#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ACCS	84680	genome.wustl.edu	37	11	44097101	44097101	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr11:44097101C>T	ENST00000263776.8	+	6	949	c.515C>T	c.(514-516)tCg>tTg	p.S172L	ACCS_ENST00000432284.2_Silent_p.L148L|ACCS_ENST00000533208.1_3'UTR	NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	172					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						GGTGGTGCCTCGCTCTTCTCT	0.607																																					Esophageal Squamous(158;148 1889 8077 23160 41213)												0													283.0	194.0	224.0					11																	44097101		2203	4300	6503	SO:0001583	missense	0			AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.515C>T	11.37:g.44097101C>T	ENSP00000263776:p.Ser172Leu		B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.S172L	ENST00000263776.8	37	c.515	CCDS7907.1	11	.	.	.	.	.	.	.	.	.	.	C	28.7	4.939667	0.92526	.	.	ENSG00000110455	ENST00000263776	D	0.91124	-2.79	4.82	4.82	0.62117	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.96470	0.8848	M	0.93808	3.46	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.977	D	0.97429	1.0014	10	0.72032	D	0.01	-13.9251	16.0536	0.80779	0.0:1.0:0.0:0.0	.	99;172	B4DYM9;Q96QU6	.;1A1L1_HUMAN	L	172	ENSP00000263776:S172L	ENSP00000263776:S172L	S	+	2	0	ACCS	44053677	1.000000	0.71417	0.989000	0.46669	0.925000	0.55904	5.919000	0.70005	2.384000	0.81235	0.650000	0.86243	TCG	ACCS	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	ENSG00000110455		0.607	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCS	HGNC	protein_coding	OTTHUMT00000389721.1	-	0.00	45	0	C	NM_032592		44097101	+1	tier1	-	no_errors	ENST00000263776	ensembl	human	known	74_37	missense	14.04	48	8	SNP	1.000	T
ACCS	84680	genome.wustl.edu	37	11	44097110	44097110	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr11:44097110C>G	ENST00000263776.8	+	6	958	c.524C>G	c.(523-525)tCt>tGt	p.S175C	ACCS_ENST00000432284.2_Silent_p.L151L|ACCS_ENST00000533208.1_3'UTR	NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	175					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						TCGCTCTTCTCTGCTCTGGCC	0.602																																					Esophageal Squamous(158;148 1889 8077 23160 41213)												0													258.0	179.0	206.0					11																	44097110		2203	4300	6503	SO:0001583	missense	0			AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.524C>G	11.37:g.44097110C>G	ENSP00000263776:p.Ser175Cys		B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.S175C	ENST00000263776.8	37	c.524	CCDS7907.1	11	.	.	.	.	.	.	.	.	.	.	C	18.64	3.666669	0.67814	.	.	ENSG00000110455	ENST00000263776	T	0.23552	1.9	4.82	3.89	0.44902	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.54775	0.1879	M	0.87827	2.91	0.80722	D	1	D;B	0.89917	1.0;0.413	D;P	0.91635	0.999;0.462	T	0.62238	-0.6896	10	0.56958	D	0.05	-12.1943	13.3172	0.60413	0.0:0.8412:0.1588:0.0	.	102;175	B4DYM9;Q96QU6	.;1A1L1_HUMAN	C	175	ENSP00000263776:S175C	ENSP00000263776:S175C	S	+	2	0	ACCS	44053686	1.000000	0.71417	0.996000	0.52242	0.962000	0.63368	4.223000	0.58587	1.131000	0.42111	0.650000	0.86243	TCT	ACCS	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	ENSG00000110455		0.602	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCS	HGNC	protein_coding	OTTHUMT00000389721.1	-	0.00	44	0	C	NM_032592		44097110	+1	tier1	-	no_errors	ENST00000263776	ensembl	human	known	74_37	missense	13.33	52	8	SNP	1.000	G
ACTR2	10097	genome.wustl.edu	37	2	65467072	65467072	+	Silent	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:65467072C>G	ENST00000260641.5	+	2	292	c.135C>G	c.(133-135)acC>acG	p.T45T	ACTR2_ENST00000542850.1_5'UTR|ACTR2_ENST00000476840.1_3'UTR|ACTR2_ENST00000377982.4_Silent_p.T45T	NM_005722.3	NP_005713.1	P61160	ARP2_HUMAN	ARP2 actin-related protein 2 homolog (yeast)	45					Arp2/3 complex-mediated actin nucleation (GO:0034314)|asymmetric cell division (GO:0008356)|cellular component movement (GO:0006928)|cilium assembly (GO:0042384)|cytoplasmic transport (GO:0016482)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|meiotic chromosome movement towards spindle pole (GO:0016344)|meiotic cytokinesis (GO:0033206)|spindle localization (GO:0051653)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)	12						GATCAACCACCAAAGTGGGAA	0.343																																																	0													73.0	71.0	72.0					2																	65467072		2203	4300	6503	SO:0001819	synonymous_variant	0			AF006082	CCDS1881.1, CCDS46307.1	2p14	2008-05-20	2001-11-28		ENSG00000138071	ENSG00000138071			169	protein-coding gene	gene with protein product		604221	"""ARP2 (actin-related protein 2, yeast) homolog"""			9230079	Standard	NM_001005386		Approved	ARP2	uc002sdp.3	P61160	OTTHUMG00000129540	ENST00000260641.5:c.135C>G	2.37:g.65467072C>G			B2RCP5|D6W5F4|E9PF41|O15142|Q96C82	Silent	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.T45	ENST00000260641.5	37	c.135	CCDS1881.1	2																																																																																			ACTR2	-	pfam_Actin-related,smart_Actin-related	ENSG00000138071		0.343	ACTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR2	HGNC	protein_coding	OTTHUMT00000251730.1	-	0.00	69	0	C	NM_001005386		65467072	+1	tier1	-	no_errors	ENST00000377982	ensembl	human	known	74_37	silent	11.69	68	9	SNP	1.000	G
ADAM33	80332	genome.wustl.edu	37	20	3652088	3652088	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr20:3652088A>T	ENST00000356518.2	-	17	2202	c.1961T>A	c.(1960-1962)cTg>cAg	p.L654Q	ADAM33_ENST00000379861.4_Missense_Mutation_p.L654Q|ADAM33_ENST00000466620.1_Intron|ADAM33_ENST00000350009.2_Intron	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	654	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						GCAGGCAGTCAGGCAGCGCTG	0.637																																																	0													66.0	67.0	66.0					20																	3652088		2203	4300	6503	SO:0001583	missense	0			AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.1961T>A	20.37:g.3652088A>T	ENSP00000348912:p.Leu654Gln		A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.L654Q	ENST00000356518.2	37	c.1961	CCDS13058.1	20	.	.	.	.	.	.	.	.	.	.	A	7.119	0.577551	0.13686	.	.	ENSG00000149451	ENST00000356518;ENST00000379861;ENST00000439201	T;T	0.01446	4.88;4.89	5.46	3.01	0.34805	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.02688	0.0081	L	0.28556	0.865	0.09310	N	1	D;D	0.55800	0.973;0.973	P;P	0.57468	0.821;0.807	T	0.42666	-0.9438	9	0.11182	T	0.66	.	5.0191	0.14352	0.6814:0.1558:0.1627:0.0	.	654;654	Q9BZ11;A2A2L3	ADA33_HUMAN;.	Q	654;654;534	ENSP00000348912:L654Q;ENSP00000369190:L654Q	ENSP00000348912:L654Q	L	-	2	0	ADAM33	3600088	0.000000	0.05858	0.822000	0.32727	0.016000	0.09150	0.168000	0.16622	0.864000	0.35578	0.459000	0.35465	CTG	ADAM33	-	pfscan_EG-like_dom	ENSG00000149451		0.637	ADAM33-001	KNOWN	basic|CCDS	protein_coding	ADAM33	HGNC	protein_coding	OTTHUMT00000077763.2	-	0.00	54	0	A	NM_025220		3652088	-1	tier1	-	no_errors	ENST00000356518	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.004	T
ADAMTS9	56999	genome.wustl.edu	37	3	64587823	64587823	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr3:64587823C>G	ENST00000498707.1	-	26	4156	c.3814G>C	c.(3814-3816)Gtg>Ctg	p.V1272L	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.V1244L	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1272	TSP type-1 8. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V1272M(2)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CGATCGATCACGTGGTCACTG	0.517																																																	2	Substitution - Missense(2)	ovary(1)|endometrium(1)											178.0	151.0	160.0					3																	64587823		2203	4300	6503	SO:0001583	missense	0			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.3814G>C	3.37:g.64587823C>G	ENSP00000418735:p.Val1272Leu		A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.V1272L	ENST00000498707.1	37	c.3814	CCDS2903.1	3	.	.	.	.	.	.	.	.	.	.	C	11.58	1.680716	0.29872	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.51325	0.71;0.71	5.55	4.68	0.58851	.	0.219427	0.38837	N	0.001549	T	0.26484	0.0647	N	0.17248	0.465	0.80722	D	1	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.14023	0.004;0.01;0.009	T	0.10200	-1.0640	10	0.19147	T	0.46	.	5.3157	0.15854	0.0:0.6111:0.162:0.2269	.	1244;1272;1272	B7ZVX9;Q9P2N4-1;Q9P2N4	.;.;ATS9_HUMAN	L	1244;1272	ENSP00000295903:V1244L;ENSP00000418735:V1272L	ENSP00000295903:V1244L	V	-	1	0	ADAMTS9	64562863	0.746000	0.28272	0.525000	0.27900	0.812000	0.45895	1.898000	0.39809	1.586000	0.49944	0.591000	0.81541	GTG	ADAMTS9	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000163638		0.517	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS9	HGNC	protein_coding	OTTHUMT00000351891.1	-	0.00	33	0	C			64587823	-1	tier1	-	no_errors	ENST00000498707	ensembl	human	known	74_37	missense	27.27	16	6	SNP	0.977	G
AGBL1	123624	genome.wustl.edu	37	15	86822975	86822975	+	Silent	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr15:86822975C>T	ENST00000441037.2	+	15	2138	c.2043C>T	c.(2041-2043)taC>taT	p.Y681Y	AGBL1_ENST00000421325.2_Silent_p.Y681Y|AGBL1_ENST00000389298.3_Silent_p.Y412Y	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	681					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						ATGTCTGCTACCTGGCCTACC	0.517																																																	0													291.0	284.0	286.0					15																	86822975		2072	4211	6283	SO:0001819	synonymous_variant	0			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.2043C>T	15.37:g.86822975C>T			A1A4X5|A6NJH6|C9JHL5	Silent	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.Y681	ENST00000441037.2	37	c.2043	CCDS58398.1	15																																																																																			AGBL1	-	NULL	ENSG00000166748		0.517	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	-	0.00	30	0	C	NM_152336		86822975	+1	tier1	-	no_errors	ENST00000441037	ensembl	human	known	74_37	silent	10.81	33	4	SNP	1.000	T
AHNAK	79026	genome.wustl.edu	37	11	62293932	62293932	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr11:62293932C>G	ENST00000378024.4	-	5	8231	c.7957G>C	c.(7957-7959)Gga>Cga	p.G2653R	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2653					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GGGCCCTCTCCTTTGAAGCCA	0.517																																																	0													182.0	184.0	183.0					11																	62293932		2202	4299	6501	SO:0001583	missense	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.7957G>C	11.37:g.62293932C>G	ENSP00000367263:p.Gly2653Arg		A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.G2653R	ENST00000378024.4	37	c.7957	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	c	15.24	2.775780	0.49786	.	.	ENSG00000124942	ENST00000244934;ENST00000378024	T	0.08193	3.12	4.31	3.38	0.38709	.	.	.	.	.	T	0.36963	0.0986	M	0.92833	3.35	0.26289	N	0.978156	D	0.89917	1.0	D	0.91635	0.999	T	0.31447	-0.9943	9	0.59425	D	0.04	-7.0E-4	13.0569	0.58986	0.1627:0.8373:0.0:0.0	.	2653	Q09666	AHNK_HUMAN	R	742;2653	ENSP00000367263:G2653R	ENSP00000244934:G742R	G	-	1	0	AHNAK	62050508	.	.	0.966000	0.40874	0.784000	0.44337	.	.	0.787000	0.33731	0.479000	0.44913	GGA	AHNAK	-	NULL	ENSG00000124942		0.517	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	-	0.00	174	0	C	NM_024060		62293932	-1	tier1	-	no_errors	ENST00000378024	ensembl	human	known	74_37	missense	19.18	118	28	SNP	0.941	G
