#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FBRSL1	57666	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	133102390	133102396	+	Frame_Shift_Del	DEL	CCCGGGA	CCCGGGA	-			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	CCCGGGA	CCCGGGA	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr12:133102390_133102396delCCCGGGA	ENST00000434748.2	+	3	1580_1586	c.560_566delCCCGGGA	c.(559-567)tcccgggacfs	p.SRD187fs	FBRSL1_ENST00000261673.6_Frame_Shift_Del_p.SRD114fs	NM_001142641.1	NP_001136113.1	Q9HCM7	FBSL_HUMAN	fibrosin-like 1	187							poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(1)|stomach(1)	4						GCCACCAGCTCCCGGGACCCGCTCAGC	0.681																																					p.187_189del		.											.	.	.	0			c.559_565del						.																																			SO:0001589	frameshift_variant	57666	exon3			CCAGCTCCCGGGA		CCDS45010.1	12q24.33	2008-12-09			ENSG00000112787	ENSG00000112787			29308	protein-coding gene	gene with protein product						10997877	Standard	NM_001142641		Approved	KIAA1545	uc001ukf.3	Q9HCM7	OTTHUMG00000167991	ENST00000434748.2:c.560_566delCCCGGGA	12.37:g.133102390_133102396delCCCGGGA	ENSP00000396160:p.Ser187fs	105	0		92	10	NM_001142641	Q86XQ1	Frame_Shift_Del	DEL	ENST00000434748.2	37	CCDS45010.1																																																																																			.		0.681	FBRSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397404.2		
PRKAA2	5563	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	57140104	57140107	+	Frame_Shift_Del	DEL	AGAC	AGAC	-			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	AGAC	AGAC	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:57140104_57140107delAGAC	ENST00000371244.4	+	2	211_214	c.145_148delAGAC	c.(145-150)agacagfs	p.RQ49fs		NM_006252.3	NP_006243.2	P54646	AAPK2_HUMAN	protein kinase, AMP-activated, alpha 2 catalytic subunit	49	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				autophagy (GO:0006914)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|cellular response to glucose starvation (GO:0042149)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of glycolytic process (GO:0045821)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(6)|endometrium(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|stomach(1)	23					Acetylsalicylic acid(DB00945)	AATCTTAAATAGACAGAAGATTCG	0.284																																					p.48_49del		.											.	.	.	0			c.144_147del						.																																			SO:0001589	frameshift_variant	5563	exon2			TTAAATAGACAGA	BC069823	CCDS605.1	1p31	2011-08-25			ENSG00000162409	ENSG00000162409			9377	protein-coding gene	gene with protein product		600497		PRKAA		7959015	Standard	NM_006252		Approved	AMPK, AMPKa2	uc001cyk.4	P54646	OTTHUMG00000008282	ENST00000371244.4:c.145_148delAGAC	1.37:g.57140104_57140107delAGAC	ENSP00000360290:p.Arg49fs	173	0		273	40	NM_006252	Q9H1E8|Q9UD43	Frame_Shift_Del	DEL	ENST00000371244.4	37	CCDS605.1																																																																																			.		0.284	PRKAA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022753.2	NM_006252	
HCN1	348980	hgsc.bcm.edu	37	5	45267285	45267286	+	Frame_Shift_Ins	INS	-	-	G			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	-	-	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr5:45267285_45267286insG	ENST00000303230.4	-	7	1745_1746	c.1688_1689insC	c.(1687-1689)tcafs	p.S563fs		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	563					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						CCACGGAAAGTGAGTAAAGACG	0.436																																					p.S563fs		.											.	.	.	0			c.1689_1690insC						.																																			SO:0001589	frameshift_variant	348980	exon7			GGAAAGTGAGTAA	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1689dupC	5.37:g.45267286_45267286dupG	ENSP00000307342:p.Ser563fs	97	0		181	119	NM_021072		Frame_Shift_Ins	INS	ENST00000303230.4	37	CCDS3952.1																																																																																			.		0.436	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
SMARCD1	6602	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	50482343	50482359	+	Frame_Shift_Del	DEL	AAGTTCTCTTCCTTTTT	AAGTTCTCTTCCTTTTT	-	rs1050725		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	AAGTTCTCTTCCTTTTT	AAGTTCTCTTCCTTTTT	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr12:50482343_50482359delAAGTTCTCTTCCTTTTT	ENST00000394963.4	+	6	1092_1108	c.694_710delAAGTTCTCTTCCTTTTT	c.(694-711)aagttctcttccttttttfs	p.KFSSFF232fs	SMARCD1_ENST00000381513.4_Frame_Shift_Del_p.KFSSFF232fs|SMARCD1_ENST00000548573.1_Frame_Shift_Del_p.KFSSFF30fs	NM_003076.4	NP_003067.3			SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1									p.F194L(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	18						ACAAAAGAGGAAGTTCTCTTCCTTTTTTAAGTCCTTG	0.415																																					p.231_237del		.											.	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.693_709del						.																																			SO:0001589	frameshift_variant	6602	exon6			AAGAGGAAGTTCT	U66617	CCDS8797.2, CCDS8798.2	12q13-q14	2008-08-05			ENSG00000066117	ENSG00000066117			11106	protein-coding gene	gene with protein product		601735				8804307, 9693044, 12917342	Standard	NM_003076		Approved	BAF60A, Rsc6p, CRACD1	uc001rvx.4	Q96GM5	OTTHUMG00000150194	ENST00000394963.4:c.694_710delAAGTTCTCTTCCTTTTT	12.37:g.50482343_50482359delAAGTTCTCTTCCTTTTT	ENSP00000378414:p.Lys232fs	49	0		36	14	NM_003076		Frame_Shift_Del	DEL	ENST00000394963.4	37	CCDS8797.2																																																																																			.		0.415	SMARCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316759.2	NM_003076	
TRAPPC11	60684	hgsc.bcm.edu;bcgsc.ca	37	4	184588276	184588276	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr4:184588276G>T	ENST00000334690.6	+	4	640	c.438G>T	c.(436-438)ttG>ttT	p.L146F	TRAPPC11_ENST00000357207.4_Missense_Mutation_p.L146F|TRAPPC11_ENST00000511409.1_3'UTR	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11	146					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)											AAACCCCTTTGCCCCCAGGTA	0.313																																					p.L146F		.											.	.	.	0			c.G438T						.						76.0	83.0	80.0					4																	184588276		2203	4300	6503	SO:0001583	missense	60684	exon4			CCCTTTGCCCCCA		CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.438G>T	4.37:g.184588276G>T	ENSP00000335371:p.Leu146Phe	87	0		67	4	NM_021942	A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	Missense_Mutation	SNP	ENST00000334690.6	37	CCDS34112.1	.	.	.	.	.	.	.	.	.	.	G	16.66	3.184175	0.57800	.	.	ENSG00000168538	ENST00000334690;ENST00000357207;ENST00000360109	.	.	.	5.09	0.135	0.14775	.	0.000000	0.64402	D	0.000001	T	0.76126	0.3944	M	0.83483	2.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.976;0.99	T	0.74290	-0.3713	9	0.39692	T	0.17	.	11.3763	0.49730	0.4723:0.0:0.5277:0.0	.	146;146	Q7Z392;Q7Z392-3	TPC11_HUMAN;.	F	146	.	ENSP00000335371:L146F	L	+	3	2	C4orf41	184825270	0.825000	0.29262	0.997000	0.53966	0.946000	0.59487	0.005000	0.13129	-0.003000	0.14444	0.460000	0.39030	TTG	.		0.313	TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361654.2	NM_021942	
C20orf194	25943	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	20	3240180	3240180	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr20:3240180G>T	ENST00000252032.9	-	33	3068	c.3001C>A	c.(3001-3003)Cca>Aca	p.P1001T	C20orf194_ENST00000453730.2_3'UTR	NM_001009984.2	NP_001009984.1	Q5TEA3	CT194_HUMAN	chromosome 20 open reading frame 194	1001										NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	39						AAGGGACTTGGCTTGATGGAG	0.532																																					p.P1001T		.											.	.	.	0			c.C3001A						.						175.0	179.0	178.0					20																	3240180		2043	4189	6232	SO:0001583	missense	25943	exon33			GACTTGGCTTGAT	AL110249	CCDS42851.1	20p13	2012-10-30			ENSG00000088854	ENSG00000088854			17721	protein-coding gene	gene with protein product		614146					Standard	NM_001009984		Approved	DKFZp434N061	uc002wii.3	Q5TEA3	OTTHUMG00000031742	ENST00000252032.9:c.3001C>A	20.37:g.3240180G>T	ENSP00000252032:p.Pro1001Thr	26	0		27	4	NM_001009984	Q66K86|Q6P2R9|Q9UFX9	Missense_Mutation	SNP	ENST00000252032.9	37	CCDS42851.1	.	.	.	.	.	.	.	.	.	.	G	12.03	1.817053	0.32145	.	.	ENSG00000088854	ENST00000252032	T	0.18810	2.19	5.21	4.26	0.50523	.	0.190378	0.46145	D	0.000310	T	0.13114	0.0318	L	0.28115	0.83	0.80722	D	1	B;B	0.18461	0.009;0.028	B;B	0.15484	0.013;0.013	T	0.08911	-1.0699	10	0.38643	T	0.18	.	6.1682	0.20402	0.1538:0.0:0.6955:0.1506	.	740;1001	Q0IIP3;Q5TEA3	.;CT194_HUMAN	T	1001	ENSP00000252032:P1001T	ENSP00000252032:P1001T	P	-	1	0	C20orf194	3188180	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.212000	0.42835	1.211000	0.43351	-0.275000	0.10095	CCA	.		0.532	C20orf194-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077734.1	NM_001009984	
SMIM3	85027	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	150175154	150175154	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr5:150175154G>A	ENST00000526627.1	+	2	1190	c.152G>A	c.(151-153)cGg>cAg	p.R51Q	AC010441.1_ENST00000600109.1_3'UTR	NM_032947.4	NP_116565.3	Q9BZL3	SMIM3_HUMAN	small integral membrane protein 3	51						integral component of membrane (GO:0016021)											TATCGCATGCGGACTCATCCG	0.547																																					p.R51Q		.											.	.	.	0			c.G152A						.																																			SO:0001583	missense	85027	exon2			GCATGCGGACTCA	AF313413	CCDS47312.1, CCDS47312.2	5q33.1	2012-10-01	2012-10-01	2012-10-01	ENSG00000256235	ENSG00000256235			30248	protein-coding gene	gene with protein product		608324	"""chromosome 5 open reading frame 62"""	C5orf62		11288140	Standard	NM_032947		Approved	MSTP150, NID67	uc003lsw.3	Q9BZL3	OTTHUMG00000163646	ENST00000526627.1:c.152G>A	5.37:g.150175154G>A	ENSP00000436897:p.Arg51Gln	25	0		20	9	NM_032947	Q3MIG3|Q6ZUV4	Missense_Mutation	SNP	ENST00000526627.1	37	CCDS47312.2	.	.	.	.	.	.	.	.	.	.	G	16.92	3.254915	0.59321	.	.	ENSG00000256235	ENST00000526627	.	.	.	5.11	4.24	0.50183	.	.	.	.	.	T	0.47340	0.1440	.	.	.	0.29079	N	0.882815	.	.	.	.	.	.	T	0.42816	-0.9429	4	.	.	.	.	12.2755	0.54733	0.0852:0.0:0.9148:0.0	.	.	.	.	Q	51	.	.	R	+	2	0	C5orf62	150155347	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	6.640000	0.74319	1.477000	0.48234	0.491000	0.48974	CGG	.		0.547	SMIM3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374647.2	NM_032947	
KRT81	3887	hgsc.bcm.edu	37	12	52685191	52685191	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr12:52685191G>A	ENST00000327741.5	-	1	127	c.59C>T	c.(58-60)cCg>cTg	p.P20L	KRT86_ENST00000423955.2_Intron|KRT86_ENST00000544024.1_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	20	Head.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		GCCGGGCCGCGGCCCGCAGGC	0.692																																					p.P20L		.											.	.	.	0			c.C59T						.						14.0	19.0	17.0					12																	52685191		2183	4232	6415	SO:0001583	missense	3887	exon1			GGCCGCGGCCCGC	X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.59C>T	12.37:g.52685191G>A	ENSP00000369349:p.Pro20Leu	40	0		84	4	NM_002281	Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Missense_Mutation	SNP	ENST00000327741.5	37	CCDS31805.1	.	.	.	.	.	.	.	.	.	.	G	18.69	3.678965	0.68042	.	.	ENSG00000205426	ENST00000327741;ENST00000389388	T	0.81415	-1.49	5.17	5.17	0.71159	.	0.000000	0.34338	U	0.004042	D	0.86640	0.5981	M	0.72118	2.19	0.42068	D	0.991195	D	0.89917	1.0	D	0.73380	0.98	D	0.87130	0.2196	10	0.62326	D	0.03	.	7.7965	0.29150	0.0882:0.1787:0.7331:0.0	.	20	Q14533	KRT81_HUMAN	L	20	ENSP00000369349:P20L	ENSP00000369349:P20L	P	-	2	0	KRT81	50971458	0.586000	0.26782	1.000000	0.80357	0.817000	0.46193	2.147000	0.42226	2.399000	0.81585	0.549000	0.68633	CCG	.		0.692	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395128.2	NM_002281	
HSPA4L	22824	hgsc.bcm.edu	37	4	128743939	128743939	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr4:128743939C>T	ENST00000296464.4	+	15	2239	c.1828C>T	c.(1828-1830)Caa>Taa	p.Q610*	HSPA4L_ENST00000439123.2_Nonsense_Mutation_p.Q641*|HSPA4L_ENST00000508776.1_Nonsense_Mutation_p.Q610*|HSPA4L_ENST00000505726.1_Nonsense_Mutation_p.Q584*	NM_014278.2	NP_055093.2	O95757	HS74L_HUMAN	heat shock 70kDa protein 4-like	610					protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)			central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						GATGATCATGCAAGATAAGTT	0.348																																					p.Q610X		.											HSPA4L,colon,carcinoma,0,1	HSPA4L	0	0			c.C1828T						.						61.0	62.0	62.0					4																	128743939		2203	4299	6502	SO:0001587	stop_gained	22824	exon15			ATCATGCAAGATA	AB023421	CCDS3734.1	4q28	2011-09-07			ENSG00000164070	ENSG00000164070		"""Heat shock proteins / HSP70"""	17041	protein-coding gene	gene with protein product						10524232	Standard	NM_014278		Approved	APG-1, Osp94, HSPH3	uc003ifm.3	O95757	OTTHUMG00000133302	ENST00000296464.4:c.1828C>T	4.37:g.128743939C>T	ENSP00000296464:p.Gln610*	76	0		41	2	NM_014278	A2ICT2|Q4W5M5|Q8IWA2	Nonsense_Mutation	SNP	ENST00000296464.4	37	CCDS3734.1	.	.	.	.	.	.	.	.	.	.	C	42	9.566759	0.99207	.	.	ENSG00000164070	ENST00000508776;ENST00000439123;ENST00000296464;ENST00000505726	.	.	.	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	18.4186	0.90579	0.0:1.0:0.0:0.0	.	.	.	.	X	610;641;610;584	.	ENSP00000296464:Q610X	Q	+	1	0	HSPA4L	128963389	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.926000	0.75835	2.596000	0.87737	0.585000	0.79938	CAA	.		0.348	HSPA4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257096.3	NM_014278	
CDC42BPG	55561	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	64597150	64597150	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr11:64597150C>T	ENST00000342711.5	-	30	3759	c.3760G>A	c.(3760-3762)Gag>Aag	p.E1254K	CDC42BPG_ENST00000491280.1_5'Flank	NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						GGCGCAGCCTCGTTGAGCAGC	0.701																																					p.E1254K		.											.	.	.	0			c.G3760A						.						11.0	15.0	13.0					11																	64597150		2184	4281	6465	SO:0001583	missense	55561	exon30			CAGCCTCGTTGAG	AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.3760G>A	11.37:g.64597150C>T	ENSP00000345133:p.Glu1254Lys	27	0		29	5	NM_017525		Missense_Mutation	SNP	ENST00000342711.5	37	CCDS31601.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.181280	0.78677	.	.	ENSG00000171219	ENST00000342711	T	0.04706	3.57	4.85	4.85	0.62838	Citron-like (2);	0.000000	0.42294	D	0.000731	T	0.20495	0.0493	M	0.72118	2.19	0.51767	D	0.999933	D	0.89917	1.0	D	0.81914	0.995	T	0.00205	-1.1922	10	0.87932	D	0	.	15.8441	0.78874	0.0:1.0:0.0:0.0	.	1254	Q6DT37	MRCKG_HUMAN	K	1254	ENSP00000345133:E1254K	ENSP00000345133:E1254K	E	-	1	0	CDC42BPG	64353726	0.910000	0.30920	0.973000	0.42090	0.293000	0.27360	1.582000	0.36568	2.440000	0.82611	0.650000	0.86243	GAG	.		0.701	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105352.4	XM_290516	
KIAA1586	57691	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	56918360	56918360	+	Missense_Mutation	SNP	G	G	C			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr6:56918360G>C	ENST00000370733.4	+	4	1270	c.1063G>C	c.(1063-1065)Gtg>Ctg	p.V355L	KIAA1586_ENST00000545356.1_Missense_Mutation_p.V328L	NM_020931.2	NP_065982.1	Q9HCI6	K1586_HUMAN	KIAA1586	355							nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)	18	Lung NSC(77;0.0969)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			AAAAGAATTGGTGTCAACTAT	0.323																																					p.V355L		.											.	.	.	0			c.G1063C						.						120.0	123.0	122.0					6																	56918360		2203	4299	6502	SO:0001583	missense	57691	exon4			GAATTGGTGTCAA	AB046806	CCDS34480.1, CCDS69138.1	6p12.1	2014-03-27			ENSG00000168116	ENSG00000168116			21360	protein-coding gene	gene with protein product						10997877	Standard	NM_001286274		Approved		uc003pdj.3	Q9HCI6	OTTHUMG00000014915	ENST00000370733.4:c.1063G>C	6.37:g.56918360G>C	ENSP00000359768:p.Val355Leu	73	0		65	27	NM_020931	A8K4M3|Q8IW25	Missense_Mutation	SNP	ENST00000370733.4	37	CCDS34480.1	.	.	.	.	.	.	.	.	.	.	g	0.006	-2.022460	0.00414	.	.	ENSG00000168116	ENST00000370733;ENST00000545356	T;T	0.21932	1.98;1.98	3.58	1.66	0.24008	Ribonuclease H-like (1);	.	.	.	.	T	0.02727	0.0082	N	0.08118	0	0.09310	N	1	B;B	0.20550	0.046;0.046	B;B	0.17722	0.019;0.019	T	0.46665	-0.9175	9	0.25751	T	0.34	.	6.1401	0.20255	0.0:0.2097:0.5739:0.2163	.	328;355	F5H2N6;Q9HCI6	.;K1586_HUMAN	L	355;328	ENSP00000359768:V355L;ENSP00000445507:V328L	ENSP00000359768:V355L	V	+	1	0	KIAA1586	57026319	0.961000	0.32948	0.020000	0.16555	0.071000	0.16799	0.291000	0.18994	0.265000	0.21872	-0.293000	0.09583	GTG	.		0.323	KIAA1586-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041033.1	NM_020931	
SLC41A3	54946	hgsc.bcm.edu	37	3	125725323	125725323	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr3:125725323C>T	ENST00000315891.6	-	12	1689	c.1451G>A	c.(1450-1452)tGc>tAc	p.C484Y	SLC41A3_ENST00000360370.4_3'UTR|SLC41A3_ENST00000346785.5_Missense_Mutation_p.C448Y|SLC41A3_ENST00000383598.2_3'UTR	NM_001008485.1|NM_017836.3	NP_001008485|NP_060306.3	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3	484						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)	p.C484Y(1)		breast(1)|endometrium(4)|large_intestine(6)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18				GBM - Glioblastoma multiforme(114;0.167)		ATGTTGAGTGCAGATGAAGGG	0.433																																					p.C484Y		.											SLC41A3_ENST00000315891,NS,carcinoma,0,1	SLC41A3_ENST00000315891	0	1	Substitution - Missense(1)	endometrium(1)	c.G1451A						.						60.0	58.0	59.0					3																	125725323		2203	4300	6503	SO:0001583	missense	54946	exon12			TGAGTGCAGATGA		CCDS33842.1, CCDS33843.1, CCDS33844.1, CCDS43144.1, CCDS54635.1	3q21.2	2013-09-02			ENSG00000114544	ENSG00000114544		"""Solute carriers"""	31046	protein-coding gene	gene with protein product		610803					Standard	NM_001164475		Approved	FLJ20473	uc003eij.3	Q96GZ6	OTTHUMG00000162678	ENST00000315891.6:c.1451G>A	3.37:g.125725323C>T	ENSP00000326070:p.Cys484Tyr	39	0		40	2	NM_001008485	A6ND60|B3KSD9|B7Z4Y2|C9JE96|E7ENY4|Q8N342|Q8NB27|Q9H9I6|Q9HAB1|Q9NX30	Missense_Mutation	SNP	ENST00000315891.6	37	CCDS33843.1	.	.	.	.	.	.	.	.	.	.	C	6.798	0.516185	0.12944	.	.	ENSG00000114544	ENST00000346785;ENST00000315891	T;T	0.36340	1.26;1.26	3.3	-0.885	0.10593	.	.	.	.	.	T	0.14960	0.0361	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.22695	-1.0209	9	0.87932	D	0	-3.9603	0.524	0.00617	0.1876:0.3386:0.2209:0.253	.	448;484	Q96GZ6-3;Q96GZ6	.;S41A3_HUMAN	Y	448;484	ENSP00000264471:C448Y;ENSP00000326070:C484Y	ENSP00000326070:C484Y	C	-	2	0	SLC41A3	127208013	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-1.042000	0.03539	-0.214000	0.10078	-0.500000	0.04577	TGC	.		0.433	SLC41A3-024	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370886.1	NM_017836	
GTDC1	79712	hgsc.bcm.edu	37	2	144728223	144728223	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:144728223G>T	ENST00000392869.2	-	7	1134	c.982C>A	c.(982-984)Cca>Aca	p.P328T	GTDC1_ENST00000392867.3_Intron|GTDC1_ENST00000344850.4_Missense_Mutation_p.P328T|GTDC1_ENST00000409214.1_Missense_Mutation_p.P328T|GTDC1_ENST00000409298.1_Missense_Mutation_p.P210T|GTDC1_ENST00000241391.5_Intron|GTDC1_ENST00000463875.2_Missense_Mutation_p.P199T|GTDC1_ENST00000542155.1_Missense_Mutation_p.P328T	NM_001284234.1	NP_001271163.1	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1	328					biosynthetic process (GO:0009058)		transferase activity, transferring glycosyl groups (GO:0016757)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(17)|ovary(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.0914)		GAGGTACCTGGGACATCTGTG	0.333																																					p.P328T		.											.	.	.	0			c.C982A						.						87.0	85.0	86.0					2																	144728223		2203	4300	6503	SO:0001583	missense	79712	exon8			TACCTGGGACATC	AY281366	CCDS2185.1, CCDS33300.1, CCDS63029.1, CCDS74582.1, CCDS74583.1	2q22.3	2013-02-22			ENSG00000121964	ENSG00000121964		"""Glycosyltransferase group 1 domain containing"""	20887	protein-coding gene	gene with protein product	"""mannosyltransferase-like"""	610165				15068588, 21821951	Standard	NM_024659		Approved	FLJ11753, Hmat-Xa	uc010fnn.3	Q4AE62	OTTHUMG00000131835	ENST00000392869.2:c.982C>A	2.37:g.144728223G>T	ENSP00000376608:p.Pro328Thr	87	0		88	4	NM_001006636	A8K5P2|D3DP81|Q53SM7|Q53TC5|Q6P7E7|Q6PJB6|Q6WKW6|Q9HAE5	Missense_Mutation	SNP	ENST00000392869.2	37	CCDS33300.1	.	.	.	.	.	.	.	.	.	.	G	17.98	3.520985	0.64747	.	.	ENSG00000121964	ENST00000392869;ENST00000409214;ENST00000409298;ENST00000542155;ENST00000344850;ENST00000463875	T;T;D;T;T;T	0.81659	-0.92;-0.92;-1.52;-0.92;-0.92;-0.92	5.81	5.81	0.92471	Glycosyl transferase, family 1 (1);	0.000000	0.85682	D	0.000000	D	0.92378	0.7581	M	0.90977	3.165	0.58432	D	0.999992	D;P;D	0.89917	1.0;0.855;1.0	D;P;D	0.91635	0.999;0.543;0.999	D	0.93041	0.6457	10	0.66056	D	0.02	.	20.0825	0.97783	0.0:0.0:1.0:0.0	.	328;210;328	G1UFN1;B8ZZ45;Q4AE62	.;.;GTDC1_HUMAN	T	328;328;210;328;328;199	ENSP00000376608:P328T;ENSP00000386581:P328T;ENSP00000386691:P210T;ENSP00000438323:P328T;ENSP00000339750:P328T;ENSP00000437964:P199T	ENSP00000339750:P328T	P	-	1	0	GTDC1	144444693	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.905000	0.69893	2.746000	0.94184	0.655000	0.94253	CCA	.		0.333	GTDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254779.2	NM_024659	
MT-ND6	4541	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	M	14487	14487	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chrM:14487T>C	ENST00000361681.2	-	1	186	c.187A>G	c.(187-189)Atg>Gtg	p.M63V	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	63			M -> V (in MT-C1D). {ECO:0000269|PubMed:14595656, ECO:0000269|PubMed:20818383}.		cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						GACAACCATCATTCCCCCTAA	0.418																																					p.M63V		.											.	.	.	0			c.A187G						.																																			SO:0001583	missense	0	exon1			CCATCATTCCCCC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.187A>G	M.37:g.14487T>C	ENSP00000354665:p.Met63Val	341	0		445	427	ENST00000361681	Q34774|Q8HG30	Missense_Mutation	SNP	ENST00000361681.2	37																																																																																				.		0.418	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
CPXM1	56265	hgsc.bcm.edu	37	20	2777840	2777840	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr20:2777840G>T	ENST00000380605.2	-	6	894	c.830C>A	c.(829-831)tCa>tAa	p.S277*		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	277					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						CTGCCCACCTGAGACTGGGCA	0.647																																					p.S277X		.											CPXM1,NS,carcinoma,0,1	CPXM1	0	0			c.C830A						.						27.0	29.0	29.0					20																	2777840		2203	4299	6502	SO:0001587	stop_gained	56265	exon6			CCACCTGAGACTG	AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.830C>A	20.37:g.2777840G>T	ENSP00000369979:p.Ser277*	39	0		50	2	NM_001184699	Q6P4G8|Q6UW65|Q9NUB5	Nonsense_Mutation	SNP	ENST00000380605.2	37	CCDS13033.1	.	.	.	.	.	.	.	.	.	.	G	36	5.948027	0.97134	.	.	ENSG00000088882	ENST00000380605	.	.	.	4.79	3.84	0.44239	.	0.410516	0.23716	N	0.045269	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	-19.7405	10.8001	0.46483	0.0922:0.0:0.9078:0.0	.	.	.	.	X	277	.	ENSP00000369979:S277X	S	-	2	0	CPXM1	2725840	1.000000	0.71417	0.996000	0.52242	0.948000	0.59901	4.782000	0.62396	1.250000	0.43966	0.655000	0.94253	TCA	.		0.647	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609	
CENPB	1059	hgsc.bcm.edu;broad.mit.edu	37	20	3765895	3765895	+	Silent	SNP	C	C	T	rs545901224	byFrequency	TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr20:3765895C>T	ENST00000379751.4	-	1	1442	c.1236G>A	c.(1234-1236)gaG>gaA	p.E412E	CDC25B_ENST00000379598.5_5'Flank|CDC25B_ENST00000344256.6_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa	412	Glu-rich (acidic).				regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						cctcttcttcctcctcctcct	0.597																																					p.E412E		.											CENPB,NS,carcinoma,0,1	CENPB	0	0			c.G1236A						.						72.0	59.0	63.0					20																	3765895		2201	4298	6499	SO:0001819	synonymous_variant	1059	exon1			TTCTTCCTCCTCC	X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761	ENST00000379751.4:c.1236G>A	20.37:g.3765895C>T		12	0		24	3	NM_001810	Q96EI4	Silent	SNP	ENST00000379751.4	37	CCDS13064.1																																																																																			.		0.597	CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077772.2	NM_001810	
BHMT2	23743	hgsc.bcm.edu	37	5	78376673	78376673	+	Missense_Mutation	SNP	G	G	T	rs373649954		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr5:78376673G>T	ENST00000255192.3	+	4	488	c.422G>T	c.(421-423)tGg>tTg	p.W141L	DMGDH_ENST00000520388.1_Intron|BHMT2_ENST00000521567.1_Intron	NM_017614.4	NP_060084.2	Q9H2M3	BHMT2_HUMAN	betaine--homocysteine S-methyltransferase 2	141	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				L-methionine salvage (GO:0071267)|S-adenosylmethionine metabolic process (GO:0046500)|S-methylmethionine metabolic process (GO:0033477)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|S-methylmethionine-homocysteine S-methyltransferase activity (GO:0061627)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	15		all_lung(232;0.00063)|Lung NSC(167;0.00171)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;2.09e-45)|Epithelial(54;9.3e-41)|all cancers(79;4.09e-36)	L-Methionine(DB00134)	GTTTTTGCCTGGAAAAATGTG	0.398																																					p.W141L		.											BHMT2,NS,NS,0,1	BHMT2	0	0			c.G422T						.						80.0	81.0	81.0					5																	78376673		2203	4300	6503	SO:0001583	missense	23743	exon4			TTGCCTGGAAAAA		CCDS4045.1, CCDS54871.1	5q13	2010-04-28	2010-04-28		ENSG00000132840	ENSG00000132840	2.1.1.5		1048	protein-coding gene	gene with protein product		605932				11087663, 18230605	Standard	NM_017614		Approved		uc003kft.3	Q9H2M3	OTTHUMG00000108158	ENST00000255192.3:c.422G>T	5.37:g.78376673G>T	ENSP00000255192:p.Trp141Leu	60	0		48	2	NM_017614	B7Z516|Q9NXX7	Missense_Mutation	SNP	ENST00000255192.3	37	CCDS4045.1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.281463	0.23392	.	.	ENSG00000132840	ENST00000255192	T	0.10763	2.84	6.16	5.3	0.74995	Homocysteine S-methyltransferase (4);	0.089643	0.85682	D	0.000000	T	0.04861	0.0131	N	0.03608	-0.345	0.80722	D	1	B	0.06786	0.001	B	0.01281	0.0	T	0.34329	-0.9833	10	0.46703	T	0.11	-24.1958	7.5447	0.27759	0.2657:0.0:0.7343:0.0	.	141	Q9H2M3	BHMT2_HUMAN	L	141	ENSP00000255192:W141L	ENSP00000255192:W141L	W	+	2	0	BHMT2	78412429	1.000000	0.71417	0.961000	0.40146	0.055000	0.15305	1.980000	0.40618	1.629000	0.50426	-0.143000	0.13931	TGG	.		0.398	BHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226962.2	NM_017614	
CACNG5	27091	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	64873577	64873577	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr17:64873577C>T	ENST00000533854.1	+	2	364	c.127C>T	c.(127-129)Ccc>Tcc	p.P43S	CACNG5_ENST00000307139.3_Missense_Mutation_p.P43S|CACNG5_ENST00000169565.3_Missense_Mutation_p.P43S			Q9UF02	CCG5_HUMAN	calcium channel, voltage-dependent, gamma subunit 5	43					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ion transmembrane transporter activity (GO:0015075)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	24			BRCA - Breast invasive adenocarcinoma(6;1.61e-08)			TGTGATTGTGCCCCAGAACCA	0.617																																					p.P43S		.											.	.	.	0			c.C127T						.						173.0	134.0	147.0					17																	64873577		2203	4300	6503	SO:0001583	missense	27091	exon1			ATTGTGCCCCAGA	AF148220	CCDS11665.1	17q24	2004-02-16				ENSG00000075429		"""Calcium channel subunits"""	1409	protein-coding gene	gene with protein product		606405				10613843	Standard	NM_145811		Approved		uc010wqj.2	Q9UF02		ENST00000533854.1:c.127C>T	17.37:g.64873577C>T	ENSP00000436836:p.Pro43Ser	16	0		30	11	NM_145811	A8K2A6|Q547R3|Q8WXS7|Q9UHM3	Missense_Mutation	SNP	ENST00000533854.1	37	CCDS11665.1	.	.	.	.	.	.	.	.	.	.	C	15.74	2.923135	0.52653	.	.	ENSG00000075429	ENST00000533854;ENST00000307139;ENST00000169565	T;T;T	0.45276	0.94;0.94;0.9	4.69	2.52	0.30459	.	0.131603	0.52532	D	0.000073	T	0.29588	0.0738	L	0.28504	0.86	0.51767	D	0.999934	B	0.29936	0.262	B	0.34931	0.192	T	0.04360	-1.0957	10	0.14252	T	0.57	-37.3364	11.1088	0.48218	0.1426:0.7192:0.1382:0.0	.	43	Q9UF02	CCG5_HUMAN	S	43	ENSP00000436836:P43S;ENSP00000303092:P43S;ENSP00000169565:P43S	ENSP00000169565:P43S	P	+	1	0	CACNG5	62304039	1.000000	0.71417	0.990000	0.47175	0.694000	0.40290	4.316000	0.59178	1.322000	0.45245	0.558000	0.71614	CCC	.		0.617	CACNG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389882.1	NM_014404, NM_145811	
MYH7	4625	hgsc.bcm.edu	37	14	23896926	23896926	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr14:23896926C>T	ENST00000355349.3	-	16	1918	c.1756G>A	c.(1756-1758)Gtg>Atg	p.V586M		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	586	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.V586M(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TTGTAGTCCACGATGCCGGCA	0.527																																					p.V586M		.											MYH7,NS,carcinoma,0,1	MYH7	0	1	Substitution - Missense(1)	prostate(1)	c.G1756A						.						158.0	133.0	142.0					14																	23896926		2203	4300	6503	SO:0001583	missense	4625	exon16			AGTCCACGATGCC	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.1756G>A	14.37:g.23896926C>T	ENSP00000347507:p.Val586Met	56	0		37	2	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	C	17.57	3.421960	0.62622	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.98329	-4.87	4.83	4.83	0.62350	Myosin head, motor domain (2);	.	.	.	.	D	0.99477	0.9814	H	0.99842	4.835	0.80722	D	1	P	0.43287	0.802	P	0.57152	0.814	D	0.97649	1.0153	9	0.87932	D	0	.	18.5198	0.90948	0.0:1.0:0.0:0.0	.	586	P12883	MYH7_HUMAN	M	586	ENSP00000347507:V586M	ENSP00000347507:V586M	V	-	1	0	MYH7	22966766	1.000000	0.71417	0.961000	0.40146	0.033000	0.12548	7.307000	0.78920	2.688000	0.91661	0.558000	0.71614	GTG	.		0.527	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
TBC1D3P5	440419	hgsc.bcm.edu	37	17	25752452	25752452	+	RNA	SNP	C	C	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr17:25752452C>A	ENST00000586223.1	+	0	1334					NR_033892.1				TBC1 domain family, member 3 pseudogene 5																		GATGGCTCCACATCTTGGGAG	0.627																																					.		.											.	.	.	0			.						.																																					440419	.			GCTCCACATCTTG			17q11.1	2014-03-20			ENSG00000266433	ENSG00000266433			43567	pseudogene	pseudogene							Standard	NR_033892		Approved		uc002gzg.3		OTTHUMG00000179156		17.37:g.25752452C>A		44	0		66	8	.		RNA	SNP	ENST00000586223.1	37																																																																																				.		0.627	TBC1D3P5-003	KNOWN	non_canonical_TEC|basic	processed_transcript	pseudogene	OTTHUMT00000451073.1	NR_033892	
SLITRK2	84631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	144904919	144904919	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chrX:144904919C>T	ENST00000370490.1	+	1	5231	c.976C>T	c.(976-978)Ccc>Tcc	p.P326S	SLITRK2_ENST00000434188.2_Missense_Mutation_p.P326S|SLITRK2_ENST00000447897.2_Missense_Mutation_p.P326S|SLITRK2_ENST00000413937.2_Missense_Mutation_p.P326S|SLITRK2_ENST00000428560.2_Missense_Mutation_p.P326S			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	326					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					AAGTTTTGGACCCATCATGGT	0.537																																					p.P326S		.											.	.	.	0			c.C976T						.						79.0	70.0	73.0					X																	144904919		2203	4300	6503	SO:0001583	missense	84631	exon5			TTTGGACCCATCA	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.976C>T	X.37:g.144904919C>T	ENSP00000359521:p.Pro326Ser	77	0		44	5	NM_001144005	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.983871	0.74474	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.55413	0.59;0.52;0.52;0.52;0.52;0.52	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.69663	0.3136	M	0.71036	2.16	0.80722	D	1	D	0.76494	0.999	D	0.66979	0.948	T	0.67719	-0.5598	10	0.32370	T	0.25	-7.46	15.945	0.79787	0.0:1.0:0.0:0.0	.	326	Q9H156	SLIK2_HUMAN	S	326	ENSP00000334374:P326S;ENSP00000411681:P326S;ENSP00000359521:P326S;ENSP00000397015:P326S;ENSP00000407347:P326S;ENSP00000412010:P326S	ENSP00000334374:P326S	P	+	1	0	SLITRK2	144712611	1.000000	0.71417	0.350000	0.25708	0.886000	0.51366	5.968000	0.70413	2.365000	0.80145	0.600000	0.82982	CCC	.		0.537	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
T	6862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	166580132	166580132	+	Missense_Mutation	SNP	G	G	A	rs368969464		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr6:166580132G>A	ENST00000296946.2	-	3	887	c.419C>T	c.(418-420)cCc>cTc	p.P140L	T_ENST00000366871.3_Missense_Mutation_p.P140L	NM_003181.3	NP_003172.1	O15178	BRAC_HUMAN	T, brachyury homolog (mouse)	140					anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|canonical Wnt signaling pathway (GO:0060070)|determination of heart left/right asymmetry (GO:0061371)|embryonic skeletal system development (GO:0048706)|heart morphogenesis (GO:0003007)|mesoderm development (GO:0007498)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord formation (GO:0014028)|penetration of zona pellucida (GO:0007341)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|signal transduction (GO:0007165)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		GAAGGAGACGGGAGCCTTCAT	0.682									Chordoma, Familial Clustering of																												p.P140L		.											.	.	.	0			c.C419T						.	G	LEU/PRO	2,4404	4.2+/-10.8	0,2,2201	57.0	65.0	62.0		419	4.6	1.0	6		62	0,8600		0,0,4300	no	missense	T	NM_003181.2	98	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	possibly-damaging	140/436	166580132	2,13004	2203	4300	6503	SO:0001583	missense	6862	exon3	Familial Cancer Database		GAGACGGGAGCCT	AJ001699	CCDS5290.1, CCDS59045.1	6q27	2011-06-13	2001-11-28		ENSG00000164458	ENSG00000164458		"""T-boxes"""	11515	protein-coding gene	gene with protein product		601397	"""T brachyury (mouse) homolog"""			8963900	Standard	NM_003181		Approved		uc003quu.2	O15178	OTTHUMG00000015991	ENST00000296946.2:c.419C>T	6.37:g.166580132G>A	ENSP00000296946:p.Pro140Leu	27	0		27	7	NM_003181	E7ERD6|Q4KMP4	Missense_Mutation	SNP	ENST00000296946.2	37	CCDS5290.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.032784	0.75504	4.54E-4	0.0	ENSG00000164458	ENST00000366876;ENST00000296946;ENST00000366871	D;D;D	0.87729	-2.29;-2.29;-2.29	4.61	4.61	0.57282	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.124816	0.53938	D	0.000052	D	0.89553	0.6748	M	0.82132	2.575	0.80722	D	1	P;D;P	0.53151	0.758;0.958;0.84	P;P;P	0.57283	0.662;0.817;0.817	D	0.87639	0.2521	10	0.19147	T	0.46	.	16.8251	0.85929	0.0:0.0:1.0:0.0	.	140;140;140	E7ERD6;O15178;Q4KMP4	.;BRAC_HUMAN;.	L	140	ENSP00000355841:P140L;ENSP00000296946:P140L;ENSP00000355836:P140L	ENSP00000296946:P140L	P	-	2	0	T	166500122	1.000000	0.71417	0.957000	0.39632	0.919000	0.55068	7.165000	0.77544	2.276000	0.75962	0.655000	0.94253	CCC	.		0.682	T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043037.2	NM_003181	
