#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ANK2	287	hgsc.bcm.edu	37	4	114271399	114271400	+	Frame_Shift_Ins	INS	-	-	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	-	-	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr4:114271399_114271400insA	ENST00000357077.4	+	37	4473_4474	c.4420_4421insA	c.(4420-4422)gaafs	p.E1474fs	ANK2_ENST00000394537.3_Frame_Shift_Ins_p.E1474fs|ANK2_ENST00000264366.6_Frame_Shift_Ins_p.E1441fs|ANK2_ENST00000506722.1_Frame_Shift_Ins_p.E1465fs|ANK2_ENST00000510275.2_Frame_Shift_Ins_p.E126fs|ANK2_ENST00000509550.1_Frame_Shift_Ins_p.E650fs	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1474	Death 1. {ECO:0000255|PROSITE- ProRule:PRU00064}.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TATGACATCAGAAAAAAGTAAG	0.337																																					p.E1474fs		.											.	.	.	0			c.4420_4421insA						.																																			SO:0001589	frameshift_variant	287	exon37			ACATCAGAAAAAA	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.4427dupA	4.37:g.114271405_114271405dupA	ENSP00000349588:p.Glu1474fs	97	0		127	42	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Frame_Shift_Ins	INS	ENST00000357077.4	37	CCDS3702.1																																																																																			.		0.337	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
DNAH6	1768	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	85043205	85043218	+	Splice_Site	DEL	CAGGTGAGGATGTT	CAGGTGAGGATGTT	-			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	CAGGTGAGGATGTT	CAGGTGAGGATGTT	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr2:85043205_85043218delCAGGTGAGGATGTT	ENST00000237449.6	+	75	12379_12381	c.12371_12373delCAGGTGAGGATGTT	c.(12370-12375)acaggt>agt	p.TG4124fs	DNAH6_ENST00000389394.3_Splice_Site_p.TG4124fs			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	4124					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						CTCTCAACCACAGGTGAGGATGTTCTTAAGATTA	0.425																																					p.4124_4125del		.											.	.	.	0			c.12370_12373del						.																																			SO:0001630	splice_region_variant	1768	exon76			CAACCACAGGTGA	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.12373+1CAGGTGAGGATGTT>-	2.37:g.85043205_85043218delCAGGTGAGGATGTT		44	0		59	12	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Frame_Shift_Del	DEL	ENST00000237449.6	37	CCDS46348.1																																																																																			.		0.425	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	Frame_Shift_Del
SPRED1	161742	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	38643598	38643607	+	Frame_Shift_Del	DEL	AGACCCTATT	AGACCCTATT	-			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	AGACCCTATT	AGACCCTATT	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr15:38643598_38643607delAGACCCTATT	ENST00000299084.4	+	7	1928_1937	c.1068_1077delAGACCCTATT	c.(1066-1077)ccagaccctattfs	p.PDPI356fs		NM_152594.2	NP_689807.1	Q7Z699	SPRE1_HUMAN	sprouty-related, EVH1 domain containing 1	356	SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			kidney(6)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		AGGATGCTCCAGACCCTATTAAAAGATGCA	0.414									Legius syndrome																												p.356_359del	Melanoma(196;2146 2959 7698 16532)	.											.	.	.	0			c.1067_1076del						.																																			SO:0001589	frameshift_variant	161742	exon7	Familial Cancer Database	Neurofibromatosis type 1 - like syndrome, SPRED1 disorder	TGCTCCAGACCCT	AK091222	CCDS32193.1	15q14	2014-06-13			ENSG00000166068	ENSG00000166068			20249	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 147"""	609291					Standard	NM_152594		Approved	FLJ33903, PPP1R147	uc001zka.4	Q7Z699		ENST00000299084.4:c.1068_1077delAGACCCTATT	15.37:g.38643598_38643607delAGACCCTATT	ENSP00000299084:p.Pro356fs	61	0		41	10	NM_152594	B2RPJ8|Q05D53|Q8N256	Frame_Shift_Del	DEL	ENST00000299084.4	37	CCDS32193.1																																																																																			.		0.414	SPRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418217.1		
STOX1	219736	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	70645255	70645259	+	Frame_Shift_Del	DEL	ACCCT	ACCCT	-	rs16925882	byFrequency	TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	ACCCT	ACCCT	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr10:70645255_70645259delACCCT	ENST00000298596.6	+	3	1786_1790	c.1703_1707delACCCT	c.(1702-1707)gaccctfs	p.DP568fs	STOX1_ENST00000399165.4_Intron|STOX1_ENST00000421961.2_Frame_Shift_Del_p.DP458fs|STOX1_ENST00000399169.4_Frame_Shift_Del_p.DP568fs|STOX1_ENST00000399162.2_Intron	NM_152709.4	NP_689922.3	Q6ZVD7	STOX1_HUMAN	storkhead box 1	568						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P569H(1)		breast(5)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|prostate(1)|skin(3)	28						TACATAAATGACCCTACTGTCAAAC	0.405																																					p.568_569del		.											STOX1,colon,carcinoma,0,1	STOX1	0	1	Substitution - Missense(1)	endometrium(1)	c.1702_1706del						.																																			SO:0001589	frameshift_variant	219736	exon3			TAAATGACCCTAC	AK057891	CCDS41535.1, CCDS44416.1, CCDS44417.1	10q22.1	2005-11-29	2005-04-04	2005-04-04	ENSG00000165730	ENSG00000165730			23508	protein-coding gene	gene with protein product		609397	"""chromosome 10 open reading frame 24"""	C10orf24			Standard	NM_152709		Approved	FLJ25162	uc001joq.3	Q6ZVD7	OTTHUMG00000018367	ENST00000298596.6:c.1703_1707delACCCT	10.37:g.70645255_70645259delACCCT	ENSP00000298596:p.Asp568fs	32	0		44	16	NM_152709	A2A3Q9|A5D6Y7|B0QZA4|B0QZA5|B0QZA6|Q4F8Q6|Q5I946|Q5I947|Q5I948|Q5VX38|Q5VX39|Q6ZRY3|Q96LR3|Q96LS0	Frame_Shift_Del	DEL	ENST00000298596.6	37	CCDS41535.1																																																																																			.		0.405	STOX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276849.3	NM_152709	
HJURP	55355	hgsc.bcm.edu	37	2	234762542	234762542	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr2:234762542G>T	ENST00000411486.2	-	2	197	c.132C>A	c.(130-132)ttC>ttA	p.F44L	HJURP_ENST00000432087.1_Missense_Mutation_p.F44L|HJURP_ENST00000441687.1_Missense_Mutation_p.F44L	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	44					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)	p.F44L(1)		NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		GGGTGTCCTCGAAGGGCTGGT	0.642																																					p.F44L		.											HJURP,NS,carcinoma,0,1	HJURP	0	1	Substitution - Missense(1)	lung(1)	c.C132A						.						160.0	146.0	151.0					2																	234762542		2203	4300	6503	SO:0001583	missense	55355	exon2			GTCCTCGAAGGGC		CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.132C>A	2.37:g.234762542G>T	ENSP00000414109:p.Phe44Leu	29	0		32	2	NM_018410	A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	ENST00000411486.2	37	CCDS33406.1	.	.	.	.	.	.	.	.	.	.	G	17.58	3.425710	0.62733	.	.	ENSG00000123485	ENST00000411486;ENST00000432087;ENST00000441687;ENST00000414924	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	4.03	0.0932	0.14476	Centromere protein Scm3, N-terminal (1);	0.247728	0.27836	N	0.017650	T	0.35128	0.0921	L	0.34521	1.04	0.25248	N	0.989695	P;P;P	0.38565	0.584;0.584;0.637	B;B;P	0.46758	0.391;0.27;0.526	T	0.23583	-1.0184	10	0.87932	D	0	-11.5454	5.9367	0.19169	0.5151:0.0:0.4849:0.0	.	44;44;44	Q8NCD3-3;Q8NCD3-2;Q8NCD3	.;.;HJURP_HUMAN	L	44	ENSP00000414109:F44L;ENSP00000407208:F44L;ENSP00000401944:F44L;ENSP00000393253:F44L	ENSP00000414109:F44L	F	-	3	2	HJURP	234427281	1.000000	0.71417	0.999000	0.59377	0.503000	0.33858	0.736000	0.26130	0.114000	0.18032	0.655000	0.94253	TTC	.		0.642	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000130996.6	NM_018410	
CABIN1	23523	hgsc.bcm.edu	37	22	24573580	24573580	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr22:24573580G>T	ENST00000398319.2	+	36	6699	c.6314G>T	c.(6313-6315)aGc>aTc	p.S2105I	CABIN1_ENST00000405822.2_Missense_Mutation_p.S2026I|CABIN1_ENST00000263119.5_Missense_Mutation_p.S2105I|CABIN1_ENST00000337989.7_Missense_Mutation_p.S475I	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	2105					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						AAGGCCCCCAGCAGTGGGAGT	0.677																																					p.S2105I		.											.	.	.	0			c.G6314T						.						40.0	42.0	41.0					22																	24573580		2203	4300	6503	SO:0001583	missense	23523	exon36			CCCCCAGCAGTGG	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.6314G>T	22.37:g.24573580G>T	ENSP00000381364:p.Ser2105Ile	52	0		49	4	NM_001199281	G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	37	CCDS13823.1	.	.	.	.	.	.	.	.	.	.	G	16.32	3.089375	0.55968	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319;ENST00000337989;ENST00000403176	T;T;T;T	0.21361	2.01;2.01;2.01;2.07	5.05	5.05	0.67936	.	0.655120	0.14463	N	0.318069	T	0.14442	0.0349	N	0.19112	0.55	0.34223	D	0.675635	B;B	0.28713	0.178;0.22	B;B	0.28139	0.086;0.08	T	0.12734	-1.0536	10	0.59425	D	0.04	.	9.2059	0.37289	0.0:0.1456:0.6831:0.1712	.	2026;2105	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	I	2105;2026;2105;475;474	ENSP00000263119:S2105I;ENSP00000384694:S2026I;ENSP00000381364:S2105I;ENSP00000336991:S475I	ENSP00000263119:S2105I	S	+	2	0	CABIN1	22903580	0.937000	0.31787	0.997000	0.53966	0.510000	0.34073	3.040000	0.49799	2.549000	0.85964	0.650000	0.86243	AGC	.		0.677	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
CDH7	1005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	63489459	63489459	+	Silent	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr18:63489459C>T	ENST00000397968.2	+	5	1194	c.768C>T	c.(766-768)aaC>aaT	p.N256N	CDH7_ENST00000323011.3_Silent_p.N256N|CDH7_ENST00000536984.2_Silent_p.N256N	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	256	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				CTGATGTCAACGATAATCCAC	0.388																																					p.N256N		.											.	.	.	0			c.C768T						.						167.0	119.0	135.0					18																	63489459		2203	4300	6503	SO:0001819	synonymous_variant	1005	exon5			TGTCAACGATAAT	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.768C>T	18.37:g.63489459C>T		26	0		38	10	NM_004361	Q9H157	Silent	SNP	ENST00000397968.2	37	CCDS11993.1																																																																																			.		0.388	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646	
SSX6	280657	hgsc.bcm.edu	37	X	47977977	47977977	+	RNA	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chrX:47977977G>A	ENST00000509958.1	+	0	64							Q7RTT6	SSX6_HUMAN	synovial sarcoma, X breakpoint 6 (pseudogene)						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			large_intestine(6)|lung(4)|skin(2)|stomach(1)	13						tttaaagtgagagacatgcga	0.453																																					.		.											.	.	.	0			.						.																																					280657	.			AAGTGAGAGACAT	BK000686		Xp11.23	2009-09-11	2009-08-26		ENSG00000171483	ENSG00000171483			19652	pseudogene	pseudogene		300541	"""SSX family pseudogene 2"", ""synovial sarcoma, X breakpoint 6"""	SSXP2		12216073	Standard	NR_028366		Approved	psiSSX2	uc011mlv.2	Q7RTT6	OTTHUMG00000021464		X.37:g.47977977G>A		25	0		24	8	.		RNA	SNP	ENST00000509958.1	37																																																																																				.		0.453	SSX6-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000362117.1	NR_028366	
RB1CC1	9821	hgsc.bcm.edu	37	8	53570077	53570077	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr8:53570077G>T	ENST00000025008.5	-	15	2835	c.2312C>A	c.(2311-2313)gCg>gAg	p.A771E	RB1CC1_ENST00000539297.1_Missense_Mutation_p.A771E|RB1CC1_ENST00000435644.2_Missense_Mutation_p.A771E|RB1CC1_ENST00000521611.1_Intron	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	771					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				ACTGTCTATCGCATTGATAAC	0.373																																					p.A771E	GBM(180;1701 2102 13475 42023 52570)	.											RB1CC1,colon,carcinoma,0,2	RB1CC1	0	0			c.C2312A						.						142.0	132.0	135.0					8																	53570077		2203	4300	6503	SO:0001583	missense	9821	exon15			TCTATCGCATTGA	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.2312C>A	8.37:g.53570077G>T	ENSP00000025008:p.Ala771Glu	43	0		31	2	NM_001083617	Q86YR4|Q8WVU9|Q92601	Missense_Mutation	SNP	ENST00000025008.5	37	CCDS34892.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.298946	0.81025	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	T;T;T	0.27256	1.69;1.68;1.68	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.42832	0.1220	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.06899	-1.0801	10	0.30078	T	0.28	-16.8463	19.3789	0.94523	0.0:0.0:1.0:0.0	.	771;771	Q8TDY2-2;Q8TDY2	.;RBCC1_HUMAN	E	771	ENSP00000025008:A771E;ENSP00000396067:A771E;ENSP00000445960:A771E	ENSP00000025008:A771E	A	-	2	0	RB1CC1	53732630	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.374000	0.97172	2.652000	0.90054	0.563000	0.77884	GCG	.		0.373	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	
KRTAP10-7	386675	hgsc.bcm.edu	37	21	46020608	46020608	+	Silent	SNP	C	C	T	rs374137541	byFrequency	TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr21:46020608C>T	ENST00000380102.2	+	1	112	c.87C>T	c.(85-87)tcC>tcT	p.S29S	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	29						keratin filament (GO:0045095)				breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						ACTCTTGCTCCGACTCCTGGC	0.677													c|||	12	0.00239617	0.0068	0.0	5008	,	,		17271	0.003		0.0	False		,,,				2504	0.0				p.S29S		.											KRTAP10-7_ENST00000380102,NS,carcinoma,0,2	KRTAP10-7_ENST00000380102	0	0			c.C87T						.	C	,	22,3984		0,22,1981	55.0	55.0	55.0		,87	-4.9	0.0	21	dbSNP_134	55	0,8298		0,0,4149	no	intron,coding-synonymous	TSPEAR,KRTAP10-7	NM_144991.2,NM_198689.2	,	0,22,6130	TT,TC,CC		0.0,0.5492,0.1788	,	,29/376	46020608	22,12282	2003	4149	6152	SO:0001819	synonymous_variant	386675	exon1			TTGCTCCGACTCC	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.87C>T	21.37:g.46020608C>T		98	2		108	6	NM_198689	Q0VDJ8|Q70LJ2	Silent	SNP	ENST00000380102.2	37																																																																																				.		0.677	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
LAMA1	284217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	6997830	6997830	+	Missense_Mutation	SNP	C	C	G			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr18:6997830C>G	ENST00000389658.3	-	33	4810	c.4717G>C	c.(4717-4719)Gat>Cat	p.D1573H		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1573	Domain II and I.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				AGAACGGCATCACCAATCTCA	0.408																																					p.D1573H		.											.	.	.	0			c.G4717C						.						214.0	194.0	201.0					18																	6997830		2203	4300	6503	SO:0001583	missense	284217	exon33			CGGCATCACCAAT	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.4717G>C	18.37:g.6997830C>G	ENSP00000374309:p.Asp1573His	51	0		51	22	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	C	4.600	0.111569	0.08831	.	.	ENSG00000101680	ENST00000389658	T	0.19250	2.16	5.36	4.49	0.54785	Laminin I (1);	0.309682	0.33235	N	0.005128	T	0.19927	0.0479	M	0.62723	1.935	0.09310	N	1	P	0.35575	0.51	B	0.29598	0.104	T	0.14643	-1.0465	10	0.40728	T	0.16	.	10.6366	0.45569	0.0:0.8521:0.0:0.1479	.	1573	P25391	LAMA1_HUMAN	H	1573	ENSP00000374309:D1573H	ENSP00000374309:D1573H	D	-	1	0	LAMA1	6987830	0.000000	0.05858	0.015000	0.15790	0.007000	0.05969	-0.546000	0.06062	1.397000	0.46682	0.655000	0.94253	GAT	.		0.408	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
CHD9	80205	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	53191285	53191285	+	Silent	SNP	A	A	G			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr16:53191285A>G	ENST00000398510.3	+	1	1371	c.1284A>G	c.(1282-1284)tcA>tcG	p.S428S	CHD9_ENST00000564845.1_Silent_p.S428S|CHD9_ENST00000566029.1_Silent_p.S428S|CHD9_ENST00000447540.1_Silent_p.S428S			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	428					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				AAGATAATTCAAGTCACATTT	0.468																																					p.S428S		.											.	.	.	0			c.A1284G						.						87.0	80.0	82.0					16																	53191285		1911	4141	6052	SO:0001819	synonymous_variant	80205	exon2			TAATTCAAGTCAC	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.1284A>G	16.37:g.53191285A>G		19	0		33	8	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Silent	SNP	ENST00000398510.3	37																																																																																				.		0.468	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
CDH5	1003	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	66424338	66424338	+	Missense_Mutation	SNP	C	C	T	rs375751151		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr16:66424338C>T	ENST00000341529.3	+	6	962	c.814C>T	c.(814-816)Cgt>Tgt	p.R272C	CDH5_ENST00000563425.2_Missense_Mutation_p.R272C	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	272	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	TGAAGACACCCGTGTGGGCAC	0.547																																					p.R272C		.											.	.	.	0			c.C814T						.						62.0	62.0	62.0					16																	66424338		2201	4300	6501	SO:0001583	missense	1003	exon6			GACACCCGTGTGG	X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.814C>T	16.37:g.66424338C>T	ENSP00000344115:p.Arg272Cys	33	0		49	19	NM_001795	Q4VAI5|Q4VAI6	Missense_Mutation	SNP	ENST00000341529.3	37	CCDS10804.1	.	.	.	.	.	.	.	.	.	.	C	13.55	2.271381	0.40194	.	.	ENSG00000179776	ENST00000341529;ENST00000379531	T	0.54866	0.55	5.97	5.97	0.96955	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.71417	0.3337	M	0.80746	2.51	0.44587	D	0.99755	D	0.71674	0.998	D	0.65443	0.935	T	0.74124	-0.3766	9	0.66056	D	0.02	.	12.8164	0.57667	0.1632:0.8368:0.0:0.0	.	272	P33151	CADH5_HUMAN	C	272	ENSP00000344115:R272C	ENSP00000344115:R272C	R	+	1	0	CDH5	64981839	0.000000	0.05858	0.995000	0.50966	0.066000	0.16364	0.490000	0.22403	2.837000	0.97791	0.655000	0.94253	CGT	.		0.547	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268767.1	NM_001795	
ARMC8	25852	hgsc.bcm.edu	37	3	137960639	137960639	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr3:137960639G>T	ENST00000469044.1	+	11	1123	c.852G>T	c.(850-852)ttG>ttT	p.L284F	ARMC8_ENST00000393058.3_Missense_Mutation_p.L274F|ARMC8_ENST00000485396.1_Missense_Mutation_p.L211F|ARMC8_ENST00000481646.1_Missense_Mutation_p.L270F|ARMC8_ENST00000358441.2_Missense_Mutation_p.L270F|ARMC8_ENST00000489213.1_Missense_Mutation_p.L242F|ARMC8_ENST00000471453.1_Missense_Mutation_p.L270F|ARMC8_ENST00000470821.1_Missense_Mutation_p.L284F|ARMC8_ENST00000461822.1_Intron|ARMC8_ENST00000491704.1_Missense_Mutation_p.L242F|ARMC8_ENST00000538260.1_Missense_Mutation_p.L253F	NM_001267041.1|NM_001267042.1	NP_001253970.1|NP_001253971.1	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8	284								p.L270F(2)		endometrium(2)|kidney(1)|large_intestine(7)|lung(5)|upper_aerodigestive_tract(1)	16						TACCTTGTTTGGTTCGAATGT	0.378																																					p.L270F		.											ARMC8_ENST00000481646,NS,carcinoma,0,3	ARMC8_ENST00000481646	0	2	Substitution - Missense(2)	lung(2)	c.G810T						.						117.0	106.0	110.0					3																	137960639		2203	4300	6503	SO:0001583	missense	25852	exon12			TTGTTTGGTTCGA		CCDS3098.1, CCDS54646.1, CCDS58853.1, CCDS58854.1, CCDS75020.1	3q22	2013-02-14			ENSG00000114098	ENSG00000114098		"""Armadillo repeat containing"""	24999	protein-coding gene	gene with protein product	"""GID complex subunit 5, VID28 homolog (S. cerevisiae)"""					11042152	Standard	NM_014154		Approved	HSPC056, DKFZP434A043, GID5, VID28	uc003esa.2	Q8IUR7	OTTHUMG00000159821	ENST00000469044.1:c.852G>T	3.37:g.137960639G>T	ENSP00000419413:p.Leu284Phe	34	0		41	2	NM_213654	A8K0L2|B7Z441|B7Z453|D3DNE6|F5GWK4|Q6PIL2|Q96D19|Q96HZ5|Q9NV02|Q9NV94|Q9Y4R9	Missense_Mutation	SNP	ENST00000469044.1	37		.	.	.	.	.	.	.	.	.	.	G	22.5	4.301870	0.81136	.	.	ENSG00000114098	ENST00000481646;ENST00000469044;ENST00000491704;ENST00000358441;ENST00000489213;ENST00000485396;ENST00000471453;ENST00000470821;ENST00000538260;ENST00000393058;ENST00000463485;ENST00000539459	T;T;T;T;T;T;T;T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.01;-0.01;-0.51;-0.01;-0.01;-0.53;-0.8;0.48	5.8	5.8	0.92144	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85906	0.5806	M	0.69823	2.125	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.995;0.992;0.999;0.999	D;D;D;P;D;D	0.87578	0.988;0.995;0.969;0.9;0.994;0.998	D	0.86694	0.1925	10	0.87932	D	0	.	17.546	0.87861	0.0:0.0:1.0:0.0	.	211;253;284;270;284;270	B7Z637;F5GWK4;Q8IUR7;Q8IUR7-2;G5E9V6;Q8IUR7-6	.;.;ARMC8_HUMAN;.;.;.	F	270;284;242;270;242;211;270;284;253;274;178;141	ENSP00000420333:L270F;ENSP00000419413:L284F;ENSP00000417304:L242F;ENSP00000351221:L270F;ENSP00000418412:L242F;ENSP00000417049:L211F;ENSP00000420440:L270F;ENSP00000418405:L284F;ENSP00000441592:L253F;ENSP00000376778:L274F;ENSP00000417403:L178F	ENSP00000351221:L270F	L	+	3	2	ARMC8	139443329	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.963000	0.49184	2.737000	0.93849	0.563000	0.77884	TTG	.		0.378	ARMC8-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000357560.1	NM_015396	
MAML2	84441	hgsc.bcm.edu	37	11	95825254	95825254	+	Silent	SNP	C	C	T	rs61749250		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr11:95825254C>T	ENST00000524717.1	-	2	3225	c.1941G>A	c.(1939-1941)caG>caA	p.Q647Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	647					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q647Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgttgttgct	0.512			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q647Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	MAML2,caecum,carcinoma,0,2	MAML2	0	1	Substitution - coding silent(1)	endometrium(1)	c.G1941A						.	C		0,4198		0,0,2099	35.0	40.0	38.0		1941	1.7	0.1	11	dbSNP_129	38	5,8237		0,5,4116	no	coding-synonymous	MAML2	NM_032427.1		0,5,6215	TT,TC,CC		0.0607,0.0,0.0402		647/1157	95825254	5,12435	2099	4121	6220	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGTTGT	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1941G>A	11.37:g.95825254C>T		34	0		44	2	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.		0.512	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
SSTR4	6754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	23016852	23016852	+	Silent	SNP	C	C	T	rs369953610		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr20:23016852C>T	ENST00000255008.3	+	1	796	c.732C>T	c.(730-732)cgC>cgT	p.R244R	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	244					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					TGGCCCTGCGCGCTGGCTGGC	0.627																																					p.R244R	Esophageal Squamous(15;850 1104 16640)	.											.	.	.	0			c.C732T						.	T		0,4290		0,0,2145	73.0	84.0	80.0		732	-1.0	0.8	20		80	1,8539		0,1,4269	no	coding-synonymous	SSTR4	NM_001052.2		0,1,6414	TT,TC,CC		0.0117,0.0,0.0078		244/389	23016852	1,12829	2145	4270	6415	SO:0001819	synonymous_variant	6754	exon1			CCTGCGCGCTGGC		CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.732C>T	20.37:g.23016852C>T		33	0		19	8	NM_001052	Q17RM1|Q17RM3|Q9UIY1	Silent	SNP	ENST00000255008.3	37	CCDS42856.1																																																																																			.		0.627	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078308.1		
ITGAL	3683	hgsc.bcm.edu	37	16	30525161	30525161	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr16:30525161G>T	ENST00000356798.6	+	25	3036	c.2856G>T	c.(2854-2856)atG>atT	p.M952I	ITGAL_ENST00000358164.5_Missense_Mutation_p.M868I|ITGAL_ENST00000433423.2_Missense_Mutation_p.M186I	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	952					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	TCAAGCACATGTACCAGGTAT	0.502																																					p.M952I	NSCLC(110;1462 1641 3311 33990 49495)	.											.	.	.	0			c.G2856T						.						176.0	141.0	153.0					16																	30525161		2197	4300	6497	SO:0001583	missense	3683	exon25			GCACATGTACCAG		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.2856G>T	16.37:g.30525161G>T	ENSP00000349252:p.Met952Ile	60	0		79	4	NM_002209	O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	37	CCDS32433.1	.	.	.	.	.	.	.	.	.	.	G	8.829	0.939463	0.18281	.	.	ENSG00000005844	ENST00000356798;ENST00000358164;ENST00000433423	T;T;T	0.42513	0.97;0.97;0.97	4.96	0.511	0.16989	Integrin alpha-2 (1);	1.106730	0.06923	N	0.809736	T	0.09949	0.0244	N	0.00246	-1.78	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.37934	-0.9684	10	0.21014	T	0.42	.	1.2501	0.01980	0.1784:0.4461:0.1749:0.2006	.	186;868;952	B4E021;Q96HB1;P20701	.;.;ITAL_HUMAN	I	952;868;186	ENSP00000349252:M952I;ENSP00000350886:M868I;ENSP00000409377:M186I	ENSP00000349252:M952I	M	+	3	0	ITGAL	30432662	0.729000	0.28090	0.812000	0.32479	0.972000	0.66771	0.158000	0.16422	0.290000	0.22444	-0.266000	0.10368	ATG	.		0.502	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2		
RGS20	8601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	54852270	54852270	+	Nonsense_Mutation	SNP	T	T	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr8:54852270T>A	ENST00000297313.3	+	3	737	c.645T>A	c.(643-645)tgT>tgA	p.C215*	RGS20_ENST00000276500.4_Nonsense_Mutation_p.C68*|RGS20_ENST00000522225.1_Intron|RGS20_ENST00000344277.6_Nonsense_Mutation_p.C100*	NM_170587.2	NP_733466.1	O76081	RGS20_HUMAN	regulator of G-protein signaling 20	215	Poly-Cys.				positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			ggtgctgctgttgtagctgct	0.627																																					p.C215X		.											.	.	.	0			c.T645A						.						40.0	44.0	42.0					8																	54852270		2151	4228	6379	SO:0001587	stop_gained	8601	exon3			CTGCTGTTGTAGC	AF074979	CCDS6155.1, CCDS6156.1, CCDS69482.1	8q11.23	2008-07-25	2007-08-14		ENSG00000147509	ENSG00000147509		"""Regulators of G-protein signaling"""	14600	protein-coding gene	gene with protein product		607193	"""regulator of G-protein signalling 20"""			9748279, 9748280	Standard	NM_003702		Approved	RGSZ1, ZGAP1	uc003xrp.3	O76081	OTTHUMG00000164750	ENST00000297313.3:c.645T>A	8.37:g.54852270T>A	ENSP00000297313:p.Cys215*	24	0		39	14	NM_170587	Q96BG9	Nonsense_Mutation	SNP	ENST00000297313.3	37	CCDS6155.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.220547	0.79464	.	.	ENSG00000147509	ENST00000297313;ENST00000344277;ENST00000276500	.	.	.	4.81	-5.79	0.02354	.	0.432597	0.31221	N	0.008039	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3318	0.83023	0.0:0.1339:0.0:0.8661	.	.	.	.	X	215;100;68	.	ENSP00000276500:C68X	C	+	3	2	RGS20	55014823	0.984000	0.35163	0.818000	0.32626	0.922000	0.55478	0.184000	0.16939	-1.138000	0.02884	-0.462000	0.05337	TGT	.		0.627	RGS20-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380058.1		
ZHX3	23051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	39832988	39832988	+	Missense_Mutation	SNP	A	A	G			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr20:39832988A>G	ENST00000309060.3	-	4	984	c.569T>C	c.(568-570)aTg>aCg	p.M190T	ZHX3_ENST00000558993.1_Missense_Mutation_p.M190T|ZHX3_ENST00000432768.2_Missense_Mutation_p.M190T|ZHX3_ENST00000540170.1_Missense_Mutation_p.M190T|ZHX3_ENST00000560361.1_Missense_Mutation_p.M190T|ZHX3_ENST00000544979.2_Missense_Mutation_p.M190T|ZHX3_ENST00000559234.1_Missense_Mutation_p.M190T|ZHX3_ENST00000557816.1_Missense_Mutation_p.M190T			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	190					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				TTTGCCTTTCATTATCTTCAT	0.493																																					p.M190T		.											.	.	.	0			c.T569C						.						95.0	96.0	96.0					20																	39832988		2203	4300	6503	SO:0001583	missense	23051	exon3			CCTTTCATTATCT	AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.569T>C	20.37:g.39832988A>G	ENSP00000312222:p.Met190Thr	19	0		24	10	NM_015035	E1P5W5|F5H820|O43145|Q6NUJ7	Missense_Mutation	SNP	ENST00000309060.3	37	CCDS13315.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.073175	0.76415	.	.	ENSG00000174306	ENST00000309060;ENST00000373263;ENST00000540170;ENST00000544979;ENST00000432768	T;T;T;T;T	0.31247	1.5;2.9;2.9;2.68;1.5	6.07	6.07	0.98685	.	0.089715	0.85682	D	0.000000	T	0.53029	0.1771	M	0.75264	2.295	0.46499	D	0.999078	P;P;D;D	0.69078	0.949;0.949;0.997;0.974	P;P;D;P	0.64410	0.76;0.786;0.925;0.736	T	0.56998	-0.7886	10	0.72032	D	0.01	-29.1888	12.4717	0.55792	0.8606:0.1393:0.0:0.0	.	190;190;190;190	A8K8Q0;Q9H4I2;F5H820;F6R4Q5	.;ZHX3_HUMAN;.;.	T	190	ENSP00000312222:M190T;ENSP00000362360:M190T;ENSP00000442290:M190T;ENSP00000443783:M190T;ENSP00000415498:M190T	ENSP00000312222:M190T	M	-	2	0	ZHX3	39266402	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.765000	0.68834	2.326000	0.78906	0.533000	0.62120	ATG	.		0.493	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079262.3	NM_015035	
