(90;1817 2035 37909 38249)												.	NUDT10	28	8	Substitution - coding silent(8)	endometrium(5)|cervix(1)|prostate(1)|lung(1)	c.G207A						.						52.0	62.0	59.0					X																	51076024		2203	4300	6503	SO:0001819	synonymous_variant	170685	exon2			CGAAGAGGCGGGA	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.207G>A	X.37:g.51076024G>A		71	1		96	8	NM_153183	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																			.		0.657	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056578.1	NM_153183	
MED12	9968	broad.mit.edu	37	X	70349589	70349589	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chrX:70349589G>T	ENST00000374080.3	+	27	3783	c.3751G>T	c.(3751-3753)Gag>Tag	p.E1251*	MED12_ENST00000333646.6_Nonsense_Mutation_p.E1251*|MED12_ENST00000374102.1_Nonsense_Mutation_p.E1251*			Q93074	MED12_HUMAN	mediator complex subunit 12	1251					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					AGAACTTCCAGAGGAGGAGGG	0.582			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome				OREG0019857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E1251X				Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	.	MED12	984	0			c.G3751T						.						35.0	42.0	40.0					X																	70349589		2137	4228	6365	SO:0001587	stop_gained	9968	exon27			CTTCCAGAGGAGG	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.3751G>T	X.37:g.70349589G>T	ENSP00000363193:p.Glu1251*	28	0	1121	35	3	NM_005120	O15410|O75557|Q9UHV6|Q9UND7	Nonsense_Mutation	SNP	ENST00000374080.3	37	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	.	44	10.850751	0.99477	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	.	.	.	5.38	5.38	0.77491	.	0.109105	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	-20.9619	18.515	0.90933	0.0:0.0:1.0:0.0	.	.	.	.	X	1251;1251;1251;1251;1219	.	ENSP00000333125:E1251X	E	+	1	0	MED12	70266314	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.113000	0.89568	2.401000	0.81631	0.468000	0.43344	GAG	.		0.582	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120	
OR2T34	127068	ucsc.edu	37	1	248737734	248737734	+	Missense_Mutation	SNP	G	G	A	rs139616012		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr1:248737734G>A	ENST00000328782.2	-	1	346	c.325C>T	c.(325-327)Cac>Tac	p.H109Y		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	109						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGGGTCAGGTGGAAGAACATC	0.542																																					p.H109Y													OR2T34,NS,carcinoma,0,4	OR2T34	72	0			c.C325T						.						120.0	109.0	112.0					1																	248737734		2163	4276	6439	SO:0001583	missense	127068	exon1			TCAGGTGGAAGAA	BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.325C>T	1.37:g.248737734G>A	ENSP00000330904:p.His109Tyr	20	0		32	4	NM_001001821	B2RNJ8|Q6IEY5|Q96R31	Missense_Mutation	SNP	ENST00000328782.2	37	CCDS31120.1	296	0.13553113553113552	69	0.1402439024390244	61	0.1685082872928177	71	0.12412587412587413	95	0.12532981530343007	.	0.011	-1.710055	0.00712	.	.	ENSG00000183310	ENST00000328782	T	0.01304	5.03	2.34	-0.481	0.12082	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00012	0.0000	N	0.00109	-2.105	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.38908	-0.9639	8	0.02654	T	1	.	4.2299	0.10597	0.597:0.1723:0.2307:0.0	.	109	Q8NGX1	O2T34_HUMAN	Y	109	ENSP00000330904:H109Y	ENSP00000330904:H109Y	H	-	1	0	OR2T34	246804357	0.001000	0.12720	0.040000	0.18447	0.392000	0.30506	0.697000	0.25556	-0.366000	0.08064	-1.344000	0.01245	CAC	.		0.542	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097138.1	NM_001001821	