NEU4	129807	hgsc.bcm.edu	37	2	242757381	242757381	+	Nonsense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:242757381G>A	ENST00000391969.2	+	5	1173	c.462G>A	c.(460-462)tgG>tgA	p.W154*	NEU4_ENST00000407683.1_Nonsense_Mutation_p.W154*|NEU4_ENST00000405370.1_Nonsense_Mutation_p.W154*|NEU4_ENST00000404257.1_Nonsense_Mutation_p.W166*|NEU4_ENST00000325935.6_Nonsense_Mutation_p.W167*	NM_001167602.1	NP_001161074.1	Q8WWR8	NEUR4_HUMAN	sialidase 4	154					ganglioside catabolic process (GO:0006689)|glycoprotein catabolic process (GO:0006516)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|organelle inner membrane (GO:0019866)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			breast(1)|lung(10)|prostate(2)|skin(2)	15		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		CTGCAGACTGGGCCACATTCG	0.711																																					p.W167X		.											.	.	.	0			c.G501A						.						18.0	17.0	17.0					2																	242757381		2194	4290	6484	SO:0001587	stop_gained	129807	exon4			AGACTGGGCCACA	BC012899	CCDS2553.1, CCDS54441.1, CCDS54442.1	2q37.3	2008-02-05			ENSG00000204099	ENSG00000204099			21328	protein-coding gene	gene with protein product		608527					Standard	NM_001167600		Approved		uc010fzr.3	Q8WWR8	OTTHUMG00000133412	ENST00000391969.2:c.462G>A	2.37:g.242757381G>A	ENSP00000375830:p.Trp154*	7	0		23	6	NM_001167599	A8K056|J3KNJ5|Q96D64	Nonsense_Mutation	SNP	ENST00000391969.2	37	CCDS54442.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.814796|5.814796	0.96982|0.96982	.|.	.|.	ENSG00000204099|ENSG00000204099	ENST00000415936;ENST00000426032|ENST00000407683;ENST00000405370;ENST00000472793;ENST00000423583;ENST00000404257;ENST00000391969;ENST00000325935;ENST00000420288	T;T|.	0.45276|.	0.92;0.9|.	4.47|4.47	4.47|4.47	0.54385|0.54385	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.44726|.	0.1307|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.36040|.	-0.9764|.	6|.	0.39692|0.02654	T|T	0.17|1	-20.7656|-20.7656	17.1412|17.1412	0.86754|0.86754	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	E|X	69;81|154;154;164;154;166;154;167;154	ENSP00000397167:G69E;ENSP00000406678:G81E|.	ENSP00000397167:G69E|ENSP00000320318:W167X	G|W	+|+	2|3	0|0	NEU4|NEU4	242406054|242406054	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.059000|0.059000	0.15707|0.15707	6.996000|6.996000	0.76263|0.76263	2.033000|2.033000	0.60031|0.60031	0.443000|0.443000	0.29094|0.29094	GGG|TGG	.		0.711	NEU4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257270.2	NM_080741	
POLR3C	10623	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	145601830	145601830	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:145601830T>C	ENST00000334163.3	-	6	861	c.701A>G	c.(700-702)tAt>tGt	p.Y234C	POLR3C_ENST00000471254.1_5'UTR|POLR3C_ENST00000369294.1_Missense_Mutation_p.Y234C	NM_006468.6	NP_006459.3	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide C (62kD)	234				KRPKYTTDNKEPIPDDGIYWQA -> RDQNILQITRXPFQM MGFIGRP (in Ref. 1; AAB63675). {ECO:0000305}.	defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			GGCCTGCCAATAAATCCCATC	0.453																																					p.Y234C		.											.	.	.	0			c.A701G						.						131.0	125.0	127.0					1																	145601830		2203	4300	6503	SO:0001583	missense	10623	exon6			TGCCAATAAATCC	AJ238234	CCDS72864.1	1q21	2013-01-21			ENSG00000186141	ENSG00000186141		"""RNA polymerase subunits"""	30076	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006468		Approved	RPC62, RPC3	uc001eoh.3	Q9BUI4	OTTHUMG00000013753	ENST00000334163.3:c.701A>G	1.37:g.145601830T>C	ENSP00000334564:p.Tyr234Cys	41	0		51	22	NM_006468	O15317|Q9Y3R6	Missense_Mutation	SNP	ENST00000334163.3	37	CCDS921.1	.	.	.	.	.	.	.	.	.	.	T	15.94	2.981118	0.53827	.	.	ENSG00000186141	ENST00000334163;ENST00000369294	T;T	0.47177	0.85;0.85	5.66	5.66	0.87406	RNA polymerase III Rpc82, C -terminal (1);	0.115873	0.64402	D	0.000011	T	0.34513	0.0900	M	0.64404	1.975	0.58432	D	0.999995	P;B;B	0.46859	0.885;0.371;0.421	B;B;B	0.41271	0.352;0.151;0.233	T	0.30179	-0.9987	10	0.42905	T	0.14	-11.8978	13.8445	0.63459	0.0:0.0:0.0:1.0	.	234;234;234	E9PHH9;Q9BUI4;Q53F76	.;RPC3_HUMAN;.	C	234	ENSP00000334564:Y234C;ENSP00000358300:Y234C	ENSP00000334564:Y234C	Y	-	2	0	POLR3C	144313187	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	4.466000	0.60148	2.148000	0.66965	0.379000	0.24179	TAT	.		0.453	POLR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038542.1	NM_006468	
SLC9A7	84679	hgsc.bcm.edu	37	X	46541898	46541898	+	Missense_Mutation	SNP	G	G	T	rs145339243		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chrX:46541898G>T	ENST00000328306.4	-	2	423	c.398C>A	c.(397-399)aCt>aAt	p.T133N		NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	133					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						GTCTTCCTGAGTGCAGCTGAG	0.488																																					p.T133N	Pancreas(118;454 1696 1930 13865 39976)	.											.	.	.	0			c.C398A						.						77.0	58.0	64.0					X																	46541898		2203	4300	6503	SO:0001583	missense	84679	exon2			TCCTGAGTGCAGC	AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.398C>A	X.37:g.46541898G>T	ENSP00000330320:p.Thr133Asn	51	0		48	4	NM_001257291	O75827|Q5JXP9	Missense_Mutation	SNP	ENST00000328306.4	37	CCDS14269.1	.	.	.	.	.	.	.	.	.	.	G	10.47	1.360159	0.24598	.	.	ENSG00000065923	ENST00000328306	T	0.54479	0.57	5.96	4.13	0.48395	Cation/H+ exchanger (1);	0.363234	0.27917	N	0.017322	T	0.26702	0.0653	N	0.02181	-0.65	0.33353	D	0.571333	B	0.13594	0.008	B	0.15052	0.012	T	0.15037	-1.0451	10	0.15066	T	0.55	.	15.6837	0.77393	0.0:0.2516:0.7484:0.0	.	133	Q96T83	SL9A7_HUMAN	N	133	ENSP00000330320:T133N	ENSP00000330320:T133N	T	-	2	0	SLC9A7	46426842	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	3.637000	0.54324	0.607000	0.29982	0.600000	0.82982	ACT	.		0.488	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056370.1	NM_032591	
ADAM12	8038	hgsc.bcm.edu	37	10	127806650	127806650	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr10:127806650G>T	ENST00000368679.4	-	6	878	c.569C>A	c.(568-570)gCa>gAa	p.A190E	ADAM12_ENST00000368676.4_Missense_Mutation_p.A190E	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	190					cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		CACATTCTTTGCAGCGAGGTT	0.478																																					p.A190E		.											ADAM12_ENST00000368679,colon,carcinoma,0,3	ADAM12_ENST00000368679	0	0			c.C569A						.						246.0	215.0	225.0					10																	127806650		2203	4300	6503	SO:0001583	missense	8038	exon6			TTCTTTGCAGCGA	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.569C>A	10.37:g.127806650G>T	ENSP00000357668:p.Ala190Glu	46	0		44	2	NM_021641	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	ENST00000368679.4	37	CCDS7653.1	.	.	.	.	.	.	.	.	.	.	G	7.813	0.716218	0.15306	.	.	ENSG00000148848	ENST00000368679;ENST00000368676;ENST00000448723	T;T;T	0.21361	4.79;2.01;3.72	4.89	-3.62	0.04543	.	1.354340	0.05027	N	0.473950	T	0.06781	0.0173	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.30542	0.187;0.284;0.284;0.141;0.282	B;B;B;B;B	0.27076	0.021;0.047;0.047;0.076;0.032	T	0.19063	-1.0317	10	0.02654	T	1	.	2.1993	0.03919	0.505:0.1107:0.1597:0.2247	.	187;187;190;187;190	A8K6G4;O43184-3;O43184-2;O43184-4;O43184	.;.;.;.;ADA12_HUMAN	E	190;190;187	ENSP00000357668:A190E;ENSP00000357665:A190E;ENSP00000391268:A187E	ENSP00000357665:A190E	A	-	2	0	ADAM12	127796640	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.244000	0.08903	-0.571000	0.06014	-0.137000	0.14449	GCA	.		0.478	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		
MYT1L	23040	hgsc.bcm.edu;bcgsc.ca	37	2	1926757	1926757	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:1926757C>T	ENST00000399161.2	-	10	1531	c.784G>A	c.(784-786)Gtg>Atg	p.V262M	MYT1L_ENST00000428368.2_Missense_Mutation_p.V262M	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	262					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.V262L(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		AGGGAGTCCACTGTTTCTCTA	0.428																																					p.V262M		.											.	.	.	1	Substitution - Missense(1)	lung(1)	c.G784A						.						188.0	181.0	183.0					2																	1926757		1941	4135	6076	SO:0001583	missense	23040	exon10			AGTCCACTGTTTC	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.784G>A	2.37:g.1926757C>T	ENSP00000382114:p.Val262Met	81	0		86	4	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37		.	.	.	.	.	.	.	.	.	.	C	13.71	2.319429	0.41096	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.57752	0.38;0.38	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.65974	0.2743	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.91635	0.916;0.999	T	0.63532	-0.6616	10	0.49607	T	0.09	-45.9005	20.6439	0.99570	0.0:1.0:0.0:0.0	.	262;262	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	M	262;210;262	ENSP00000382114:V262M;ENSP00000396103:V262M	ENSP00000295067:V210M	V	-	1	0	MYT1L	1905764	1.000000	0.71417	0.972000	0.41901	0.120000	0.20174	5.928000	0.70088	2.884000	0.98904	0.655000	0.94253	GTG	.		0.428	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
MBNL3	55796	hgsc.bcm.edu	37	X	131526199	131526199	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chrX:131526199G>T	ENST00000370853.3	-	3	584	c.506C>A	c.(505-507)cCa>cAa	p.P169Q	MBNL3_ENST00000538204.1_Missense_Mutation_p.P119Q|MBNL3_ENST00000370849.3_Missense_Mutation_p.P119Q|MBNL3_ENST00000370839.3_Missense_Mutation_p.P169Q|MBNL3_ENST00000394311.2_Missense_Mutation_p.P73Q|RAP2C-AS1_ENST00000421483.2_RNA|RAP2C-AS1_ENST00000441399.2_RNA|MBNL3_ENST00000473364.1_5'UTR|MBNL3_ENST00000370844.1_Missense_Mutation_p.P73Q|MBNL3_ENST00000370857.3_Missense_Mutation_p.P169Q	NM_018388.3	NP_060858.2	Q9NUK0	MBNL3_HUMAN	muscleblind-like splicing regulator 3	169	Pro-rich.				mRNA processing (GO:0006397)|multicellular organismal development (GO:0007275)|negative regulation of myoblast differentiation (GO:0045662)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|prostate(2)	16	Acute lymphoblastic leukemia(192;0.000127)					CATCAGTTTTGGGCCAACAGC	0.428																																					p.P169Q		.											.	.	.	0			c.C506A						.						114.0	100.0	105.0					X																	131526199		2203	4300	6503	SO:0001583	missense	55796	exon3			AGTTTTGGGCCAA	AF491305	CCDS14633.1, CCDS14634.1, CCDS55492.1, CCDS55493.1, CCDS55494.1	Xq26.2	2013-01-18	2012-02-23		ENSG00000076770	ENSG00000076770		"""Zinc fingers, CCCH-type domain containing"""	20564	protein-coding gene	gene with protein product		300413	"""muscleblind-like 3 (Drosophila)"""			12297108, 10970838	Standard	NM_018388		Approved	CHCR, FLJ11316, MBLX39, MBXL	uc004ewv.4	Q9NUK0	OTTHUMG00000022426	ENST00000370853.3:c.506C>A	X.37:g.131526199G>T	ENSP00000359890:p.Pro169Gln	117	0		99	3	NM_018388	Q5JXN8|Q5JXN9|Q5JXP4|Q6UDQ1|Q8IUR4|Q8TAD9|Q8TAF4|Q9H0Z7|Q9UF37	Missense_Mutation	SNP	ENST00000370853.3	37	CCDS14633.1	.	.	.	.	.	.	.	.	.	.	G	8.054	0.766565	0.15983	.	.	ENSG00000076770	ENST00000394311;ENST00000538204;ENST00000370857;ENST00000370853;ENST00000370849;ENST00000370839;ENST00000370844;ENST00000436215;ENST00000421707	T;T;T;T;T;T;T;T;T	0.38887	1.11;1.11;1.11;1.11;1.11;1.11;1.11;1.11;1.11	5.56	2.45	0.29901	.	0.248214	0.34853	N	0.003638	T	0.11707	0.0285	N	0.00996	-1.065	0.33449	D	0.58335	B;B;B;B;B	0.22683	0.004;0.073;0.008;0.073;0.004	B;B;B;B;B	0.25405	0.009;0.042;0.02;0.06;0.009	T	0.35674	-0.9779	10	0.02654	T	1	-0.4969	6.9145	0.24352	0.0984:0.0:0.295:0.6066	.	119;169;169;119;73	Q9NUK0-4;Q9NUK0;Q9NUK0-2;Q9NUK0-3;Q8IUR4	.;MBNL3_HUMAN;.;.;.	Q	73;119;169;169;119;169;73;73;73	ENSP00000377848:P73Q;ENSP00000439618:P119Q;ENSP00000359894:P169Q;ENSP00000359890:P169Q;ENSP00000359886:P119Q;ENSP00000359876:P169Q;ENSP00000359881:P73Q;ENSP00000406014:P73Q;ENSP00000402128:P73Q	ENSP00000359876:P169Q	P	-	2	0	MBNL3	131353880	1.000000	0.71417	0.262000	0.24481	0.450000	0.32258	3.168000	0.50801	0.488000	0.27723	0.538000	0.68166	CCA	.		0.428	MBNL3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058319.1	NM_018388	
OR5P2	120065	hgsc.bcm.edu	37	11	7818383	7818383	+	Missense_Mutation	SNP	G	G	C	rs138967151	byFrequency	TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr11:7818383G>C	ENST00000329434.2	-	1	137	c.107C>G	c.(106-108)tCt>tGt	p.S36C	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153444.1	NP_703145.1	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P, member 2	36						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	22				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GAGATTACCAGATAGGATGAT	0.438																																					p.S36C		.											.,7	.	68	0			c.C107G						.						56.0	69.0	65.0					11																	7818383		2098	4292	6390	SO:0001583	missense	120065	exon1			TTACCAGATAGGA	AF173006	CCDS7782.1	11p15.4	2012-08-09			ENSG00000183303	ENSG00000183303		"""GPCR / Class A : Olfactory receptors"""	14783	protein-coding gene	gene with protein product							Standard	NM_153444		Approved	JCG3	uc001mfp.1	Q8WZ92	OTTHUMG00000165668	ENST00000329434.2:c.107C>G	11.37:g.7818383G>C	ENSP00000331823:p.Ser36Cys	13	1		27	2	NM_153444	Q3MIS8	Missense_Mutation	SNP	ENST00000329434.2	37	CCDS7782.1	.	.	.	.	.	.	.	.	.	.	G	2.219	-0.378843	0.05000	.	.	ENSG00000183303	ENST00000329434	T	0.00454	7.32	5.5	-1.19	0.09585	.	0.725764	0.12849	N	0.434127	T	0.00210	0.0006	N	0.12961	0.28	0.09310	N	1	B	0.14438	0.01	B	0.17979	0.02	T	0.36939	-0.9727	10	0.66056	D	0.02	-19.0492	4.8352	0.13460	0.4091:0.315:0.2759:0.0	.	36	Q8WZ92	OR5P2_HUMAN	C	36	ENSP00000331823:S36C	ENSP00000331823:S36C	S	-	2	0	OR5P2	7774959	0.000000	0.05858	0.150000	0.22450	0.088000	0.18126	0.516000	0.22817	-0.068000	0.12953	0.555000	0.69702	TCT	.		0.438	OR5P2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385696.1	NM_153444	
RECQL4	9401	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	145739898	145739898	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr8:145739898C>T	ENST00000428558.2	-	10	1673	c.1632G>A	c.(1630-1632)ctG>ctA	p.L544L	CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000532237.1_5'UTR	NM_004260.3	NP_004251.3	O94761	RECQ4_HUMAN	RecQ protein-like 4	544	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)|multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|bubble DNA binding (GO:0000405)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GACACGGTGGCAGGCCAGACA	0.627			"""N, F, S"""			"""osteosarcoma, skin basal and sqamous cell"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Rothmund-Thomson syndrome;RAPADILINO syndrome;Baller-Gerold syndrome																												p.L544L		.	yes	Rec		Rothmund-Thompson Syndrome	8	8q24.3	9401	RecQ protein-like 4		M	.	.	.	0			c.G1632A						.						36.0	39.0	38.0					8																	145739898		2086	4199	6285	SO:0001819	synonymous_variant	9401	exon10	Familial Cancer Database	RTS, Poikiloderma Atrophicans and Cataract, Congenital Poikiloderma; ;Craniosynostosis with Radial Defects	CGGTGGCAGGCCA	AB006532	CCDS75804.1	8q24.3	2014-09-17	2014-03-07	2014-03-07		ENSG00000160957			9949	protein-coding gene	gene with protein product		603780				9878247, 15960976	Standard	NM_004260		Approved	RecQ4	uc003zdj.3	O94761		ENST00000428558.2:c.1632G>A	8.37:g.145739898C>T		27	0		31	16	NM_004260	Q3Y424|Q96DW2|Q96F55	Silent	SNP	ENST00000428558.2	37																																																																																				.		0.627	RECQL4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_004260	
PTCHD2	57540	hgsc.bcm.edu	37	1	11596598	11596598	+	Missense_Mutation	SNP	C	C	T	rs201820638		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:11596598C>T	ENST00000294484.6	+	21	4172	c.4034C>T	c.(4033-4035)gCg>gTg	p.A1345V	PTCHD2_ENST00000389575.3_Missense_Mutation_p.A1345V|PTCHD2_ENST00000304391.6_Silent_p.G231G	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1345					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GGCATCATGGCGCCCAGCTCT	0.652																																					p.A1345V		.											PTCHD2,NS,carcinoma,0,1	PTCHD2	0	0			c.C4034T						.	C	VAL/ALA	0,4382		0,0,2191	65.0	68.0	67.0		4034	3.0	0.9	1		67	1,8563	1.2+/-3.3	0,1,4281	no	missense	PTCHD2	NM_020780.1	64	0,1,6472	TT,TC,CC		0.0117,0.0,0.0077	probably-damaging	1345/1393	11596598	1,12945	2191	4282	6473	SO:0001583	missense	57540	exon21			TCATGGCGCCCAG	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.4034C>T	1.37:g.11596598C>T	ENSP00000294484:p.Ala1345Val	22	0		19	2	NM_020780	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	37	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.358065	0.82243	0.0	1.17E-4	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.90324	-2.65;-2.64	5.02	3.0	0.34707	Membrane transport protein, MMPL type (1);	0.238909	0.32935	N	0.005463	D	0.91287	0.7253	L	0.36672	1.1	0.35767	D	0.820609	D	0.76494	0.999	P	0.62089	0.898	D	0.93871	0.7162	10	0.87932	D	0	-13.4323	13.7593	0.62956	0.0:0.4314:0.5686:0.0	.	1345	Q9P2K9	PTHD2_HUMAN	V	1345	ENSP00000294484:A1345V;ENSP00000374226:A1345V	ENSP00000294484:A1345V	A	+	2	0	PTCHD2	11519185	0.996000	0.38824	0.859000	0.33776	0.989000	0.77384	2.715000	0.47210	1.091000	0.41335	-0.311000	0.09066	GCG	0.001		0.652	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
OR2G3	81469	hgsc.bcm.edu	37	1	247769640	247769640	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:247769640C>A	ENST00000320002.2	+	1	785	c.753C>A	c.(751-753)ttC>ttA	p.F251L	RP11-978I15.10_ENST00000435333.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA|RNU6-691P_ENST00000516585.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	251						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F251L(2)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TGATTATATTCTATGGCACCA	0.488																																					p.F251L		.											OR2G3,NS,carcinoma,0,1	OR2G3	0	2	Substitution - Missense(2)	lung(2)	c.C753A						.						109.0	102.0	104.0					1																	247769640		2203	4300	6503	SO:0001583	missense	81469	exon1			TATATTCTATGGC	BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.753C>A	1.37:g.247769640C>A	ENSP00000326301:p.Phe251Leu	27	0		45	2	NM_001001914	B2RN64|Q5JQT1|Q6IF45	Missense_Mutation	SNP	ENST00000320002.2	37	CCDS31093.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.847862	0.51164	.	.	ENSG00000177476	ENST00000320002	T	0.00285	8.3	3.65	1.63	0.23807	GPCR, rhodopsin-like superfamily (1);	0.197068	0.24361	U	0.039187	T	0.00580	0.0019	M	0.83012	2.62	0.22401	N	0.999134	D	0.89917	1.0	D	0.91635	0.999	T	0.41251	-0.9519	10	0.72032	D	0.01	.	7.4028	0.26973	0.0:0.7608:0.0:0.2392	.	251	Q8NGZ4	OR2G3_HUMAN	L	251	ENSP00000326301:F251L	ENSP00000326301:F251L	F	+	3	2	OR2G3	245836263	0.000000	0.05858	0.765000	0.31456	0.644000	0.38419	-1.153000	0.03169	0.283000	0.22279	0.492000	0.49549	TTC	.		0.488	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097624.1		
EPPK1	83481	hgsc.bcm.edu	37	8	144940742	144940742	+	Missense_Mutation	SNP	G	G	A	rs549060166	byFrequency	TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr8:144940742G>A	ENST00000525985.1	-	2	6751	c.6680C>T	c.(6679-6681)gCg>gTg	p.A2227V				P58107	EPIPL_HUMAN	epiplakin 1	2227						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CAGGACGCCCGCGATGCAGCT	0.677													G|||	3	0.000599042	0.0023	0.0	5008	,	,		61066	0.0		0.0	False		,,,				2504	0.0				p.A2227V		.											.	.	.	0			c.C6680T						.																																			SO:0001583	missense	83481	exon1			ACGCCCGCGATGC	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6680C>T	8.37:g.144940742G>A	ENSP00000436337:p.Ala2227Val	43	0		70	5	NM_031308	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	G	35	5.489922	0.96339	.	.	ENSG00000227184	ENST00000525985	T	0.74526	-0.85	4.67	4.67	0.58626	.	.	.	.	.	D	0.86936	0.6053	M	0.84433	2.695	0.47778	D	0.999511	D	0.89917	1.0	D	0.97110	1.0	D	0.88471	0.3062	9	0.56958	D	0.05	.	15.1226	0.72457	0.0:0.0:1.0:0.0	.	2227	E9PPU0	.	V	2227	ENSP00000436337:A2227V	ENSP00000436337:A2227V	A	-	2	0	EPPK1	145012730	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.474000	0.73578	2.420000	0.82092	0.591000	0.81541	GCG	.		0.677	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
MAML2	84441	hgsc.bcm.edu;bcgsc.ca	37	11	95825254	95825254	+	Silent	SNP	C	C	T	rs61749250		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr11:95825254C>T	ENST00000524717.1	-	2	3225	c.1941G>A	c.(1939-1941)caG>caA	p.Q647Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	647					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q647Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgttgttgct	0.512			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q647Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	MAML2,caecum,carcinoma,0,2	MAML2	0	1	Substitution - coding silent(1)	endometrium(1)	c.G1941A						.	C		0,4198		0,0,2099	35.0	40.0	38.0		1941	1.7	0.1	11	dbSNP_129	38	5,8237		0,5,4116	no	coding-synonymous	MAML2	NM_032427.1		0,5,6215	TT,TC,CC		0.0607,0.0,0.0402		647/1157	95825254	5,12435	2099	4121	6220	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGTTGT	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1941G>A	11.37:g.95825254C>T		51	0		39	4	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.		0.512	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
FRY	10129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	32753081	32753081	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr13:32753081C>A	ENST00000380250.3	+	22	3278	c.2782C>A	c.(2782-2784)Ccc>Acc	p.P928T		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	928						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		AGTTGCAAAACCCAGTATTAT	0.443																																					p.P928T		.											.	.	.	0			c.C2782A						.						81.0	81.0	81.0					13																	32753081		1894	4132	6026	SO:0001583	missense	10129	exon22			GCAAAACCCAGTA	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.2782C>A	13.37:g.32753081C>A	ENSP00000369600:p.Pro928Thr	77	0		77	21	NM_023037	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	37	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	C	18.52	3.641084	0.67244	.	.	ENSG00000073910	ENST00000380250	T	0.24538	1.85	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.34077	0.0885	M	0.68317	2.08	0.80722	D	1	B	0.18166	0.026	B	0.17098	0.017	T	0.07731	-1.0757	10	0.54805	T	0.06	.	20.0204	0.97499	0.0:1.0:0.0:0.0	.	928	Q5TBA9	FRY_HUMAN	T	928	ENSP00000369600:P928T	ENSP00000369600:P928T	P	+	1	0	FRY	31651081	1.000000	0.71417	0.995000	0.50966	0.999000	0.98932	7.431000	0.80335	2.729000	0.93468	0.650000	0.86243	CCC	.		0.443	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
KCNK17	89822	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	39278778	39278778	+	Silent	SNP	G	G	A	rs368724952		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr6:39278778G>A	ENST00000373231.4	-	2	475	c.243C>T	c.(241-243)gtC>gtT	p.V81V	KCNK17_ENST00000453413.2_Silent_p.V81V	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	81					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						ATGCTTGGACGACATCCTGGG	0.557																																					p.V81V		.											.	.	.	0			c.C243T						.						118.0	109.0	112.0					6																	39278778		2203	4300	6503	SO:0001819	synonymous_variant	89822	exon2			TTGGACGACATCC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.243C>T	6.37:g.39278778G>A		27	0		30	4	NM_001135111	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Silent	SNP	ENST00000373231.4	37	CCDS4842.1																																																																																			.		0.557	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
DGKI	9162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	137150763	137150763	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr7:137150763T>C	ENST00000288490.5	-	27	2527	c.2527A>G	c.(2527-2529)Atg>Gtg	p.M843V	DGKI_ENST00000424189.2_Missense_Mutation_p.M856V|DGKI_ENST00000453654.2_Missense_Mutation_p.M553V|DGKI_ENST00000446122.1_Missense_Mutation_p.M825V	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	843					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						GAAATCTCCATCACAAAGTGC	0.448																																					p.M843V		.											.	.	.	0			c.A2527G						.						70.0	73.0	72.0					7																	137150763		2203	4300	6503	SO:0001583	missense	9162	exon27			TCTCCATCACAAA	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2527A>G	7.37:g.137150763T>C	ENSP00000288490:p.Met843Val	49	0		45	17	NM_004717	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	37	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	T	11.22	1.573588	0.28092	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.30981	2.06;1.51;1.7	5.82	5.82	0.92795	.	0.140824	0.64402	D	0.000004	T	0.14614	0.0353	N	0.02539	-0.55	0.41919	D	0.990503	B;B	0.09022	0.0;0.002	B;B	0.08055	0.002;0.003	T	0.15578	-1.0432	10	0.20519	T	0.43	.	16.1814	0.81903	0.0:0.0:0.0:1.0	.	553;843	E9PFX6;O75912	.;DGKI_HUMAN	V	553;801;846;843;825	ENSP00000392161:M553V;ENSP00000288490:M843V;ENSP00000399131:M825V	ENSP00000288490:M843V	M	-	1	0	DGKI	136801303	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.335000	0.79234	2.234000	0.73211	0.533000	0.62120	ATG	.		0.448	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717	
PPM1G	5496	hgsc.bcm.edu	37	2	27605369	27605369	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:27605369G>T	ENST00000344034.4	-	8	1569	c.1305C>A	c.(1303-1305)ttC>ttA	p.F435L	PPM1G_ENST00000350803.4_Missense_Mutation_p.F435L|ZNF513_ENST00000323703.6_5'Flank|ZNF513_ENST00000407879.1_5'Flank	NM_177983.2	NP_817092.1	O15355	PPM1G_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1G	435					cell cycle arrest (GO:0007050)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					CAATGACCATGAATTCATGGT	0.483																																					p.F435L		.											PPM1G,NS,carcinoma,0,1	PPM1G	0	0			c.C1305A						.						244.0	228.0	233.0					2																	27605369		2203	4300	6503	SO:0001583	missense	5496	exon8			GACCATGAATTCA	Y13936	CCDS1752.1	2p23.3	2012-04-17	2010-03-05		ENSG00000115241	ENSG00000115241	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9278	protein-coding gene	gene with protein product	"""PP2C, gamma"", ""protein phosphatase 2C, gamma isoform"""	605119	"""protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform"""			9276438	Standard	NM_177983		Approved	PP2CG, PP2Cgamma	uc002rkl.4	O15355	OTTHUMG00000097788	ENST00000344034.4:c.1305C>A	2.37:g.27605369G>T	ENSP00000342778:p.Phe435Leu	35	0		31	2	NM_177983		Missense_Mutation	SNP	ENST00000344034.4	37	CCDS1752.1	.	.	.	.	.	.	.	.	.	.	G	18.31	3.596236	0.66332	.	.	ENSG00000115241	ENST00000344034;ENST00000350803;ENST00000544412;ENST00000395543	T;T	0.25250	1.81;1.81	5.64	1.88	0.25563	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.48857	0.1523	M	0.82323	2.585	0.80722	D	1	D;D	0.63880	0.991;0.993	P;D	0.74348	0.843;0.983	T	0.48725	-0.9010	10	0.87932	D	0	-8.092	9.2151	0.37342	0.2981:0.0:0.7019:0.0	.	236;435	Q59GB2;O15355	.;PPM1G_HUMAN	L	435;435;418;236	ENSP00000342778:F435L;ENSP00000264714:F435L	ENSP00000342778:F435L	F	-	3	2	PPM1G	27458873	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	4.764000	0.62264	0.344000	0.23847	-0.150000	0.13652	TTC	.		0.483	PPM1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215032.1	NM_002707	
SCLY	51540	hgsc.bcm.edu	37	2	238991562	238991562	+	Intron	SNP	T	T	C	rs367917223|rs3835105|rs397841019		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:238991562T>C	ENST00000555827.1	+	7	841				SCLY_ENST00000422984.2_Intron|SCLY_ENST00000373332.3_Intron|SCLY_ENST00000254663.6_Intron|SCLY_ENST00000429612.2_Intron|SCLY_ENST00000409736.2_Intron			Q96I15	SCLY_HUMAN	selenocysteine lyase						cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)	pyridoxal phosphate binding (GO:0030170)|selenocysteine lyase activity (GO:0009000)|transferase activity (GO:0016740)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	22		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;1.37e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.6e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.25e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000128)|Lung(119;0.0118)|LUSC - Lung squamous cell carcinoma(224;0.0285)		ATTCTCTTTCTTTTTTTTTTT	0.423																																					.	Melanoma(24;424 891 11947 32582 36034)|Ovarian(46;648 1065 26199 32764 45893)	.											.	.	.	0			.						.																																			SO:0001627	intron_variant	0	.			TCTTTCTTTTTTT	AF175767	CCDS2524.1, CCDS2524.2	2q37.3	2008-02-05			ENSG00000132330	ENSG00000132330			18161	protein-coding gene	gene with protein product	"""putative selenocysteine lyase"""	611056				10692412	Standard	NM_016510		Approved	SCL	uc010fyv.4	Q96I15	OTTHUMG00000133336	ENST00000555827.1:c.778-327T>C	2.37:g.238991562T>C		8	1		16	4	.	B9A068|J3KN06|Q53SN1|Q53SN8|Q7L670|Q9NVT7|Q9NZR7	RNA	SNP	ENST00000555827.1	37																																																																																				.		0.423	SCLY-204	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_016510	
ZNF829	374899	hgsc.bcm.edu;bcgsc.ca	37	19	37382535	37382535	+	Silent	SNP	C	C	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr19:37382535C>A	ENST00000391711.3	-	6	1522	c.1158G>T	c.(1156-1158)ggG>ggT	p.G386G	ZNF829_ENST00000520965.1_Silent_p.G467G|ZNF345_ENST00000526123.1_Intron|ZNF345_ENST00000432005.2_Intron	NM_001037232.3	NP_001032309.2	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	386					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TAAAGGCCTTCCCACATTCAT	0.378																																					p.G467G		.											.	.	.	0			c.G1401T						.						73.0	77.0	75.0					19																	37382535		2201	4298	6499	SO:0001819	synonymous_variant	374899	exon6			GGCCTTCCCACAT	BC107131	CCDS42557.1, CCDS59380.1	19q13.12	2013-01-08			ENSG00000185869	ENSG00000185869		"""Zinc fingers, C2H2-type"", ""-"""	34032	protein-coding gene	gene with protein product							Standard	NM_001037232		Approved	DKFZp779O175	uc021utr.1	Q3KNS6	OTTHUMG00000048161	ENST00000391711.3:c.1158G>T	19.37:g.37382535C>A		66	0		62	4	NM_001171979	Q3KNS7|Q6ZNN0|Q7Z657	Silent	SNP	ENST00000391711.3	37	CCDS42557.1																																																																																			.		0.378	ZNF829-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109575.3	NM_001037232	
XPNPEP2	7512	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	128881717	128881717	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chrX:128881717G>T	ENST00000371106.3	+	7	817	c.625G>T	c.(625-627)Gag>Tag	p.E209*		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	209						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						TGCCCTGCAGGAGGCATTCAC	0.517																																					p.E209X		.											.	.	.	0			c.G625T						.						122.0	108.0	113.0					X																	128881717		2203	4299	6502	SO:0001587	stop_gained	7512	exon7			CTGCAGGAGGCAT	U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.625G>T	X.37:g.128881717G>T	ENSP00000360147:p.Glu209*	46	0		43	5	NM_003399	A0AV16|O75994	Nonsense_Mutation	SNP	ENST00000371106.3	37	CCDS14613.1	.	.	.	.	.	.	.	.	.	.	G	36	5.816141	0.96982	.	.	ENSG00000122121	ENST00000371106	.	.	.	4.82	3.01	0.34805	.	0.177349	0.49916	D	0.000130	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-15.8993	6.9144	0.24352	0.2025:0.0:0.7975:0.0	.	.	.	.	X	209	.	ENSP00000360147:E209X	E	+	1	0	XPNPEP2	128709398	0.041000	0.20044	0.611000	0.29010	0.922000	0.55478	0.518000	0.22847	0.290000	0.22444	0.513000	0.50165	GAG	.		0.517	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058210.1	NM_003399	
AIMP2	7965	hgsc.bcm.edu;bcgsc.ca	37	7	6062935	6062935	+	Splice_Site	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr7:6062935G>T	ENST00000223029.3	+	4	695	c.576G>T	c.(574-576)gtG>gtT	p.V192V	AIMP2_ENST00000400479.2_Splice_Site_p.V114V|EIF2AK1_ENST00000199389.6_3'UTR|AIMP2_ENST00000395236.2_Splice_Site_p.V123V	NM_006303.3	NP_006294.2	Q13155	AIMP2_HUMAN	aminoacyl tRNA synthetase complex-interacting multifunctional protein 2	192	Interaction with TP53.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|negative regulation of cell proliferation (GO:0008285)|positive regulation of protein ubiquitination (GO:0031398)|tRNA aminoacylation for protein translation (GO:0006418)|Type II pneumocyte differentiation (GO:0060510)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						TCTTTTCAGTGCCGAAGACGC	0.517																																					p.V192V		.											.	.	.	0			c.G576T						.						79.0	75.0	76.0					7																	6062935		2203	4300	6503	SO:0001630	splice_region_variant	7965	exon4			TTCAGTGCCGAAG	U24169	CCDS5344.1	7p22.1	2009-05-29			ENSG00000106305	ENSG00000106305			20609	protein-coding gene	gene with protein product		600859				8666379, 18695251	Standard	NM_006303		Approved	p38, PRO0992, JTV-1, JTV1	uc003spo.3	Q13155	OTTHUMG00000122077	ENST00000223029.3:c.575-1G>T	7.37:g.6062935G>T		42	0		62	4	NM_006303	Q75MR1|Q96CZ5|Q9P1L2	Silent	SNP	ENST00000223029.3	37	CCDS5344.1																																																																																			.		0.517	AIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242834.2	NM_006303	Silent
TINF2	26277	hgsc.bcm.edu	37	14	24710311	24710311	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr14:24710311C>T	ENST00000267415.7	-	5	860	c.519G>A	c.(517-519)gtG>gtA	p.V173V	TINF2_ENST00000558510.1_5'Flank|TINF2_ENST00000559019.1_Intron|TINF2_ENST00000540705.1_Silent_p.V138V|TINF2_ENST00000558566.1_Intron|TINF2_ENST00000538777.1_Intron|TINF2_ENST00000399423.4_Silent_p.V173V	NM_001099274.1	NP_001092744.1	Q9BSI4	TINF2_HUMAN	TERF1 (TRF1)-interacting nuclear factor 2	173					negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of protein ADP-ribosylation (GO:0010836)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of telomere maintenance (GO:0032206)|protein localization to chromosome (GO:0034502)|protein localization to chromosome, telomeric region (GO:0070198)|telomere assembly (GO:0032202)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	chromosome, telomeric region (GO:0000781)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinucleolar chromocenter (GO:0010370)	telomeric DNA binding (GO:0042162)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|prostate(1)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(265;0.0185)		TCCAACTCAGCACATCCTGAA	0.527									Congenital Dyskeratosis;Ataxia Pancytopenia syndrome																												p.V173V		.											TINF2_ENST00000267415,caecum,carcinoma,0,2	TINF2_ENST00000267415	0	0			c.G519A						.						154.0	152.0	153.0					14																	24710311		2068	4214	6282	SO:0001819	synonymous_variant	26277	exon5	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita;Myelocerebellar disorder	ACTCAGCACATCC	AF195512	CCDS41936.1, CCDS41937.1	14q12	2008-07-29				ENSG00000092330			11824	protein-coding gene	gene with protein product		604319				10581025, 18252230	Standard	NM_012461		Approved	TIN2	uc001woa.4	Q9BSI4		ENST00000267415.7:c.519G>A	14.37:g.24710311C>T		45	0		31	2	NM_001099274	B3W5Q7|Q9H904|Q9UHC2	Silent	SNP	ENST00000267415.7	37	CCDS41936.1																																																																																			.		0.527	TINF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415406.2		