NR1I3	9970	hgsc.bcm.edu	37	1	161202597	161202597	+	Splice_Site	SNP	C	C	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr1:161202597C>A	ENST00000367982.4	-	5	703	c.548G>T	c.(547-549)cGt>cTt	p.R183L	NR1I3_ENST00000511676.1_Splice_Site_p.R154L|NR1I3_ENST00000515621.1_Splice_Site_p.R108L|NR1I3_ENST00000412844.2_Splice_Site_p.R154L|NR1I3_ENST00000506209.1_Splice_Site_p.R154L|NR1I3_ENST00000367979.2_Splice_Site_p.R183L|NR1I3_ENST00000367980.2_Splice_Site_p.R183L|NR1I3_ENST00000504010.1_Splice_Site_p.R154L|NR1I3_ENST00000511748.1_Intron|NR1I3_ENST00000367983.4_Splice_Site_p.R183L|NR1I3_ENST00000428574.2_Splice_Site_p.R183L|NR1I3_ENST00000367981.3_Splice_Site_p.R154L|NR1I3_ENST00000505005.1_Splice_Site_p.R183L|NR1I3_ENST00000508387.1_Intron|NR1I3_ENST00000512372.1_Splice_Site_p.R154L|NR1I3_ENST00000479324.1_5'Flank|NR1I3_ENST00000502985.1_Intron|NR1I3_ENST00000367984.4_Splice_Site_p.R183L|NR1I3_ENST00000511944.1_Intron|NR1I3_ENST00000515452.1_Splice_Site_p.R183L|NR1I3_ENST00000508740.1_Splice_Site_p.R154L|NR1I3_ENST00000437437.2_Splice_Site_p.R154L|NR1I3_ENST00000367985.3_Splice_Site_p.R183L|NR1I3_ENST00000442691.2_Splice_Site_p.R183L			Q14994	NR1I3_HUMAN	nuclear receptor subfamily 1, group I, member 3	183					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor activity (GO:0004882)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	15	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			GGTCACTCACCGGAAGACGGG	0.493																																					p.R183L		.											NR1I3_ENST00000428574,right_upper_lobe,carcinoma,0,2	NR1I3_ENST00000428574	0	0			c.G548T						.						100.0	101.0	101.0					1																	161202597		2203	4300	6503	SO:0001630	splice_region_variant	9970	exon5			ACTCACCGGAAGA	Z30425	CCDS1228.1, CCDS41427.1, CCDS41428.1, CCDS41429.1, CCDS41430.1, CCDS44260.1, CCDS44261.1, CCDS44262.1, CCDS53405.1, CCDS53406.1, CCDS53407.1, CCDS53408.1, CCDS53409.1, CCDS53410.1, CCDS53411.1	1q23.3	2013-01-16			ENSG00000143257	ENSG00000143257		"""Nuclear hormone receptors"""	7969	protein-coding gene	gene with protein product	"""constitutive androstane receptor"""	603881				8114692	Standard	NM_001077480		Approved	MB67, CAR1, CAR	uc001fzp.3	Q14994	OTTHUMG00000034347	ENST00000367982.4:c.548+1G>T	1.37:g.161202597C>A		33	1		50	2	NM_005122	E9PB75|E9PC13|E9PDU3|E9PGH6|E9PH10|E9PHC8|E9PHN4|F1D8Q0|F1D8Q1|Q0VAC9|Q4U0F0|Q5VTW5|Q5VTW6|Q6GZ68|Q6GZ76|Q6GZ77|Q6GZ78|Q6GZ79|Q6GZ82|Q6GZ83|Q6GZ84|Q6GZ85|Q6GZ87|Q6GZ89	Missense_Mutation	SNP	ENST00000367982.4	37	CCDS41430.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.007115	0.75046	.	.	ENSG00000143257	ENST00000512372;ENST00000367983;ENST00000367980;ENST00000437437;ENST00000442691;ENST00000412844;ENST00000428574;ENST00000505005;ENST00000508740;ENST00000367982;ENST00000504010;ENST00000511676;ENST00000367981;ENST00000515621;ENST00000367984;ENST00000367985;ENST00000367979;ENST00000506209;ENST00000515452	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97016	-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21	5.4	4.48	0.54585	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.160493	0.51477	D	0.000089	D	0.95300	0.8475	L	0.48642	1.525	0.49798	D	0.999823	P;D;D;P;D;P;P;D;D;P;D;D;D;D;P;D;D;D	0.89917	0.873;0.991;1.0;0.824;1.0;0.913;0.74;0.995;1.0;0.74;0.999;1.0;1.0;0.971;0.718;1.0;1.0;0.999	P;P;D;P;D;P;P;D;D;P;D;D;D;P;B;D;D;D	0.91635	0.615;0.825;0.998;0.511;0.998;0.612;0.508;0.936;0.998;0.508;0.975;0.985;0.999;0.825;0.222;0.985;0.985;0.994	D	0.94689	0.7872	8	.	.	.	.	7.4289	0.27115	0.0:0.7436:0.1699:0.0865	.	183;154;154;183;183;183;183;183;183;183;108;154;154;154;154;154;154;183	B7Z8R7;E9PCF2;E9PHN4;Q6GZ85;E9PHC8;Q0VAC9;F1D8Q1;Q14994;E9PC13;Q4U0F0;D6REZ7;Q6GZ87;E9PDU3;Q6GZ68;E9PH10;Q6GZ84;E9PGH6;E9PB75	.;.;.;.;.;.;.;NR1I3_HUMAN;.;.;.;.;.;.;.;.;.;.	L	154;183;183;154;183;154;183;183;154;183;154;154;154;108;183;183;183;154;183	ENSP00000425417:R154L;ENSP00000356962:R183L;ENSP00000356959:R183L;ENSP00000407446:R154L;ENSP00000406493:R183L;ENSP00000399361:R154L;ENSP00000412672:R183L;ENSP00000424934:R183L;ENSP00000423666:R154L;ENSP00000356961:R183L;ENSP00000424345:R154L;ENSP00000427175:R154L;ENSP00000356960:R154L;ENSP00000421588:R108L;ENSP00000356963:R183L;ENSP00000356965:R183L;ENSP00000356958:R183L;ENSP00000423089:R154L;ENSP00000427034:R183L	.	R	-	2	0	NR1I3	159469221	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	2.525000	0.45598	1.487000	0.48415	0.561000	0.74099	CGT	.		0.493	NR1I3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083048.2		Missense_Mutation
RRN3	54700	hgsc.bcm.edu	37	16	15188060	15188060	+	Missense_Mutation	SNP	G	G	A	rs201504364		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr16:15188060G>A	ENST00000198767.6	-	1	114	c.31C>T	c.(31-33)Ccg>Tcg	p.P11S	RRN3_ENST00000429751.2_Missense_Mutation_p.P11S|PDXDC1_ENST00000535621.2_Intron|RRN3_ENST00000564131.1_Missense_Mutation_p.P11S|RRN3_ENST00000563559.1_Missense_Mutation_p.P11S|RRN3_ENST00000327307.7_5'Flank|RP11-72I8.1_ENST00000569858.1_RNA	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	11					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.P11S(3)		NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						GCATCTCCCGGCAAACGCGTG	0.637																																					p.P11S		.											RRN3,NS,carcinoma,0,3	RRN3	0	3	Substitution - Missense(3)	lung(1)|prostate(1)|central_nervous_system(1)	c.C31T						.						15.0	14.0	14.0					16																	15188060		2193	4294	6487	SO:0001583	missense	54700	exon1			CTCCCGGCAAACG	AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.31C>T	16.37:g.15188060G>A	ENSP00000198767:p.Pro11Ser	70	2		79	9	NM_018427	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	ENST00000198767.6	37	CCDS10559.1	.	.	.	.	.	.	.	.	.	.	.	10.34	1.323150	0.24080	.	.	ENSG00000085721	ENST00000198767;ENST00000429751	T;T	0.46819	1.02;0.86	3.13	0.948	0.19561	.	.	.	.	.	T	0.19485	0.0468	N	0.08118	0	0.09310	N	0.999994	B;B;B	0.10296	0.0;0.003;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.26538	-1.0100	9	0.06494	T	0.89	.	3.8332	0.08883	0.1556:0.2546:0.5898:0.0	.	11;11;11	F5H148;Q3MHU9;Q9NYV6	.;.;RRN3_HUMAN	S	11	ENSP00000198767:P11S;ENSP00000402027:P11S	ENSP00000198767:P11S	P	-	1	0	RRN3	15095561	0.001000	0.12720	0.003000	0.11579	0.038000	0.13279	0.733000	0.26087	0.121000	0.18284	0.305000	0.20034	CCG	0.003		0.637	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252087.2	NM_018427	
RRN3	54700	hgsc.bcm.edu	37	16	15188066	15188066	+	Missense_Mutation	SNP	G	G	A	rs200006712		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr16:15188066G>A	ENST00000198767.6	-	1	108	c.25C>T	c.(25-27)Cgt>Tgt	p.R9C	RRN3_ENST00000429751.2_Missense_Mutation_p.R9C|PDXDC1_ENST00000535621.2_Intron|RRN3_ENST00000564131.1_Missense_Mutation_p.R9C|RRN3_ENST00000563559.1_Missense_Mutation_p.R9C|RRN3_ENST00000327307.7_5'Flank|RP11-72I8.1_ENST00000569858.1_RNA	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	9					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.R9C(3)		NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						CCCGGCAAACGCGTGTGAAGC	0.642																																					p.R9C		.											RRN3,NS,carcinoma,0,3	RRN3	0	3	Substitution - Missense(3)	lung(1)|prostate(1)|central_nervous_system(1)	c.C25T						.						15.0	13.0	14.0					16																	15188066		2194	4290	6484	SO:0001583	missense	54700	exon1			GCAAACGCGTGTG	AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.25C>T	16.37:g.15188066G>A	ENSP00000198767:p.Arg9Cys	68	2		79	9	NM_018427	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	ENST00000198767.6	37	CCDS10559.1	.	.	.	.	.	.	.	.	.	.	.	18.86	3.712820	0.68730	.	.	ENSG00000085721	ENST00000198767;ENST00000429751	T;T	0.59906	0.68;0.23	3.13	3.13	0.36017	.	.	.	.	.	T	0.59032	0.2164	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.77557	0.988;0.99;0.982	T	0.62627	-0.6814	9	0.87932	D	0	.	9.8894	0.41281	0.0:0.0:1.0:0.0	.	9;9;9	F5H148;Q3MHU9;Q9NYV6	.;.;RRN3_HUMAN	C	9	ENSP00000198767:R9C;ENSP00000402027:R9C	ENSP00000198767:R9C	R	-	1	0	RRN3	15095567	1.000000	0.71417	0.965000	0.40720	0.035000	0.12851	2.717000	0.47227	1.752000	0.51891	0.305000	0.20034	CGT	0.003		0.642	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252087.2	NM_018427	
APEH	327	hgsc.bcm.edu	37	3	49723522	49723522	+	IGR	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr3:49723522G>A	ENST00000296456.5	+	0	3220				AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000383728.3_3'UTR|MST1_ENST00000494828.2_5'Flank|MST1_ENST00000449682.2_Missense_Mutation_p.R374C	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)	p.R360C(2)		endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TCTGTACAACGCCGGATCTGG	0.697																																					p.R374C		.											MST1,NS,carcinoma,0,2	MST1	0	2	Substitution - Missense(2)	lung(1)|central_nervous_system(1)	c.C1120T						.						12.0	14.0	13.0					3																	49723522		2191	4284	6475	SO:0001628	intergenic_variant	4485	exon9			TACAACGCCGGAT	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49723522G>A		37	0		41	4	NM_020998	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.037157	0.93630	.	.	ENSG00000173531	ENST00000449682	T	0.68181	-0.31	5.4	4.52	0.55395	.	0.000000	0.42682	D	0.000669	D	0.83078	0.5176	M	0.90425	3.115	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.83214	-0.0072	10	0.32370	T	0.25	.	13.2202	0.59883	0.0778:0.0:0.9222:0.0	.	374	G3XAK1	.	C	374	ENSP00000414287:R374C	ENSP00000414287:R374C	R	-	1	0	MST1	49698526	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	8.008000	0.88588	2.526000	0.85167	0.655000	0.94253	CGT	.		0.697	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
ZNF33B	7582	hgsc.bcm.edu	37	10	43089614	43089614	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr10:43089614G>T	ENST00000359467.3	-	5	898	c.784C>A	c.(784-786)Ctc>Atc	p.L262I	ZNF33B_ENST00000486187.1_RNA	NM_006955.1	NP_008886.1	Q06732	ZN33B_HUMAN	zinc finger protein 33B	262					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(15)|skin(1)|stomach(1)	29						TGGAACAAGAGGGATGAACTA	0.388																																					p.L262I	Melanoma(137;1247 1767 16772 25727 43810)	.											ZNF33B,NS,carcinoma,0,1	ZNF33B	0	0			c.C784A						.						108.0	96.0	100.0					10																	43089614		2203	4300	6503	SO:0001583	missense	7582	exon5			ACAAGAGGGATGA	X68688, AJ491697	CCDS7198.1	10q11.2	2013-01-08	2005-03-18		ENSG00000196693	ENSG00000196693		"""Zinc fingers, C2H2-type"", ""-"""	13097	protein-coding gene	gene with protein product		194522	"""zinc finger protein 33b (KOX 31)"", ""zinc finger protein 11B"""	ZNF11B		2014798	Standard	NM_006955		Approved	KOX31, KOX2	uc001jaf.1	Q06732	OTTHUMG00000018014	ENST00000359467.3:c.784C>A	10.37:g.43089614G>T	ENSP00000352444:p.Leu262Ile	46	0		48	2	NM_006955	Q06731|Q32MA2|Q86XY8|Q8NDW3	Missense_Mutation	SNP	ENST00000359467.3	37	CCDS7198.1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.813829	0.32053	.	.	ENSG00000196693	ENST00000359467;ENST00000395836	T	0.40756	1.02	2.28	1.29	0.21616	.	0.788139	0.10377	N	0.682070	T	0.39172	0.1068	M	0.72894	2.215	0.09310	N	0.999997	B	0.11235	0.004	B	0.06405	0.002	T	0.43278	-0.9401	10	0.87932	D	0	.	4.7524	0.13066	0.2705:0.0:0.7295:0.0	.	262	Q06732	ZN33B_HUMAN	I	262;228	ENSP00000352444:L262I	ENSP00000352444:L262I	L	-	1	0	ZNF33B	42409620	0.000000	0.05858	0.025000	0.17156	0.419000	0.31324	-0.052000	0.11865	0.462000	0.27095	0.416000	0.27883	CTC	.		0.388	ZNF33B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_006955	
GOLGA2P5	55592	hgsc.bcm.edu	37	12	100552529	100552529	+	RNA	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr12:100552529G>A	ENST00000397112.4	-	0	1600				AC010203.1_ENST00000408843.1_RNA|RN7SL176P_ENST00000580352.1_RNA	NR_036632.1		Q9HBQ8	GGA2B_HUMAN								Golgi apparatus (GO:0005794)				large_intestine(1)|lung(3)	4						AACAGTTCCCGTTTCCTCCTG	0.532																																					.		.											.	.	.	0			.						.																																					55592	.			GTTCCCGTTTCCT																													12.37:g.100552529G>A		61	0		72	4	.	Q9NSV2	RNA	SNP	ENST00000397112.4	37																																																																																				.		0.532	GOLGA2B-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000396439.2		
TACC2	10579	hgsc.bcm.edu;bcgsc.ca	37	10	123970434	123970434	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr10:123970434G>T	ENST00000369005.1	+	9	6834	c.6494G>T	c.(6493-6495)aGt>aTt	p.S2165I	TACC2_ENST00000369000.1_5'UTR|TACC2_ENST00000515273.1_Missense_Mutation_p.S2169I|TACC2_ENST00000513429.1_Missense_Mutation_p.S311I|TACC2_ENST00000369001.1_5'UTR|TACC2_ENST00000369004.3_Missense_Mutation_p.S243I|TACC2_ENST00000453444.2_Missense_Mutation_p.S2169I|TACC2_ENST00000334433.3_Missense_Mutation_p.S2165I|TACC2_ENST00000260733.3_Missense_Mutation_p.S243I|TACC2_ENST00000360561.3_Missense_Mutation_p.S243I|TACC2_ENST00000515603.1_Missense_Mutation_p.S2120I|TACC2_ENST00000358010.1_Missense_Mutation_p.S311I|TACC2_ENST00000368999.1_Missense_Mutation_p.S243I	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	2165					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CTTGTCCCCAGTGGGGAGAAT	0.562																																					p.S2165I		.											.	.	.	0			c.G6494T						.						95.0	107.0	103.0					10																	123970434		2203	4300	6503	SO:0001583	missense	10579	exon9			TCCCCAGTGGGGA	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.6494G>T	10.37:g.123970434G>T	ENSP00000358001:p.Ser2165Ile	69	0		56	4	NM_206862	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	G	3.241	-0.155393	0.06544	.	.	ENSG00000138162	ENST00000369005;ENST00000513429;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000358010;ENST00000453444;ENST00000340076;ENST00000360561;ENST00000368999;ENST00000369004;ENST00000260733;ENST00000514539;ENST00000505639	T;T;T;T;T;T;T;T;T;T;T;T;T	0.30981	3.91;3.52;3.97;3.96;3.91;3.52;3.97;3.4;3.34;3.34;3.4;2.99;1.51	5.54	1.46	0.22682	.	0.864012	0.09636	N	0.775584	T	0.20981	0.0505	L	0.36672	1.1	0.09310	N	1	B;B;B;B;B;B;B;B;B	0.16396	0.004;0.017;0.0;0.009;0.017;0.0;0.0;0.002;0.009	B;B;B;B;B;B;B;B;B	0.17098	0.002;0.011;0.001;0.017;0.011;0.001;0.001;0.002;0.017	T	0.31641	-0.9936	10	0.45353	T	0.12	0.7929	2.1468	0.03789	0.1375:0.2617:0.36:0.2408	.	260;2169;243;2120;2169;243;243;311;2165	E9PGB3;E9PBC6;D6RAA5;E7EMZ9;B7ZMJ9;O95359-6;O95359-1;O95359-5;O95359	.;.;.;.;.;.;.;.;TACC2_HUMAN	I	2165;311;2169;2120;2165;311;2169;2155;243;243;243;243;260;6	ENSP00000358001:S2165I;ENSP00000425062:S311I;ENSP00000424467:S2169I;ENSP00000427618:S2120I;ENSP00000334280:S2165I;ENSP00000350701:S311I;ENSP00000395048:S2169I;ENSP00000353763:S243I;ENSP00000357995:S243I;ENSP00000422815:S243I;ENSP00000260733:S243I;ENSP00000420967:S260I;ENSP00000426303:S6I	ENSP00000260733:S243I	S	+	2	0	TACC2	123960424	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	0.871000	0.28023	0.010000	0.14839	0.655000	0.94253	AGT	.		0.562	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1		
ZMIZ2	83637	hgsc.bcm.edu	37	7	44804019	44804019	+	Splice_Site	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr7:44804019G>T	ENST00000309315.4	+	14	1985	c.1862G>T	c.(1861-1863)tGc>tTc	p.C621F	ZMIZ2_ENST00000441627.1_Splice_Site_p.C621F|ZMIZ2_ENST00000413916.1_Splice_Site_p.C563F|ZMIZ2_ENST00000433667.1_Splice_Site_p.C589F|ZMIZ2_ENST00000265346.7_Splice_Site_p.C595F	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	621					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						TCTCTACAGTGCTTTGACCTG	0.502																																					p.C621F	NSCLC(20;604 852 1948 16908 50522)	.											ZMIZ2,NS,carcinoma,0,1	ZMIZ2	0	0			c.G1862T						.						94.0	102.0	100.0					7																	44804019		2194	4299	6493	SO:0001630	splice_region_variant	83637	exon14			TACAGTGCTTTGA	AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.1861-1G>T	7.37:g.44804019G>T		29	0		18	2	NM_031449	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Missense_Mutation	SNP	ENST00000309315.4	37	CCDS43576.1	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743576	0.69418	.	.	ENSG00000122515	ENST00000413916;ENST00000309315;ENST00000441627;ENST00000433667;ENST00000265346;ENST00000414051	D;D;D;D;D	0.96427	-4.01;-4.01;-4.01;-4.01;-4.01	5.05	5.05	0.67936	Zinc finger, MIZ-type (2);	0.000000	0.64402	D	0.000003	D	0.98773	0.9587	H	0.96430	3.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99556	1.0967	10	0.87932	D	0	-13.6695	17.3284	0.87256	0.0:0.0:1.0:0.0	.	595;621;563	Q8NF64-2;Q8NF64;Q8NF64-3	.;ZMIZ2_HUMAN;.	F	563;621;621;589;595;624	ENSP00000409648:C563F;ENSP00000311778:C621F;ENSP00000414723:C621F;ENSP00000396601:C589F;ENSP00000265346:C595F	ENSP00000265346:C595F	C	+	2	0	ZMIZ2	44770544	1.000000	0.71417	1.000000	0.80357	0.534000	0.34807	9.229000	0.95273	2.639000	0.89480	0.491000	0.48974	TGC	.		0.502	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449	Missense_Mutation
MT-ND4	4538	hgsc.bcm.edu	37	M	12125	12125	+	Missense_Mutation	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chrM:12125G>A	ENST00000361381.2	+	1	1366	c.1366G>A	c.(1366-1368)Ggg>Agg	p.G456R	MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-ND5_ENST00000361567.2_5'Flank			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	456					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						ACATCATTACCGGGTTTTCCT	0.418																																					p.G456X		.											.	.	.	0			c.G1366A						.																																			SO:0001583	missense	0	exon1			ATTACCGGGTTTT			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.1366G>A	M.37:g.12125G>A	ENSP00000354961:p.Gly456Arg	8	0		33	23	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Nonsense_Mutation	SNP	ENST00000361381.2	37																																																																																				.		0.418	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
TRIM56	81844	hgsc.bcm.edu	37	7	100732027	100732027	+	Silent	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr7:100732027G>T	ENST00000306085.6	+	3	1731	c.1434G>T	c.(1432-1434)ctG>ctT	p.L478L		NM_030961.1	NP_112223.1	Q9BRZ2	TRI56_HUMAN	tripartite motif containing 56	478					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of type I interferon production (GO:0032481)|protein K63-linked ubiquitination (GO:0070534)|regulation of type I interferon production (GO:0032479)|response to type I interferon (GO:0034340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L478L(2)		breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	Lung NSC(181;0.136)|all_lung(186;0.182)					GCCCAGCCCTGGGGCCGAATC	0.622																																					p.L478L	Ovarian(89;1092 1379 22756 38989 39611)	.											TRIM56_ENST00000306085,NS,carcinoma,0,2	TRIM56_ENST00000306085	0	2	Substitution - coding silent(2)	lung(2)	c.G1434T						.						56.0	66.0	63.0					7																	100732027		1922	4116	6038	SO:0001819	synonymous_variant	81844	exon3			AGCCCTGGGGCCG	BK000511	CCDS43625.1	7q11.2	2013-01-09	2011-01-25		ENSG00000169871	ENSG00000169871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19028	protein-coding gene	gene with protein product			"""tripartite motif-containing 56"""				Standard	NM_030961		Approved	RNF109	uc003uxq.3	Q9BRZ2	OTTHUMG00000157032	ENST00000306085.6:c.1434G>T	7.37:g.100732027G>T		32	0		29	2	NM_030961	Q6PJS5|Q86VT6|Q8N2H8|Q8NAC0|Q9H031	Silent	SNP	ENST00000306085.6	37	CCDS43625.1																																																																																			.		0.622	TRIM56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347185.1	NM_030961	
SAGE1	55511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	134986716	134986716	+	Missense_Mutation	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chrX:134986716C>T	ENST00000370709.3	+	3	301	c.301C>T	c.(301-303)Cca>Tca	p.P101S	SAGE1_ENST00000324447.3_Missense_Mutation_p.P101S|SAGE1_ENST00000537770.1_Missense_Mutation_p.P101S|SAGE1_ENST00000535938.1_Missense_Mutation_p.P101S			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	101						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					GTCAACTGCTCCACCATGGCC	0.423																																					p.P101S		.											.	.	.	0			c.C301T						.						149.0	117.0	128.0					X																	134986716		2203	4300	6503	SO:0001583	missense	55511	exon4			ACTGCTCCACCAT	AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.301C>T	X.37:g.134986716C>T	ENSP00000359743:p.Pro101Ser	50	0		68	14	NM_018666	Q5JNW0	Missense_Mutation	SNP	ENST00000370709.3	37	CCDS14652.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.274819	0.23307	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000537770;ENST00000370709	T;T;T;T	0.54071	0.63;0.63;0.59;0.63	1.25	0.258	0.15578	.	0.104082	0.39834	U	0.001255	T	0.54255	0.1847	L	0.36672	1.1	0.09310	N	1	B;D	0.89917	0.295;1.0	B;D	0.91635	0.178;0.999	T	0.41627	-0.9498	10	0.54805	T	0.06	.	4.8089	0.13333	0.0:0.6064:0.3936:0.0	.	101;101	F5H2Z8;Q9NXZ1	.;SAGE1_HUMAN	S	101	ENSP00000323191:P101S;ENSP00000445959:P101S;ENSP00000438276:P101S;ENSP00000359743:P101S	ENSP00000323191:P101S	P	+	1	0	SAGE1	134814382	0.178000	0.23122	0.003000	0.11579	0.054000	0.15201	-0.047000	0.11963	0.014000	0.14944	0.284000	0.19432	CCA	.		0.423	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058448.1	NM_018666	
GP1BA	2811	hgsc.bcm.edu;bcgsc.ca	37	17	4837171	4837171	+	Silent	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr17:4837171G>A	ENST00000329125.5	+	2	1347	c.1272G>A	c.(1270-1272)ccG>ccA	p.P424P		NM_000173.5	NP_000164.5	P07359	GP1BA_HUMAN	glycoprotein Ib (platelet), alpha polypeptide	424	Pro/Thr-rich.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|fibrinolysis (GO:0042730)|platelet activation (GO:0030168)|regulation of blood coagulation (GO:0030193)|thrombin receptor signaling pathway (GO:0070493)	anchored component of external side of plasma membrane (GO:0031362)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)	p.E412_P424delEPTSEPAPSPTTP(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(5)|stomach(1)|urinary_tract(1)	20						cgaccaccccggagcccacct	0.751																																					p.P424P		.											.	.	.	1	Deletion - In frame(1)	stomach(1)	c.G1272A						.																																			SO:0001819	synonymous_variant	2811	exon2			CACCCCGGAGCCC		CCDS54068.1	17p13.2	2014-09-17			ENSG00000185245	ENSG00000185245		"""CD molecules"""	4439	protein-coding gene	gene with protein product		606672		GP1B		3353370	Standard	NM_000173		Approved	CD42b	uc021tnz.1	P07359	OTTHUMG00000177946	ENST00000329125.5:c.1272G>A	17.37:g.4837171G>A		29	0		42	7	NM_000173	E7ES66|Q14441|Q16469|Q8N1F3|Q8NG39|Q9HDC7|Q9UEK1|Q9UQS4	Silent	SNP	ENST00000329125.5	37	CCDS54068.1																																																																																			.		0.751	GP1BA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439889.1		
SENP3	26168	hgsc.bcm.edu	37	17	7466484	7466484	+	Missense_Mutation	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr17:7466484C>T	ENST00000429205.2	+	2	140	c.91C>T	c.(91-93)Cgt>Tgt	p.R31C	SENP3_ENST00000321337.7_Missense_Mutation_p.R31C|SENP3-EIF4A1_ENST00000579777.1_RNA|SENP3_ENST00000578868.1_3'UTR			Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 3	31	Pro-rich.			ER -> DG (in Ref. 1; AAG33252). {ECO:0000305}.		cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|ovary(1)	2		Prostate(122;0.157)				CAGGCGGGAGCGTCTTCGTTG	0.632																																					p.R31C		.											SENP3_ENST00000429205,colon,carcinoma,0,1	SENP3_ENST00000429205	0	0			c.C91T						.						13.0	15.0	14.0					17																	7466484		1926	4102	6028	SO:0001583	missense	26168	exon2			CGGGAGCGTCTTC	AK000923	CCDS73958.1	17p13	2012-05-02	2005-08-17			ENSG00000161956			17862	protein-coding gene	gene with protein product		612844	"""SUMO1/sentrin/SMT3 specific protease 3"""			10806345, 11230166	Standard	NM_015670		Approved	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1	uc002ghm.3	Q9H4L4		ENST00000429205.2:c.91C>T	17.37:g.7466484C>T	ENSP00000403712:p.Arg31Cys	75	0		64	3	NM_015670	Q66K15|Q86VS7|Q96PS4|Q9Y3W9	Missense_Mutation	SNP	ENST00000429205.2	37		.	.	.	.	.	.	.	.	.	.	C	14.57	2.573775	0.45902	.	.	ENSG00000161956	ENST00000321337;ENST00000429205	T;T	0.35973	1.28;1.28	4.72	3.75	0.43078	.	0.349899	0.24757	N	0.035858	T	0.18841	0.0452	N	0.08118	0	0.38640	D	0.951594	B	0.02656	0.0	B	0.01281	0.0	T	0.06445	-1.0826	10	0.87932	D	0	-2.2113	8.366	0.32387	0.0:0.8942:0.0:0.1058	.	31	Q9H4L4	SENP3_HUMAN	C	31	ENSP00000314029:R31C;ENSP00000403712:R31C	ENSP00000314029:R31C	R	+	1	0	SENP3	7407208	0.996000	0.38824	0.994000	0.49952	0.967000	0.64934	1.948000	0.40303	1.204000	0.43247	0.563000	0.77884	CGT	.		0.632	SENP3-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015670	
EFTUD1P1	648809	hgsc.bcm.edu;bcgsc.ca	37	15	84789851	84789851	+	IGR	SNP	T	T	C			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr15:84789851T>C								EFTUD1P1 (7423 upstream) : RP13-262C2.3 (50078 downstream)																							GGCCTCTCACTCAAGAAGAAA	0.502																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	648809	.			TCTCACTCAAGAA																													15.37:g.84789851T>C		53	0		57	5	.		RNA	SNP		37																																																																																				.	0	0.502								
ZNF98	148198	hgsc.bcm.edu	37	19	22574573	22574573	+	Silent	SNP	C	C	T	rs74174065		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr19:22574573C>T	ENST00000357774.5	-	4	1585	c.1464G>A	c.(1462-1464)aaG>aaA	p.K488K		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	488					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				ATTTGTAGGGCTTCTCTCCAG	0.393																																					p.K488K		.											ZNF98_ENST00000357774,NS,carcinoma,0,2	ZNF98_ENST00000357774	0	0			c.G1464A						.						73.0	66.0	68.0					19																	22574573		2181	4273	6454	SO:0001819	synonymous_variant	148198	exon4			GTAGGGCTTCTCT		CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.1464G>A	19.37:g.22574573C>T		38	1		46	4	NM_001098626		Silent	SNP	ENST00000357774.5	37	CCDS46031.1																																																																																			.		0.393	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1	NM_001098626	
BRAT1	221927	hgsc.bcm.edu	37	7	2586990	2586990	+	Missense_Mutation	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr7:2586990C>T	ENST00000340611.4	-	3	506	c.250G>A	c.(250-252)Gca>Aca	p.A84T		NM_152743.3	NP_689956.2	Q6PJG6	BRAT1_HUMAN	BRCA1-associated ATM activator 1	84					response to ionizing radiation (GO:0010212)	membrane (GO:0016020)|nucleus (GO:0005634)		p.A84T(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23						TCCTGGGCTGCGAAGGTTCCT	0.627																																					p.A84T		.											BRAT1,NS,carcinoma,0,1	BRAT1	0	1	Substitution - Missense(1)	endometrium(1)	c.G250A						.						75.0	68.0	71.0					7																	2586990		2203	4300	6503	SO:0001583	missense	221927	exon3			GGGCTGCGAAGGT	BC015632	CCDS5334.1	7p22.3	2011-03-22	2011-02-28	2011-03-22	ENSG00000106009	ENSG00000106009			21701	protein-coding gene	gene with protein product	"""BRCA1-associated protein required for ATM activation protein 1"""	614506	"""chromosome 7 open reading frame 27"""	C7orf27, BAAT1		16452482	Standard	NM_152743		Approved	MGC22916	uc003smi.3	Q6PJG6	OTTHUMG00000119091	ENST00000340611.4:c.250G>A	7.37:g.2586990C>T	ENSP00000339637:p.Ala84Thr	52	0		44	2	NM_152743	A4D200|C9JY24|Q8IW85|Q8IZ43|Q8WVR8|Q96IV9|Q9H7J8|Q9UFA3	Missense_Mutation	SNP	ENST00000340611.4	37	CCDS5334.1	.	.	.	.	.	.	.	.	.	.	C	16.81	3.227027	0.58668	.	.	ENSG00000106009	ENST00000340611	T	0.22945	1.93	5.01	5.01	0.66863	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.53174	0.1780	M	0.77616	2.38	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	T	0.58896	-0.7555	10	0.87932	D	0	-13.1456	16.0942	0.81110	0.0:1.0:0.0:0.0	.	84;84	Q6PJG6-2;Q6PJG6	.;BRAT1_HUMAN	T	84	ENSP00000339637:A84T	ENSP00000339637:A84T	A	-	1	0	BRAT1	2553516	0.994000	0.37717	0.171000	0.22900	0.121000	0.20230	3.582000	0.53921	2.331000	0.79229	0.650000	0.86243	GCA	.		0.627	BRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239305.2	NM_152743	
TLL1	7092	hgsc.bcm.edu	37	4	166999170	166999170	+	Missense_Mutation	SNP	C	C	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr4:166999170C>A	ENST00000061240.2	+	18	3077	c.2430C>A	c.(2428-2430)caC>caA	p.H810Q	TLL1_ENST00000507499.1_Missense_Mutation_p.H833Q	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	810	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		CTCCTGGCCACCGAATCAAAT	0.463																																					p.H810Q		.											TLL1,right_lower_lobe,carcinoma,0,1	TLL1	0	0			c.C2430A						.						118.0	101.0	106.0					4																	166999170		2203	4300	6503	SO:0001583	missense	7092	exon18			TGGCCACCGAATC	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2430C>A	4.37:g.166999170C>A	ENSP00000061240:p.His810Gln	45	0		41	2	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	C	9.841	1.191075	0.21954	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	T;T	0.34275	1.37;1.37	5.78	2.55	0.30701	CUB (5);	0.125897	0.53938	U	0.000049	T	0.30947	0.0781	L	0.58669	1.825	0.80722	D	1	B;B	0.16802	0.019;0.001	B;B	0.19148	0.024;0.011	T	0.15723	-1.0427	10	0.41790	T	0.15	.	7.4937	0.27477	0.0:0.5801:0.2238:0.1961	.	833;810	E9PD25;O43897	.;TLL1_HUMAN	Q	810;833	ENSP00000061240:H810Q;ENSP00000426082:H833Q	ENSP00000061240:H810Q	H	+	3	2	TLL1	167218620	1.000000	0.71417	1.000000	0.80357	0.193000	0.23685	1.731000	0.38135	1.329000	0.45376	0.650000	0.86243	CAC	.		0.463	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
GALNTL5	168391	hgsc.bcm.edu	37	7	151699823	151699823	+	Missense_Mutation	SNP	G	G	T	rs149988530		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr7:151699823G>T	ENST00000392800.2	+	6	937	c.683G>T	c.(682-684)aGc>aTc	p.S228I	GALNTL5_ENST00000431418.2_Missense_Mutation_p.S228I|GALNTL5_ENST00000483959.1_3'UTR	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	228	Catalytic subdomain A.				spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)	p.S228I(1)		NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		TTCCTGGACAGCCACTGTGAG	0.502																																					p.S228I		.											GALNTL5,NS,carcinoma,0,1	GALNTL5	0	1	Substitution - Missense(1)	lung(1)	c.G683T						.						84.0	78.0	80.0					7																	151699823		2203	4300	6503	SO:0001583	missense	168391	exon6			TGGACAGCCACTG	AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.683G>T	7.37:g.151699823G>T	ENSP00000376548:p.Ser228Ile	42	0		44	2	NM_145292	Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Missense_Mutation	SNP	ENST00000392800.2	37	CCDS5929.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.391875	0.83011	.	.	ENSG00000106648	ENST00000431418;ENST00000392800	T;T	0.62232	0.04;0.04	4.83	4.83	0.62350	Glycosyl transferase, family 2 (1);	0.000000	0.56097	D	0.000030	D	0.86711	0.5998	H	0.98883	4.36	0.51012	D	0.999907	D	0.89917	1.0	D	0.81914	0.995	D	0.90978	0.4825	10	0.87932	D	0	.	13.2335	0.59957	0.0:0.1593:0.8407:0.0	.	228	Q7Z4T8	GLTL5_HUMAN	I	228	ENSP00000392582:S228I;ENSP00000376548:S228I	ENSP00000376548:S228I	S	+	2	0	GALNTL5	151330756	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	9.267000	0.95665	2.673000	0.90976	0.650000	0.86243	AGC	.		0.502	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348395.1	NM_145292	