AKAP6	9472	genome.wustl.edu	37	14	33291546	33291546	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr14:33291546C>A	ENST00000280979.4	+	13	4697	c.4527C>A	c.(4525-4527)tgC>tgA	p.C1509*	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1509					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		AAAAATCATGCAAATCTAAAC	0.368																																					Melanoma(49;821 1200 7288 13647 42351)												0													72.0	72.0	72.0					14																	33291546		2203	4299	6502	SO:0001587	stop_gained	0			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.4527C>A	14.37:g.33291546C>A	ENSP00000280979:p.Cys1509*		A7E242|A7E2D4|O15028	Nonsense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.C1509*	ENST00000280979.4	37	c.4527	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	C	42	9.337938	0.99142	.	.	ENSG00000151320	ENST00000280979	.	.	.	5.79	3.01	0.34805	.	0.152323	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.4754	3.546	0.07828	0.1695:0.5096:0.0:0.321	.	.	.	.	X	1509	.	ENSP00000280979:C1509X	C	+	3	2	AKAP6	32361297	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	1.183000	0.32041	0.804000	0.34136	0.655000	0.94253	TGC	AKAP6	-	NULL	ENSG00000151320		0.368	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	-	0.00	46	0	C	NM_004274		33291546	+1	tier1	-	no_errors	ENST00000280979	ensembl	human	known	74_37	nonsense	32.14	19	9	SNP	1.000	A
AMPD1	270	genome.wustl.edu	37	1	115231339	115231339	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:115231339A>C	ENST00000520113.2	-	3	172	c.157T>G	c.(157-159)Ttt>Gtt	p.F53V	AMPD1_ENST00000369538.3_Missense_Mutation_p.F49V|AMPD1_ENST00000353928.6_Missense_Mutation_p.F20V			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	53					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	TTTTCAGCAAAGTTGCGCATT	0.413																																																	0													134.0	131.0	132.0					1																	115231339		2203	4300	6503	SO:0001583	missense	0			M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.157T>G	1.37:g.115231339A>C	ENSP00000430075:p.Phe53Val		A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.F53V	ENST00000520113.2	37	c.157	CCDS876.2	1	.	.	.	.	.	.	.	.	.	.	A	12.16	1.854877	0.32791	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	T;T;T	0.39406	1.08;1.08;1.08	5.5	5.5	0.81552	.	0.267888	0.42964	D	0.000640	T	0.17023	0.0409	L	0.32530	0.975	0.37818	D	0.928299	B;B	0.31581	0.329;0.107	B;B	0.26517	0.07;0.039	T	0.09143	-1.0688	10	0.48119	T	0.1	-11.9912	10.2957	0.43623	0.9263:0.0:0.0737:0.0	.	49;20	Q5TF02;P23109	.;AMPD1_HUMAN	V	53;49;20	ENSP00000430075:F53V;ENSP00000358551:F49V;ENSP00000316520:F20V	ENSP00000316520:F20V	F	-	1	0	AMPD1	115032862	1.000000	0.71417	1.000000	0.80357	0.514000	0.34195	3.779000	0.55379	2.216000	0.71823	0.533000	0.62120	TTT	AMPD1	-	pirsf_AMP_deaminase	ENSG00000116748		0.413	AMPD1-001	KNOWN	basic|CCDS	protein_coding	AMPD1	HGNC	protein_coding	OTTHUMT00000032860.4	-	0.00	76	0	A			115231339	-1	tier1	-	no_errors	ENST00000520113	ensembl	human	known	74_37	missense	19.57	37	9	SNP	1.000	C
ANKLE1	126549	genome.wustl.edu	37	19	17394145	17394145	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:17394145C>G	ENST00000394458.3	+	5	848	c.572C>G	c.(571-573)cCc>cGc	p.P191R	ANKLE1_ENST00000594072.1_Missense_Mutation_p.P180R|ANKLE1_ENST00000433424.2_Missense_Mutation_p.P245R|ANKLE1_ENST00000598347.1_Missense_Mutation_p.P191R|ANKLE1_ENST00000404085.1_Missense_Mutation_p.P213R	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1	191										large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						CCAGGACCCCCCAGCCTCCCT	0.592																																																	0													67.0	77.0	74.0					19																	17394145		2202	4300	6502	SO:0001583	missense	0			AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.572C>G	19.37:g.17394145C>G	ENSP00000377971:p.Pro191Arg		A8VU82|Q8N8J8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_LEM_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_LEM/LEM-like_dom,superfamily_Lactate_DH/Glyco_Ohase_4_C,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_LEM_dom	p.P191R	ENST00000394458.3	37	c.572	CCDS12354.2	19	.	.	.	.	.	.	.	.	.	.	C	12.78	2.039548	0.35989	.	.	ENSG00000160117	ENST00000404261;ENST00000433424;ENST00000404085;ENST00000394458;ENST00000438921	T;T;T	0.72725	-0.57;-0.68;-0.65	4.1	3.04	0.35103	.	2.490280	0.01718	N	0.028145	T	0.66396	0.2785	N	0.24115	0.695	0.09310	N	1	P;P;P;P	0.48230	0.907;0.815;0.906;0.845	B;B;P;B	0.49752	0.425;0.295;0.621;0.368	T	0.59080	-0.7521	10	0.23302	T	0.38	-11.331	8.2915	0.31960	0.0:0.8789:0.0:0.1211	.	191;177;191;180	E7ETZ9;Q8NAG6-1;Q8NAG6;A0JLW0	.;.;ANKL1_HUMAN;.	R	191;245;213;180;191	ENSP00000384753:P191R;ENSP00000394460:P245R;ENSP00000384008:P213R	ENSP00000377971:P180R	P	+	2	0	ANKLE1	17255145	0.008000	0.16893	0.099000	0.21106	0.115000	0.19883	0.662000	0.25038	2.000000	0.58554	0.313000	0.20887	CCC	ANKLE1	-	NULL	ENSG00000160117		0.592	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE1	HGNC	protein_coding	OTTHUMT00000325392.2	-	0.00	37	0	C	NM_152363		17394145	+1	tier1	-	no_errors	ENST00000394458	ensembl	human	known	74_37	missense	21.43	22	6	SNP	0.210	G
Unknown	0	genome.wustl.edu	37	22	17151133	17151133	+	IGR	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr22:17151133C>A								TPTEP1 (16434 upstream) : ANKRD62P1-PARP4P3 (3317 downstream)																							AGTTATGTTTCCTTGTACACC	0.313																																																	0																																										SO:0001628	intergenic_variant	0																															22.37:g.17151133C>A				RNA	SNP	-	NULL		37	NULL		22																																																																																			ANKRD62P1-PARP4P3	-	-	ENSG00000189295	0	0.313					ANKRD62P1-PARP4P3	HGNC			-	0.00	48	0	C			17151133	-1	tier1	-	no_errors	ENST00000456726	ensembl	human	known	74_37	rna	35.85	34	19	SNP	0.001	A
ANO1	55107	genome.wustl.edu	37	11	70007297	70007297	+	Missense_Mutation	SNP	G	G	A	rs377208404		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr11:70007297G>A	ENST00000355303.5	+	17	1914	c.1609G>A	c.(1609-1611)Gtc>Atc	p.V537I	ANO1_ENST00000538023.1_Missense_Mutation_p.V537I|ANO1_ENST00000531349.1_Missense_Mutation_p.V246I|ANO1_ENST00000530676.1_Missense_Mutation_p.V391I|ANO1_ENST00000398543.2_Missense_Mutation_p.V391I|ANO1_ENST00000316296.5_Missense_Mutation_p.V479I	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	537					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	CGTCCTCGGCGTCATCATCTA	0.627																																																	0								G	ILE/VAL	0,4240		0,0,2120	62.0	64.0	63.0		1609	5.3	1.0	11		63	1,8409		0,1,4204	no	missense	ANO1	NM_018043.5	29	0,1,6324	AA,AG,GG		0.0119,0.0,0.0079	probably-damaging	537/987	70007297	1,12649	2120	4205	6325	SO:0001583	missense	0			BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.1609G>A	11.37:g.70007297G>A	ENSP00000347454:p.Val537Ile		A8KAM3|Q8IYY8|Q8N7V3	Missense_Mutation	SNP	pfam_Anoctamin	p.V537I	ENST00000355303.5	37	c.1609	CCDS44663.1	11	.	.	.	.	.	.	.	.	.	.	G	22.3	4.274599	0.80580	0.0	1.19E-4	ENSG00000131620	ENST00000355303;ENST00000538023;ENST00000398543;ENST00000546327;ENST00000316296;ENST00000530676;ENST00000531349;ENST00000531300	T;T;T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04;-0.04;-0.04	5.29	5.29	0.74685	.	0.000000	0.64402	D	0.000001	T	0.73923	0.3649	L	0.48877	1.53	0.58432	D	0.999998	D;D;D	0.76494	0.971;0.999;0.994	P;D;D	0.70016	0.612;0.967;0.954	T	0.71899	-0.4453	9	.	.	.	.	18.9454	0.92620	0.0:0.0:1.0:0.0	.	246;479;537	E9PNA7;Q5XXA6-3;Q5XXA6	.;.;ANO1_HUMAN	I	537;537;391;295;479;391;246;88	ENSP00000347454:V537I;ENSP00000444689:V537I;ENSP00000381551:V391I;ENSP00000319477:V479I;ENSP00000435797:V391I;ENSP00000432843:V246I;ENSP00000435868:V88I	.	V	+	1	0	ANO1	69684945	1.000000	0.71417	0.982000	0.44146	0.993000	0.82548	7.760000	0.85248	2.460000	0.83146	0.655000	0.94253	GTC	ANO1	-	pfam_Anoctamin	ENSG00000131620		0.627	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANO1	HGNC	protein_coding	OTTHUMT00000393685.1	-	0.00	18	0	G	NM_018043		70007297	+1	tier1	-	no_errors	ENST00000355303	ensembl	human	known	74_37	missense	18.18	27	6	SNP	1.000	A
APC	324	genome.wustl.edu	37	5	112178800	112178800	+	Silent	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr5:112178800A>G	ENST00000457016.1	+	16	7889	c.7509A>G	c.(7507-7509)ggA>ggG	p.G2503G	APC_ENST00000508376.2_Silent_p.G2503G|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Silent_p.G2503G			P25054	APC_HUMAN	adenomatous polyposis coli	2503	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGGCTGGTGGATGGCGAAAAC	0.478		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)		yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	1	Unknown(1)	skin(1)											105.0	87.0	93.0					5																	112178800		2202	4300	6502	SO:0001819	synonymous_variant	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.7509A>G	5.37:g.112178800A>G			D3DT03|Q15162|Q15163|Q93042	Silent	SNP	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_APC_dom,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.G2503	ENST00000457016.1	37	c.7509	CCDS4107.1	5																																																																																			APC	-	pfam_APC_basic_dom	ENSG00000134982		0.478	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	HGNC	protein_coding	OTTHUMT00000250738.2	-	0.00	34	0	A	NM_000038		112178800	+1	tier1	-	no_errors	ENST00000257430	ensembl	human	known	74_37	silent	59.26	11	16	SNP	0.091	G
ARSB	411	genome.wustl.edu	37	5	78135194	78135194	+	Missense_Mutation	SNP	C	C	T	rs570630772		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr5:78135194C>T	ENST00000264914.4	-	6	1734	c.1198G>A	c.(1198-1200)Gtg>Atg	p.V400M	ARSB_ENST00000565165.1_Missense_Mutation_p.V400M|ARSB_ENST00000396151.3_Missense_Mutation_p.V400M	NM_000046.3	NP_000037.2	P15848	ARSB_HUMAN	arylsulfatase B	400					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|lysosomal transport (GO:0007041)|lysosome organization (GO:0007040)|post-translational protein modification (GO:0043687)|response to estrogen (GO:0043627)|response to methylmercury (GO:0051597)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|rough endoplasmic reticulum (GO:0005791)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)		GAAGAGTCCACGAAGTTCGGG	0.428																																					Melanoma(169;563 1968 25780 26156 52266)												0													132.0	130.0	131.0					5																	78135194		2203	4300	6503	SO:0001583	missense	0			M32373	CCDS4043.1, CCDS43334.1	5q14.1	2013-02-14			ENSG00000113273	ENSG00000113273	3.1.6.1	"""Arylsulfatase family"""	714	protein-coding gene	gene with protein product		611542				2303452	Standard	NM_000046		Approved		uc003kfq.3	P15848	OTTHUMG00000108129	ENST00000264914.4:c.1198G>A	5.37:g.78135194C>T	ENSP00000264914:p.Val400Met		B2RC20|Q8N322|Q9UDI9	Missense_Mutation	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.V400M	ENST00000264914.4	37	c.1198	CCDS4043.1	5	.	.	.	.	.	.	.	.	.	.	C	14.07	2.426700	0.43020	.	.	ENSG00000113273	ENST00000264914;ENST00000396151	D;D	0.97553	-4.02;-4.43	5.78	3.95	0.45737	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	1.073260	0.07200	N	0.857291	D	0.94765	0.8310	L	0.28649	0.875	0.22531	N	0.999013	P;P	0.50443	0.935;0.866	B;P	0.46419	0.377;0.516	D	0.87335	0.2327	10	0.36615	T	0.2	.	8.6129	0.33813	0.1572:0.7622:0.0:0.0806	.	400;400	Q8N322;P15848	.;ARSB_HUMAN	M	400	ENSP00000264914:V400M;ENSP00000379455:V400M	ENSP00000264914:V400M	V	-	1	0	ARSB	78170950	0.999000	0.42202	0.019000	0.16419	0.025000	0.11179	1.777000	0.38604	0.735000	0.32537	0.561000	0.74099	GTG	ARSB	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000113273		0.428	ARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSB	HGNC	protein_coding	OTTHUMT00000226932.2	-	0.00	47	0	C	NM_000046		78135194	-1	tier1	-	no_errors	ENST00000264914	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.661	T