TMEM43	79188	hgsc.bcm.edu	37	3	14183116	14183116	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr3:14183116G>T	ENST00000306077.4	+	12	1278	c.1024G>T	c.(1024-1026)Gac>Tac	p.D342Y	RP11-434D12.1_ENST00000601399.1_Intron|RP11-434D12.1_ENST00000608606.1_Intron	NM_024334.2	NP_077310.1	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	342					nuclear membrane organization (GO:0071763)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|cervix(3)|endometrium(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(2)	19						TGTTTTCCGAGACCTGGTCAA	0.577																																					p.D342Y		.											.	.	.	0			c.G1024T						.						181.0	140.0	154.0					3																	14183116		2203	4300	6503	SO:0001583	missense	79188	exon12			TTCCGAGACCTGG	BC008054	CCDS2618.1	3p25.1	2014-09-17			ENSG00000170876	ENSG00000170876			28472	protein-coding gene	gene with protein product		612048	"""arrhythmogenic right ventricular dysplasia 5"""	ARVD5		11230166, 18313022	Standard	NM_024334		Approved	MGC3222, DKFZp586G1919, LUMA	uc003byk.2	Q9BTV4	OTTHUMG00000129802	ENST00000306077.4:c.1024G>T	3.37:g.14183116G>T	ENSP00000303992:p.Asp342Tyr	52	0		45	3	NM_024334	Q7L4N5|Q8NC30|Q96A63|Q96F19|Q96JX0|Q9H076	Missense_Mutation	SNP	ENST00000306077.4	37	CCDS2618.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.007735	0.93287	.	.	ENSG00000170876	ENST00000306077	T	0.37058	1.22	5.71	5.71	0.89125	.	0.103355	0.64402	D	0.000004	T	0.48333	0.1494	L	0.29908	0.895	0.80722	D	1	D	0.61080	0.989	P	0.61070	0.883	T	0.46275	-0.9203	10	0.66056	D	0.02	-39.9708	19.8516	0.96743	0.0:0.0:1.0:0.0	.	342	Q9BTV4	TMM43_HUMAN	Y	342	ENSP00000303992:D342Y	ENSP00000303992:D342Y	D	+	1	0	TMEM43	14158117	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	9.114000	0.94329	2.685000	0.91497	0.585000	0.79938	GAC	.		0.577	TMEM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252030.2	NM_024334	
SIDT1	54847	hgsc.bcm.edu	37	3	113321990	113321990	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr3:113321990G>T	ENST00000264852.4	+	12	1982	c.1256G>T	c.(1255-1257)cGg>cTg	p.R419L	SIDT1_ENST00000393830.3_Missense_Mutation_p.R419L|SIDT1_ENST00000463226.1_3'UTR	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	419					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)			breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						AACATCATCCGGACCAAGGTA	0.502																																					p.R419L		.											SIDT1,mucosal,malignant_melanoma,0,1	SIDT1	0	0			c.G1256T						.						91.0	86.0	88.0					3																	113321990		2203	4300	6503	SO:0001583	missense	54847	exon12			TCATCCGGACCAA	AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.1256G>T	3.37:g.113321990G>T	ENSP00000264852:p.Arg419Leu	40	0		26	2	NM_017699	Q17RR4	Missense_Mutation	SNP	ENST00000264852.4	37	CCDS2974.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.954762	0.92726	.	.	ENSG00000072858	ENST00000264852;ENST00000393830	T;T	0.22743	1.94;1.94	5.63	5.63	0.86233	.	0.000000	0.64402	D	0.000010	T	0.50051	0.1593	M	0.83953	2.67	0.80722	D	1	D;D	0.56746	0.971;0.977	P;P	0.61940	0.863;0.896	T	0.47195	-0.9136	10	0.46703	T	0.11	-16.6897	20.047	0.97613	0.0:0.0:1.0:0.0	.	419;419	Q9NXL6-2;Q9NXL6	.;SIDT1_HUMAN	L	419	ENSP00000264852:R419L;ENSP00000377416:R419L	ENSP00000264852:R419L	R	+	2	0	SIDT1	114804680	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.391000	0.97249	2.802000	0.96397	0.563000	0.77884	CGG	.		0.502	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317564.1	NM_017699	
ARAF	369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	47426127	47426127	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chrX:47426127C>T	ENST00000377045.4	+	7	841	c.647C>T	c.(646-648)cCc>cTc	p.P216L	ARAF_ENST00000290277.6_Intron	NM_001256196.1|NM_001654.4	NP_001243125.1|NP_001645.1	P10398	ARAF_HUMAN	A-Raf proto-oncogene, serine/threonine kinase	216					cellular protein modification process (GO:0006464)|negative regulation of apoptotic process (GO:0043066)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			biliary_tract(1)|endometrium(4)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	29					Adenosine triphosphate(DB00171)	ACGTCCACTCCCAACGTCCAT	0.662																																					p.P219L		.											.	.	.	0			c.C656T						.						76.0	61.0	66.0					X																	47426127		2203	4300	6503	SO:0001583	missense	369	exon7			CCACTCCCAACGT	X04790	CCDS35232.1, CCDS59164.1, CCDS75970.1	Xp11.3-p11.23	2014-06-26	2014-06-26	2005-01-19	ENSG00000078061	ENSG00000078061			646	protein-coding gene	gene with protein product		311010	"""v-raf murine sarcoma 3611 viral oncogene homolog 1"""	ARAF1			Standard	NM_001654		Approved		uc004dic.2	P10398	OTTHUMG00000021446	ENST00000377045.4:c.647C>T	X.37:g.47426127C>T	ENSP00000366244:p.Pro216Leu	66	0		54	36	NM_001256196	P07557|Q5H9B2|Q5H9B3	Missense_Mutation	SNP	ENST00000377045.4	37	CCDS35232.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.037064	0.93630	.	.	ENSG00000078061	ENST00000377045	T	0.76186	-1.0	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.85792	0.5779	M	0.78456	2.415	0.80722	D	1	D;D	0.64830	0.992;0.994	P;D	0.71184	0.865;0.972	D	0.87731	0.2579	10	0.87932	D	0	.	15.4172	0.74980	0.0:1.0:0.0:0.0	.	216;82	P10398;B4DV85	ARAF_HUMAN;.	L	216	ENSP00000366244:P216L	ENSP00000366244:P216L	P	+	2	0	ARAF	47311071	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.334000	0.79224	2.233000	0.73108	0.544000	0.68410	CCC	.		0.662	ARAF-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056418.1		
NFE2L2	4780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	178098799	178098799	+	Missense_Mutation	SNP	T	T	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:178098799T>A	ENST00000397062.3	-	2	800	c.246A>T	c.(244-246)gaA>gaT	p.E82D	NFE2L2_ENST00000423513.1_Missense_Mutation_p.E66D|NFE2L2_ENST00000446151.2_Missense_Mutation_p.E66D|NFE2L2_ENST00000397063.4_Missense_Mutation_p.E66D|NFE2L2_ENST00000464747.1_Missense_Mutation_p.E66D	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	82					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E82D(8)|p.G81_F83delGEF(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TTGGGAGAAATTCACCTGTCT	0.433			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.E82D		.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	NFE2L2,NS,carcinoma,0,9	NFE2L2	0	9	Substitution - Missense(8)|Deletion - In frame(1)	endometrium(3)|liver(2)|upper_aerodigestive_tract(1)|cervix(1)|oesophagus(1)|kidney(1)	c.A246T						.						138.0	137.0	137.0					2																	178098799		1903	4104	6007	SO:0001583	missense	4780	exon2			GAGAAATTCACCT		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.246A>T	2.37:g.178098799T>A	ENSP00000380252:p.Glu82Asp	68	0		94	45	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	37	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.816244	0.90790	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.67;1.67;1.53	5.78	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.58395	0.2119	M	0.87180	2.865	0.53688	D	0.999979	D;D;D;D	0.89917	0.999;0.997;1.0;0.999	D;D;D;D	0.83275	0.991;0.978;0.996;0.991	T	0.64976	-0.6280	10	0.72032	D	0.01	.	11.2269	0.48888	0.0:0.0712:0.0:0.9288	.	66;66;66;82	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	D	66;82;66;66;66;66	ENSP00000380253:E66D;ENSP00000380252:E82D;ENSP00000411575:E66D;ENSP00000400073:E66D;ENSP00000412191:E66D;ENSP00000410015:E66D	ENSP00000380252:E82D	E	-	3	2	NFE2L2	177807045	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.909000	0.39917	2.210000	0.71456	0.460000	0.39030	GAA	.		0.433	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
HLA-B	3106	hgsc.bcm.edu	37	6	31324018	31324018	+	Missense_Mutation	SNP	G	G	A	rs41542712		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr6:31324018G>A	ENST00000412585.2	-	3	573	c.545C>T	c.(544-546)gCc>gTc	p.A182V		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	182	Alpha-2.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						CTCCAGGTAGGCTCTCCGCTG	0.697									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.A182V		.											.	.	.	0			c.C545T						.						26.0	19.0	22.0					6																	31324018		2148	4212	6360	SO:0001583	missense	3106	exon3	Familial Cancer Database	;Lichen Sclerosis, Familial	AGGTAGGCTCTCC	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.545C>T	6.37:g.31324018G>A	ENSP00000399168:p.Ala182Val	29	0		57	7	NM_005514	Q29764	Missense_Mutation	SNP	ENST00000412585.2	37	CCDS34394.1	.	.	.	.	.	.	.	.	.	.	N	12.33	1.905696	0.33628	.	.	ENSG00000234745	ENST00000412585;ENST00000428231;ENST00000452596;ENST00000434333	T;T	0.00848	5.62;5.62	3.18	1.21	0.21127	MHC class I, alpha chain, alpha1/alpha2 (4);MHC classes I/II-like antigen recognition protein (2);MHC class I-like antigen recognition (2);	1.200770	0.06721	N	0.774906	T	0.01387	0.0045	M	0.85542	2.76	0.18873	N	0.999984	P;P	0.52842	0.956;0.629	P;P	0.51415	0.669;0.504	T	0.42582	-0.9443	10	0.56958	D	0.05	.	9.2404	0.37493	0.0:0.0:0.3651:0.6349	rs41542712	182;182	P30480;P01889	1B42_HUMAN;1B07_HUMAN	V	182;61;61;193	ENSP00000399168:A182V;ENSP00000405931:A193V	ENSP00000399168:A182V	A	-	2	0	HLA-B	31431997	0.000000	0.05858	0.047000	0.18901	0.021000	0.10359	-0.587000	0.05780	0.136000	0.18733	0.297000	0.19635	GCC	0.001		0.697	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
IL12RB2	3595	hgsc.bcm.edu	37	1	67787288	67787288	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:67787288C>A	ENST00000262345.1	+	3	720	c.80C>A	c.(79-81)gCg>gAg	p.A27E	IL12RB2_ENST00000544434.1_Missense_Mutation_p.A27E|IL12RB2_ENST00000371000.1_Missense_Mutation_p.A27E|IL12RB2_ENST00000541374.1_Missense_Mutation_p.A27E	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	27					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)	p.A27G(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						ATTGCAGATGCGTGCAAGAGA	0.378																																					p.A27E		.											IL12RB2,NS,carcinoma,0,1	IL12RB2	0	1	Substitution - Missense(1)	lung(1)	c.C80A						.						105.0	96.0	99.0					1																	67787288		2203	4300	6503	SO:0001583	missense	3595	exon3			CAGATGCGTGCAA	U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.80C>A	1.37:g.67787288C>A	ENSP00000262345:p.Ala27Glu	40	0		67	3	NM_001559	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	ENST00000262345.1	37	CCDS638.1	.	.	.	.	.	.	.	.	.	.	C	5.262	0.233850	0.09969	.	.	ENSG00000081985	ENST00000262345;ENST00000371000;ENST00000541374;ENST00000544434	T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11	5.56	1.84	0.25277	Immunoglobulin C2-set-like, ligand-binding (1);	0.436821	0.25860	N	0.027824	T	0.27967	0.0689	N	0.19112	0.55	0.19775	N	0.99996	B;B;B;B	0.09022	0.002;0.0;0.001;0.0	B;B;B;B	0.13407	0.009;0.003;0.008;0.005	T	0.34104	-0.9842	10	0.02654	T	1	-3.9302	3.8963	0.09141	0.1587:0.1723:0.0:0.669	.	27;27;27;27	B4DGA4;F5H7L6;Q99665-2;Q99665	.;.;.;I12R2_HUMAN	E	27	ENSP00000262345:A27E;ENSP00000360039:A27E;ENSP00000445276:A27E;ENSP00000442443:A27E	ENSP00000262345:A27E	A	+	2	0	IL12RB2	67559876	0.138000	0.22547	0.998000	0.56505	0.009000	0.06853	0.049000	0.14099	0.068000	0.16574	-1.878000	0.00547	GCG	.		0.378	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2	NM_001559	
EML4	27436	hgsc.bcm.edu	37	2	42483696	42483696	+	Silent	SNP	T	T	C			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:42483696T>C	ENST00000318522.5	+	3	526	c.264T>C	c.(262-264)ggT>ggC	p.G88G	EML4_ENST00000401738.3_Silent_p.G88G|EML4_ENST00000402711.2_Silent_p.G88G	NM_019063.3	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	88					microtubule-based process (GO:0007017)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|mitotic spindle (GO:0072686)			EML4/ALK(543)	NS(2)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	12						ATGGAAGTGGTGCAAACAGAA	0.368			T	ALK	NSCLC																																p.G88G		.		Dom	yes		2	2p21	27436	echinoderm microtubule associated protein like 4		E	.	.	.	0			c.T264C						.						115.0	103.0	107.0					2																	42483696		2203	4300	6503	SO:0001819	synonymous_variant	27436	exon3			AAGTGGTGCAAAC	AF177377	CCDS1807.1, CCDS46266.1	2p21	2013-01-10		2002-02-15	ENSG00000143924	ENSG00000143924		"""WD repeat domain containing"""	1316	protein-coding gene	gene with protein product		607442		C2orf2			Standard	NM_019063		Approved	ROPP120, ELP120	uc002rsi.3	Q9HC35	OTTHUMG00000128603	ENST00000318522.5:c.264T>C	2.37:g.42483696T>C		93	0		110	5	NM_001145076	A6H8Y6|B2RBK3|B2RTW7|B5MCW9|Q3SWW0|Q53R29|Q53TW8|Q6PJ45|Q9NV40	Silent	SNP	ENST00000318522.5	37	CCDS1807.1																																																																																			.		0.368	EML4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250463.3	NM_019063	
ZMIZ2	83637	hgsc.bcm.edu	37	7	44806150	44806150	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr7:44806150T>C	ENST00000309315.4	+	18	2666	c.2543T>C	c.(2542-2544)tTg>tCg	p.L848S	ZMIZ2_ENST00000265346.7_Missense_Mutation_p.L822S|ZMIZ2_ENST00000433667.1_Missense_Mutation_p.L816S|ZMIZ2_ENST00000441627.1_Missense_Mutation_p.L848S|ZMIZ2_ENST00000413916.1_Missense_Mutation_p.L790S|ZMIZ2_ENST00000463931.1_3'UTR	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	848	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						CGGCAGTCCTTGGGCCAAGCG	0.652																																					p.L848S	NSCLC(20;604 852 1948 16908 50522)	.											.	.	.	0			c.T2543C						.						51.0	56.0	54.0					7																	44806150		1891	4125	6016	SO:0001583	missense	83637	exon18			AGTCCTTGGGCCA	AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.2543T>C	7.37:g.44806150T>C	ENSP00000311778:p.Leu848Ser	60	0		91	3	NM_031449	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Missense_Mutation	SNP	ENST00000309315.4	37	CCDS43576.1	.	.	.	.	.	.	.	.	.	.	T	7.083	0.570528	0.13560	.	.	ENSG00000122515	ENST00000413916;ENST00000309315;ENST00000441627;ENST00000433667;ENST00000265346;ENST00000414051	T;T;T;T;T	0.30182	1.57;1.54;1.54;1.54;1.56	5.19	5.19	0.71726	.	0.131614	0.32608	N	0.005876	T	0.21145	0.0509	L	0.29908	0.895	0.40183	D	0.977316	B;P;P;P	0.39940	0.032;0.696;0.57;0.552	B;B;B;B	0.38264	0.017;0.253;0.269;0.253	T	0.04255	-1.0965	10	0.09084	T	0.74	-6.6835	13.4454	0.61138	0.0:0.0:0.0:1.0	.	471;822;848;790	B3KR25;Q8NF64-2;Q8NF64;Q8NF64-3	.;.;ZMIZ2_HUMAN;.	S	790;848;848;816;822;851	ENSP00000409648:L790S;ENSP00000311778:L848S;ENSP00000414723:L848S;ENSP00000396601:L816S;ENSP00000265346:L822S	ENSP00000265346:L822S	L	+	2	0	ZMIZ2	44772675	0.972000	0.33761	1.000000	0.80357	0.956000	0.61745	3.086000	0.50159	2.184000	0.69523	0.460000	0.39030	TTG	.		0.652	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449	
TOM1	10043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	22	35719501	35719501	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr22:35719501G>A	ENST00000449058.2	+	5	504	c.379G>A	c.(379-381)Gcg>Acg	p.A127T	TOM1_ENST00000447733.1_Missense_Mutation_p.A94T|TOM1_ENST00000436462.2_Missense_Mutation_p.A89T|TOM1_ENST00000411850.1_Missense_Mutation_p.A127T|TOM1_ENST00000382034.5_Missense_Mutation_p.A60T|TOM1_ENST00000425375.1_Intron	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	127	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)			NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						CTGGGCTGACGCGTTCCGCAG	0.597																																					p.A127T		.											.	.	.	0			c.G379A						.						124.0	118.0	120.0					22																	35719501		2203	4300	6503	SO:0001583	missense	10043	exon5			GCTGACGCGTTCC	AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.379G>A	22.37:g.35719501G>A	ENSP00000394466:p.Ala127Thr	10	0		14	4	NM_001135732	B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Missense_Mutation	SNP	ENST00000449058.2	37	CCDS13913.1	.	.	.	.	.	.	.	.	.	.	G	34	5.372492	0.95923	.	.	ENSG00000100284	ENST00000447733;ENST00000456128;ENST00000449058;ENST00000411850;ENST00000450839;ENST00000451197;ENST00000436462;ENST00000382034;ENST00000443206	T;T;T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87;1.87;1.87	4.74	4.74	0.60224	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.000000	0.85682	D	0.000000	T	0.43188	0.1236	L	0.41236	1.265	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.998;0.995;0.999	T	0.23440	-1.0188	10	0.39692	T	0.17	0.1045	17.7246	0.88361	0.0:0.0:1.0:0.0	.	89;136;127;127	E7EPD0;B4DKQ5;O60784-2;O60784	.;.;.;TOM1_HUMAN	T	94;121;127;127;127;136;89;60;94	ENSP00000398876:A94T;ENSP00000393714:A121T;ENSP00000394466:A127T;ENSP00000413697:A127T;ENSP00000402556:A89T;ENSP00000371465:A60T;ENSP00000389789:A94T	ENSP00000371465:A60T	A	+	1	0	TOM1	34049501	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.725000	0.98778	2.187000	0.69744	0.561000	0.74099	GCG	.		0.597	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320641.1	NM_005488	
IFITM3	10410	hgsc.bcm.edu	37	11	320723	320723	+	Missense_Mutation	SNP	C	C	T	rs199582787	byFrequency	TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr11:320723C>T	ENST00000399808.4	-	1	327	c.91G>A	c.(91-93)Gtg>Atg	p.V31M	IFITM3_ENST00000602735.1_Missense_Mutation_p.V10M|RP11-326C3.14_ENST00000602809.1_lincRNA|RP11-326C3.11_ENST00000508004.2_RNA|RP11-326C3.11_ENST00000602429.1_RNA|IFITM3_ENST00000526811.1_Missense_Mutation_p.V10M|RP11-326C3.10_ENST00000534271.1_RNA|RP11-326C3.11_ENST00000602756.1_RNA	NM_021034.2	NP_066362.2	Q01628	IFM3_HUMAN	interferon induced transmembrane protein 3	31					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral transcription (GO:0032897)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				central_nervous_system(7)|endometrium(7)|kidney(2)|large_intestine(1)|lung(1)	18		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		GCCCCCAGCACAGCCACCTCG	0.612																																					p.V31M		.											IFITM3,brain,glioma,0,1	IFITM3	0	0			c.G91A						.						87.0	98.0	95.0					11																	320723		1967	4140	6107	SO:0001583	missense	10410	exon1			CCAGCACAGCCAC	X57352	CCDS41585.1	11p15.5	2011-05-24	2011-05-24		ENSG00000142089	ENSG00000142089			5414	protein-coding gene	gene with protein product		605579	"""interferon induced transmembrane protein 3 (1-8U)"""			1906403, 16326387	Standard	NM_021034		Approved	1-8U	uc001lpa.2	Q01628		ENST00000399808.4:c.91G>A	11.37:g.320723C>T	ENSP00000382707:p.Val31Met	20	1		44	4	NM_021034	Q53Y76|Q96HK8|Q96J15	Missense_Mutation	SNP	ENST00000399808.4	37	CCDS41585.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.526447	0.27299	.	.	ENSG00000142089	ENST00000399808;ENST00000270031;ENST00000526811	T;T	0.79454	-1.03;-1.27	4.61	-4.91	0.03085	.	11.488500	0.02440	N	0.084490	T	0.64516	0.2605	L	0.39147	1.195	0.09310	N	1	B	0.16802	0.019	B	0.15484	0.013	T	0.46400	-0.9194	10	0.13108	T	0.6	0.9022	6.4601	0.21952	0.1231:0.361:0.0:0.5159	.	31	Q01628	IFM3_HUMAN	M	31;15;10	ENSP00000382707:V31M;ENSP00000432108:V10M	ENSP00000372047:V15M	V	-	1	0	IFITM3	310723	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-1.638000	0.02013	-0.562000	0.06086	-1.790000	0.00627	GTG	.		0.612	IFITM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384765.1	NM_021034	
WHSC1	7468	hgsc.bcm.edu;bcgsc.ca	37	4	1918727	1918727	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr4:1918727G>T	ENST00000382895.3	+	6	1321	c.890G>T	c.(889-891)aGt>aTt	p.S297I	WHSC1_ENST00000382892.2_Missense_Mutation_p.S297I|WHSC1_ENST00000514045.1_Missense_Mutation_p.S297I|WHSC1_ENST00000508803.1_Missense_Mutation_p.S297I|WHSC1_ENST00000398261.1_Missense_Mutation_p.S297I|WHSC1_ENST00000382891.5_Missense_Mutation_p.S297I|WHSC1_ENST00000420906.2_Missense_Mutation_p.S297I|WHSC1_ENST00000503128.1_Missense_Mutation_p.S297I	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	297					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		TGCCAGGAAAGTGCCAAGCAG	0.398			T	IGH@	MM																																p.S297I		.		Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	.	.	.	0			c.G890T						.						65.0	68.0	67.0					4																	1918727		2203	4300	6503	SO:0001583	missense	7468	exon4			AGGAAAGTGCCAA	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.890G>T	4.37:g.1918727G>T	ENSP00000372351:p.Ser297Ile	98	0		74	4	NM_133335	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	ENST00000382895.3	37	CCDS33940.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.890294	0.91889	.	.	ENSG00000109685	ENST00000508803;ENST00000514045;ENST00000382891;ENST00000382892;ENST00000420906;ENST00000382895;ENST00000503128;ENST00000509115;ENST00000398261	T;T;T;T;T;T;T;T;T	0.71698	-0.59;-0.59;-0.59;-0.59;-0.59;-0.59;-0.59;-0.59;-0.59	5.25	5.25	0.73442	.	0.000000	0.64402	D	0.000001	T	0.78704	0.4325	L	0.44542	1.39	0.80722	D	1	D;D;D;D	0.69078	0.994;0.97;0.994;0.997	P;P;P;D	0.64410	0.896;0.78;0.896;0.925	T	0.76484	-0.2942	10	0.38643	T	0.18	.	19.0434	0.93011	0.0:0.0:1.0:0.0	.	297;297;297;297	O96028-3;O96028;O96028-5;O96028-6	.;NSD2_HUMAN;.;.	I	297	ENSP00000423972:S297I;ENSP00000421681:S297I;ENSP00000372347:S297I;ENSP00000372348:S297I;ENSP00000399251:S297I;ENSP00000372351:S297I;ENSP00000425761:S297I;ENSP00000422878:S297I;ENSP00000381311:S297I	ENSP00000308780:S297I	S	+	2	0	WHSC1	1888525	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.716000	0.84723	2.717000	0.92951	0.655000	0.94253	AGT	.		0.398	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330	
JOSD1	9929	hgsc.bcm.edu	37	22	39085046	39085046	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr22:39085046G>T	ENST00000216039.5	-	3	1082	c.403C>A	c.(403-405)Ctc>Atc	p.L135I		NM_014876.5	NP_055691.1	Q15040	JOS1_HUMAN	Josephin domain containing 1	135	Josephin. {ECO:0000255|PROSITE- ProRule:PRU00331}.					cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	omega peptidase activity (GO:0008242)			large_intestine(1)|lung(1)|ovary(2)|pancreas(1)	5	Melanoma(58;0.04)					TGCCTTTTGAGGGGCAGTTTC	0.567																																					p.L135I		.											JOSD1,NS,lymphoid_neoplasm,+2,1	JOSD1	+2	0			c.C403A						.						94.0	78.0	84.0					22																	39085046		2203	4300	6503	SO:0001583	missense	9929	exon3			TTTTGAGGGGCAG		CCDS13976.1	22q13.1	2005-11-10			ENSG00000100221	ENSG00000100221			28953	protein-coding gene	gene with protein product		615323				7584044	Standard	NM_014876		Approved	KIAA0063	uc003awf.3	Q15040	OTTHUMG00000151030	ENST00000216039.5:c.403C>A	22.37:g.39085046G>T	ENSP00000216039:p.Leu135Ile	37	0		34	2	NM_014876	A8K712	Missense_Mutation	SNP	ENST00000216039.5	37	CCDS13976.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.2|28.2	4.898583|4.898583	0.91962|0.91962	.|.	.|.	ENSG00000100221|ENSG00000100221	ENST00000216039|ENST00000545590	T|T	0.46819|0.47869	0.86|0.83	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.60470|0.60470	0.2271|0.2271	L|L	0.48362|0.48362	1.52|1.52	0.80722|0.80722	D|D	1|1	P|.	0.47484|.	0.896|.	P|.	0.44394|.	0.448|.	T|T	0.60291|0.60291	-0.7292|-0.7292	10|7	0.30078|0.72032	T|D	0.28|0.01	.|.	19.9759|19.9759	0.97304|0.97304	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	135|.	Q15040|.	JOS1_HUMAN|.	I|H	135|86	ENSP00000216039:L135I|ENSP00000444798:P86H	ENSP00000216039:L135I|ENSP00000444798:P86H	L|P	-|-	1|2	0|0	JOSD1|JOSD1	37414992|37414992	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.869000|9.869000	0.99810|0.99810	2.713000|2.713000	0.92767|0.92767	0.655000|0.655000	0.94253|0.94253	CTC|CCT	.		0.567	JOSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321047.1	NM_014876	
ZNF676	163223	hgsc.bcm.edu	37	19	22363737	22363737	+	Missense_Mutation	SNP	C	C	G	rs572031376	byFrequency	TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr19:22363737C>G	ENST00000397121.2	-	3	1099	c.782G>C	c.(781-783)gGa>gCa	p.G261A		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	261					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				GCTACTAAATCCTTTGCCACA	0.393													G|||	17	0.00339457	0.0015	0.0029	5008	,	,		24868	0.0089		0.003	False		,,,				2504	0.001				p.G261A		.											.	.	.	0			c.G782C						.						89.0	96.0	93.0					19																	22363737		2158	4274	6432	SO:0001583	missense	163223	exon3			CTAAATCCTTTGC	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.782G>C	19.37:g.22363737C>G	ENSP00000380310:p.Gly261Ala	60	0		80	4	NM_001001411	A8MVX5	Missense_Mutation	SNP	ENST00000397121.2	37	CCDS42539.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.455683	0.00012	.	.	ENSG00000196109	ENST00000397121	T	0.35236	1.32	0.81	-1.62	0.08372	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09247	0.0228	N	0.00788	-1.185	0.09310	N	1	B	0.11235	0.004	B	0.14023	0.01	T	0.28996	-1.0026	9	0.02654	T	1	.	8.4431	0.32826	0.0:0.685:0.315:0.0	.	261	Q8N7Q3	ZN676_HUMAN	A	261	ENSP00000380310:G261A	ENSP00000380310:G261A	G	-	2	0	ZNF676	22155577	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.024000	0.12435	-1.409000	0.02038	-1.398000	0.01145	GGA	.		0.393	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
RBL1	5933	hgsc.bcm.edu	37	20	35651208	35651208	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr20:35651208G>A	ENST00000373664.3	-	17	2470	c.2404C>T	c.(2404-2406)Cgc>Tgc	p.R802C	RBL1_ENST00000344359.3_Missense_Mutation_p.R802C	NM_002895.2	NP_002886.2	P28749	RBL1_HUMAN	retinoblastoma-like 1	802	Domain B.|Pocket; binds T and E1A.				chromatin modification (GO:0016568)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription factor binding (GO:0008134)	p.R802C(1)		NS(1)|breast(1)|endometrium(7)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	42		Myeloproliferative disorder(115;0.00878)				TCACGTAAGCGTACACTTGCC	0.343																																					p.R802C		.											RBL1,NS,carcinoma,0,1	RBL1	0	1	Substitution - Missense(1)	endometrium(1)	c.C2404T						.						90.0	79.0	83.0					20																	35651208		2203	4300	6503	SO:0001583	missense	5933	exon17			GTAAGCGTACACT	L14812	CCDS13289.1, CCDS13290.1	20q11.23	2014-03-11	2014-03-11		ENSG00000080839	ENSG00000080839			9893	protein-coding gene	gene with protein product		116957				1833063	Standard	NM_183404		Approved	p107, cp107, PRB1	uc002xgi.3	P28749	OTTHUMG00000032406	ENST00000373664.3:c.2404C>T	20.37:g.35651208G>A	ENSP00000362768:p.Arg802Cys	56	0		73	3	NM_183404	A8K2W5|Q4VXA0|Q8N5K6|Q9H1L5|Q9H1M1	Missense_Mutation	SNP	ENST00000373664.3	37	CCDS13289.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.048672	0.93740	.	.	ENSG00000080839	ENST00000373664;ENST00000344359	D;D	0.95482	-3.72;-3.72	5.39	5.39	0.77823	Retinoblastoma-associated protein, B-box (1);Cyclin-like (3);	0.000000	0.85682	D	0.000000	D	0.98283	0.9431	M	0.91920	3.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99198	1.0872	10	0.87932	D	0	-7.6332	19.175	0.93600	0.0:0.0:1.0:0.0	.	802;802	P28749-2;P28749	.;RBL1_HUMAN	C	802	ENSP00000362768:R802C;ENSP00000343646:R802C	ENSP00000343646:R802C	R	-	1	0	RBL1	35084622	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.669000	0.98622	2.541000	0.85698	0.555000	0.69702	CGC	.		0.343	RBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079067.2	NM_002895	
DNAAF3	352909	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	55672774	55672774	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr19:55672774G>A	ENST00000524407.2	-	7	709	c.676C>T	c.(676-678)Cac>Tac	p.H226Y	DNAAF3_ENST00000455045.1_Missense_Mutation_p.H172Y|DNAAF3_ENST00000391720.4_Missense_Mutation_p.H273Y|CTD-2587H24.4_ENST00000587871.1_5'Flank|DNAAF3_ENST00000527223.2_Missense_Mutation_p.H294Y|CTD-2587H24.5_ENST00000591665.1_RNA|DNAAF3_ENST00000587789.2_5'Flank			Q8N9W5	DAAF3_HUMAN	dynein, axonemal, assembly factor 3	226					axonemal dynein complex assembly (GO:0070286)|motile cilium assembly (GO:0044458)	cytoplasm (GO:0005737)											TCCTGGGGGTGAATGACTTGA	0.657																																					p.H294Y		.											.	.	.	0			c.C880T						.						13.0	17.0	16.0					19																	55672774		1906	4092	5998	SO:0001583	missense	352909	exon7			GGGGGTGAATGAC	AK097388	CCDS12918.2, CCDS58679.1, CCDS58680.1, CCDS59422.1	19q13.42	2012-10-05	2012-03-09	2012-03-09	ENSG00000167646	ENSG00000167646			30492	protein-coding gene	gene with protein product		614566	"""chromosome 19 open reading frame 51"", ""ciliary dyskinesia, primary 2"""	C19orf51, CILD2		22387996	Standard	NM_001256714		Approved	FLJ40069, FLJ36139, PF22, PCD	uc002qjl.2	Q8N9W5	OTTHUMG00000128547	ENST00000524407.2:c.676C>T	19.37:g.55672774G>A	ENSP00000432046:p.His226Tyr	60	0		74	19	NM_001256714	A8MUY0|E3W9A1|E9PAX5|Q6P4F6|Q8N9W0|Q96AR2	Missense_Mutation	SNP	ENST00000524407.2	37	CCDS59422.1	.	.	.	.	.	.	.	.	.	.	G	8.699	0.909260	0.17833	.	.	ENSG00000167646	ENST00000301249;ENST00000455045;ENST00000391720	T;T	0.18016	2.24;2.24	4.15	3.02	0.34903	.	0.247017	0.39020	N	0.001485	T	0.31104	0.0786	M	0.75777	2.31	0.26485	N	0.975035	P;P;D;P	0.69078	0.908;0.952;0.997;0.898	B;P;P;B	0.59288	0.439;0.719;0.855;0.434	T	0.03739	-1.1008	10	0.32370	T	0.25	-31.1904	8.9054	0.35521	0.0:0.0:0.7022:0.2977	.	294;172;247;226	E9PAX5;E3W9A1;Q8N9W5-3;Q8N9W5	.;.;.;CS051_HUMAN	Y	294;172;273	ENSP00000394343:H172Y;ENSP00000375600:H273Y	ENSP00000301249:H294Y	H	-	1	0	C19orf51	60364586	1.000000	0.71417	0.995000	0.50966	0.251000	0.25915	2.018000	0.40991	2.324000	0.78689	0.549000	0.68633	CAC	.		0.657	DNAAF3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250388.5	NM_178837	
HECW2	57520	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	197138745	197138745	+	Splice_Site	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:197138745C>T	ENST00000260983.3	-	16	3420	c.3238G>A	c.(3238-3240)Gct>Act	p.A1080T	HECW2_ENST00000409111.1_Splice_Site_p.A724T	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1080					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GATGACATACCCACTGGAACC	0.468																																					p.A1080T		.											.	.	.	0			c.G3238A						.						299.0	220.0	247.0					2																	197138745		2203	4300	6503	SO:0001630	splice_region_variant	57520	exon16			ACATACCCACTGG	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.3238+1G>A	2.37:g.197138745C>T		45	0		40	19	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.282130	0.80692	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	D;D	0.83914	-1.78;-1.78	5.45	5.45	0.79879	.	0.192676	0.44097	D	0.000492	T	0.76622	0.4013	L	0.39397	1.21	0.80722	D	1	B	0.25772	0.134	B	0.16289	0.015	T	0.70684	-0.4804	9	.	.	.	.	17.6425	0.88140	0.0:1.0:0.0:0.0	.	1080	Q9P2P5	HECW2_HUMAN	T	724;1080	ENSP00000386775:A724T;ENSP00000260983:A1080T	.	A	-	1	0	HECW2	196846990	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.303000	0.78871	2.836000	0.97738	0.655000	0.94253	GCT	.		0.468	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	Missense_Mutation
HEPH	9843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	65476101	65476101	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chrX:65476101C>T	ENST00000343002.2	+	16	3489	c.2825C>T	c.(2824-2826)aCc>aTc	p.T942I	HEPH_ENST00000374727.3_Missense_Mutation_p.T945I|HEPH_ENST00000441993.2_Missense_Mutation_p.T945I|HEPH_ENST00000419594.1_Missense_Mutation_p.T753I|HEPH_ENST00000519389.1_Missense_Mutation_p.T996I|HEPH_ENST00000336279.5_Missense_Mutation_p.T675I			Q9BQS7	HEPH_HUMAN	hephaestin	942	Plastocyanin-like 6.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						AATGTGGCAACCCATGGGTCC	0.428																																					p.T996I		.											.	.	.	0			c.C2987T						.						146.0	133.0	138.0					X																	65476101		2203	4300	6503	SO:0001583	missense	9843	exon17			TGGCAACCCATGG	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.2825C>T	X.37:g.65476101C>T	ENSP00000343939:p.Thr942Ile	70	0		55	15	NM_138737	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	ENST00000343002.2	37		.	.	.	.	.	.	.	.	.	.	C	6.813	0.519101	0.13005	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002	D;D;D;D;D;D	0.99207	-5.56;-5.56;-5.56;-5.56;-5.56;-5.56	4.43	2.64	0.31445	Cupredoxin (2);	0.916992	0.09401	N	0.807274	D	0.97486	0.9177	L	0.41492	1.28	0.20196	N	0.999929	B;B;P;B	0.47034	0.031;0.013;0.889;0.002	B;B;B;B	0.43194	0.078;0.04;0.411;0.014	D	0.94135	0.7392	10	0.39692	T	0.17	.	6.8491	0.24005	0.0:0.6927:0.0:0.3073	.	996;342;753;942	E9PHN8;B4DFV3;E7ES21;Q9BQS7	.;.;.;HEPH_HUMAN	I	996;945;675;945;753;942	ENSP00000430620:T996I;ENSP00000363859:T945I;ENSP00000337418:T675I;ENSP00000411687:T945I;ENSP00000413211:T753I;ENSP00000343939:T942I	ENSP00000337418:T675I	T	+	2	0	HEPH	65392826	0.000000	0.05858	0.473000	0.27253	0.465000	0.32709	-0.295000	0.08298	0.442000	0.26555	0.600000	0.82982	ACC	.		0.428	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737	
SH3GLB1	51100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	87200770	87200770	+	Missense_Mutation	SNP	C	C	G			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:87200770C>G	ENST00000370558.4	+	7	993	c.669C>G	c.(667-669)caC>caG	p.H223Q	SH3GLB1_ENST00000535010.1_Missense_Mutation_p.H123Q|SH3GLB1_ENST00000482504.1_Missense_Mutation_p.H244Q	NM_001206651.1|NM_001206653.1|NM_016009.4	NP_001193580.1|NP_001193582.1|NP_057093.1	Q9Y371	SHLB1_HUMAN	SH3-domain GRB2-like endophilin B1	223	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				'de novo' posttranslational protein folding (GO:0051084)|apoptotic process (GO:0006915)|phosphatidic acid biosynthetic process (GO:0006654)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|protein complex (GO:0043234)	fatty acid binding (GO:0005504)|identical protein binding (GO:0042802)|lysophosphatidic acid acyltransferase activity (GO:0042171)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|stomach(1)	11		Lung NSC(277;0.209)		all cancers(265;0.0136)|Epithelial(280;0.0414)		AGGCCCATCACCTTCGCTGTC	0.418																																					p.H252Q		.											.	.	.	0			c.C756G						.						123.0	116.0	119.0					1																	87200770		2203	4300	6503	SO:0001583	missense	51100	exon8			CCATCACCTTCGC	AF263293	CCDS710.1, CCDS55612.1, CCDS55613.1, CCDS72819.1	1p22.3	2012-04-17	2001-12-04		ENSG00000097033	ENSG00000097033		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	10833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 70"""	609287	"""SH3-domain, GRB2-like, endophilin B1"""			11161816, 11259440	Standard	NM_016009		Approved	CGI-61, KIAA0491, Bif-1, PPP1R70	uc001dly.3	Q9Y371	OTTHUMG00000010257	ENST00000370558.4:c.669C>G	1.37:g.87200770C>G	ENSP00000473267:p.His223Gln	72	0		89	15	NM_001206651	B4E182|Q5H8U5|Q9H3Z0|Q9NR47|Q9NYA9	Missense_Mutation	SNP	ENST00000370558.4	37	CCDS710.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.927602	0.52759	.	.	ENSG00000097033	ENST00000212369;ENST00000535010;ENST00000482504	T;T	0.62639	0.01;0.01	5.53	-0.605	0.11623	BAR (3);IRSp53/MIM homology domain (IMD) (1);	0.000000	0.85682	D	0.000000	T	0.49490	0.1560	L	0.41961	1.31	0.54753	D	0.999986	D;D;P	0.89917	1.0;1.0;0.566	D;D;P	0.87578	0.998;0.997;0.531	T	0.57289	-0.7837	10	0.06625	T	0.88	-0.8289	11.5201	0.50546	0.0:0.4349:0.0:0.5651	.	123;244;223	B4E182;Q9Y371-2;Q9Y371	.;.;SHLB1_HUMAN	Q	223;123;244	ENSP00000441355:H123Q;ENSP00000418744:H244Q	ENSP00000212369:H223Q	H	+	3	2	SH3GLB1	86973358	0.995000	0.38212	0.996000	0.52242	0.983000	0.72400	0.455000	0.21843	-0.118000	0.11851	-0.137000	0.14449	CAC	.		0.418	SH3GLB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028287.2	NM_016009	