LRP1B	53353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	141812821	141812821	+	Missense_Mutation	SNP	G	G	C			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr2:141812821G>C	ENST00000389484.3	-	10	2387	c.1416C>G	c.(1414-1416)agC>agG	p.S472R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	472	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CACATGCATGGCTTCTGACTA	0.403										TSP Lung(27;0.18)																											p.S472R	Colon(99;50 2074 2507 20106)	.											.	.	.	0			c.C1416G						.						84.0	75.0	78.0					2																	141812821		2203	4300	6503	SO:0001583	missense	53353	exon10			TGCATGGCTTCTG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1416C>G	2.37:g.141812821G>C	ENSP00000374135:p.Ser472Arg	39	0		37	12	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.899765	0.72754	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.97598	-4.45	5.45	5.45	0.79879	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.057764	0.64402	U	0.000002	D	0.95840	0.8646	L	0.47716	1.5	0.42433	D	0.992686	P	0.49961	0.93	P	0.44860	0.462	D	0.95388	0.8479	10	0.38643	T	0.18	.	19.2911	0.94100	0.0:0.0:1.0:0.0	.	472	Q9NZR2	LRP1B_HUMAN	R	472;410	ENSP00000374135:S472R	ENSP00000374135:S472R	S	-	3	2	LRP1B	141529291	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.717000	0.47227	2.569000	0.86673	0.557000	0.71058	AGC	.		0.403	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
KIAA1468	57614	hgsc.bcm.edu	37	18	59919949	59919949	+	Missense_Mutation	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr18:59919949C>T	ENST00000398130.2	+	12	2018	c.1786C>T	c.(1786-1788)Cgt>Tgt	p.R596C	KIAA1468_ENST00000256858.6_Missense_Mutation_p.R596C	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	596										autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				TGGACCAACACGTGTAGAAGC	0.373																																					p.R596C		.											KIAA1468,colon,carcinoma,0,1	KIAA1468	0	0			c.C1786T						.						121.0	104.0	110.0					18																	59919949		2203	4300	6503	SO:0001583	missense	57614	exon12			CCAACACGTGTAG	BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.1786C>T	18.37:g.59919949C>T	ENSP00000381198:p.Arg596Cys	36	0		41	2	NM_020854		Missense_Mutation	SNP	ENST00000398130.2	37	CCDS11979.2	.	.	.	.	.	.	.	.	.	.	C	28.6	4.932384	0.92389	.	.	ENSG00000134444	ENST00000398130;ENST00000256858	T;T	0.45668	0.89;0.89	5.81	5.81	0.92471	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67748	0.2926	M	0.76838	2.35	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	P;D;D	0.78314	0.896;0.991;0.991	T	0.66452	-0.5920	9	.	.	.	-12.6458	20.0621	0.97678	0.0:1.0:0.0:0.0	.	596;596;240	Q9P260-2;Q9P260;B2RD46	.;K1468_HUMAN;.	C	596	ENSP00000381198:R596C;ENSP00000256858:R596C	.	R	+	1	0	KIAA1468	58070929	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.830000	0.69324	2.750000	0.94351	0.655000	0.94253	CGT	.		0.373	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256187.1	NM_020854	
SCAPER	49855	hgsc.bcm.edu	37	15	77046217	77046217	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr15:77046217G>T	ENST00000563290.1	-	15	1893	c.1798C>A	c.(1798-1800)Cat>Aat	p.H600N	SCAPER_ENST00000538941.2_Missense_Mutation_p.H354N|SCAPER_ENST00000324767.7_Missense_Mutation_p.H600N			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	600	Glu-rich.					endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.H600Y(1)		NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						AACTCAGCATGAAGTAATTTT	0.378																																					p.H600N		.											SCAPER_ENST00000538941,NS,carcinoma,0,2	SCAPER_ENST00000538941	0	1	Substitution - Missense(1)	lung(1)	c.C1798A						.						231.0	219.0	223.0					15																	77046217		1873	4092	5965	SO:0001583	missense	49855	exon14			CAGCATGAAGTAA	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.1798C>A	15.37:g.77046217G>T	ENSP00000454973:p.His600Asn	32	0		38	2	NM_020843	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	37	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.724526	0.89298	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.23348	1.92;1.91	5.77	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.29652	0.0740	N	0.14661	0.345	0.49389	D	0.999786	P;P	0.51653	0.947;0.947	P;P	0.56042	0.79;0.61	T	0.15206	-1.0445	10	0.51188	T	0.08	.	16.7438	0.85466	0.0:0.1294:0.8706:0.0	.	621;354	Q9BY12-2;F5H7X8	.;.	N	600;354;622	ENSP00000326924:H600N;ENSP00000442190:H354N	ENSP00000303560:H622N	H	-	1	0	SCAPER	74833272	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.585000	0.98223	1.411000	0.46957	0.655000	0.94253	CAT	.		0.378	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
HIATL1	84641	hgsc.bcm.edu	37	9	97177491	97177491	+	Missense_Mutation	SNP	C	C	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr9:97177491C>A	ENST00000375344.3	+	2	429	c.160C>A	c.(160-162)Ctt>Att	p.L54I	HIATL1_ENST00000428393.2_5'UTR	NM_032558.2	NP_115947.2	Q5SR56	HIAL1_HUMAN	hippocampus abundant transcript-like 1	54					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	11		Acute lymphoblastic leukemia(62;0.136)				TGTCATCTTCCTTGAATTCTT	0.373																																					p.L54I	Pancreas(77;1260 1915 1973 10423)	.											.	.	.	0			c.C160A						.						213.0	192.0	199.0					9																	97177491		2203	4300	6503	SO:0001583	missense	84641	exon2			ATCTTCCTTGAAT	AK027659	CCDS6710.2	9q22.32	2009-12-04			ENSG00000148110	ENSG00000148110			23376	protein-coding gene	gene with protein product							Standard	XM_005252277		Approved	FLJ14753	uc004aur.3	Q5SR56	OTTHUMG00000020265	ENST00000375344.3:c.160C>A	9.37:g.97177491C>A	ENSP00000364493:p.Leu54Ile	112	0		98	4	NM_032558	B4DUE6|E9PD58|Q3KQT4|Q53GU5|Q8WU95|Q96SM4	Missense_Mutation	SNP	ENST00000375344.3	37	CCDS6710.2	.	.	.	.	.	.	.	.	.	.	.	16.57	3.159860	0.57368	.	.	ENSG00000148110	ENST00000375344	T	0.60797	0.16	3.8	3.8	0.43715	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.344301	0.21380	N	0.075491	T	0.66645	0.2810	M	0.76328	2.33	0.80722	D	1	P	0.47253	0.892	P	0.56788	0.806	T	0.64980	-0.6279	10	0.34782	T	0.22	-0.9052	7.4129	0.27027	0.0:0.8807:0.0:0.1193	.	54	Q5SR56	HIAL1_HUMAN	I	54	ENSP00000364493:L54I	ENSP00000364493:L54I	L	+	1	0	HIATL1	96217312	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	0.601000	0.24119	2.131000	0.65755	0.305000	0.20034	CTT	.		0.373	HIATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053184.1	NM_032558	
ZNF615	284370	hgsc.bcm.edu	37	19	52497156	52497156	+	Silent	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr19:52497156C>T	ENST00000602063.1	-	6	1522	c.1173G>A	c.(1171-1173)caG>caA	p.Q391Q	ZNF615_ENST00000391795.3_Silent_p.Q396Q|ZNF615_ENST00000594083.1_Silent_p.Q402Q|ZNF615_ENST00000376716.5_Silent_p.Q391Q|ZNF615_ENST00000598071.1_Silent_p.Q402Q			Q8N8J6	ZN615_HUMAN	zinc finger protein 615	391					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q402H(1)|p.Q391H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(5)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	42		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		TATGAGTTTGCTGATGTGTGA	0.393																																					p.Q402Q		.											ZNF615,NS,carcinoma,0,2	ZNF615	0	2	Substitution - Missense(2)	lung(2)	c.G1206A						.						94.0	86.0	89.0					19																	52497156		2203	4300	6503	SO:0001819	synonymous_variant	284370	exon7			AGTTTGCTGATGT	AK096691	CCDS12846.1, CCDS59418.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	24740	protein-coding gene	gene with protein product						12477932	Standard	NM_001199324		Approved	FLJ33710	uc002pyf.2	Q8N8J6		ENST00000602063.1:c.1173G>A	19.37:g.52497156C>T		37	0		47	2	NM_001199324	B7ZKW9|Q2M2Y6|Q5CZB0|Q6ZMT7|Q6ZRB3	Silent	SNP	ENST00000602063.1	37	CCDS12846.1																																																																																			.		0.393	ZNF615-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462391.1	NM_198480	
NAV1	89796	hgsc.bcm.edu	37	1	201749556	201749556	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr1:201749556G>T	ENST00000367296.4	+	4	1654	c.1234G>T	c.(1234-1236)Gaa>Taa	p.E412*	NAV1_ENST00000295624.6_Nonsense_Mutation_p.E412*|NAV1_ENST00000367295.1_Nonsense_Mutation_p.E21*|NAV1_ENST00000367300.3_Nonsense_Mutation_p.E412*|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367297.4_Nonsense_Mutation_p.E412*|NAV1_ENST00000367302.1_Nonsense_Mutation_p.E425*	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	412					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.E412K(1)		breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						TAGCTGGGATGAAAGCAGCTC	0.468																																					p.E412X		.											NAV1,NS,carcinoma,0,1	NAV1	0	1	Substitution - Missense(1)	lung(1)	c.G1234T						.						114.0	104.0	107.0					1																	201749556		2203	4300	6503	SO:0001587	stop_gained	89796	exon4			TGGGATGAAAGCA	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.1234G>T	1.37:g.201749556G>T	ENSP00000356265:p.Glu412*	28	0		41	2	NM_020443	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Nonsense_Mutation	SNP	ENST00000367296.4	37	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	G	44	11.014327	0.99503	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000367295	.	.	.	5.42	5.42	0.78866	.	0.165903	0.50627	D	0.000102	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-25.9456	18.8379	0.92169	0.0:0.0:1.0:0.0	.	.	.	.	X	425;412;412;412;412;21	.	ENSP00000295624:E412X	E	+	1	0	NAV1	200016179	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.833000	0.99426	2.531000	0.85337	0.655000	0.94253	GAA	.		0.468	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443	
SHKBP1	92799	hgsc.bcm.edu	37	19	41088331	41088331	+	Missense_Mutation	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr19:41088331G>A	ENST00000291842.5	+	10	968	c.919G>A	c.(919-921)Ggg>Agg	p.G307R	SHKBP1_ENST00000600733.1_Splice_Site	NM_138392.3	NP_612401.2	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	307					protein homooligomerization (GO:0051260)			p.G307W(1)		breast(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(3)|urinary_tract(1)	29			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AAGCCACACAGGGCGCATCGG	0.597																																					p.G307R		.											SHKBP1,colon,carcinoma,0,1	SHKBP1	0	1	Substitution - Missense(1)	large_intestine(1)	c.G919A						.						88.0	84.0	85.0					19																	41088331		2203	4300	6503	SO:0001583	missense	92799	exon10			CACACAGGGCGCA	AF258553	CCDS12560.1	19q13.2	2013-01-10				ENSG00000160410		"""WD repeat domain containing"""	19214	protein-coding gene	gene with protein product						11152963	Standard	NM_138392		Approved	PP203, Sb1	uc002oob.3	Q8TBC3		ENST00000291842.5:c.919G>A	19.37:g.41088331G>A	ENSP00000291842:p.Gly307Arg	61	0		49	2	NM_138392	Q8N2I6|Q8WY93|Q96IB8	Missense_Mutation	SNP	ENST00000291842.5	37	CCDS12560.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.408171	0.83340	.	.	ENSG00000160410	ENST00000291842;ENST00000446701	T	0.11277	2.79	4.62	4.62	0.57501	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.37156	0.0993	M	0.82193	2.58	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.998;1.0;1.0;0.999	T	0.34129	-0.9841	10	0.87932	D	0	-25.3929	16.3577	0.83243	0.0:0.0:1.0:0.0	.	185;144;230;144;307	B4DLI0;B4DUW2;B4DUV2;B3KVX8;Q8TBC3	.;.;.;.;SHKB1_HUMAN	R	307;144	ENSP00000291842:G307R	ENSP00000291842:G307R	G	+	1	0	SHKBP1	45780171	1.000000	0.71417	0.697000	0.30258	0.658000	0.38924	9.023000	0.93683	2.405000	0.81733	0.561000	0.74099	GGG	.		0.597	SHKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462613.2	NM_138392	
IARS2	55699	hgsc.bcm.edu	37	1	220284124	220284124	+	Intron	SNP	A	A	T	rs554865203		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr1:220284124A>T	ENST00000302637.5	+	11	1431				IARS2_ENST00000366922.1_Intron	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial						gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	TTTTTTTTTTAAAGTTATAAA	0.338																																					.		.											.	.	.	0			.						.						40.0	46.0	44.0					1																	220284124		2203	4299	6502	SO:0001627	intron_variant	26828	.			TTTTTTAAAGTTA	AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.1328-4A>T	1.37:g.220284124A>T		39	0		75	4	.	B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	RNA	SNP	ENST00000302637.5	37	CCDS1523.1																																																																																			.		0.338	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018060	
LRP1	4035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	57569279	57569279	+	Missense_Mutation	SNP	A	A	G			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr12:57569279A>G	ENST00000243077.3	+	23	4050	c.3584A>G	c.(3583-3585)aAc>aGc	p.N1195S		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1195	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TGCAGCCACAACTGCTCAGTG	0.617											OREG0021937	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N1195S		.											.	.	.	0			c.A3584G						.						63.0	54.0	57.0					12																	57569279		2203	4300	6503	SO:0001583	missense	4035	exon23			GCCACAACTGCTC	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.3584A>G	12.37:g.57569279A>G	ENSP00000243077:p.Asn1195Ser	15	0	1024	29	5	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	A	14.06	2.422342	0.43020	.	.	ENSG00000123384	ENST00000243077	D	0.96300	-3.97	4.87	4.87	0.63330	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.95294	0.8473	N	0.25426	0.745	0.80722	D	1	D	0.63880	0.993	D	0.68192	0.956	D	0.92620	0.6107	10	0.08381	T	0.77	.	13.5953	0.61987	1.0:0.0:0.0:0.0	.	1195	Q07954	LRP1_HUMAN	S	1195	ENSP00000243077:N1195S	ENSP00000243077:N1195S	N	+	2	0	LRP1	55855546	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.060000	0.93907	2.052000	0.61016	0.533000	0.62120	AAC	.		0.617	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
PARP2	10038	hgsc.bcm.edu	37	14	20820419	20820419	+	Silent	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr14:20820419G>T	ENST00000250416.5	+	7	579	c.552G>T	c.(550-552)acG>acT	p.T184T	PARP2_ENST00000429687.3_Silent_p.T171T|PARP2_ENST00000527915.1_Silent_p.T184T	NM_001042618.1|NM_005484.3	NP_001036083.1|NP_005475.2	Q9UGN5	PARP2_HUMAN	poly (ADP-ribose) polymerase 2	184					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway (GO:0097191)|protein ADP-ribosylation (GO:0006471)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.T135T(1)|p.T184T(1)		central_nervous_system(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)	15	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;5.34e-07)|all cancers(55;3.7e-06)	GBM - Glioblastoma multiforme(265;0.00888)|READ - Rectum adenocarcinoma(17;0.0649)		TTGACAAAACGAAAAACAATT	0.368								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																													p.T184T		.											PARP2_ENST00000250416,rectum,carcinoma,0,2	PARP2_ENST00000250416	0	2	Substitution - coding silent(2)	large_intestine(2)	c.G552T						.						104.0	94.0	97.0					14																	20820419		1829	4087	5916	SO:0001819	synonymous_variant	10038	exon7			CAAAACGAAAAAC	AF085734	CCDS41910.1, CCDS45077.1	14q11.2-q12	2010-02-16	2008-07-28	2004-08-26	ENSG00000129484	ENSG00000129484		"""Poly (ADP-ribose) polymerases"""	272	protein-coding gene	gene with protein product		607725	"""ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2"", ""poly (ADP-ribose) polymerase family, member 2"""	ADPRTL2		10329013, 18353725	Standard	NM_005484		Approved		uc001vxc.3	Q9UGN5	OTTHUMG00000166106	ENST00000250416.5:c.552G>T	14.37:g.20820419G>T		51	0		53	3	NM_005484	Q8TEU4|Q9NUV2|Q9UMR4|Q9Y6C8	Silent	SNP	ENST00000250416.5	37	CCDS41910.1																																																																																			.		0.368	PARP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000387847.2		
FAM173B	134145	hgsc.bcm.edu;bcgsc.ca	37	5	10227607	10227607	+	Silent	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr5:10227607G>T	ENST00000511437.1	-	5	660	c.648C>A	c.(646-648)ggC>ggA	p.G216G	FAM173B_ENST00000510047.1_Silent_p.G199G|FAM173B_ENST00000280330.8_Silent_p.G52G|FAM173B_ENST00000510052.1_5'Flank	NM_199133.3	NP_954584.2	Q6P4H8	F173B_HUMAN	family with sequence similarity 173, member B	216						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	16						TCTTTTCACGGCCTCTAAAAG	0.488																																					p.G216G		.											.	.	.	0			c.C648A						.						122.0	121.0	121.0					5																	10227607		1960	4138	6098	SO:0001819	synonymous_variant	134145	exon5			TTCACGGCCTCTA		CCDS43301.1, CCDS58942.1	5p15.2	2008-08-08			ENSG00000150756	ENSG00000150756			27029	protein-coding gene	gene with protein product						12477932	Standard	NM_199133		Approved		uc003jeo.3	Q6P4H8	OTTHUMG00000161771	ENST00000511437.1:c.648C>A	5.37:g.10227607G>T		44	0		58	4	NM_199133	B4DT41|B4DXK2|E9PBZ4	Silent	SNP	ENST00000511437.1	37	CCDS43301.1																																																																																			.		0.488	FAM173B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000366048.2	NM_199133	
MYO5B	4645	hgsc.bcm.edu	37	18	47405423	47405423	+	Missense_Mutation	SNP	C	C	G			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr18:47405423C>G	ENST00000285039.7	-	24	3467	c.3168G>C	c.(3166-3168)atG>atC	p.M1056I	MYO5B_ENST00000587895.1_5'Flank|MYO5B_ENST00000324581.6_Missense_Mutation_p.M197I	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	1056					endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		GTTCTTTCTTCATGAGATTTT	0.453																																					p.M1056I		.											.	.	.	0			c.G3168C						.						79.0	78.0	78.0					18																	47405423		1855	4101	5956	SO:0001583	missense	4645	exon24			TTTCTTCATGAGA	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.3168G>C	18.37:g.47405423C>G	ENSP00000285039:p.Met1056Ile	38	0		58	5	NM_001080467	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	C	8.702	0.909898	0.17833	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	T;T	0.16324	2.35;2.35	5.28	4.4	0.53042	.	0.179711	0.50627	N	0.000110	T	0.10551	0.0258	N	0.14661	0.345	0.50039	D	0.999842	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09058	-1.0692	10	0.44086	T	0.13	.	10.8003	0.46485	0.1469:0.7115:0.1416:0.0	.	1056;197	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	I	1056;197	ENSP00000285039:M1056I;ENSP00000315531:M197I	ENSP00000285039:M1056I	M	-	3	0	MYO5B	45659421	1.000000	0.71417	0.998000	0.56505	0.363000	0.29612	3.368000	0.52357	1.194000	0.43101	0.563000	0.77884	ATG	.		0.453	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
ACAN	176	hgsc.bcm.edu	37	15	89400503	89400503	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr15:89400503G>T	ENST00000561243.1	+	11	4687	c.4687G>T	c.(4687-4689)Ggg>Tgg	p.G1563W	ACAN_ENST00000559004.1_Missense_Mutation_p.G1563W|ACAN_ENST00000439576.2_Missense_Mutation_p.G1563W|ACAN_ENST00000352105.7_Missense_Mutation_p.G1563W			P16112	PGCA_HUMAN	aggrecan	1597	CS-2.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TTCTGAAGTAGGGACTGACCT	0.512																																					p.G1563W		.											AGC1,right_upper_lobe,carcinoma,0,2	AGC1	0	0			c.G4687T						.						51.0	53.0	52.0					15																	89400503		1848	4097	5945	SO:0001583	missense	176	exon12			GAAGTAGGGACTG	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.4687G>T	15.37:g.89400503G>T	ENSP00000453342:p.Gly1563Trp	47	0		40	2	NM_001135	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.593317	0.46214	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	D;D	0.95949	-3.86;-3.86	4.47	3.52	0.40303	.	0.805385	0.10139	N	0.711121	D	0.96046	0.8712	L	0.34521	1.04	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.986;0.995	D	0.89795	0.3971	10	0.56958	D	0.05	-5.9602	13.6819	0.62491	0.0:0.1559:0.8441:0.0	.	1563;1563	E7ENV9;E7EX88	.;.	W	1563;1563;1449	ENSP00000387356:G1563W;ENSP00000341615:G1563W	ENSP00000268134:G1449W	G	+	1	0	ACAN	87201507	0.273000	0.24181	0.010000	0.14722	0.547000	0.35210	2.792000	0.47837	1.181000	0.42912	0.655000	0.94253	GGG	.		0.512	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
AIM2	9447	hgsc.bcm.edu	37	1	159038461	159038461	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr1:159038461G>T	ENST00000368130.4	-	3	581	c.293C>A	c.(292-294)cCa>cAa	p.P98Q	AIM2_ENST00000411768.1_5'UTR	NM_004833.1	NP_004824.1	O14862	AIM2_HUMAN	absent in melanoma 2	98					activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to drug (GO:0035690)|cellular response to interferon-beta (GO:0035458)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein oligomerization (GO:0032461)|pyroptosis (GO:0070269)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)			breast(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(1)	16	all_hematologic(112;0.0429)					TAGTGGCTTTGGTTTTGTTAC	0.393																																					p.P98Q		.											.	.	.	0			c.C293A						.						218.0	182.0	194.0					1																	159038461		2203	4300	6503	SO:0001583	missense	9447	exon3			GGCTTTGGTTTTG	AF024714	CCDS1181.1	1q22	2008-07-18			ENSG00000163568	ENSG00000163568			357	protein-coding gene	gene with protein product		604578				9242382	Standard	NM_004833		Approved	PYHIN4	uc001ftj.1	O14862	OTTHUMG00000037183	ENST00000368130.4:c.293C>A	1.37:g.159038461G>T	ENSP00000357112:p.Pro98Gln	67	0		105	5	NM_004833	A8K7M7|Q5T3V9|Q96FG9	Missense_Mutation	SNP	ENST00000368130.4	37	CCDS1181.1	.	.	.	.	.	.	.	.	.	.	G	6.377	0.437707	0.12104	.	.	ENSG00000163568	ENST00000368130;ENST00000411768	T;T	0.29397	3.19;1.57	2.12	1.09	0.20402	.	.	.	.	.	T	0.05135	0.0137	N	0.19112	0.55	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.43458	-0.9390	9	0.16896	T	0.51	2.0123	5.5558	0.17115	0.0:0.0:0.5336:0.4664	.	98	O14862	AIM2_HUMAN	Q	98	ENSP00000357112:P98Q;ENSP00000405197:P98Q	ENSP00000357112:P98Q	P	-	2	0	AIM2	157305085	0.000000	0.05858	0.001000	0.08648	0.144000	0.21451	-0.335000	0.07873	0.324000	0.23333	0.561000	0.74099	CCA	.		0.393	AIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090341.1	NM_004833	
KCNAB1	7881	hgsc.bcm.edu	37	3	156175301	156175301	+	Silent	SNP	C	C	A	rs146234419	byFrequency	TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr3:156175301C>A	ENST00000490337.1	+	4	481	c.417C>A	c.(415-417)gcC>gcA	p.A139A	KCNAB1_ENST00000302490.8_Silent_p.A121A|KCNAB1_ENST00000471742.1_Silent_p.A128A|KCNAB1_ENST00000389636.5_Silent_p.A139A|KCNAB1_ENST00000497291.1_3'UTR|KCNAB1_ENST00000389634.5_Silent_p.A121A	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	139					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TTGATACTGCCGAAGTCTATG	0.468																																					p.A139A		.											KCNAB1_ENST00000490337,NS,carcinoma,+2,3	KCNAB1_ENST00000490337	+2	0			c.C417A						.						248.0	215.0	226.0					3																	156175301		2203	4300	6503	SO:0001819	synonymous_variant	7881	exon4			TACTGCCGAAGTC	U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.417C>A	3.37:g.156175301C>A		49	0		36	2	NM_172160	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Silent	SNP	ENST00000490337.1	37	CCDS3174.1																																																																																			.		0.468	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351411.1	NM_003471	
CASP8	841	hgsc.bcm.edu	37	2	202149565	202149565	+	Missense_Mutation	SNP	C	C	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr2:202149565C>A	ENST00000432109.2	+	9	1018	c.829C>A	c.(829-831)Ctt>Att	p.L277I	CASP8_ENST00000358485.4_Missense_Mutation_p.L336I|CASP8_ENST00000264274.9_Missense_Mutation_p.L193I|CASP8_ENST00000392259.2_3'UTR|CASP8_ENST00000392266.3_3'UTR|CASP8_ENST00000264275.5_Missense_Mutation_p.L294I|CASP8_ENST00000323492.7_Missense_Mutation_p.L262I	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	277					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						CTTTGAAGAGCTTCATTTTGA	0.443										HNSCC(4;0.00038)																											p.L336I	Melanoma(82;831 1348 20716 36952 40159)	.											CASP8_ENST00000358485,NS,carcinoma,0,3	CASP8_ENST00000358485	0	0			c.C1006A						.						77.0	73.0	75.0					2																	202149565		2203	4300	6503	SO:0001583	missense	841	exon8			GAAGAGCTTCATT	U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.829C>A	2.37:g.202149565C>A	ENSP00000412523:p.Leu277Ile	24	0		34	2	NM_001080125	O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Missense_Mutation	SNP	ENST00000432109.2	37	CCDS2342.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.063485	0.55432	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000432109;ENST00000264275;ENST00000358485;ENST00000323492;ENST00000444430	T;T;T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77;1.77;1.77	5.6	5.6	0.85130	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.212639	0.44483	D	0.000447	T	0.63534	0.2519	M	0.92555	3.32	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;0.995;0.999;1.0	D;D;D;D;D	0.91635	0.999;0.993;0.99;0.998;0.993	T	0.72279	-0.4340	10	0.72032	D	0.01	.	19.6188	0.95647	0.0:1.0:0.0:0.0	.	193;336;277;262;294	Q14790-3;Q14790-9;Q14790;Q14790-2;Q14790-4	.;.;CASP8_HUMAN;.;.	I	262;193;277;294;336;262;56	ENSP00000376091:L262I;ENSP00000264274:L193I;ENSP00000412523:L277I;ENSP00000264275:L294I;ENSP00000351273:L336I;ENSP00000325722:L262I;ENSP00000394434:L56I	ENSP00000264274:L193I	L	+	1	0	CASP8	201857810	0.996000	0.38824	0.957000	0.39632	0.079000	0.17450	3.312000	0.51927	2.646000	0.89796	0.655000	0.94253	CTT	.		0.443	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000336853.2	NM_001228	
C1QTNF9	338872	hgsc.bcm.edu;broad.mit.edu	37	13	24895265	24895265	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr13:24895265C>T	ENST00000382071.2	+	4	446	c.361C>T	c.(361-363)Cag>Tag	p.Q121*	C1QTNF9_ENST00000332018.4_Nonsense_Mutation_p.Q121*|C1QTNF9-AS1_ENST00000449656.1_RNA|AL359736.1_ENST00000422229.2_Splice_Site_p.*101*			P0C862	C1T9A_HUMAN	C1q and tumor necrosis factor related protein 9	121	Collagen-like 2.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				endometrium(1)|kidney(2)|lung(6)	9		all_cancers(29;3.55e-20)|all_epithelial(30;4.25e-17)|all_lung(29;1.04e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.00565)|Epithelial(112;0.027)|OV - Ovarian serous cystadenocarcinoma(117;0.115)|Lung(94;0.159)		GACTGGGCCTCAGGGGCAGAA	0.622																																					p.Q121X		.											.	.	.	0			c.C361T						.						21.0	12.0	15.0					13																	24895265		2023	3554	5577	SO:0001587	stop_gained	338872	exon4			GGGCCTCAGGGGC	BC040438	CCDS9306.1	13q12.12	2010-08-18			ENSG00000240654	ENSG00000240654			28732	protein-coding gene	gene with protein product		614285				12975309, 18787108	Standard	NM_178540		Approved	MGC48915, CTRP9, C1QTNF9A, AQL1	uc001upj.3	P0C862	OTTHUMG00000016576	ENST00000382071.2:c.361C>T	13.37:g.24895265C>T	ENSP00000371503:p.Gln121*	37	0		28	13	NM_178540	A2A3T6|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	Nonsense_Mutation	SNP	ENST00000382071.2	37	CCDS9306.1	.	.	.	.	.	.	.	.	.	.	N	11.01	1.512220	0.27036	.	.	ENSG00000240654	ENST00000382071;ENST00000332018	.	.	.	4.1	4.1	0.47936	.	0.196102	0.45867	D	0.000334	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.947	0.64091	0.0:1.0:0.0:0.0	.	.	.	.	X	121	.	.	Q	+	1	0	C1QTNF9	23793265	0.985000	0.35326	0.518000	0.27811	0.038000	0.13279	2.923000	0.48868	2.250000	0.74265	0.536000	0.68110	CAG	.		0.622	C1QTNF9-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044177.1	NM_178540	
ORC1	4998	hgsc.bcm.edu	37	1	52840513	52840513	+	Missense_Mutation	SNP	C	C	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr1:52840513C>A	ENST00000371568.3	-	16	2578	c.2360G>T	c.(2359-2361)cGa>cTa	p.R787L	ORC1_ENST00000371566.1_Missense_Mutation_p.R787L	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	787	Necessary and sufficient for ORC complex assembly.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R787Q(1)		breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CAGTCCTGATCGACGGAACTC	0.443																																					p.R787L		.											ORC1,NS,carcinoma,0,1	ORC1	0	1	Substitution - Missense(1)	prostate(1)	c.G2360T						.						73.0	72.0	72.0					1																	52840513		2203	4300	6503	SO:0001583	missense	4998	exon16			CCTGATCGACGGA		CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.2360G>T	1.37:g.52840513C>A	ENSP00000360623:p.Arg787Leu	54	0		49	2	NM_004153	D3DQ34|Q13471|Q5T0F5	Missense_Mutation	SNP	ENST00000371568.3	37	CCDS566.1	.	.	.	.	.	.	.	.	.	.	C	17.41	3.382090	0.61845	.	.	ENSG00000085840	ENST00000371568;ENST00000371566	T;T	0.46819	0.86;0.86	5.96	3.13	0.36017	CDC6, C-terminal (1);	0.056074	0.64402	D	0.000001	T	0.60663	0.2286	M	0.64404	1.975	0.58432	D	0.999999	D;D	0.56746	0.977;0.977	P;P	0.61940	0.896;0.896	T	0.61377	-0.7075	10	0.72032	D	0.01	-2.9804	11.5399	0.50661	0.0:0.8085:0.0:0.1915	.	782;787	B7Z8H0;Q13415	.;ORC1_HUMAN	L	787	ENSP00000360623:R787L;ENSP00000360621:R787L	ENSP00000360621:R787L	R	-	2	0	ORC1	52613101	0.997000	0.39634	0.576000	0.28549	0.323000	0.28346	3.677000	0.54619	0.439000	0.26476	-0.768000	0.03414	CGA	.		0.443	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022202.1	NM_004153	