ARAP3	64411	genome.wustl.edu	37	5	141041788	141041788	+	Silent	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr5:141041788G>A	ENST00000239440.4	-	20	2900	c.2835C>T	c.(2833-2835)ggC>ggT	p.G945G	ARAP3_ENST00000513878.1_Silent_p.G607G|ARAP3_ENST00000512390.1_5'UTR|ARAP3_ENST00000508305.1_Intron	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	945	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						GGGCACGAGCGCCCCCTTTCC	0.642																																																	0													64.0	68.0	67.0					5																	141041788		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.2835C>T	5.37:g.141041788G>A			B4DIT1|D3DQE3	Silent	SNP	pfam_RhoGAP_dom,pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ras-assoc,pfam_SAM_2,pfam_SAM_type1,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.G945	ENST00000239440.4	37	c.2835	CCDS4266.1	5																																																																																			ARAP3	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000120318		0.642	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP3	HGNC	protein_coding	OTTHUMT00000251805.1	-	0.00	22	0	G	NM_022481		141041788	-1	tier1	-	no_errors	ENST00000239440	ensembl	human	known	74_37	silent	16.00	21	4	SNP	0.007	A
ASXL1	171023	genome.wustl.edu	37	20	30947592	30947592	+	Intron	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr20:30947592C>T	ENST00000375687.4	+	1	481				ASXL1_ENST00000306058.5_Nonsense_Mutation_p.Q15*|ASXL1_ENST00000542461.1_Intron|ASXL1_ENST00000375689.1_Nonsense_Mutation_p.Q15*	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1						bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						AGAGGACTTGCAGGTGAAATA	0.443			"""F, N, Mis"""		"""MDS, CMML"""																																			Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	0																																										SO:0001627	intron_variant	0			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.57+957C>T	20.37:g.30947592C>T			B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Nonsense_Mutation	SNP	NULL	p.Q15*	ENST00000375687.4	37	c.43	CCDS13201.1	20	.	.	.	.	.	.	.	.	.	.	C	15.63	2.889377	0.52014	.	.	ENSG00000171456	ENST00000375689;ENST00000306058	.	.	.	4.04	-2.9	0.05648	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.804	0.13310	0.1689:0.4648:0.0:0.3663	.	.	.	.	X	15	.	ENSP00000305119:Q15X	Q	+	1	0	ASXL1	30411253	0.000000	0.05858	0.000000	0.03702	0.137000	0.21094	-0.256000	0.08757	-0.720000	0.04935	-0.379000	0.06801	CAG	ASXL1	-	NULL	ENSG00000171456		0.443	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASXL1	HGNC	protein_coding	OTTHUMT00000078624.2	-	0.00	43	0	C	NM_015338		30947592	+1	tier1	-	no_errors	ENST00000306058	ensembl	human	known	74_37	nonsense	5.97	63	4	SNP	0.000	T
ATXN2L	11273	genome.wustl.edu	37	16	28844774	28844774	+	Nonsense_Mutation	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr16:28844774C>G	ENST00000336783.4	+	15	2137	c.1970C>G	c.(1969-1971)tCa>tGa	p.S657*	ATXN2L_ENST00000340394.8_Nonsense_Mutation_p.S657*|RP11-24N18.1_ENST00000563565.1_RNA|ATXN2L_ENST00000395547.2_Nonsense_Mutation_p.S657*|ATXN2L_ENST00000564304.1_Nonsense_Mutation_p.S663*|ATXN2L_ENST00000382686.4_Nonsense_Mutation_p.S657*|ATXN2L_ENST00000570200.1_Nonsense_Mutation_p.S657*|ATXN2L_ENST00000325215.6_Nonsense_Mutation_p.S657*|ATXN2L_ENST00000565845.1_3'UTR	NM_007245.3	NP_009176.2	Q8WWM7	ATX2L_HUMAN	ataxin 2-like	657					regulation of cytoplasmic mRNA processing body assembly (GO:0010603)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nuclear speck (GO:0016607)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						GTAAAGAAATCAACGTTGAAC	0.507																																																	0													118.0	92.0	101.0					16																	28844774		2197	4300	6497	SO:0001587	stop_gained	0				CCDS10639.1, CCDS10640.1, CCDS10641.1, CCDS32423.1, CCDS45451.1, CCDS58443.1	16p11	2008-02-05			ENSG00000168488	ENSG00000168488			31326	protein-coding gene	gene with protein product		607931				11784712, 14769358	Standard	NM_007245		Approved	A2lp, A2D	uc002dqy.4	Q8WWM7	OTTHUMG00000097038	ENST00000336783.4:c.1970C>G	16.37:g.28844774C>G	ENSP00000338718:p.Ser657*		A8K1R6|B9EGM2|E9PAR9|O95135|Q63ZY4|Q6NVJ8|Q6PJW6|Q8IU61|Q8IU95|Q8WWM3|Q8WWM4|Q8WWM5|Q8WWM6|Q99703	Nonsense_Mutation	SNP	pfam_LsmAD_domain,pfam_Ataxin-2_C,superfamily_LSM_dom	p.S657*	ENST00000336783.4	37	c.1970	CCDS10641.1	16	.	.	.	.	.	.	.	.	.	.	.	42	9.241986	0.99111	.	.	ENSG00000168488	ENST00000340394;ENST00000395547;ENST00000336783;ENST00000382686;ENST00000325215	.	.	.	5.6	5.6	0.85130	.	0.000000	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-9.0927	18.3894	0.90477	0.0:1.0:0.0:0.0	.	.	.	.	X	657	.	ENSP00000315650:S657X	S	+	2	0	ATXN2L	28752275	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	7.242000	0.78210	2.653000	0.90120	0.563000	0.77884	TCA	ATXN2L	-	pfam_Ataxin-2_C	ENSG00000168488		0.507	ATXN2L-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATXN2L	HGNC	protein_coding	OTTHUMT00000214139.1	-	0.00	28	0	C	NM_007245		28844774	+1	tier1	-	no_errors	ENST00000395547	ensembl	human	known	74_37	nonsense	34.09	29	15	SNP	1.000	G
AVL9	23080	genome.wustl.edu	37	7	32623449	32623449	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr7:32623449C>G	ENST00000318709.4	+	16	2098	c.1877C>G	c.(1876-1878)tCt>tGt	p.S626C	AVL9_ENST00000409301.1_Missense_Mutation_p.S608C|AVL9_ENST00000404479.1_Intron	NM_015060.1	NP_055875.1	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	626					cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						ACAGCTATGTCTTCATGGCTT	0.468																																																	0													110.0	98.0	102.0					7																	32623449		2203	4300	6503	SO:0001583	missense	0			D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000318709.4:c.1877C>G	7.37:g.32623449C>G	ENSP00000315568:p.Ser626Cys		Q92573	Missense_Mutation	SNP	pfam_ABL9/DENND6_dom	p.S626C	ENST00000318709.4	37	c.1877	CCDS34613.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.2|23.2	4.389825|4.389825	0.82902|0.82902	.|.	.|.	ENSG00000105778|ENSG00000105778	ENST00000446718|ENST00000318709;ENST00000409301;ENST00000329714	T|T;T	0.51325|0.57107	0.71|0.55;0.42	5.59|5.59	5.59|5.59	0.84812|0.84812	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.73257|0.73257	0.3564|0.3564	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.79784	.|0.993	T|T	0.75368|0.75368	-0.3342|-0.3342	7|10	0.02654|0.87932	T|D	1|0	-21.5513|-21.5513	19.1914|19.1914	0.93667|0.93667	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|626	.|Q8NBF6	.|AVL9_HUMAN	V|C	500|626;608;568	ENSP00000395134:L500V|ENSP00000315568:S626C;ENSP00000387011:S608C	ENSP00000395134:L500V|ENSP00000315568:S626C	L|S	+|+	1|2	0|0	AVL9|AVL9	32589974|32589974	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	5.939000|5.939000	0.70179|0.70179	2.648000|2.648000	0.89879|0.89879	0.561000|0.561000	0.74099|0.74099	CTT|TCT	AVL9	-	NULL	ENSG00000105778		0.468	AVL9-003	NOVEL	basic|appris_principal|CCDS	protein_coding	AVL9	HGNC	protein_coding	OTTHUMT00000328643.1	-	0.00	34	0	C	NM_015060		32623449	+1	tier1	-	no_errors	ENST00000318709	ensembl	human	novel	74_37	missense	26.19	31	11	SNP	1.000	G
B4GALNT1	2583	genome.wustl.edu	37	12	58022903	58022903	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr12:58022903C>T	ENST00000341156.4	-	7	1323	c.739G>A	c.(739-741)Gct>Act	p.A247T	B4GALNT1_ENST00000418555.2_Missense_Mutation_p.A192T|B4GALNT1_ENST00000550943.1_5'Flank|B4GALNT1_ENST00000449184.3_Intron	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	247					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			GTGAAAGCAGCCTCATGTCCC	0.537																																																	0													75.0	68.0	71.0					12																	58022903		2203	4300	6503	SO:0001583	missense	0			M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.739G>A	12.37:g.58022903C>T	ENSP00000341562:p.Ala247Thr		B4DE26|Q8N636	Missense_Mutation	SNP	pfam_Glyco_trans_2,pirsf_GM2_synthase	p.A247T	ENST00000341156.4	37	c.739	CCDS8950.1	12	.	.	.	.	.	.	.	.	.	.	.	19.44	3.827746	0.71143	.	.	ENSG00000135454	ENST00000341156;ENST00000418555	T;T	0.21932	1.98;2.04	5.34	4.39	0.52855	.	0.179518	0.48286	D	0.000196	T	0.23532	0.0569	L	0.60067	1.865	0.80722	D	1	P;P	0.40909	0.476;0.732	B;B	0.40199	0.185;0.322	T	0.02625	-1.1132	10	0.59425	D	0.04	.	12.0415	0.53456	0.1724:0.8276:0.0:0.0	.	192;247	B4DE26;Q00973	.;B4GN1_HUMAN	T	247;192	ENSP00000341562:A247T;ENSP00000401601:A192T	ENSP00000341562:A247T	A	-	1	0	B4GALNT1	56309170	0.273000	0.24181	0.097000	0.21041	0.811000	0.45836	2.370000	0.44240	2.522000	0.85027	0.655000	0.94253	GCT	B4GALNT1	-	pirsf_GM2_synthase	ENSG00000135454		0.537	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT1	HGNC	protein_coding	OTTHUMT00000407853.1	-	0.00	48	0	C	NM_001478		58022903	-1	tier1	-	no_errors	ENST00000341156	ensembl	human	known	74_37	missense	38.89	33	21	SNP	0.363	T
BIRC6	57448	genome.wustl.edu	37	2	32693120	32693120	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:32693120G>C	ENST00000421745.2	+	28	5855	c.5721G>C	c.(5719-5721)caG>caC	p.Q1907H		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1907					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CTGCAAACCAGCCAGAAATTG	0.393																																					Pancreas(94;175 1509 16028 18060 45422)												0													61.0	61.0	61.0					2																	32693120		2203	4300	6503	SO:0001583	missense	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.5721G>C	2.37:g.32693120G>C	ENSP00000393596:p.Gln1907His		Q9ULD1	Missense_Mutation	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.Q1907H	ENST00000421745.2	37	c.5721	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	G	16.55	3.153417	0.57259	.	.	ENSG00000115760	ENST00000421745	T	0.76709	-1.04	5.9	1.31	0.21738	.	0.063428	0.64402	D	0.000004	D	0.83885	0.5351	L	0.58101	1.795	0.48762	D	0.9997	D	0.61697	0.99	D	0.72982	0.979	D	0.83929	0.0305	10	0.66056	D	0.02	.	13.2389	0.59985	0.2417:0.0:0.7583:0.0	.	1907	Q9NR09	BIRC6_HUMAN	H	1907	ENSP00000393596:Q1907H	ENSP00000393596:Q1907H	Q	+	3	2	BIRC6	32546624	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.777000	0.47717	0.333000	0.23563	-0.156000	0.13503	CAG	BIRC6	-	NULL	ENSG00000115760		0.393	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	-	0.00	55	0	G	NM_016252		32693120	+1	tier1	-	no_errors	ENST00000421745	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	C