DSPP	1834	hgsc.bcm.edu	37	4	88537123	88537123	+	Silent	SNP	C	C	T	rs372453629	byFrequency	TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr4:88537123C>T	ENST00000282478.7	+	4	3342	c.3309C>T	c.(3307-3309)agC>agT	p.S1103S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1103S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1103	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcgacagcagcgacagcagcg	0.547													c|||	2714	0.541933	0.5439	0.6254	5008	,	,		13665	0.5903		0.5467	False		,,,				2504	0.4254				p.S1103S		.											DSPP,NS,carcinoma,0,2	DSPP	0	0			c.C3309T						.						12.0	19.0	17.0					4																	88537123		1097	2123	3220	SO:0001819	synonymous_variant	1834	exon5			CAGCAGCGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3309C>T	4.37:g.88537123C>T		7	2		2	2	NM_014208	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.547	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
SLC9A3	6550	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	488540	488540	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr5:488540G>T	ENST00000264938.3	-	3	575	c.566C>A	c.(565-567)gCg>gAg	p.A189E	SLC9A3_ENST00000514375.1_Missense_Mutation_p.A189E	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	189					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GTCCACAGCCGCCATGAGGCT	0.652																																					p.A189E		.											.	.	.	0			c.C566A						.						28.0	26.0	27.0					5																	488540		2200	4290	6490	SO:0001583	missense	6550	exon3			ACAGCCGCCATGA		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.566C>A	5.37:g.488540G>T	ENSP00000264938:p.Ala189Glu	74	0		169	39	NM_004174	B7ZKR2|E9PF67|Q3MIW3	Missense_Mutation	SNP	ENST00000264938.3	37	CCDS3855.1	.	.	.	.	.	.	.	.	.	.	G	18.18	3.567383	0.65651	.	.	ENSG00000066230	ENST00000264938;ENST00000514375	T;T	0.17054	2.3;2.3	4.64	4.64	0.57946	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.42108	0.1188	M	0.70903	2.155	0.58432	D	0.999992	D;P	0.89917	1.0;0.956	D;P	0.70227	0.968;0.779	T	0.42716	-0.9435	10	0.87932	D	0	.	17.4894	0.87699	0.0:0.0:1.0:0.0	.	189;189	E9PF67;P48764	.;SL9A3_HUMAN	E	189	ENSP00000264938:A189E;ENSP00000422983:A189E	ENSP00000264938:A189E	A	-	2	0	SLC9A3	541540	0.998000	0.40836	0.141000	0.22245	0.007000	0.05969	7.712000	0.84684	2.281000	0.76405	0.561000	0.74099	GCG	.		0.652	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	NM_004174	
SMC6	79677	hgsc.bcm.edu	37	2	17906563	17906563	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:17906563C>T	ENST00000448223.2	-	9	956	c.687G>A	c.(685-687)acG>acA	p.T229T	SMC6_ENST00000351948.4_Silent_p.T229T|SMC6_ENST00000381272.4_Silent_p.T255T|SMC6_ENST00000402989.1_Silent_p.T229T	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	229					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)	p.E231fs*17(1)		NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TTCTTTCTTTCGTTTCCATAA	0.313																																					p.T229T		.											.,1	.	102	1	Deletion - Frameshift(1)	kidney(1)	c.G687A						.						158.0	128.0	138.0					2																	17906563		2203	4297	6500	SO:0001819	synonymous_variant	79677	exon9			TTCTTTCGTTTCC	AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.687G>A	2.37:g.17906563C>T		35	0		60	3	NM_001142286	A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Silent	SNP	ENST00000448223.2	37	CCDS1690.1																																																																																			.		0.313	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207359.1	NM_024624	
C3P1	388503	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	10157072	10157072	+	RNA	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr19:10157072G>A	ENST00000495140.1	+	0	851							Q6ZMU1	C3P1_HUMAN	complement component 3 precursor pseudogene							extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)			endometrium(4)|large_intestine(2)|lung(6)|urinary_tract(1)	13						CTGTGAGGCTGGGCTCCGGGA	0.592																																					.		.											.	.	.	0			.						.																																					388503	.			GAGGCTGGGCTCC	AK131489		19p13.2	2009-04-08			ENSG00000167798	ENSG00000167798			34414	pseudogene	pseudogene							Standard	NR_027300		Approved	CPLP	uc010dwx.2	Q6ZMU1	OTTHUMG00000158555		19.37:g.10157072G>A		21	0		36	19	.		RNA	SNP	ENST00000495140.1	37																																																																																				.		0.592	C3P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000351284.1	NR_027300	
ST3GAL3	6487	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	44290442	44290442	+	Intron	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:44290442C>T	ENST00000361392.4	+	4	386				ST3GAL3_ENST00000372377.4_Intron|ST3GAL3_ENST00000528371.1_Intron|ST3GAL3_ENST00000531816.1_Intron|ST3GAL3_ENST00000262915.3_Silent_p.D98D|ST3GAL3_ENST00000347631.2_Intron|ST3GAL3_ENST00000372368.2_Silent_p.D83D|ST3GAL3_ENST00000372362.2_Intron|ST3GAL3_ENST00000372374.2_Intron|ST3GAL3_ENST00000531451.1_Intron|ST3GAL3_ENST00000361812.4_Intron|ST3GAL3_ENST00000372365.1_Intron|ST3GAL3_ENST00000372367.1_Intron|ST3GAL3_ENST00000330208.2_Intron|ST3GAL3_ENST00000372366.1_Intron|ST3GAL3_ENST00000335430.6_Intron|ST3GAL3_ENST00000372369.1_Intron|ST3GAL3_ENST00000372375.2_Silent_p.D83D|ST3GAL3_ENST00000545417.1_Intron|ST3GAL3_ENST00000361400.4_Intron|ST3GAL3_ENST00000361746.4_Silent_p.D98D|ST3GAL3_ENST00000531993.1_Intron|ST3GAL3_ENST00000353126.3_Intron|ST3GAL3_ENST00000533933.1_Intron|ST3GAL3_ENST00000351035.3_Silent_p.D67D|ST3GAL3_ENST00000332628.6_Intron|ST3GAL3_ENST00000372372.2_Silent_p.D67D|ST3GAL3_ENST00000461375.1_Intron	NM_001270459.1|NM_006279.3|NM_174964.2	NP_001257388.1|NP_006270.1|NP_777624.1	Q11203	SIAT6_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 3						carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)|N-acetyllactosaminide alpha-2,3-sialyltransferase activity (GO:0008118)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(3)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)				ttggccttgactgcatattgg	0.468																																					p.D98D		.											.	.	.	0			c.C294T						.						78.0	80.0	79.0					1																	44290442		2203	4300	6503	SO:0001627	intron_variant	6487	exon5			CCTTGACTGCATA	L23768	CCDS492.1, CCDS493.1, CCDS494.1, CCDS495.1, CCDS496.1, CCDS497.1, CCDS498.1, CCDS499.1, CCDS500.1, CCDS53310.1, CCDS57988.1, CCDS57989.1, CCDS57990.1, CCDS57991.1, CCDS57992.1, CCDS57993.1, CCDS57994.1	1p34.1	2014-01-31	2005-02-07	2005-02-07	ENSG00000126091	ENSG00000126091	2.4.99.6	"""Sialyltransferases"""	10866	protein-coding gene	gene with protein product	"""ST3Gal III"""	606494	"""sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase)"", ""mental retardation, non-syndromic, autosomal recessive, 12"""	SIAT6, MRT12		8333853, 21907012	Standard	NM_174963		Approved		uc001cjz.4	Q11203	OTTHUMG00000007561	ENST00000361392.4:c.209+9837C>T	1.37:g.44290442C>T		83	0		99	18	NM_174963	A9Z1W2|D3DPX8|Q5T4W9|Q5T4X0|Q5T4X7|Q5T4X8|Q5T4X9|Q5T4Y0|Q5T4Y2|Q5T4Y3|Q5T4Y4|Q86UR6|Q86UR7|Q86UR8|Q86UR9|Q86US0|Q86US1|Q86US2|Q8IX41|Q8IX42|Q8IX43|Q8IX44|Q8IX45|Q8IX46|Q8IX47|Q8IX48|Q8IX49|Q8IX50|Q8IX51|Q8IX52|Q8IX53|Q8IX54|Q8IX55|Q8IX56|Q8IX57|Q8IX58	Silent	SNP	ENST00000361392.4	37	CCDS492.1																																																																																			.		0.468	ST3GAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019964.1	NM_174963	
C1orf112	55732	hgsc.bcm.edu;bcgsc.ca	37	1	169796306	169796306	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:169796306G>A	ENST00000286031.6	+	11	1663	c.963G>A	c.(961-963)caG>caA	p.Q321Q	C1orf112_ENST00000413811.2_Silent_p.Q292Q|C1orf112_ENST00000498289.1_3'UTR|C1orf112_ENST00000359326.4_Silent_p.Q321Q	NM_018186.2	NP_060656.2	Q9NSG2	CA112_HUMAN	chromosome 1 open reading frame 112	321										breast(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|stomach(1)	34	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TCACATTTCAGCCTTTCATGC	0.398																																					p.Q321Q		.											.	.	.	0			c.G963A						.						143.0	138.0	140.0					1																	169796306		2203	4300	6503	SO:0001819	synonymous_variant	55732	exon11			ATTTCAGCCTTTC	AL354614	CCDS1285.1	1q24.2	2012-06-26			ENSG00000000460	ENSG00000000460			25565	protein-coding gene	gene with protein product						12477932	Standard	NM_018186		Approved	FLJ10706	uc001ggq.3	Q9NSG2	OTTHUMG00000035821	ENST00000286031.6:c.963G>A	1.37:g.169796306G>A		65	0		86	4	NM_018186	A6NFP1|B3KU42|Q3KNQ1|Q9H8L5|Q9NVJ0	Silent	SNP	ENST00000286031.6	37	CCDS1285.1																																																																																			.		0.398	C1orf112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087126.3	NM_018186	
AGAP2	116986	hgsc.bcm.edu	37	12	58131312	58131312	+	Missense_Mutation	SNP	C	C	T	rs561812307		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr12:58131312C>T	ENST00000547588.1	-	1	717	c.718G>A	c.(718-720)Gcc>Acc	p.A240T	AGAP2_ENST00000257897.3_Intron	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	240					axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						gcggcggcggcggtggcggcg	0.706																																					p.A240T		.											AGAP2_ENST00000547588,NS,carcinoma,0,1	AGAP2_ENST00000547588	0	0			c.G718A						.						4.0	6.0	5.0					12																	58131312		1428	3301	4729	SO:0001583	missense	116986	exon1			CGGCGGCGGTGGC	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.718G>A	12.37:g.58131312C>T	ENSP00000449241:p.Ala240Thr	30	0		38	2	NM_001122772	A8K9F7|O00578|Q548E0|Q8IWU3	Missense_Mutation	SNP	ENST00000547588.1	37	CCDS44932.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.24|10.24	1.294811|1.294811	0.23564|0.23564	.|.	.|.	ENSG00000135439|ENSG00000135439	ENST00000547588|ENST00000328568	T|.	0.39997|.	1.05|.	3.81|3.81	-1.14|-1.14	0.09741|0.09741	.|.	1.354790|.	0.05448|.	N|.	0.548952|.	T|T	0.10508|0.10508	0.0257|0.0257	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B|.	0.14012|.	0.009;0.005|.	B;B|.	0.06405|.	0.002;0.001|.	T|T	0.24548|0.24548	-1.0157|-1.0157	10|5	0.56958|.	D|.	0.05|.	.|.	0.5619|0.5619	0.00680|0.00680	0.1874:0.3561:0.184:0.2724|0.1874:0.3561:0.184:0.2724	.|.	240;240|.	F8VVT9;Q99490|.	.;AGAP2_HUMAN|.	T|H	240|103	ENSP00000449241:A240T|.	ENSP00000449241:A240T|.	A|R	-|-	1|2	0|0	AGAP2|AGAP2	56417579|56417579	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.016000|0.016000	0.09150|0.09150	0.086000|0.086000	0.14935|0.14935	-0.555000|-0.555000	0.06142|0.06142	0.455000|0.455000	0.32223|0.32223	GCC|CGC	.		0.706	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408367.1	NM_014770	
PPA1	5464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	71978550	71978550	+	Silent	SNP	T	T	C			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr10:71978550T>C	ENST00000373232.3	-	3	246	c.147A>G	c.(145-147)gaA>gaG	p.E49E	PPA1_ENST00000495346.1_5'UTR|PPA1_ENST00000608321.1_Silent_p.E49E	NM_021129.3	NP_066952.1	Q15181	IPYR_HUMAN	pyrophosphatase (inorganic) 1	49					diphosphate metabolic process (GO:0071344)|gene expression (GO:0010467)|phosphate-containing compound metabolic process (GO:0006796)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(2)	10						AGCGTGGTACTTCAACTACCA	0.393																																					p.E49E		.											.	.	.	0			c.A147G						.						96.0	82.0	87.0					10																	71978550		2203	4300	6503	SO:0001819	synonymous_variant	5464	exon3			TGGTACTTCAACT	AF154065	CCDS7299.1	10q11.1-q24	2012-10-02	2005-10-07	2005-10-07	ENSG00000180817	ENSG00000180817	3.6.1.1		9226	protein-coding gene	gene with protein product	"""cytosolic inorganic pyrophosphatase"", ""inorganic pyrophosphatase 1"", ""pyrophosphate phospho-hydrolase"""	179030	"""pyrophosphatase (inorganic)"""	PP		10542310, 975879	Standard	NM_021129		Approved	SID6-8061, Ppase, IOPPP, PP1	uc001jqv.1	Q15181	OTTHUMG00000018399	ENST00000373232.3:c.147A>G	10.37:g.71978550T>C		43	0		38	6	NM_021129	Q2M348|Q5SQT7|Q6P7P4|Q9UQJ5|Q9Y5B1	Silent	SNP	ENST00000373232.3	37	CCDS7299.1																																																																																			.		0.393	PPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048490.2	NM_021129	
EEF1E1	9521	hgsc.bcm.edu;bcgsc.ca	37	6	8097530	8097530	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr6:8097530G>T	ENST00000379715.5	-	2	314	c.258C>A	c.(256-258)tcC>tcA	p.S86S	EEF1E1-BLOC1S5_ENST00000397456.2_Silent_p.S86S|EEF1E1_ENST00000429723.2_Silent_p.S86S|EEF1E1_ENST00000507463.1_Silent_p.S86S	NM_004280.4	NP_004271.1	O43324	MCA3_HUMAN	eukaryotic translation elongation factor 1 epsilon 1	86	C-terminal.|GST C-terminal.				gene expression (GO:0010467)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				endometrium(1)|prostate(1)	2	Ovarian(93;0.0398)					CATTTTTACTGGAGTGCCCAT	0.413																																					p.S86S		.											.	.	.	0			c.C258A						.						258.0	233.0	242.0					6																	8097530		2203	4300	6503	SO:0001819	synonymous_variant	9521	exon2			TTTACTGGAGTGC	AF054186	CCDS4507.1, CCDS47370.1	6p24.3	2009-05-20			ENSG00000124802	ENSG00000124802			3212	protein-coding gene	gene with protein product	"""aminoacyl tRNA synthetase complex-interacting multifunctional protein 3"""	609206		P18		9653160	Standard	NM_004280		Approved	AIMP3	uc003mxz.3	O43324	OTTHUMG00000014221	ENST00000379715.5:c.258C>A	6.37:g.8097530G>T		66	0		82	4	NM_001135650	C9JLK5|Q5THS2	Silent	SNP	ENST00000379715.5	37	CCDS4507.1	.	.	.	.	.	.	.	.	.	.	G	0.307	-0.970418	0.02232	.	.	ENSG00000124802	ENST00000502429	.	.	.	5.62	3.85	0.44370	.	.	.	.	.	T	0.32496	0.0831	.	.	.	0.35451	D	0.795695	.	.	.	.	.	.	T	0.17653	-1.0362	4	.	.	.	-1.4441	6.0182	0.19615	0.2112:0.0:0.6559:0.1329	.	.	.	.	Q	73	.	.	P	-	2	0	EEF1E1	8042529	0.595000	0.26857	0.016000	0.15963	0.082000	0.17680	0.823000	0.27366	0.731000	0.32448	0.655000	0.94253	CCA	.		0.413	EEF1E1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039799.2	NM_004280	
SGK2	10110	hgsc.bcm.edu;bcgsc.ca	37	20	42213625	42213625	+	Missense_Mutation	SNP	C	C	T	rs140923021		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr20:42213625C>T	ENST00000341458.4	+	12	1472	c.1253C>T	c.(1252-1254)gCg>gTg	p.A418V	SGK2_ENST00000423407.3_Missense_Mutation_p.A358V|SGK2_ENST00000373077.1_Missense_Mutation_p.A357V|SGK2_ENST00000373092.3_Missense_Mutation_p.A358V|SGK2_ENST00000426287.1_Missense_Mutation_p.A384V|SGK2_ENST00000373100.1_Missense_Mutation_p.A358V	NM_016276.3	NP_057360.2	Q9HBY8	SGK2_HUMAN	serum/glucocorticoid regulated kinase 2	418	AGC-kinase C-terminal.				intracellular signal transduction (GO:0035556)|ion transmembrane transport (GO:0034220)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TTTTCTTATGCGCCAGAGGAT	0.507																																					p.A418V		.											.	.	.	0			c.C1253T						.	C	VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	102.0	100.0	100.0		1073,1253,1073	2.6	0.2	20	dbSNP_134	100	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	SGK2	NM_001199264.1,NM_016276.3,NM_170693.2	64,64,64	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging,possibly-damaging	358/368,418/428,358/368	42213625	2,13004	2203	4300	6503	SO:0001583	missense	10110	exon12			CTTATGCGCCAGA	AF169034	CCDS13320.1, CCDS13321.1	20q13.2	2008-07-04			ENSG00000101049	ENSG00000101049			13900	protein-coding gene	gene with protein product		607589				10548550	Standard	NM_016276		Approved		uc002xkv.3	Q9HBY8	OTTHUMG00000033054	ENST00000341458.4:c.1253C>T	20.37:g.42213625C>T	ENSP00000340608:p.Ala418Val	57	0		62	4	NM_016276	Q52PK5|Q5H8Y6|Q5H8Z1|Q5TZR3|Q9UKG6	Missense_Mutation	SNP	ENST00000341458.4	37	CCDS13320.1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.051372	0.36181	0.0	2.33E-4	ENSG00000101049	ENST00000373100;ENST00000373092;ENST00000373077;ENST00000423407;ENST00000341458;ENST00000426287	T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73	5.64	2.64	0.31445	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);	0.212334	0.49305	N	0.000142	T	0.46386	0.1390	N	0.16368	0.405	0.43003	D	0.994523	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.29243	-1.0018	10	0.27082	T	0.32	.	8.3563	0.32331	0.0:0.7279:0.1288:0.1433	.	418;358	Q9HBY8;Q9HBY8-2	SGK2_HUMAN;.	V	358;358;357;358;418;384	ENSP00000362192:A358V;ENSP00000362184:A358V;ENSP00000362168:A357V;ENSP00000392795:A358V;ENSP00000340608:A418V;ENSP00000412214:A384V	ENSP00000340608:A418V	A	+	2	0	SGK2	41647039	0.915000	0.31059	0.157000	0.22605	0.090000	0.18270	1.764000	0.38471	0.415000	0.25817	0.655000	0.94253	GCG	0.000		0.507	SGK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080383.1		
TULP4	56995	hgsc.bcm.edu	37	6	158924680	158924680	+	Missense_Mutation	SNP	C	C	T	rs200432004		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr6:158924680C>T	ENST00000367097.3	+	13	5342	c.3985C>T	c.(3985-3987)Cgg>Tgg	p.R1329W	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	1329					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		AGTCCCCCAGCGGACAGAAAA	0.567																																					p.R1329W		.											TULP4,NS,malignant_melanoma,0,1	TULP4	0	0			c.C3985T						.						43.0	48.0	47.0					6																	158924680		2203	4300	6503	SO:0001583	missense	56995	exon13			CCCCAGCGGACAG		CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.3985C>T	6.37:g.158924680C>T	ENSP00000356064:p.Arg1329Trp	61	0		69	3	NM_020245	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Missense_Mutation	SNP	ENST00000367097.3	37	CCDS34561.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.156641	0.57259	.	.	ENSG00000130338	ENST00000367097	T	0.66638	-0.22	5.7	0.809	0.18725	.	0.000000	0.85682	D	0.000000	T	0.70325	0.3211	M	0.61703	1.905	0.80722	D	1	D	0.76494	0.999	P	0.62435	0.902	T	0.77284	-0.2645	10	0.87932	D	0	-34.4639	17.6151	0.88065	0.5299:0.4701:0.0:0.0	.	1329	Q9NRJ4	TULP4_HUMAN	W	1329	ENSP00000356064:R1329W	ENSP00000356064:R1329W	R	+	1	2	TULP4	158844668	1.000000	0.71417	0.993000	0.49108	0.975000	0.68041	1.024000	0.30077	0.195000	0.20347	-0.314000	0.08810	CGG	.		0.567	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042869.1	NM_020245	
NEB	4703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	152384096	152384096	+	Missense_Mutation	SNP	C	C	G			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:152384096C>G	ENST00000172853.10	-	119	16783	c.16636G>C	c.(16636-16638)Gac>Cac	p.D5546H	NEB_ENST00000603639.1_Missense_Mutation_p.D7247H|NEB_ENST00000427231.2_Missense_Mutation_p.D7247H|NEB_ENST00000604864.1_Missense_Mutation_p.D7247H|NEB_ENST00000409198.1_Missense_Mutation_p.D5546H|NEB_ENST00000397345.3_Missense_Mutation_p.D7247H			P20929	NEBU_HUMAN	nebulin	5546					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTCTTATAGTCCAGCTGTTTT	0.473																																					p.D7282H		.											.	.	.	0			c.G21844C						.						63.0	63.0	63.0					2																	152384096		1892	4117	6009	SO:0001583	missense	4703	exon148			TATAGTCCAGCTG	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.16636G>C	2.37:g.152384096C>G	ENSP00000172853:p.Asp5546His	51	0		38	8	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	C	16.59	3.164558	0.57476	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	6.17	5.27	0.74061	.	0.087776	0.85682	D	0.000000	T	0.60818	0.2298	L	0.54323	1.7	0.80722	D	1	P;D;D	0.89917	0.871;0.981;1.0	P;D;D	0.85130	0.634;0.952;0.997	T	0.58629	-0.7603	10	0.54805	T	0.06	.	17.0573	0.86537	0.1275:0.8725:0.0:0.0	.	5546;7247;1977	P20929;F8WCP0;Q14215	NEBU_HUMAN;.;.	H	5546;7247;7247;1595;1977;5546	ENSP00000386259:D5546H;ENSP00000380505:D7247H;ENSP00000416578:D7247H;ENSP00000410961:D1977H;ENSP00000172853:D5546H	ENSP00000172853:D5546H	D	-	1	0	NEB	152092342	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	4.657000	0.61490	2.941000	0.99782	0.655000	0.94253	GAC	.		0.473	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
TM4SF5	9032	hgsc.bcm.edu	37	17	4675353	4675353	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr17:4675353C>T	ENST00000270560.3	+	1	167	c.136C>T	c.(136-138)Caa>Taa	p.Q46*		NM_003963.2	NP_003954.2	O14894	T4S5_HUMAN	transmembrane 4 L six family member 5	46						integral component of plasma membrane (GO:0005887)		p.Q46E(1)		large_intestine(2)|lung(3)|ovary(1)	6						TCTCAGCTTGCAAGTCTGGCT	0.622																																					p.Q46X		.											TM4SF5,NS,carcinoma,0,1	TM4SF5	0	1	Substitution - Missense(1)	lung(1)	c.C136T						.						119.0	106.0	111.0					17																	4675353		2203	4300	6503	SO:0001587	stop_gained	9032	exon1			AGCTTGCAAGTCT	AF027204	CCDS11054.1	17p13.3	2007-01-06	2005-03-21		ENSG00000142484	ENSG00000142484			11857	protein-coding gene	gene with protein product		604657	"""transmembrane 4 superfamily member 5"""			9479038	Standard	NM_003963		Approved		uc002fyw.1	O14894	OTTHUMG00000090776	ENST00000270560.3:c.136C>T	17.37:g.4675353C>T	ENSP00000270560:p.Gln46*	38	0		50	3	NM_003963	Q17RW9|Q6IB79	Nonsense_Mutation	SNP	ENST00000270560.3	37	CCDS11054.1	.	.	.	.	.	.	.	.	.	.	C	37	6.522785	0.97633	.	.	ENSG00000142484	ENST00000270560	.	.	.	5.54	5.54	0.83059	.	0.235813	0.44285	D	0.000480	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-0.3095	16.9865	0.86341	0.0:1.0:0.0:0.0	.	.	.	.	X	46	.	ENSP00000270560:Q46X	Q	+	1	0	TM4SF5	4622102	0.998000	0.40836	1.000000	0.80357	0.984000	0.73092	2.840000	0.48215	2.598000	0.87819	0.655000	0.94253	CAA	.		0.622	TM4SF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207558.2		
CCDC103	388389	hgsc.bcm.edu	37	17	42979874	42979874	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr17:42979874G>T	ENST00000417826.2	+	4	513	c.418G>T	c.(418-420)Gga>Tga	p.G140*	FAM187A_ENST00000331733.4_5'UTR|FAM187A_ENST00000412523.2_Intron|EFTUD2_ENST00000426333.2_5'Flank|CCDC103_ENST00000410006.2_Nonsense_Mutation_p.G140*|AC015936.3_ENST00000441312.1_RNA	NM_001258399.1|NM_213607.2	NP_001245328.1|NP_998772.1	Q8IW40	CC103_HUMAN	coiled-coil domain containing 103	140					axonemal dynein complex assembly (GO:0070286)|cell projection organization (GO:0030030)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|outer dynein arm assembly (GO:0036158)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein homodimerization activity (GO:0042803)	p.G140R(1)		endometrium(1)|kidney(1)|large_intestine(3)|prostate(1)|skin(1)	7		Prostate(33;0.109)				GACAGATGTGGGATTTGGACT	0.637																																					p.G140X		.											CCDC103,colon,carcinoma,0,1	CCDC103	0	1	Substitution - Missense(1)	large_intestine(1)	c.G418T						.						69.0	74.0	73.0					17																	42979874		2203	4300	6503	SO:0001587	stop_gained	388389	exon4			GATGTGGGATTTG	AK023156	CCDS11490.1, CCDS58554.1	17q21.31	2013-02-22			ENSG00000167131	ENSG00000167131			32700	protein-coding gene	gene with protein product		614677				22581229	Standard	NM_213607		Approved	FLJ13094, FLJ34211, PR46b, CILD17	uc031ray.1	Q8IW40	OTTHUMG00000154264	ENST00000417826.2:c.418G>T	17.37:g.42979874G>T	ENSP00000391692:p.Gly140*	21	0		30	2	NM_001258395	A8K145|B8ZZU0	Nonsense_Mutation	SNP	ENST00000417826.2	37	CCDS11490.1	.	.	.	.	.	.	.	.	.	.	G	32	5.124025	0.94429	.	.	ENSG00000167131	ENST00000357776;ENST00000417826;ENST00000410006	.	.	.	6.16	6.16	0.99307	.	0.108387	0.35378	U	0.003246	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-7.9395	19.0403	0.92995	0.0:0.0:1.0:0.0	.	.	.	.	X	140	.	ENSP00000350420:G140X	G	+	1	0	CCDC103	40335400	1.000000	0.71417	0.992000	0.48379	0.856000	0.48823	7.808000	0.86044	2.937000	0.99478	0.650000	0.86243	GGA	.		0.637	CCDC103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334578.1	NM_213607	
TDRD9	122402	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	104471611	104471611	+	Splice_Site	SNP	C	C	T	rs199531888		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr14:104471611C>T	ENST00000409874.4	+	15	1630	c.1582C>T	c.(1582-1584)Cgt>Tgt	p.R528C	TDRD9_ENST00000339063.5_Splice_Site_p.R528C	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	528	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				TTCTTTTCAGCGTTGTCCATT	0.463																																					p.R528C		.											TDRD9_ENST00000409874,NS,carcinoma,0,2	TDRD9_ENST00000409874	0	0			c.C1582T						.						70.0	65.0	67.0					14																	104471611		2203	4300	6503	SO:0001630	splice_region_variant	122402	exon15			TTTCAGCGTTGTC	AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.1582-1C>T	14.37:g.104471611C>T		51	0		41	4	NM_153046	A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Missense_Mutation	SNP	ENST00000409874.4	37	CCDS9987.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.62|18.62	3.663778|3.663778	0.67700|0.67700	.|.	.|.	ENSG00000156414|ENSG00000156414	ENST00000557332|ENST00000409874;ENST00000339063	.|T;T	.|0.03607	.|3.87;3.87	5.56|5.56	5.56|5.56	0.83823|0.83823	.|Helicase, C-terminal (1);	.|0.183376	.|0.37012	.|N	.|0.002284	T|T	0.28532|0.28532	0.0706|0.0706	H|H	0.95745|0.95745	3.715|3.715	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.81914	.|0.909;0.995	T|T	0.32322|0.32322	-0.9911|-0.9911	5|10	.|0.87932	.|D	.|0	.|.	15.876|15.876	0.79162|0.79162	0.1359:0.8641:0.0:0.0|0.1359:0.8641:0.0:0.0	.|.	.|528;528	.|Q8NDG6-2;Q8NDG6	.|.;TDRD9_HUMAN	V|C	254|528	.|ENSP00000387303:R528C;ENSP00000343545:R528C	.|ENSP00000343545:R528C	A|R	+|+	2|1	0|0	TDRD9|TDRD9	103541364|103541364	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.778000|0.778000	0.44026|0.44026	3.004000|3.004000	0.49513|0.49513	2.622000|2.622000	0.88805|0.88805	0.655000|0.655000	0.94253|0.94253	GCG|CGT	0.001		0.463	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328325.3	NM_153046	Missense_Mutation
CDHR2	54825	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	176002399	176002399	+	Nonsense_Mutation	SNP	C	C	A	rs565382865		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr5:176002399C>A	ENST00000510636.1	+	9	1014	c.740C>A	c.(739-741)tCg>tAg	p.S247*	CDHR2_ENST00000506348.1_Nonsense_Mutation_p.S247*|CDHR2_ENST00000261944.5_Nonsense_Mutation_p.S247*	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	247	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						GAGTTTTACTCGGCCTCTGTG	0.627																																					p.S247X		.											.	.	.	0			c.C740A						.						87.0	84.0	85.0					5																	176002399		2203	4300	6503	SO:0001587	stop_gained	54825	exon9			TTTACTCGGCCTC	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.740C>A	5.37:g.176002399C>A	ENSP00000424565:p.Ser247*	16	0		33	14	NM_017675	A1L3U4|A6NC80|Q9NXP8	Nonsense_Mutation	SNP	ENST00000510636.1	37	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	C	36	5.709756	0.96821	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	.	.	.	4.32	3.41	0.39046	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.5353	6.5984	0.22687	0.0:0.7565:0.0:0.2435	.	.	.	.	X	247	.	ENSP00000261944:S247X	S	+	2	0	CDHR2	175935005	0.038000	0.19896	0.997000	0.53966	0.991000	0.79684	0.930000	0.28858	0.937000	0.37394	0.478000	0.44815	TCG	.		0.627	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675	
ZC3H7B	23264	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	41723243	41723243	+	Missense_Mutation	SNP	A	A	G			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr22:41723243A>G	ENST00000352645.4	+	5	576	c.319A>G	c.(319-321)Aag>Gag	p.K107E	ZC3H7B_ENST00000351589.4_Missense_Mutation_p.K107E	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	107					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						GGACAGCGAGAAGGCGCTGGG	0.632																																					p.K107E		.											.	.	.	0			c.A319G						.						119.0	94.0	102.0					22																	41723243		2203	4300	6503	SO:0001583	missense	23264	exon5			AGCGAGAAGGCGC		CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.319A>G	22.37:g.41723243A>G	ENSP00000345793:p.Lys107Glu	37	0		35	11	NM_017590	A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Missense_Mutation	SNP	ENST00000352645.4	37	CCDS14013.1	.	.	.	.	.	.	.	.	.	.	A	13.78	2.337903	0.41398	.	.	ENSG00000100403	ENST00000352645;ENST00000351589	T;T	0.62364	0.03;0.03	5.27	5.27	0.74061	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.096995	0.64402	D	0.000001	T	0.66973	0.2844	L	0.50919	1.6	0.45490	D	0.998452	B;D	0.55605	0.34;0.972	B;P	0.56563	0.17;0.801	T	0.62525	-0.6836	10	0.11485	T	0.65	-26.3846	15.197	0.73100	1.0:0.0:0.0:0.0	.	107;107	Q9UGR2-2;Q9UGR2	.;Z3H7B_HUMAN	E	107	ENSP00000345793:K107E;ENSP00000263243:K107E	ENSP00000263243:K107E	K	+	1	0	ZC3H7B	40053189	1.000000	0.71417	1.000000	0.80357	0.593000	0.36681	6.348000	0.73009	1.989000	0.58080	0.402000	0.26972	AAG	.		0.632	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320696.1	NM_017590	
GPR123	84435	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	134940752	134940752	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr10:134940752C>A	ENST00000392607.3	+	6	853	c.417C>A	c.(415-417)agC>agA	p.S139R	GPR123_ENST00000607359.1_Missense_Mutation_p.S859R|GPR123_ENST00000392606.2_Missense_Mutation_p.S42R	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	139					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		ACCTCGTCAGCGGAGGGGTCC	0.657																																					p.S139R		.											.	.	.	0			c.C417A						.						50.0	43.0	45.0					10																	134940752		2202	4299	6501	SO:0001583	missense	84435	exon6			CGTCAGCGGAGGG	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.417C>A	10.37:g.134940752C>A	ENSP00000376384:p.Ser139Arg	70	0		73	35	NM_001083909	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Missense_Mutation	SNP	ENST00000392607.3	37	CCDS41580.1	.	.	.	.	.	.	.	.	.	.	C	11.44	1.638869	0.29157	.	.	ENSG00000197177	ENST00000368577;ENST00000392607;ENST00000392606	T	0.43294	0.95	3.43	-5.32	0.02722	GPCR, family 2-like (1);	0.267878	0.30260	N	0.010024	T	0.45074	0.1324	M	0.74881	2.28	0.42316	D	0.99223	B;P	0.41947	0.115;0.766	B;P	0.44860	0.136;0.462	T	0.56763	-0.7925	10	0.72032	D	0.01	-5.5554	15.4991	0.75680	0.0:0.811:0.0:0.189	.	139;859	Q86SQ6;Q86SQ6-1	GP123_HUMAN;.	R	859;139;43	ENSP00000376384:S139R	ENSP00000357566:S859R	S	+	3	2	GPR123	134790742	0.044000	0.20184	0.927000	0.36925	0.114000	0.19823	-0.916000	0.04029	-1.275000	0.02417	-2.069000	0.00389	AGC	.		0.657	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051113.2		
MGAM	8972	hgsc.bcm.edu	37	7	141794453	141794453	+	Splice_Site	SNP	A	A	T	rs202001107	byFrequency	TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr7:141794453A>T	ENST00000549489.2	+	39	4747	c.4652A>T	c.(4651-4653)tAt>tTt	p.Y1551F	MGAM_ENST00000475668.2_Splice_Site_p.Y2447F	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1551	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GGCATATCCTATGTGAGTGTC	0.527													a|||	8	0.00159744	0.0061	0.0	5008	,	,		17903	0.0		0.0	False		,,,				2504	0.0				p.Y1551F		.											MGAM_ENST00000549489,NS,carcinoma,0,3	MGAM_ENST00000549489	0	0			c.A4652T						.						120.0	108.0	112.0					7																	141794453		2075	4202	6277	SO:0001630	splice_region_variant	8972	exon39			TATCCTATGTGAG	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4653+1A>T	7.37:g.141794453A>T		41	2		60	3	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	A	16.16	3.045439	0.55110	.	.	ENSG00000257335	ENST00000549489;ENST00000475668	D	0.93859	-3.3	5.15	3.98	0.46160	Glycoside hydrolase, superfamily (1);	.	.	.	.	D	0.91143	0.7211	L	0.28400	0.85	0.36228	D	0.852428	P	0.46706	0.883	P	0.50825	0.651	D	0.91753	0.5414	9	0.51188	T	0.08	.	10.8375	0.46696	0.8585:0.0:0.0:0.1415	.	1551	O43451	MGA_HUMAN	F	1551;2448	ENSP00000447378:Y1551F	ENSP00000373973:Y1551F	Y	+	2	0	MGAM	141440922	1.000000	0.71417	1.000000	0.80357	0.321000	0.28281	7.065000	0.76727	0.878000	0.35920	0.533000	0.62120	TAT	.		0.527	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		Missense_Mutation
MICAL3	57553	hgsc.bcm.edu;bcgsc.ca	37	22	18370200	18370200	+	Splice_Site	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr22:18370200G>T	ENST00000441493.2	-	14	2245	c.1893C>A	c.(1891-1893)gaC>gaA	p.D631E	MICAL3_ENST00000383094.3_Splice_Site_p.D631E|MICAL3_ENST00000585038.1_Splice_Site_p.D631E|MICAL3_ENST00000414725.2_Splice_Site_p.D631E|MICAL3_ENST00000429452.1_Splice_Site_p.D631E|MICAL3_ENST00000207726.7_Splice_Site_p.D631E|MICAL3_ENST00000400561.2_Splice_Site_p.D631E|MICAL3_ENST00000444520.1_Splice_Site_p.D631E	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	631					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		GGTCCAAGGTGTCTGGGAATA	0.532																																					p.D631E		.											.	.	.	0			c.C1893A						.						121.0	108.0	112.0					22																	18370200		1568	3582	5150	SO:0001630	splice_region_variant	57553	exon14			CAAGGTGTCTGGG	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.1892-1C>A	22.37:g.18370200G>T		41	0		57	4	NM_015241	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	g	5.656	0.305596	0.10678	.	.	ENSG00000093100;ENSG00000093100;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156	ENST00000441493;ENST00000429452;ENST00000400561;ENST00000444520;ENST00000414725;ENST00000383094;ENST00000207726	T;T;T;T;T;T;T	0.66460	0.05;-0.21;-0.02;-0.02;-0.02;-0.01;-0.02	6.02	-3.14	0.05250	.	0.248326	0.45867	N	0.000330	T	0.38558	0.1045	N	0.14661	0.345	0.18873	N	0.999987	B;B;B;B;B	0.19706	0.0;0.003;0.002;0.007;0.038	B;B;B;B;B	0.12156	0.001;0.007;0.007;0.007;0.006	T	0.31613	-0.9937	10	0.11794	T	0.64	.	9.402	0.38437	0.5283:0.0981:0.3736:0.0	.	631;631;631;631;631	B2RXJ5;Q7RTP6-3;Q7RTP6-2;Q7RTP6-4;Q7RTP6	.;.;.;.;MICA3_HUMAN	E	631	ENSP00000416015:D631E;ENSP00000414846:D631E;ENSP00000383406:D631E;ENSP00000410315:D631E;ENSP00000391827:D631E;ENSP00000372574:D631E;ENSP00000207726:D631E	ENSP00000207726:D631E	D	-	3	2	XXbac-B461K10.4;MICAL3	16750200	0.007000	0.16637	0.258000	0.24420	0.309000	0.27889	-0.842000	0.04354	-0.293000	0.08986	-0.127000	0.14921	GAC	.		0.532	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		Missense_Mutation