ARID4B	51742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	235331898	235331898	+	Missense_Mutation	SNP	A	A	G			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr1:235331898A>G	ENST00000264183.3	-	24	4378	c.3881T>C	c.(3880-3882)tTa>tCa	p.L1294S	ARID4B_ENST00000366603.2_Missense_Mutation_p.L1294S|ARID4B_ENST00000349213.3_Missense_Mutation_p.L1208S|ARID4B-IT1_ENST00000357671.6_RNA	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	1294	Ser-rich.				histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			CGGTTCAGCTAAAGTTAACAT	0.458																																					p.L1294S		.											.	.	.	0			c.T3881C						.						112.0	90.0	98.0					1																	235331898		2203	4300	6503	SO:0001583	missense	51742	exon24			TCAGCTAAAGTTA	AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.3881T>C	1.37:g.235331898A>G	ENSP00000264183:p.Leu1294Ser	72	0		87	12	NM_016374	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Missense_Mutation	SNP	ENST00000264183.3	37	CCDS31061.1	.	.	.	.	.	.	.	.	.	.	A	15.72	2.916133	0.52546	.	.	ENSG00000054267	ENST00000349213;ENST00000366603;ENST00000264183	T;T;T	0.30981	1.51;1.54;1.54	4.96	4.96	0.65561	.	0.000000	0.64402	D	0.000003	T	0.41789	0.1174	N	0.22421	0.69	0.53005	D	0.999965	D;D	0.76494	0.999;0.998	D;D	0.83275	0.994;0.996	T	0.39272	-0.9622	10	0.56958	D	0.05	-8.9756	14.8378	0.70197	1.0:0.0:0.0:0.0	.	1208;1294	Q4LE39-2;Q4LE39	.;ARI4B_HUMAN	S	1208;1294;1294	ENSP00000264184:L1208S;ENSP00000355562:L1294S;ENSP00000264183:L1294S	ENSP00000264183:L1294S	L	-	2	0	ARID4B	233398521	1.000000	0.71417	0.918000	0.36340	0.986000	0.74619	7.924000	0.87555	2.087000	0.62958	0.455000	0.32223	TTA	.		0.458	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095566.3	NM_016374	
CTNNA2	1496	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	80808879	80808879	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr2:80808879G>T	ENST00000402739.4	+	13	1947	c.1942G>T	c.(1942-1944)Gat>Tat	p.D648Y	AC008067.2_ENST00000609950.1_RNA|CTNNA2_ENST00000466387.1_Missense_Mutation_p.D648Y|CTNNA2_ENST00000361291.4_Missense_Mutation_p.D682Y|CTNNA2_ENST00000541047.1_Missense_Mutation_p.D648Y|CTNNA2_ENST00000496558.1_Missense_Mutation_p.D648Y|AC008067.2_ENST00000596887.1_RNA|CTNNA2_ENST00000343114.3_Missense_Mutation_p.D327Y|CTNNA2_ENST00000540488.1_Missense_Mutation_p.D648Y|AC008067.2_ENST00000430876.1_RNA	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	648					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GGAAGATTATGATGTGCGTAG	0.458																																					p.D648Y		.											.	.	.	0			c.G1942T						.						104.0	107.0	106.0					2																	80808879		2074	4190	6264	SO:0001583	missense	1496	exon14			GATTATGATGTGC		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1942G>T	2.37:g.80808879G>T	ENSP00000384638:p.Asp648Tyr	26	0		41	4	NM_001164883	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37		.	.	.	.	.	.	.	.	.	.	G	26.8	4.772002	0.90108	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114	T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.61627	0.2362	L	0.58669	1.825	0.80722	D	1	D;P;B;D	0.63880	0.98;0.47;0.169;0.993	P;B;B;D	0.65443	0.844;0.223;0.141;0.935	T	0.56848	-0.7911	9	.	.	.	.	19.8305	0.96632	0.0:0.0:1.0:0.0	.	280;648;648;648	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	Y	648;648;682;648;648;648;327	ENSP00000418191:D648Y;ENSP00000419295:D648Y;ENSP00000355398:D682Y;ENSP00000384638:D648Y;ENSP00000444675:D648Y;ENSP00000441705:D648Y;ENSP00000341500:D327Y	.	D	+	1	0	CTNNA2	80662390	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.864000	0.99589	2.672000	0.90937	0.650000	0.86243	GAT	.		0.458	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
NTRK1	4914	hgsc.bcm.edu	37	1	156844710	156844710	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr1:156844710G>T	ENST00000524377.1	+	11	1305	c.1264G>T	c.(1264-1266)Gtg>Ttg	p.V422L	NTRK1_ENST00000392302.2_Missense_Mutation_p.V386L|NTRK1_ENST00000358660.3_Missense_Mutation_p.V416L|NTRK1_ENST00000368196.3_Missense_Mutation_p.V416L	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	422					activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V422L(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	CTCGGTGGCTGTGGGCCTGGC	0.557			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																											p.V422L		.		Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	NTRK1_ENST00000392302,caecum,carcinoma,-2,1	NTRK1_ENST00000392302	-2	1	Substitution - Missense(1)	lung(1)	c.G1264T						.						122.0	118.0	119.0					1																	156844710		2203	4300	6503	SO:0001583	missense	4914	exon11			GTGGCTGTGGGCC	Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.1264G>T	1.37:g.156844710G>T	ENSP00000431418:p.Val422Leu	28	0		41	2	NM_002529	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	ENST00000524377.1	37	CCDS1161.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.357201	0.82243	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	T;T;T;T	0.78707	-1.16;-1.15;-1.18;-1.2	5.46	5.46	0.80206	.	0.000000	0.49916	D	0.000127	D	0.87067	0.6085	M	0.81112	2.525	0.80722	D	1	D;P;D;D	0.89917	0.998;0.849;0.999;1.0	D;P;D;D	0.83275	0.972;0.511;0.987;0.996	D	0.87646	0.2525	10	0.56958	D	0.05	.	17.85	0.88744	0.0:0.0:1.0:0.0	.	416;416;422;386	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	L	386;416;422;416	ENSP00000376120:V386L;ENSP00000357179:V416L;ENSP00000431418:V422L;ENSP00000351486:V416L	ENSP00000351486:V416L	V	+	1	0	NTRK1	155111334	1.000000	0.71417	0.988000	0.46212	0.426000	0.31534	9.204000	0.95041	2.551000	0.86045	0.561000	0.74099	GTG	.		0.557	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529	
PHKB	5257	hgsc.bcm.edu;bcgsc.ca	37	16	47675545	47675545	+	Missense_Mutation	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr16:47675545C>T	ENST00000323584.5	+	16	1574	c.1550C>T	c.(1549-1551)aCt>aTt	p.T517I	PHKB_ENST00000299167.8_Missense_Mutation_p.T517I|PHKB_ENST00000455779.1_Missense_Mutation_p.T510I|PHKB_ENST00000566044.1_Missense_Mutation_p.T510I	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	517					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				GGTATTCAAACTCAAACTCCT	0.368																																					p.T517I		.											.	.	.	0			c.C1550T						.						123.0	110.0	115.0					16																	47675545		2201	4300	6501	SO:0001583	missense	5257	exon16			TTCAAACTCAAAC		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.1550C>T	16.37:g.47675545C>T	ENSP00000313504:p.Thr517Ile	60	0		74	4	NM_000293	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	37	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.067087	0.76301	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.91407	-2.84;-2.84	5.98	5.98	0.97165	Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.95370	0.8497	M	0.76002	2.32	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.962	D	0.94419	0.7639	10	0.49607	T	0.09	-23.8326	20.0532	0.97636	0.0:1.0:0.0:0.0	.	517;510	Q93100;Q93100-4	KPBB_HUMAN;.	I	510;510;517	ENSP00000414345:T510I;ENSP00000313504:T517I	ENSP00000299167:T510I	T	+	2	0	PHKB	46233046	1.000000	0.71417	0.999000	0.59377	0.344000	0.29017	7.281000	0.78621	2.835000	0.97688	0.650000	0.86243	ACT	.		0.368	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1		
C9orf72	203228	hgsc.bcm.edu	37	9	27566901	27566901	+	Missense_Mutation	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr9:27566901C>T	ENST00000380003.3	-	2	281	c.218G>A	c.(217-219)cGa>cAa	p.R73Q	C9orf72_ENST00000379997.3_Missense_Mutation_p.R73Q|C9orf72_ENST00000488117.1_5'UTR	NM_001256054.1|NM_018325.3	NP_001242983.1|NP_060795.1	Q96LT7	CI072_HUMAN	chromosome 9 open reading frame 72	73					autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular space (GO:0005615)|lysosome (GO:0005764)|nucleus (GO:0005634)	Rab GTPase binding (GO:0017137)	p.N68_N74delNGEILRN(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|pancreas(1)	23		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		CTCTGCATTTCGAAGGATTTC	0.388																																					p.R73Q		.											C9orf72,caecum,carcinoma,0,2	C9orf72	0	1	Deletion - In frame(1)	ovary(1)	c.G218A						.						101.0	97.0	98.0					9																	27566901		2203	4300	6503	SO:0001583	missense	203228	exon2			GCATTTCGAAGGA	AL832467	CCDS6522.1, CCDS6523.1	9p21.1	2014-09-17			ENSG00000147894	ENSG00000147894			28337	protein-coding gene	gene with protein product		614260				21944778, 24549040	Standard	NM_145005		Approved	MGC23980	uc003zqq.3	Q96LT7	OTTHUMG00000019716	ENST00000380003.3:c.218G>A	9.37:g.27566901C>T	ENSP00000369339:p.Arg73Gln	54	0		37	2	NM_018325	A8K5W0|D3DRK6|G8I0B6|Q6NUS9	Missense_Mutation	SNP	ENST00000380003.3	37	CCDS6522.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.849767	0.91277	.	.	ENSG00000147894	ENST00000380003;ENST00000379997;ENST00000379995	T;T;T	0.43688	0.94;0.94;0.94	5.85	4.94	0.65067	.	0.061358	0.64402	D	0.000002	T	0.50871	0.1641	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.72982	0.979;0.963	T	0.38628	-0.9652	9	.	.	.	.	15.3672	0.74531	0.0:0.9322:0.0:0.0678	.	73;73	Q96LT7-2;Q96LT7	.;CI072_HUMAN	Q	73	ENSP00000369339:R73Q;ENSP00000369333:R73Q;ENSP00000369331:R73Q	.	R	-	2	0	C9orf72	27556901	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.753000	0.94483	0.655000	0.94253	CGA	.		0.388	C9orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051969.1	NM_018325	
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	2976042	2976042	+	Nonsense_Mutation	SNP	G	G	C			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr8:2976042G>C	ENST00000520002.1	-	43	6867	c.6312C>G	c.(6310-6312)taC>taG	p.Y2104*	CSMD1_ENST00000537824.1_Nonsense_Mutation_p.Y2103*|CSMD1_ENST00000400186.3_Nonsense_Mutation_p.Y2104*|CSMD1_ENST00000542608.1_Nonsense_Mutation_p.Y2103*|CSMD1_ENST00000602557.1_Nonsense_Mutation_p.Y2104*|CSMD1_ENST00000602723.1_Nonsense_Mutation_p.Y2104*			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2104	Sushi 12. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GCCCCACGCTGTAATCCGAGT	0.428																																					p.Y2103X		.											.	.	.	0			c.C6309G						.						150.0	146.0	147.0					8																	2976042		2010	4174	6184	SO:0001587	stop_gained	64478	exon42			CACGCTGTAATCC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6312C>G	8.37:g.2976042G>C	ENSP00000430733:p.Tyr2104*	80	0		72	14	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Nonsense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	47|47	13.284769|13.284769	0.99732|0.99732	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	.|.	.|.	.|.	5.03|5.03	1.85|1.85	0.25348|0.25348	.|.	.|0.080390	.|0.51477	.|D	.|0.000094	T|.	0.28333|.	0.0700|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.17077|.	-1.0381|.	4|.	.|0.02654	.|T	.|1	.|.	8.5485|8.5485	0.33438|0.33438	0.4673:0.0:0.5327:0.0|0.4673:0.0:0.5327:0.0	.|.	.|.	.|.	.|.	E|X	1584|2104;2104;1965;2103;2103	.|.	.|ENSP00000320445:Y1965X	Q|Y	-|-	1|3	0|2	CSMD1|CSMD1	2963449|2963449	1.000000|1.000000	0.71417|0.71417	0.299000|0.299000	0.25016|0.25016	0.299000|0.299000	0.27559|0.27559	1.283000|1.283000	0.33237|0.33237	0.151000|0.151000	0.19162|0.19162	-0.251000|-0.251000	0.11542|0.11542	CAG|TAC	.		0.428	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
LRRFIP1	9208	hgsc.bcm.edu	37	2	238683054	238683054	+	Silent	SNP	A	A	G			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr2:238683054A>G	ENST00000308482.9	+	23	1830	c.1761A>G	c.(1759-1761)gcA>gcG	p.A587A		NM_001137550.1	NP_001131022.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1	0	Lys-rich.				innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		CTGAAAATGCAGAAAAAATAG	0.348																																					p.A587A		.											.	.	.	0			c.A1761G						.						75.0	67.0	69.0					2																	238683054		1568	3582	5150	SO:0001819	synonymous_variant	9208	exon23			AAATGCAGAAAAA	AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000308482.9:c.1761A>G	2.37:g.238683054A>G		90	0		87	4	NM_001137550	E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Silent	SNP	ENST00000308482.9	37	CCDS46551.1																																																																																			.		0.348	LRRFIP1-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000257169.3	NM_004735	
TUBBP5	643224	hgsc.bcm.edu	37	9	141070915	141070915	+	RNA	SNP	C	C	G			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr9:141070915C>G	ENST00000503395.1	+	0	1690									tubulin, beta pseudogene 5									p.T178T(1)									TGTCAGACACCGTGGTGGAGC	0.522																																					.		.											ENSG00000254381,NS,carcinoma,0,6	ENSG00000254381	0	1	Substitution - coding silent(1)	prostate(1)	.						.																																					643224	.			AGACACCGTGGTG	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141070915C>G		84	1		84	4	.		RNA	SNP	ENST00000503395.1	37																																																																																				.		0.522	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156	
CCDC144CP	348254	hgsc.bcm.edu	37	17	20242721	20242721	+	RNA	SNP	A	A	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr17:20242721A>T	ENST00000340196.4	+	0	2823				RN7SL17P_ENST00000583626.1_RNA			Q8IYA2	C144C_HUMAN	coiled-coil domain containing 144C, pseudogene																		TATTTTTAAAACATGTAGCCC	0.303																																					.		.											.	.	.	0			.						.																																					348254	.			TTTAAAACATGTA			17p11.2	2013-03-14	2013-03-14	2013-03-14	ENSG00000154898	ENSG00000154898			29073	pseudogene	pseudogene			"""coiled-coil domain containing 144C"""	CCDC144C		11997339	Standard	NR_023380		Approved		uc010cqy.1	Q8IYA2	OTTHUMG00000059513		17.37:g.20242721A>T		259	0		331	110	.	B7WNP5	RNA	SNP	ENST00000340196.4	37																																																																																				.		0.303	CCDC144CP-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000132378.2	NR_023380	
CHIA	27159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	111854340	111854340	+	Splice_Site	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr1:111854340G>T	ENST00000369740.1	+	3	158	c.55G>T	c.(55-57)Ggc>Tgc	p.G19C	CHIA_ENST00000353665.6_5'UTR|CHIA_ENST00000343320.6_Splice_Site_p.G19C|CHIA_ENST00000451398.2_5'UTR|CHIA_ENST00000483391.1_Intron|CHIA_ENST00000430615.1_5'UTR	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	19					apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		TTTGCAGCTCGGTAAGTCATG	0.388																																					p.G19C		.											.	.	.	0			c.G55T						.						227.0	216.0	220.0					1																	111854340		1883	4103	5986	SO:0001630	splice_region_variant	27159	exon3			CAGCTCGGTAAGT	AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.55+1G>T	1.37:g.111854340G>T		42	0		54	19	NM_201653	Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Missense_Mutation	SNP	ENST00000369740.1	37	CCDS41368.1	.	.	.	.	.	.	.	.	.	.	-	14.07	2.424982	0.43020	.	.	ENSG00000134216	ENST00000369740;ENST00000343320	T;T	0.05717	3.4;3.4	4.38	3.45	0.39498	.	0.213507	0.28006	U	0.016961	T	0.13243	0.0321	M	0.71920	2.185	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.01096	-1.1453	10	0.48119	T	0.1	-5.9554	12.3324	0.55048	0.0:0.172:0.828:0.0	.	19	Q9BZP6	CHIA_HUMAN	C	19	ENSP00000358755:G19C;ENSP00000341828:G19C	ENSP00000341828:G19C	G	+	1	0	CHIA	111655863	1.000000	0.71417	0.991000	0.47740	0.430000	0.31655	2.481000	0.45215	1.155000	0.42497	0.655000	0.94253	GGC	.		0.388	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030710.1		Missense_Mutation
ATP2B1	490	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	90028837	90028837	+	Missense_Mutation	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr12:90028837C>T	ENST00000428670.3	-	4	1054	c.598G>A	c.(598-600)Ggt>Agt	p.G200S	ATP2B1_ENST00000261173.2_Missense_Mutation_p.G200S|ATP2B1_ENST00000348959.3_Missense_Mutation_p.G200S|ATP2B1_ENST00000359142.3_Missense_Mutation_p.G200S			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	200					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						ATGACCTGACCACCCCTGATG	0.398																																					p.G200S		.											.	.	.	0			c.G598A						.						137.0	118.0	124.0					12																	90028837		2203	4299	6502	SO:0001583	missense	490	exon3			CCTGACCACCCCT	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.598G>A	12.37:g.90028837C>T	ENSP00000392043:p.Gly200Ser	31	0		37	10	NM_001001323	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	ENST00000428670.3	37	CCDS9035.1	.	.	.	.	.	.	.	.	.	.	C	35	5.503406	0.96371	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670	D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.73	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.95674	0.8593	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;0.981	D;P	0.91635	0.999;0.871	D	0.94833	0.7998	9	.	.	.	-20.692	20.1615	0.98135	0.0:1.0:0.0:0.0	.	200;200	P20020-3;P20020-2	.;.	S	200	ENSP00000261173:G200S;ENSP00000343599:G200S;ENSP00000352054:G200S;ENSP00000392043:G200S	.	G	-	1	0	ATP2B1	88552968	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.060000	0.57477	2.835000	0.97688	0.650000	0.86243	GGT	.		0.398	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406653.1	NM_001682	
GRM7	2917	hgsc.bcm.edu	37	3	7494394	7494394	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr3:7494394G>T	ENST00000357716.4	+	6	1549	c.1275G>T	c.(1273-1275)atG>atT	p.M425I	GRM7_ENST00000486284.1_Missense_Mutation_p.M425I|GRM7_ENST00000402647.2_Missense_Mutation_p.M425I|GRM7_ENST00000389336.4_Missense_Mutation_p.M425I|GRM7_ENST00000458641.2_3'UTR|GRM7_ENST00000403881.1_Missense_Mutation_p.M425I	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	425					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)	p.M425I(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						TTCACCACATGAACAAGGATC	0.478																																					p.M425I		.											GRM7,rectum,carcinoma,0,1	GRM7	0	1	Substitution - Missense(1)	large_intestine(1)	c.G1275T						.						106.0	88.0	94.0					3																	7494394		2203	4300	6503	SO:0001583	missense	2917	exon6			CCACATGAACAAG	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.1275G>T	3.37:g.7494394G>T	ENSP00000350348:p.Met425Ile	58	0		40	2	NM_000844	Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.237716	0.79800	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492;ENST00000445087	D;D;D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52;-1.52;-1.52	5.88	5.88	0.94601	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.89143	0.6631	M	0.73372	2.23	0.80722	D	1	P;D;P;P	0.54964	0.656;0.969;0.925;0.69	P;D;D;B	0.70227	0.679;0.968;0.954;0.379	D	0.87634	0.2518	10	0.42905	T	0.14	.	18.8061	0.92038	0.0:0.0:1.0:0.0	.	425;180;425;425	Q14831-5;Q59G95;Q14831;Q14831-2	.;.;GRM7_HUMAN;.	I	425;425;425;425;425;425;425;82	ENSP00000350348:M425I;ENSP00000417536:M425I;ENSP00000373987:M425I;ENSP00000385664:M425I;ENSP00000384585:M425I;ENSP00000395035:M82I	ENSP00000350348:M425I	M	+	3	0	GRM7	7469394	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.876000	0.87215	2.782000	0.95742	0.655000	0.94253	ATG	.		0.478	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844	
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651412	1651412	+	Silent	SNP	G	G	C	rs569811286		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr11:1651412G>C	ENST00000399676.2	+	1	380	c.342G>C	c.(340-342)ggG>ggC	p.G114G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	114	8 X 4 AA repeats of C-C-X-P.			Missing (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)		p.G114G(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCTGTGGGGGGTCCAAGGGGG	0.706													N|||	1	0.000199681	0.0	0.0	5008	,	,		3556	0.001		0.0	False		,,,				2504	0.0				p.G114G		.											KRTAP5-5,NS,carcinoma,+1,1	KRTAP5-5	+1	1	Substitution - coding silent(1)	prostate(1)	c.G342C						.						20.0	31.0	27.0					11																	1651412		2083	4147	6230	SO:0001819	synonymous_variant	439915	exon1			TGGGGGGTCCAAG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.342G>C	11.37:g.1651412G>C		39	1		43	5	NM_001001480	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.706	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
TULP1	7287	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	35479510	35479510	+	Silent	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr6:35479510G>A	ENST00000229771.6	-	4	343	c.264C>T	c.(262-264)taC>taT	p.Y88Y	TULP1_ENST00000322263.4_Intron	NM_003322.3	NP_003313.3	O00294	TULP1_HUMAN	tubby like protein 1	88					dendrite development (GO:0016358)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|phagocytosis (GO:0006909)|photoreceptor cell maintenance (GO:0045494)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|retina development in camera-type eye (GO:0060041)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|synapse (GO:0045202)	actin filament binding (GO:0051015)|G-protein coupled photoreceptor activity (GO:0008020)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	19						GGAACCTGGCGTAGACCGTCT	0.721																																					p.Y88Y	GBM(55;1027 1091 11115 23439)	.											.	.	.	0			c.C264T						.						9.0	10.0	10.0					6																	35479510		2188	4277	6465	SO:0001819	synonymous_variant	7287	exon4			CCTGGCGTAGACC	U82468	CCDS4807.1, CCDS75436.1	6p21.3	2014-01-28			ENSG00000112041	ENSG00000112041			12423	protein-coding gene	gene with protein product		602280		RP14		9096357, 9521870	Standard	NM_003322		Approved	TUBL1, LCA15	uc003okv.4	O00294	OTTHUMG00000014575	ENST00000229771.6:c.264C>T	6.37:g.35479510G>A		45	0		55	18	NM_003322	O43536|Q5TGM5|Q8N571	Silent	SNP	ENST00000229771.6	37	CCDS4807.1																																																																																			.		0.721	TULP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040307.2		
WSCD1	23302	hgsc.bcm.edu	37	17	6023684	6023684	+	Missense_Mutation	SNP	C	C	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr17:6023684C>A	ENST00000574946.1	+	9	1821	c.1431C>A	c.(1429-1431)gaC>gaA	p.D477E	WSCD1_ENST00000317744.5_Missense_Mutation_p.D477E|WSCD1_ENST00000539421.1_Missense_Mutation_p.D477E|WSCD1_ENST00000574232.1_Missense_Mutation_p.D477E|WSCD1_ENST00000573634.1_Missense_Mutation_p.D361E			Q658N2	WSCD1_HUMAN	WSC domain containing 1	477						integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						ACGTCCTGGACTGGCTCAAGT	0.637																																					p.D477E		.											WSCD1,NS,carcinoma,0,1	WSCD1	0	0			c.C1431A						.						135.0	128.0	131.0					17																	6023684		2203	4300	6503	SO:0001583	missense	23302	exon9			CCTGGACTGGCTC		CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.1431C>A	17.37:g.6023684C>A	ENSP00000460825:p.Asp477Glu	34	0		55	3	NM_015253	A8K0N8|D3DTM3|O60276|Q96G45	Missense_Mutation	SNP	ENST00000574946.1	37	CCDS32538.1	.	.	.	.	.	.	.	.	.	.	C	13.77	2.335989	0.41398	.	.	ENSG00000179314	ENST00000317744;ENST00000539421	T;T	0.81247	-1.47;-1.47	5.54	4.55	0.56014	Sulfotransferase domain (1);	0.097230	0.64402	D	0.000001	T	0.73729	0.3624	L	0.53561	1.675	0.47009	D	0.999282	B	0.15719	0.014	B	0.23419	0.046	T	0.66316	-0.5954	10	0.25106	T	0.35	-41.3476	7.7102	0.28673	0.0:0.7471:0.1666:0.0863	.	477	Q658N2	WSCD1_HUMAN	E	477	ENSP00000323087:D477E;ENSP00000446032:D477E	ENSP00000323087:D477E	D	+	3	2	WSCD1	5964408	1.000000	0.71417	1.000000	0.80357	0.631000	0.37964	3.108000	0.50337	1.301000	0.44836	0.655000	0.94253	GAC	.		0.637	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438965.4	NM_015253	
ALMS1	7840	hgsc.bcm.edu	37	2	73613037	73613037	+	Missense_Mutation	SNP	A	A	T	rs61156725|rs72319667|rs3074417	byFrequency	TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr2:73613037A>T	ENST00000264448.6	+	1	152	c.41A>T	c.(40-42)gAg>gTg	p.E14V	ALMS1_ENST00000409009.1_Missense_Mutation_p.E14V|ALMS1_ENST00000377715.1_Missense_Mutation_p.E14V	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	14	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E27_E28delEE(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						GAGCTggaggaggaggaggag	0.697																																					p.E14V		.											.	.	.	1	Deletion - In frame(1)	ovary(1)	c.A41T						.						3.0	4.0	4.0					2																	73613037		1515	3244	4759	SO:0001583	missense	7840	exon1			TGGAGGAGGAGGA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.41A>T	2.37:g.73613037A>T	ENSP00000264448:p.Glu14Val	12	0		24	6	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	A	15.37	2.813706	0.50527	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.26660	2.37;2.58;1.72	3.19	3.19	0.36642	.	0.259523	0.20097	U	0.099311	T	0.31358	0.0794	N	0.19112	0.55	0.24255	N	0.995306	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.02698	-1.1122	10	0.87932	D	0	.	8.1308	0.31027	1.0:0.0:0.0:0.0	.	14;14	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	V	14	ENSP00000386627:E14V;ENSP00000264448:E14V;ENSP00000366944:E14V	ENSP00000264448:E14V	E	+	2	0	ALMS1	73466545	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	3.230000	0.51286	1.682000	0.51000	0.397000	0.26171	GAG	.		0.697	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
MED27	9442	hgsc.bcm.edu	37	9	134889833	134889833	+	Missense_Mutation	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr9:134889833C>T	ENST00000292035.5	-	3	433	c.370G>A	c.(370-372)Gca>Aca	p.A124T	MED27_ENST00000357028.2_Missense_Mutation_p.A124T	NM_004269.3	NP_004260.2	Q6P2C8	MED27_HUMAN	mediator complex subunit 27	124					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	18		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		AGGCCAGATGCTAGTCCTGCA	0.423																																					p.A124T	Colon(41;784 923 6932 42329 52483)	.											.	.	.	0			c.G370A						.						96.0	79.0	85.0					9																	134889833		2203	4300	6503	SO:0001583	missense	9442	exon3			CAGATGCTAGTCC	AF104252	CCDS6945.1, CCDS59153.1, CCDS69689.1	9q34.13	2008-02-05	2007-07-30	2007-07-30	ENSG00000160563	ENSG00000160563			2377	protein-coding gene	gene with protein product		605044	"""cofactor required for Sp1 transcriptional activation, subunit 8, 34kDa"""	CRSP8		9989412	Standard	NM_004269		Approved	TRAP37, CRSP34	uc004cbe.2	Q6P2C8	OTTHUMG00000020833	ENST00000292035.5:c.370G>A	9.37:g.134889833C>T	ENSP00000292035:p.Ala124Thr	56	0		38	3	NM_001253881	O95401|Q4F964|Q5VTA4|Q5VTA5|Q9BU57|Q9NYR4|V9GYV9	Missense_Mutation	SNP	ENST00000292035.5	37	CCDS6945.1	.	.	.	.	.	.	.	.	.	.	C	19.05	3.751528	0.69533	.	.	ENSG00000160563	ENST00000292035;ENST00000357028;ENST00000372184	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.74673	0.3747	L	0.46819	1.47	0.80722	D	1	P;D;D	0.76494	0.873;0.996;0.999	B;D;D	0.73708	0.412;0.981;0.931	T	0.76263	-0.3023	9	0.72032	D	0.01	-6.6411	18.4048	0.90532	0.0:1.0:0.0:0.0	.	124;124;124	B4DPP5;Q6P2C8-2;Q6P2C8	.;.;MED27_HUMAN	T	124;86;124	.	ENSP00000292035:A124T	A	-	1	0	MED27	133879654	1.000000	0.71417	0.568000	0.28447	0.757000	0.42996	6.951000	0.75983	2.655000	0.90218	0.462000	0.41574	GCA	.		0.423	MED27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054770.2	NM_004269	
FARS2	10667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	5545474	5545474	+	Silent	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr6:5545474C>T	ENST00000324331.6	+	5	1302	c.966C>T	c.(964-966)atC>atT	p.I322I	FARS2_ENST00000274680.4_Silent_p.I322I			O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2, mitochondrial	322					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)|stomach(2)	15	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	TAGCCATGATCCTCTACGACA	0.448																																					p.I322I		.											.	.	.	0			c.C966T						.						203.0	199.0	200.0					6																	5545474		2203	4300	6503	SO:0001819	synonymous_variant	10667	exon5			CATGATCCTCTAC	AF097441	CCDS4494.1	6p25.1	2011-07-01	2007-02-23	2004-12-03	ENSG00000145982	ENSG00000145982	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	21062	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 2, mitochondrial"""	611592	"""phenylalanine-tRNA synthetase 1 (mitochondrial)"""	FARS1		10329163	Standard	NM_006567		Approved	dJ236A3.1	uc003mwr.2	O95363	OTTHUMG00000014178	ENST00000324331.6:c.966C>T	6.37:g.5545474C>T		72	0		61	26	NM_006567	B2R664|Q53F66|Q5TCS3|Q6FG29|Q9NPY7|Q9P062	Silent	SNP	ENST00000324331.6	37	CCDS4494.1																																																																																			.		0.448	FARS2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467790.1	NM_006567	
ABCA12	26154	hgsc.bcm.edu	37	2	215865498	215865498	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr2:215865498G>T	ENST00000272895.7	-	22	3329	c.3110C>A	c.(3109-3111)aCt>aAt	p.T1037N	ABCA12_ENST00000389661.4_Missense_Mutation_p.T719N	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1037					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GTTCCTTCCAGTTTGCAATTC	0.423																																					p.T1037N	Ovarian(66;664 1488 5121 34295)	.											ABCA12,colon,carcinoma,0,1	ABCA12	0	0			c.C3110A						.						126.0	131.0	129.0					2																	215865498		2203	4300	6503	SO:0001583	missense	26154	exon22			CTTCCAGTTTGCA	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.3110C>A	2.37:g.215865498G>T	ENSP00000272895:p.Thr1037Asn	30	0		57	3	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	G	18.88	3.716503	0.68844	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.95756	-3.8;-3.8	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000001	D	0.97854	0.9295	M	0.80746	2.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.989;0.996	D	0.98154	1.0443	10	0.72032	D	0.01	.	19.9082	0.97015	0.0:0.0:1.0:0.0	.	1037;719	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	N	1037;719	ENSP00000272895:T1037N;ENSP00000374312:T719N	ENSP00000272895:T1037N	T	-	2	0	ABCA12	215573743	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.488000	0.73637	2.705000	0.92388	0.555000	0.69702	ACT	.		0.423	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