STXBP5	134957	ucsc.edu	37	6	147648314	147648314	+	Missense_Mutation	SNP	C	C	T	rs368337313		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr6:147648314C>T	ENST00000321680.6	+	18	1982	c.1982C>T	c.(1981-1983)gCa>gTa	p.A661V	STXBP5_ENST00000367480.3_Missense_Mutation_p.A661V|STXBP5_ENST00000179882.6_Missense_Mutation_p.A332V|STXBP5_ENST00000367481.3_Missense_Mutation_p.A661V	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	661					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		CTCCAGAAAGCAGTGCTGCTC	0.433																																					p.A661V													.	STXBP5	163	0			c.C1982T						.						142.0	134.0	136.0					6																	147648314		2203	4300	6503	SO:0001583	missense	134957	exon18			AGAAAGCAGTGCT	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.1982C>T	6.37:g.147648314C>T	ENSP00000321826:p.Ala661Val	21	0		39	4	NM_139244	Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Missense_Mutation	SNP	ENST00000321680.6	37	CCDS47499.1	.	.	.	.	.	.	.	.	.	.	C	18.42	3.619583	0.66787	.	.	ENSG00000164506	ENST00000367479;ENST00000367481;ENST00000321680;ENST00000367480;ENST00000179882	T;T;T;T	0.65732	2.61;2.63;2.7;-0.17	6.07	6.07	0.98685	.	0.157793	0.64402	D	0.000020	T	0.41026	0.1141	N	0.22421	0.69	0.47905	D	0.999542	B;B;B;B	0.24882	0.021;0.11;0.113;0.055	B;B;B;B	0.29862	0.033;0.108;0.046;0.03	T	0.27571	-1.0070	10	0.25751	T	0.34	.	20.6525	0.99598	0.0:1.0:0.0:0.0	.	661;2;661;332	Q5T5C0-2;Q5JRH1;Q5T5C0;B3KXX0	.;.;STXB5_HUMAN;.	V	8;661;661;661;332	ENSP00000356451:A661V;ENSP00000321826:A661V;ENSP00000356450:A661V;ENSP00000179882:A332V	ENSP00000179882:A332V	A	+	2	0	STXBP5	147690007	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.959000	0.70339	2.890000	0.99128	0.585000	0.79938	GCA	.		0.433	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1		
FER1L6	654463	ucsc.edu	37	8	125081641	125081641	+	Silent	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr8:125081641G>T	ENST00000522917.1	+	29	3965	c.3759G>T	c.(3757-3759)ggG>ggT	p.G1253G	FER1L6_ENST00000399018.1_Silent_p.G1253G|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1253						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TAGAAGATGGGCCAAAGAAGA	0.458																																					p.G1253G													.	FER1L6	268	0			c.G3759T						.						164.0	160.0	161.0					8																	125081641		1902	4116	6018	SO:0001819	synonymous_variant	654463	exon29			AGATGGGCCAAAG	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.3759G>T	8.37:g.125081641G>T		32	0		34	4	NM_001039112		Silent	SNP	ENST00000522917.1	37	CCDS43767.1																																																																																			.		0.458	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
CACNB2	783	ucsc.edu	37	10	18690927	18690927	+	Silent	SNP	C	C	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr10:18690927C>T	ENST00000324631.7	+	3	348	c.288C>T	c.(286-288)cgC>cgT	p.R96R	CACNB2_ENST00000377319.3_Silent_p.R41R|CACNB2_ENST00000352115.6_Silent_p.R96R|CACNB2_ENST00000377315.4_Silent_p.R48R|CACNB2_ENST00000377329.4_Silent_p.R42R|CACNB2_ENST00000377331.2_Silent_p.R68R|CACNB2_ENST00000377328.1_Silent_p.R96R|CACNB2_ENST00000282343.8_Silent_p.R68R|CACNB2_ENST00000396576.2_Silent_p.R41R	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit	96					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGGCAGTGCGCAGAGAAGCGG	0.527																																					p.R96R													.	CACNB2	220	0			c.C288T						.						73.0	62.0	66.0					10																	18690927		2203	4300	6503	SO:0001819	synonymous_variant	783	exon3			AGTGCGCAGAGAA	U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764	ENST00000324631.7:c.288C>T	10.37:g.18690927C>T		22	0		38	4	NM_201596	A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Silent	SNP	ENST00000324631.7	37	CCDS7125.1																																																																																			.		0.527	CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047072.2	NM_000724	