BRD1	23774	genome.wustl.edu	37	22	50217191	50217191	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr22:50217191G>A	ENST00000216267.8	-	1	1261	c.775C>T	c.(775-777)Cgc>Tgc	p.R259C	BRD1_ENST00000459821.1_5'Flank|BRD1_ENST00000457780.2_Missense_Mutation_p.R259C|BRD1_ENST00000404034.1_Missense_Mutation_p.R259C|BRD1_ENST00000542442.1_5'Flank|BRD1_ENST00000404760.1_Missense_Mutation_p.R259C|BRD1_ENST00000342989.5_5'Flank	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1	259					histone H3 acetylation (GO:0043966)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleus (GO:0005634)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		AGGCAGTGGCGGCAGAGCCAC	0.642																																																	0													22.0	23.0	23.0					22																	50217191		2200	4294	6494	SO:0001583	missense	0			AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425			1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""			10591208, 10602503	Standard	NM_014577		Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.775C>T	22.37:g.50217191G>A	ENSP00000216267:p.Arg259Cys		A6ZJA4	Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Bromodomain,pfam_PWWP_dom,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP_dom,prints_Bromodomain,pfscan_PWWP_dom,pfscan_Znf_PHD-finger,pfscan_Bromodomain	p.R259C	ENST00000216267.8	37	c.775	CCDS14080.1	22	.	.	.	.	.	.	.	.	.	.	G	16.17	3.047639	0.55110	.	.	ENSG00000100425	ENST00000216267;ENST00000404034;ENST00000404760;ENST00000457780	D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31	5.0	3.98	0.46160	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.93562	0.7945	M	0.87900	2.915	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.93803	0.7103	9	.	.	.	.	12.8237	0.57708	0.0:0.0:0.5776:0.4224	.	259;259;259	Q86X06;O95696;O95696-2	.;BRD1_HUMAN;.	C	259	ENSP00000216267:R259C;ENSP00000384076:R259C;ENSP00000385858:R259C;ENSP00000410042:R259C	.	R	-	1	0	BRD1	48603195	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	1.389000	0.34453	1.094000	0.41399	0.467000	0.42956	CGC	BRD1	-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000100425		0.642	BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BRD1	HGNC	protein_coding	OTTHUMT00000317402.1	-	0.00	27	0	G	NM_014577		50217191	-1	tier1	-	no_errors	ENST00000216267	ensembl	human	known	74_37	missense	28.00	18	7	SNP	1.000	A
BTG4	54766	genome.wustl.edu	37	11	111365944	111365947	+	Frame_Shift_Del	DEL	GTAA	GTAA	-			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	GTAA	GTAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr11:111365944_111365947delGTAA	ENST00000356018.2	-	5	802_805	c.603_606delTTAC	c.(601-606)acttacfs	p.TY201fs		NM_017589.3	NP_060059.1	Q9NY30	BTG4_HUMAN	B-cell translocation gene 4	201					cell cycle arrest (GO:0007050)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|neuron differentiation (GO:0030182)					large_intestine(2)|upper_aerodigestive_tract(1)	3		all_cancers(61;3.78e-13)|all_epithelial(67;5.29e-08)|Melanoma(852;3.15e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0204)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;1.22e-06)|BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|all cancers(92;2.18e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0509)		GCGAGCCATGGTAAGTGTTTCCCA	0.529																																																	0																																										SO:0001589	frameshift_variant	0			AJ271351	CCDS8346.1	11q23	2008-05-27				ENSG00000137707			13862	protein-coding gene	gene with protein product		605673				10995567	Standard	NM_017589		Approved	PC3B	uc001plj.3	Q9NY30		ENST00000356018.2:c.603_606delTTAC	11.37:g.111365944_111365947delGTAA	ENSP00000348300:p.Thr201fs		Q8NEH7	Frame_Shift_Del	DEL	pfam_Anti_prolifrtn,smart_Anti_prolifrtn,prints_Anti_prolifrtn	p.Y202fs	ENST00000356018.2	37	c.606_603	CCDS8346.1	11																																																																																			BTG4	-	NULL	ENSG00000137707		0.529	BTG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTG4	HGNC	protein_coding	OTTHUMT00000391177.1		0.00	47	0	GTAA			111365947	-1	tier1		no_errors	ENST00000356018	ensembl	human	known	74_37	frame_shift_del	8.57	32	3	DEL	0.000:0.000:0.000:0.000	-
GYS2	2998	genome.wustl.edu	37	12	21690117	21690117	+	Intron	SNP	A	A	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr12:21690117A>C	ENST00000261195.2	-	16	2145					NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)						carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TGTCTGCCAAAGACAAAAATA	0.398																																					Colon(149;9 1820 3690 10544 50424)												0													57.0	54.0	55.0					12																	21690117		2203	4300	6503	SO:0001627	intron_variant	0				CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.1891-8T>G	12.37:g.21690117A>C			A0AVD8	RNA	SNP	-	NULL	ENST00000261195.2	37	NULL	CCDS8690.1	12																																																																																			C12orf39	-	-	ENSG00000134548		0.398	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf39	HGNC	protein_coding	OTTHUMT00000402396.1	-	0.00	30	0	A	NM_021957		21690117	+1	tier1	-	no_errors	ENST00000537527	ensembl	human	known	74_37	rna	47.62	11	10	SNP	0.998	C
C19orf53	28974	genome.wustl.edu	37	19	13888981	13888981	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:13888981C>T	ENST00000588234.1	+	3	579	c.269C>T	c.(268-270)gCt>gTt	p.A90V	C19orf53_ENST00000593274.1_Missense_Mutation_p.A47V	NM_014047.2	NP_054766.1	Q9UNZ5	L10K_HUMAN	chromosome 19 open reading frame 53	90										breast(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	6			OV - Ovarian serous cystadenocarcinoma(19;7.7e-24)|Epithelial(5;2.53e-19)			AAAGGGGCAGCTGCCGCCACC	0.597																																																	0													45.0	42.0	43.0					19																	13888981		2203	4300	6503	SO:0001583	missense	0			AF078852	CCDS12298.1	19p13.2	2011-11-24			ENSG00000104979	ENSG00000104979			24991	protein-coding gene	gene with protein product	"""leydig cell tumor 10 kDa protein homolog"""					11042152	Standard	NM_014047		Approved	HSPC023, LYDG10	uc002mxg.3	Q9UNZ5		ENST00000588234.1:c.269C>T	19.37:g.13888981C>T	ENSP00000465432:p.Ala90Val		B2R4J9	Missense_Mutation	SNP	pfam_UPF0390	p.A90V	ENST00000588234.1	37	c.269	CCDS12298.1	19	.	.	.	.	.	.	.	.	.	.	C	9.594	1.127004	0.20959	.	.	ENSG00000104979	ENST00000221576	.	.	.	0.99	-1.56	0.08532	.	1.446920	0.04433	N	0.369631	T	0.14313	0.0346	.	.	.	0.09310	N	1	P	0.47604	0.898	B	0.28784	0.094	T	0.33033	-0.9884	8	0.36615	T	0.2	.	5.788	0.18345	0.0:0.6641:0.3359:0.0	.	90	Q9UNZ5	L10K_HUMAN	V	90	.	ENSP00000221576:A90V	A	+	2	0	C19orf53	13749981	0.001000	0.12720	0.007000	0.13788	0.052000	0.14988	0.229000	0.17833	0.300000	0.22699	0.306000	0.20318	GCT	C19orf53	-	NULL	ENSG00000104979		0.597	C19orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf53	HGNC	protein_coding	OTTHUMT00000453621.1	-	0.00	50	0	C	NM_014047		13888981	+1	tier1	-	no_errors	ENST00000588234	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.010	T
C1orf74	148304	genome.wustl.edu	37	1	209956263	209956263	+	Silent	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:209956263C>T	ENST00000294811.1	-	2	973	c.717G>A	c.(715-717)gaG>gaA	p.E239E		NM_152485.2	NP_689698.1	Q96LT6	CA074_HUMAN	chromosome 1 open reading frame 74	239										endometrium(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	15				OV - Ovarian serous cystadenocarcinoma(81;0.0328)		TGAGGTCCTTCTCCCAGGTGT	0.502																																																	0													86.0	93.0	91.0					1																	209956263		2203	4300	6503	SO:0001819	synonymous_variant	0			AK057807	CCDS1491.1	1q32.2	2008-02-05			ENSG00000162757	ENSG00000162757			26319	protein-coding gene	gene with protein product						12477932	Standard	NM_152485		Approved	FLJ25078	uc001hhp.1	Q96LT6	OTTHUMG00000036483	ENST00000294811.1:c.717G>A	1.37:g.209956263C>T				Silent	SNP	NULL	p.E239	ENST00000294811.1	37	c.717	CCDS1491.1	1																																																																																			C1orf74	-	NULL	ENSG00000162757		0.502	C1orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf74	HGNC	protein_coding	OTTHUMT00000088745.1	-	0.00	36	0	C	NM_152485		209956263	-1	tier1	-	no_errors	ENST00000294811	ensembl	human	known	74_37	silent	42.59	31	23	SNP	0.225	T
C6orf183	389422	genome.wustl.edu	37	6	109575795	109575795	+	RNA	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr6:109575795G>T	ENST00000453496.2	+	0	633							Q5T699	CF183_HUMAN	chromosome 6 open reading frame 183																		CTACCAAGAGGAATGCACCTG	0.512																																																	0																																												0					6q21	2013-11-06	2012-02-07	2012-02-07	ENSG00000243587	ENSG00000243587			21562	other	unknown							Standard			Approved	bA487F23.3		Q5T699	OTTHUMG00000015337		6.37:g.109575795G>T				RNA	SNP	-	NULL	ENST00000453496.2	37	NULL		6																																																																																			C6orf183	-	-	ENSG00000243587		0.512	C6orf183-002	KNOWN	basic	processed_transcript	C6orf183	HGNC	polymorphic_pseudogene	OTTHUMT00000257660.2	-	0.00	36	0	G			109575795	+1	tier1	-	no_errors	ENST00000453496	ensembl	human	known	74_37	rna	12.50	28	4	SNP	0.919	T
CACNA1E	777	genome.wustl.edu	37	1	181752856	181752856	+	Silent	SNP	G	G	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:181752856G>C	ENST00000367573.2	+	40	5406	c.5406G>C	c.(5404-5406)acG>acC	p.T1802T	CACNA1E_ENST00000360108.3_Silent_p.T1783T|CACNA1E_ENST00000357570.5_Silent_p.T1753T|CACNA1E_ENST00000367570.1_Silent_p.T1802T|CACNA1E_ENST00000526775.1_Silent_p.T1783T|CACNA1E_ENST00000358338.5_Silent_p.T1734T|CACNA1E_ENST00000367567.4_Silent_p.T1409T	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1802					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						AGGACATGACGGTCCACTTCA	0.448																																																	0													105.0	102.0	103.0					1																	181752856		1997	4170	6167	SO:0001819	synonymous_variant	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.5406G>C	1.37:g.181752856G>C			B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.T1802	ENST00000367573.2	37	c.5406	CCDS55664.1	1																																																																																			CACNA1E	-	NULL	ENSG00000198216		0.448	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	-	0.00	89	0	G	NM_000721		181752856	+1	tier1	-	no_errors	ENST00000367573	ensembl	human	known	74_37	silent	6.09	108	7	SNP	0.014	C