MACF1	23499	hgsc.bcm.edu	37	1	39903515	39903515	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:39903515C>T	ENST00000372915.3	+	70	17839	c.17752C>T	c.(17752-17754)Cca>Tca	p.P5918S	MACF1_ENST00000564288.1_Missense_Mutation_p.P6019S|MACF1_ENST00000539005.1_Missense_Mutation_p.P3830S|MACF1_ENST00000289893.4_Missense_Mutation_p.P4462S|MACF1_ENST00000317713.7_Missense_Mutation_p.P3960S|MACF1_ENST00000545844.1_Missense_Mutation_p.P3960S|MACF1_ENST00000567887.1_Missense_Mutation_p.P6056S|MACF1_ENST00000361689.2_Missense_Mutation_p.P3960S			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5918					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GCGTATGCCACCACTGATCCC	0.453																																					p.P3960S		.											.	.	.	0			c.C11878T						.						184.0	168.0	173.0					1																	39903515		2203	4300	6503	SO:0001583	missense	23499	exon68			ATGCCACCACTGA	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.17752C>T	1.37:g.39903515C>T	ENSP00000362006:p.Pro5918Ser	42	0		59	4	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.3|29.3	4.996835|4.996835	0.93167|0.93167	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.48522|.	0.81;0.81;0.81;0.81;0.81;0.81|.	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	0.000000|.	0.64402|.	D|.	0.000011|.	T|T	0.74015|0.74015	0.3661|0.3661	M|M	0.63428|0.63428	1.95|1.95	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.999;1.0|.	T|T	0.71368|0.71368	-0.4614|-0.4614	10|5	0.87932|.	D|.	0|.	.|.	19.497|19.497	0.95077|0.95077	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	5918;3960|.	Q9UPN3;F8W8Q1|.	MACF1_HUMAN;.|.	S|I	3960;5918;3960;3960;3830;4462|2963	ENSP00000439537:P3960S;ENSP00000362006:P5918S;ENSP00000354573:P3960S;ENSP00000313438:P3960S;ENSP00000444364:P3830S;ENSP00000289893:P4462S|.	ENSP00000289893:P4462S|.	P|T	+|+	1|2	0|0	MACF1|MACF1	39676102|39676102	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.989000|0.989000	0.77384|0.77384	7.776000|7.776000	0.85560|0.85560	2.677000|2.677000	0.91161|0.91161	0.563000|0.563000	0.77884|0.77884	CCA|ACC	.		0.453	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
ZNF134	7693	hgsc.bcm.edu	37	19	58132757	58132757	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr19:58132757G>A	ENST00000396161.5	+	3	1580	c.1270G>A	c.(1270-1272)Gca>Aca	p.A424T		NM_003435.3	NP_003426.3	P52741	ZN134_HUMAN	zinc finger protein 134	424					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(3)|prostate(1)	11		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		AGTTCACACTGCAGGCAGGCT	0.453																																					p.A424T		.											.	.	.	0			c.G1270A						.						184.0	192.0	189.0					19																	58132757		2202	4300	6502	SO:0001583	missense	7693	exon3			CACACTGCAGGCA	U09412	CCDS42638.1	19q13.4	2013-01-08	2006-06-13			ENSG00000213762		"""Zinc fingers, C2H2-type"""	12918	protein-coding gene	gene with protein product		604076	"""zinc finger protein 134 (clone pHZ-15)"""			7557990	Standard	NM_003435		Approved	pHZ-15	uc002qpn.2	P52741		ENST00000396161.5:c.1270G>A	19.37:g.58132757G>A	ENSP00000379464:p.Ala424Thr	74	0		63	4	NM_003435	Q9Y4B2	Missense_Mutation	SNP	ENST00000396161.5	37	CCDS42638.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.813905	0.90790	.	.	ENSG00000213762	ENST00000418193;ENST00000541849;ENST00000396161	T	0.08984	3.03	4.08	-0.951	0.10369	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04770	0.0129	N	0.17474	0.49	0.09310	N	1	B	0.18310	0.027	B	0.08055	0.003	T	0.38542	-0.9656	9	0.72032	D	0.01	.	5.1032	0.14770	0.2571:0.0:0.5989:0.144	.	424	P52741	ZN134_HUMAN	T	491;344;424	ENSP00000379464:A424T	ENSP00000379464:A424T	A	+	1	0	ZNF134	62824569	0.106000	0.21978	0.000000	0.03702	0.955000	0.61496	2.197000	0.42696	-0.133000	0.11537	0.563000	0.77884	GCA	.		0.453	ZNF134-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466808.1	NM_003435	
TCHH	7062	hgsc.bcm.edu	37	1	152082449	152082449	+	Missense_Mutation	SNP	T	T	C	rs199978971		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:152082449T>C	ENST00000368804.1	-	2	3243	c.3244A>G	c.(3244-3246)Aag>Gag	p.K1082E		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1082	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.K1082E(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			tcctcttccttccgatattgc	0.607																																					p.K1082E		.											TCHH,NS,carcinoma,0,1	TCHH	0	1	Substitution - Missense(1)	endometrium(1)	c.A3244G						.						102.0	106.0	105.0					1																	152082449		1986	4156	6142	SO:0001583	missense	7062	exon3			CTTCCTTCCGATA	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3244A>G	1.37:g.152082449T>C	ENSP00000357794:p.Lys1082Glu	35	1		67	3	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	T	6.939	0.543097	0.13250	.	.	ENSG00000159450	ENST00000368804	T	0.06068	3.35	2.92	-0.391	0.12446	.	.	.	.	.	T	0.00412	0.0013	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44221	-0.9342	9	0.02654	T	1	-0.0583	2.25	0.04041	0.1808:0.3455:0.3555:0.1182	.	1082	Q07283	TRHY_HUMAN	E	1082	ENSP00000357794:K1082E	ENSP00000357794:K1082E	K	-	1	0	TCHH	150349073	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-2.878000	0.00716	-0.354000	0.08212	-0.413000	0.06143	AAG	.		0.607	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
PAGE2B	389860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	55102523	55102523	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chrX:55102523G>A	ENST00000374971.1	+	2	101	c.49G>A	c.(49-51)Gac>Aac	p.D17N	PAGE2B_ENST00000374974.3_Missense_Mutation_p.D17N	NM_001015038.1	NP_001015038.1	Q5JRK9	GGEE3_HUMAN	P antigen family, member 2B	17										lung(3)	3						AAGAGGAAATGACCAAGAGTC	0.338																																					p.D17N		.											.	.	.	0			c.G49A						.						124.0	104.0	111.0					X																	55102523		2203	4300	6503	SO:0001583	missense	389860	exon2			GGAAATGACCAAG		CCDS35304.1	Xp11.22	2009-06-17			ENSG00000238269	ENSG00000238269			31805	protein-coding gene	gene with protein product							Standard	NM_001015038		Approved	CT16.5	uc004due.4	Q5JRK9	OTTHUMG00000021645	ENST00000374971.1:c.49G>A	X.37:g.55102523G>A	ENSP00000364110:p.Asp17Asn	109	0		73	45	NM_001015038	A1L414	Missense_Mutation	SNP	ENST00000374971.1	37	CCDS35304.1	.	.	.	.	.	.	.	.	.	.	g	12.43	1.936230	0.34189	.	.	ENSG00000238269	ENST00000374974;ENST00000374971;ENST00000453343	T;T	0.10573	2.86;2.86	1.16	0.142	0.14816	.	.	.	.	.	T	0.14787	0.0357	M	0.70275	2.135	0.09310	N	1	P	0.44380	0.834	P	0.46825	0.528	T	0.14504	-1.0470	9	0.33940	T	0.23	.	4.2155	0.10531	0.0:0.0:0.6087:0.3913	.	17	Q5JRK9	GGEE3_HUMAN	N	17	ENSP00000364113:D17N;ENSP00000364110:D17N	ENSP00000364110:D17N	D	+	1	0	PAGE2B	55119248	0.000000	0.05858	0.000000	0.03702	0.147000	0.21601	0.103000	0.15292	-0.004000	0.14419	0.287000	0.19450	GAC	.		0.338	PAGE2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056849.1	XM_372224	
TPT1-AS1	100190939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	13	45957312	45957312	+	RNA	SNP	A	A	C			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr13:45957312A>C	ENST00000517509.1	+	0	930				TPT1-AS1_ENST00000522673.1_RNA|TPT1-AS1_ENST00000520585.1_RNA|TPT1-AS1_ENST00000519454.1_RNA|TPT1-AS1_ENST00000523445.1_RNA	NR_024458.1				TPT1 antisense RNA 1																		caagtaaggtacctgccgtcg	0.547																																					.		.											.	.	.	0			.						.																																					100190939	.			TAAGGTACCTGCC	AF318337		13q14.13	2012-10-12	2012-08-15		ENSG00000170919	ENSG00000170919		"""Long non-coding RNAs"""	43686	non-coding RNA	RNA, long non-coding			"""TPT1 antisense RNA 1 (non-protein coding)"""				Standard	NR_024458		Approved		uc021rjh.1		OTTHUMG00000016851		13.37:g.45957312A>C		49	0		40	6	.		RNA	SNP	ENST00000517509.1	37																																																																																				.		0.547	TPT1-AS1-003	KNOWN	basic	antisense	antisense	OTTHUMT00000374919.1	NR_024458	
PHF7	51533	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52442599	52442599	+	5'Flank	SNP	A	A	G			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr3:52442599A>G	ENST00000327906.3	+	0	0				PHF7_ENST00000347025.2_5'Flank|BAP1_ENST00000296288.5_Missense_Mutation_p.L49P|BAP1_ENST00000460680.1_Missense_Mutation_p.L49P	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7							Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		CCATTTGAACAGGAAGATAAA	0.468																																					p.L49P		.											.	.	.	0			c.T146C						.						35.0	34.0	34.0					3																	52442599		2203	4299	6502	SO:0001631	upstream_gene_variant	8314	exon4			TTGAACAGGAAGA	AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495		3.37:g.52442599A>G	Exception_encountered	38	0		20	16	NM_004656	K4DI82	Missense_Mutation	SNP	ENST00000327906.3	37	CCDS2854.1	.	.	.	.	.	.	.	.	.	.	A	28.4	4.915937	0.92178	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.64260	-0.09;-0.09	5.43	5.43	0.79202	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.000000	0.64402	D	0.000001	D	0.86029	0.5835	H	0.97023	3.925	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90851	0.4731	10	0.87932	D	0	-2.3505	15.4676	0.75412	1.0:0.0:0.0:0.0	.	49	Q92560	BAP1_HUMAN	P	49	ENSP00000417132:L49P;ENSP00000296288:L49P	ENSP00000296288:L49P	L	-	2	0	BAP1	52417639	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.297000	0.96120	2.061000	0.61500	0.533000	0.62120	CTG	.		0.468	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351155.1	NM_016483	
AC006116.24	0	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	56888251	56888251	+	RNA	SNP	A	A	C			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr19:56888251A>C	ENST00000591836.1	-	0	402				ZNF542_ENST00000490123.1_RNA																							CCAGGTGCAGAGATTAAGGAG	0.333																																					.		.											.	.	.	0			.						.																																					147947	.			GTGCAGAGATTAA																													19.37:g.56888251A>C		24	0		21	8	.		RNA	SNP	ENST00000591836.1	37																																																																																				.		0.333	AC006116.24-001	KNOWN	basic	sense_intronic	sense_intronic	OTTHUMT00000459747.1		
SUPT7L	9913	hgsc.bcm.edu	37	2	27878431	27878431	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:27878431G>T	ENST00000337768.5	-	5	1352	c.783C>A	c.(781-783)gtC>gtA	p.V261V	SUPT7L_ENST00000404798.2_Silent_p.V126V|SUPT7L_ENST00000405491.1_Silent_p.V259V|SUPT7L_ENST00000464789.2_Silent_p.V259V|SUPT7L_ENST00000406540.1_Silent_p.V259V	NM_001282729.1|NM_014860.1	NP_001269658.1|NP_055675.1	O94864	ST65G_HUMAN	suppressor of Ty 7 (S. cerevisiae)-like	261					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|maintenance of protein location in nucleus (GO:0051457)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)					TCTCAGGATTGACAATCCTTT	0.448																																					p.V261V		.											SUPT7L,NS,carcinoma,0,1	SUPT7L	0	0			c.C783A						.						119.0	117.0	118.0					2																	27878431		1940	4155	6095	SO:0001819	synonymous_variant	9913	exon5			AGGATTGACAATC	AF197954	CCDS42667.1, CCDS62885.1, CCDS62886.1	2p23.3	2008-02-05			ENSG00000119760	ENSG00000119760			30632	protein-coding gene	gene with protein product		612762				9872452, 11564863	Standard	NM_001282732		Approved	STAF65, gamma, KIAA0764, SPT7L	uc002rli.1	O94864	OTTHUMG00000151947	ENST00000337768.5:c.783C>A	2.37:g.27878431G>T		31	0		25	2	NM_014860	B4E3W3|Q6IB21|Q9H2T6	Silent	SNP	ENST00000337768.5	37	CCDS42667.1																																																																																			.		0.448	SUPT7L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324568.1	NM_014860	
FAM50B	26240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	3850817	3850817	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr6:3850817G>A	ENST00000380274.1	+	1	1198	c.772G>A	c.(772-774)Gcg>Acg	p.A258T	FAM50B_ENST00000380272.3_Missense_Mutation_p.A258T			Q9Y247	FA50B_HUMAN	family with sequence similarity 50, member B	258						nucleus (GO:0005634)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(3)|urinary_tract(3)	17	Ovarian(93;0.0925)	all_hematologic(90;0.108)				CATCGCCAGGGCGAGGGGCAA	0.637																																					p.A258T		.											.	.	.	0			c.G772A						.						67.0	56.0	60.0					6																	3850817		2203	4300	6503	SO:0001583	missense	26240	exon2			GCCAGGGCGAGGG	Y18504	CCDS4487.1	6p25.2	2008-05-15			ENSG00000145945	ENSG00000145945			18789	protein-coding gene	gene with protein product		614686				10534398	Standard	NM_012135		Approved	D6S2654E, X5L	uc003mvu.3	Q9Y247	OTTHUMG00000014147	ENST00000380274.1:c.772G>A	6.37:g.3850817G>A	ENSP00000369627:p.Ala258Thr	31	0		30	8	NM_012135	Q5T2L6	Missense_Mutation	SNP	ENST00000380274.1	37	CCDS4487.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.553658	0.86231	.	.	ENSG00000145945	ENST00000380274;ENST00000380272	.	.	.	4.34	4.34	0.51931	.	0.059465	0.64402	D	0.000003	T	0.57388	0.2050	M	0.64260	1.97	0.58432	D	0.999997	P	0.50272	0.933	P	0.53102	0.718	T	0.58509	-0.7624	9	0.42905	T	0.14	-24.7078	14.8117	0.70000	0.0:0.0:1.0:0.0	.	258	Q9Y247	FA50B_HUMAN	T	258	.	ENSP00000369625:A258T	A	+	1	0	FAM50B	3795816	1.000000	0.71417	0.222000	0.23844	0.806000	0.45545	5.962000	0.70364	2.430000	0.82344	0.555000	0.69702	GCG	.		0.637	FAM50B-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039693.1	NM_012135	
SLC9A9	285195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	143567100	143567100	+	Missense_Mutation	SNP	A	A	G	rs559067786		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr3:143567100A>G	ENST00000316549.6	-	1	273	c.65T>C	c.(64-66)gTg>gCg	p.V22A	SLC9A9_ENST00000498717.2_5'UTR	NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9	22					ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)			breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						AAGCAGCTCCACCGCTCCCTG	0.413																																					p.V22A		.											.	.	.	0			c.T65C						.						156.0	149.0	151.0					3																	143567100		2203	4300	6503	SO:0001583	missense	285195	exon1			AGCTCCACCGCTC	AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.65T>C	3.37:g.143567100A>G	ENSP00000320246:p.Val22Ala	108	0		66	14	NM_173653	A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Missense_Mutation	SNP	ENST00000316549.6	37	CCDS33872.1	.	.	.	.	.	.	.	.	.	.	A	17.19	3.325309	0.60743	.	.	ENSG00000181804	ENST00000316549;ENST00000474151	T;T	0.22743	1.94;1.94	5.66	5.66	0.87406	.	0.095420	0.45867	D	0.000326	T	0.16599	0.0399	L	0.31065	0.9	0.43885	D	0.996505	B	0.21520	0.057	B	0.15052	0.012	T	0.07028	-1.0794	10	0.17832	T	0.49	.	15.8923	0.79309	1.0:0.0:0.0:0.0	.	22	Q8IVB4	SL9A9_HUMAN	A	22	ENSP00000320246:V22A;ENSP00000418627:V22A	ENSP00000320246:V22A	V	-	2	0	SLC9A9	145049790	1.000000	0.71417	0.995000	0.50966	0.982000	0.71751	4.528000	0.60580	2.157000	0.67596	0.533000	0.62120	GTG	.		0.413	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354994.1	NM_173653	
SNCG	6623	hgsc.bcm.edu;bcgsc.ca	37	10	88718478	88718478	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr10:88718478C>A	ENST00000372017.3	+	1	66	c.24C>A	c.(22-24)ttC>ttA	p.F8L	MMRN2_ENST00000372027.5_5'Flank|SNCG_ENST00000348795.4_Missense_Mutation_p.F8L	NM_003087.2	NP_003078.2	O76070	SYUG_HUMAN	synuclein, gamma (breast cancer-specific protein 1)	8					adult locomotory behavior (GO:0008344)|aggressive behavior (GO:0002118)|cellular response to hydrostatic pressure (GO:0071464)|protein secretion (GO:0009306)|regulation of dopamine secretion (GO:0014059)|regulation of neurotransmitter secretion (GO:0046928)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				endometrium(1)|skin(1)	2						AGAAGGGCTTCTCCATCGCCA	0.612																																					p.F8L		.											.	.	.	0			c.C24A						.						80.0	71.0	74.0					10																	88718478		2203	4300	6503	SO:0001583	missense	6623	exon1			GGGCTTCTCCATC	AF044311	CCDS7380.1	10q23.2-q23.3	2006-06-28			ENSG00000173267	ENSG00000173267			11141	protein-coding gene	gene with protein product	"""synoretin"""	602998				9044857, 9700196	Standard	NM_003087		Approved	BCSG1, SR, persyn	uc001keb.2	O76070	OTTHUMG00000018656	ENST00000372017.3:c.24C>A	10.37:g.88718478C>A	ENSP00000361087:p.Phe8Leu	43	0		69	4	NM_003087	O15104|Q96P61	Missense_Mutation	SNP	ENST00000372017.3	37	CCDS7380.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.366638	0.61513	.	.	ENSG00000173267	ENST00000348795;ENST00000372017	D;D	0.82526	-1.62;-1.62	5.62	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.80037	0.4550	L	0.49126	1.545	0.45634	D	0.998565	P	0.42296	0.775	P	0.46758	0.526	T	0.75326	-0.3357	10	0.23302	T	0.38	-19.5449	7.8031	0.29187	0.0:0.7574:0.0:0.2426	.	8	O76070	SYUG_HUMAN	L	8	ENSP00000344658:F8L;ENSP00000361087:F8L	ENSP00000344658:F8L	F	+	3	2	SNCG	88708458	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.555000	0.36277	1.388000	0.46506	0.555000	0.69702	TTC	.		0.612	SNCG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049167.1		
UNC79	57578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	94088818	94088818	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr14:94088818C>T	ENST00000393151.2	+	30	5239	c.5239C>T	c.(5239-5241)Cga>Tga	p.R1747*	UNC79_ENST00000555664.1_Nonsense_Mutation_p.R1747*|UNC79_ENST00000256339.4_Nonsense_Mutation_p.R1570*|UNC79_ENST00000553484.1_Nonsense_Mutation_p.R1769*			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1747					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						GAAGCAAAAACGAGACCTCCT	0.587																																					p.R1570X		.											.	.	.	0			c.C4708T						.						66.0	70.0	69.0					14																	94088818		2203	4300	6503	SO:0001587	stop_gained	57578	exon30			CAAAAACGAGACC	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.5239C>T	14.37:g.94088818C>T	ENSP00000376858:p.Arg1747*	37	0		24	20	NM_020818	B5MDL6|Q6ZUT7	Nonsense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	C	42	9.493133	0.99186	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	.	.	.	5.2	2.14	0.27477	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.8113	14.9559	0.71113	0.6013:0.3987:0.0:0.0	.	.	.	.	X	1570;1747;1769;1747;1769	.	ENSP00000256339:R1570X	R	+	1	2	KIAA1409	93158571	1.000000	0.71417	0.996000	0.52242	0.764000	0.43329	0.745000	0.26259	0.538000	0.28769	0.305000	0.20034	CGA	.		0.587	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
FAM71A	149647	hgsc.bcm.edu	37	1	212798528	212798528	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:212798528G>T	ENST00000294829.3	+	1	740	c.309G>T	c.(307-309)caG>caT	p.Q103H	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	103						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		GACATGGCCAGGCCACCAAGA	0.557																																					p.Q103H		.											FAM71A,NS,carcinoma,0,1	FAM71A	0	0			c.G309T						.						61.0	61.0	61.0					1																	212798528		2203	4300	6503	SO:0001583	missense	149647	exon1			TGGCCAGGCCACC		CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.309G>T	1.37:g.212798528G>T	ENSP00000294829:p.Gln103His	28	0		54	3	NM_153606	Q5VTZ1	Missense_Mutation	SNP	ENST00000294829.3	37	CCDS1507.1	.	.	.	.	.	.	.	.	.	.	G	4.886	0.164661	0.09287	.	.	ENSG00000162771	ENST00000294829	T	0.04049	3.72	4.18	-0.361	0.12564	.	4.058970	0.00741	N	0.001009	T	0.06096	0.0158	L	0.51422	1.61	0.09310	N	1	B	0.26363	0.147	B	0.18561	0.022	T	0.37033	-0.9723	10	0.51188	T	0.08	-6.8965	3.9381	0.09314	0.346:0.1767:0.4773:0.0	.	103	Q8IYT1	FA71A_HUMAN	H	103	ENSP00000294829:Q103H	ENSP00000294829:Q103H	Q	+	3	2	FAM71A	210865151	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.098000	0.11024	-0.154000	0.11118	-0.262000	0.10625	CAG	.		0.557	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098529.1	NM_153606	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	179437209	179437209	+	Missense_Mutation	SNP	T	T	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:179437209T>A	ENST00000591111.1	-	276	68951	c.68727A>T	c.(68725-68727)aaA>aaT	p.K22909N	TTN_ENST00000359218.5_Missense_Mutation_p.K15610N|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.K15485N|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K21982N|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K24550N|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K15677N|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	22909	Fibronectin type-III 66. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGTTCTTGATTTTTGAACCTC	0.453																																					p.K24550N		.											.	.	.	0			c.A73650T						.						73.0	69.0	71.0					2																	179437209		1872	4107	5979	SO:0001583	missense	7273	exon326			CTTGATTTTTGAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.68727A>T	2.37:g.179437209T>A	ENSP00000465570:p.Lys22909Asn	35	0		44	10	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	10.27	1.305140	0.23736	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	6.07	1.94	0.25998	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50188	0.1601	L	0.58428	1.81	0.48632	D	0.999687	P;P;P;P	0.43633	0.813;0.813;0.813;0.701	B;B;B;B	0.42798	0.398;0.398;0.398;0.247	T	0.54275	-0.8318	9	0.87932	D	0	.	11.0461	0.47859	0.0:0.2049:0.0:0.7951	.	15485;15610;15677;22909	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	21982;15485;15677;15610;15483	ENSP00000343764:K21982N;ENSP00000434586:K15485N;ENSP00000340554:K15677N;ENSP00000352154:K15610N	ENSP00000340554:K15677N	K	-	3	2	TTN	179145455	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.872000	0.39549	0.509000	0.28195	0.528000	0.53228	AAA	.		0.453	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
F2RL1	2150	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	76128777	76128777	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr5:76128777C>T	ENST00000296677.4	+	2	551	c.345C>T	c.(343-345)gcC>gcT	p.A115A		NM_005242.4	NP_005233	P55085	PAR2_HUMAN	coagulation factor II (thrombin) receptor-like 1	115					blood coagulation (GO:0007596)|chemokine (C-C motif) ligand 2 secretion (GO:0035926)|chemokine secretion (GO:0090195)|defense response to virus (GO:0051607)|establishment of endothelial barrier (GO:0061028)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|interleukin-1 beta secretion (GO:0050702)|interleukin-10 secretion (GO:0072608)|leukocyte migration (GO:0050900)|leukocyte proliferation (GO:0070661)|mature dendritic cell differentiation (GO:0097029)|negative regulation of chemokine secretion (GO:0090198)|negative regulation of JNK cascade (GO:0046329)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neutrophil activation (GO:0042119)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of cell migration (GO:0030335)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of eosinophil degranulation (GO:0043311)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JNK cascade (GO:0046330)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of neutrophil mediated killing of gram-negative bacterium (GO:0070963)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of renin secretion into blood stream (GO:1900135)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of toll-like receptor 2 signaling pathway (GO:0034137)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasodilation (GO:0045909)|regulation of blood coagulation (GO:0030193)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of JNK cascade (GO:0046328)|T cell activation involved in immune response (GO:0002286)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	13		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;7.7e-51)|Epithelial(54;2.77e-45)|all cancers(79;3.47e-41)		TTTACATGGCCAATCTGGCCT	0.478																																					p.A115A		.											F2RL1,NS,carcinoma,0,1	F2RL1	0	0			c.C345T						.						249.0	246.0	247.0					5																	76128777		2203	4300	6503	SO:0001819	synonymous_variant	2150	exon2			CATGGCCAATCTG	BC018130	CCDS4033.1	5q13	2012-08-08			ENSG00000164251	ENSG00000164251		"""GPCR / Class A : Protease activated receptors"""	3538	protein-coding gene	gene with protein product	"""proteinase-activated receptor-2"""	600933		GPR11		7937743, 7556175	Standard	NM_005242		Approved	PAR2	uc003keo.3	P55085	OTTHUMG00000102118	ENST00000296677.4:c.345C>T	5.37:g.76128777C>T		35	0		27	9	NM_005242	Q13317|Q13346|Q53XJ8	Silent	SNP	ENST00000296677.4	37	CCDS4033.1																																																																																			.		0.478	F2RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219957.2		
GSK3A	2931	hgsc.bcm.edu	37	19	42737289	42737289	+	Silent	SNP	A	A	G			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr19:42737289A>G	ENST00000222330.3	-	8	1198	c.1071T>C	c.(1069-1071)ccT>ccC	p.P357P	GSK3A_ENST00000398249.4_Silent_p.P275P	NM_019884.2	NP_063937.2	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	357	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cardiac left ventricle morphogenesis (GO:0003214)|cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|cellular response to interleukin-3 (GO:0036016)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transferase activity (GO:0051348)|negative regulation of type B pancreatic cell development (GO:2000077)|negative regulation of UDP-glucose catabolic process (GO:0010905)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of heart contraction (GO:0045823)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein phosphorylation (GO:0006468)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of systemic arterial blood pressure (GO:0003073)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytosol (GO:0005829)	ATP binding (GO:0005524)|protein kinase A catalytic subunit binding (GO:0034236)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(3)|large_intestine(3)|lung(6)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	19		Prostate(69;0.00682)				CTTTAATCTGAGGGAACTTGA	0.567																																					p.P357P		.											.	.	.	0			c.T1071C						.						136.0	132.0	133.0					19																	42737289		2203	4300	6503	SO:0001819	synonymous_variant	2931	exon8			AATCTGAGGGAAC		CCDS12599.1	19q13	2008-02-15			ENSG00000105723	ENSG00000105723			4616	protein-coding gene	gene with protein product		606784				9809441	Standard	NM_019884		Approved		uc002otb.1	P49840	OTTHUMG00000150722	ENST00000222330.3:c.1071T>C	19.37:g.42737289A>G		58	0		79	4	NM_019884	O14959	Silent	SNP	ENST00000222330.3	37	CCDS12599.1																																																																																			.		0.567	GSK3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319782.1		
TEX2	55852	hgsc.bcm.edu;broad.mit.edu	37	17	62271115	62271115	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr17:62271115C>T	ENST00000583097.1	-	4	2152	c.1980G>A	c.(1978-1980)ccG>ccA	p.P660P	TEX2_ENST00000258991.3_Silent_p.P660P|TEX2_ENST00000584379.1_Silent_p.P660P			Q8IWB9	TEX2_HUMAN	testis expressed 2	660					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		CCTCAGCTGGCGGCTTCTCTT	0.483																																					p.P660P		.											.	.	.	0			c.G1980A						.						102.0	91.0	95.0					17																	62271115		2203	4300	6503	SO:0001819	synonymous_variant	55852	exon4			AGCTGGCGGCTTC	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.1980G>A	17.37:g.62271115C>T		69	0		81	4	NM_018469	Q6AHZ5|Q8N3L0|Q9C0C5	Silent	SNP	ENST00000583097.1	37																																																																																				.		0.483	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469	
PLEKHA3	65977	hgsc.bcm.edu	37	2	179348065	179348065	+	Intron	SNP	A	A	T	rs142974431	byFrequency	TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:179348065A>T	ENST00000234453.5	+	2	442				PLEKHA3_ENST00000461474.1_Intron	NM_019091.3	NP_061964.3	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3							Golgi apparatus (GO:0005794)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			Gataaaaagaattaaaaaaaa	0.274																																					.		.											.	.	.	0			.						.						12.0	12.0	12.0					2																	179348065		692	1581	2273	SO:0001627	intron_variant	100302152	.			AAAAGAATTAAAA	AF286162	CCDS33336.1	2q31.2	2013-01-10	2002-01-14		ENSG00000116095	ENSG00000116095		"""Pleckstrin homology (PH) domain containing"""	14338	protein-coding gene	gene with protein product	"""four-phosphate-adaptor protein 1"""	607774	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3"""			11001876, 15107860	Standard	NM_019091		Approved	FAPP1	uc002umn.3	Q9HB20	OTTHUMG00000154446	ENST00000234453.5:c.41-2303A>T	2.37:g.179348065A>T		72	0		123	4	.	Q4ZG69|Q86TQ1|Q9NXT3	RNA	SNP	ENST00000234453.5	37	CCDS33336.1																																																																																			.		0.274	PLEKHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335241.2	NM_019091	
CHTF18	63922	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	845949	845949	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr16:845949G>A	ENST00000262315.9	+	18	2391	c.2328G>A	c.(2326-2328)gtG>gtA	p.V776V	CHTF18_ENST00000455171.2_Silent_p.V804V|CHTF18_ENST00000317063.6_Silent_p.V985V	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	776					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				TCCCCTAGGTGAGCACACAGC	0.642																																					p.V776V		.											.	.	.	0			c.G2328A						.						26.0	33.0	31.0					16																	845949		2140	4248	6388	SO:0001819	synonymous_variant	63922	exon18			CTAGGTGAGCACA	BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.2328G>A	16.37:g.845949G>A		16	0		20	7	NM_022092	B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Silent	SNP	ENST00000262315.9	37	CCDS45371.1																																																																																			.		0.642	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109061.3	NM_022092	
ZIC3	7547	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	136649399	136649399	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chrX:136649399G>A	ENST00000287538.5	+	1	1099	c.549G>A	c.(547-549)caG>caA	p.Q183Q	RP1-137H15.2_ENST00000442841.1_RNA|ZIC3_ENST00000370606.3_Silent_p.Q183Q	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	183					anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					ACAACAACCAGGTCCACCTGG	0.701																																					p.Q183Q		.											.	.	.	0			c.G549A						.						26.0	29.0	28.0					X																	136649399		2178	4237	6415	SO:0001819	synonymous_variant	7547	exon1			CAACCAGGTCCAC	AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.549G>A	X.37:g.136649399G>A		36	0		28	11	NM_003413	B2CNW4|Q14DE5|Q5JY75	Silent	SNP	ENST00000287538.5	37	CCDS14663.1																																																																																			.		0.701	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058526.1		
ATM	472	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	108121693	108121693	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr11:108121693C>A	ENST00000452508.2	+	11	1690	c.1501C>A	c.(1501-1503)Caa>Aaa	p.Q501K	ATM_ENST00000278616.4_Missense_Mutation_p.Q501K			Q13315	ATM_HUMAN	ATM serine/threonine kinase	501					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TGAGCAAATACAAGCTGAAAA	0.383			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.Q501K		.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	.	.	0			c.C1501A						.						130.0	142.0	138.0					11																	108121693		2201	4298	6499	SO:0001583	missense	472	exon10	Familial Cancer Database	AT, Louis-Bar syndrome	CAAATACAAGCTG	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.1501C>A	11.37:g.108121693C>A	ENSP00000388058:p.Gln501Lys	100	0		56	37	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	C	18.46	3.628472	0.67015	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.53640	0.61;0.61;0.61	6.04	5.08	0.68730	Armadillo-type fold (1);	0.054764	0.64402	D	0.000001	T	0.45915	0.1366	L	0.57536	1.79	0.33907	D	0.639239	B	0.26318	0.146	B	0.24974	0.057	T	0.59231	-0.7493	10	0.62326	D	0.03	.	14.1262	0.65222	0.0:0.6909:0.3091:0.0	.	501	Q13315	ATM_HUMAN	K	501	ENSP00000435747:Q501K;ENSP00000278616:Q501K;ENSP00000388058:Q501K	ENSP00000278616:Q501K	Q	+	1	0	ATM	107626903	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.480000	0.73604	2.873000	0.98535	0.561000	0.74099	CAA	.		0.383	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
HDGF	3068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156713449	156713449	+	Missense_Mutation	SNP	A	A	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:156713449A>T	ENST00000357325.5	-	5	1025	c.711T>A	c.(709-711)caT>caA	p.H237Q	HDGF_ENST00000368209.5_Missense_Mutation_p.H230Q|HDGF_ENST00000537739.1_Missense_Mutation_p.H237Q|HDGF_ENST00000465180.1_5'UTR|MRPL24_ENST00000368211.4_5'Flank|HDGF_ENST00000416666.2_Missense_Mutation_p.H205Q|HDGF_ENST00000368206.5_Missense_Mutation_p.H253Q|MRPL24_ENST00000361531.2_5'Flank	NM_004494.2	NP_004485.1	P51858	HDGF_HUMAN	hepatoma-derived growth factor	237					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription corepressor binding (GO:0001222)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9	all_hematologic(923;0.088)|Hepatocellular(266;0.158)	Breast(1374;0.198)		Colorectal(1306;0.018)		CTCACCTCTCATGATCTCTGA	0.622																																					p.H253Q		.											.	.	.	0			c.T759A						.						58.0	66.0	63.0					1																	156713449		2203	4300	6503	SO:0001583	missense	3068	exon5			CCTCTCATGATCT	D16431	CCDS1156.1, CCDS44247.1, CCDS44248.1	1q23.1	2013-10-14	2010-03-19		ENSG00000143321	ENSG00000143321			4856	protein-coding gene	gene with protein product	"""high-mobility group protein 1-like"""	600339	"""hepatoma-derived growth factor (high-mobility group protein 1-like)"""			8833162	Standard	NM_004494		Approved	HMG1L2	uc001fpy.4	P51858	OTTHUMG00000041295	ENST00000357325.5:c.711T>A	1.37:g.156713449A>T	ENSP00000349878:p.His237Gln	37	0		50	10	NM_001126050	B3KU21|D3DVC9|Q5SZ07|Q5SZ08|Q5SZ09	Missense_Mutation	SNP	ENST00000357325.5	37	CCDS1156.1	.	.	.	.	.	.	.	.	.	.	A	14.89	2.671072	0.47781	.	.	ENSG00000143321	ENST00000357325;ENST00000368209;ENST00000537739;ENST00000416666;ENST00000368206;ENST00000406805	T;T;T;T;T	0.34667	1.89;1.41;1.89;1.47;1.35	4.41	-4.02	0.04034	.	0.521490	0.16686	U	0.203727	T	0.23171	0.0560	N	0.25647	0.755	0.20307	N	0.999915	D;D;D;P	0.65815	0.995;0.995;0.995;0.932	D;D;D;P	0.70487	0.969;0.969;0.969;0.88	T	0.31641	-0.9936	10	0.40728	T	0.16	-9.6676	11.5074	0.50474	0.3455:0.0:0.6545:0.0	.	212;253;230;237	B7Z958;Q5SZ07;Q5SZ08;P51858	.;.;.;HDGF_HUMAN	Q	237;230;237;205;253;260	ENSP00000349878:H237Q;ENSP00000357192:H230Q;ENSP00000443120:H237Q;ENSP00000416752:H205Q;ENSP00000357189:H253Q	ENSP00000349878:H237Q	H	-	3	2	HDGF	154980073	0.727000	0.28069	0.946000	0.38457	0.975000	0.68041	-0.549000	0.06041	-0.667000	0.05303	0.329000	0.21502	CAT	.		0.622	HDGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098946.1	NM_004494	