DAXX	1616	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	33289677	33289677	+	Missense_Mutation	SNP	A	A	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr6:33289677A>T	ENST00000374542.5	-	2	230	c.26T>A	c.(25-27)gTg>gAg	p.V9E	DAXX_ENST00000477162.1_5'Flank|DAXX_ENST00000414083.2_Intron|DAXX_ENST00000266000.6_Missense_Mutation_p.V9E	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	9	Necessary for interaction with USP7 and ATRX.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						ATCATCCAGCACGATGATGCT	0.602			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																p.V21E		.		Rec	yes		6	6p21.3	1616	death-domain associated protein		E	.	.	.	0			c.T62A						.						52.0	53.0	53.0					6																	33289677		2203	4300	6503	SO:0001583	missense	1616	exon2			TCCAGCACGATGA	AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.26T>A	6.37:g.33289677A>T	ENSP00000363668:p.Val9Glu	15	0		15	8	NM_001141970	B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Missense_Mutation	SNP	ENST00000374542.5	37	CCDS4776.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.976711	0.74360	.	.	ENSG00000204209	ENST00000266000;ENST00000374542;ENST00000446403;ENST00000453407;ENST00000446511	.	.	.	4.98	4.98	0.66077	.	0.130592	0.52532	D	0.000075	T	0.62938	0.2469	M	0.63428	1.95	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.65573	0.936;0.936	T	0.68591	-0.5368	9	0.87932	D	0	-17.5717	11.0145	0.47681	1.0:0.0:0.0:0.0	.	21;9	B4E1C1;Q9UER7	.;DAXX_HUMAN	E	9	.	ENSP00000266000:V9E	V	-	2	0	DAXX	33397655	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	4.778000	0.62368	2.102000	0.63906	0.444000	0.29173	GTG	.		0.602	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076403.1		
CDH9	1007	hgsc.bcm.edu	37	5	26890641	26890641	+	Missense_Mutation	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr5:26890641C>T	ENST00000231021.4	-	8	1458	c.1286G>A	c.(1285-1287)cGt>cAt	p.R429H		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	429	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						ACCAAAAATACGGTCCATATC	0.403																																					p.R429H	Melanoma(8;187 585 15745 40864 52829)	.											.	.	.	0			c.G1286A						.						95.0	96.0	96.0					5																	26890641		2203	4300	6503	SO:0001583	missense	1007	exon8			AAAATACGGTCCA	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1286G>A	5.37:g.26890641C>T	ENSP00000231021:p.Arg429His	93	0		94	4	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	C	16.46	3.128966	0.56721	.	.	ENSG00000113100	ENST00000231021	T	0.52057	0.68	5.09	5.09	0.68999	Cadherin (4);Cadherin-like (1);	0.052671	0.64402	D	0.000001	T	0.43964	0.1271	L	0.56124	1.755	0.37266	D	0.907212	B;B	0.28820	0.053;0.224	B;B	0.33690	0.035;0.168	T	0.46857	-0.9161	9	.	.	.	.	10.68	0.45809	0.0:0.911:0.0:0.089	.	22;429	B4DFP0;Q9ULB4	.;CADH9_HUMAN	H	429	ENSP00000231021:R429H	.	R	-	2	0	CDH9	26926398	0.952000	0.32445	1.000000	0.80357	0.767000	0.43475	3.214000	0.51161	2.385000	0.81259	0.453000	0.30009	CGT	.		0.403	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
TUBGCP2	10844	hgsc.bcm.edu	37	10	135107110	135107110	+	Silent	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr10:135107110C>T	ENST00000252936.3	-	5	819	c.780G>A	c.(778-780)gtG>gtA	p.V260V	TUBGCP2_ENST00000368563.2_Silent_p.V260V|TUBGCP2_ENST00000417178.2_Silent_p.V130V|RP11-122K13.12_ENST00000424450.1_RNA|TUBGCP2_ENST00000543663.1_Silent_p.V288V|TUBGCP2_ENST00000368562.1_5'Flank			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	260					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		GGATCCTGTGCACCAGCTCCC	0.687																																					p.V288V		.											TUBGCP2,colon,carcinoma,0,1	TUBGCP2	0	0			c.G864A						.						39.0	33.0	35.0					10																	135107110		2184	4266	6450	SO:0001819	synonymous_variant	10844	exon7			CCTGTGCACCAGC	AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.780G>A	10.37:g.135107110C>T		79	0		81	3	NM_001256617	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Silent	SNP	ENST00000252936.3	37	CCDS7676.1																																																																																			.		0.687	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051148.1		
SMG8	55181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	57288383	57288383	+	Missense_Mutation	SNP	A	A	C	rs374585441		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr17:57288383A>C	ENST00000543872.2	+	2	1235	c.971A>C	c.(970-972)aAc>aCc	p.N324T	SMG8_ENST00000580498.1_Intron|SMG8_ENST00000300917.5_Missense_Mutation_p.N324T|SMG8_ENST00000578922.1_Missense_Mutation_p.N324T|CTD-2510F5.6_ENST00000577660.1_Intron			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	324					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						CAGAGCATCAACTGCCTCTTT	0.507																																					p.N324T		.											.	.	.	0			c.A971C						.						76.0	67.0	70.0					17																	57288383		2203	4300	6503	SO:0001583	missense	55181	exon1			GCATCAACTGCCT	AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.971A>C	17.37:g.57288383A>C	ENSP00000438748:p.Asn324Thr	60	0		58	22	NM_018149	Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Missense_Mutation	SNP	ENST00000543872.2	37	CCDS11615.1	.	.	.	.	.	.	.	.	.	.	A	15.99	2.995630	0.54147	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	T;T	0.47177	0.85;0.85	5.88	5.88	0.94601	.	0.080799	0.85682	D	0.000000	T	0.63861	0.2547	L	0.49350	1.555	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	T	0.65973	-0.6038	10	0.72032	D	0.01	-18.7555	15.4686	0.75422	1.0:0.0:0.0:0.0	.	324	Q8ND04	SMG8_HUMAN	T	324	ENSP00000300917:N324T;ENSP00000438748:N324T	ENSP00000300917:N324T	N	+	2	0	SMG8	54643165	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.957000	0.93082	2.235000	0.73313	0.533000	0.62120	AAC	.		0.507	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445960.2	NM_018149	
NT5C2	22978	hgsc.bcm.edu;bcgsc.ca	37	10	104866417	104866417	+	Silent	SNP	C	C	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr10:104866417C>A	ENST00000404739.3	-	3	245	c.222G>T	c.(220-222)gtG>gtT	p.V74V	NT5C2_ENST00000423468.2_Silent_p.V45V|NT5C2_ENST00000343289.5_Silent_p.V74V|NT5C2_ENST00000369857.4_Intron			P49902	5NTC_HUMAN	5'-nucleotidase, cytosolic II	74					cell death (GO:0008219)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|nucleobase-containing small molecule metabolic process (GO:0055086)|phosphorylation (GO:0016310)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleoside phosphotransferase activity (GO:0050146)|nucleotide binding (GO:0000166)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|urinary_tract(1)	16		all_hematologic(284;0.176)|Colorectal(252;0.178)		Epithelial(162;1.33e-08)|all cancers(201;1.04e-07)|BRCA - Breast invasive adenocarcinoma(275;0.159)	Adenosine triphosphate(DB00171)|Ribavirin(DB00811)	CTAATCTCTCCACAGTAAGCT	0.388																																					p.V74V		.											.	.	.	0			c.G222T						.						147.0	148.0	148.0					10																	104866417		2203	4300	6503	SO:0001819	synonymous_variant	22978	exon5			TCTCTCCACAGTA	D38524	CCDS7544.1	10q24.32	2014-03-03	2002-04-18	2002-04-19	ENSG00000076685	ENSG00000076685			8022	protein-coding gene	gene with protein product	"""purine 5' nucleotidase"""	600417	"""5'-nucleotidase (purine), cytosolic type B"""	NT5B		7999131, 24482476	Standard	NM_012229		Approved	PNT5, GMP, cN-II, SPG65	uc001kwq.3	P49902	OTTHUMG00000018981	ENST00000404739.3:c.222G>T	10.37:g.104866417C>A		44	0		47	4	NM_012229	B7Z382|D3DR91|Q5JUV5	Silent	SNP	ENST00000404739.3	37	CCDS7544.1																																																																																			.		0.388	NT5C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050121.1	NM_012229	
KDR	3791	hgsc.bcm.edu;bcgsc.ca	37	4	55953862	55953862	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr4:55953862G>T	ENST00000263923.4	-	27	3869	c.3574C>A	c.(3574-3576)Ctc>Atc	p.L1192I	RP11-530I17.1_ENST00000511222.1_RNA	NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	1192					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GGCAGAGAGAGTCCAGAATCC	0.433			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.L1192I		.		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	.	.	.	0			c.C3574A						.						162.0	140.0	147.0					4																	55953862		2203	4300	6503	SO:0001583	missense	3791	exon27			GAGAGAGTCCAGA	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.3574C>A	4.37:g.55953862G>T	ENSP00000263923:p.Leu1192Ile	68	0		80	5	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	ENST00000263923.4	37	CCDS3497.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.154614	0.78114	.	.	ENSG00000128052	ENST00000263923	T	0.76839	-1.05	5.61	5.61	0.85477	.	0.199401	0.45606	D	0.000351	T	0.77718	0.4172	L	0.40543	1.245	0.44207	D	0.997033	D	0.59357	0.985	P	0.50162	0.633	T	0.73623	-0.3924	10	0.23302	T	0.38	.	19.6231	0.95667	0.0:0.0:1.0:0.0	.	1192	P35968	VGFR2_HUMAN	I	1192	ENSP00000263923:L1192I	ENSP00000263923:L1192I	L	-	1	0	KDR	55648619	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.757000	0.62213	2.659000	0.90383	0.561000	0.74099	CTC	.		0.433	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
PDE4B	5142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	66713147	66713147	+	Missense_Mutation	SNP	G	G	C			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr1:66713147G>C	ENST00000329654.4	+	4	473	c.286G>C	c.(286-288)Gat>Cat	p.D96H	PDE4B_ENST00000371049.3_Missense_Mutation_p.D96H|PDE4B_ENST00000423207.2_Missense_Mutation_p.D81H	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	96					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.D81H(1)|p.D96H(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	TTTAAGCTTTGATGTGGAAAA	0.527																																					p.D96H		.											PDE4B_ENST00000423207,NS,carcinoma,0,2	PDE4B_ENST00000423207	0	2	Substitution - Missense(2)	lung(2)	c.G286C						.						194.0	211.0	205.0					1																	66713147		2203	4300	6503	SO:0001583	missense	5142	exon4			AGCTTTGATGTGG	L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.286G>C	1.37:g.66713147G>C	ENSP00000332116:p.Asp96His	38	0		23	6	NM_001037341	A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Missense_Mutation	SNP	ENST00000329654.4	37	CCDS632.1	.	.	.	.	.	.	.	.	.	.	G	30	5.053995	0.93793	.	.	ENSG00000184588	ENST00000329654;ENST00000341517;ENST00000371049;ENST00000423207;ENST00000412480	T;T;T;T;D	0.85955	-0.87;-0.87;-0.87;-1.14;-2.05	5.95	5.95	0.96441	.	0.298154	0.41294	D	0.000915	D	0.90003	0.6879	L	0.54323	1.7	0.80722	D	1	D;D;P	0.67145	0.996;0.994;0.919	D;D;P	0.70016	0.967;0.928;0.832	D	0.89885	0.4033	10	0.87932	D	0	.	20.3747	0.98911	0.0:0.0:1.0:0.0	.	81;86;96	Q07343-3;Q59GM8;Q07343	.;.;PDE4B_HUMAN	H	96;96;96;81;4	ENSP00000332116:D96H;ENSP00000342637:D96H;ENSP00000360088:D96H;ENSP00000392947:D81H;ENSP00000397548:D4H	ENSP00000332116:D96H	D	+	1	0	PDE4B	66485735	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.817000	0.96982	0.563000	0.77884	GAT	.		0.527	PDE4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025188.3	NM_002600	
DRD5	1816	hgsc.bcm.edu	37	4	9784882	9784882	+	Missense_Mutation	SNP	A	A	G			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr4:9784882A>G	ENST00000304374.2	+	1	1625	c.1229A>G	c.(1228-1230)tAc>tGc	p.Y410C		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	410					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)	p.Y410C(1)		NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GCAGCTGCCTACATCCACATG	0.567																																					p.Y410C		.											DRD5,NS,carcinoma,0,1	DRD5	0	1	Substitution - Missense(1)	endometrium(1)	c.A1229G						.						95.0	78.0	84.0					4																	9784882		2203	4300	6503	SO:0001583	missense	1816	exon1			CTGCCTACATCCA	X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.1229A>G	4.37:g.9784882A>G	ENSP00000306129:p.Tyr410Cys	37	1		33	3	NM_000798	B2R9S3|Q8NEQ8	Missense_Mutation	SNP	ENST00000304374.2	37	CCDS3405.1	.	.	.	.	.	.	.	.	.	.	a	4.012	-0.000485	0.07819	.	.	ENSG00000169676	ENST00000304374	T	0.65732	-0.17	4.84	-0.829	0.10796	.	0.427940	0.23452	N	0.048029	T	0.52484	0.1737	M	0.63843	1.955	0.40005	D	0.975218	B	0.13145	0.007	B	0.12156	0.007	T	0.39354	-0.9618	10	0.42905	T	0.14	.	7.8717	0.29569	0.5289:0.3988:0.0724:0.0	.	410	P21918	DRD5_HUMAN	C	410	ENSP00000306129:Y410C	ENSP00000306129:Y410C	Y	+	2	0	DRD5	9393980	1.000000	0.71417	0.005000	0.12908	0.158000	0.22134	3.963000	0.56773	-0.248000	0.09583	0.377000	0.23210	TAC	.		0.567	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1		
IARS	3376	hgsc.bcm.edu;bcgsc.ca	37	9	95003186	95003186	+	Missense_Mutation	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr9:95003186C>T	ENST00000375643.3	-	30	3501	c.3235G>A	c.(3235-3237)Gct>Act	p.A1079T	IARS_ENST00000447699.2_Missense_Mutation_p.A969T|IARS_ENST00000443024.2_Missense_Mutation_p.A1079T|IARS_ENST00000375629.3_Missense_Mutation_p.A132T|IARS_ENST00000375627.1_Missense_Mutation_p.A132T|IARS_ENST00000474340.1_5'UTR	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	1079					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	TATGCACAAGCAGGACCAGGA	0.403																																					p.A1079T		.											.	.	.	0			c.G3235A						.						155.0	118.0	131.0					9																	95003186		2203	4300	6503	SO:0001583	missense	3376	exon30			CACAAGCAGGACC	AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.3235G>A	9.37:g.95003186C>T	ENSP00000364794:p.Ala1079Thr	65	0		44	4	NM_013417	A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Missense_Mutation	SNP	ENST00000375643.3	37	CCDS6694.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.992316	0.74703	.	.	ENSG00000196305	ENST00000375643;ENST00000451588;ENST00000375629;ENST00000443024;ENST00000543028;ENST00000447699;ENST00000375660;ENST00000421189;ENST00000436450;ENST00000375627	T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07	6.08	6.08	0.98989	.	0.045487	0.85682	D	0.000000	T	0.67002	0.2847	M	0.66939	2.045	0.80722	D	1	P;B;B	0.44429	0.835;0.04;0.04	B;B;B	0.42522	0.39;0.051;0.051	T	0.68269	-0.5453	10	0.51188	T	0.08	-9.7511	20.2672	0.98462	0.0:1.0:0.0:0.0	.	589;1079;924	F5H1M4;P41252;Q6P0M4	.;SYIC_HUMAN;.	T	1079;96;132;1079;88;969;1079;88;96;132	ENSP00000364794:A1079T;ENSP00000364780:A132T;ENSP00000406448:A1079T;ENSP00000415020:A969T;ENSP00000364778:A132T	ENSP00000364778:A132T	A	-	1	0	IARS	94043007	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	4.769000	0.62300	2.894000	0.99253	0.591000	0.81541	GCT	.		0.403	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053059.2	NM_002161	
NPFFR1	64106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	72025934	72025934	+	Missense_Mutation	SNP	A	A	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr10:72025934A>T	ENST00000277942.6	-	2	220	c.221T>A	c.(220-222)aTg>aAg	p.M74K		NM_022146.4	NP_071429.1	Q9GZQ6	NPFF1_HUMAN	neuropeptide FF receptor 1	74					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			endometrium(2)|lung(1)	3						GACAGTATGCATGTGCCGGTT	0.552																																					p.M74K		.											.	.	.	0			c.T221A						.						88.0	86.0	86.0					10																	72025934		2158	4282	6440	SO:0001583	missense	64106	exon2			GTATGCATGTGCC	AB040104	CCDS53539.1	10q21-q22	2012-08-10	2006-02-15	2006-02-15	ENSG00000148734	ENSG00000148734		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	17425	protein-coding gene	gene with protein product	"""neuropeptide FF 1"""	607448	"""G protein-coupled receptor 147"""	GPR147		11024015	Standard	NM_022146		Approved	OT7T022, NPFF1R1	uc021psj.1	Q9GZQ6	OTTHUMG00000018404	ENST00000277942.6:c.221T>A	10.37:g.72025934A>T	ENSP00000277942:p.Met74Lys	45	0		31	10	NM_022146	A2RRF0|Q8NGR0|Q96RN3	Missense_Mutation	SNP	ENST00000277942.6	37	CCDS53539.1	.	.	.	.	.	.	.	.	.	.	A	18.74	3.688244	0.68271	.	.	ENSG00000148734	ENST00000449957;ENST00000277942	T;T	0.36520	1.25;1.25	5.05	5.05	0.67936	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.60340	0.2261	M	0.79343	2.45	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63717	-0.6574	10	0.51188	T	0.08	.	13.6094	0.62068	1.0:0.0:0.0:0.0	.	74	Q9GZQ6	NPFF1_HUMAN	K	72;74	ENSP00000401171:M72K;ENSP00000277942:M74K	ENSP00000277942:M74K	M	-	2	0	NPFFR1	71695940	1.000000	0.71417	1.000000	0.80357	0.462000	0.32619	7.442000	0.80503	1.901000	0.55032	0.260000	0.18958	ATG	.		0.552	NPFFR1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048504.2	NM_022146	
TMEM177	80775	hgsc.bcm.edu	37	2	120439254	120439254	+	Silent	SNP	C	C	T	rs150982620		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr2:120439254C>T	ENST00000424086.1	+	2	1298	c.825C>T	c.(823-825)agC>agT	p.S275S	TMEM177_ENST00000401466.1_Silent_p.S275S|TMEM177_ENST00000496203.1_Intron|TMEM177_ENST00000272521.6_Silent_p.S275S|TMEM177_ENST00000409951.1_Intron	NM_001105198.1	NP_001098668.1	Q53S58	TM177_HUMAN	transmembrane protein 177	275						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	13	Colorectal(110;0.196)					ATACACCCAGCGGGAACATCG	0.572																																					p.S275S		.											TMEM177,NS,carcinoma,0,1	TMEM177	0	0			c.C825T						.						62.0	59.0	60.0					2																	120439254		2203	4300	6503	SO:0001819	synonymous_variant	80775	exon2			ACCCAGCGGGAAC	BC004404	CCDS2128.1	2q14.2	2008-02-05			ENSG00000144120	ENSG00000144120			28143	protein-coding gene	gene with protein product						12477932	Standard	NM_001105198		Approved	MGC10993	uc002tmc.1	Q53S58	OTTHUMG00000153312	ENST00000424086.1:c.825C>T	2.37:g.120439254C>T		16	0		22	2	NM_030577	Q9BT20	Silent	SNP	ENST00000424086.1	37	CCDS2128.1																																																																																			.		0.572	TMEM177-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330673.1	NM_030577	
CDKN2A	1029	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	21971108	21971108	+	Missense_Mutation	SNP	C	C	A	rs11552822		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr9:21971108C>A	ENST00000304494.5	-	2	520	c.250G>T	c.(250-252)Gac>Tac	p.D84Y	CDKN2A_ENST00000498124.1_Missense_Mutation_p.D84Y|CDKN2A_ENST00000579755.1_Missense_Mutation_p.R98L|CDKN2A_ENST00000497750.1_Missense_Mutation_p.D33Y|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000578845.2_Missense_Mutation_p.D33Y|CDKN2A_ENST00000361570.3_Missense_Mutation_p.R139L|CDKN2A_ENST00000446177.1_Missense_Mutation_p.D84Y|CDKN2A_ENST00000498628.2_Missense_Mutation_p.D33Y|CDKN2A_ENST00000530628.2_Missense_Mutation_p.R98L|CDKN2A_ENST00000479692.2_Missense_Mutation_p.D33Y|CDKN2A_ENST00000494262.1_Missense_Mutation_p.D33Y|CDKN2A_ENST00000579122.1_Missense_Mutation_p.D84Y	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	84			D -> E (in a bladder tumor).|D -> H (in non-small cell lung carcinoma). {ECO:0000269|PubMed:8060323}.|D -> N (in an esophagus, a head and neck and a lung tumor).|D -> Y (in CMM2; also found in a lung and a prostate tumor; dbSNP:rs11552822). {ECO:0000269|PubMed:10874641}.		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.D84Y(11)|p.D84N(7)|p.D84fs*63(2)|p.D84H(2)|p.H83fs*2(2)|p.R139Q(2)|p.D84fs*1(1)|p.D84_F90del(1)|p.R139L(1)|p.0(1)|p.V82_G89>G(1)|p.E61_L94del(1)|p.R137fs*48(1)|p.A68fs*3(1)|p.P81_A85del(1)|p.R80fs*34(1)|p.V82_E88del(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CGGGCAGCGTCGTGCACGGGT	0.741	D84Y(DU145_PROSTATE)|D84Y(LK2_LUNG)	17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																											p.R98L		.											CDKN2A_ENST00000498124,left_upper_lobe,carcinoma,0,35	CDKN2A_ENST00000498124	0	1396	Whole gene deletion(1316)|Unknown(44)|Substitution - Missense(23)|Deletion - Frameshift(5)|Deletion - In frame(4)|Insertion - Frameshift(3)|Complex - deletion inframe(1)	haematopoietic_and_lymphoid_tissue(283)|skin(175)|central_nervous_system(170)|lung(154)|urinary_tract(91)|bone(74)|soft_tissue(57)|oesophagus(54)|upper_aerodigestive_tract(52)|pleura(51)|ovary(36)|kidney(32)|breast(32)|pancreas(30)|biliary_tract(15)|thyroid(13)|NS(12)|stomach(12)|prostate(11)|autonomic_ganglia(9)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(5)|thymus(4)|vulva(2)|endometrium(2)|genital_tract(1)	c.G293T	GRCh37	CM085316|CM990358	CDKN2A	M	rs11552822	.						13.0	16.0	15.0					9																	21971108		2178	4258	6436	SO:0001583	missense	1029	exon2			CAGCGTCGTGCAC	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.250G>T	9.37:g.21971108C>A	ENSP00000307101:p.Asp84Tyr	21	0		12	7	NM_058195	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	ENST00000304494.5	37	CCDS6510.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.137500|5.137500	0.94517|0.94517	.|.	.|.	ENSG00000147889|ENSG00000147889	ENST00000304494;ENST00000446177|ENST00000361570;ENST00000530628	D;D|D;D	0.94232|0.84070	-3.38;-3.38|-1.8;-1.73	5.93|5.93	5.93|5.93	0.95920|0.95920	Ankyrin repeat-containing domain (4);|.	.|0.000000	.|0.30428	.|N	.|0.009646	D|D	0.87744|0.87744	0.6254|0.6254	L|L	0.32530|0.32530	0.975|0.975	0.49213|0.49213	D|D	0.999766|0.999766	D|D	0.89917|0.89917	1.0|1.0	D|D	0.97110|0.91635	1.0|0.999	D|D	0.88398|0.88398	0.3013|0.3013	9|10	0.02654|0.87932	T|D	1|0	-18.6892|-18.6892	19.1221|19.1221	0.93367|0.93367	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	rs11552822|rs11552822	84|139	P42771|Q8N726	CD2A1_HUMAN|CD2A2_HUMAN	Y|L	84|139;98	ENSP00000307101:D84Y;ENSP00000394932:D84Y|ENSP00000355153:R139L;ENSP00000432664:R98L	ENSP00000307101:D84Y|ENSP00000355153:R139L	D|R	-|-	1|2	0|0	CDKN2A|CDKN2A	21961108|21961108	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.954000|0.954000	0.61252|0.61252	6.879000|6.879000	0.75572|0.75572	2.808000|2.808000	0.96608|0.96608	0.655000|0.655000	0.94253|0.94253	GAC|CGA	.		0.741	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	NM_000077	
AHNAK	79026	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	62292529	62292529	+	Missense_Mutation	SNP	C	C	G			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr11:62292529C>G	ENST00000378024.4	-	5	9634	c.9360G>C	c.(9358-9360)atG>atC	p.M3120I	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	3120					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CAGGAACTTTCATGTCACCTT	0.468																																					p.M3120I		.											.	.	.	0			c.G9360C						.						218.0	235.0	229.0					11																	62292529		2202	4299	6501	SO:0001583	missense	79026	exon5			AACTTTCATGTCA	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.9360G>C	11.37:g.62292529C>G	ENSP00000367263:p.Met3120Ile	88	0		85	31	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	c	0.003	-2.565059	0.00134	.	.	ENSG00000124942	ENST00000378024	T	0.00653	5.96	3.79	-7.58	0.01313	.	.	.	.	.	T	0.00271	0.0008	N	0.02802	-0.49	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43702	-0.9375	9	0.06891	T	0.86	0.0853	3.8772	0.09062	0.421:0.1957:0.308:0.0753	.	3120	Q09666	AHNK_HUMAN	I	3120	ENSP00000367263:M3120I	ENSP00000367263:M3120I	M	-	3	0	AHNAK	62049105	0.003000	0.15002	0.000000	0.03702	0.005000	0.04900	-2.171000	0.01267	-4.077000	0.00076	-0.676000	0.03789	ATG	.		0.468	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
OR6C4	341418	hgsc.bcm.edu	37	12	55945614	55945614	+	Missense_Mutation	SNP	G	G	A	rs375998098	byFrequency	TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr12:55945614G>A	ENST00000394256.2	+	1	632	c.604G>A	c.(604-606)Gtt>Att	p.V202I	RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA	NM_001005494.1	NP_001005494.1	Q8NGE1	OR6C4_HUMAN	olfactory receptor, family 6, subfamily C, member 4	202						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	11						CCTCTTGGCCGTTGTGACTCT	0.483													G|||	4	0.000798722	0.0	0.0	5008	,	,		21643	0.0		0.0	False		,,,				2504	0.0041				p.V202I		.											OR6C4,colon,carcinoma,0,1	OR6C4	0	0			c.G604A						.						161.0	136.0	144.0					12																	55945614		2203	4300	6503	SO:0001583	missense	341418	exon1			TTGGCCGTTGTGA	BK004261	CCDS31827.1	12q14.2	2012-08-09				ENSG00000179626		"""GPCR / Class A : Olfactory receptors"""	19632	protein-coding gene	gene with protein product							Standard	NM_001005494		Approved		uc010spp.2	Q8NGE1	OTTHUMG00000169959	ENST00000394256.2:c.604G>A	12.37:g.55945614G>A	ENSP00000377799:p.Val202Ile	32	0		24	2	NM_001005494	A8MZG7|B2RNN2|Q6IFK1	Missense_Mutation	SNP	ENST00000394256.2	37	CCDS31827.1	.	.	.	.	.	.	.	.	.	.	G	2.858	-0.236702	0.05944	.	.	ENSG00000179626	ENST00000394256	T	0.37584	1.19	4.98	0.942	0.19525	GPCR, rhodopsin-like superfamily (1);	0.903729	0.09142	N	0.842780	T	0.20333	0.0489	N	0.17564	0.495	0.09310	N	1	B	0.15719	0.014	B	0.18561	0.022	T	0.25710	-1.0124	10	0.41790	T	0.15	.	3.6982	0.08372	0.3561:0.0:0.4794:0.1645	.	202	Q8NGE1	OR6C4_HUMAN	I	202	ENSP00000377799:V202I	ENSP00000377799:V202I	V	+	1	0	OR6C4	54231881	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.655000	0.05348	0.066000	0.16515	0.655000	0.94253	GTT	.		0.483	OR6C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406678.1		
ANTXR1	84168	hgsc.bcm.edu;bcgsc.ca	37	2	69420523	69420523	+	Silent	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr2:69420523G>T	ENST00000303714.4	+	17	1732	c.1410G>T	c.(1408-1410)gtG>gtT	p.V470V		NM_032208.2	NP_115584.1	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1	470					actin cytoskeleton reorganization (GO:0031532)|reproductive process (GO:0022414)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|lamellipodium membrane (GO:0031258)	actin filament binding (GO:0051015)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|transmembrane signaling receptor activity (GO:0004888)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						GTGTGTCTGTGATGCGTCCAC	0.453									Familial Infantile Hemangioma																												p.V470V		.											.	.	.	0			c.G1410T						.						193.0	181.0	185.0					2																	69420523		2203	4300	6503	SO:0001819	synonymous_variant	84168	exon17	Familial Cancer Database	Infantile Capillary Hemangioma, HCI, Hereditary Capillary Hemangioma	GTCTGTGATGCGT	AF421380	CCDS1892.1, CCDS46313.1, CCDS46314.1	2p13.1	2006-04-12			ENSG00000169604	ENSG00000169604			21014	protein-coding gene	gene with protein product	"""anthrax toxin receptor"", ""tumor endothelial marker 8 precursor"""	606410				10947988, 11559528	Standard	NM_032208		Approved	TEM8, FLJ21776, FLJ10601, ATR	uc002sfg.3	Q9H6X2	OTTHUMG00000129575	ENST00000303714.4:c.1410G>T	2.37:g.69420523G>T		53	0		56	4	NM_032208	A8K7U8|J7K7G4|J7KF88|Q4ZFV6|Q53QD8|Q96P02|Q9NVP3	Silent	SNP	ENST00000303714.4	37	CCDS1892.1																																																																																			.		0.453	ANTXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251770.2	NM_032208	
KIAA2018	205717	hgsc.bcm.edu	37	3	113376107	113376107	+	Silent	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr3:113376107C>T	ENST00000478658.1	-	5	4439	c.4422G>A	c.(4420-4422)caG>caA	p.Q1474Q	KIAA2018_ENST00000316407.4_Silent_p.Q1474Q|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	1474	Gln-rich.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						gttgttgttgctgttgctgct	0.493																																					p.Q1474Q		.											KIAA2018,colon,carcinoma,0,1	KIAA2018	0	0			c.G4422A						.						88.0	96.0	93.0					3																	113376107		2193	4279	6472	SO:0001819	synonymous_variant	205717	exon7			TTGTTGCTGTTGC	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4422G>A	3.37:g.113376107C>T		18	1		17	3	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	37	CCDS43133.1																																																																																			.		0.493	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
MUC4	4585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	195512268	195512268	+	Silent	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr3:195512268G>A	ENST00000463781.3	-	2	6642	c.6183C>T	c.(6181-6183)gaC>gaT	p.D2061D	MUC4_ENST00000475231.1_Silent_p.D2061D|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGCGTGGTGTCACCTGTGG	0.572																																					p.D2061D		.											.	.	.	0			c.C6183T						.						18.0	18.0	18.0					3																	195512268		683	1570	2253	SO:0001819	synonymous_variant	4585	exon2			CGTGGTGTCACCT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6183C>T	3.37:g.195512268G>A		148	0		124	19	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
DDI1	414301	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	103908641	103908641	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr11:103908641G>T	ENST00000302259.3	+	1	1334	c.1091G>T	c.(1090-1092)gGa>gTa	p.G364V	PDGFD_ENST00000302251.5_Intron|PDGFD_ENST00000393158.2_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	364							aspartic-type endopeptidase activity (GO:0004190)			central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		CTTCCTGAGGGAGAGTTGCCC	0.458																																					p.G364V		.											.	.	.	0			c.G1091T						.						74.0	73.0	73.0					11																	103908641		2202	4299	6501	SO:0001583	missense	414301	exon1			CTGAGGGAGAGTT		CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.1091G>T	11.37:g.103908641G>T	ENSP00000302805:p.Gly364Val	29	0		33	4	NM_001001711	Q7Z4U6|Q8WTS3	Missense_Mutation	SNP	ENST00000302259.3	37	CCDS31660.1	.	.	.	.	.	.	.	.	.	.	G	13.13	2.145075	0.37825	.	.	ENSG00000170967	ENST00000302259	T	0.23348	1.91	4.97	4.04	0.47022	.	0.132511	0.49305	D	0.000146	T	0.41650	0.1168	M	0.79805	2.47	0.58432	D	0.999999	D	0.59767	0.986	P	0.50791	0.65	T	0.51426	-0.8707	10	0.72032	D	0.01	-29.3307	13.2951	0.60292	0.0:0.1602:0.8398:0.0	.	364	Q8WTU0	DDI1_HUMAN	V	364	ENSP00000302805:G364V	ENSP00000302805:G364V	G	+	2	0	DDI1	103413851	1.000000	0.71417	1.000000	0.80357	0.090000	0.18270	6.477000	0.73591	1.439000	0.47511	0.655000	0.94253	GGA	.		0.458	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387326.1	NM_001001711	