CACNG5	27091	genome.wustl.edu	37	17	64880731	64880731	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr17:64880731T>G	ENST00000533854.1	+	5	760	c.523T>G	c.(523-525)Tat>Gat	p.Y175D	CACNG5_ENST00000307139.3_Missense_Mutation_p.Y175D|CACNG5_ENST00000169565.3_Missense_Mutation_p.Y175D			Q9UF02	CCG5_HUMAN	calcium channel, voltage-dependent, gamma subunit 5	175					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ion transmembrane transporter activity (GO:0015075)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	24			BRCA - Breast invasive adenocarcinoma(6;1.61e-08)			CAACTACAAGTATGGGTGGTC	0.552																																																	0													123.0	109.0	114.0					17																	64880731		2203	4300	6503	SO:0001583	missense	0			AF148220	CCDS11665.1	17q24	2004-02-16				ENSG00000075429		"""Calcium channel subunits"""	1409	protein-coding gene	gene with protein product		606405				10613843	Standard	NM_145811		Approved		uc010wqj.2	Q9UF02		ENST00000533854.1:c.523T>G	17.37:g.64880731T>G	ENSP00000436836:p.Tyr175Asp		A8K2A6|Q547R3|Q8WXS7|Q9UHM3	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_gsu,prints_VDCC_g5su	p.Y175D	ENST00000533854.1	37	c.523	CCDS11665.1	17	.	.	.	.	.	.	.	.	.	.	T	19.76	3.887033	0.72410	.	.	ENSG00000075429	ENST00000533854;ENST00000307139;ENST00000169565	D;D;D	0.91180	-2.8;-2.8;-2.8	3.86	3.86	0.44501	.	0.000000	0.85682	D	0.000000	D	0.95326	0.8483	M	0.86651	2.83	0.58432	D	0.999996	D	0.76494	0.999	D	0.87578	0.998	D	0.95832	0.8859	10	0.87932	D	0	-26.6016	12.858	0.57897	0.0:0.0:0.0:1.0	.	175	Q9UF02	CCG5_HUMAN	D	175	ENSP00000436836:Y175D;ENSP00000303092:Y175D;ENSP00000169565:Y175D	ENSP00000169565:Y175D	Y	+	1	0	CACNG5	62311193	1.000000	0.71417	0.997000	0.53966	0.908000	0.53690	7.364000	0.79526	1.996000	0.58369	0.496000	0.49642	TAT	CACNG5	-	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_gsu	ENSG00000075429		0.552	CACNG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG5	HGNC	protein_coding	OTTHUMT00000389882.1	-	0.00	47	0	T	NM_014404, NM_145811		64880731	+1	tier1	-	no_errors	ENST00000169565	ensembl	human	known	74_37	missense	40.91	26	18	SNP	1.000	G
CADPS	8618	genome.wustl.edu	37	3	62612225	62612225	+	Intron	SNP	T	T	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr3:62612225T>A	ENST00000383710.4	-	6	1675				CADPS_ENST00000283269.9_Intron|CADPS_ENST00000490353.2_Missense_Mutation_p.E450V|CADPS_ENST00000357948.3_Intron	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator						catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		aggcagttgttctcttctgtt	0.423																																																	0																																										SO:0001627	intron_variant	0			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.1325+19171A>T	3.37:g.62612225T>A			A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	NULL	p.E450V	ENST00000383710.4	37	c.1349	CCDS46858.1	3	.	.	.	.	.	.	.	.	.	.	T	6.513	0.462800	0.12402	.	.	ENSG00000163618	ENST00000490353	T	0.44482	0.92	3.93	1.5	0.22942	.	.	.	.	.	T	0.38161	0.1030	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36986	-0.9725	6	0.87932	D	0	.	4.1422	0.10198	0.0:0.1096:0.209:0.6814	.	.	.	.	V	450	ENSP00000418736:E450V	ENSP00000418736:E450V	E	-	2	0	CADPS	62587265	0.001000	0.12720	0.001000	0.08648	0.024000	0.10985	0.348000	0.20031	0.318000	0.23185	0.533000	0.62120	GAA	CADPS	-	NULL	ENSG00000163618		0.423	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CADPS	HGNC	protein_coding	OTTHUMT00000351951.5	-	0.00	41	0	T	NM_003716, NM_183393, NM_183394		62612225	-1	tier1	-	no_errors	ENST00000490353	ensembl	human	novel	74_37	missense	30.56	24	11	SNP	0.001	A
CARTPT	9607	genome.wustl.edu	37	5	71016354	71016354	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr5:71016354G>A	ENST00000296777.4	+	3	394	c.263G>A	c.(262-264)tGt>tAt	p.C88Y	CARTPT_ENST00000513096.1_3'UTR	NM_004291.3	NP_004282.1	Q16568	CART_HUMAN	CART prepropeptide	88					activation of MAPKK activity (GO:0000186)|adult feeding behavior (GO:0008343)|cell-cell signaling (GO:0007267)|cellular glucose homeostasis (GO:0001678)|cellular response to starvation (GO:0009267)|circadian regulation of gene expression (GO:0032922)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of appetite (GO:0032099)|negative regulation of bone resorption (GO:0045779)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of osteoclast differentiation (GO:0045671)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of epinephrine secretion (GO:0032812)|positive regulation of transmission of nerve impulse (GO:0051971)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|somatostatin secretion (GO:0070253)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)|secretory granule (GO:0030141)				large_intestine(1)|lung(2)|ovary(1)	4		Lung NSC(167;0.00153)|Ovarian(174;0.0175)|Prostate(74;0.11)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;8.4e-56)	Amphetamine(DB00182)	GGTGAGCAGTGTGCAGTGAGG	0.522																																																	0													173.0	139.0	151.0					5																	71016354		2203	4300	6503	SO:0001583	missense	0			U16826	CCDS4011.1	5q13.2	2008-02-05			ENSG00000164326	ENSG00000164326			24323	protein-coding gene	gene with protein product	"""cocaine and amphetamine regulated transcript"""	602606				9590691, 8647455	Standard	NM_004291		Approved	CART	uc003kbv.2	Q16568	OTTHUMG00000131261	ENST00000296777.4:c.263G>A	5.37:g.71016354G>A	ENSP00000296777:p.Cys88Tyr		Q6FG92	Missense_Mutation	SNP	pfam_CART,superfamily_CART	p.C88Y	ENST00000296777.4	37	c.263	CCDS4011.1	5	.	.	.	.	.	.	.	.	.	.	G	18.63	3.666352	0.67814	.	.	ENSG00000164326	ENST00000296777	T	0.71698	-0.59	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.83431	0.5253	M	0.66297	2.02	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.84906	0.0845	10	0.87932	D	0	.	18.0889	0.89468	0.0:0.0:1.0:0.0	.	88	Q16568	CART_HUMAN	Y	88	ENSP00000296777:C88Y	ENSP00000296777:C88Y	C	+	2	0	CARTPT	71052110	1.000000	0.71417	0.957000	0.39632	0.540000	0.34992	9.011000	0.93618	2.560000	0.86352	0.655000	0.94253	TGT	CARTPT	-	pfam_CART,superfamily_CART	ENSG00000164326		0.522	CARTPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARTPT	HGNC	protein_coding	OTTHUMT00000254029.2	-	0.00	44	0	G	NM_004291		71016354	+1	tier1	-	no_errors	ENST00000296777	ensembl	human	known	74_37	missense	33.33	14	7	SNP	1.000	A
CCDC141	285025	genome.wustl.edu	37	2	179825996	179825996	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:179825996T>G	ENST00000409284.1	-	5	858	c.741A>C	c.(739-741)caA>caC	p.Q247H	CCDC141_ENST00000420890.2_Missense_Mutation_p.Q247H			Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	247										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TCTGCAGAACTTGACTCAATT	0.438																																																	0																																										SO:0001583	missense	0			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000409284.1:c.741A>C	2.37:g.179825996T>G	ENSP00000386503:p.Gln247His		H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Spectrin_repeat,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.Q247H	ENST00000409284.1	37	c.741		2	.	.	.	.	.	.	.	.	.	.	T	13.27	2.186146	0.38609	.	.	ENSG00000163492	ENST00000420890;ENST00000443758;ENST00000446116;ENST00000409284	T;T;T;T	0.36699	1.24;1.24;1.24;1.24	5.85	2.05	0.26809	.	.	.	.	.	T	0.31949	0.0813	M	0.65975	2.015	0.80722	D	1	B	0.21905	0.062	B	0.17433	0.018	T	0.05818	-1.0862	8	.	.	.	.	7.3418	0.26641	0.1195:0.6891:0.0:0.1914	.	247	B8ZZB3	.	H	247	ENSP00000395995:Q247H;ENSP00000390190:Q247H;ENSP00000388745:Q247H;ENSP00000386503:Q247H	.	Q	-	3	2	CCDC141	179534241	0.998000	0.40836	0.992000	0.48379	0.967000	0.64934	0.473000	0.22132	0.094000	0.17404	-0.146000	0.13790	CAA	CCDC141	-	NULL	ENSG00000163492		0.438	CCDC141-003	PUTATIVE	basic	protein_coding	CCDC141	HGNC	protein_coding	OTTHUMT00000335873.1	-	0.00	80	0	T	NM_173648		179825996	-1	tier1	-	no_errors	ENST00000420890	ensembl	human	known	74_37	missense	65.06	29	54	SNP	1.000	G
CCDC175	729665	genome.wustl.edu	37	14	60004791	60004791	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr14:60004791delC	ENST00000537690.2	-	13	1628	c.1573delG	c.(1573-1575)gcafs	p.A525fs	CCDC175_ENST00000281581.4_Frame_Shift_Del_p.A525fs	NM_001164399.1	NP_001157871.1	P0C221	CC175_HUMAN	coiled-coil domain containing 175	525																	TTAACAAATGCTTTCTCCTCT	0.318																																																	0													183.0	144.0	156.0					14																	60004791		692	1590	2282	SO:0001589	frameshift_variant	0				CCDS53898.1	14q23.1	2012-09-24	2012-09-24	2012-09-24	ENSG00000151838	ENSG00000151838			19847	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 38"""	C14orf38			Standard	NM_001164399		Approved		uc021rtw.1	P0C221		ENST00000537690.2:c.1573delG	14.37:g.60004791delC	ENSP00000453940:p.Ala525fs		G3V5J7	Frame_Shift_Del	DEL	superfamily_Prefoldin	p.A525fs	ENST00000537690.2	37	c.1573	CCDS53898.1	14																																																																																			CCDC175	-	NULL	ENSG00000151838		0.318	CCDC175-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC175	HGNC	protein_coding	OTTHUMT00000471273.1		0.00	58	0	C	NM_001164399		60004791	-1	tier1		no_errors	ENST00000281581	ensembl	human	known	74_37	frame_shift_del	12.73	48	7	DEL	0.000	-
CCDC79	283847	genome.wustl.edu	37	16	66811230	66811230	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr16:66811230delA	ENST00000558713.2	-	10	933	c.861delT	c.(859-861)tttfs	p.F287fs	CCDC79_ENST00000433154.1_Frame_Shift_Del_p.F287fs|CCDC79_ENST00000433574.1_Frame_Shift_Del_p.F287fs|CCDC79_ENST00000432602.1_Frame_Shift_Del_p.F287fs|CCDC79_ENST00000561333.1_5'UTR|CCDC79_ENST00000415744.1_Frame_Shift_Del_p.F287fs			Q8NA31	TERB1_HUMAN	coiled-coil domain containing 79	287					meiotic telomere clustering (GO:0045141)|synapsis (GO:0007129)	chromosome, telomeric region (GO:0000781)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|skin(2)	7						GTACTATCCCAAAAGTAGCTA	0.299																																																	0													95.0	74.0	81.0					16																	66811230		692	1591	2283	SO:0001589	frameshift_variant	0			AK093213		16q22.1	2012-10-03			ENSG00000249961	ENSG00000249961			26675	protein-coding gene	gene with protein product							Standard	NM_001136505		Approved	FLJ35894	uc010viv.2	Q8NA31	OTTHUMG00000133562	ENST00000558713.2:c.861delT	16.37:g.66811230delA	ENSP00000462883:p.Phe287fs		A0AUW1	Frame_Shift_Del	DEL	pfam_SANT/Myb,superfamily_ARM-type_fold,superfamily_Homeodomain-like,superfamily_Cytokine_IL1-like,smart_SANT/Myb	p.F287fs	ENST00000558713.2	37	c.861		16																																																																																			CCDC79	-	superfamily_ARM-type_fold	ENSG00000249961		0.299	CCDC79-003	KNOWN	basic|appris_principal	protein_coding	CCDC79	HGNC	protein_coding	OTTHUMT00000418864.2		0.00	48	0	A			66811230	-1	tier1		no_errors	ENST00000433154	ensembl	human	known	74_37	frame_shift_del	20.00	32	8	DEL	0.844	-