GLTP	51228	hgsc.bcm.edu	37	12	110295408	110295408	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr12:110295408G>T	ENST00000318348.4	-	3	332	c.219C>A	c.(217-219)atC>atA	p.I73I	GLTP_ENST00000544393.1_Silent_p.I73I	NM_016433.3	NP_057517.1	Q9NZD2	GLTP_HUMAN	glycolipid transfer protein	73					glycolipid transport (GO:0046836)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)|lipid binding (GO:0008289)	p.I73M(1)		endometrium(1)|kidney(1)|lung(1)|upper_aerodigestive_tract(1)	4		Lung NSC(355;2.38e-06)|Breast(359;0.00354)|Myeloproliferative disorder(1001;0.0122)		BRCA - Breast invasive adenocarcinoma(302;0.0025)		CCACCTCCAGGATGTTCTGCA	0.552																																					p.I73I		.											GLTP,mouth,carcinoma,0,1	GLTP	0	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.C219A						.						98.0	92.0	94.0					12																	110295408		2203	4300	6503	SO:0001819	synonymous_variant	51228	exon3			CTCCAGGATGTTC	AF209704, AY372530	CCDS9136.1	12q24.11	2008-08-08			ENSG00000139433	ENSG00000139433			24867	protein-coding gene	gene with protein product		608949				15287756, 15901739	Standard	NM_016433		Approved		uc001tpm.3	Q9NZD2	OTTHUMG00000169278	ENST00000318348.4:c.219C>A	12.37:g.110295408G>T		39	0		42	2	NM_016433	Q53Z13|Q96J68	Silent	SNP	ENST00000318348.4	37	CCDS9136.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.686706	0.68157	.	.	ENSG00000139433	ENST00000540772	.	.	.	4.89	4.0	0.46444	.	.	.	.	.	T	0.58977	0.2160	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55958	-0.8058	4	.	.	.	.	8.6951	0.34291	0.1759:0.0:0.8241:0.0	.	.	.	.	Y	57	.	.	S	-	2	0	GLTP	108779791	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.705000	0.47127	1.199000	0.43173	0.650000	0.86243	TCC	.		0.552	GLTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403278.2	NM_016433	
IRF9	10379	hgsc.bcm.edu	37	14	24632181	24632181	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr14:24632181G>A	ENST00000396864.3	+	3	474	c.187G>A	c.(187-189)Gca>Aca	p.A63T	IRF9_ENST00000557894.1_5'UTR|RP11-468E2.4_ENST00000558468.1_3'UTR	NM_006084.4	NP_006075.3	Q00978	IRF9_HUMAN	interferon regulatory factor 9	63					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(265;0.00853)		CTAGGCCTGGGCAATATTTAA	0.522																																					p.A63T		.											IRF9,caecum,carcinoma,0,1	IRF9	0	0			c.G187A						.						38.0	39.0	39.0					14																	24632181		2203	4300	6503	SO:0001583	missense	10379	exon3			GCCTGGGCAATAT	M87503	CCDS9615.1	14q11.2	2007-07-06	2007-07-06	2007-07-06	ENSG00000213928	ENSG00000213928			6131	protein-coding gene	gene with protein product		147574	"""interferon-stimulated transcription factor 3, gamma (48kD)"", ""interferon-stimulated transcription factor 3, gamma 48kDa"""	ISGF3G		1630447, 10199920	Standard	NM_006084		Approved		uc001wmq.3	Q00978	OTTHUMG00000028799	ENST00000396864.3:c.187G>A	14.37:g.24632181G>A	ENSP00000380073:p.Ala63Thr	49	0		44	2	NM_006084	D3DS61	Missense_Mutation	SNP	ENST00000396864.3	37	CCDS9615.1	.	.	.	.	.	.	.	.	.	.	G	35	5.591497	0.96590	.	.	ENSG00000213928	ENST00000396864	D	0.99105	-5.43	5.08	5.08	0.68730	Interferon regulatory factor, conserved site (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.000000	0.64402	U	0.000004	D	0.99498	0.9821	H	0.95004	3.61	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98235	1.0485	10	0.87932	D	0	0.8833	17.2487	0.87035	0.0:0.0:1.0:0.0	.	63	Q00978	IRF9_HUMAN	T	63	ENSP00000380073:A63T	ENSP00000380073:A63T	A	+	1	0	IRF9	23702021	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	8.884000	0.92432	2.375000	0.81037	0.650000	0.86243	GCA	.		0.522	IRF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071927.2		
SLC39A5	283375	hgsc.bcm.edu;bcgsc.ca	37	12	56630250	56630250	+	Missense_Mutation	SNP	C	C	T	rs577350818		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr12:56630250C>T	ENST00000266980.4	+	7	1309	c.1016C>T	c.(1015-1017)gCc>gTc	p.A339V	SLC39A5_ENST00000454355.2_Missense_Mutation_p.A339V|ANKRD52_ENST00000548241.1_5'Flank	NM_001135195.1	NP_001128667.1	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (zinc transporter), member 5	339					cellular response to zinc ion starvation (GO:0034224)|G1 to G0 transition involved in cell differentiation (GO:0070315)|neural precursor cell proliferation (GO:0061351)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			NS(1)|cervix(6)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						AGTGGGATGGCCCTTCAGCCC	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		23406	0.0		0.0	False		,,,				2504	0.001				p.A339V		.											.	.	.	0			c.C1016T						.						121.0	122.0	122.0					12																	56630250		2203	4300	6503	SO:0001583	missense	283375	exon9			GGATGGCCCTTCA		CCDS8912.2	12q13.3	2013-07-17	2013-07-17		ENSG00000139540	ENSG00000139540		"""Solute carriers"""	20502	protein-coding gene	gene with protein product		608730	"""solute carrier family 39 (metal ion transporter), member 5"""				Standard	NM_173596		Approved		uc010sqj.2	Q6ZMH5	OTTHUMG00000156962	ENST00000266980.4:c.1016C>T	12.37:g.56630250C>T	ENSP00000266980:p.Ala339Val	74	0		71	4	NM_173596	B2R808|Q8N6Y3	Missense_Mutation	SNP	ENST00000266980.4	37	CCDS8912.2	.	.	.	.	.	.	.	.	.	.	C	13.10	2.135192	0.37728	.	.	ENSG00000139540	ENST00000454355;ENST00000266980	T;T	0.48522	0.81;0.81	4.86	3.01	0.34805	.	0.233115	0.29424	N	0.012184	T	0.28333	0.0700	L	0.27975	0.815	0.27483	N	0.952528	B	0.10296	0.003	B	0.15484	0.013	T	0.18618	-1.0331	10	0.11485	T	0.65	-2.0184	7.1339	0.25517	0.0:0.7926:0.0:0.2074	.	339	Q6ZMH5	S39A5_HUMAN	V	339	ENSP00000405360:A339V;ENSP00000266980:A339V	ENSP00000266980:A339V	A	+	2	0	SLC39A5	54916517	0.989000	0.36119	0.993000	0.49108	0.974000	0.67602	0.823000	0.27366	0.744000	0.32741	0.655000	0.94253	GCC	.		0.532	SLC39A5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346834.1	NM_173596	
PPM1D	8493	hgsc.bcm.edu	37	17	58740756	58740756	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr17:58740756G>T	ENST00000305921.3	+	6	1893	c.1661G>T	c.(1660-1662)gGc>gTc	p.G554V	RNU6-623P_ENST00000363143.1_RNA	NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	554					G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			AGACGAAATGGCTTAAGTCGA	0.473											OREG0031485	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.G554V		.											.	.	.	0			c.G1661T						.						85.0	79.0	81.0					17																	58740756		2203	4300	6503	SO:0001583	missense	8493	exon6			GAAATGGCTTAAG	U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.1661G>T	17.37:g.58740756G>T	ENSP00000306682:p.Gly554Val	51	0	1033	66	3	NM_003620	Q53XP4|Q6P991|Q8IVR6	Missense_Mutation	SNP	ENST00000305921.3	37	CCDS11625.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935181	0.73442	.	.	ENSG00000170836	ENST00000305921	T	0.54479	0.57	6.08	6.08	0.98989	.	0.169585	0.52532	D	0.000076	T	0.49474	0.1559	L	0.29908	0.895	0.58432	D	0.999997	D	0.56521	0.976	P	0.45829	0.494	T	0.51387	-0.8712	10	0.62326	D	0.03	-5.4114	18.8526	0.92238	0.0:0.0:1.0:0.0	.	554	O15297	PPM1D_HUMAN	V	554	ENSP00000306682:G554V	ENSP00000306682:G554V	G	+	2	0	PPM1D	56095538	0.999000	0.42202	0.993000	0.49108	0.993000	0.82548	4.696000	0.61774	2.894000	0.99253	0.591000	0.81541	GGC	.		0.473	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449474.1	NM_003620	
BAI3	577	hgsc.bcm.edu	37	6	69665993	69665993	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr6:69665993C>T	ENST00000370598.1	+	7	2094	c.1273C>T	c.(1273-1275)Cgg>Tgg	p.R425W		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	425	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GCAGAGAAGCCGGCAGTGCAC	0.537																																					p.R425W		.											BAI3,colon,carcinoma,0,1	BAI3	0	0			c.C1273T						.						83.0	74.0	77.0					6																	69665993		2203	4300	6503	SO:0001583	missense	577	exon7			AGAAGCCGGCAGT	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1273C>T	6.37:g.69665993C>T	ENSP00000359630:p.Arg425Trp	40	0		11	2	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	C	17.11	3.304431	0.60305	.	.	ENSG00000135298	ENST00000370598	T	0.65732	-0.17	5.71	2.62	0.31277	.	0.000000	0.85682	D	0.000000	D	0.85191	0.5640	H	0.99312	4.51	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91683	0.5360	10	0.87932	D	0	.	15.8653	0.79060	0.6098:0.3902:0.0:0.0	.	425	O60242	BAI3_HUMAN	W	425	ENSP00000359630:R425W	ENSP00000359630:R425W	R	+	1	2	BAI3	69722714	0.967000	0.33354	0.996000	0.52242	0.589000	0.36550	0.521000	0.22893	0.705000	0.31890	0.591000	0.81541	CGG	.		0.537	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
DENND4B	9909	hgsc.bcm.edu	37	1	153907303	153907303	+	Silent	SNP	C	C	T	rs557071025	byFrequency	TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:153907303C>T	ENST00000361217.4	-	18	3124	c.2706G>A	c.(2704-2706)caG>caA	p.Q902Q	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	902	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gctgctgctgctgttgctgct	0.642																																					p.Q902Q		.											DENND4B_ENST00000361217,bladder,carcinoma,0,2	DENND4B_ENST00000361217	0	0			c.G2706A						.						30.0	39.0	36.0					1																	153907303		2184	4281	6465	SO:0001819	synonymous_variant	9909	exon18			CTGCTGCTGTTGC	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2706G>A	1.37:g.153907303C>T		16	0		34	2	NM_014856	Q5T4K0	Silent	SNP	ENST00000361217.4	37	CCDS44228.1																																																																																			.		0.642	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
TRIM39	56658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30303613	30303613	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr6:30303613G>A	ENST00000396547.1	+	4	801	c.641G>A	c.(640-642)cGa>cAa	p.R214Q	TRIM39_ENST00000376656.4_Missense_Mutation_p.R214Q|TRIM39_ENST00000396548.1_Missense_Mutation_p.R214Q|TRIM39_ENST00000396551.3_Missense_Mutation_p.R214Q|TRIM39_ENST00000540416.1_Missense_Mutation_p.R214Q|TRIM39_ENST00000376659.5_Missense_Mutation_p.R214Q|TRIM39-RPP21_ENST00000513556.1_Missense_Mutation_p.R126Q			Q9HCM9	TRI39_HUMAN	tripartite motif containing 39	214					apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of apoptotic signaling pathway (GO:2001235)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			ovary(3)	3						TTGCTTTCACGACTGGAAGAA	0.557																																					p.R214Q		.											.	.	.	0			c.G641A						.						59.0	58.0	58.0					6																	30303613		1510	2709	4219	SO:0001583	missense	56658	exon5			TTTCACGACTGGA	BC034985	CCDS34377.1, CCDS34378.1	6p22.1	2013-01-09	2011-01-25	2002-06-07	ENSG00000204599	ENSG00000204599		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10065	protein-coding gene	gene with protein product		605700	"""ring finger protein 23"", ""tripartite motif-containing 39"""	RNF23		11006080	Standard	NM_021253		Approved			Q9HCM9	OTTHUMG00000031066	ENST00000396547.1:c.641G>A	6.37:g.30303613G>A	ENSP00000379796:p.Arg214Gln	26	0		32	14	NM_172016	Q5STG3|Q5STG4|Q76BL3|Q8IYT9|Q96IB6	Missense_Mutation	SNP	ENST00000396547.1	37	CCDS34377.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.24|17.24	3.339965|3.339965	0.60963|0.60963	.|.	.|.	ENSG00000204599|ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000248167	ENST00000420746|ENST00000396551;ENST00000376656;ENST00000545104;ENST00000540416;ENST00000449040;ENST00000412529;ENST00000428728;ENST00000396548;ENST00000376659;ENST00000396547;ENST00000513556	.|T;T;T;T;T;T;T;T	.|0.64803	.|3.58;0.12;3.58;-0.12;3.58;3.58;0.12;3.58	5.33|5.33	2.55|2.55	0.30701|0.30701	.|.	.|0.357077	.|0.23201	.|N	.|0.050800	T|T	0.32071|0.32071	0.0817|0.0817	L|L	0.39085|0.39085	1.19|1.19	0.09310|0.09310	N|N	1|1	.|B;D;P	.|0.53151	.|0.005;0.958;0.777	.|B;P;B	.|0.47744	.|0.001;0.556;0.411	T|T	0.13845|0.13845	-1.0494|-1.0494	5|10	.|0.14252	.|T	.|0.57	.|.	7.388|7.388	0.26893|0.26893	0.3413:0.0:0.6587:0.0|0.3413:0.0:0.6587:0.0	.|.	.|128;214;214	.|F5H2V3;Q9HCM9;Q9HCM9-2	.|.;TRI39_HUMAN;.	N|Q	144|214;214;214;214;214;128;214;214;214;214;126	.|ENSP00000379800:R214Q;ENSP00000365844:R214Q;ENSP00000439400:R214Q;ENSP00000406019:R214Q;ENSP00000379797:R214Q;ENSP00000365847:R214Q;ENSP00000379796:R214Q;ENSP00000424048:R126Q	.|ENSP00000365844:R214Q	D|R	+|+	1|2	0|0	TRIM39|TRIM39-RPP21;TRIM39	30411592|30411592	0.000000|0.000000	0.05858|0.05858	0.243000|0.243000	0.24186|0.24186	0.968000|0.968000	0.65278|0.65278	0.865000|0.865000	0.27940|0.27940	0.823000|0.823000	0.34589|0.34589	0.650000|0.650000	0.86243|0.86243	GAC|CGA	.		0.557	TRIM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076086.2	NM_172016	
LRRIQ4	344657	hgsc.bcm.edu	37	3	169555341	169555341	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr3:169555341G>T	ENST00000340806.6	+	5	1605	c.1605G>T	c.(1603-1605)aaG>aaT	p.K535N		NM_001080460.1	NP_001073929.1	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	535								p.K535K(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30						AACCACAAAAGAAAGGAAAGA	0.368																																					p.K535N		.											LRRIQ4,rectum,carcinoma,0,1	LRRIQ4	0	1	Substitution - coding silent(1)	large_intestine(1)	c.G1605T						.						60.0	55.0	57.0					3																	169555341		1844	4101	5945	SO:0001583	missense	344657	exon5			ACAAAAGAAAGGA		CCDS46951.1	3q26.2	2008-08-08	2008-06-12	2008-06-12	ENSG00000188306	ENSG00000188306			34298	protein-coding gene	gene with protein product	"""leucine rich repeat containing 64"""						Standard	NM_001080460		Approved	LRRC64	uc003fgb.3	A6NIV6	OTTHUMG00000164420	ENST00000340806.6:c.1605G>T	3.37:g.169555341G>T	ENSP00000342188:p.Lys535Asn	85	0		47	3	NM_001080460		Missense_Mutation	SNP	ENST00000340806.6	37	CCDS46951.1	.	.	.	.	.	.	.	.	.	.	G	9.489	1.100276	0.20552	.	.	ENSG00000188306	ENST00000340806	T	0.37915	1.17	4.98	2.12	0.27331	.	0.000000	0.64402	D	0.000016	T	0.50973	0.1647	M	0.62723	1.935	0.35790	D	0.822305	D	0.89917	1.0	D	0.83275	0.996	T	0.58014	-0.7711	10	0.52906	T	0.07	.	7.8205	0.29284	0.3406:0.0:0.6594:0.0	.	535	A6NIV6	LRIQ4_HUMAN	N	535	ENSP00000342188:K535N	ENSP00000342188:K535N	K	+	3	2	LRRIQ4	171038035	0.999000	0.42202	0.994000	0.49952	0.088000	0.18126	0.332000	0.19751	0.586000	0.29626	0.555000	0.69702	AAG	.		0.368	LRRIQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378698.1	NM_001080460	
ARHGAP21	57584	hgsc.bcm.edu;bcgsc.ca	37	10	24889838	24889838	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr10:24889838G>A	ENST00000396432.2	-	14	3355	c.2869C>T	c.(2869-2871)Cca>Tca	p.P957S	ARHGAP21_ENST00000320481.6_Missense_Mutation_p.P744S|ARHGAP21_ENST00000493154.1_Intron	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	956	Interaction with ARF1 and ARF6.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						TGTTTCCATGGCCGAATACTT	0.433																																					p.P957S		.											.	.	.	0			c.C2869T						.						99.0	95.0	96.0					10																	24889838		2203	4300	6503	SO:0001583	missense	57584	exon14			TCCATGGCCGAAT	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.2869C>T	10.37:g.24889838G>A	ENSP00000379709:p.Pro957Ser	84	0		81	4	NM_020824	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	37	CCDS7144.2	.	.	.	.	.	.	.	.	.	.	G	15.39	2.818963	0.50633	.	.	ENSG00000107863	ENST00000396432;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73	5.49	5.49	0.81192	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.105833	0.64402	D	0.000004	T	0.49575	0.1565	N	0.00605	-1.335	0.43953	D	0.996621	P;P	0.37731	0.607;0.455	B;P	0.44647	0.42;0.456	T	0.61187	-0.7113	10	0.23302	T	0.38	.	19.3804	0.94530	0.0:0.0:1.0:0.0	.	947;956	F8W9U9;Q5T5U3	.;RHG21_HUMAN	S	957;744;947;957;792	ENSP00000379709:P957S;ENSP00000365604:P744S;ENSP00000365592:P947S;ENSP00000405018:P957S	ENSP00000365604:P744S	P	-	1	0	ARHGAP21	24929844	1.000000	0.71417	0.996000	0.52242	0.967000	0.64934	4.505000	0.60421	2.571000	0.86741	0.655000	0.94253	CCA	.		0.433	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
EP400	57634	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	132504692	132504692	+	Missense_Mutation	SNP	C	C	G			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr12:132504692C>G	ENST00000333577.4	+	23	4593	c.4484C>G	c.(4483-4485)tCt>tGt	p.S1495C	EP400_ENST00000330386.6_Missense_Mutation_p.S1459C|EP400_ENST00000332482.4_Missense_Mutation_p.S1422C|EP400_ENST00000389561.2_Missense_Mutation_p.S1459C|EP400_ENST00000389562.2_Missense_Mutation_p.S1458C			Q96L91	EP400_HUMAN	E1A binding protein p400	1495					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		ACCACGGCCTCTGCTGCTCCA	0.652																																					p.S1459C		.											.	.	.	0			c.C4376G						.						41.0	45.0	44.0					12																	132504692		2203	4299	6502	SO:0001583	missense	57634	exon22			CGGCCTCTGCTGC	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.4484C>G	12.37:g.132504692C>G	ENSP00000333602:p.Ser1495Cys	24	0		16	15	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37		.	.	.	.	.	.	.	.	.	.	C	6.864	0.528725	0.13127	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296;ENST00000542457	D;D;D;D;D	0.90620	-2.68;-2.68;-2.68;-2.68;-2.7	5.56	4.66	0.58398	.	0.324594	0.35555	N	0.003134	D	0.84238	0.5428	N	0.08118	0	0.09310	N	1	B;B;B	0.29590	0.25;0.25;0.25	B;B;B	0.37047	0.24;0.24;0.24	T	0.77351	-0.2620	10	0.52906	T	0.07	.	16.5309	0.84359	0.0:0.8692:0.1308:0.0	.	1459;1459;1458	Q96L91-2;Q96L91-4;Q96L91-5	.;.;.	C	1495;1459;1458;1422;1459;1459;1459	ENSP00000333602:S1495C;ENSP00000374212:S1459C;ENSP00000374213:S1458C;ENSP00000331737:S1422C;ENSP00000330620:S1459C	ENSP00000330620:S1459C	S	+	2	0	EP400	131070645	0.788000	0.28762	0.001000	0.08648	0.174000	0.22865	5.512000	0.67030	1.328000	0.45358	0.650000	0.86243	TCT	.		0.652	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
KMT2C	58508	hgsc.bcm.edu	37	7	151921114	151921114	+	Nonsense_Mutation	SNP	A	A	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr7:151921114A>T	ENST00000262189.6	-	20	3527	c.3309T>A	c.(3307-3309)tgT>tgA	p.C1103*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.C1103*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1103					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.C1103*(10)									CACATTGTCTACATTGCAGAA	0.338																																					p.C1103X		.											MLL3_ENST00000355193,NS,carcinoma,0,10	MLL3_ENST00000355193	0	10	Substitution - Nonsense(10)	kidney(6)|endometrium(4)	c.T3309A						.						56.0	51.0	52.0					7																	151921114		2203	4300	6503	SO:0001587	stop_gained	58508	exon20			TTGTCTACATTGC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3309T>A	7.37:g.151921114A>T	ENSP00000262189:p.Cys1103*	89	1		98	5	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	A	41	8.814636	0.98964	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	5.39	-2.79	0.05841	.	0.000000	0.50627	D	0.000105	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.2367	0.59972	0.4373:0.0:0.5627:0.0	rs4024337	.	.	.	X	1103	.	ENSP00000262189:C1103X	C	-	3	2	MLL3	151552047	0.735000	0.28153	0.983000	0.44433	0.992000	0.81027	-0.154000	0.10130	-0.431000	0.07307	0.528000	0.53228	TGT	.		0.338	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
EGFLAM	133584	hgsc.bcm.edu	37	5	38407067	38407067	+	Silent	SNP	T	T	C			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr5:38407067T>C	ENST00000354891.3	+	8	1312	c.966T>C	c.(964-966)gcT>gcC	p.A322A	EGFLAM_ENST00000322350.5_Silent_p.A322A|EGFLAM_ENST00000397202.2_Intron|EGFLAM_ENST00000336740.6_Silent_p.A88A	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	322					extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					CCACGGTGGCTCCCCAGCCCA	0.488																																					p.A322A	Colon(62;485 1295 3347 17454)	.											.	.	.	0			c.T966C						.						146.0	139.0	141.0					5																	38407067		2203	4300	6503	SO:0001819	synonymous_variant	133584	exon8			GGTGGCTCCCCAG	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.966T>C	5.37:g.38407067T>C		30	0		80	4	NM_001205301	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Silent	SNP	ENST00000354891.3	37	CCDS56363.1																																																																																			.		0.488	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
KLRF1	51348	hgsc.bcm.edu	37	12	9985911	9985911	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr12:9985911T>C	ENST00000279544.3	+	3	261	c.197T>C	c.(196-198)gTa>gCa	p.V66A	KLRF1_ENST00000324214.4_Intron|KLRF1_ENST00000354855.3_Intron|KLRF1_ENST00000537723.1_Missense_Mutation_p.V66A	NM_016523.1	NP_057607	Q9NZS2	KLRF1_HUMAN	killer cell lectin-like receptor subfamily F, member 1	66					cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|MHC class I receptor activity (GO:0032393)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)	13						TCTCAGGGAGTATTGCTAAAA	0.348																																					p.V66A		.											.	.	.	0			c.T197C						.						93.0	88.0	89.0					12																	9985911		1847	4091	5938	SO:0001583	missense	51348	exon3			AGGGAGTATTGCT	AF175206	CCDS41750.1	12p13.31	2011-08-30			ENSG00000150045	ENSG00000150045		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	13342	protein-coding gene	gene with protein product		605029				10671213	Standard	NM_001291823		Approved	CLEC5C, NKp80	uc021qux.1	Q9NZS2		ENST00000279544.3:c.197T>C	12.37:g.9985911T>C	ENSP00000279544:p.Val66Ala	78	0		83	4	NM_016523	Q4KMT5|Q96PR2|Q96PR3|Q9NZS1	Missense_Mutation	SNP	ENST00000279544.3	37	CCDS41750.1	.	.	.	.	.	.	.	.	.	.	T	8.516	0.867688	0.17250	.	.	ENSG00000150045	ENST00000279544;ENST00000537723	T;T	0.56611	4.99;0.45	2.57	2.57	0.30868	.	.	.	.	.	T	0.35682	0.0940	L	0.29908	0.895	0.22280	N	0.999232	B;P	0.37864	0.247;0.61	B;B	0.35240	0.063;0.198	T	0.10800	-1.0614	8	.	.	.	.	7.0986	0.25323	0.0:0.0:0.0:1.0	.	66;66	Q9NZS2;Q4KN30	KLRF1_HUMAN;.	A	66	ENSP00000279544:V66A;ENSP00000443054:V66A	.	V	+	2	0	KLRF1	9877178	0.998000	0.40836	0.994000	0.49952	0.365000	0.29674	1.872000	0.39549	1.458000	0.47871	0.378000	0.23410	GTA	.		0.348	KLRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399535.1	NM_016523	
HLA-DMA	3108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	32918505	32918505	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr6:32918505G>T	ENST00000374843.4	-	2	249	c.164C>A	c.(163-165)cCc>cAc	p.P55H	HLA-DMA_ENST00000395305.3_Intron|HLA-DMA_ENST00000395303.3_Missense_Mutation_p.P55H|HLA-DMA_ENST00000464392.1_Intron|XXbac-BPG181M17.5_ENST00000429234.1_Intron	NM_006120.3	NP_006111.2	P28067	DMA_HUMAN	major histocompatibility complex, class II, DM alpha	55	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|chaperone mediated protein folding requiring cofactor (GO:0051085)|immunoglobulin mediated immune response (GO:0016064)|inner ear development (GO:0048839)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|positive regulation of immune response (GO:0050778)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein transport (GO:0015031)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)	MHC class II protein complex binding (GO:0023026)			kidney(1)|large_intestine(2)|lung(8)	11						TCCCACACTGGGACTCCCATC	0.557																																					p.P55H		.											.	.	.	0			c.C164A						.						114.0	118.0	117.0					6																	32918505		1508	2708	4216	SO:0001583	missense	3108	exon2			ACACTGGGACTCC		CCDS4761.1	6p21.3	2013-01-11			ENSG00000204257	ENSG00000204257		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4934	protein-coding gene	gene with protein product		142855				1922385	Standard	NM_006120		Approved	D6S222E, RING6	uc003ocm.2	P28067	OTTHUMG00000031173	ENST00000374843.4:c.164C>A	6.37:g.32918505G>T	ENSP00000363976:p.Pro55His	20	0		25	11	NM_006120	Q29639|Q29640	Missense_Mutation	SNP	ENST00000374843.4	37	CCDS4761.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.907340	0.52333	.	.	ENSG00000204257	ENST00000395303;ENST00000374843;ENST00000456800;ENST00000422832;ENST00000341486	T;T;T;T	0.00976	5.48;5.48;5.48;5.48	5.53	5.53	0.82687	MHC class II, alpha/beta chain, N-terminal (1);MHC classes I/II-like antigen recognition protein (1);MHC class II, alpha chain, N-terminal (2);	0.215479	0.49305	D	0.000150	T	0.02012	0.0063	L	0.47190	1.495	0.38740	D	0.953861	D;D	0.89917	1.0;1.0	D;D	0.74674	0.984;0.984	T	0.61792	-0.6990	10	0.87932	D	0	.	14.8363	0.70187	0.0:0.0:1.0:0.0	.	55;55	P28067;Q31604	DMA_HUMAN;.	H	55;55;85;22;47	ENSP00000378714:P55H;ENSP00000363976:P55H;ENSP00000409668:P85H;ENSP00000403122:P22H	ENSP00000345804:P47H	P	-	2	0	HLA-DMA	33026483	0.983000	0.35010	0.335000	0.25508	0.263000	0.26337	4.510000	0.60455	2.885000	0.99019	0.643000	0.83706	CCC	.		0.557	HLA-DMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076325.2	NM_006120	
ATAD5	79915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	29220847	29220847	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr17:29220847T>C	ENST00000321990.4	+	21	5354	c.4976T>C	c.(4975-4977)tTa>tCa	p.L1659S		NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1659					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				ATGTCCTTCTTAGATGCACTT	0.358																																					p.L1659S		.											.	.	.	0			c.T4976C						.						178.0	184.0	182.0					17																	29220847		2203	4300	6503	SO:0001583	missense	79915	exon21			CCTTCTTAGATGC		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.4976T>C	17.37:g.29220847T>C	ENSP00000313171:p.Leu1659Ser	64	0		111	24	NM_024857	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	T	18.52	3.641594	0.67244	.	.	ENSG00000176208	ENST00000321990	T	0.05855	3.38	6.08	6.08	0.98989	.	0.730388	0.13264	N	0.401094	T	0.17408	0.0418	M	0.61703	1.905	0.27513	N	0.951636	D	0.57899	0.981	P	0.55161	0.77	T	0.09314	-1.0680	10	0.87932	D	0	.	11.6508	0.51288	0.0:0.0684:0.0:0.9316	.	1659	Q96QE3	ATAD5_HUMAN	S	1659	ENSP00000313171:L1659S	ENSP00000313171:L1659S	L	+	2	0	ATAD5	26244973	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	4.660000	0.61511	2.333000	0.79357	0.482000	0.46254	TTA	.		0.358	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857	
CKAP4	10970	hgsc.bcm.edu	37	12	106633701	106633701	+	Nonsense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr12:106633701C>A	ENST00000378026.4	-	2	1046	c.910G>T	c.(910-912)Gag>Tag	p.E304*	CKAP4_ENST00000552828.1_5'UTR	NM_006825.3	NP_006816.2	Q07065	CKAP4_HUMAN	cytoskeleton-associated protein 4	304						cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|pancreas(1)|urinary_tract(1)	20						ATGTCCCACTCTCTGGACTTG	0.547																																					p.E304X		.											CKAP4,NS,carcinoma,0,1	CKAP4	0	0			c.G910T						.						115.0	117.0	116.0					12																	106633701		2203	4300	6503	SO:0001587	stop_gained	10970	exon2			CCCACTCTCTGGA	X69910	CCDS9103.1	12q23.3	2006-06-23				ENSG00000136026			16991	protein-coding gene	gene with protein product						8314870	Standard	NM_006825		Approved	P63, CLIMP-63, ERGIC-63	uc001tlk.3	Q07065		ENST00000378026.4:c.910G>T	12.37:g.106633701C>A	ENSP00000367265:p.Glu304*	40	0		55	3	NM_006825	Q504S5|Q53ES6	Nonsense_Mutation	SNP	ENST00000378026.4	37	CCDS9103.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.441930	0.83993	.	.	ENSG00000136026	ENST00000378026	.	.	.	5.8	4.92	0.64577	.	0.377319	0.32081	N	0.006611	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-6.15	14.6606	0.68868	0.0:0.9308:0.0:0.0692	.	.	.	.	X	304	.	ENSP00000367265:E304X	E	-	1	0	CKAP4	105157831	0.035000	0.19736	0.010000	0.14722	0.616000	0.37450	1.805000	0.38883	1.474000	0.48178	0.563000	0.77884	GAG	.		0.547	CKAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407196.1		
TMEM110	375346	hgsc.bcm.edu	37	3	52876847	52876847	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr3:52876847G>T	ENST00000355083.5	-	7	893	c.748C>A	c.(748-750)Cac>Aac	p.H250N	TMEM110_ENST00000464769.1_5'UTR|TMEM110-MUSTN1_ENST00000504329.1_Missense_Mutation_p.H250N	NM_198563.2	NP_940965.1	Q86TL2	TM110_HUMAN	transmembrane protein 110	250						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)	4				BRCA - Breast invasive adenocarcinoma(193;7.72e-05)|Kidney(197;0.000777)|KIRC - Kidney renal clear cell carcinoma(197;0.000915)|OV - Ovarian serous cystadenocarcinoma(275;0.0541)		GACTCCTCGTGGGATGCGGCC	0.592																																					p.H250N		.											.,1	.	.	0			c.C748A						.						124.0	110.0	115.0					3																	52876847		2203	4300	6503	SO:0001583	missense	100526772	exon7			CCTCGTGGGATGC	BC047015	CCDS2866.1	3p21.1	2010-08-13			ENSG00000213533	ENSG00000213533			30526	protein-coding gene	gene with protein product						12477932	Standard	NM_198563		Approved	MGC52022		Q86TL2	OTTHUMG00000150346	ENST00000355083.5:c.748C>A	3.37:g.52876847G>T	ENSP00000347195:p.His250Asn	45	0		36	3	NM_001198974		Missense_Mutation	SNP	ENST00000355083.5	37	CCDS2866.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.434146	0.83776	.	.	ENSG00000248592;ENSG00000213533	ENST00000504329;ENST00000355083	.	.	.	5.09	5.09	0.68999	.	0.059815	0.64402	U	0.000003	T	0.35537	0.0935	N	0.24115	0.695	0.58432	D	0.999997	P;P	0.41673	0.759;0.759	B;B	0.37833	0.259;0.259	T	0.12656	-1.0539	9	0.19590	T	0.45	-14.2721	11.9165	0.52767	0.08:0.0:0.92:0.0	.	250;250	Q86TL2;A8MSY1	TM110_HUMAN;.	N	250	.	ENSP00000347195:H250N	H	-	1	0	TMEM110-MUSTN1;TMEM110	52851887	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.244000	0.78228	2.345000	0.79718	0.591000	0.81541	CAC	.		0.592	TMEM110-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352949.2	NM_198563	
PCNT	5116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	47769730	47769730	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr21:47769730T>C	ENST00000359568.5	+	8	1447	c.1340T>C	c.(1339-1341)cTg>cCg	p.L447P	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	447	Glu-rich.				brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GAAAAACAGCTGGAGGTGGGC	0.418																																					p.L447P		.											.	.	.	0			c.T1340C						.						64.0	66.0	65.0					21																	47769730		2203	4300	6503	SO:0001583	missense	5116	exon8			AACAGCTGGAGGT	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.1340T>C	21.37:g.47769730T>C	ENSP00000352572:p.Leu447Pro	79	0		52	34	NM_006031	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	T	9.822	1.186020	0.21870	.	.	ENSG00000160299	ENST00000359568;ENST00000337772	T	0.26957	1.7	3.98	-0.131	0.13494	.	1.083490	0.07525	N	0.911145	T	0.36744	0.0978	L	0.42245	1.32	0.30188	N	0.799806	D;D	0.71674	0.998;0.997	D;D	0.69142	0.962;0.916	T	0.39375	-0.9617	10	0.32370	T	0.25	.	6.9038	0.24297	0.1622:0.0:0.5285:0.3093	.	329;447	O95613-2;O95613	.;PCNT_HUMAN	P	447;434	ENSP00000352572:L447P	ENSP00000338675:L434P	L	+	2	0	PCNT	46594158	0.234000	0.23783	0.188000	0.23233	0.199000	0.23934	0.379000	0.20585	-0.010000	0.14271	0.450000	0.29827	CTG	.		0.418	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
KIAA0368	23392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	114192870	114192870	+	Missense_Mutation	SNP	A	A	G			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr9:114192870A>G	ENST00000338205.5	-	8	1106	c.887T>C	c.(886-888)aTg>aCg	p.M296T	KIAA0368_ENST00000259335.4_Missense_Mutation_p.M474T			Q5VYK3	ECM29_HUMAN	KIAA0368	302					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						CACCTTGTACATCTTATTAAT	0.353																																					p.M474T		.											.	.	.	0			c.T1421C						.						130.0	126.0	127.0					9																	114192870		1841	4090	5931	SO:0001583	missense	23392	exon10			TTGTACATCTTAT	AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.887T>C	9.37:g.114192870A>G	ENSP00000339889:p.Met296Thr	43	0		22	8	NM_001080398	O15074|Q8WU82	Missense_Mutation	SNP	ENST00000338205.5	37		.	.	.	.	.	.	.	.	.	.	A	16.58	3.162352	0.57368	.	.	ENSG00000136813	ENST00000338205;ENST00000259335	T	0.47177	0.85	5.56	5.56	0.83823	Armadillo-type fold (1);	0.044186	0.85682	D	0.000000	T	0.46268	0.1384	L	0.40543	1.245	0.80722	D	1	B	0.31413	0.322	B	0.37267	0.245	T	0.49457	-0.8938	10	0.87932	D	0	.	15.7077	0.77598	1.0:0.0:0.0:0.0	.	302	Q5VYK3	ECM29_HUMAN	T	296;474	ENSP00000259335:M474T	ENSP00000259335:M474T	M	-	2	0	KIAA0368	113232691	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.405000	0.90213	2.103000	0.63969	0.460000	0.39030	ATG	.		0.353	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
IPO5	3843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	98652792	98652792	+	Splice_Site	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr13:98652792G>A	ENST00000490680.1	+	10	1066		c.e10-1		IPO5_ENST00000539640.1_Splice_Site|IPO5_ENST00000261574.5_Splice_Site			O00410	IPO5_HUMAN	importin 5						cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						TATGTGTTTAGCAATGCAGTT	0.368																																					.		.											.	.	.	0			c.1056-1G>A						.						123.0	110.0	115.0					13																	98652792		2203	4300	6503	SO:0001630	splice_region_variant	3843	exon13			TGTTTAGCAATGC	U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.1002-1G>A	13.37:g.98652792G>A		30	0		38	10	NM_002271	B4DZA0|O15257|Q5T578|Q86XC7	Splice_Site	SNP	ENST00000490680.1	37		.	.	.	.	.	.	.	.	.	.	G	24.8	4.568307	0.86439	.	.	ENSG00000065150	ENST00000261574;ENST00000357602;ENST00000490680;ENST00000539640;ENST00000469360	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8948	0.96954	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IPO5	97450793	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	9.581000	0.98210	2.699000	0.92147	0.655000	0.94253	.	.		0.368	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000354655.1	NM_002271	Intron
CAMTA1	23261	broad.mit.edu	37	1	7811427	7811427	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:7811427G>A	ENST00000303635.7	+	20	5065	c.4858G>A	c.(4858-4860)Gct>Act	p.A1620T	CAMTA1_ENST00000476864.1_Missense_Mutation_p.A184T|CAMTA1_ENST00000439411.2_Missense_Mutation_p.A1606T	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	1620	IQ 3. {ECO:0000255|PROSITE- ProRule:PRU00116}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		TCGCCGGACGGCTGTGATTGT	0.488			T	WWTR1	epitheliod hemangioendothelioma																																p.A1620T				Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	CAMTA1	226	0			c.G4858A						.						62.0	70.0	67.0					1																	7811427		2203	4300	6503	SO:0001583	missense	23261	exon20			CGGACGGCTGTGA	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.4858G>A	1.37:g.7811427G>A	ENSP00000306522:p.Ala1620Thr	44	0		28	3	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	37	CCDS30576.1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.478180	0.44044	.	.	ENSG00000171735	ENST00000303635;ENST00000439411;ENST00000414738;ENST00000303646;ENST00000476864	T;T;T	0.74632	-0.86;-0.86;-0.86	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.81494	0.4834	L	0.34521	1.04	0.80722	D	1	D;B;B	0.69078	0.997;0.402;0.337	D;B;B	0.77004	0.989;0.168;0.437	T	0.81324	-0.0984	10	0.51188	T	0.08	-11.2626	19.9857	0.97347	0.0:0.0:1.0:0.0	.	663;583;1620	B4DXR3;Q7Z7P1;Q9Y6Y1	.;.;CMTA1_HUMAN	T	1620;1606;663;583;184	ENSP00000306522:A1620T;ENSP00000402561:A1606T;ENSP00000452319:A184T	ENSP00000306522:A1620T	A	+	1	0	CAMTA1	7734014	1.000000	0.71417	0.149000	0.22428	0.363000	0.29612	5.470000	0.66756	2.706000	0.92434	0.655000	0.94253	GCT	.		0.488	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