ZNF624	57547	ucsc.edu;bcgsc.ca	37	17	16527621	16527621	+	Silent	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr17:16527621G>T	ENST00000311331.7	-	6	670	c.579C>A	c.(577-579)ctC>ctA	p.L193L		NM_020787.3	NP_065838.2	Q9P2J8	ZN624_HUMAN	zinc finger protein 624	193					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	26				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		GAGTCTTCTTGAGTGGAATTA	0.388																																					p.L193L	NSCLC(186;1023 2134 13330 38202 39800)												.	ZNF624	91	0			c.C579A						.						91.0	92.0	92.0					17																	16527621		2203	4300	6503	SO:0001819	synonymous_variant	57547	exon6			CTTCTTGAGTGGA	AB037770	CCDS11180.1	17p11.2	2013-01-08			ENSG00000197566	ENSG00000197566		"""Zinc fingers, C2H2-type"", ""-"""	29254	protein-coding gene	gene with protein product						10718198	Standard	NM_020787		Approved	KIAA1349	uc010cpi.2	Q9P2J8	OTTHUMG00000058996	ENST00000311331.7:c.579C>A	17.37:g.16527621G>T		47	0		42	4	NM_020787	Q3SY62|Q3SY63|Q6ZN27	Silent	SNP	ENST00000311331.7	37	CCDS11180.1																																																																																			.		0.388	ZNF624-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130512.3	XM_047617	
LPIN2	9663	ucsc.edu	37	18	2923829	2923829	+	Silent	SNP	C	C	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr18:2923829C>T	ENST00000261596.4	-	16	2356	c.2118G>A	c.(2116-2118)caG>caA	p.Q706Q	RP11-737O24.5_ENST00000608032.1_RNA	NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	706	C-LIP.				cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		CTTTGCCCAGCTGTGGGAGAA	0.488																																					p.Q706Q													.	LPIN2	75	0			c.G2118A						.						150.0	136.0	141.0					18																	2923829		2203	4300	6503	SO:0001819	synonymous_variant	9663	exon16			GCCCAGCTGTGGG	D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.2118G>A	18.37:g.2923829C>T		24	0		31	4	NM_014646	A7MD25|D3DUH3	Silent	SNP	ENST00000261596.4	37	CCDS11829.1																																																																																			.		0.488	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254363.2	NM_014646	
MAPK12	6300	ucsc.edu	37	22	50694524	50694524	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr22:50694524G>T	ENST00000215659.8	-	7	924	c.609C>A	c.(607-609)taC>taA	p.Y203*	MAPK12_ENST00000497036.1_5'UTR|MAPK12_ENST00000395780.1_Nonsense_Mutation_p.Y113*	NM_002969.3	NP_002960.2	P53778	MK12_HUMAN	mitogen-activated protein kinase 12	203	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle arrest (GO:0007050)|DNA damage induced protein phosphorylation (GO:0006975)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of peptidase activity (GO:0010952)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	8		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCGTCTGCGTGTAGCGCATCC	0.617																																					p.Y203X													.	MAPK12	43	0			c.C609A						.						51.0	52.0	52.0					22																	50694524		2202	4299	6501	SO:0001587	stop_gained	6300	exon7			CTGCGTGTAGCGC	U66243	CCDS14089.1	22q13.3	2012-05-08			ENSG00000188130	ENSG00000188130	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6874	protein-coding gene	gene with protein product		602399		SAPK3		9169156	Standard	NM_002969		Approved	ERK6, PRKM12, p38gamma, SAPK-3	uc003bkm.1	P53778	OTTHUMG00000030145	ENST00000215659.8:c.609C>A	22.37:g.50694524G>T	ENSP00000215659:p.Tyr203*	18	0		21	4	NM_002969	Q14260|Q6IC53|Q99588|Q99672	Nonsense_Mutation	SNP	ENST00000215659.8	37	CCDS14089.1	.	.	.	.	.	.	.	.	.	.	G	39	7.822464	0.98510	.	.	ENSG00000188130	ENST00000438835;ENST00000395780;ENST00000215659	.	.	.	4.24	3.2	0.36748	.	0.000000	0.31167	U	0.008121	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.5955	9.491	0.38960	0.2319:0.0:0.7681:0.0	.	.	.	.	X	193;113;203	.	ENSP00000215659:Y203X	Y	-	3	2	MAPK12	49036651	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	1.188000	0.32102	0.985000	0.38656	0.561000	0.74099	TAC	.		0.617	MAPK12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074999.2	NM_002969	