CCKBR	887	genome.wustl.edu	37	11	6281230	6281230	+	Silent	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr11:6281230G>A	ENST00000334619.2	+	1	265	c.72G>A	c.(70-72)ccG>ccA	p.P24P	CCKBR_ENST00000532715.1_Silent_p.P24P|CCKBR_ENST00000525014.1_Silent_p.P24P|CCKBR_ENST00000525462.1_Silent_p.P24P|CCKBR_ENST00000531712.1_Silent_p.P24P	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	24					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)			NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	TGTGCCGCCCGGGGGCGCCTC	0.721																																																	0													10.0	14.0	13.0					11																	6281230		2173	4261	6434	SO:0001819	synonymous_variant	0			D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.72G>A	11.37:g.6281230G>A			A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Gastrin_rcpt,prints_Cholcskin_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.P24	ENST00000334619.2	37	c.72	CCDS7761.1	11																																																																																			CCKBR	-	prints_Gastrin_rcpt	ENSG00000110148		0.721	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCKBR	HGNC	protein_coding	OTTHUMT00000257230.2	-	0.00	41	0	G	NM_176875		6281230	+1	tier1	-	no_errors	ENST00000525462	ensembl	human	known	74_37	silent	20.83	36	10	SNP	0.570	A
CD109	135228	genome.wustl.edu	37	6	74497077	74497077	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr6:74497077T>C	ENST00000287097.5	+	21	2570	c.2458T>C	c.(2458-2460)Ttt>Ctt	p.F820L	CD109_ENST00000422508.2_Missense_Mutation_p.F743L|CD109_ENST00000437994.2_Missense_Mutation_p.F820L			Q6YHK3	CD109_HUMAN	CD109 molecule	820					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						AACTGTTCTTTTTCCCATCAG	0.443																																																	0													107.0	105.0	106.0					6																	74497077		2203	4300	6503	SO:0001583	missense	0			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.2458T>C	6.37:g.74497077T>C	ENSP00000287097:p.Phe820Leu		A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.F820L	ENST00000287097.5	37	c.2458	CCDS4982.1	6	.	.	.	.	.	.	.	.	.	.	T	18.17	3.563414	0.65651	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.30448	1.53;1.77;1.54	5.45	5.45	0.79879	.	0.102871	0.64402	D	0.000002	T	0.48943	0.1528	M	0.81239	2.535	0.47214	D	0.99935	D;P;D	0.67145	0.996;0.944;0.989	P;D;P	0.65443	0.904;0.935;0.688	T	0.55560	-0.8122	10	0.66056	D	0.02	.	15.6958	0.77494	0.0:0.0:0.0:1.0	.	743;820;820	Q6YHK3-2;Q6YHK3-4;Q6YHK3	.;.;CD109_HUMAN	L	820;743;820	ENSP00000388062:F820L;ENSP00000404475:F743L;ENSP00000287097:F820L	ENSP00000287097:F820L	F	+	1	0	CD109	74553798	1.000000	0.71417	0.976000	0.42696	0.288000	0.27193	2.885000	0.48570	2.288000	0.76882	0.528000	0.53228	TTT	CD109	-	NULL	ENSG00000156535		0.443	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD109	HGNC	protein_coding	OTTHUMT00000041230.3	-	0.00	44	0	T	NM_133493		74497077	+1	tier1	-	no_errors	ENST00000287097	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.976	C
CD63	967	genome.wustl.edu	37	12	56119600	56119600	+	Silent	SNP	G	G	T	rs373117647		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr12:56119600G>T	ENST00000549117.1	-	7	1084	c.648C>A	c.(646-648)gtC>gtA	p.V216V	CD63_ENST00000548898.1_Silent_p.V123V|CD63_ENST00000257857.4_Silent_p.V216V|CD63_ENST00000552692.1_Silent_p.V216V|CD63_ENST00000546939.1_Silent_p.V134V|CD63_ENST00000552067.1_Silent_p.V123V|CD63_ENST00000552754.1_Silent_p.V193V|CD63_ENST00000420846.3_Intron|CD63_ENST00000548160.1_Silent_p.V123V|CD63_ENST00000550776.1_Silent_p.V134V	NM_001257389.1	NP_001244318.1	P08962	CD63_HUMAN	CD63 molecule	216					blood coagulation (GO:0007596)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular protein localization (GO:0034613)|endosome to melanosome transport (GO:0035646)|pigment granule maturation (GO:0048757)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of receptor internalization (GO:0002092)|protein transport (GO:0015031)|regulation of rubidium ion transport (GO:2000680)|regulation of vascular endothelial growth factor signaling pathway (GO:1900746)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|multivesicular body, internal vesicle (GO:0097487)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)				kidney(1)|large_intestine(3)|lung(2)|ovary(1)	7						CTCTTACCTCGACAAAAGCAA	0.587																																					Pancreas(123;1459 1747 6717 18841 37380)												0													54.0	50.0	51.0					12																	56119600		2203	4300	6503	SO:0001819	synonymous_variant	0			M58485	CCDS8890.1, CCDS58242.1, CCDS58243.1	12q12-q13	2013-02-14	2006-03-28					"""CD molecules"", ""Tetraspanins"""	1692	protein-coding gene	gene with protein product		155740	"""CD63 antigen (melanoma 1 antigen)"""	MLA1			Standard	NM_001780		Approved	ME491, TSPAN30	uc031qhv.1	P08962		ENST00000549117.1:c.648C>A	12.37:g.56119600G>T			F8VZE2|Q5TZP3|Q8N6Z9|Q9UCG6	Silent	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.V216	ENST00000549117.1	37	c.648	CCDS8890.1	12																																																																																			CD63	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	ENSG00000135404		0.587	CD63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD63	HGNC	protein_coding	OTTHUMT00000409234.1	-	0.00	42	0	G			56119600	-1	tier1	-	no_errors	ENST00000257857	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.904	T
CD81	975	genome.wustl.edu	37	11	2418077	2418077	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr11:2418077G>T	ENST00000263645.5	+	8	948	c.692G>T	c.(691-693)cGg>cTg	p.R231L	CD81_ENST00000381036.3_Missense_Mutation_p.R269L|CD81_ENST00000481687.1_Missense_Mutation_p.R237L|CD81_ENST00000492627.1_Missense_Mutation_p.R160L|CD81_ENST00000526072.1_Missense_Mutation_p.R160L	NM_004356.3	NP_004347.1	P60033	CD81_HUMAN	CD81 molecule	231					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of 1-phosphatidylinositol 4-kinase activity (GO:0043128)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein localization (GO:0008104)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of immune response (GO:0050776)|viral entry into host cell (GO:0046718)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	MHC class II protein complex binding (GO:0023026)			endometrium(1)|lung(3)|skin(1)	5		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000338)|LUSC - Lung squamous cell carcinoma(625;0.191)		TGTGGCATCCGGAACAGCTCC	0.667																																																	0													50.0	45.0	47.0					11																	2418077		2202	4298	6500	SO:0001583	missense	0				CCDS7734.1, CCDS73240.1	11p15.5	2014-09-17	2006-03-28		ENSG00000110651	ENSG00000110651		"""CD molecules"", ""Tetraspanins"""	1701	protein-coding gene	gene with protein product		186845	"""CD81 antigen (target of antiproliferative antibody 1)"""	TAPA1		1650385	Standard	XM_005253260		Approved	TAPA-1, TSPAN28	uc001lwf.1	P60033	OTTHUMG00000009892	ENST00000263645.5:c.692G>T	11.37:g.2418077G>T	ENSP00000263645:p.Arg231Leu		P18582|Q5U0J6	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.R231L	ENST00000263645.5	37	c.692	CCDS7734.1	11	.	.	.	.	.	.	.	.	.	.	G	25.2	4.612786	0.87258	.	.	ENSG00000110651	ENST00000263645;ENST00000492627;ENST00000527343;ENST00000381036;ENST00000526072;ENST00000481687	T;T;T;T;T;T	0.63744	0.38;0.04;0.17;0.1;0.04;-0.06	3.34	3.34	0.38264	.	0.839956	0.09455	U	0.799843	T	0.80481	0.4631	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.78211	-0.2292	10	0.59425	D	0.04	.	12.5687	0.56323	0.0:0.0:1.0:0.0	.	269;231	A6NMH8;P60033	.;CD81_HUMAN	L	231;160;220;269;160;237	ENSP00000263645:R231L;ENSP00000437242:R160L;ENSP00000433767:R220L;ENSP00000370424:R269L;ENSP00000431780:R160L;ENSP00000432033:R237L	ENSP00000263645:R231L	R	+	2	0	CD81	2374653	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.668000	0.74457	1.885000	0.54596	0.561000	0.74099	CGG	CD81	-	NULL	ENSG00000110651		0.667	CD81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD81	HGNC	protein_coding	OTTHUMT00000027357.4	-	0.00	63	0	G	NM_004356		2418077	+1	tier1	-	no_errors	ENST00000263645	ensembl	human	known	74_37	missense	55.56	24	30	SNP	1.000	T
CENPE	1062	genome.wustl.edu	37	4	104080029	104080029	+	Silent	SNP	G	G	T	rs145323573		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr4:104080029G>T	ENST00000265148.3	-	23	2705	c.2616C>A	c.(2614-2616)acC>acA	p.T872T	CENPE_ENST00000380026.3_Silent_p.T847T	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	872					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		GAAGTTCTTGGGTCTTGTAAG	0.373																																																	0													48.0	47.0	47.0					4																	104080029		2203	4298	6501	SO:0001819	synonymous_variant	0			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.2616C>A	4.37:g.104080029G>T			A6NKY9|A8K2U7|Q4LE75	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.T872	ENST00000265148.3	37	c.2616	CCDS34042.1	4																																																																																			CENPE	-	NULL	ENSG00000138778		0.373	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		-	0.00	68	0	G			104080029	-1	tier1	-	no_errors	ENST00000265148	ensembl	human	known	74_37	silent	7.69	48	4	SNP	0.040	T
CHML	1122	genome.wustl.edu	37	1	241797460	241797460	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:241797460C>A	ENST00000366553.1	-	1	1772	c.1609G>T	c.(1609-1611)Gaa>Taa	p.E537*	OPN3_ENST00000469376.1_Intron|OPN3_ENST00000331838.5_Intron|OPN3_ENST00000366554.2_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	537					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			TCGTTTATTTCTGTTTCAGTA	0.383																																																	0													70.0	68.0	69.0					1																	241797460		2202	4298	6500	SO:0001587	stop_gained	0			X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.1609G>T	1.37:g.241797460C>A	ENSP00000355511:p.Glu537*		B2RAB9|Q17RE0|Q9H1Y4	Nonsense_Mutation	SNP	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.E537*	ENST00000366553.1	37	c.1609	CCDS31073.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.126216	0.94429	.	.	ENSG00000203668	ENST00000366553	.	.	.	4.55	3.64	0.41730	.	0.841216	0.10485	U	0.669091	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-6.6236	7.0648	0.25145	0.0:0.8055:0.0:0.1945	.	.	.	.	X	537	.	ENSP00000355511:E537X	E	-	1	0	CHML	239864083	0.977000	0.34250	0.482000	0.27366	0.419000	0.31324	2.412000	0.44609	1.536000	0.49237	0.655000	0.94253	GAA	CHML	-	pirsf_Rab_geranylTrfase_A_euk	ENSG00000203668		0.383	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHML	HGNC	protein_coding	OTTHUMT00000095712.1	-	0.00	54	0	C	NM_001821		241797460	-1	tier1	-	no_errors	ENST00000366553	ensembl	human	known	74_37	nonsense	5.06	75	4	SNP	0.791	A