HOXD9	3235	hgsc.bcm.edu;bcgsc.ca	37	2	176988855	176988855	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr2:176988855G>T	ENST00000249499.6	+	2	1420	c.1011G>T	c.(1009-1011)agG>agT	p.R337S	HOXD-AS2_ENST00000440016.2_RNA	NM_014213.3	NP_055028.3	P28356	HXD9_HUMAN	homeobox D9	337					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal system morphogenesis (GO:0048704)|hindlimb morphogenesis (GO:0035137)|mammary gland development (GO:0030879)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(5)|prostate(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		AGAACCGTAGGATGAAAATGA	0.537																																					p.R337S	GBM(47;924 952 7959 9248 12176)	.											.	.	.	0			c.G1011T						.						69.0	81.0	77.0					2																	176988855		2203	4300	6503	SO:0001583	missense	3235	exon2			CCGTAGGATGAAA		CCDS2267.2	2q31.1	2011-06-20	2005-12-22		ENSG00000128709	ENSG00000128709		"""Homeoboxes / ANTP class : HOXL subclass"""	5140	protein-coding gene	gene with protein product		142982	"""homeo box D9"""	HOX4C, HOX4		1973146, 1358459	Standard	NM_014213		Approved		uc010zex.2	P28356	OTTHUMG00000132516	ENST00000249499.6:c.1011G>T	2.37:g.176988855G>T	ENSP00000249499:p.Arg337Ser	66	0		65	4	NM_014213	Q86ST1	Missense_Mutation	SNP	ENST00000249499.6	37	CCDS2267.2	.	.	.	.	.	.	.	.	.	.	G	16.45	3.126859	0.56721	.	.	ENSG00000128709	ENST00000249499	D	0.99158	-5.5	5.7	1.78	0.24846	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99513	0.9826	H	0.99074	4.42	0.52099	D	0.999946	D	0.89917	1.0	D	0.91635	0.999	D	0.98162	1.0447	10	0.87932	D	0	.	8.589	0.33674	0.3899:0.0:0.6101:0.0	.	337	P28356	HXD9_HUMAN	S	337	ENSP00000249499:R337S	ENSP00000249499:R337S	R	+	3	2	HOXD9	176697101	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.889000	0.28282	0.722000	0.32252	0.650000	0.86243	AGG	.		0.537	HOXD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255698.4		
CDX4	1046	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	72674415	72674415	+	Silent	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chrX:72674415C>T	ENST00000373514.2	+	3	849	c.849C>T	c.(847-849)tcC>tcT	p.S283S		NM_005193.1	NP_005184.1	O14627	CDX4_HUMAN	caudal type homeobox 4	283					anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|labyrinthine layer development (GO:0060711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|skin(1)	18	Renal(35;0.156)					TTATAGTCTCCGAATGAAAGA	0.428																																					p.S283S		.											.	.	.	0			c.C849T						.						57.0	46.0	50.0					X																	72674415		2202	4300	6502	SO:0001819	synonymous_variant	1046	exon3			AGTCTCCGAATGA	AF029879	CCDS14424.1	Xq13.2	2012-03-09	2007-07-09		ENSG00000131264	ENSG00000131264		"""Homeoboxes / ANTP class : HOXL subclass"""	1808	protein-coding gene	gene with protein product		300025	"""caudal type homeo box transcription factor 4"""			7655457	Standard	NM_005193		Approved		uc011mqk.2	O14627	OTTHUMG00000021831	ENST00000373514.2:c.849C>T	X.37:g.72674415C>T		69	0		316	24	NM_005193	A1A513|Q5JS20	Silent	SNP	ENST00000373514.2	37	CCDS14424.1																																																																																			.		0.428	CDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057229.2	NM_005193	
C1QL1	10882	hgsc.bcm.edu	37	17	43037583	43037583	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr17:43037583G>T	ENST00000253407.3	-	2	772	c.750C>A	c.(748-750)ttC>ttA	p.F250L		NM_006688.3	NP_006679.1	O75973	C1QRF_HUMAN	complement component 1, q subcomponent-like 1	250	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				locomotory behavior (GO:0007626)	collagen trimer (GO:0005581)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)				lung(1)|prostate(1)	2		Prostate(33;0.155)				TGAAGCCAGAGAACGTGCTGT	0.632																																					p.F250L		.											C1QL1,NS,carcinoma,0,2	C1QL1	0	0			c.C750A						.						305.0	246.0	266.0					17																	43037583		2203	4300	6503	SO:0001583	missense	10882	exon2			GCCAGAGAACGTG	AF410771	CCDS11492.1	17q21	2010-08-18			ENSG00000131094	ENSG00000131094			24182	protein-coding gene	gene with protein product		611586				9878755	Standard	NM_006688		Approved	CRF, C1QRF, C1QTNF14	uc002ihv.3	O75973	OTTHUMG00000162944	ENST00000253407.3:c.750C>A	17.37:g.43037583G>T	ENSP00000253407:p.Phe250Leu	50	0		41	3	NM_006688		Missense_Mutation	SNP	ENST00000253407.3	37	CCDS11492.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.473751	0.84640	.	.	ENSG00000131094	ENST00000253407	D	0.92911	-3.13	4.4	2.42	0.29668	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.000000	0.85682	D	0.000000	D	0.96367	0.8815	H	0.94925	3.6	0.51233	D	0.999918	D	0.76494	0.999	D	0.85130	0.997	D	0.94932	0.8083	10	0.87932	D	0	.	7.7959	0.29148	0.2783:0.0:0.7217:0.0	.	250	O75973	C1QRF_HUMAN	L	250	ENSP00000253407:F250L	ENSP00000253407:F250L	F	-	3	2	C1QL1	40393109	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	2.301000	0.43628	0.498000	0.27948	0.555000	0.69702	TTC	.		0.632	C1QL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371119.3	NM_006688	
PTPRA	5786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	2968722	2968722	+	Missense_Mutation	SNP	G	G	A	rs375070304		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr20:2968722G>A	ENST00000216877.6	+	7	945	c.545G>A	c.(544-546)cGc>cAc	p.R182H	PTPRA_ENST00000425918.2_Missense_Mutation_p.R202H|PTPRA_ENST00000399903.2_Missense_Mutation_p.R191H|PTPRA_ENST00000380393.3_Missense_Mutation_p.R191H|PTPRA_ENST00000358719.4_Missense_Mutation_p.R47H|PTPRA_ENST00000356147.3_Missense_Mutation_p.R182H|PTPRA_ENST00000318266.5_Missense_Mutation_p.R182H	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	191					axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						AATTCTTTCCGCTTATCCAAC	0.448																																					p.R191H		.											.	.	.	0			c.G572A						.	G	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	145.0	138.0	140.0		572,545,545	5.8	1.0	20		140	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	PTPRA	NM_002836.3,NM_080840.2,NM_080841.2	29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	191/803,182/794,182/794	2968722	1,13005	2203	4300	6503	SO:0001583	missense	5786	exon12			CTTTCCGCTTATC		CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.545G>A	20.37:g.2968722G>A	ENSP00000216877:p.Arg182His	43	0		47	17	NM_002836	A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Missense_Mutation	SNP	ENST00000216877.6	37	CCDS13039.1	.	.	.	.	.	.	.	.	.	.	G	33	5.200911	0.94997	0.0	1.16E-4	ENSG00000132670	ENST00000380393;ENST00000455631;ENST00000216877;ENST00000399903;ENST00000358719;ENST00000418580;ENST00000425918;ENST00000318266;ENST00000356147	T;T;T;T;T;T;T;T	0.53857	3.87;0.6;3.86;3.87;3.82;3.87;3.86;3.86	5.8	5.8	0.92144	.	0.000000	0.85682	U	0.000000	T	0.58566	0.2131	L	0.29908	0.895	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.65773	0.925;0.938;0.938	T	0.53718	-0.8399	10	0.32370	T	0.25	.	14.2385	0.65943	0.0708:0.0:0.9292:0.0	.	202;191;182	B7Z2A4;P18433-3;P18433-4	.;.;.	H	191;182;182;191;47;191;202;182;182	ENSP00000369756:R191H;ENSP00000414089:R182H;ENSP00000216877:R182H;ENSP00000382787:R191H;ENSP00000351559:R47H;ENSP00000393553:R202H;ENSP00000314568:R182H;ENSP00000348468:R182H	ENSP00000216877:R182H	R	+	2	0	PTPRA	2916722	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.104000	0.94239	2.735000	0.93741	0.655000	0.94253	CGC	.		0.448	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077682.3		
ROCK1P1	727758	hgsc.bcm.edu	37	18	110357	110357	+	RNA	SNP	G	G	C			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr18:110357G>C	ENST00000608049.1	+	0	389					NR_033770.1				Rho-associated, coiled-coil containing protein kinase 1 pseudogene 1																		tggaagtcttgtctaggctct	0.483																																					.		.											.	.	.	0			.						.																																					727758	.			AGTCTTGTCTAGG			18p11.32	2012-10-04			ENSG00000263006	ENSG00000263006			37832	pseudogene	pseudogene							Standard	NR_033770		Approved		uc002kke.3		OTTHUMG00000177913		18.37:g.110357G>C		26	0		51	4	.		RNA	SNP	ENST00000608049.1	37																																																																																				.		0.483	ROCK1P1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000472417.1		
UBQLN1	29979	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	9	86297904	86297904	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr9:86297904G>T	ENST00000376395.4	-	3	933	c.410C>A	c.(409-411)tCt>tAt	p.S137Y	UBQLN1_ENST00000257468.7_Missense_Mutation_p.S137Y	NM_013438.4|NM_053067.2	NP_038466.2|NP_444295.1	Q9UMX0	UBQL1_HUMAN	ubiquilin 1	137					cellular response to hypoxia (GO:0071456)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|regulation of protein ubiquitination (GO:0031396)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|protein complex (GO:0043234)	kinase binding (GO:0019900)			breast(4)|endometrium(2)|kidney(4)|large_intestine(6)|lung(10)|prostate(1)	27						ACCAGATGTAGAGTTACTATT	0.408																																					p.S137Y	Melanoma(186;1284 2073 12755 14558 18426)	.											.	.	.	0			c.C410A						.						171.0	155.0	161.0					9																	86297904		2203	4300	6503	SO:0001583	missense	29979	exon3			GATGTAGAGTTAC	AF176069	CCDS6663.1, CCDS6664.1	9q22	2013-02-12			ENSG00000135018	ENSG00000135018		"""Ubiquilin family"""	12508	protein-coding gene	gene with protein product		605046				9303440, 10807547	Standard	NM_013438		Approved	DSK2, PLIC-1, XDRP1, DA41	uc004amv.3	Q9UMX0	OTTHUMG00000020104	ENST00000376395.4:c.410C>A	9.37:g.86297904G>T	ENSP00000365576:p.Ser137Tyr	70	0		38	4	NM_053067	Q5T6J5|Q5T6J9|Q8IXS9|Q8N2Q3|Q9H0T8|Q9H3R4|Q9HAZ5	Missense_Mutation	SNP	ENST00000376395.4	37	CCDS6663.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.303003	0.81136	.	.	ENSG00000135018	ENST00000376395;ENST00000257468	D;D	0.81659	-1.52;-1.52	5.11	5.11	0.69529	.	0.234157	0.38492	N	0.001679	T	0.74981	0.3788	L	0.52573	1.65	0.37641	D	0.922056	B;B	0.19583	0.037;0.021	B;B	0.23716	0.048;0.021	T	0.70676	-0.4806	10	0.02654	T	1	.	18.911	0.92485	0.0:0.0:1.0:0.0	.	137;137	Q9UMX0-2;Q9UMX0	.;UBQL1_HUMAN	Y	137	ENSP00000365576:S137Y;ENSP00000257468:S137Y	ENSP00000257468:S137Y	S	-	2	0	UBQLN1	85487724	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.681000	0.61663	2.529000	0.85273	0.655000	0.94253	TCT	.		0.408	UBQLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000052834.1	NM_013438	
ABCA13	154664	hgsc.bcm.edu	37	7	48327660	48327660	+	Silent	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr7:48327660G>A	ENST00000435803.1	+	20	8964	c.8940G>A	c.(8938-8940)gcG>gcA	p.A2980A		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2980					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.A2980A(2)|p.A2925A(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCACTTTGGCGCAGGACCACT	0.438																																					p.A2980A		.											ABCA13_ENST00000435803,NS,carcinoma,0,2	ABCA13_ENST00000435803	0	3	Substitution - coding silent(3)	prostate(3)	c.G8940A						.						146.0	144.0	144.0					7																	48327660		1873	4104	5977	SO:0001819	synonymous_variant	154664	exon20			TTTGGCGCAGGAC	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.8940G>A	7.37:g.48327660G>A		35	0		47	2	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	CCDS47584.1																																																																																			.		0.438	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
WHSC1L1	54904	hgsc.bcm.edu	37	8	38157087	38157087	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr8:38157087G>T	ENST00000317025.8	-	15	3150	c.2633C>A	c.(2632-2634)tCa>tAa	p.S878*	WHSC1L1_ENST00000433384.2_Intron|WHSC1L1_ENST00000527502.1_Nonsense_Mutation_p.S878*	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1	878					histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			CATGGGGTCTGAATGGTCCTG	0.398			T	NUP98	AML																																p.S878X		.		Dom	yes		8	8p12	54904	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)		L	.	.	.	0			c.C2633A						.						102.0	94.0	96.0					8																	38157087		1902	4119	6021	SO:0001587	stop_gained	54904	exon15			GGGTCTGAATGGT	AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.2633C>A	8.37:g.38157087G>T	ENSP00000313983:p.Ser878*	100	0		83	3	NM_023034	B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	Nonsense_Mutation	SNP	ENST00000317025.8	37	CCDS43729.1	.	.	.	.	.	.	.	.	.	.	G	46	12.252945	0.99650	.	.	ENSG00000147548	ENST00000317025;ENST00000446459;ENST00000527502	.	.	.	5.83	5.83	0.93111	.	0.000000	0.39759	U	0.001261	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	20.111	0.97911	0.0:0.0:1.0:0.0	.	.	.	.	X	878;815;878	.	ENSP00000313983:S878X	S	-	2	0	WHSC1L1	38276244	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.747000	0.94245	0.650000	0.86243	TCA	.		0.398	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381924.3	NM_023034	
UNC5B	219699	hgsc.bcm.edu	37	10	73051326	73051326	+	Missense_Mutation	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr10:73051326C>T	ENST00000335350.6	+	10	1848	c.1432C>T	c.(1432-1434)Ccc>Tcc	p.P478S	UNC5B_ENST00000373192.4_Missense_Mutation_p.P467S	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	478					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						GGACCCCTTACCCAGCCTTAA	0.637																																					p.P478S		.											UNC5B,colon,carcinoma,0,1	UNC5B	0	0			c.C1432T						.						72.0	73.0	72.0					10																	73051326		2203	4300	6503	SO:0001583	missense	219699	exon10			CCCTTACCCAGCC	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.1432C>T	10.37:g.73051326C>T	ENSP00000334329:p.Pro478Ser	69	0		64	3	NM_170744	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	c	21.2	4.111939	0.77210	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.52526	0.75;0.66	4.47	4.47	0.54385	.	0.138317	0.49916	D	0.000130	T	0.62282	0.2415	L	0.51853	1.615	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.57929	-0.7726	10	0.23891	T	0.37	-27.9657	17.5121	0.87763	0.0:1.0:0.0:0.0	.	467;478	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	S	478;467	ENSP00000334329:P478S;ENSP00000362288:P467S	ENSP00000334329:P478S	P	+	1	0	UNC5B	72721332	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	7.815000	0.86186	2.190000	0.69967	0.651000	0.88453	CCC	.		0.637	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744	
DNAH2	146754	hgsc.bcm.edu	37	17	7705318	7705318	+	Silent	SNP	C	C	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr17:7705318C>A	ENST00000572933.1	+	58	10415	c.8955C>A	c.(8953-8955)ctC>ctA	p.L2985L	DNAH2_ENST00000389173.2_Silent_p.L2985L			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2985					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L2985L(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				ACCTGGAACTCCTGTCTGGAT	0.512																																					p.L2985L		.											DNAH2,NS,carcinoma,0,1	DNAH2	0	1	Substitution - coding silent(1)	lung(1)	c.C8955A						.						95.0	88.0	90.0					17																	7705318		2203	4300	6503	SO:0001819	synonymous_variant	146754	exon57			GGAACTCCTGTCT	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.8955C>A	17.37:g.7705318C>A		26	0		35	2	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	37	CCDS32551.1																																																																																			.		0.512	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
CFAP44	55779	hgsc.bcm.edu	37	3	113063555	113063555	+	Nonsense_Mutation	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr3:113063555G>A	ENST00000393845.2	-	23	3136	c.3070C>T	c.(3070-3072)Cga>Tga	p.R1024*		NM_001164496.1	NP_001157968.1														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						AGTGGATCTCGAAATCTGAAA	0.343																																					p.R1024X		.											WDR52_ENST00000393845,NS,carcinoma,0,1	WDR52_ENST00000393845	0	0			c.C3070T						.						115.0	90.0	98.0					3																	113063555		692	1591	2283	SO:0001587	stop_gained	55779	exon23			GATCTCGAAATCT																												ENST00000393845.2:c.3070C>T	3.37:g.113063555G>A	ENSP00000377428:p.Arg1024*	38	0		48	2	NM_001164496		Nonsense_Mutation	SNP	ENST00000393845.2	37	CCDS54624.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	41|41	8.774946|8.774946	0.98950|0.98950	.|.	.|.	ENSG00000206530|ENSG00000206530	ENST00000393845|ENST00000465636	.|.	.|.	.|.	4.69|4.69	4.69|4.69	0.59074|0.59074	.|.	4.658740|.	0.00958|.	U|.	0.003072|.	.|T	.|0.71333	.|0.3327	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.70092	.|-0.4967	.|4	0.02654|.	T|.	1|.	-9.5668|-9.5668	15.9168|15.9168	0.79524|0.79524	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	1024|160	.|.	ENSP00000377428:R1024X|.	R|S	-|-	1|2	2|0	WDR52|WDR52	114546245|114546245	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	4.520000|4.520000	0.60524|0.60524	2.603000|2.603000	0.88011|0.88011	0.591000|0.591000	0.81541|0.81541	CGA|TCG	.		0.343	WDR52-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
MOSPD2	158747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	14936834	14936834	+	Missense_Mutation	SNP	C	C	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chrX:14936834C>A	ENST00000380492.3	+	14	1437	c.1349C>A	c.(1348-1350)cCa>cAa	p.P450Q	MOSPD2_ENST00000482354.1_Missense_Mutation_p.P450Q|MOSPD2_ENST00000495110.1_3'UTR	NM_001177475.1|NM_152581.3	NP_001170946.1|NP_689794.1	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2	450						integral component of membrane (GO:0016021)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	Hepatocellular(33;0.183)					AGCAGTAAACCAAACACTCTT	0.269																																					p.P450Q		.											.	.	.	0			c.C1349A						.						83.0	73.0	76.0					X																	14936834		2202	4298	6500	SO:0001583	missense	158747	exon14			GTAAACCAAACAC	AL834345	CCDS14162.1	Xp22.31	2006-03-16			ENSG00000130150	ENSG00000130150			28381	protein-coding gene	gene with protein product						15533722	Standard	NM_152581		Approved	MGC26706	uc004cwi.3	Q8NHP6	OTTHUMG00000021170	ENST00000380492.3:c.1349C>A	X.37:g.14936834C>A	ENSP00000369860:p.Pro450Gln	222	0		183	36	NM_152581	Q8N3H2|Q8NA83	Missense_Mutation	SNP	ENST00000380492.3	37	CCDS14162.1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.730496	0.48939	.	.	ENSG00000130150	ENST00000380492	T	0.64260	-0.09	5.86	5.86	0.93980	PapD-like (1);	0.099026	0.64402	D	0.000001	T	0.65144	0.2663	M	0.69823	2.125	0.58432	D	0.999999	P	0.43519	0.809	B	0.39465	0.3	T	0.69862	-0.5030	10	0.56958	D	0.05	.	18.9712	0.92715	0.0:1.0:0.0:0.0	.	450	Q8NHP6	MSPD2_HUMAN	Q	450	ENSP00000369860:P450Q	ENSP00000369860:P450Q	P	+	2	0	MOSPD2	14846755	1.000000	0.71417	0.992000	0.48379	0.907000	0.53573	4.384000	0.59607	2.614000	0.88457	0.594000	0.82650	CCA	.		0.269	MOSPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055837.1	NM_152581	
OLFM4	10562	hgsc.bcm.edu;bcgsc.ca	37	13	53624252	53624252	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr13:53624252G>T	ENST00000219022.2	+	5	957	c.879G>T	c.(877-879)ttG>ttT	p.L293F		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	293	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		TGGCGCCATTGAATACAGATG	0.448																																					p.L293F		.											.	.	.	0			c.G879T						.						112.0	100.0	104.0					13																	53624252		2203	4300	6503	SO:0001583	missense	10562	exon5			GCCATTGAATACA	AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.879G>T	13.37:g.53624252G>T	ENSP00000219022:p.Leu293Phe	87	0		82	4	NM_006418	O95362|Q5VWG0|Q86T22	Missense_Mutation	SNP	ENST00000219022.2	37	CCDS9440.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.308227	0.40895	.	.	ENSG00000102837	ENST00000219022	D	0.89343	-2.5	5.92	4.18	0.49190	Olfactomedin-like (3);	0.168812	0.40385	N	0.001105	D	0.93009	0.7775	M	0.68593	2.085	0.38737	D	0.953796	D	0.76494	0.999	D	0.77557	0.99	D	0.93370	0.6734	10	0.56958	D	0.05	.	13.2097	0.59817	0.1309:0.0:0.8691:0.0	.	293	Q6UX06	OLFM4_HUMAN	F	293	ENSP00000219022:L293F	ENSP00000219022:L293F	L	+	3	2	OLFM4	52522253	0.883000	0.30277	0.515000	0.27774	0.112000	0.19704	1.864000	0.39469	0.822000	0.34565	0.650000	0.86243	TTG	.		0.448	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045112.2	NM_006418	
AIM1	202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	106991412	106991412	+	Missense_Mutation	SNP	C	C	G	rs572684440		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr6:106991412C>G	ENST00000369066.3	+	9	4242	c.3755C>G	c.(3754-3756)gCg>gGg	p.A1252G	AIM1_ENST00000535438.1_Missense_Mutation_p.A71G	NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		ACAGAAGAGGCGACTGGAGAC	0.408																																					p.A1252G		.											.	.	.	0			c.C3755G						.						273.0	262.0	266.0					6																	106991412		2203	4300	6503	SO:0001583	missense	202	exon9			AAGAGGCGACTGG	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.3755C>G	6.37:g.106991412C>G	ENSP00000358062:p.Ala1252Gly	63	0		40	22	NM_001624	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	C	8.678	0.904477	0.17760	.	.	ENSG00000112297	ENST00000369066;ENST00000457437;ENST00000535438	T;T;T	0.74106	-0.64;-0.81;-0.75	5.32	2.53	0.30540	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	1.224440	0.05373	N	0.535756	T	0.47525	0.1450	L	0.29908	0.895	0.09310	N	1	P;B	0.34934	0.476;0.336	B;B	0.40825	0.341;0.272	T	0.51411	-0.8709	10	0.51188	T	0.08	.	3.8938	0.09130	0.3604:0.3999:0.0:0.2397	.	71;1252	B4DU04;Q9Y4K1	.;AIM1_HUMAN	G	1252;71;71	ENSP00000358062:A1252G;ENSP00000391419:A71G;ENSP00000439183:A71G	ENSP00000358062:A1252G	A	+	2	0	AIM1	107098105	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.716000	0.04991	0.359000	0.24239	0.650000	0.86243	GCG	.		0.408	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
ABCC1	4363	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	16180684	16180684	+	Missense_Mutation	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr16:16180684G>A	ENST00000399410.3	+	18	2471	c.2296G>A	c.(2296-2298)Gtg>Atg	p.V766M	ABCC1_ENST00000349029.5_Intron|ABCC1_ENST00000399408.2_Missense_Mutation_p.V766M|ABCC1_ENST00000345148.5_Missense_Mutation_p.V766M|ABCC1_ENST00000346370.5_Intron|ABCC1_ENST00000351154.5_Missense_Mutation_p.V707M	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	766	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	TCCCCAGGGCGTGAACCTGTC	0.577																																					p.V766M		.											.	.	.	0			c.G2296A						.						59.0	70.0	67.0					16																	16180684		2169	4290	6459	SO:0001583	missense	4363	exon18			CAGGGCGTGAACC	L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.2296G>A	16.37:g.16180684G>A	ENSP00000382342:p.Val766Met	29	0		34	8	NM_004996	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	ENST00000399410.3	37	CCDS42122.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.174206	0.78452	.	.	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000351154;ENST00000345148;ENST00000536381	D;D;D;D	0.93763	-3.28;-3.28;-3.28;-3.28	5.38	5.38	0.77491	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.059638	0.64402	D	0.000003	D	0.96144	0.8743	M	0.63208	1.945	0.80722	D	1	D;D;D;D	0.89917	0.998;0.996;1.0;1.0	D;P;D;D	0.91635	0.934;0.707;0.999;0.999	D	0.96523	0.9387	10	0.87932	D	0	-28.6867	18.1249	0.89583	0.0:0.0:1.0:0.0	.	766;707;766;766	P33527-4;P33527-2;P33527;P33527-9	.;.;MRP1_HUMAN;.	M	766;766;707;766;440	ENSP00000382342:V766M;ENSP00000382340:V766M;ENSP00000263017:V707M;ENSP00000263014:V766M	ENSP00000263014:V766M	V	+	1	0	ABCC1	16088185	0.999000	0.42202	1.000000	0.80357	0.985000	0.73830	2.786000	0.47790	2.520000	0.84964	0.563000	0.77884	GTG	.		0.577	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109701.1	NM_004996	
PLEKHA3	65977	hgsc.bcm.edu	37	2	179363817	179363817	+	Intron	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr2:179363817G>T	ENST00000234453.5	+	6	1017					NM_019091.3	NP_061964.3	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3							Golgi apparatus (GO:0005794)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			ATTTTTTTTTGCCAGTTATCT	0.274																																					.		.											.	.	.	0			.						.						201.0	167.0	178.0					2																	179363817		692	1591	2283	SO:0001627	intron_variant	100302152	.			TTTTTTGCCAGTT	AF286162	CCDS33336.1	2q31.2	2013-01-10	2002-01-14		ENSG00000116095	ENSG00000116095		"""Pleckstrin homology (PH) domain containing"""	14338	protein-coding gene	gene with protein product	"""four-phosphate-adaptor protein 1"""	607774	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3"""			11001876, 15107860	Standard	NM_019091		Approved	FAPP1	uc002umn.3	Q9HB20	OTTHUMG00000154446	ENST00000234453.5:c.616-121G>T	2.37:g.179363817G>T		96	0		114	7	.	Q4ZG69|Q86TQ1|Q9NXT3	RNA	SNP	ENST00000234453.5	37	CCDS33336.1																																																																																			.		0.274	PLEKHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335241.2	NM_019091	
GDI1	2664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	153667150	153667150	+	Missense_Mutation	SNP	T	T	C			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chrX:153667150T>C	ENST00000447750.2	+	3	528	c.193T>C	c.(193-195)Tcg>Ccg	p.S65P		NM_001493.2	NP_001484.1	P31150	GDIA_HUMAN	GDP dissociation inhibitor 1	65					negative regulation of axonogenesis (GO:0050771)|negative regulation of protein targeting to membrane (GO:0090315)|protein transport (GO:0015031)|Rab protein signal transduction (GO:0032482)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|midbody (GO:0030496)|neuron projection (GO:0043005)|protein complex (GO:0043234)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|Rab GDP-dissociation inhibitor activity (GO:0005093)			autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	16	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCCCCCTGAGTCGATGGGCCG	0.572																																					p.S65P		.											.	.	.	0			c.T193C						.						180.0	194.0	189.0					X																	153667150		2203	4300	6503	SO:0001583	missense	2664	exon3			CCTGAGTCGATGG	X79353	CCDS35452.1	Xq28	2008-08-01			ENSG00000203879	ENSG00000203879			4226	protein-coding gene	gene with protein product	"""mental retardation, X-linked 41"", ""mental retardation, X-linked 48"", ""rab GDP-dissociation inhibitor, alpha"""	300104		MRX48, MRX41, GDIL		7543319, 7849400	Standard	NM_001493		Approved	RABGDIA, XAP-4, OPHN2, FLJ41411	uc004fli.4	P31150	OTTHUMG00000033293	ENST00000447750.2:c.193T>C	X.37:g.153667150T>C	ENSP00000394071:p.Ser65Pro	47	0		41	7	NM_001493	P50394|Q6FG50|Q7Z2G6|Q7Z2G9|Q7Z2H5|Q7Z2I6	Missense_Mutation	SNP	ENST00000447750.2	37	CCDS35452.1	.	.	.	.	.	.	.	.	.	.	T	13.83	2.355165	0.41700	.	.	ENSG00000203879	ENST00000447750;ENST00000369741	D	0.86366	-2.11	4.82	-1.65	0.08291	.	0.497516	0.19865	N	0.104326	T	0.78842	0.4347	L	0.48986	1.54	0.25255	N	0.989641	B;B	0.15719	0.014;0.007	B;B	0.21151	0.031;0.033	T	0.65446	-0.6166	10	0.44086	T	0.13	-12.1872	4.4719	0.11717	0.445:0.0:0.1452:0.4098	.	65;65	B4DH24;P31150	.;GDIA_HUMAN	P	65	ENSP00000394071:S65P	ENSP00000358756:S65P	S	+	1	0	GDI1	153320344	0.998000	0.40836	0.172000	0.22920	0.871000	0.50021	1.047000	0.30367	-0.216000	0.10048	0.486000	0.48141	TCG	.		0.572	GDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081649.2	NM_001493	
LINC00886	730091	hgsc.bcm.edu;bcgsc.ca	37	3	156527661	156527661	+	lincRNA	SNP	C	C	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr3:156527661C>A	ENST00000472943.1	-	0	148					NR_038387.1				long intergenic non-protein coding RNA 886																		TCTGAGCCTTCTTCTCATCTT	0.433																																					.		.											.	.	.	0			.						.																																					647033	.			AGCCTTCTTCTCA			3q25.31	2013-05-17			ENSG00000240875	ENSG00000240875		"""Long non-coding RNAs"""	48572	non-coding RNA	RNA, long non-coding							Standard	NR_038387		Approved				OTTHUMG00000158647		3.37:g.156527661C>A		72	0		49	4	.		RNA	SNP	ENST00000472943.1	37																																																																																				.		0.433	LINC00886-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000351622.1		
DCLK1	9201	hgsc.bcm.edu	37	13	36686146	36686146	+	Missense_Mutation	SNP	C	C	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr13:36686146C>T	ENST00000360631.3	-	3	794	c.583G>A	c.(583-585)Gtg>Atg	p.V195M	DCLK1_ENST00000255448.4_Missense_Mutation_p.V195M|DCLK1_ENST00000379892.4_Missense_Mutation_p.V195M			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	195	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.V195M(2)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		CGTGGCTTCACGCCACTTCTG	0.527																																					p.V195M		.											DCLK1_ENST00000255448,NS,carcinoma,0,2	DCLK1_ENST00000255448	0	2	Substitution - Missense(2)	endometrium(2)	c.G583A						.						172.0	154.0	160.0					13																	36686146		2203	4300	6503	SO:0001583	missense	9201	exon3			GCTTCACGCCACT	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.583G>A	13.37:g.36686146C>T	ENSP00000353846:p.Val195Met	30	0		30	2	NM_004734	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	ENST00000360631.3	37		.	.	.	.	.	.	.	.	.	.	C	21.8	4.200854	0.79015	.	.	ENSG00000133083	ENST00000255448;ENST00000360631;ENST00000539451;ENST00000379892	D;D;D	0.93426	-3.22;-3.22;-3.22	5.55	5.55	0.83447	.	0.058710	0.64402	D	0.000002	D	0.94374	0.8191	M	0.70275	2.135	0.80722	D	1	D	0.53745	0.962	P	0.47673	0.554	D	0.94624	0.7816	10	0.66056	D	0.02	.	19.8703	0.96847	0.0:1.0:0.0:0.0	.	195	O15075-2	.	M	195	ENSP00000255448:V195M;ENSP00000353846:V195M;ENSP00000369222:V195M	ENSP00000255448:V195M	V	-	1	0	DCLK1	35584146	1.000000	0.71417	0.995000	0.50966	0.958000	0.62258	4.724000	0.61972	2.770000	0.95276	0.650000	0.86243	GTG	.		0.527	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