GPATCH2	55105	bcgsc.ca	37	1	217604610	217604610	+	Silent	SNP	T	T	C			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr1:217604610T>C	ENST00000366935.3	-	10	1574	c.1464A>G	c.(1462-1464)cgA>cgG	p.R488R		NM_018040.2	NP_060510.1	Q9NW75	GPTC2_HUMAN	G patch domain containing 2	488	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.				negative regulation of phosphatase activity (GO:0010923)		nucleic acid binding (GO:0003676)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)	35				OV - Ovarian serous cystadenocarcinoma(81;0.0397)|all cancers(67;0.0744)|GBM - Glioblastoma multiforme(131;0.0872)		CCTTGCCATCTCGTCCAAGGC	0.483																																					p.R488R													GPATCH2,NS,carcinoma,-2,1	GPATCH2	53	0			c.A1464G						.						129.0	133.0	132.0					1																	217604610		2203	4300	6503	SO:0001819	synonymous_variant	55105	exon10			GCCATCTCGTCCA	AK001114	CCDS1518.1, CCDS73031.1	1q41	2013-01-28		2006-12-13	ENSG00000092978	ENSG00000092978		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""G patch domain containing"""	25499	protein-coding gene	gene with protein product	"""cancer/testis antigen 110"", ""protein phosphatase 1, regulatory subunit 30"""			GPATC2		19432882, 15375528	Standard	XM_005273174		Approved	FLJ10252, CT110, PPP1R30	uc001hlf.1	Q9NW75	OTTHUMG00000000527	ENST00000366935.3:c.1464A>G	1.37:g.217604610T>C		42	0		57	4	NM_018040	Q5VYK7|Q5VYK8|Q86YE7	Silent	SNP	ENST00000366935.3	37	CCDS1518.1																																																																																			.		0.483	GPATCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001272.1	NM_018040	
DNAH6	1768	bcgsc.ca	37	2	84822773	84822773	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr2:84822773A>G	ENST00000237449.6	+	17	2736	c.2728A>G	c.(2728-2730)Aaa>Gaa	p.K910E	DNAH6_ENST00000398278.2_Missense_Mutation_p.K910E|DNAH6_ENST00000389394.3_Missense_Mutation_p.K910E			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	910	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TTCATAGTCCAAATTTGATTG	0.308																																					p.K910E													.	DNAH6	194	0			c.A2728G						.						42.0	35.0	37.0					2																	84822773		692	1591	2283	SO:0001583	missense	1768	exon18			TAGTCCAAATTTG	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.2728A>G	2.37:g.84822773A>G	ENSP00000237449:p.Lys910Glu	27	0		47	4	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	A	6.108	0.388200	0.11581	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.61040	0.14;0.14;0.14	5.88	5.88	0.94601	Dynein heavy chain, domain-2 (1);	.	.	.	.	T	0.37404	0.1002	N	0.12182	0.205	0.28229	N	0.926196	B	0.02656	0.0	B	0.09377	0.004	T	0.08932	-1.0698	9	0.05436	T	0.98	.	15.2791	0.73767	1.0:0.0:0.0:0.0	.	910	Q9C0G6	DYH6_HUMAN	E	910	ENSP00000374045:K910E;ENSP00000381326:K910E;ENSP00000237449:K910E	ENSP00000237449:K910E	K	+	1	0	DNAH6	84676284	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.222000	0.65277	2.243000	0.73865	0.528000	0.53228	AAA	.		0.308	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