CLRN1	7401	genome.wustl.edu	37	3	150690475	150690475	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr3:150690475T>G	ENST00000327047.1	-	1	311	c.21A>C	c.(19-21)aaA>aaC	p.K7N	CLRN1-AS1_ENST00000465576.1_RNA|CLRN1_ENST00000328863.4_Missense_Mutation_p.K7N|CLRN1-AS1_ENST00000476886.1_RNA|RP11-166N6.2_ENST00000469268.1_RNA	NM_174878.2	NP_777367.1	P58418	CLRN1_HUMAN	clarin 1	7			K -> I (in dbSNP:rs3796241).		actin filament organization (GO:0007015)|auditory receptor cell stereocilium organization (GO:0060088)|cell motility (GO:0048870)|equilibrioception (GO:0050957)|photoreceptor cell maintenance (GO:0045494)|positive regulation of lamellipodium assembly (GO:0010592)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)	14			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			AAAAAATGATTTTCTTCTGTT	0.502																																																	0													78.0	75.0	76.0					3																	150690475		2203	4300	6503	SO:0001583	missense	0			AF388366	CCDS3153.1, CCDS35492.1, CCDS56285.1	3q25.1	2014-09-17	2006-11-23	2006-11-23	ENSG00000163646	ENSG00000163646			12605	protein-coding gene	gene with protein product		606397	"""Usher syndrome 3A"""	USH3, USH3A, RP61		7711740, 8975700	Standard	NM_052995		Approved		uc021xfr.1	P58418	OTTHUMG00000140368	ENST00000327047.1:c.21A>C	3.37:g.150690475T>G	ENSP00000322280:p.Lys7Asn		D3DNJ3|E1ACU9|Q8N6A9	Missense_Mutation	SNP	NULL	p.K7N	ENST00000327047.1	37	c.21	CCDS3153.1	3	.	.	.	.	.	.	.	.	.	.	T	16.60	3.169185	0.57584	.	.	ENSG00000163646	ENST00000327047;ENST00000328863	T;T	0.78924	-1.22;-1.22	5.55	0.106	0.14540	.	0.100721	0.64402	D	0.000002	T	0.73179	0.3554	M	0.71581	2.175	0.43292	D	0.995273	P	0.44734	0.842	B	0.40165	0.321	T	0.72947	-0.4137	10	0.54805	T	0.06	1.6611	11.4763	0.50300	0.0:0.3562:0.0:0.6438	.	7	P58418	CLRN1_HUMAN	N	7	ENSP00000322280:K7N;ENSP00000329158:K7N	ENSP00000322280:K7N	K	-	3	2	CLRN1	152173165	0.463000	0.25799	0.999000	0.59377	0.994000	0.84299	0.526000	0.22971	0.096000	0.17463	0.533000	0.62120	AAA	CLRN1	-	NULL	ENSG00000163646		0.502	CLRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLRN1	HGNC	protein_coding	OTTHUMT00000277060.1	-	0.00	27	0	T			150690475	-1	tier1	-	no_errors	ENST00000328863	ensembl	human	known	74_37	missense	19.23	21	5	SNP	0.946	G
CNTF	1270	genome.wustl.edu	37	11	58391895	58391895	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr11:58391895G>A	ENST00000361987.4	+	2	583	c.503G>A	c.(502-504)tGg>tAg	p.W168*	ZFP91-CNTF_ENST00000389919.4_3'UTR	NM_000614.3	NP_000605.1	P26441	CNTF_HUMAN	ciliary neurotrophic factor	168					ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|growth (GO:0040007)|muscle organ morphogenesis (GO:0048644)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of photoreceptor cell differentiation (GO:0046533)|neuron development (GO:0048666)|positive regulation of cell proliferation (GO:0008284)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of retinal cell programmed cell death (GO:0046668)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor activity (GO:0008083)|interleukin-6 receptor binding (GO:0005138)			NS(1)|breast(1)|kidney(2)|large_intestine(4)|lung(1)|ovary(1)	10		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				CTTTCACAGTGGACAGTAAGG	0.483																																																	0													109.0	109.0	109.0					11																	58391895		2201	4295	6496	SO:0001587	stop_gained	0			BC068030	CCDS31554.1	11q12	2011-07-21			ENSG00000242689	ENSG00000242689			2169	protein-coding gene	gene with protein product		118945				1840538, 1714745	Standard	NM_000614		Approved	HCNTF	uc001nna.4	P26441	OTTHUMG00000137476	ENST00000361987.4:c.503G>A	11.37:g.58391895G>A	ENSP00000355370:p.Trp168*		B2RAB2	Nonsense_Mutation	SNP	pfam_Ciliary_neurotrophic_fac_CNTF,superfamily_4_helix_cytokine-like_core	p.W168*	ENST00000361987.4	37	c.503	CCDS31554.1	11	.	.	.	.	.	.	.	.	.	.	G	23.0	4.361238	0.82353	.	.	ENSG00000242689	ENST00000361987	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-4.8411	16.2686	0.82603	0.0:0.0:1.0:0.0	.	.	.	.	X	168	.	.	W	+	2	0	CNTF	58148471	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.201000	0.72124	2.575000	0.86900	0.650000	0.86243	TGG	CNTF	-	pfam_Ciliary_neurotrophic_fac_CNTF,superfamily_4_helix_cytokine-like_core	ENSG00000242689		0.483	CNTF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTF	HGNC	protein_coding	OTTHUMT00000268673.1	-	0.00	28	0	G	NM_000614		58391895	+1	tier1	-	no_errors	ENST00000361987	ensembl	human	known	74_37	nonsense	12.77	40	6	SNP	1.000	A
CNTN5	53942	genome.wustl.edu	37	11	99931943	99931943	+	Splice_Site	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr11:99931943G>T	ENST00000524871.1	+	10	1270		c.e10-1		CNTN5_ENST00000279463.3_Splice_Site|CNTN5_ENST00000418526.2_Splice_Site|CNTN5_ENST00000528682.1_Splice_Site|CNTN5_ENST00000527185.1_Splice_Site	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5						cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		CCCTATCGTAGCCCCGTTCCA	0.408																																																	0													168.0	155.0	159.0					11																	99931943		1908	4138	6046	SO:0001630	splice_region_variant	0			AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.981-1G>T	11.37:g.99931943G>T			A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Splice_Site	SNP	-	e8-1	ENST00000524871.1	37	c.981-1	CCDS53696.1	11	.	.	.	.	.	.	.	.	.	.	G	18.33	3.599801	0.66332	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3608	0.90374	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CNTN5	99437153	1.000000	0.71417	0.997000	0.53966	0.564000	0.35744	9.813000	0.99286	2.649000	0.89929	0.585000	0.79938	.	CNTN5	-	-	ENSG00000149972		0.408	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNTN5	HGNC	protein_coding	OTTHUMT00000395148.2	-	0.00	60	0	G	NM_014361	Intron	99931943	+1	tier1	-	no_errors	ENST00000279463	ensembl	human	known	74_37	splice_site	15.79	32	6	SNP	1.000	T
COL1A2	1278	genome.wustl.edu	37	7	94054949	94054949	+	Missense_Mutation	SNP	G	G	T	rs72659309		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr7:94054949G>T	ENST00000297268.6	+	43	3280	c.2809G>T	c.(2809-2811)Ggt>Tgt	p.G937C		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	937					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)	p.G937S(1)	COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TGGTCCCCCAGGTCGCGATGG	0.478										HNSCC(75;0.22)																																							1	Substitution - Missense(1)	ovary(1)	GRCh37	CM070783	COL1A2	M	rs72659309						105.0	95.0	98.0					7																	94054949		2203	4300	6503	SO:0001583	missense	0			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2809G>T	7.37:g.94054949G>T	ENSP00000297268:p.Gly937Cys		P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fib_collagen_C	p.G937C	ENST00000297268.6	37	c.2809	CCDS34682.1	7	.	.	.	.	.	.	.	.	.	.	G	22.1	4.246330	0.80024	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.99186	-5.53	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.99606	0.9857	H	0.97340	3.985	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97849	1.0273	10	0.87932	D	0	.	19.5787	0.95455	0.0:0.0:1.0:0.0	.	937	P08123	CO1A2_HUMAN	C	937;938	ENSP00000297268:G937C	ENSP00000297268:G937C	G	+	1	0	COL1A2	93892885	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.657000	0.98554	2.941000	0.99782	0.655000	0.94253	GGT	COL1A2	-	NULL	ENSG00000164692		0.478	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A2	HGNC	protein_coding	OTTHUMT00000309045.2	-	0.00	50	0	G	NM_000089		94054949	+1	tier1	rs72659309	no_errors	ENST00000297268	ensembl	human	known	74_37	missense	22.92	37	11	SNP	1.000	T
COL3A1	1281	genome.wustl.edu	37	2	189859455	189859456	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:189859455_189859456GG>TT	ENST00000304636.3	+	20	1523_1524	c.1353_1354GG>TT	c.(1351-1356)gaGGct>gaTTct	p.451_452EA>DS	COL3A1_ENST00000317840.5_Missense_Mutation_p.451_452EA>DS	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	451	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TTCAGGGTGAGGCTGGTATTCC	0.396																																																	0																																										SO:0001583	missense	0			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	Exception_encountered	2.37:g.189859455_189859456delinsTT	ENSP00000304408:p.E451_A452delinsDS		D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.E451D|p.A452S	ENST00000304636.3	37	c.1353|c.1354	CCDS2297.1	2																																																																																			COL3A1	-	NULL	ENSG00000168542		0.396	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL3A1	HGNC	protein_coding	OTTHUMT00000255899.3	-	0.00	26	0	G	NM_000090		189859455|189859456	+1	tier1	-	no_errors	ENST00000304636	ensembl	human	known	74_37	missense	62.86	13	22	SNP	1.000	T
COPS5	10987	genome.wustl.edu	37	8	67971526	67971526	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr8:67971526C>T	ENST00000357849.4	-	2	618	c.298G>A	c.(298-300)Gtg>Atg	p.V100M	COPS5_ENST00000517736.1_Missense_Mutation_p.V36M|AC109335.1_ENST00000578628.1_RNA|COPS5_ENST00000519963.1_5'Flank|PPP1R42_ENST00000517834.1_5'Flank	NM_006837.2	NP_006828.2	Q92905	CSN5_HUMAN	COP9 signalosome subunit 5	100	MPN.				cullin deneddylation (GO:0010388)|exosomal secretion (GO:1990182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein deneddylation (GO:0000338)|protein deubiquitination (GO:0016579)|regulation of cell cycle (GO:0051726)|regulation of JNK cascade (GO:0046328)|transcription from RNA polymerase II promoter (GO:0006366)|translation (GO:0006412)|translational initiation (GO:0006413)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|eukaryotic translation initiation factor 3 complex (GO:0005852)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|transcription coactivator activity (GO:0003713)|translation initiation factor activity (GO:0003743)|ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|skin(3)	14	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)			GTGCCCTCCACAGGCAAAGCA	0.443																																																	0													162.0	128.0	140.0					8																	67971526		2203	4300	6503	SO:0001583	missense	0			U65928	CCDS6198.1	8q13.1	2013-03-14	2013-03-14		ENSG00000121022	ENSG00000121022			2240	protein-coding gene	gene with protein product		604850	"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 5"", ""COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)"""			8837781, 9341143	Standard	NM_006837		Approved	JAB1, SGN5, MOV-34, CSN5	uc003xxe.3	Q92905	OTTHUMG00000164563	ENST00000357849.4:c.298G>A	8.37:g.67971526C>T	ENSP00000350512:p.Val100Met		O15386|Q6AW95|Q86WQ4|Q9BQ17	Missense_Mutation	SNP	pfam_JAB_MPN_dom,smart_JAB_MPN_dom	p.V100M	ENST00000357849.4	37	c.298	CCDS6198.1	8	.	.	.	.	.	.	.	.	.	.	C	32	5.146288	0.94603	.	.	ENSG00000121022	ENST00000357849;ENST00000517736;ENST00000518747	T;T;T	0.62941	-0.01;-0.01;-0.01	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.87378	0.6162	H	0.97415	4	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.91559	0.5263	10	0.87932	D	0	-0.0265	19.4952	0.95069	0.0:1.0:0.0:0.0	.	69;36;100	Q59GH5;E5RHH5;Q92905	.;.;CSN5_HUMAN	M	100;36;36	ENSP00000350512:V100M;ENSP00000429774:V36M;ENSP00000428586:V36M	ENSP00000350512:V100M	V	-	1	0	COPS5	68134080	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.771000	0.85420	2.675000	0.91044	0.655000	0.94253	GTG	COPS5	-	pfam_JAB_MPN_dom,smart_JAB_MPN_dom	ENSG00000121022		0.443	COPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS5	HGNC	protein_coding	OTTHUMT00000379245.2	-	0.00	43	0	C			67971526	-1	tier1	-	no_errors	ENST00000357849	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	T