ARID1A	8289	broad.mit.edu;bcgsc.ca	37	1	27101384	27101394	+	Frame_Shift_Del	DEL	GGTCCCTCTGC	GGTCCCTCTGC	-			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr1:27101384_27101394delGGTCCCTCTGC	ENST00000324856.7	+	18	5037_5047	c.4666_4676delGGTCCCTCTGC	c.(4666-4677)ggtccctctgccfs	p.GPSA1556fs	ARID1A_ENST00000457599.2_Intron|ARID1A_ENST00000540690.1_Intron|ARID1A_ENST00000374152.2_Frame_Shift_Del_p.GPSA1173fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1556					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GCCCCCATATGGTCCCTCTGCCCCTGTGCCC	0.602			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.1556_1559del				Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	0			c.4666_4676del						.																																			SO:0001589	frameshift_variant	8289	exon18			CCATATGGTCCCT	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.4666_4676delGGTCCCTCTGC	1.37:g.27101384_27101394delGGTCCCTCTGC	ENSP00000320485:p.Gly1556fs	48	0		25	8	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Del	DEL	ENST00000324856.7	37	CCDS285.1																																																																																			.		0.602	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
FAM72A	729533	broad.mit.edu	37	1	206145504	206145504	+	Missense_Mutation	SNP	T	T	C			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr1:206145504T>C	ENST00000367128.3	+	3	1129	c.281T>C	c.(280-282)cTt>cCt	p.L94P	FAM72A_ENST00000470041.1_3'UTR|FAM72A_ENST00000367129.2_Missense_Mutation_p.L94P|FAM72A_ENST00000341209.5_Missense_Mutation_p.L54P			Q5TYM5	FA72A_HUMAN	family with sequence similarity 72, member A	94						mitochondrion (GO:0005739)		p.L94P(1)		endometrium(2)	2						TCCTGTCTTCTTTCCTGCAAC	0.383																																					p.L94P													FAM72A,NS,carcinoma,0,1	FAM72A	9	1	Substitution - Missense(1)	endometrium(1)	c.T281C						.						244.0	204.0	216.0					1																	206145504		1568	3578	5146	SO:0001583	missense	729533	exon3			GTCTTCTTTCCTG	CR407567	CCDS73016.1	1q32.1	2008-03-26			ENSG00000196550	ENSG00000196550			24044	protein-coding gene	gene with protein product		614710				12477932	Standard	NM_001123168		Approved	MGC57827, RP11-312O7.1	uc001hdr.4	Q5TYM5	OTTHUMG00000042552	ENST00000367128.3:c.281T>C	1.37:g.206145504T>C	ENSP00000356096:p.Leu94Pro	162	1		193	6	NM_001123168	B2RV15|Q5TYM4	Missense_Mutation	SNP	ENST00000367128.3	37	CCDS41458.1	.	.	.	.	.	.	.	.	.	.	T	15.28	2.785677	0.49997	.	.	ENSG00000196550	ENST00000367129;ENST00000367128;ENST00000341209	T;T;T	0.33654	1.4;1.4;1.4	3.07	3.07	0.35406	.	0.000000	0.64402	U	0.000003	T	0.40595	0.1123	M	0.65975	2.015	0.80722	D	1	D	0.54207	0.965	P	0.47981	0.563	T	0.31052	-0.9957	10	0.35671	T	0.21	.	10.6623	0.45708	0.0:0.0:0.0:1.0	.	94	Q5TYM5	FA72A_HUMAN	P	94;94;54	ENSP00000356097:L94P;ENSP00000356096:L94P;ENSP00000340661:L54P	ENSP00000340661:L54P	L	+	2	0	FAM72A	204312127	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	5.652000	0.67959	1.399000	0.46721	0.254000	0.18369	CTT	.		0.383	FAM72A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100825.1		
TBATA	219793	broad.mit.edu	37	10	72541754	72541754	+	Missense_Mutation	SNP	C	C	T	rs200788611		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr10:72541754C>T	ENST00000299290.1	-	4	469	c.80G>A	c.(79-81)cGc>cAc	p.R27H	TBATA_ENST00000545575.1_Missense_Mutation_p.R17H|TBATA_ENST00000456372.2_Missense_Mutation_p.R27H	NM_152710.2	NP_689923	Q96M53	TBATA_HUMAN	thymus, brain and testes associated	27					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|nucleus (GO:0005634)											CCTTGGCTTGCGCCCTGACTT	0.592																																					p.R27H													C10orf27,NS,carcinoma,-1,2	.	.	0			c.G80A						.						73.0	77.0	75.0					10																	72541754		2203	4300	6503	SO:0001583	missense	219793	exon4			GGCTTGCGCCCTG	AK057382	CCDS7308.1	10q22.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166220	ENSG00000166220			23511	protein-coding gene	gene with protein product		612640	"""chromosome 10 open reading frame 27"""	C10orf27		20937703	Standard	NM_152710		Approved	FLJ32820, spatial	uc001jrj.1	Q96M53	OTTHUMG00000018413	ENST00000299290.1:c.80G>A	10.37:g.72541754C>T	ENSP00000299290:p.Arg27His	29	0		41	4	NM_152710	A4QPA8|B2RPQ2|Q5T4G2	Missense_Mutation	SNP	ENST00000299290.1	37	CCDS7308.1	.	.	.	.	.	.	.	.	.	.	c	1.001	-0.691041	0.03303	.	.	ENSG00000166220	ENST00000299290;ENST00000536955;ENST00000456372;ENST00000545575	T	0.42513	0.97	5.16	-10.3	0.00346	.	2.595140	0.00973	N	0.003262	T	0.09113	0.0225	N	0.00347	-1.61	0.09310	N	1	B;B;B;B;B;B	0.10296	0.002;0.003;0.001;0.001;0.001;0.001	B;B;B;B;B;B	0.06405	0.001;0.002;0.001;0.0;0.001;0.0	T	0.35450	-0.9788	10	0.29301	T	0.29	0.8149	2.1381	0.03768	0.1711:0.2167:0.3799:0.2324	.	16;16;27;27;17;27	B7Z8D7;B7Z8G0;B7ZMN4;B7ZMN5;B7Z8I8;Q96M53	.;.;.;.;.;SPATL_HUMAN	H	27;14;27;17	ENSP00000299290:R27H	ENSP00000299290:R27H	R	-	2	0	C10orf27	72211760	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.368000	0.02580	-2.434000	0.00554	-2.674000	0.00144	CGC	.		0.592	TBATA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048519.1	NM_152710	
OR51I1	390063	broad.mit.edu	37	11	5462013	5462013	+	Missense_Mutation	SNP	C	C	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr11:5462013C>A	ENST00000380211.1	-	1	731	c.732G>T	c.(730-732)atG>atT	p.M244I	HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron|AC104389.28_ENST00000415970.1_RNA	NM_001005288.2	NP_001005288.1	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I, member 1	244					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGATGTGTGACATGCAGGTGT	0.493																																					p.M244I													.	OR51I1	66	0			c.G732T						.						108.0	93.0	98.0					11																	5462013		2201	4297	6498	SO:0001583	missense	390063	exon1			GTGTGACATGCAG	BK004429	CCDS31382.1	11p15.4	2012-08-09			ENSG00000167359	ENSG00000167359		"""GPCR / Class A : Olfactory receptors"""	15200	protein-coding gene	gene with protein product							Standard	NM_001005288		Approved		uc010qze.2	Q9H343	OTTHUMG00000066908	ENST00000380211.1:c.732G>T	11.37:g.5462013C>A	ENSP00000369559:p.Met244Ile	14	0		14	6	NM_001005288	B9EKW2|Q6IF33	Missense_Mutation	SNP	ENST00000380211.1	37	CCDS31382.1	.	.	.	.	.	.	.	.	.	.	C	8.429	0.848178	0.17034	.	.	ENSG00000167359	ENST00000321307;ENST00000380211	T	0.35605	1.3	5.47	0.897	0.19258	GPCR, rhodopsin-like superfamily (1);	0.279428	0.31601	N	0.007371	T	0.07954	0.0199	N	0.00583	-1.355	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21965	-1.0230	10	0.32370	T	0.25	.	1.4574	0.02388	0.218:0.3689:0.2472:0.1659	.	244	Q9H343	O51I1_HUMAN	I	241;244	ENSP00000369559:M244I	ENSP00000439622:M241I	M	-	3	0	OR51I1	5418589	0.000000	0.05858	0.998000	0.56505	0.909000	0.53808	-0.387000	0.07361	0.644000	0.30656	0.551000	0.68910	ATG	.		0.493	OR51I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143399.1	NM_001005288	
HERC2P2	400322	broad.mit.edu	37	15	23283078	23283078	+	RNA	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr15:23283078G>A	ENST00000560464.1	-	0	5172									hect domain and RLD 2 pseudogene 2																		AGTCTTCACCGCCTTTCTTCA	0.542																																					.													.	.	.	0			.						.																																					0	.			TTCACCGCCTTTC	AF041080		15q11.2	2014-03-18			ENSG00000140181				4870	pseudogene	pseudogene						9730612	Standard	NR_002824		Approved	D15F37S3	uc001yvq.2		OTTHUMG00000171926		15.37:g.23283078G>A		41	1		59	11	.		RNA	SNP	ENST00000560464.1	37																																																																																				.		0.542	HERC2P2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000415936.1		
WASH3P	374666	broad.mit.edu	37	15	102506815	102506816	+	RNA	DEL	CC	CC	-	rs151176585		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr15:102506815_102506816delCC	ENST00000557932.1	+	0	172							C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						tacctctccacctggagcgcac	0.421																																					.													.	WASH3P	56	0			.						.																																					0	.			TCTCCACCTGGAG			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102506815_102506816delCC		69	7		75	17	.		RNA	DEL	ENST00000557932.1	37																																																																																				CC|0.500;-|0.500		0.421	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417608.1	NM_199163	
NPIPB6	728741	broad.mit.edu	37	16	28354442	28354442	+	Missense_Mutation	SNP	T	T	G			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr16:28354442T>G	ENST00000532254.1	-	7	1449	c.764A>C	c.(763-765)gAa>gCa	p.E255A	NPIPB6_ENST00000533640.1_Missense_Mutation_p.E237A	NM_001282524.1	NP_001269453.1	E9PJ23	NPIB6_HUMAN	nuclear pore complex interacting protein family, member B6	255																	TTTTAAAGTTTCAGCTGTGAG	0.502																																					.													.	.	.	0			.						.																																			SO:0001583	missense	728741	.			AAAGTTTCAGCTG		CCDS61892.1	16p11.2	2013-06-11			ENSG00000198156	ENSG00000198156			37454	protein-coding gene	gene with protein product							Standard	XM_005255741		Approved			E9PJ23	OTTHUMG00000166319	ENST00000532254.1:c.764A>C	16.37:g.28354442T>G	ENSP00000431871:p.Glu255Ala	36	0		56	20	.		Missense_Mutation	SNP	ENST00000532254.1	37		.	.	.	.	.	.	.	.	.	.	-	10.14	1.267977	0.23136	.	.	ENSG00000198156	ENST00000533640;ENST00000532254	T;T	0.58940	0.3;0.3	0.167	0.167	0.15006	.	.	.	.	.	T	0.66005	0.2746	L	0.51422	1.61	0.09310	N	1	D;D	0.76494	0.997;0.999	D;D	0.87578	0.994;0.998	T	0.53872	-0.8377	8	0.87932	D	0	.	.	.	.	.	255;237	E9PJ23;E9PS57	.;.	A	237;255	ENSP00000435924:E237A;ENSP00000431871:E255A	ENSP00000431871:E255A	E	-	2	0	RP11-57A19.3	28261943	0.001000	0.12720	0.015000	0.15790	0.016000	0.09150	-0.218000	0.09240	0.237000	0.21200	0.234000	0.17832	GAA	.		0.502	NPIPB6-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389133.1	XM_001717652	
NPIPB11	728888	broad.mit.edu	37	16	29415043	29415043	+	Silent	SNP	G	G	A	rs62035609		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr16:29415043G>A	ENST00000524087.1	-	2	155	c.81C>T	c.(79-81)caC>caT	p.H27H	SNX29P2_ENST00000398878.3_lincRNA			E5RHQ5	NPB11_HUMAN	nuclear pore complex interacting protein family, member B11	27						integral component of membrane (GO:0016021)		p.H27H(24)									CTGACTTTACGTGCTGCTGCA	0.577																																					.													RP11-231C14.2_ENST00000524087,bladder,carcinoma,0,28	.	.	24	Substitution - coding silent(24)	endometrium(22)|kidney(2)	.						.																																			SO:0001819	synonymous_variant	728888	.			CTTTACGTGCTGC			16p11.2	2013-06-11			ENSG00000254206	ENSG00000254206			37453	protein-coding gene	gene with protein product							Standard	XM_006721110		Approved			E5RHQ5	OTTHUMG00000170467	ENST00000524087.1:c.81C>T	16.37:g.29415043G>A		119	1		190	6	.		Silent	SNP	ENST00000524087.1	37																																																																																				G|0.500;A|0.500		0.577	NPIPB11-001	PUTATIVE	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000374094.1	XM_002343430	
HSP90AB2P	391634	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	13339698	13339698	+	RNA	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr4:13339698G>T	ENST00000602906.1	+	0	1049							Q58FF8	H90B2_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 2, pseudogene						protein folding (GO:0006457)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			kidney(3)|lung(1)	4						GGAAGAGCCTGGTCTCAGTTA	0.522																																					.													.	.	.	0			.						.																																					0	.			GAGCCTGGTCTCA	AY956763		4p15.33	2012-04-18	2011-04-15		ENSG00000205940	ENSG00000205940			32537	pseudogene	pseudogene			"""heat shock protein 90kDa alpha (cytosolic), class B member 2 (pseudogene)"""			16269234	Standard	NG_032979		Approved	HSP90BB		Q58FF8			4.37:g.13339698G>T		38	0		79	29	.		RNA	SNP	ENST00000602906.1	37																																																																																				.		0.522	HSP90AB2P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000359156.2		
BOD1L1	259282	broad.mit.edu	37	4	13602293	13602293	+	Silent	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr4:13602293G>T	ENST00000040738.5	-	10	6366	c.6231C>A	c.(6229-6231)acC>acA	p.T2077T		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2077						nucleus (GO:0005634)	DNA binding (GO:0003677)										AATCATTTGTGGTACTGGTGG	0.428																																					p.T2077T													.	.	.	0			c.C6231A						.						83.0	82.0	82.0					4																	13602293		2203	4300	6503	SO:0001819	synonymous_variant	259282	exon10			ATTTGTGGTACTG	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.6231C>A	4.37:g.13602293G>T		38	0		46	3	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	ENST00000040738.5	37	CCDS3411.2																																																																																			.		0.428	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
GUSBP1	728411	broad.mit.edu	37	5	21490969	21490970	+	RNA	DEL	TT	TT	-			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr5:21490969_21490970delTT	ENST00000607545.1	+	0	179					NR_027026.1		Q15486	GUSP1_HUMAN	glucuronidase, beta pseudogene 1						carbohydrate metabolic process (GO:0005975)|nervous system development (GO:0007399)|skeletal system development (GO:0001501)		hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)										aaaaaaaaaattaaaaaattaa	0.515																																					.													.	.	.	0			.						.																																					0	.			AAAAAATTAAAAA	BC064850, X75940		5p14.3	2012-10-04			ENSG00000183666	ENSG00000183666			13670	pseudogene	pseudogene						8565635	Standard	NR_027026		Approved		uc010iub.3	Q15486	OTTHUMG00000162474		5.37:g.21490969_21490970delTT		5	0		20	8	.	A6NLY8|A8K1B7|Q969T8|Q9BUH2	RNA	DEL	ENST00000607545.1	37																																																																																				.		0.515	GUSBP1-006	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000470546.1	NG_008324	
PKHD1	5314	broad.mit.edu;bcgsc.ca	37	6	51890257	51890257	+	Missense_Mutation	SNP	G	G	C			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr6:51890257G>C	ENST00000371117.3	-	32	4626	c.4351C>G	c.(4351-4353)Ccc>Gcc	p.P1451A	PKHD1_ENST00000340994.4_Missense_Mutation_p.P1451A	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1451	IPT/TIG 9.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CCAGGCAAGGGGTCACCCTCC	0.532																																					p.P1451A													.	PKHD1	927	0			c.C4351G						.						67.0	70.0	69.0					6																	51890257		2203	4300	6503	SO:0001583	missense	5314	exon32			GCAAGGGGTCACC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.4351C>G	6.37:g.51890257G>C	ENSP00000360158:p.Pro1451Ala	32	0		34	10	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	G	1.229	-0.624794	0.03636	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.87029	-2.0;-2.2	5.87	0.858	0.19030	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.682577	0.14712	N	0.302910	T	0.64271	0.2583	L	0.51422	1.61	0.09310	N	1	B;B	0.27013	0.081;0.166	B;B	0.28916	0.05;0.096	T	0.55153	-0.8185	10	0.07644	T	0.81	.	9.0561	0.36405	0.4582:0.0:0.5418:0.0	.	1451;1451	P08F94-2;P08F94	.;PKHD1_HUMAN	A	1451	ENSP00000360158:P1451A;ENSP00000341097:P1451A	ENSP00000341097:P1451A	P	-	1	0	PKHD1	51998216	0.033000	0.19621	0.191000	0.23289	0.318000	0.28184	0.891000	0.28309	0.065000	0.16485	-0.136000	0.14681	CCC	.		0.532	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
ZNF12	7559	broad.mit.edu	37	7	6731408	6731408	+	Frame_Shift_Del	DEL	T	T	-			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr7:6731408delT	ENST00000405858.1	-	5	1706	c.1165delA	c.(1165-1167)accfs	p.T389fs	ZNF12_ENST00000404360.1_Frame_Shift_Del_p.T315fs|AC073343.2_ENST00000577401.1_RNA|ZNF12_ENST00000342651.5_Frame_Shift_Del_p.T351fs|AC073343.13_ENST00000366167.2_RNA	NM_006956.2|NM_016265.3	NP_008887.2|NP_057349.2	P17014	ZNF12_HUMAN	zinc finger protein 12	389					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(3)	16		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		TGCGAGAAGGTTTTCCCACAG	0.428																																					p.T389fs													.	ZNF12	53	0			c.1165delA						.						69.0	70.0	70.0					7																	6731408		2102	4252	6354	SO:0001589	frameshift_variant	7559	exon5			AGAAGGTTTTCCC	X52334, AB021643	CCDS47538.1, CCDS47539.1	7p21.1	2013-01-08	2005-06-09		ENSG00000164631	ENSG00000164631		"""Zinc fingers, C2H2-type"", ""-"""	12902	protein-coding gene	gene with protein product		194536	"""zinc finger protein 325"""	ZNF325			Standard	NM_016265		Approved	KOX3, GIOT-3	uc003sqt.1	P17014	OTTHUMG00000151910	ENST00000405858.1:c.1165delA	7.37:g.6731408delT	ENSP00000385939:p.Thr389fs	26	0		6	2	NM_016265	A8MYC4|A8WFQ8|B2RNQ7|B4DF45|Q6N016|Q8NHZ0|Q9H9P0|Q9ULZ6	Frame_Shift_Del	DEL	ENST00000405858.1	37	CCDS47538.1																																																																																			.		0.428	ZNF12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324373.2	NM_016265	
INTS8	55656	broad.mit.edu	37	8	95841228	95841228	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr8:95841228G>T	ENST00000523731.1	+	5	677	c.544G>T	c.(544-546)Gag>Tag	p.E182*	INTS8_ENST00000447247.1_Nonsense_Mutation_p.E182*	NM_017864.2	NP_060334.2	Q75QN2	INT8_HUMAN	integrator complex subunit 8	182					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(3)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	28	Breast(36;1.05e-06)					ACAGGAAAAAGAGCTAACAGA	0.328																																					p.E182X													.	INTS8	92	0			c.G544T						.						115.0	108.0	111.0					8																	95841228		2202	4300	6502	SO:0001587	stop_gained	55656	exon5			GAAAAAGAGCTAA	AK091278	CCDS34925.1	8q22.1	2007-05-03	2006-03-15	2006-03-15	ENSG00000164941	ENSG00000164941			26048	protein-coding gene	gene with protein product		611351	"""chromosome 8 open reading frame 52"""	C8orf52		16239144	Standard	NM_017864		Approved	FLJ20530, INT8, MGC131633	uc003yhb.4	Q75QN2	OTTHUMG00000164695	ENST00000523731.1:c.544G>T	8.37:g.95841228G>T	ENSP00000430338:p.Glu182*	29	0		37	3	NM_017864	B2RN92|Q5RKZ3|Q6P1R5|Q7Z314|Q9NVS6|Q9NWY7	Nonsense_Mutation	SNP	ENST00000523731.1	37	CCDS34925.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	36|36|36	5.900314|5.900314|5.900314	0.97081|0.97081|0.97081	.|.|.	.|.|.	ENSG00000164941|ENSG00000164941|ENSG00000164941	ENST00000522171;ENST00000519457;ENST00000519053;ENST00000523731;ENST00000447247|ENST00000520526|ENST00000521860	.|.|.	.|.|.	.|.|.	5.06|5.06|5.06	5.06|5.06|5.06	0.68205|0.68205|0.68205	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	.|T|T	.|0.73814|0.73814	.|0.3635|0.3635	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	A|A|A	1|1|1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|T|T	.|0.73353|0.73353	.|-0.4009|-0.4009	.|4|3	0.33141|0.87932|.	T|D|.	0.24|0|.	-19.9848|-19.9848|-19.9848	17.7762|17.7762|17.7762	0.88508|0.88508|0.88508	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|.|.	.|.|.	.|.|.	X|N|I	141;135;73;182;182|3|169	.|.|.	ENSP00000343274:E182X|ENSP00000430180:K3N|.	E|K|R	+|+|+	1|3|2	0|2|0	INTS8|INTS8|INTS8	95910404|95910404|95910404	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.998000|0.998000|0.998000	0.56505|0.56505|0.56505	0.984000|0.984000|0.984000	0.73092|0.73092|0.73092	6.819000|6.819000|6.819000	0.75262|0.75262|0.75262	2.499000|2.499000|2.499000	0.84300|0.84300|0.84300	0.467000|0.467000|0.467000	0.42956|0.42956|0.42956	GAG|AAG|AGA	.		0.328	INTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379794.1	NM_017864	
GLIS3	169792	broad.mit.edu	37	9	4118102	4118102	+	Frame_Shift_Del	DEL	G	G	-			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr9:4118102delG	ENST00000324333.10	-	3	1104	c.911delC	c.(910-912)ccafs	p.P306fs	GLIS3_ENST00000381971.3_Frame_Shift_Del_p.P461fs	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	306	Pro-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		GTAAgggggtggggggcctgg	0.731																																					p.P459fs													.	GLIS3	152	0			c.1376delC						.						9.0	12.0	11.0					9																	4118102		1889	3860	5749	SO:0001589	frameshift_variant	169792	exon4			GGGGGTGGGGGGC	BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.911delC	9.37:g.4118102delG	ENSP00000325494:p.Pro306fs	10	0		7	2	NM_001042413	B1AL19|Q1PHK5	Frame_Shift_Del	DEL	ENST00000324333.10	37	CCDS6451.1																																																																																			.		0.731	GLIS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051559.1	NM_152629	
MT-CYB	4519	broad.mit.edu	37	M	14783	14783	+	Silent	SNP	T	T	C			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chrM:14783T>C	ENST00000361789.2	+	1	37	c.37T>C	c.(37-39)Tta>Cta	p.L13L	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	13					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CCCTAATAAAATTAATTAACC	0.448																																					p.L13L													.	.	.	0			c.T37C						.																																			SO:0001819	synonymous_variant	4519	exon1			ATAAAATTAATTA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.37T>C	M.37:g.14783T>C		275	0		733	5	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	37																																																																																				.		0.448	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
PNPLA4	8228	broad.mit.edu	37	X	7868821	7868821	+	Missense_Mutation	SNP	A	A	G			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chrX:7868821A>G	ENST00000381042.4	-	7	838	c.668T>C	c.(667-669)cTt>cCt	p.L223P	PNPLA4_ENST00000537427.1_Missense_Mutation_p.L136P|PNPLA4_ENST00000444736.1_Missense_Mutation_p.L223P	NM_004650.2	NP_004641.1	P41247	PLPL4_HUMAN	patatin-like phospholipase domain containing 4	223					lipid catabolic process (GO:0016042)		triglyceride lipase activity (GO:0004806)			kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)				TGGGGGAAAAAGGGCTTGGTT	0.353																																					p.L223P													.	PNPLA4	24	0			c.T668C						.						57.0	52.0	54.0					X																	7868821		2203	4299	6502	SO:0001583	missense	8228	exon7			GGAAAAAGGGCTT	U03886	CCDS14129.1, CCDS55368.1	Xp22.3	2014-03-14			ENSG00000006757	ENSG00000006757	3.1.1.3	"""Patatin-like phospholipase domain containing"""	24887	protein-coding gene	gene with protein product		300102				7806223, 16799181, 19029121	Standard	NM_004650		Approved	DXS1283E, GS2, iPLA2eta	uc011mhr.1	P41247	OTTHUMG00000021103	ENST00000381042.4:c.668T>C	X.37:g.7868821A>G	ENSP00000370430:p.Leu223Pro	313	1		309	4	NM_004650	A8K1H3|B4E362|Q8WW83	Missense_Mutation	SNP	ENST00000381042.4	37	CCDS14129.1	.	.	.	.	.	.	.	.	.	.	A	13.79	2.341460	0.41498	.	.	ENSG00000006757	ENST00000381042;ENST00000444736;ENST00000537427	T;T;T	0.81078	-1.45;-1.45;-1.45	4.38	4.38	0.52667	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.193685	0.33127	N	0.005243	D	0.89866	0.6839	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.90635	0.4570	10	0.87932	D	0	-22.634	9.3053	0.37872	1.0:0.0:0.0:0.0	.	223	P41247	PLPL4_HUMAN	P	223;223;136	ENSP00000370430:L223P;ENSP00000415245:L223P;ENSP00000443157:L136P	ENSP00000370430:L223P	L	-	2	0	PNPLA4	7828821	1.000000	0.71417	0.139000	0.22197	0.388000	0.30384	5.486000	0.66856	1.452000	0.47756	0.481000	0.45027	CTT	.		0.353	PNPLA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055687.1	NM_004650	
PRICKLE3	4007	broad.mit.edu	37	X	49034449	49034449	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chrX:49034449G>T	ENST00000376317.3	-	7	942	c.848C>A	c.(847-849)gCt>gAt	p.A283D	PRICKLE3_ENST00000540849.1_Missense_Mutation_p.A215D|PRICKLE3_ENST00000536904.1_Missense_Mutation_p.A202D|PRICKLE3_ENST00000538114.1_Intron	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)	283	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.						zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						TCCTAGTGAAGCTTCACACTC	0.632																																					p.A283D													.	PRICKLE3	59	0			c.C848A						.						58.0	50.0	53.0					X																	49034449		2202	4299	6501	SO:0001583	missense	4007	exon7			AGTGAAGCTTCAC	BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.848C>A	X.37:g.49034449G>T	ENSP00000365494:p.Ala283Asp	36	0		34	3	NM_006150	B7Z8F2|O76007|Q53XR5	Missense_Mutation	SNP	ENST00000376317.3	37	CCDS14320.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.09|12.09	1.834845|1.834845	0.32421|0.32421	.|.	.|.	ENSG00000012211|ENSG00000012211	ENST00000376317;ENST00000536904;ENST00000540849|ENST00000453382;ENST00000432913	D;D;D|.	0.87334|.	-2.24;-2.24;-2.24|.	4.67|4.67	3.76|3.76	0.43208|0.43208	Zinc finger, LIM-type (5);|.	0.000000|.	0.38005|.	N|.	0.001850|.	T|T	0.42337|0.42337	0.1198|0.1198	N|N	0.21583|0.21583	0.68|0.68	0.43683|0.43683	D|D	0.996125|0.996125	B;B;B;P|.	0.35527|.	0.153;0.392;0.153;0.507|.	B;B;B;B|.	0.39590|.	0.18;0.18;0.18;0.304|.	T|T	0.19811|0.19811	-1.0294|-1.0294	10|5	0.19590|.	T|.	0.45|.	-13.2703|-13.2703	9.4562|9.4562	0.38756|0.38756	0.0:0.352:0.6479:0.0|0.0:0.352:0.6479:0.0	.|.	283;245;202;283|.	B2RBS3;B7Z6S4;B7Z8F2;O43900|.	.;.;.;PRIC3_HUMAN|.	D|R	283;202;215|295;293	ENSP00000365494:A283D;ENSP00000441385:A202D;ENSP00000446051:A215D|.	ENSP00000365494:A283D|.	A|S	-|-	2|3	0|2	PRICKLE3|PRICKLE3	48921393|48921393	0.016000|0.016000	0.18221|0.18221	0.992000|0.992000	0.48379|0.48379	0.873000|0.873000	0.50193|0.50193	1.343000|1.343000	0.33930|0.33930	2.138000|2.138000	0.66242|0.66242	0.416000|0.416000	0.27883|0.27883	GCT|AGC	.		0.632	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060811.1	NM_006150	
NUDT10	170685	broad.mit.edu	37	X	51076024	51076024	+	Silent	SNP	G	G	A	rs143435240		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chrX:51076024G>A	ENST00000376006.3	+	2	427	c.207G>A	c.(205-207)gaG>gaA	p.E69E	NUDT10_ENST00000356450.2_Silent_p.E69E	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	234					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.E69E(8)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					TGTACGAAGAGGCGGGAGTCA	0.657																																					p.E69E	NSCLC(90;1817 2035 37909 38249)												.	NUDT10	28	8	Substitution - coding silent(8)	endometrium(5)|cervix(1)|prostate(1)|lung(1)	c.G207A						.						52.0	62.0	59.0					X																	51076024		2203	4300	6503	SO:0001819	synonymous_variant	170685	exon2			CGAAGAGGCGGGA	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.207G>A	X.37:g.51076024G>A		89	1		106	8	NM_153183	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																			.		0.657	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056578.1	NM_153183	
XIST	7503	broad.mit.edu	37	X	73065142	73065142	+	lincRNA	SNP	A	A	G			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chrX:73065142A>G	ENST00000429829.1	-	0	7446					NR_001564.2				X inactive specific transcript (non-protein coding)																		GGCCAGGAAAAGGGGCCTTGG	0.498																																					.													.	.	.	0			.						.						189.0	172.0	177.0					X																	73065142		876	1991	2867			0	.			AGGAAAAGGGGCC	M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73065142A>G		64	0		358	5	.		RNA	SNP	ENST00000429829.1	37																																																																																				.		0.498	XIST-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000057239.1	NR_001564	
HMGB3	3149	broad.mit.edu	37	X	150156360	150156360	+	Silent	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chrX:150156360G>A	ENST00000325307.7	+	5	672	c.576G>A	c.(574-576)gaG>gaA	p.E192E	HMGB3_ENST00000448905.2_Silent_p.E192E	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	192	Asp/Glu-rich (acidic).				DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)	p.E192E(1)		endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					aggaagaagaggaggaggagg	0.443																																					p.E192E													.	HMGB3	27	1	Substitution - coding silent(1)	large_intestine(1)	c.G576A						.						50.0	48.0	49.0					X																	150156360		2202	4299	6501	SO:0001819	synonymous_variant	3149	exon5			AGAAGAGGAGGAG	AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.576G>A	X.37:g.150156360G>A		27	0		32	3	NM_005342	O95556|Q6NS40	Silent	SNP	ENST00000325307.7	37	CCDS35428.1																																																																																			.		0.443	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060867.1	NM_005342	
ERVW-1	30816	ucsc.edu	37	7	92099233	92099233	+	Missense_Mutation	SNP	G	G	A	rs199552228		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr7:92099233G>A	ENST00000493463.2	-	1	1386	c.463C>T	c.(463-465)Cat>Tat	p.H155Y	ERVW-1_ENST00000604270.1_Intron|AC007566.10_ENST00000427458.1_RNA|ERVW-1_ENST00000603053.1_Missense_Mutation_p.H155Y	NM_014590.3	NP_055405.3	Q9UQF0	SYCY1_HUMAN	endogenous retrovirus group W, member 1	155					anatomical structure morphogenesis (GO:0009653)|syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)				endometrium(1)|large_intestine(1)|lung(15)	17						agggtttcatgtagttttgag	0.478																																					.													.	.	.	0			.						.						39.0	44.0	42.0					7																	92099233		2203	4298	6501	SO:0001583	missense	30816	.			TTTCATGTAGTTT	AF208161	CCDS5626.1	7q21.2	2011-06-16	2011-05-05	2011-05-05	ENSG00000242950	ENSG00000242950			13525	other	endogenous retrovirus	"""envelope protein"", ""HERV-W Env glycoprotein"", ""enverin"", ""syncytin-1"", ""HERV-tryptophan envelope protein"", ""HERV-W{7q21.1} provirus ancestral Env polyprotein"", ""HERV-7q envelope protein"", ""envelope glycoprotein"", ""syncytin"""	604659	"""endogenous retroviral family W, env(C7), member 1"""	ERVWE1		9835022, 9882319, 21542922	Standard	NM_001130925		Approved	HERV-W, HERV-W-ENV, HERVW, HERV-7q	uc022ahe.1	Q9UQF0	OTTHUMG00000131249	ENST00000493463.2:c.463C>T	7.37:g.92099233G>A	ENSP00000419945:p.His155Tyr	29	1		31	8	.	B2RPD4|O95244|O95245|Q8NHY7|Q9NRZ2|Q9NZG3	Missense_Mutation	SNP	ENST00000493463.2	37	CCDS5626.1	.	.	.	.	.	.	.	.	.	.	G	9.344	1.063783	0.20067	.	.	ENSG00000242950	ENST00000493463	T	0.17370	2.28	0.0465	0.0465	0.14256	.	.	.	.	.	T	0.12475	0.0303	N	0.22421	0.69	0.09310	N	1	.	.	.	.	.	.	T	0.31392	-0.9945	6	0.72032	D	0.01	.	.	.	.	.	.	.	.	Y	155	ENSP00000419945:H155Y	ENSP00000419945:H155Y	H	-	1	0	ERVW-1	91937169	0.358000	0.24947	0.328000	0.25416	0.329000	0.28539	0.170000	0.16663	0.132000	0.18615	0.134000	0.15878	CAT	.		0.478	ERVW-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254009.2	NM_014590	