CCDC14	64770	bcgsc.ca	37	3	123633883	123633883	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr3:123633883C>T	ENST00000488653.2	-	13	2695	c.2605G>A	c.(2605-2607)Gct>Act	p.A869T	CCDC14_ENST00000489746.1_Missense_Mutation_p.A669T|CCDC14_ENST00000483247.1_5'UTR|CCDC14_ENST00000433542.2_Missense_Mutation_p.A828T|CCDC14_ENST00000485727.1_Missense_Mutation_p.A669T|CCDC14_ENST00000310351.4_Missense_Mutation_p.A709T			Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	869					substantia nigra development (GO:0021762)	centrosome (GO:0005813)				NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)	21		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		TTGGTGGCAGCAGGGATCTTA	0.458																																					p.A828T													.	CCDC14	97	0			c.G2482A						.						120.0	106.0	110.0					3																	123633883		2203	4300	6503	SO:0001583	missense	64770	exon12			TGGCAGCAGGGAT	AL122079	CCDS3025.2	3q21.1	2014-03-20			ENSG00000175455	ENSG00000175455			25766	protein-coding gene	gene with protein product						12477932	Standard	NM_022757		Approved	FLJ12892, DKFZp434L1050	uc010hrt.3	Q49A88	OTTHUMG00000153005	ENST00000488653.2:c.2605G>A	3.37:g.123633883C>T	ENSP00000420180:p.Ala869Thr	41	0		40	4	NM_022757	B7Z2T2|B8ZZ41|B8ZZ58|D3DN98|Q7Z3N3|Q86T30|Q8IWF8|Q8WUJ8|Q96K47|Q9H9A3|Q9UFH0	Missense_Mutation	SNP	ENST00000488653.2	37		.	.	.	.	.	.	.	.	.	.	C	11.25	1.584681	0.28268	.	.	ENSG00000175455	ENST00000488653;ENST00000310351;ENST00000485727;ENST00000489746;ENST00000433542;ENST00000409697	T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87	5.23	2.33	0.28932	.	0.826842	0.10911	N	0.620547	T	0.28699	0.0711	L	0.40543	1.245	0.09310	N	1	B;B;B	0.25809	0.135;0.135;0.081	B;B;B	0.23852	0.049;0.049;0.049	T	0.24870	-1.0148	10	0.36615	T	0.2	.	1.9401	0.03345	0.1699:0.481:0.1882:0.1608	.	869;828;710	Q49A88;Q49A88-6;Q49A88-5	CCD14_HUMAN;.;.	T	869;709;669;669;828;850	ENSP00000420180:A869T;ENSP00000312031:A709T;ENSP00000418002:A669T;ENSP00000418403:A669T;ENSP00000395706:A828T;ENSP00000386866:A850T	ENSP00000312031:A709T	A	-	1	0	CCDC14	125116573	0.000000	0.05858	0.390000	0.26220	0.898000	0.52572	-0.171000	0.09883	0.717000	0.32145	0.591000	0.81541	GCT	.		0.458	CCDC14-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_022757	
DDX60	55601	bcgsc.ca	37	4	169214990	169214990	+	Missense_Mutation	SNP	C	C	A	rs146995893		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr4:169214990C>A	ENST00000393743.3	-	7	1121	c.830G>T	c.(829-831)cGc>cTc	p.R277L		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	277					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		TCCTAAAAAGCGATGGTACAT	0.408																																					p.R277L													.	DDX60	304	0			c.G830T						.						114.0	118.0	116.0					4																	169214990		2203	4300	6503	SO:0001583	missense	55601	exon7			AAAAAGCGATGGT	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.830G>T	4.37:g.169214990C>A	ENSP00000377344:p.Arg277Leu	50	0		66	4	NM_017631	Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	37	CCDS34097.1	.	.	.	.	.	.	.	.	.	.	C	9.541	1.113485	0.20795	.	.	ENSG00000137628	ENST00000393743	T	0.17528	2.27	4.12	-4.33	0.03677	.	1.231740	0.05507	N	0.559471	T	0.12944	0.0314	L	0.43152	1.355	0.09310	N	1	B	0.27380	0.177	B	0.25614	0.062	T	0.38628	-0.9652	10	0.08179	T	0.78	.	11.5041	0.50454	0.0:0.277:0.0:0.723	.	277	Q8IY21	DDX60_HUMAN	L	277	ENSP00000377344:R277L	ENSP00000377344:R277L	R	-	2	0	DDX60	169451565	0.000000	0.05858	0.000000	0.03702	0.896000	0.52359	-0.263000	0.08670	-0.857000	0.04115	-0.259000	0.10710	CGC	C|1.000;T|0.000		0.408	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