RP6-206I17.1	0	broad.mit.edu	37	1	143663875	143663875	+	lincRNA	SNP	G	G	T	rs373397451	byFrequency	TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:143663875G>T	ENST00000445753.1	-	0	531																											CCCCGACACAGACCTGAACCG	0.632													.|||	793	0.158347	0.4062	0.0504	5008	,	,		8835	0.12		0.0408	False		,,,				2504	0.0603				.													.	.	.	0			.						.																																					0	.			GACACAGACCTGA																													1.37:g.143663875G>T		59	1		79	4	.		RNA	SNP	ENST00000445753.1	37																																																																																				G|1.000;|0.000		0.632	RP6-206I17.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000037956.1		
RP11-480I12.5	0	broad.mit.edu	37	1	202827070	202827071	+	RNA	DEL	TT	TT	-			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:202827070_202827071delTT	ENST00000443294.1	-	0	382																											cttttctttctttttttttttt	0.49																																					.													.	.	.	0			.						.																																					0	.			TCTTTCTTTTTTT																													1.37:g.202827080_202827081delTT		5	0		6	2	.		RNA	DEL	ENST00000443294.1	37																																																																																				.		0.490	RP11-480I12.5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000099138.1		
FMN2	56776	broad.mit.edu	37	1	240341360	240341360	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:240341360C>T	ENST00000319653.9	+	3	2152	c.1922C>T	c.(1921-1923)gCt>gTt	p.A641V	RP11-567G24.3_ENST00000412311.1_RNA|RP11-567G24.3_ENST00000444308.1_RNA	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	641					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CTCGAGGATGCTGAAACAGGT	0.433																																					p.A641V													.	FMN2	451	0			c.C1922T						.						88.0	86.0	87.0					1																	240341360		2203	4300	6503	SO:0001583	missense	56776	exon3			AGGATGCTGAAAC	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.1922C>T	1.37:g.240341360C>T	ENSP00000318884:p.Ala641Val	50	0		67	3	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	C	10.24	1.296965	0.23650	.	.	ENSG00000155816	ENST00000447095;ENST00000319653	T;T	0.78364	-1.17;-1.17	5.37	1.96	0.26148	.	0.918601	0.09229	N	0.830847	T	0.64560	0.2609	L	0.33485	1.01	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.50972	-0.8764	10	0.39692	T	0.17	.	4.3712	0.11249	0.1495:0.5589:0.0:0.2916	.	641	Q9NZ56	FMN2_HUMAN	V	74;641	ENSP00000409308:A74V;ENSP00000318884:A641V	ENSP00000318884:A641V	A	+	2	0	FMN2	238407983	0.000000	0.05858	0.004000	0.12327	0.005000	0.04900	0.079000	0.14782	0.219000	0.20840	0.650000	0.86243	GCT	.		0.433	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
C10orf128	170371	broad.mit.edu	37	10	50396360	50396360	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr10:50396360G>A	ENST00000474718.1	-	1	44	c.22C>T	c.(22-24)Ctg>Ttg	p.L8L	C10orf128_ENST00000374148.1_Silent_p.L8L|C10orf128_ENST00000374153.2_Silent_p.L8L|C10orf128_ENST00000470884.1_5'UTR|C10orf128_ENST00000374151.3_Silent_p.L8L	NM_001010863.1	NP_001010863.1	Q5T292	CJ128_HUMAN	chromosome 10 open reading frame 128	8						integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(1)	3						AGGATCCTCAGCATGCTGACC	0.652																																					p.L8L													.	C10orf128	20	0			c.C22T						.						50.0	52.0	52.0					10																	50396360		1951	4143	6094	SO:0001819	synonymous_variant	170371	exon1			TCCTCAGCATGCT	BC031641	CCDS41519.1, CCDS73128.1	10q11.23	2012-06-13			ENSG00000204161	ENSG00000204161			27274	protein-coding gene	gene with protein product						12477932	Standard	NM_001010863		Approved	Em:AC084727.5	uc001jhn.4	Q5T292	OTTHUMG00000018188	ENST00000474718.1:c.22C>T	10.37:g.50396360G>A		10	0		9	3	NM_001010863	A6XND2|Q5T289|Q5T291	Silent	SNP	ENST00000474718.1	37	CCDS41519.1																																																																																			.		0.652	C10orf128-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047978.1	NM_001010863	
SKIDA1	387640	broad.mit.edu	37	10	21805720	21805720	+	Silent	SNP	A	A	G			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr10:21805720A>G	ENST00000449193.2	-	4	3284	c.1032T>C	c.(1030-1032)caT>caC	p.H344H	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_Silent_p.H265H	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	263	Glu-rich.|Ser-rich.					nucleus (GO:0005634)											ggtggtggtgatggtggtggt	0.716																																					p.H344H													.	.	.	0			c.T1032C						.						4.0	6.0	5.0					10																	21805720		1658	3602	5260	SO:0001819	synonymous_variant	387640	exon4			GTGGTGATGGTGG	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1032T>C	10.37:g.21805720A>G		21	0		17	3	NM_207371	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	37	CCDS44363.1																																																																																			.		0.716	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
FAM35A	54537	broad.mit.edu	37	10	88911830	88911830	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr10:88911830C>A	ENST00000298784.1	+	3	833	c.719C>A	c.(718-720)aCa>aAa	p.T240K	RN7SL733P_ENST00000582253.1_RNA|FAM35A_ENST00000298786.4_Missense_Mutation_p.T240K	NM_019054.2	NP_061927.2	Q86V20	FA35A_HUMAN	family with sequence similarity 35, member A	240								p.T240K(2)		endometrium(2)|kidney(2)|large_intestine(5)|lung(1)|ovary(2)|prostate(2)|skin(2)	16						TCAACTGATACAGAATTTCTC	0.388																																					p.T240K	Ovarian(175;703 2004 25460 32514 43441)												FAM35A,NS,carcinoma,0,3	FAM35A	48	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.C719A						.						30.0	30.0	30.0					10																	88911830		2203	4295	6498	SO:0001583	missense	54537	exon3			CTGATACAGAATT	BC051863	CCDS7383.1	10q23.2	2010-06-02			ENSG00000122376	ENSG00000122376			28773	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_019054		Approved	MGC5560, bA163M19.1, FAM35A1	uc001kei.4	Q86V20	OTTHUMG00000018669	ENST00000298784.1:c.719C>A	10.37:g.88911830C>A	ENSP00000298784:p.Thr240Lys	214	1		219	4	NM_019054	O95885|Q9H991	Missense_Mutation	SNP	ENST00000298784.1	37	CCDS7383.1	.	.	.	.	.	.	.	.	.	.	c	16.25	3.071539	0.55646	.	.	ENSG00000122376	ENST00000298786;ENST00000298784;ENST00000358313	T;T;T	0.27104	1.7;1.69;1.69	4.09	3.09	0.35607	.	0.289768	0.25801	N	0.028214	T	0.45716	0.1356	.	.	.	0.34044	D	0.655393	D	0.63046	0.992	D	0.65573	0.936	T	0.61700	-0.7009	9	0.59425	D	0.04	-9.6069	12.3445	0.55114	0.0:0.9021:0.0:0.0979	.	240	Q86V20	FA35A_HUMAN	K	240	ENSP00000298786:T240K;ENSP00000298784:T240K;ENSP00000351064:T240K	ENSP00000298784:T240K	T	+	2	0	FAM35A	88901810	1.000000	0.71417	0.665000	0.29768	0.884000	0.51177	2.667000	0.46808	2.134000	0.65973	0.537000	0.68136	ACA	.		0.388	FAM35A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049196.2	NM_019054	
LOC101929735	101929735	broad.mit.edu	37	14	22887281	22887281	+	lincRNA	SNP	C	C	G			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr14:22887281C>G	ENST00000555460.1	+	0	137				AE000661.37_ENST00000514473.2_RNA|AE000661.37_ENST00000545670.1_RNA|AE000661.37_ENST00000541008.1_RNA|AE000661.37_ENST00000537850.1_RNA|AE000661.37_ENST00000535351.1_RNA																							CCCAAGTTCCCAGGCCTCTTC	0.498																																					.													.	.	.	0			.						.																																					0	.			AGTTCCCAGGCCT																													14.37:g.22887281C>G		23	0		14	6	.		RNA	SNP	ENST00000555460.1	37																																																																																				.		0.498	AE000661.50-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000410668.1		
RP11-509A17.3	0	broad.mit.edu	37	15	20563408	20563417	+	lincRNA	DEL	CCTCTCCCTT	CCTCTCCCTT	-	rs537093760|rs537797892	byFrequency	TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr15:20563408_20563417delCCTCTCCCTT	ENST00000557528.1	+	0	1812				AC026495.1_ENST00000581090.1_RNA																							CCTCCCAGAGcctctcccttcctctccctt	0.671														795	0.158746	0.1793	0.1427	5008	,	,		62278	0.1319		0.1322	False		,,,				2504	0.1973				.													.	.	.	0			.						.																																					0	.			CCAGAGCCTCTCC																													15.37:g.20563418_20563427delCCTCTCCCTT		45	0		52	8	.		RNA	DEL	ENST00000557528.1	37																																																																																				.		0.671	RP11-509A17.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000414658.1		
HERC2P4	100289574	broad.mit.edu	37	16	32152597	32152597	+	IGR	DEL	A	A	-			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr16:32152597delA								RP11-1166P10.6 (56491 upstream) : HERC2P4 (28707 downstream)																							TAAGGCACATAATGAGCAATT	0.318																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			GCACATAATGAGC																													16.37:g.32152597delA		43	1		44	7	.		RNA	DEL		37																																																																																				.	0	0.318								
DOK4	55715	broad.mit.edu;bcgsc.ca	37	16	57509842	57509842	+	Missense_Mutation	SNP	G	G	A	rs368504381		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr16:57509842G>A	ENST00000340099.4	-	3	465	c.94C>T	c.(94-96)Cgg>Tgg	p.R32W	DOK4_ENST00000561918.1_5'UTR|DOK4_ENST00000566936.1_Missense_Mutation_p.R32W|DOK4_ENST00000569548.1_Missense_Mutation_p.R32W	NM_018110.3	NP_060580.2	Q8TEW6	DOK4_HUMAN	docking protein 4	32	PH.				MAPK cascade (GO:0000165)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)		receptor signaling protein activity (GO:0005057)			kidney(1)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(2)	6						GAGGATTTCCGGAACACCAGC	0.652																																					p.R32W													.	DOK4	19	0			c.C94T						.	G	TRP/ARG	0,4396		0,0,2198	32.0	35.0	34.0		94	5.3	1.0	16		34	1,8599	1.2+/-3.3	0,1,4299	no	missense	DOK4	NM_018110.3	101	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	32/327	57509842	1,12995	2198	4300	6498	SO:0001583	missense	0	exon3			ATTTCCGGAACAC	BC003541	CCDS10783.1	16q13	2013-01-10			ENSG00000125170	ENSG00000125170		"""Pleckstrin homology (PH) domain containing"""	19868	protein-coding gene	gene with protein product		608333				10493829	Standard	NM_018110		Approved	FLJ10488	uc002elv.4	Q8TEW6	OTTHUMG00000133460	ENST00000340099.4:c.94C>T	16.37:g.57509842G>A	ENSP00000344277:p.Arg32Trp	70	1		72	6	NM_018110	O75209|Q9BTP2|Q9NVV3	Missense_Mutation	SNP	ENST00000340099.4	37	CCDS10783.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.755959	0.89843	0.0	1.16E-4	ENSG00000125170	ENST00000340099	T	0.77358	-1.09	5.29	5.29	0.74685	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.238837	0.32343	N	0.006227	T	0.82042	0.4951	L	0.43152	1.355	0.50467	D	0.999879	D;D	0.69078	0.995;0.997	D;P	0.70227	0.968;0.792	T	0.81521	-0.0895	10	0.51188	T	0.08	-8.1212	11.3626	0.49653	0.0:0.0:0.8193:0.1806	.	32;32	Q8TEW6;B2RD67	DOK4_HUMAN;.	W	32	ENSP00000344277:R32W	ENSP00000344277:R32W	R	-	1	2	DOK4	56067343	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.871000	0.56077	2.753000	0.94483	0.650000	0.86243	CGG	.		0.652	DOK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257335.3		
RP11-599B13.3	0	broad.mit.edu;ucsc.edu	37	17	7960608	7960608	+	lincRNA	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr17:7960608C>T	ENST00000577807.1	-	0	50																											actctgtttccaacagtagag	0.373																																					.													.	.	.	0			.						.																																					0	.			TGTTTCCAACAGT																													17.37:g.7960608C>T		67	0		76	30	.		RNA	SNP	ENST00000577807.1	37																																																																																				.		0.373	RP11-599B13.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000441439.1		
RP11-156P1.2	0	broad.mit.edu	37	17	45125501	45125501	+	IGR	SNP	A	A	G			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr17:45125501A>G	ENST00000571841.1	+	0	889				RP11-156P1.3_ENST00000575173.1_RNA|LRRC37A17P_ENST00000570478.1_RNA																							ttacagatgaagaaaaacaag	0.398																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			AGATGAAGAAAAA																													17.37:g.45125501A>G		39	0		57	3	.		RNA	SNP	ENST00000571841.1	37																																																																																				A|1.000;|0.000		0.398	RP11-156P1.2-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding	OTTHUMT00000440447.1		
ZNF98	148198	broad.mit.edu	37	19	22586259	22586259	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr19:22586259C>T	ENST00000357774.5	-	2	207	c.86G>A	c.(85-87)tGc>tAc	p.C29Y	ZNF98_ENST00000601553.1_Missense_Mutation_p.C29Y	NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	29	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				GGTGTCCAGGCATTGCCACTC	0.413																																					p.C29Y													ZNF98_ENST00000357774,right_lower_lobe,carcinoma,+1,2	ZNF98	230	0			c.G86A						.						85.0	91.0	89.0					19																	22586259		2201	4297	6498	SO:0001583	missense	148198	exon2			TCCAGGCATTGCC		CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.86G>A	19.37:g.22586259C>T	ENSP00000350418:p.Cys29Tyr	87	1		84	5	NM_001098626		Missense_Mutation	SNP	ENST00000357774.5	37	CCDS46031.1	.	.	.	.	.	.	.	.	.	.	.	9.924	1.213091	0.22289	.	.	ENSG00000197360	ENST00000357774	T	0.01767	4.65	1.06	-0.855	0.10700	Krueppel-associated box (4);	.	.	.	.	T	0.04634	0.0126	L	0.49513	1.565	0.09310	N	1	D	0.63046	0.992	D	0.68483	0.958	T	0.42932	-0.9422	9	0.49607	T	0.09	.	3.5131	0.07716	0.444:0.556:0.0:0.0	.	29	A6NK75	ZNF98_HUMAN	Y	29	ENSP00000350418:C29Y	ENSP00000350418:C29Y	C	-	2	0	ZNF98	22378099	0.000000	0.05858	0.066000	0.19879	0.248000	0.25809	-0.295000	0.08298	0.532000	0.28657	0.298000	0.19748	TGC	.		0.413	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1	NM_001098626	
ANKRD20A8P	729171	broad.mit.edu	37	2	95518658	95518658	+	RNA	DEL	A	A	-	rs55971499|rs375429617|rs76918942		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:95518658delA	ENST00000432432.2	-	0	605					NR_040113.1		Q5CZ79	AN20B_HUMAN	ankyrin repeat domain 20 family, member A8, pseudogene																		ACTAATTAAGAAAAAAAAAAA	0.264																																					.													.	.	.	0			.						.																																					0	.			ATTAAGAAAAAAA			2q11.1	2011-09-16	2010-12-15	2010-12-15	ENSG00000229089	ENSG00000229089			23666	pseudogene	pseudogene			"""ankyrin repeat domain 20B"""	ANKRD20B			Standard	NR_003366		Approved		uc010fhq.2	Q5CZ79	OTTHUMG00000155138		2.37:g.95518658delA		5	0		9	4	.	A6NC18	RNA	DEL	ENST00000432432.2	37																																																																																				.		0.264	ANKRD20A8P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	pseudogene	OTTHUMT00000451404.1		
KIAA1715	80856	broad.mit.edu	37	2	176794915	176794915	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:176794915T>C	ENST00000272748.4	-	13	1314	c.1067A>G	c.(1066-1068)cAc>cGc	p.H356R	KIAA1715_ENST00000535310.1_3'UTR|KIAA1715_ENST00000544803.1_Missense_Mutation_p.H387R	NM_030650.1	NP_085153.1	Q9C0E8	LNP_HUMAN	KIAA1715	356					blood coagulation (GO:0007596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|limb development (GO:0060173)|regulation of chondrocyte differentiation (GO:0032330)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)	20			OV - Ovarian serous cystadenocarcinoma(117;0.0793)			AAGAACATCGTGTTCTAAAGA	0.353																																					p.H356R													.	KIAA1715	61	0			c.A1067G						.						143.0	132.0	136.0					2																	176794915		2203	4299	6502	SO:0001583	missense	80856	exon13			ACATCGTGTTCTA	AB051502	CCDS33332.1	2q31	2014-06-27			ENSG00000144320	ENSG00000144320			21610	protein-coding gene	gene with protein product	"""lunapark"", ""limb and neural patterns"""	610236				11214970, 22729086	Standard	NM_030650		Approved	ulnaless, Ul, LNP1, LNP	uc002ukc.1	Q9C0E8	OTTHUMG00000154112	ENST00000272748.4:c.1067A>G	2.37:g.176794915T>C	ENSP00000272748:p.His356Arg	43	0		36	4	NM_030650	B7ZLA8|Q2M2V8|Q2YD99|Q658W8|Q8N5V9|Q96MS5	Missense_Mutation	SNP	ENST00000272748.4	37	CCDS33332.1	.	.	.	.	.	.	.	.	.	.	t	7.462	0.644953	0.14451	.	.	ENSG00000144320	ENST00000272748;ENST00000536291;ENST00000409660;ENST00000544803	.	.	.	5.43	4.25	0.50352	.	0.687038	0.15427	N	0.262905	T	0.37625	0.1010	N	0.08118	0	0.80722	D	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.0;0.0	T	0.18147	-1.0346	9	0.87932	D	0	0.062	10.4469	0.44499	0.0:0.0:0.2064:0.7936	.	358;387;353;356	F5H2Y7;B7ZLA8;B7ZLA9;Q9C0E8	.;.;.;LNP_HUMAN	R	356;358;233;387	.	ENSP00000272748:H356R	H	-	2	0	KIAA1715	176503161	0.983000	0.35010	1.000000	0.80357	0.971000	0.66376	2.066000	0.41452	0.943000	0.37553	0.487000	0.48397	CAC	.		0.353	KIAA1715-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333949.3	XM_042834	
KIAA1715	80856	broad.mit.edu	37	2	176794918	176794918	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:176794918T>C	ENST00000272748.4	-	13	1311	c.1064A>G	c.(1063-1065)gAa>gGa	p.E355G	KIAA1715_ENST00000535310.1_3'UTR|KIAA1715_ENST00000544803.1_Missense_Mutation_p.E386G	NM_030650.1	NP_085153.1	Q9C0E8	LNP_HUMAN	KIAA1715	355					blood coagulation (GO:0007596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|limb development (GO:0060173)|regulation of chondrocyte differentiation (GO:0032330)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)	20			OV - Ovarian serous cystadenocarcinoma(117;0.0793)			AACATCGTGTTCTAAAGATTC	0.348																																					p.E355G													.	KIAA1715	61	0			c.A1064G						.						138.0	127.0	131.0					2																	176794918		2203	4299	6502	SO:0001583	missense	80856	exon13			TCGTGTTCTAAAG	AB051502	CCDS33332.1	2q31	2014-06-27			ENSG00000144320	ENSG00000144320			21610	protein-coding gene	gene with protein product	"""lunapark"", ""limb and neural patterns"""	610236				11214970, 22729086	Standard	NM_030650		Approved	ulnaless, Ul, LNP1, LNP	uc002ukc.1	Q9C0E8	OTTHUMG00000154112	ENST00000272748.4:c.1064A>G	2.37:g.176794918T>C	ENSP00000272748:p.Glu355Gly	40	0		35	4	NM_030650	B7ZLA8|Q2M2V8|Q2YD99|Q658W8|Q8N5V9|Q96MS5	Missense_Mutation	SNP	ENST00000272748.4	37	CCDS33332.1	.	.	.	.	.	.	.	.	.	.	t	13.04	2.118515	0.37436	.	.	ENSG00000144320	ENST00000272748;ENST00000536291;ENST00000409660;ENST00000544803	.	.	.	3.99	3.99	0.46301	.	0.296732	0.38548	N	0.001655	T	0.67239	0.2872	M	0.61703	1.905	0.80722	D	1	D;B;B;B	0.63880	0.993;0.033;0.005;0.006	P;B;B;B	0.60886	0.88;0.013;0.006;0.003	T	0.70200	-0.4937	9	0.87932	D	0	-8.4093	9.5972	0.39580	0.0:0.0:0.0:1.0	.	357;386;352;355	F5H2Y7;B7ZLA8;B7ZLA9;Q9C0E8	.;.;.;LNP_HUMAN	G	355;357;232;386	.	ENSP00000272748:E355G	E	-	2	0	KIAA1715	176503164	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.019000	0.49635	1.555000	0.49500	0.487000	0.48397	GAA	.		0.348	KIAA1715-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333949.3	XM_042834	
ALG1L	200810	broad.mit.edu	37	3	125648088	125648088	+	IGR	SNP	G	G	A	rs553243048	byFrequency	TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr3:125648088G>A	ENST00000340333.3	-	0	805				FAM86JP_ENST00000485843.1_RNA	NM_001015050.2|NM_001195223.1	NP_001015050.2|NP_001182152.1	Q6GMV1	ALG1L_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like								transferase activity, transferring glycosyl groups (GO:0016757)			large_intestine(2)|lung(2)	4						CCGAGCCTCCGGAAAAGAAAT	0.537													.|||	48	0.00958466	0.0076	0.0014	5008	,	,		18829	0.0		0.0	False		,,,				2504	0.0378				.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			GCCTCCGGAAAAG	BC073816	CCDS33840.1, CCDS74998.1	3q21.2	2013-02-22	2013-02-22		ENSG00000189366	ENSG00000189366		"""Glycosyltransferase group 1 domain containing"""	33721	protein-coding gene	gene with protein product	"""asparagine-linked glycosylation 1-like 1"""		"""asparagine-linked glycosylation 1-like"""				Standard	NM_001015050		Approved	ALG1L1	uc003eig.2	Q6GMV1	OTTHUMG00000159588		3.37:g.125648088G>A		50	2		36	6	.	D3DNA5	RNA	SNP	ENST00000340333.3	37	CCDS33840.1																																																																																			.		0.537	ALG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356347.1	NM_001015050	
SOX2	6657	broad.mit.edu;bcgsc.ca	37	3	181430207	181430226	+	Frame_Shift_Del	DEL	GCGGCGGCGGCAACTCCACC	GCGGCGGCGGCAACTCCACC	-	rs398123693		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr3:181430207_181430226delGCGGCGGCGGCAACTCCACC	ENST00000325404.1	+	1	486_505	c.59_78delGCGGCGGCGGCAACTCCACC	c.(58-78)ggcggcggcggcaactccaccfs	p.GGGGNST20fs	SOX2_ENST00000431565.2_Frame_Shift_Del_p.GGGGNST20fs	NM_003106.3	NP_003097.1	P48431	SOX2_HUMAN	SRY (sex determining region Y)-box 2	20	Poly-Gly.				adenohypophysis development (GO:0021984)|cell cycle arrest (GO:0007050)|cerebral cortex development (GO:0021987)|chromatin organization (GO:0006325)|detection of mechanical stimulus involved in equilibrioception (GO:0050973)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|diencephalon morphogenesis (GO:0048852)|endodermal cell fate specification (GO:0001714)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|eye development (GO:0001654)|forebrain development (GO:0030900)|forebrain neuron differentiation (GO:0021879)|glial cell fate commitment (GO:0021781)|inner ear development (GO:0048839)|inner ear morphogenesis (GO:0042472)|lens induction in camera-type eye (GO:0060235)|lung alveolus development (GO:0048286)|male genitalia development (GO:0030539)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate commitment (GO:0048663)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|osteoblast differentiation (GO:0001649)|pigment biosynthetic process (GO:0046148)|pituitary gland development (GO:0021983)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|response to growth factor (GO:0070848)|response to retinoic acid (GO:0032526)|response to wounding (GO:0009611)|retina morphogenesis in camera-type eye (GO:0060042)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|skin(1)	10	all_cancers(143;1.22e-16)|Ovarian(172;0.0283)		all cancers(12;1.82e-48)|Epithelial(37;9.85e-40)|OV - Ovarian serous cystadenocarcinoma(80;7.37e-23)|Lung(8;2.01e-21)|GBM - Glioblastoma multiforme(1;2.13e-08)			ACTTCGGGGGGCGGCGGCGGCAACTCCACCGCGGCGGCGG	0.732			A		"""NSCLC, oesophageal squamous carcinoma"""		MICROPHTHALMIA AND ESOPHAGEAL ATRESIA SYNDROME																														p.20_26del				Dom	yes		3	3q26.3-q27	6657	SRY (sex determining region Y)-box 2	yes	E	.	SOX2	28	0			c.59_78del	GRCh37	CD054424|CD070528|CI064733	SOX2	D|I		.																																			SO:0001589	frameshift_variant	6657	exon1			CGGGGGGCGGCGG	BC013923	CCDS3239.1	3q26.3-q27	2014-09-17						"""SRY (sex determining region Y)-boxes"""	11195	protein-coding gene	gene with protein product		184429				7849401	Standard	NM_003106		Approved		uc003fkx.3	P48431		ENST00000325404.1:c.59_78delGCGGCGGCGGCAACTCCACC	3.37:g.181430207_181430226delGCGGCGGCGGCAACTCCACC	ENSP00000323588:p.Gly20fs	25	0		12	8	NM_003106	Q14537	Frame_Shift_Del	DEL	ENST00000325404.1	37	CCDS3239.1																																																																																			.		0.732	SOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350419.1	NM_003106	
RSPH10B	222967	broad.mit.edu;bcgsc.ca	37	7	6006556	6006556	+	Silent	SNP	A	A	G			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr7:6006556A>G	ENST00000405415.1	-	2	578	c.192T>C	c.(190-192)gtT>gtC	p.V64V	RSPH10B_ENST00000404406.1_Silent_p.V64V|RSPH10B_ENST00000337579.3_Silent_p.V64V|RSPH10B_ENST00000441023.2_Silent_p.V64V			P0C881	R10B1_HUMAN	radial spoke head 10 homolog B (Chlamydomonas)	64										breast(1)|kidney(1)|lung(4)|ovary(1)|skin(4)	11		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)		CGTTCTGCTGAACGTTTTGGC	0.493																																					p.V64V													RSPH10B,NS,carcinoma,-2,1	RSPH10B	28	0			c.T192C						.						187.0	131.0	151.0					7																	6006556		2090	3790	5880	SO:0001819	synonymous_variant	222967	exon3			CTGCTGAACGTTT		CCDS34598.1	7p22.2	2008-07-04			ENSG00000155026	ENSG00000155026			27362	protein-coding gene	gene with protein product						16507594	Standard	NM_173565		Approved		uc003sph.1	P0C881	OTTHUMG00000152378	ENST00000405415.1:c.192T>C	7.37:g.6006556A>G		103	0		111	15	NM_173565	A6NMW7|Q86ST9|Q8NE68	Silent	SNP	ENST00000405415.1	37	CCDS34598.1																																																																																			.		0.493	RSPH10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325465.2	NM_173565	
MT-CO2	4513	broad.mit.edu;bcgsc.ca	37	M	8251	8251	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chrM:8251G>A	ENST00000361739.1	+	1	666	c.666G>A	c.(664-666)ggG>ggA	p.G222G	MT-TW_ENST00000387382.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TK_ENST00000387421.1_RNA			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	222					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						TTTGAAATAGGGCCCGTATTT	0.433																																					p.G222G													.	.	.	0			c.G666A						.																																			SO:0001819	synonymous_variant	4513	exon1			AATAGGGCCCGTA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.666G>A	M.37:g.8251G>A		37	0		40	37	ENST00000361739	Q37526	Silent	SNP	ENST00000361739.1	37																																																																																				.		0.433	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024029	
KIAA2012	100652824	ucsc.edu;bcgsc.ca	37	2	203055059	203055059	+	IGR	SNP	C	C	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:203055059C>A								AC079354.5 (10945 upstream) : SUMO1 (15843 downstream)																							GGTTCCTTTGCCTCAGACTCC	0.483																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			CCTTTGCCTCAGA																													2.37:g.203055059C>A		28	0		39	4	.		Missense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	C	7.732	0.699448	0.15106	.	.	ENSG00000182329	ENST00000498697	.	.	.	3.79	1.89	0.25635	.	0.581086	0.14492	N	0.316272	T	0.26810	0.0656	.	.	.	0.09310	N	1	B	0.27732	0.187	B	0.21546	0.035	T	0.13656	-1.0501	8	0.27785	T	0.31	.	9.8524	0.41066	0.0:0.5679:0.4321:0.0	.	293	Q0VF49	K2012_HUMAN	D	468	.	ENSP00000419834:A468D	A	+	2	0	AC079354.1	202763304	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.066000	0.14489	0.520000	0.28426	0.650000	0.86243	GCC	.	0	0.483								
TMEM128	85013	ucsc.edu	37	4	4239589	4239589	+	Missense_Mutation	SNP	C	C	T	rs202215273		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr4:4239589C>T	ENST00000382753.4	-	4	481	c.472G>A	c.(472-474)Gtc>Atc	p.V158I	TMEM128_ENST00000540397.1_Missense_Mutation_p.V158I|TMEM128_ENST00000538516.1_Intron|TMEM128_ENST00000254742.2_Missense_Mutation_p.V134I			Q5BJH2	TM128_HUMAN	transmembrane protein 128	158						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.166)		ATAAACATGACAACCCCCATA	0.358																																					p.V134I													TMEM128,NS,carcinoma,+2,1	TMEM128	12	0			c.G400A						.																																			SO:0001583	missense	85013	exon4			ACATGACAACCCC	BC007729	CCDS3373.1, CCDS75099.1	4p16.3	2008-02-05			ENSG00000132406	ENSG00000132406			28201	protein-coding gene	gene with protein product							Standard	XM_005248034		Approved	MGC13159	uc003ghq.1	Q5BJH2	OTTHUMG00000125475	ENST00000382753.4:c.472G>A	4.37:g.4239589C>T	ENSP00000372201:p.Val158Ile	96	2		91	10	NM_032927	B4DHS7|D3DVS3|Q5H9U6|Q96I94	Missense_Mutation	SNP	ENST00000382753.4	37		.	.	.	.	.	.	.	.	.	.	C	11.35	1.613970	0.28712	.	.	ENSG00000132406	ENST00000254742;ENST00000382753;ENST00000540397	.	.	.	4.89	0.648	0.17801	.	0.141721	0.45361	D	0.000380	T	0.39253	0.1071	L	0.41415	1.275	0.33775	D	0.623521	B;B	0.02656	0.0;0.0	B;B	0.09377	0.002;0.004	T	0.41270	-0.9518	9	0.30078	T	0.28	-13.7734	10.8272	0.46640	0.0:0.6852:0.0:0.3148	.	158;134	D3DVS1;Q5BJH2-2	.;.	I	134;158;158	.	ENSP00000254742:V134I	V	-	1	0	TMEM128	4290490	0.486000	0.25980	0.400000	0.26346	0.915000	0.54546	1.113000	0.31184	0.151000	0.19162	-0.186000	0.12905	GTC	.		0.358	TMEM128-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000246798.2	NM_032927	
ADIRF	10974	ucsc.edu	37	10	88730012	88730012	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr10:88730012G>A	ENST00000372013.3	+	2	470	c.117G>A	c.(115-117)ggG>ggA	p.G39G	ADIRF-AS1_ENST00000609111.1_RNA|ADIRF-AS1_ENST00000440490.1_RNA|ADIRF-AS1_ENST00000418273.2_RNA|RP11-96C23.15_ENST00000609363.1_RNA|RP11-96C23.5_ENST00000433214.2_RNA	NM_006829.2	NP_006820.1	Q15847	ADIRF_HUMAN	adipogenesis regulatory factor	39					cell differentiation (GO:0030154)|cellular response to cisplatin (GO:0072719)|cellular response to radiation (GO:0071478)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of response to drug (GO:2001023)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)											CAGAGGCGGGGCAGAAAGGTC	0.677																																					p.G39G													.	.	.	0			c.G117A						.						20.0	26.0	24.0					10																	88730012		2163	4244	6407	SO:0001819	synonymous_variant	119385	exon2			GGCGGGGCAGAAA	BC004471	CCDS7381.1	10q23.31	2013-02-20	2013-02-20	2013-02-20	ENSG00000148671	ENSG00000148671			24043	protein-coding gene	gene with protein product	"""adipose specific 2"", ""adipose most abundant gene transcript 2"", ""adipogenesis factor rich in obesity"""		"""chromosome 10 open reading frame 116"""	C10orf116		8619847, 23239344	Standard	NM_006829		Approved	APM2, AFRO	uc001ked.2	Q15847	OTTHUMG00000018668	ENST00000372013.3:c.117G>A	10.37:g.88730012G>A		25	0		29	4	NM_006829		Silent	SNP	ENST00000372013.3	37	CCDS7381.1																																																																																			.		0.677	ADIRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049194.1	NM_006829	
GPR133	283383	ucsc.edu	37	12	131456080	131456080	+	Missense_Mutation	SNP	T	T	G	rs201546462		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr12:131456080T>G	ENST00000261654.5	+	4	824	c.265T>G	c.(265-267)Tac>Gac	p.Y89D	GPR133_ENST00000535015.1_Missense_Mutation_p.Y121D	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	89					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TTACGGCAGGTACAACAGCTC	0.483																																					p.Y89D													.	GPR133	136	0			c.T265G						.						77.0	64.0	68.0					12																	131456080		2203	4300	6503	SO:0001583	missense	283383	exon4			GGCAGGTACAACA	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.265T>G	12.37:g.131456080T>G	ENSP00000261654:p.Tyr89Asp	61	16		52	17	NM_198827	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	37	CCDS9272.1	.	.	.	.	.	.	.	.	.	.	T	6.423	0.446247	0.12164	.	.	ENSG00000111452	ENST00000261654;ENST00000542091;ENST00000535015	T;T;T	0.58652	0.42;0.32;0.42	4.43	-0.955	0.10356	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.629054	0.16003	N	0.234182	T	0.41811	0.1175	L	0.44542	1.39	0.09310	N	0.999999	B;B	0.26935	0.164;0.078	B;B	0.30943	0.122;0.062	T	0.40289	-0.9571	10	0.72032	D	0.01	.	0.9795	0.01433	0.1547:0.177:0.1606:0.5077	.	121;89	B7ZLF7;Q6QNK2	.;GP133_HUMAN	D	89;89;121	ENSP00000261654:Y89D;ENSP00000442501:Y89D;ENSP00000444425:Y121D	ENSP00000261654:Y89D	Y	+	1	0	GPR133	130022033	0.995000	0.38212	0.000000	0.03702	0.010000	0.07245	2.383000	0.44354	-0.098000	0.12285	0.533000	0.62120	TAC	.		0.483	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	
FANCA	2175	ucsc.edu	37	16	89805162	89805162	+	Intron	SNP	T	T	C			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr16:89805162T>C	ENST00000389301.3	-	43	4291				ZNF276_ENST00000289816.5_3'UTR|FANCA_ENST00000568369.1_Intron	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A						DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		CCACTAGGCCTCAGACCACAG	0.627			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												.			yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	.	ZNF276	70	0			.						.						19.0	20.0	20.0					16																	89805162		2198	4300	6498	SO:0001627	intron_variant	92822	.	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TAGGCCTCAGACC	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.4261-46A>G	16.37:g.89805162T>C		18	1		31	7	.	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Nonstop_Mutation	SNP	ENST00000389301.3	37	CCDS32515.1																																																																																			.		0.627	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1		
MYADM	91663	ucsc.edu	37	19	54376839	54376839	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr19:54376839G>T	ENST00000391769.2	+	3	336	c.56G>T	c.(55-57)gGc>gTc	p.G19V	MYADM_ENST00000391768.2_Missense_Mutation_p.G19V|MYADM_ENST00000336967.3_Missense_Mutation_p.G19V|AC008440.5_ENST00000413496.2_RNA|MYADM_ENST00000391771.1_Missense_Mutation_p.G19V|MYADM_ENST00000391770.4_Missense_Mutation_p.G19V	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker	19					establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		TCATCTTCGGGCCTGGGGTCC	0.607											OREG0003650	type=REGULATORY REGION|Gene=MYADM|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.G19V													.	MYADM	39	0			c.G56T						.						57.0	51.0	53.0					19																	54376839		2203	4300	6503	SO:0001583	missense	91663	exon2			CTTCGGGCCTGGG	AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.56G>T	19.37:g.54376839G>T	ENSP00000375649:p.Gly19Val	27	0	999	36	4	NM_001020818	B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	Missense_Mutation	SNP	ENST00000391769.2	37	CCDS12866.1	.	.	.	.	.	.	.	.	.	.	G	11.59	1.682874	0.29872	.	.	ENSG00000179820	ENST00000421337;ENST00000336967;ENST00000391770;ENST00000448420;ENST00000439000;ENST00000391771;ENST00000415619;ENST00000391769;ENST00000391768;ENST00000414489	.	.	.	3.14	0.8	0.18672	.	0.552231	0.16657	N	0.204930	T	0.27765	0.0683	N	0.08118	0	0.42114	D	0.991397	B	0.12630	0.006	B	0.08055	0.003	T	0.04607	-1.0939	9	0.72032	D	0.01	-9.5128	5.7653	0.18224	0.0:0.2179:0.5576:0.2245	.	19	Q96S97	MYADM_HUMAN	V	19	.	ENSP00000337222:G19V	G	+	2	0	MYADM	59068651	0.997000	0.39634	0.451000	0.26982	0.274000	0.26718	1.078000	0.30754	0.015000	0.14971	0.313000	0.20887	GGC	.		0.607	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134337.1	NM_138373	
PI4KA	5297	ucsc.edu;bcgsc.ca	37	22	21150447	21150447	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr22:21150447C>A	ENST00000572273.1	-	18	2320	c.2090G>T	c.(2089-2091)gGc>gTc	p.G697V	PI4KA_ENST00000255882.6_Missense_Mutation_p.G755V|PI4KA_ENST00000466162.1_5'Flank			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	697					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			TAGGGCAGGGCCCTTCTCGCT	0.582																																					p.G755V	GBM(136;1332 1831 3115 23601 50806)												.	PI4KA	313	0			c.G2264T						.						93.0	73.0	80.0					22																	21150447		2203	4300	6503	SO:0001583	missense	5297	exon18			GCAGGGCCCTTCT	L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.2090G>T	22.37:g.21150447C>A	ENSP00000458238:p.Gly697Val	21	0		24	4	NM_058004	Q7Z625|Q9UPG2	Missense_Mutation	SNP	ENST00000572273.1	37		.	.	.	.	.	.	.	.	.	.	C	14.38	2.519136	0.44866	.	.	ENSG00000241973	ENST00000255882	.	.	.	4.62	4.62	0.57501	.	0.114136	0.64402	D	0.000017	T	0.38825	0.1055	N	0.08118	0	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.17137	-1.0379	9	0.28530	T	0.3	-25.6138	17.256	0.87056	0.0:1.0:0.0:0.0	.	697	P42356	PI4KA_HUMAN	V	697	.	ENSP00000255882:G697V	G	-	2	0	PI4KA	19480447	1.000000	0.71417	0.999000	0.59377	0.363000	0.29612	7.597000	0.82733	2.402000	0.81655	0.591000	0.81541	GGC	.		0.582	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