PAFAH1B2	5049	ucsc.edu	37	11	117023206	117023206	+	Missense_Mutation	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr11:117023206G>A	ENST00000527958.1	+	2	202	c.43G>A	c.(43-45)Gca>Aca	p.A15T	PAFAH1B2_ENST00000419197.2_Missense_Mutation_p.A15T|PAFAH1B2_ENST00000530272.1_Missense_Mutation_p.A15T|PAFAH1B2_ENST00000529887.2_Missense_Mutation_p.A15T|PAFAH1B2_ENST00000526888.1_Intron	NM_002572.3	NP_002563.1	P68402	PA1B2_HUMAN	platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa)	15					brain development (GO:0007420)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|positive regulation of macroautophagy (GO:0016239)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)			kidney(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;1.68e-05)|Epithelial(105;0.000162)|all cancers(92;0.00111)		TCCGCATGCAGCAGAAGATAT	0.413			T	IGH@	MLCLS																																p.A15T				Dom	yes		11	11q23	5049	"""platelet-activating factor acetylhydrolase, isoform Ib, beta subunit 30kDa"""		L	.	PAFAH1B2	19	0			c.G43A						.						133.0	118.0	123.0					11																	117023206		2201	4296	6497	SO:0001583	missense	5049	exon2			CATGCAGCAGAAG	D63390	CCDS8380.1, CCDS53713.1, CCDS53714.1, CCDS53715.1	11q23	2011-10-24	2010-02-10			ENSG00000168092			8575	protein-coding gene	gene with protein product	"""PAF-AH1b alpha 2 subunit"""	602508	"""platelet-activating factor acetylhydrolase, isoform Ib, beta subunit 30kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 2 (30kDa)"""			9144386, 9693049	Standard	NM_002572		Approved		uc001pqe.2	P68402		ENST00000527958.1:c.43G>A	11.37:g.117023206G>A	ENSP00000435289:p.Ala15Thr	18	0		30	4	NM_001184747	A8DPS5|A8DPS6|A8DPS7|E9PEJ5|E9PLP3|O00687|Q29459|Q6IBR6	Missense_Mutation	SNP	ENST00000527958.1	37	CCDS8380.1	.	.	.	.	.	.	.	.	.	.	G	18.41	3.618971	0.66787	.	.	ENSG00000168092	ENST00000527958;ENST00000419197;ENST00000529887;ENST00000530272	T;T;T	0.43294	0.95;1.0;1.0	5.57	5.57	0.84162	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);	0.050656	0.85682	D	0.000000	T	0.36220	0.0959	L	0.36672	1.1	0.47819	D	0.999522	P;B;B	0.49961	0.93;0.283;0.175	B;B;B	0.40864	0.342;0.04;0.04	T	0.07328	-1.0778	10	0.22706	T	0.39	-10.7398	19.1523	0.93493	0.0:0.0:1.0:0.0	.	15;15;15	E9PLP3;A8DPS6;P68402	.;.;PA1B2_HUMAN	T	15	ENSP00000435289:A15T;ENSP00000388742:A15T;ENSP00000431365:A15T	ENSP00000388742:A15T	A	+	1	0	PAFAH1B2	116528416	0.995000	0.38212	0.996000	0.52242	0.986000	0.74619	4.420000	0.59841	2.620000	0.88729	0.655000	0.94253	GCA	.		0.413	PAFAH1B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392826.1	NM_002572	
CIT	11113	ucsc.edu	37	12	120172046	120172046	+	Silent	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr12:120172046G>A	ENST00000261833.7	-	25	3199	c.3147C>T	c.(3145-3147)gtC>gtT	p.V1049V	CIT_ENST00000537607.1_5'UTR|CIT_ENST00000392521.2_Silent_p.V1091V	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1049					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		CATCACCCAGGACGCTCCTCC	0.547																																					p.V1091V													.	CIT	535	0			c.C3273T						.						125.0	104.0	111.0					12																	120172046		2203	4300	6503	SO:0001819	synonymous_variant	11113	exon26			ACCCAGGACGCTC	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.3147C>T	12.37:g.120172046G>A		24	1		23	5	NM_001206999	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Silent	SNP	ENST00000261833.7	37	CCDS9192.1	.	.	.	.	.	.	.	.	.	.	G	3.252	-0.153050	0.06585	.	.	ENSG00000122966	ENST00000392520	.	.	.	5.35	3.27	0.37495	.	.	.	.	.	T	0.54886	0.1886	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50775	-0.8788	4	.	.	.	.	6.1573	0.20344	0.3467:0.0:0.6533:0.0	.	.	.	.	F	677	.	.	S	-	2	0	CIT	118656429	1.000000	0.71417	0.998000	0.56505	0.314000	0.28054	1.328000	0.33758	1.265000	0.44215	-0.373000	0.07131	TCC	.		0.547	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174	
GPR32	2854	ucsc.edu;bcgsc.ca	37	19	51274851	51274851	+	Missense_Mutation	SNP	A	A	C	rs201404376		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr19:51274851A>C	ENST00000270590.4	+	1	1131	c.994A>C	c.(994-996)Act>Cct	p.T332P		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	332					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CCAGTCTTTGACTTCTGCCCT	0.552																																					p.T332P	Esophageal Squamous(113;152 1581 5732 15840 44398)												GPR32,NS,carcinoma,0,5	GPR32	68	0			c.A994C						.						66.0	71.0	69.0					19																	51274851		2203	4298	6501	SO:0001583	missense	2854	exon1			TCTTTGACTTCTG	AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.994A>C	19.37:g.51274851A>C	ENSP00000270590:p.Thr332Pro	31	0		50	8	NM_001506	Q502U7|Q6NWS5	Missense_Mutation	SNP	ENST00000270590.4	37	CCDS12801.1	.	.	.	.	.	.	.	.	.	.	a	0.006	-2.066505	0.00382	.	.	ENSG00000142511	ENST00000270590	T	0.36699	1.24	2.71	-0.781	0.10965	.	.	.	.	.	T	0.12518	0.0304	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31138	-0.9954	9	0.02654	T	1	.	3.6506	0.08202	0.205:0.5623:0.0:0.2327	.	332	O75388	GPR32_HUMAN	P	332	ENSP00000270590:T332P	ENSP00000270590:T332P	T	+	1	0	GPR32	55966663	0.000000	0.05858	0.025000	0.17156	0.653000	0.38743	0.089000	0.15002	-0.262000	0.09392	-0.755000	0.03482	ACT	.		0.552	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465016.1		
SLC25A38P1	441915	bcgsc.ca	37	1	172718039	172718039	+	IGR	SNP	C	C	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr1:172718039C>A								FASLG (82025 upstream) : RP1-15D23.2 (27005 downstream)																							TTGGAATCTACTTTGGCACTC	0.537																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	441915	.			AATCTACTTTGGC																													1.37:g.172718039C>A		24	0		29	4	.		RNA	SNP		37																																																																																				.	0	0.537								
TANK	10010	bcgsc.ca	37	2	162081140	162081140	+	Splice_Site	SNP	A	A	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr2:162081140A>T	ENST00000392749.2	+	6	643		c.e6-1		TANK_ENST00000406287.1_Splice_Site|AC009299.2_ENST00000445372.1_RNA|TANK_ENST00000402568.1_Splice_Site|AC009299.2_ENST00000421122.2_RNA|TANK_ENST00000405852.1_Splice_Site|TANK_ENST00000259075.2_Splice_Site	NM_001199135.1	NP_001186064.1	Q92844	TANK_HUMAN	TRAF family member-associated NFKB activator						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)	21						TTTTTTTTTTAGGGGTAATAT	0.269																																					.													.	TANK	35	0			c.405-2A>T						.						32.0	35.0	34.0					2																	162081140		2162	4278	6440	SO:0001630	splice_region_variant	10010	exon6			TTTTTTAGGGGTA	U59863	CCDS2215.1, CCDS46436.1	2q24-q31	2008-02-05			ENSG00000136560	ENSG00000136560			11562	protein-coding gene	gene with protein product		603893		TRAF2		8710854, 8855313	Standard	NM_004180		Approved	I-TRAF	uc002ubr.2	Q92844	OTTHUMG00000132037	ENST00000392749.2:c.405-1A>T	2.37:g.162081140A>T		190	1		225	8	NM_004180	D3DPB5|Q7Z4J6|Q92885	Splice_Site	SNP	ENST00000392749.2	37	CCDS2215.1	.	.	.	.	.	.	.	.	.	.	A	12.78	2.039691	0.35989	.	.	ENSG00000136560	ENST00000259075;ENST00000432002;ENST00000392749;ENST00000429217;ENST00000406287;ENST00000402568;ENST00000405852;ENST00000456358;ENST00000437623	.	.	.	2.6	2.6	0.31112	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.4052	0.44252	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TANK	161789386	1.000000	0.71417	0.715000	0.30552	0.291000	0.27294	6.043000	0.71004	0.779000	0.33543	0.383000	0.25322	.	.		0.269	TANK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324232.1	NM_133484	Intron
LRRC73	221424	bcgsc.ca	37	6	43476117	43476117	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr6:43476117G>T	ENST00000372441.1	-	3	1375	c.475C>A	c.(475-477)Cct>Act	p.P159T		NM_001012974.1	NP_001012992.1	Q5JTD7	LRC73_HUMAN	leucine rich repeat containing 73	159																	CAGCCCTTAGGGGTGATGCCA	0.592																																					p.P159T													.	.	.	0			c.C475A						.						56.0	53.0	54.0					6																	43476117		2203	4300	6503	SO:0001583	missense	221424	exon3			CCTTAGGGGTGAT		CCDS34456.1	6p21.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000204052	ENSG00000204052			21375	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 154"""	C6orf154			Standard	NM_001012974		Approved	dJ337H4.2	uc003ovk.2	Q5JTD7	OTTHUMG00000014737	ENST00000372441.1:c.475C>A	6.37:g.43476117G>T	ENSP00000361518:p.Pro159Thr	54	0		53	4	NM_001012974		Missense_Mutation	SNP	ENST00000372441.1	37	CCDS34456.1	.	.	.	.	.	.	.	.	.	.	G	13.02	2.111531	0.37242	.	.	ENSG00000204052	ENST00000372441	T	0.52526	0.66	5.44	5.44	0.79542	.	0.315698	0.35646	N	0.003063	T	0.17450	0.0419	L	0.31476	0.935	0.35045	D	0.760107	B	0.23442	0.085	B	0.16722	0.016	T	0.07693	-1.0759	9	.	.	.	-7.0331	9.4854	0.38926	0.0:0.1429:0.6883:0.1687	.	159	Q5JTD7	CF154_HUMAN	T	159	ENSP00000361518:P159T	.	P	-	1	0	C6orf154	43584095	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.993000	0.29680	2.533000	0.85409	0.650000	0.86243	CCT	.		0.592	LRRC73-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040635.1	NM_001012974	
RPL23AP46	442260	bcgsc.ca	37	6	133319072	133319072	+	IGR	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr6:133319072G>A								RPS12 (180369 upstream) : LINC00326 (90146 downstream)																							TTTTTTGTGTGTATGTGGCTG	0.498																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	442260	.			TTGTGTGTATGTG																													6.37:g.133319072G>A		35	0		27	16	.		RNA	SNP		37																																																																																				.	0	0.498								
TSNARE1	203062	bcgsc.ca	37	8	143396383	143396383	+	Missense_Mutation	SNP	C	C	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr8:143396383C>A	ENST00000307180.3	-	8	1172	c.1055G>T	c.(1054-1056)tGc>tTc	p.C352F	TSNARE1_ENST00000519651.1_Missense_Mutation_p.C132F|TSNARE1_ENST00000524325.1_Missense_Mutation_p.C351F|TSNARE1_ENST00000520166.1_Missense_Mutation_p.C351F|TSNARE1_ENST00000518928.1_5'UTR	NM_145003.3	NP_659440.2	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	352					intracellular protein transport (GO:0006886)|synaptic vesicle exocytosis (GO:0016079)	integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			breast(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(6)|ovary(2)|stomach(2)|urinary_tract(1)	20	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CACTCCATAGCACTGAATGGC	0.632																																					p.C352F													.	TSNARE1	59	0			c.G1055T						.						131.0	93.0	106.0					8																	143396383		2203	4300	6503	SO:0001583	missense	203062	exon8			CCATAGCACTGAA			8q24.3	2005-08-18							26437	protein-coding gene	gene with protein product						14702039	Standard	XM_005250828		Approved	FLJ31164	uc003ywk.3	Q96NA8		ENST00000307180.3:c.1055G>T	8.37:g.143396383C>A	ENSP00000303437:p.Cys352Phe	22	0		19	3	NM_145003	B7ZLB0|Q14D03	Missense_Mutation	SNP	ENST00000307180.3	37	CCDS6384.1	.	.	.	.	.	.	.	.	.	.	C	2.182	-0.387411	0.04932	.	.	ENSG00000171045	ENST00000524325;ENST00000307180;ENST00000520166;ENST00000519651	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	4.21	0.298	0.15766	t-SNARE (1);	0.553031	0.13133	U	0.411276	T	0.17577	0.0422	N	0.22421	0.69	0.19300	N	0.999979	B;B;B;B	0.28055	0.171;0.199;0.171;0.171	B;B;B;B	0.23018	0.021;0.043;0.021;0.021	T	0.14504	-1.0470	10	0.56958	D	0.05	.	6.5624	0.22493	0.0:0.5587:0.0:0.4413	.	351;132;352;352	B7ZLB0;E5RHT3;Q96NA8;A0AVG3	.;.;TSNA1_HUMAN;.	F	351;352;351;132	ENSP00000428763:C351F;ENSP00000303437:C352F;ENSP00000427770:C351F;ENSP00000429679:C132F	ENSP00000303437:C352F	C	-	2	0	TSNARE1	143394290	0.001000	0.12720	0.004000	0.12327	0.018000	0.09664	0.132000	0.15891	-0.303000	0.08856	0.650000	0.86243	TGC	.		0.632	TSNARE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_145003	
GLIS3	169792	bcgsc.ca	37	9	4286193	4286193	+	Missense_Mutation	SNP	C	C	T	rs200195201		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr9:4286193C>T	ENST00000381971.3	-	2	826	c.233G>A	c.(232-234)cGc>cAc	p.R78H		NM_001042413.1	NP_001035878.1	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	312	Ser-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		CAGATGGATGCGGCTCTCAGC	0.567																																					p.R78H													.	GLIS3	152	0			c.G233A						.	C	HIS/ARG	1,4105		0,1,2052	74.0	79.0	77.0		233	2.9	0.9	9		77	0,8388		0,0,4194	no	missense	GLIS3	NM_001042413.1	29	0,1,6246	TT,TC,CC		0.0,0.0244,0.0080	benign	78/931	4286193	1,12493	2053	4194	6247	SO:0001583	missense	169792	exon2			TGGATGCGGCTCT	BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000381971.3:c.233G>A	9.37:g.4286193C>T	ENSP00000371398:p.Arg78His	27	0		28	4	NM_001042413	B1AL19|Q1PHK5	Missense_Mutation	SNP	ENST00000381971.3	37	CCDS43784.1	.	.	.	.	.	.	.	.	.	.	C	13.90	2.374006	0.42105	2.44E-4	0.0	ENSG00000107249	ENST00000381971;ENST00000477901;ENST00000481827	T	0.10192	2.9	5.75	2.92	0.33932	.	.	.	.	.	T	0.04227	0.0117	N	0.08118	0	0.09310	N	0.999991	B;P	0.35844	0.226;0.524	B;B	0.30855	0.004;0.121	T	0.38457	-0.9660	9	0.20046	T	0.44	.	4.9974	0.14247	0.1341:0.1175:0.628:0.1204	.	78;78	F8WEV9;Q8NEA6-2	.;.	H	78	ENSP00000371398:R78H	ENSP00000371398:R78H	R	-	2	0	GLIS3	4276193	1.000000	0.71417	0.909000	0.35828	0.980000	0.70556	2.079000	0.41577	0.791000	0.33826	-0.128000	0.14901	CGC	C|0.999;T|0.001		0.567	GLIS3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354776.1	NM_152629	
OR13D3P	402374	bcgsc.ca	37	9	107485385	107485385	+	IGR	SNP	C	C	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr9:107485385C>A								OR13D1 (27619 upstream) : NIPSNAP3A (24583 downstream)																							TCTTTTCATGCACATGAAGCC	0.408																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TTCATGCACATGA																													9.37:g.107485385C>A		39	0		36	4	.		RNA	SNP		37																																																																																				.	0	0.408								
GJD4	219770	bcgsc.ca	37	10	35897268	35897268	+	Missense_Mutation	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr10:35897268G>A	ENST00000321660.1	+	2	985	c.827G>A	c.(826-828)gGc>gAc	p.G276D	RP11-425A6.5_ENST00000609313.1_RNA	NM_153368.2	NP_699199.2	Q96KN9	CXD4_HUMAN	gap junction protein, delta 4, 40.1kDa	276					cell communication (GO:0007154)|regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014717)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						GAGGGGGCTGGCAGCCCCAGG	0.697																																					p.G276D													.	GJD4	38	0			c.G827A						.						10.0	11.0	11.0					10																	35897268		2119	4146	6265	SO:0001583	missense	219770	exon2			GGGCTGGCAGCCC	AJ414564	CCDS7191.1	10p11.22	2007-11-27			ENSG00000177291	ENSG00000177291		"""Ion channels / Gap junction proteins (connexins)"""	23296	protein-coding gene	gene with protein product	"""connexin 40.1"""	611922				12477932	Standard	NM_153368		Approved	CX40.1, FLJ90023	uc001iyy.1	Q96KN9	OTTHUMG00000017957	ENST00000321660.1:c.827G>A	10.37:g.35897268G>A	ENSP00000315070:p.Gly276Asp	50	0		55	4	NM_153368	Q8N2R7	Missense_Mutation	SNP	ENST00000321660.1	37	CCDS7191.1	.	.	.	.	.	.	.	.	.	.	G	3.932	-0.015906	0.07681	.	.	ENSG00000177291	ENST00000321660	D	0.97575	-4.44	4.87	1.01	0.19927	.	9.050420	0.00496	N	0.000147	D	0.90762	0.7100	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	D	0.85372	0.1114	10	0.11485	T	0.65	.	5.0171	0.14343	0.4823:0.4035:0.1142:0.0	.	276	Q96KN9	CXD4_HUMAN	D	276	ENSP00000315070:G276D	ENSP00000315070:G276D	G	+	2	0	GJD4	35937274	0.001000	0.12720	0.032000	0.17829	0.022000	0.10575	-0.739000	0.04866	-0.022000	0.13986	0.467000	0.42956	GGC	.		0.697	GJD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047576.1	NM_153368	
MUC6	4588	bcgsc.ca	37	11	1017363	1017363	+	Missense_Mutation	SNP	C	C	G	rs199783663		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr11:1017363C>G	ENST00000421673.2	-	31	5488	c.5438G>C	c.(5437-5439)gGt>gCt	p.G1813A		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1813	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGTGACAGGACCTGTGGAAGA	0.592																																					p.G1813A													.	MUC6	408	0			c.G5438C						.						800.0	792.0	795.0					11																	1017363		2202	4298	6500	SO:0001583	missense	4588	exon31			ACAGGACCTGTGG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5438G>C	11.37:g.1017363C>G	ENSP00000406861:p.Gly1813Ala	115	1		163	9	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	2.223	-0.377906	0.05000	.	.	ENSG00000184956	ENST00000421673	T	0.26223	1.75	3.21	1.11	0.20524	.	.	.	.	.	T	0.22513	0.0543	L	0.46741	1.465	0.09310	N	1	P	0.50272	0.933	P	0.50082	0.63	T	0.10800	-1.0614	9	0.07990	T	0.79	.	3.5014	0.07674	0.1733:0.553:0.1691:0.1047	.	1813	Q6W4X9	MUC6_HUMAN	A	1813	ENSP00000406861:G1813A	ENSP00000406861:G1813A	G	-	2	0	MUC6	1007363	0.000000	0.05858	0.002000	0.10522	0.026000	0.11368	-1.411000	0.02478	0.136000	0.18733	0.313000	0.20887	GGT	.		0.592	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC2	4583	bcgsc.ca	37	11	1092615	1092615	+	Silent	SNP	C	C	T	rs201595190		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr11:1092615C>T	ENST00000441003.2	+	30	4461	c.4434C>T	c.(4432-4434)agC>agT	p.S1478S	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Silent_p.S1479S|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4213	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccactcccagccctccaacca	0.637																																					p.S1478S													.	MUC2	614	0			c.C4434T						.						135.0	246.0	207.0					11																	1092615		1480	2775	4255	SO:0001819	synonymous_variant	4583	exon30			TCCCAGCCCTCCA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4434C>T	11.37:g.1092615C>T		211	9		250	19	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	bcgsc.ca	37	11	1093050	1093050	+	Silent	SNP	C	C	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr11:1093050C>A	ENST00000441003.2	+	30	4896	c.4869C>A	c.(4867-4869)ggC>ggA	p.G1623G	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Intron|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	cacccactggcacacagaccc	0.632																																					p.G1623G													.	MUC2	614	0			c.C4869A						.						129.0	166.0	153.0					11																	1093050		1883	3610	5493	SO:0001819	synonymous_variant	4583	exon30			CACTGGCACACAG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4869C>A	11.37:g.1093050C>A		230	5		284	16	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	bcgsc.ca	37	11	1093061	1093061	+	Missense_Mutation	SNP	C	C	T	rs111210454		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr11:1093061C>T	ENST00000441003.2	+	30	4907	c.4880C>T	c.(4879-4881)cCa>cTa	p.P1627L	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.P1594L|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	acacagaccccaaccccaaca	0.632																																					p.P1627L													.	MUC2	614	0			c.C4880T						.						128.0	165.0	153.0					11																	1093061		1874	3606	5480	SO:0001583	missense	4583	exon30			AGACCCCAACCCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4880C>T	11.37:g.1093061C>T	ENSP00000415183:p.Pro1627Leu	225	4		272	18	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	6.096	0.386050	0.11524	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.13657	2.57;2.97	1.61	1.61	0.23674	.	13.230700	0.00633	U	0.000492	T	0.09774	0.0240	.	.	.	0.09310	N	1	B	0.17465	0.022	B	0.08055	0.003	T	0.22906	-1.0203	9	0.27785	T	0.31	.	6.7045	0.23242	0.0:1.0:0.0:0.0	.	1627	E7EUV1	.	L	1627;1594	ENSP00000415183:P1627L;ENSP00000351956:P1594L	ENSP00000351956:P1594L	P	+	2	0	MUC2	1083061	0.000000	0.05858	0.009000	0.14445	0.048000	0.14542	0.279000	0.18771	0.910000	0.36722	0.121000	0.15741	CCA	.		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	bcgsc.ca	37	11	1093223	1093223	+	Missense_Mutation	SNP	C	C	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr11:1093223C>A	ENST00000441003.2	+	30	5069	c.5042C>A	c.(5041-5043)aCc>aAc	p.T1681N	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.T1648N|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	atcaccaccaccactacGGTG	0.627																																					p.T1681N													.	MUC2	614	0			c.C5042A						.						81.0	146.0	123.0					11																	1093223		1810	3320	5130	SO:0001583	missense	4583	exon30			CCACCACCACTAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5042C>A	11.37:g.1093223C>A	ENSP00000415183:p.Thr1681Asn	150	1		244	9	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	6.380	0.438260	0.12104	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.13538	2.58;2.71	1.75	1.75	0.24633	.	0.237231	0.18200	U	0.148541	T	0.04907	0.0132	.	.	.	0.09310	N	1	P	0.41978	0.767	B	0.26310	0.068	T	0.38950	-0.9637	9	0.18710	T	0.47	.	6.899	0.24273	0.0:1.0:0.0:0.0	.	1681	E7EUV1	.	N	1681;1648	ENSP00000415183:T1681N;ENSP00000351956:T1648N	ENSP00000351956:T1648N	T	+	2	0	MUC2	1083223	0.028000	0.19301	0.001000	0.08648	0.007000	0.05969	2.708000	0.47152	0.981000	0.38548	0.184000	0.17185	ACC	.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
ESYT1	23344	bcgsc.ca	37	12	56524397	56524397	+	Missense_Mutation	SNP	G	G	T			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr12:56524397G>T	ENST00000394048.5	+	2	686	c.422G>T	c.(421-423)tGg>tTg	p.W141L	RP11-603J24.5_ENST00000549438.1_RNA|ESYT1_ENST00000541590.1_Missense_Mutation_p.W141L|RP11-603J24.5_ENST00000550947.1_RNA|ESYT1_ENST00000267113.4_Missense_Mutation_p.W141L	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	141	Glycerophospholipid-binding barrel-like domain. {ECO:0000250}.				lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						AAGGCTGAATGGCTCAATAAG	0.502																																					p.W141L													.	ESYT1	84	0			c.G422T						.						193.0	172.0	179.0					12																	56524397		2203	4300	6503	SO:0001583	missense	23344	exon2			CTGAATGGCTCAA	AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.422G>T	12.37:g.56524397G>T	ENSP00000377612:p.Trp141Leu	54	0		83	4	NM_015292	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Missense_Mutation	SNP	ENST00000394048.5	37	CCDS8904.1	.	.	.	.	.	.	.	.	.	.	G	17.38	3.375366	0.61735	.	.	ENSG00000139641	ENST00000551790;ENST00000394048;ENST00000267113;ENST00000541590	D;D;D;D	0.95588	-3.75;-3.75;-3.75;-3.75	4.57	4.57	0.56435	.	0.256814	0.42172	D	0.000752	D	0.95828	0.8642	M	0.78223	2.4	0.58432	D	0.999996	P;P	0.51449	0.945;0.941	P;B	0.49999	0.628;0.444	D	0.95933	0.8940	10	0.87932	D	0	-3.3131	11.7462	0.51821	0.0:0.0:0.8235:0.1765	.	141;141	Q9BSJ8-2;Q9BSJ8	.;ESYT1_HUMAN	L	20;141;141;141	ENSP00000447756:W20L;ENSP00000377612:W141L;ENSP00000267113:W141L;ENSP00000445952:W141L	ENSP00000267113:W141L	W	+	2	0	ESYT1	54810664	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	6.873000	0.75541	2.277000	0.76020	0.563000	0.77884	TGG	.		0.502	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292	
SLC17A8	246213	bcgsc.ca	37	12	100811849	100811849	+	Missense_Mutation	SNP	G	G	A			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr12:100811849G>A	ENST00000323346.5	+	11	1653	c.1340G>A	c.(1339-1341)aGc>aAc	p.S447N	SLC17A8_ENST00000392989.3_Missense_Mutation_p.S397N|SLC17A8_ENST00000552697.1_3'UTR	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	447					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						CGCTATGCCAGCATTCTCATG	0.468																																					p.S447N													.	SLC17A8	89	0			c.G1340A						.						178.0	163.0	168.0					12																	100811849		2203	4300	6503	SO:0001583	missense	246213	exon11			ATGCCAGCATTCT	AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.1340G>A	12.37:g.100811849G>A	ENSP00000316909:p.Ser447Asn	46	0		64	4	NM_139319	B3KXZ6|B7ZKV4|Q17RQ8	Missense_Mutation	SNP	ENST00000323346.5	37	CCDS9077.1	.	.	.	.	.	.	.	.	.	.	G	34	5.294776	0.95546	.	.	ENSG00000179520	ENST00000323346;ENST00000392989	T;T	0.55234	0.53;0.53	5.55	5.55	0.83447	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.81088	0.4750	M	0.94101	3.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.988	D	0.85397	0.1129	10	0.87932	D	0	.	19.8667	0.96806	0.0:0.0:1.0:0.0	.	447;397	Q8NDX2;Q8NDX2-2	VGLU3_HUMAN;.	N	447;397	ENSP00000316909:S447N;ENSP00000376715:S397N	ENSP00000316909:S447N	S	+	2	0	SLC17A8	99335980	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.813000	0.99286	2.773000	0.95371	0.655000	0.94253	AGC	.		0.468	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408673.2	NM_139319	
TERF1P5	283523	bcgsc.ca	37	13	19255796	19255796	+	IGR	SNP	T	T	C	rs531807042	byFrequency	TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr13:19255796T>C								LINC00387 (5493 upstream) : LINC00418 (37110 downstream)																							AAAAGACAGATGGAGGACCAT	0.373													T|||	2	0.000399361	0.0	0.0	5008	,	,		17970	0.002		0.0	False		,,,				2504	0.0				.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	283523	.			GACAGATGGAGGA																													13.37:g.19255796T>C		122	0		114	16	.		RNA	SNP		37																																																																																				.	0	0.373								
ARHGAP42P4	254398	bcgsc.ca	37	14	20156938	20156938	+	IGR	SNP	C	C	G	rs199925830		TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr14:20156938C>G								RP11-597A11.2 (4040 upstream) : OR4Q3 (58648 downstream)																							AAATATTACTCTATCCTTGAA	0.338																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	254398	.			ATTACTCTATCCT																													14.37:g.20156938C>G		18	0		29	8	.		RNA	SNP		37																																																																																				.	0	0.338								
SPRED1	161742	bcgsc.ca	37	15	38643613	38643613	+	Missense_Mutation	SNP	A	A	C			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr15:38643613A>C	ENST00000299084.4	+	7	1943	c.1083A>C	c.(1081-1083)agA>agC	p.R361S		NM_152594.2	NP_689807.1	Q7Z699	SPRE1_HUMAN	sprouty-related, EVH1 domain containing 1	361	SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			kidney(6)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		CTATTAAAAGATGCATATATC	0.423									Legius syndrome																												p.R361S	Melanoma(196;2146 2959 7698 16532)												.	SPRED1	51	0			c.A1083C						.						175.0	167.0	170.0					15																	38643613		2200	4297	6497	SO:0001583	missense	161742	exon7	Familial Cancer Database	Neurofibromatosis type 1 - like syndrome, SPRED1 disorder	TAAAAGATGCATA	AK091222	CCDS32193.1	15q14	2014-06-13			ENSG00000166068	ENSG00000166068			20249	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 147"""	609291					Standard	NM_152594		Approved	FLJ33903, PPP1R147	uc001zka.4	Q7Z699		ENST00000299084.4:c.1083A>C	15.37:g.38643613A>C	ENSP00000299084:p.Arg361Ser	55	0		41	13	NM_152594	B2RPJ8|Q05D53|Q8N256	Missense_Mutation	SNP	ENST00000299084.4	37	CCDS32193.1	.	.	.	.	.	.	.	.	.	.	A	13.26	2.184281	0.38609	.	.	ENSG00000166068	ENST00000299084	T	0.61859	0.07	6.02	4.83	0.62350	.	0.044760	0.85682	D	0.000000	T	0.40862	0.1134	N	0.11560	0.145	0.47862	D	0.999539	D	0.53312	0.959	P	0.52343	0.696	T	0.39981	-0.9587	10	0.06891	T	0.86	-0.221	7.553	0.27808	0.7867:0.1432:0.0702:0.0	.	361	Q7Z699	SPRE1_HUMAN	S	361	ENSP00000299084:R361S	ENSP00000299084:R361S	R	+	3	2	SPRED1	36430905	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.143000	0.58051	2.319000	0.78375	0.462000	0.41574	AGA	.		0.423	SPRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418217.1		
CALM1P1	802	bcgsc.ca	37	X	94754909	94754909	+	IGR	SNP	T	T	C			TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chrX:94754909T>C								AL390966.1 (365538 upstream) : RNA5SP510 (82153 downstream)																							AGCAGAACTATGTCACGTCAT	0.378																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	802	.			GAACTATGTCACG																													X.37:g.94754909T>C		19	0		25	12	.		RNA	SNP		37																																																																																				.	0	0.378								
OR8K3	219473	ucsc.edu	37	11	56086147	56086147	+	Missense_Mutation	SNP	G	G	A	rs960193	byFrequency	TCGA-ZD-A8I3-01A-11D-A417-09	TCGA-ZD-A8I3-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	b5635673-eac4-4e25-ba71-0a09611b221f	928e9a57-b250-4873-94b9-50702b7907c8	g.chr11:56086147G>A	ENST00000312711.1	+	1	365	c.365G>A	c.(364-366)cGc>cAc	p.R122H		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	122			L -> R (in dbSNP:rs960193).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					TCCTACGACCTCTATGTGGCC	0.393																																					p.L122H													OR8K3,NS,carcinoma,+1,1	OR8K3	92	0			c.T365A	GRCh37	CM035855	OR8K3	M	rs960193	.						118.0	110.0	113.0					11																	56086147		2201	4296	6497	SO:0001583	missense	219473	exon1			ACGACCTCTATGT	AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.365G>A	11.37:g.56086147G>A	ENSP00000323555:p.Arg122His	36	0		32	16	NM_001005202	Q6IFC4	Missense_Mutation	SNP	ENST00000312711.1	37	CCDS31527.1																																																																																			G|0.721;T|0.279		0.393	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391602.1	NM_001005202	