SLC2A12	154091	bcgsc.ca	37	6	134350693	134350693	+	Silent	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr6:134350693G>T	ENST00000275230.5	-	2	425	c.270C>A	c.(268-270)gcC>gcA	p.A90A		NM_145176.2	NP_660159.1	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 12	90					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|large_intestine(6)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	17	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		AGGCAAGGAGGGCTCCAATGA	0.512																																					p.A90A	Melanoma(122;1663 1672 14489 35294 41228)												.	SLC2A12	43	0			c.C270A						.						94.0	89.0	90.0					6																	134350693		2203	4300	6503	SO:0001819	synonymous_variant	154091	exon2			AAGGAGGGCTCCA	AL035699	CCDS5169.1	6q23.2	2013-05-22			ENSG00000146411	ENSG00000146411		"""Solute carriers"""	18067	protein-coding gene	gene with protein product		610372				11780753, 11832379	Standard	XM_006715349		Approved	GLUT12, GLUT8	uc003qem.1	Q8TD20	OTTHUMG00000015611	ENST00000275230.5:c.270C>A	6.37:g.134350693G>T		20	0		10	3	NM_145176	B3KV17|Q7Z6U3|Q96MR8	Silent	SNP	ENST00000275230.5	37	CCDS5169.1																																																																																			.		0.512	SLC2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042302.1		
RPS3AP34	100271260	bcgsc.ca	37	8	12428040	12428040	+	IGR	SNP	C	C	A	rs4115597		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr8:12428040C>A								AC130352.1 (43690 upstream) : AC068587.2 (7473 downstream)																							GATAAATTGGCAAACCTTTTC	0.398																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	100271260	.			AATTGGCAAACCT																													8.37:g.12428040C>A		26	0		30	5	.		RNA	SNP		37																																																																																				C|0.833;A|0.167	0	0.398								
FAM21EP	100421577	bcgsc.ca	37	10	51820731	51820731	+	RNA	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr10:51820731G>T	ENST00000456967.1	-	0	1397					NR_038275.1																						GCTCCAGCTTGCCAATCCTGG	0.488																																					.													.	.	.	0			.						.																																					0	.			CAGCTTGCCAATC																													10.37:g.51820731G>T		76	0		66	4	.		RNA	SNP	ENST00000456967.1	37																																																																																				.		0.488	RP11-324H6.5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000048059.1		
MUC2	4583	bcgsc.ca	37	11	1093312	1093312	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr11:1093312C>G	ENST00000441003.2	+	30	5158	c.5131C>G	c.(5131-5133)Cca>Gca	p.P1711A	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.P1678A	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	gaccccaaccccaacacccac	0.637																																					p.P1711A													.	MUC2	614	0			c.C5131G						.						145.0	191.0	175.0					11																	1093312		1907	3560	5467	SO:0001583	missense	4583	exon30			CCAACCCCAACAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5131C>G	11.37:g.1093312C>G	ENSP00000415183:p.Pro1711Ala	300	11		329	18	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.304	-0.972196	0.02215	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.08458	3.09;3.11	1.4	-2.79	0.05841	.	0.190326	0.20108	U	0.099085	T	0.02533	0.0077	.	.	.	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.41106	-0.9527	9	0.08179	T	0.78	.	2.4144	0.04432	0.4935:0.3028:0.0:0.2036	.	1711	E7EUV1	.	A	1711;1678	ENSP00000415183:P1711A;ENSP00000351956:P1678A	ENSP00000351956:P1678A	P	+	1	0	MUC2	1083312	0.000000	0.05858	0.002000	0.10522	0.017000	0.09413	-5.838000	0.00095	-0.673000	0.05259	-1.098000	0.02139	CCA	.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