PER3	8863	bcgsc.ca	37	1	7890026	7890026	+	Missense_Mutation	SNP	A	A	G	rs199947375|rs57875989		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:7890026A>G	ENST00000361923.2	+	18	3167	c.2992A>G	c.(2992-2994)Aag>Gag	p.K998E	RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Missense_Mutation_p.K1007E	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	998	5 X 18 AA tandem repeats of S-[HP]-[AP]- T-[AT]-[GST]-[ATV]-L-S-[MT]-G-[LS]-P-P- [MRS]-[EKR]-[NST]-P.|Ser-rich.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.K998E(1)		breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		GCCTCCCATGAAGAATCCATC	0.587																																					p.K998E													PER3,NS,carcinoma,0,4	PER3	95	1	Substitution - Missense(1)	central_nervous_system(1)	c.A2992G						.						84.0	69.0	74.0					1																	7890026		1999	3897	5896	SO:0001583	missense	8863	exon18			CCCATGAAGAATC	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2992A>G	1.37:g.7890026A>G	ENSP00000355031:p.Lys998Glu	48	0		25	6	NM_016831	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	ENST00000361923.2	37	CCDS89.1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.434686	0.00182	.	.	ENSG00000049246	ENST00000377532;ENST00000361923	T;T	0.13538	2.58;2.58	.	.	.	Period circadian-like, C-terminal (1);	5.912170	0.01354	N	0.012011	T	0.04724	0.0128	N	0.04508	-0.205	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.26503	-1.0101	8	0.02654	T	1	.	.	.	.	.	998;1007;1007;998	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	E	1007;998	ENSP00000366755:K1007E;ENSP00000355031:K998E	ENSP00000355031:K998E	K	+	1	0	PER3	7812613	0.002000	0.14202	0.013000	0.15412	0.014000	0.08584	-0.844000	0.04345	-0.911000	0.03843	-0.891000	0.02926	AAG	.		0.587	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
PRAMEF14	729528	bcgsc.ca	37	1	13669138	13669138	+	Silent	SNP	A	A	G			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:13669138A>G	ENST00000344998.3	-	4	1230	c.1048T>C	c.(1048-1050)Ttg>Ctg	p.L350L	PRAMEF14_ENST00000334600.6_Silent_p.L398L|PRAMEF14_ENST00000602491.1_5'UTR			Q5SWL7	PRA14_HUMAN	PRAME family member 14	350					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GTGTGGCACAACAGGTCCTTC	0.547																																					p.L350L													.	PRAMEF14	9	0			c.T1048C						.						106.0	121.0	116.0					1																	13669138		2152	4287	6439	SO:0001819	synonymous_variant	729528	exon4			GGCACAACAGGTC			1p36.21	2014-04-01			ENSG00000204481	ENSG00000204481		"""-"""	13576	other	unknown							Standard	NM_001024661		Approved	OTTHUMG00000007916		Q5SWL7	OTTHUMG00000007916	ENST00000344998.3:c.1048T>C	1.37:g.13669138A>G		70	3		13	4	NM_001099854		Silent	SNP	ENST00000344998.3	37																																																																																				A|0.500;G|0.500		0.547	PRAMEF14-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_001099854	
RPL23AP15	391175	bcgsc.ca	37	1	228637197	228637197	+	IGR	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:228637197C>T								HIST3H3 (24171 upstream) : HIST3H2A (7867 downstream)																							GGGTGACATGCGGATCTTCTT	0.517																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			GACATGCGGATCT																													1.37:g.228637197C>T		71	0		86	10	.		RNA	SNP		37																																																																																				.	0	0.517								
Unknown	0	bcgsc.ca	37	2	91800780	91800780	+	IGR	SNP	T	T	C			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:91800780T>C								RP11-575H3.1 (31860 upstream) : AC027612.6 (4405 downstream)																							AAAAACTCTCTGAGGACATCC	0.522																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			ACTCTCTGAGGAC																													2.37:g.91800780T>C		192	0		282	25	.		RNA	SNP		37																																																																																				.	0	0.522								
DRD5P1	1817	bcgsc.ca	37	2	91873835	91873835	+	RNA	SNP	A	A	G	rs9326662		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:91873835A>G	ENST00000436174.1	-	0	1145																											CCCCCACGGCATTCCCCTGCG	0.687																																					.													.	.	.	0			.						.																																					1817	.			CACGGCATTCCCC																													2.37:g.91873835A>G		68	17		88	39	.		RNA	SNP	ENST00000436174.1	37																																																																																				.		0.687	AC027612.3-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000338339.1		
RPS20P14	440992	bcgsc.ca	37	3	186618070	186618070	+	IGR	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr3:186618070C>T								ADIPOQ (41818 upstream) : ST6GAL1 (30203 downstream)																							CAAGCCGCAGCGTAAAATCCT	0.507																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	440992	.			CCGCAGCGTAAAA																													3.37:g.186618070C>T		65	0		39	27	.		RNA	SNP		37																																																																																				.	0	0.507								
MUC4	4585	bcgsc.ca	37	3	195509127	195509127	+	Silent	SNP	A	A	G	rs71637183|rs200879287		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr3:195509127A>G	ENST00000463781.3	-	2	9783	c.9324T>C	c.(9322-9324)acT>acC	p.T3108T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.T3108T|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T3108T(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGGGCTAGTGACAGGAA	0.587																																					p.T3108T													MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	Substitution - coding silent(1)	kidney(1)	c.T9324C						.						19.0	11.0	13.0					3																	195509127		669	1553	2222	SO:0001819	synonymous_variant	4585	exon2			AGGGCTAGTGACA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9324T>C	3.37:g.195509127A>G		84	16		67	24	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			A|0.998;G|0.002		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
BBS12	166379	bcgsc.ca	37	4	123663872	123663872	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr4:123663872G>T	ENST00000314218.3	+	2	1018	c.825G>T	c.(823-825)ttG>ttT	p.L275F	BBS12_ENST00000542236.1_Missense_Mutation_p.L275F	NM_152618.2	NP_689831.2	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12	275					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|eating behavior (GO:0042755)|intraciliary transport (GO:0042073)|negative regulation of fat cell differentiation (GO:0045599)|photoreceptor cell maintenance (GO:0045494)	cilium (GO:0005929)	ATP binding (GO:0005524)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|prostate(4)	21						CAGTAGGCTTGAGTCATGGAG	0.403									Bardet-Biedl syndrome																												p.L275F													.	BBS12	63	0			c.G825T						.						83.0	81.0	81.0					4																	123663872		2203	4300	6503	SO:0001583	missense	166379	exon3	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AGGCTTGAGTCAT	AK123553	CCDS3728.1	4q27	2014-06-17	2006-12-13	2006-12-13	ENSG00000181004	ENSG00000181004		"""Heat Shock Proteins / Chaperonins"""	26648	protein-coding gene	gene with protein product		610683	"""chromosome 4 open reading frame 24"""	C4orf24		17160889	Standard	NM_001178007		Approved	FLJ35630, FLJ41559	uc003ieu.3	Q6ZW61	OTTHUMG00000133070	ENST00000314218.3:c.825G>T	4.37:g.123663872G>T	ENSP00000319062:p.Leu275Phe	30	0		22	3	NM_001178007	D3DNX5|Q7Z342|Q7Z482|Q8NAB8	Missense_Mutation	SNP	ENST00000314218.3	37	CCDS3728.1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.482311	0.63962	.	.	ENSG00000181004	ENST00000314218;ENST00000542236	D;D	0.82433	-1.61;-1.61	5.48	4.58	0.56647	.	0.298586	0.26840	N	0.022224	D	0.89801	0.6820	M	0.71581	2.175	0.44539	D	0.997493	D	0.89917	1.0	D	0.87578	0.998	D	0.90395	0.4398	10	0.87932	D	0	-33.6815	14.1105	0.65118	0.0:0.0:0.7474:0.2526	.	275	Q6ZW61	BBS12_HUMAN	F	275	ENSP00000319062:L275F;ENSP00000438273:L275F	ENSP00000319062:L275F	L	+	3	2	BBS12	123883322	1.000000	0.71417	0.999000	0.59377	0.964000	0.63967	1.591000	0.36665	2.729000	0.93468	0.650000	0.86243	TTG	.		0.403	BBS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256710.1	NM_152618	
SPRY1	10252	bcgsc.ca	37	4	124322966	124322966	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr4:124322966C>A	ENST00000394339.2	+	2	560	c.220C>A	c.(220-222)Cat>Aat	p.H74N	SPRY1_ENST00000339241.1_Missense_Mutation_p.H74N	NM_001258039.1|NM_005841.2	NP_001244968.1|NP_005832.1	O43609	SPY1_HUMAN	sprouty homolog 1, antagonist of FGF signaling (Drosophila)	74					epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				NS(1)|large_intestine(4)|lung(2)|ovary(1)|skin(3)	11						ACAAGAAAAGCATGAAAGGAC	0.463																																					p.H74N													.	SPRY1	28	0			c.C220A						.						104.0	105.0	105.0					4																	124322966		2203	4300	6503	SO:0001583	missense	10252	exon2			GAAAAGCATGAAA	AF041037	CCDS3731.1	4q	2009-04-17	2001-11-28		ENSG00000164056	ENSG00000164056			11269	protein-coding gene	gene with protein product		602465	"""sprouty (Drosophila) homolog 1 (antagonist of FGF signaling)"""			9458049, 15962011	Standard	NM_001258038		Approved	hSPRY1	uc003ifa.4	O43609	OTTHUMG00000133071	ENST00000394339.2:c.220C>A	4.37:g.124322966C>A	ENSP00000377871:p.His74Asn	32	0		18	3	NM_001258039	D3DNX6|Q6PNE0	Missense_Mutation	SNP	ENST00000394339.2	37	CCDS3731.1	.	.	.	.	.	.	.	.	.	.	C	8.817	0.936558	0.18206	.	.	ENSG00000164056	ENST00000339241;ENST00000507703;ENST00000394339	T;T;T	0.54279	0.58;1.57;0.58	4.78	4.78	0.61160	.	0.295511	0.32901	N	0.005511	T	0.42921	0.1224	L	0.34521	1.04	0.43275	D	0.995231	B	0.19817	0.039	B	0.14578	0.011	T	0.24905	-1.0147	9	.	.	.	-5.9293	17.6504	0.88162	0.0:1.0:0.0:0.0	.	74	O43609	SPY1_HUMAN	N	74	ENSP00000343785:H74N;ENSP00000421036:H74N;ENSP00000377871:H74N	.	H	+	1	0	SPRY1	124542416	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	5.319000	0.65835	2.481000	0.83766	0.561000	0.74099	CAT	.		0.463	SPRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256711.1		
SETD7	80854	bcgsc.ca	37	4	140454482	140454482	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr4:140454482C>T	ENST00000274031.3	-	3	845	c.209G>A	c.(208-210)gGc>gAc	p.G70D	SETD7_ENST00000506866.2_Missense_Mutation_p.G70D|SETD7_ENST00000404104.3_Missense_Mutation_p.G70D|SETD7_ENST00000406354.1_Missense_Mutation_p.A53T	NM_030648.2	NP_085151.1	Q8WTS6	SETD7_HUMAN	SET domain containing (lysine methyltransferase) 7	70					chromatin modification (GO:0016568)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	8	all_hematologic(180;0.156)					AACTCCCTGGCCCTGCAAGGC	0.493																																					p.G70D													SETD7,colon,carcinoma,0,1	SETD7	35	0			c.G209A						.						73.0	64.0	67.0					4																	140454482		2203	4300	6503	SO:0001583	missense	80854	exon3			CCCTGGCCCTGCA	AB051504	CCDS3748.1	4q31.1	2011-07-01			ENSG00000145391	ENSG00000145391		"""Chromatin-modifying enzymes / K-methyltransferases"""	30412	protein-coding gene	gene with protein product		606594				11850410, 11779497	Standard	NM_030648		Approved	KIAA1717, SET7, SET7/9, Set9, KMT7	uc003ihw.3	Q8WTS6	OTTHUMG00000133385	ENST00000274031.3:c.209G>A	4.37:g.140454482C>T	ENSP00000274031:p.Gly70Asp	74	0		63	4	NM_030648	B5WWL3|Q0VAH3|Q4W5A9|Q9C0E6	Missense_Mutation	SNP	ENST00000274031.3	37	CCDS3748.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.95|19.95	3.922433|3.922433	0.73213|0.73213	.|.	.|.	ENSG00000145391|ENSG00000145391	ENST00000406354|ENST00000506866;ENST00000274031;ENST00000404104	.|D;D;D	.|0.93953	.|-3.32;-3.32;-3.32	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.98201|0.98201	0.9405|0.9405	H|H	0.97265|0.97265	3.97|3.97	0.49299|0.49299	D|D	0.999773|0.999773	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	D|D	0.98951|0.98951	1.0794|1.0794	6|10	0.87932|0.87932	D|D	0|0	-25.6738|-25.6738	20.0608|20.0608	0.97674|0.97674	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|70;70	.|B5MCZ8;Q8WTS6	.|.;SETD7_HUMAN	T|D	53|70	.|ENSP00000427300:G70D;ENSP00000274031:G70D;ENSP00000385913:G70D	ENSP00000384336:A53T|ENSP00000274031:G70D	A|G	-|-	1|2	0|0	SETD7|SETD7	140673932|140673932	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.297000|7.297000	0.78799|0.78799	2.733000|2.733000	0.93635|0.93635	0.650000|0.650000	0.86243|0.86243	GCC|GGC	.		0.493	SETD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257236.1	NM_030648	
FRG1	2483	bcgsc.ca	37	4	190876283	190876283	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr4:190876283C>A	ENST00000226798.4	+	5	631	c.409C>A	c.(409-411)Caa>Aaa	p.Q137K	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	137					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		ACCAAGAGAACAATGGGAACC	0.353																																					p.Q137K													.	FRG1	76	0			c.C409A						.						88.0	87.0	87.0					4																	190876283		2203	4300	6503	SO:0001583	missense	2483	exon5			AGAGAACAATGGG	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.409C>A	4.37:g.190876283C>A	ENSP00000226798:p.Gln137Lys	411	6		270	10	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	16.72	3.202137	0.58234	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.49139	2.03;0.79	4.04	4.04	0.47022	Actin cross-linking (1);	0.103449	0.64402	D	0.000002	T	0.54902	0.1887	M	0.88377	2.95	0.80722	D	1	B	0.11235	0.004	B	0.15484	0.013	T	0.60078	-0.7333	10	0.42905	T	0.14	-3.5101	14.1451	0.65347	0.0:1.0:0.0:0.0	.	137	Q14331	FRG1_HUMAN	K	137;74	ENSP00000226798:Q137K;ENSP00000435943:Q74K	ENSP00000226798:Q137K	Q	+	1	0	FRG1	191113277	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.292000	0.78731	1.964000	0.57103	0.567000	0.79289	CAA	.		0.353	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
ATG10	83734	bcgsc.ca	37	5	81549163	81549163	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr5:81549163C>A	ENST00000282185.3	+	7	876	c.582C>A	c.(580-582)agC>agA	p.S194R	ATG10_ENST00000514253.2_Intron|ATG10_ENST00000458350.3_Missense_Mutation_p.S194R	NM_031482.4	NP_113670.1	Q9H0Y0	ATG10_HUMAN	autophagy related 10	194					autophagy (GO:0006914)|autophagy in response to ER overload (GO:0034263)|positive regulation of protein modification process (GO:0031401)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|intracellular (GO:0005622)	Atg12 ligase activity (GO:0019777)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(2)	9		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)		CATGGCTGAGCATTGTAGGGC	0.418																																					p.S194R													.	ATG10	23	0			c.C582A						.						172.0	148.0	156.0					5																	81549163		2203	4300	6503	SO:0001583	missense	83734	exon8			GCTGAGCATTGTA	AK024016	CCDS4057.1	5q14.1	2014-02-12	2012-06-06	2005-09-11	ENSG00000152348	ENSG00000152348			20315	protein-coding gene	gene with protein product		610800	"""APG10 autophagy 10-like (S. cerevisiae)"", ""ATG10 autophagy related 10 homolog (S. cerevisiae)"""	APG10L			Standard	NM_031482		Approved	DKFZP586I0418, FLJ13954	uc003khr.3	Q9H0Y0	OTTHUMG00000119041	ENST00000282185.3:c.582C>A	5.37:g.81549163C>A	ENSP00000282185:p.Ser194Arg	83	0		52	4	NM_001131028	B2RE09|Q6PIX1|Q9H842	Missense_Mutation	SNP	ENST00000282185.3	37	CCDS4057.1	.	.	.	.	.	.	.	.	.	.	C	19.82	3.898570	0.72639	.	.	ENSG00000152348	ENST00000282185;ENST00000458350	T;T	0.30448	1.53;1.53	6.07	4.3	0.51218	.	0.000000	0.85682	D	0.000000	T	0.49218	0.1544	M	0.69823	2.125	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.47262	-0.9131	10	0.44086	T	0.13	-0.1891	7.2951	0.26389	0.0:0.7621:0.0:0.2379	.	194	Q9H0Y0	ATG10_HUMAN	R	194	ENSP00000282185:S194R;ENSP00000404938:S194R	ENSP00000282185:S194R	S	+	3	2	ATG10	81584919	0.736000	0.28164	0.915000	0.36163	0.868000	0.49771	0.987000	0.29603	1.585000	0.49928	0.655000	0.94253	AGC	.		0.418	ATG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239252.2	NM_001131028	
GPR98	84059	bcgsc.ca	37	5	89969943	89969943	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr5:89969943G>T	ENST00000405460.2	+	23	5098	c.5002G>T	c.(5002-5004)Gca>Tca	p.A1668S	GPR98_ENST00000450321.2_3'UTR	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1668					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ATTGGTTTCTGCAATTCCTGG	0.388																																					p.A1668S													.	GPR98	605	0			c.G5002T						.						114.0	108.0	110.0					5																	89969943		1899	4125	6024	SO:0001583	missense	84059	exon23			GTTTCTGCAATTC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.5002G>T	5.37:g.89969943G>T	ENSP00000384582:p.Ala1668Ser	74	0		32	3	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.837028	0.91117	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.28454	1.61	5.07	4.19	0.49359	.	0.094557	0.64402	D	0.000001	T	0.45256	0.1333	L	0.59436	1.845	0.80722	D	1	D	0.52996	0.957	P	0.55871	0.786	T	0.45264	-0.9273	10	0.59425	D	0.04	.	14.1476	0.65360	0.0738:0.0:0.9262:0.0	.	1668	Q8WXG9	GPR98_HUMAN	S	1668	ENSP00000384582:A1668S	ENSP00000296619:A1668S	A	+	1	0	GPR98	90005699	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	7.568000	0.82369	1.251000	0.43983	0.555000	0.69702	GCA	.		0.388	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
SECISBP2	79048	bcgsc.ca	37	9	91943787	91943787	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr9:91943787G>T	ENST00000375807.3	+	5	858	c.787G>T	c.(787-789)Gca>Tca	p.A263S	SECISBP2_ENST00000339901.4_Missense_Mutation_p.A190S|SECISBP2_ENST00000534113.2_Missense_Mutation_p.A195S|SECISBP2_ENST00000470305.1_3'UTR	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	263					translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						AAAACCAGCTGCAGTGTTATC	0.388																																					p.A263S													.	SECISBP2	64	0			c.G787T						.						46.0	45.0	45.0					9																	91943787		2203	4300	6503	SO:0001583	missense	79048	exon5			CCAGCTGCAGTGT	AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.787G>T	9.37:g.91943787G>T	ENSP00000364965:p.Ala263Ser	42	0		19	3	NM_024077	F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Missense_Mutation	SNP	ENST00000375807.3	37	CCDS6683.1	.	.	.	.	.	.	.	.	.	.	G	9.780	1.174949	0.21704	.	.	ENSG00000187742	ENST00000375807;ENST00000395669;ENST00000339901;ENST00000534113;ENST00000425851	T;T;T;T	0.71698	-0.59;-0.59;-0.59;0.98	4.97	-0.53	0.11898	.	0.819737	0.10820	N	0.630581	T	0.47469	0.1447	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B	0.32467	0.255;0.255;0.372;0.255;0.372	B;B;B;B;B	0.30855	0.057;0.039;0.121;0.039;0.085	T	0.30060	-0.9991	10	0.14252	T	0.57	-0.0076	6.2299	0.20728	0.1778:0.4565:0.3657:0.0	.	283;262;190;263;195	Q59H19;B4DZC7;Q96T21-2;Q96T21;F8W892	.;.;.;SEBP2_HUMAN;.	S	263;283;190;195;98	ENSP00000364965:A263S;ENSP00000364959:A190S;ENSP00000436650:A195S;ENSP00000414288:A98S	ENSP00000364959:A190S	A	+	1	0	SECISBP2	91133607	0.000000	0.05858	0.000000	0.03702	0.433000	0.31745	-0.178000	0.09782	0.076000	0.16826	0.460000	0.39030	GCA	.		0.388	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052990.3	NM_024077	
SLC22A9	114571	bcgsc.ca	37	11	63149670	63149670	+	Missense_Mutation	SNP	C	C	A	rs564236291|rs78765214|rs568732086|rs201804022	byFrequency	TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr11:63149670C>A	ENST00000279178.3	+	6	1243	c.994C>A	c.(994-996)Caa>Aaa	p.Q332K	SLC22A9_ENST00000310969.4_3'UTR	NM_080866.2	NP_543142.2	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion transporter), member 9	332					hormone transport (GO:0009914)|short-chain fatty acid import (GO:0015913)|sodium-independent organic anion transport (GO:0043252)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	anion:anion antiporter activity (GO:0015301)|short-chain fatty acid uptake transporter activity (GO:0015636)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	18						GGAGGCAGCACAAAAAAAAAA	0.403																																					p.Q332K													.	SLC22A9	77	0			c.C994A						.						141.0	137.0	138.0					11																	63149670		2201	4298	6499	SO:0001583	missense	114571	exon6			GCAGCACAAAAAA	AP001880	CCDS8043.1	11q12.3	2014-05-20	2008-01-11		ENSG00000149742	ENSG00000149742		"""Solute carriers"""	16261	protein-coding gene	gene with protein product		607579				11327718, 17393504	Standard	NM_080866		Approved	OAT4, FLJ23666, UST3, OAT7	uc001nww.3	Q8IVM8	OTTHUMG00000167805	ENST00000279178.3:c.994C>A	11.37:g.63149670C>A	ENSP00000279178:p.Gln332Lys	88	4		94	11	NM_080866	A0AVB7|A4PB24|Q8TCC8|Q8TEC0|Q8WYN7	Missense_Mutation	SNP	ENST00000279178.3	37	CCDS8043.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.013677	0.35511	.	.	ENSG00000149742	ENST00000279178	T	0.57595	0.39	3.53	-3.45	0.04781	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	3.812700	0.01193	N	0.007392	T	0.29914	0.0748	N	0.04508	-0.205	0.09310	N	1	B	0.31893	0.345	B	0.37692	0.256	T	0.20240	-1.0281	10	0.09084	T	0.74	.	7.2045	0.25899	0.3046:0.2446:0.4508:0.0	.	332	Q8IVM8	S22A9_HUMAN	K	332	ENSP00000279178:Q332K	ENSP00000279178:Q332K	Q	+	1	0	SLC22A9	62906246	0.000000	0.05858	0.003000	0.11579	0.605000	0.37080	-0.027000	0.12371	-0.339000	0.08401	0.134000	0.15878	CAA	.		0.403	SLC22A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396371.1	NM_080866	
RP11-754I20.1	0	bcgsc.ca	37	14	19114464	19114464	+	RNA	SNP	T	T	C	rs202138047		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr14:19114464T>C	ENST00000553170.1	+	0	71																											ACTGGGCCTGTGCCAATGGCC	0.433																																					.													.	.	.	0			.						.																																					0	.			GGCCTGTGCCAAT																													14.37:g.19114464T>C		233	6		142	17	.		RNA	SNP	ENST00000553170.1	37																																																																																				T|0.500;C|0.500		0.433	RP11-754I20.1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000408394.1		
RP11-252A24.2	0	bcgsc.ca	37	16	74372609	74372609	+	RNA	SNP	G	G	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr16:74372609G>A	ENST00000429810.2	-	0	1587																											AAAAAAAAAGGAGCAAAAATG	0.403																																					.													.	.	.	0			.						.																																					0	.			AAAAAGGAGCAAA																													16.37:g.74372609G>A		98	2		90	10	.		RNA	SNP	ENST00000429810.2	37																																																																																				.		0.403	RP11-252A24.2-003	KNOWN	basic	retained_intron	pseudogene	OTTHUMT00000434683.1		
DHRS7C	201140	bcgsc.ca	37	17	9684863	9684863	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr17:9684863C>A	ENST00000330255.5	-	2	215	c.203G>T	c.(202-204)gGa>gTa	p.G68V	DHRS7C_ENST00000571134.1_Missense_Mutation_p.G68V	NM_001105571.2|NM_001220493.1	NP_001099041.1|NP_001207422.1	A6NNS2	DRS7C_HUMAN	dehydrogenase/reductase (SDR family) member 7C	68					regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	extracellular region (GO:0005576)|longitudinal sarcoplasmic reticulum (GO:0014801)|sarcoplasmic reticulum membrane (GO:0033017)	retinol dehydrogenase activity (GO:0004745)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)	15						CCAGTTCTTTCCACACAGCAC	0.567																																					p.G68V													.	DHRS7C	34	0			c.G203T						.						85.0	90.0	88.0					17																	9684863		2024	4178	6202	SO:0001583	missense	201140	exon2			TTCTTTCCACACA		CCDS56020.1, CCDS58517.1	17p13.1	2011-09-20				ENSG00000184544		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	32423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 32C, member 2"""					19027726	Standard	NM_001105571		Approved	SDR32C2	uc010vvb.2	A6NNS2		ENST00000330255.5:c.203G>T	17.37:g.9684863C>A	ENSP00000327975:p.Gly68Val	42	0		54	4	NM_001220493	B7ZW74|B9EJH3	Missense_Mutation	SNP	ENST00000330255.5	37	CCDS56020.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.004623	0.74932	.	.	ENSG00000184544	ENST00000330255	D	0.88277	-2.36	5.04	4.06	0.47325	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.92244	0.7540	L	0.55834	1.745	0.80722	D	1	D;D	0.63880	0.993;0.961	D;P	0.69307	0.963;0.907	D	0.92741	0.6208	10	0.87932	D	0	.	14.1634	0.65461	0.0:0.8389:0.1611:0.0	.	68;65	A6NNS2;B9EJH3	DRS7C_HUMAN;.	V	68	ENSP00000327975:G68V	ENSP00000327975:G68V	G	-	2	0	DHRS7C	9625588	1.000000	0.71417	0.994000	0.49952	0.967000	0.64934	5.707000	0.68370	1.110000	0.41699	0.557000	0.71058	GGA	.		0.567	DHRS7C-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439863.1	XM_113912	
ZNF254	9534	bcgsc.ca	37	19	24310210	24310210	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr19:24310210G>T	ENST00000357002.4	+	4	1523	c.1408G>T	c.(1408-1410)Gca>Tca	p.A470S	ZNF254_ENST00000342944.6_Missense_Mutation_p.A385S	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254	470					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				ATGTGGCAAGGCATTTATATG	0.398																																					p.A470S													.	ZNF254	88	0			c.G1408T						.						58.0	59.0	58.0					19																	24310210		2203	4299	6502	SO:0001583	missense	9534	exon4			GGCAAGGCATTTA	AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.1408G>T	19.37:g.24310210G>T	ENSP00000349494:p.Ala470Ser	71	0		65	4	NM_203282	A4QPC0|Q86XL7	Missense_Mutation	SNP	ENST00000357002.4	37	CCDS32983.1	.	.	.	.	.	.	.	.	.	.	G	8.797	0.931996	0.18131	.	.	ENSG00000213096	ENST00000342944;ENST00000357002	T;T	0.26067	1.76;1.76	1.07	-0.307	0.12777	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19087	0.0458	N	0.04260	-0.245	0.09310	N	1	D	0.60160	0.987	P	0.60415	0.874	T	0.13737	-1.0498	9	0.46703	T	0.11	.	4.387	0.11321	0.4444:0.0:0.5556:0.0	.	470	O75437	ZN254_HUMAN	S	385;470	ENSP00000445527:A385S;ENSP00000349494:A470S	ENSP00000445527:A385S	A	+	1	0	ZNF254	24102050	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.825000	0.04433	-0.639000	0.05502	-1.261000	0.01458	GCA	.		0.398	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466453.1	NM_004876	
ICOSLG	23308	bcgsc.ca	37	21	45656893	45656893	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr21:45656893G>T	ENST00000407780.3	-	3	390	c.263C>A	c.(262-264)cCg>cAg	p.P88Q	ICOSLG_ENST00000400379.3_Missense_Mutation_p.P88Q|ICOSLG_ENST00000400377.3_Intron|ICOSLG_ENST00000344330.4_Missense_Mutation_p.P88Q	NM_001283052.1	NP_001269981.1	O75144	ICOSL_HUMAN	inducible T-cell co-stimulator ligand	88	Ig-like V-type.				B cell activation (GO:0042113)|defense response (GO:0006952)|hyperosmotic response (GO:0006972)|positive regulation of activated T cell proliferation (GO:0042104)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(2)|lung(1)|stomach(1)|urinary_tract(1)	5				Colorectal(79;0.0163)|READ - Rectum adenocarcinoma(84;0.0772)		CATGCCGGCCGGTGACATCAG	0.597																																					p.P88Q													.	ICOSLG	20	0			c.C263A						.						70.0	89.0	83.0					21																	45656893		2145	4250	6395	SO:0001583	missense	23308	exon3			CCGGCCGGTGACA	AB014553	CCDS42952.1, CCDS63377.1, CCDS63379.1	21q22.3	2014-01-30		2005-01-12	ENSG00000160223	ENSG00000160223		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Endogenous ligands"""	17087	protein-coding gene	gene with protein product	"""B7-related protein 1"", ""B7 homologue 2"", ""B7 homolog 2"""	605717		ICOSL		9734811, 11007762	Standard	NM_001283050		Approved	KIAA0653, GL50, B7-H2, B7RP-1, B7H2, B7RP1, ICOS-L, CD275	uc002zee.3	O75144	OTTHUMG00000086920	ENST00000407780.3:c.263C>A	21.37:g.45656893G>T	ENSP00000384432:p.Pro88Gln	38	0		35	4	NM_015259	A8MUZ1|Q9HD18|Q9NRQ1	Missense_Mutation	SNP	ENST00000407780.3	37	CCDS42952.1	.	.	.	.	.	.	.	.	.	.	G	15.07	2.723081	0.48728	.	.	ENSG00000160223	ENST00000344330;ENST00000407780;ENST00000400379	T;T;T	0.64618	-0.11;-0.11;-0.11	5.01	-9.3	0.00649	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.315590	0.05266	N	0.516710	T	0.63943	0.2554	L	0.54323	1.7	0.09310	N	1	D;D	0.71674	0.998;0.998	D;D	0.66196	0.942;0.942	T	0.62464	-0.6849	10	0.21014	T	0.42	-7.1614	6.0562	0.19812	0.2553:0.1103:0.5262:0.1083	.	88;88	A0N0L8;O75144	.;ICOSL_HUMAN	Q	88	ENSP00000339477:P88Q;ENSP00000384432:P88Q;ENSP00000383230:P88Q	ENSP00000339477:P88Q	P	-	2	0	ICOSLG	44481321	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.607000	0.05648	-2.066000	0.00886	-0.961000	0.02630	CCG	.		0.597	ICOSLG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000195838.1	NM_015259	
KIF4CP	347363	bcgsc.ca	37	X	78579158	78579158	+	IGR	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chrX:78579158G>T								GPR174 (151432 upstream) : ITM2A (36722 downstream)																							TTCAATGGGAGGTGCATACAC	0.408																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	347363	.			ATGGGAGGTGCAT																													X.37:g.78579158G>T		34	0		27	3	.		RNA	SNP		37																																																																																				.	0	0.408								
PRPS1	5631	bcgsc.ca	37	X	106888557	106888557	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chrX:106888557C>T	ENST00000372435.4	+	5	803	c.681C>T	c.(679-681)ggC>ggT	p.G227G	PRPS1_ENST00000372418.1_Silent_p.G127G|PRPS1_ENST00000372428.4_Silent_p.G160G|PRPS1_ENST00000543248.1_Silent_p.G227G	NM_002764.3	NP_002755.1	P60891	PRPS1_HUMAN	phosphoribosyl pyrophosphate synthetase 1	227	Binding of phosphoribosylpyrophosphate. {ECO:0000255}.				5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|hypoxanthine biosynthetic process (GO:0046101)|nervous system development (GO:0007399)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|pyrimidine nucleotide biosynthetic process (GO:0006221)|ribonucleoside monophosphate biosynthetic process (GO:0009156)|small molecule metabolic process (GO:0044281)|urate biosynthetic process (GO:0034418)	cytosol (GO:0005829)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)			breast(3)|endometrium(2)|kidney(3)|large_intestine(3)|lung(11)|upper_aerodigestive_tract(1)	23						ACACTTGTGGCACAATCTGCC	0.502																																					p.G227G													.	PRPS1	33	0			c.C681T						.						191.0	161.0	171.0					X																	106888557		2203	4300	6503	SO:0001819	synonymous_variant	5631	exon5			TTGTGGCACAATC	X15331	CCDS14529.1, CCDS76007.1	Xq22.3	2014-09-17			ENSG00000147224	ENSG00000147224	2.7.6.1		9462	protein-coding gene	gene with protein product	"""PRS I"", ""ribose-phosphate diphosphokinase 1"""	311850	"""deafness, X-linked 2, perceptive, congenital"""	DFN2		1962753, 20021999	Standard	NM_002764		Approved	CMTX5, DFNX1	uc004ene.4	P60891	OTTHUMG00000022167	ENST00000372435.4:c.681C>T	X.37:g.106888557C>T		71	0		51	4	NM_002764	B1ALA8|B2R6T7|B4DNL6|D3DUX6|P09329	Silent	SNP	ENST00000372435.4	37	CCDS14529.1																																																																																			.		0.502	PRPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057840.1		
FLG	2312	hgsc.bcm.edu	37	1	152279697	152279698	+	Missense_Mutation	DNP	CT	CT	TG			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	CT	CT	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr1:152279697_152279698CT>TG	ENST00000368799.1	-	3	7699_7700	c.7664_7665AG>CA	c.(7663-7665)gAG>gCA	p.E2555A	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2555	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCTGGGCCCCTCTGATTGTCC	0.599									Ichthyosis																												p.E2555A		.											FLG,caecum,carcinoma,0,1	FLG	0	0			c.A7664C						.																																			SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	GGCCCCTCTGATT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7664_7665delinsTG	1.37:g.152279697_152279698delinsTG	ENSP00000357789:p.Glu2555Ala	71	1		104	6	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	DNP	ENST00000368799.1	37	CCDS30860.1																																																																																			.		0.599	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
AC016995.3	0	broad.mit.edu	37	2	38710046	38710047	+	lincRNA	DNP	TA	TA	AT	rs61417537|rs574017590|rs57355803		TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	TA	TA						Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr2:38710046_38710047TA>AT	ENST00000417039.1	-	0	696																											aaataaataataaataaataaa	0.272																																					.													.	.	.	0			.						.																																					0	.			AATAATAAATAAA																												Exception_encountered	2.37:g.38710046_38710047delinsAT		59	3		55	11	.		RNA	DNP	ENST00000417039.1	37																																																																																				.		0.272	AC016995.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000331173.1		
MAP3K14	9020	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	43351847	43351847	+	RNA	SNP	G	G	T			TCGA-ZH-A8Y2-01A-11D-A417-09	TCGA-ZH-A8Y2-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9443f09f-550c-4111-8a6d-6a74f267b0dc	581c6971-13b1-4bda-9ea8-c3dc3280aacc	g.chr17:43351847G>T	ENST00000344686.2	-	0	1509							Q99558	M3K14_HUMAN	mitogen-activated protein kinase kinase kinase 14						cellular response to mechanical stimulus (GO:0071260)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|T cell costimulation (GO:0031295)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|NF-kappaB-inducing kinase activity (GO:0004704)|protein kinase activity (GO:0004672)	p.F468F(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27						GCAGCTCCATGAAGATGTTGA	0.537																																					.		.											MAP3K14,NS,carcinoma,0,1	MAP3K14	0	1	Substitution - coding silent(1)	cervix(1)	.						.						62.0	66.0	64.0					17																	43351847		2042	4197	6239			9020	p.F467L			CTCCATGAAGATG	Y10256	CCDS74079.1	17q21.31	2014-06-16			ENSG00000006062	ENSG00000006062	2.7.11.25	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6853	protein-coding gene	gene with protein product	"""serine/threonine protein-kinase"""	604655				9020361	Standard	NM_003954		Approved	NIK, HSNIK, FTDCR1B, HS	uc002iiw.1	Q99558	OTTHUMG00000180364		17.37:g.43351847G>T		65	0		89	13	.	A8K2D8|D3DX67|Q8IYN1	Missense_Mutation	SNP	ENST00000344686.2	37		.	.	.	.	.	.	.	.	.	.	G	17.35	3.367009	0.61513	.	.	ENSG00000006062	ENST00000344686;ENST00000376926	.	.	.	5.38	4.41	0.53225	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.057972	0.64402	D	0.000001	T	0.39091	0.1065	L	0.27944	0.81	0.34561	D	0.712419	P	0.39094	0.659	B	0.43658	0.426	T	0.55438	-0.8141	8	0.54805	T	0.06	.	9.3627	0.38206	0.1609:0.0:0.8391:0.0	.	468	Q99558	M3K14_HUMAN	L	467;251	.	ENSP00000342059:F467L	F	-	3	2	MAP3K14	40707630	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.042000	0.57347	1.278000	0.44430	0.561000	0.74099	TTC	.		0.537	MAP3K14-201	KNOWN	basic	processed_transcript	processed_transcript		NM_003954	