SECISBP2L	9728	bcgsc.ca	37	15	49304061	49304061	+	Splice_Site	SNP	C	C	A			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr15:49304061C>A	ENST00000559471.1	-	13	1995		c.e13-1		SECISBP2L_ENST00000261847.3_Splice_Site	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like								poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						TTAAAATAACCTAAAAGTCAT	0.343																																					.													.	SECISBP2L	118	0			c.1732-1G>T						.						70.0	74.0	73.0					15																	49304061		2197	4295	6492	SO:0001630	splice_region_variant	9728	exon14			AATAACCTAAAAG	BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.1732-1G>T	15.37:g.49304061C>A		53	0		69	4	NM_001193489	Q8N767	Splice_Site	SNP	ENST00000559471.1	37	CCDS53942.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.980440	0.74474	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1233	0.93372	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SECISBP2L	47091353	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	6.978000	0.76147	2.760000	0.94817	0.557000	0.71058	.	.		0.343	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1	NM_014701	Intron
PIF1	80119	bcgsc.ca	37	15	65114771	65114771	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr15:65114771G>T	ENST00000268043.4	-	3	691	c.597C>A	c.(595-597)agC>agA	p.S199R	PIF1_ENST00000559239.1_Missense_Mutation_p.S199R|PIF1_ENST00000333425.6_Missense_Mutation_p.S199R					PIF1 5'-to-3' DNA helicase											kidney(1)|lung(1)	2						TGGAGGGCAAGCTCAGCCTCT	0.612																																					p.S199R													.	PIF1	43	0			c.C597A						.						46.0	43.0	44.0					15																	65114771		2202	4299	6501	SO:0001583	missense	80119	exon3			GGGCAAGCTCAGC	AK026345	CCDS10195.2, CCDS66797.1	15q22.1	2013-05-13	2013-05-13	2006-11-24	ENSG00000140451	ENSG00000140451	3.6.4.12		26220	protein-coding gene	gene with protein product		610953	"""chromosome 15 open reading frame 20"", ""PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae)"""	C15orf20		10926538, 16522649	Standard	NM_025049		Approved	FLJ22692	uc002ant.2	Q9H611	OTTHUMG00000132974	ENST00000268043.4:c.597C>A	15.37:g.65114771G>T	ENSP00000268043:p.Ser199Arg	50	0		56	4	NM_025049		Missense_Mutation	SNP	ENST00000268043.4	37	CCDS10195.2	.	.	.	.	.	.	.	.	.	.	G	7.635	0.679625	0.14907	.	.	ENSG00000140451	ENST00000268043;ENST00000333425	T;T	0.54675	0.56;0.56	5.39	-1.3	0.09259	.	1.280410	0.04653	N	0.407414	T	0.25158	0.0611	N	0.05510	-0.035	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.08330	-1.0727	10	0.13108	T	0.6	-3.2319	0.6261	0.00786	0.2958:0.1211:0.3353:0.2478	.	199;199	Q9H611-2;Q9H611	.;PIF1_HUMAN	R	199	ENSP00000268043:S199R;ENSP00000328174:S199R	ENSP00000268043:S199R	S	-	3	2	PIF1	62901824	0.009000	0.17119	0.258000	0.24420	0.936000	0.57629	0.358000	0.20216	-0.201000	0.10284	-0.258000	0.10820	AGC	.		0.612	PIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256533.1	NM_025049	
AC016995.3	0	broad.mit.edu	37	2	38710046	38710047	+	lincRNA	DNP	TA	TA	AT	rs61417537|rs574017590|rs57355803		TCGA-W5-AA2H-01A-31D-A417-09	TCGA-W5-AA2H-10A-01D-A41A-09	TA	TA						Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d06dd55a-d1a0-4571-b5c2-9d0b89ec7839	a5370b86-69de-4f97-87c3-777c38cee0e9	g.chr2:38710046_38710047TA>AT	ENST00000417039.1	-	0	696																											aaataaataataaataaataaa	0.272																																					.													.	.	.	0			.						.																																					0	.			AATAATAAATAAA																												Exception_encountered	2.37:g.38710046_38710047delinsAT		46	5		45	10	.		RNA	DNP	ENST00000417039.1	37																																																																																				.		0.272	AC016995.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000331173.1		