CPEB2	132864	genome.wustl.edu	37	4	15063712	15063712	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr4:15063712C>T	ENST00000507071.1	+	10	1457	c.1370C>T	c.(1369-1371)gCt>gTt	p.A457V	CPEB2_ENST00000442003.2_Missense_Mutation_p.A875V|CPEB2_ENST00000382395.3_Missense_Mutation_p.A435V|CPEB2_ENST00000538197.1_Missense_Mutation_p.A902V|CPEB2_ENST00000345451.3_Missense_Mutation_p.A427V|CPEB2_ENST00000382401.3_Missense_Mutation_p.A430V|RP11-665G4.1_ENST00000502344.1_RNA|RP11-665G4.1_ENST00000513384.1_RNA|CPEB2_ENST00000541112.1_Missense_Mutation_p.A894V|CPEB2_ENST00000259997.5_Missense_Mutation_p.A465V			Q7Z5Q1	CPEB2_HUMAN	cytoplasmic polyadenylation element binding protein 2	457	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular response to arsenic-containing substance (GO:0071243)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to oxidative stress (GO:0034599)|negative regulation of cytoplasmic translation (GO:2000766)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of GTPase activity (GO:0034260)	cytoplasm (GO:0005737)|messenger ribonucleoprotein complex (GO:1990124)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|ribosome binding (GO:0043022)|translation repressor activity, nucleic acid binding (GO:0000900)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|skin(3)	14						GTGGAACTTGCTATGATCATG	0.378																																																	0													134.0	130.0	132.0					4																	15063712		2203	4300	6503	SO:0001583	missense	0			AY247744	CCDS56325.1, CCDS56326.1	4p15.33	2013-02-12			ENSG00000137449	ENSG00000137449		"""RNA binding motif (RRM) containing"""	21745	protein-coding gene	gene with protein product		610605				12672660	Standard	NM_182485		Approved		uc003gnk.2	Q7Z5Q1	OTTHUMG00000090669	ENST00000507071.1:c.1370C>T	4.37:g.15063712C>T	ENSP00000424084:p.Ala457Val		E7EPM3|F5H160|Q3B8N6|Q3MI89|Q3MI90|Q3MI92|Q7Z5Q0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A902V	ENST00000507071.1	37	c.2705		4	.	.	.	.	.	.	.	.	.	.	C	28.9	4.963710	0.92791	.	.	ENSG00000137449	ENST00000538197;ENST00000541112;ENST00000442003;ENST00000507071;ENST00000345451;ENST00000382395;ENST00000382401;ENST00000259997;ENST00000382391;ENST00000509684	T;T;T;T;T;T;T;T;T	0.24538	1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85	4.99	4.99	0.66335	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.85682	D	0.000000	T	0.54549	0.1865	M	0.78801	2.425	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;0.999;0.999;1.0;1.0;0.999	D;D;D;D;D;D	0.91635	0.987;0.997;0.987;0.996;0.999;0.986	T	0.60964	-0.7158	10	0.87932	D	0	-15.5662	18.269	0.90062	0.0:1.0:0.0:0.0	.	430;435;875;902;427;457	Q7Z5Q1-4;Q7Z5Q1-6;E7EPM3;F5H160;Q7Z5Q1-5;Q7Z5Q1	.;.;.;.;.;CPEB2_HUMAN	V	902;894;875;457;427;435;430;465;444;110	ENSP00000443985:A902V;ENSP00000437884:A894V;ENSP00000414270:A875V;ENSP00000424084:A457V;ENSP00000334058:A427V;ENSP00000371832:A435V;ENSP00000371838:A430V;ENSP00000259997:A465V;ENSP00000423890:A110V	ENSP00000259997:A465V	A	+	2	0	CPEB2	14672810	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.818000	0.86416	2.304000	0.77564	0.655000	0.94253	GCT	CPEB2	-	smart_RRM_dom,pfscan_RRM_dom	ENSG00000137449		0.378	CPEB2-001	KNOWN	basic|appris_candidate	protein_coding	CPEB2	HGNC	protein_coding	OTTHUMT00000207349.2	-	0.00	55	0	C	XM_059607		15063712	+1	tier1	-	no_errors	ENST00000538197	ensembl	human	known	74_37	missense	35.00	39	21	SNP	1.000	T
CPS1	1373	genome.wustl.edu	37	2	211521345	211521345	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:211521345G>C	ENST00000233072.5	+	30	3851	c.3655G>C	c.(3655-3657)Gcc>Ccc	p.A1219P	CPS1_ENST00000430249.2_Missense_Mutation_p.A1225P|CPS1_ENST00000451903.2_Missense_Mutation_p.A768P	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1219	ATP-grasp 2.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	CAGCCAAGGGGCCATTGAAAA	0.418																																																	0													64.0	64.0	64.0					2																	211521345		2203	4300	6503	SO:0001583	missense	0			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.3655G>C	2.37:g.211521345G>C	ENSP00000233072:p.Ala1219Pro		B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_CarbamoylP_synth_lsu_oligo,pfam_GATASE,pfam_CarbamoylP_synth_lsu_N,pfam_MGS-like_dom,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_dom,superfamily_MGS-like_dom,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu	p.A1225P	ENST00000233072.5	37	c.3673	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	G	23.0	4.357977	0.82243	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.97186	-4.28;-4.28;-4.28	6.08	6.08	0.98989	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);	0.000000	0.85682	D	0.000000	D	0.97396	0.9148	M	0.79475	2.455	0.80722	D	1	P;B	0.40107	0.703;0.395	B;B	0.43990	0.438;0.438	D	0.97470	1.0040	10	0.87932	D	0	-3.8303	20.6634	0.99662	0.0:0.0:1.0:0.0	.	1229;1219	Q59HF8;P31327	.;CPSM_HUMAN	P	1225;1227;1219;768	ENSP00000402608:A1225P;ENSP00000233072:A1219P;ENSP00000406136:A768P	ENSP00000233072:A1219P	A	+	1	0	CPS1	211229590	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.281000	0.95811	2.894000	0.99253	0.655000	0.94253	GCC	CPS1	-	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,pfscan_ATP-grasp,tigrfam_CarbamoylP_synth_lsu	ENSG00000021826		0.418	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	HGNC	protein_coding	OTTHUMT00000256569.5	-	0.00	70	0	G			211521345	+1	tier1	-	no_errors	ENST00000430249	ensembl	human	known	74_37	missense	23.81	64	20	SNP	1.000	C
CPXM2	119587	genome.wustl.edu	37	10	125516830	125516830	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr10:125516830C>T	ENST00000241305.3	-	12	1970	c.1816G>A	c.(1816-1818)Gaa>Aaa	p.E606K	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	606					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		ATGGACAGTTCGAAGCAGTTT	0.493																																																	0																																										SO:0001583	missense	0			AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.1816G>A	10.37:g.125516830C>T	ENSP00000241305:p.Glu606Lys		B4E3Q2	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.E606K	ENST00000241305.3	37	c.1816	CCDS7637.1	10	.	.	.	.	.	.	.	.	.	.	C	29.0	4.965252	0.92855	.	.	ENSG00000121898	ENST00000368854;ENST00000241305;ENST00000540123;ENST00000418782	T	0.11930	2.73	4.71	3.81	0.43845	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.50343	0.1610	H	0.97131	3.945	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	T	0.67201	-0.5730	10	0.87932	D	0	-14.8374	12.9185	0.58218	0.0:0.9219:0.0:0.0781	.	606	Q8N436	CPXM2_HUMAN	K	102;606;439;581	ENSP00000241305:E606K	ENSP00000241305:E606K	E	-	1	0	CPXM2	125506820	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	7.515000	0.81761	1.204000	0.43247	-0.142000	0.14014	GAA	CPXM2	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000121898		0.493	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM2	HGNC	protein_coding	OTTHUMT00000050853.1	-	0.00	38	0	C	NM_198148		125516830	-1	tier1	-	no_errors	ENST00000241305	ensembl	human	known	74_37	missense	15.38	22	4	SNP	1.000	T
CROCC	9696	genome.wustl.edu	37	1	17256962	17256962	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:17256962A>G	ENST00000375541.5	+	7	791	c.722A>G	c.(721-723)gAa>gGa	p.E241G	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		ATGCTCCGAGAACAGCTGGAC	0.652																																																	0													42.0	37.0	39.0					1																	17256962		2199	4287	6486	SO:0001583	missense	0			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.722A>G	1.37:g.17256962A>G	ENSP00000364691:p.Glu241Gly			Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_t-SNARE	p.E241G	ENST00000375541.5	37	c.722	CCDS30616.1	1	.	.	.	.	.	.	.	.	.	.	A	19.43	3.826291	0.71143	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.16597	2.33	5.21	5.21	0.72293	.	.	.	.	.	T	0.39937	0.1097	M	0.75615	2.305	0.54753	D	0.99998	P;D	0.69078	0.89;0.997	P;D	0.65443	0.817;0.935	T	0.23619	-1.0183	9	0.49607	T	0.09	.	13.8857	0.63706	1.0:0.0:0.0:0.0	.	104;241	A1L0S8;Q5TZA2	.;CROCC_HUMAN	G	241;122	ENSP00000364691:E241G	ENSP00000364691:E241G	E	+	2	0	CROCC	17129549	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.895000	0.92512	1.959000	0.56917	0.454000	0.30748	GAA	CROCC	-	NULL	ENSG00000058453		0.652	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	HGNC	protein_coding	OTTHUMT00000006249.2	-	0.00	110	0	A	NM_014675		17256962	+1	tier1	-	no_errors	ENST00000375541	ensembl	human	known	74_37	missense	15.23	127	23	SNP	1.000	G
CSE1L	1434	genome.wustl.edu	37	20	47701869	47701869	+	Missense_Mutation	SNP	C	C	G	rs35437801		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr20:47701869C>G	ENST00000262982.2	+	16	1792	c.1669C>G	c.(1669-1671)Ctt>Gtt	p.L557V	CSE1L_ENST00000396192.3_Missense_Mutation_p.L501V|CSE1L_ENST00000542325.1_Missense_Mutation_p.L340V	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	557					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			GCTAACAAACCTTTTCAAAGC	0.413																																																	0													111.0	104.0	106.0					20																	47701869		2203	4300	6503	SO:0001583	missense	0			U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.1669C>G	20.37:g.47701869C>G	ENSP00000262982:p.Leu557Val		A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Missense_Mutation	SNP	pfam_CAS_CSE1_C,pfam_Cse1,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.L557V	ENST00000262982.2	37	c.1669	CCDS13412.1	20	.	.	.	.	.	.	.	.	.	.	C	19.45	3.830626	0.71258	.	.	ENSG00000124207	ENST00000417408;ENST00000262982;ENST00000542325;ENST00000396192	T;T;T	0.77098	-1.07;-1.07;-1.07	5.56	4.62	0.57501	Armadillo-like helical (1);Armadillo-type fold (1);CAS/CSE, C-terminal (1);	0.057058	0.64402	D	0.000001	D	0.86339	0.5909	M	0.76002	2.32	0.80722	D	1	D;D;D;D;D	0.76494	0.994;0.999;0.996;0.995;0.999	P;D;D;P;D	0.66497	0.821;0.944;0.941;0.858;0.944	D	0.87570	0.2477	10	0.56958	D	0.05	-23.1316	14.492	0.67657	0.0:0.9295:0.0:0.0705	.	246;340;501;501;557	F5GX54;B4DUC5;A3RLL6;F8W904;P55060	.;.;.;.;XPO2_HUMAN	V	155;557;340;501	ENSP00000262982:L557V;ENSP00000446477:L340V;ENSP00000379495:L501V	ENSP00000262982:L557V	L	+	1	0	CSE1L	47135276	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.670000	0.54569	1.488000	0.48433	0.655000	0.94253	CTT	CSE1L	-	pfam_CAS_CSE1_C,superfamily_ARM-type_fold	ENSG00000124207		0.413	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSE1L	HGNC	protein_coding	OTTHUMT00000080345.2	-	0.00	34	0	C	NM_001316		47701869	+1	tier1	-	no_errors	ENST00000262982	ensembl	human	known	74_37	missense	14.71	29	5	SNP	1.000	G
C1orf94	84970	genome.wustl.edu	37	1	34631391	34631391	+	5'Flank	DEL	G	G	-			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:34631391delG	ENST00000373374.3	+	0	0				CSMD2_ENST00000373381.4_5'Flank	NM_032884.3	NP_116273.2	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94											central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				ATCTAGGGCCGGGGGCGATGC	0.557																																																	0													158.0	122.0	134.0					1																	34631391		2203	4300	6503	SO:0001631	upstream_gene_variant	0			AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012		1.37:g.34631391delG	Exception_encountered		B3KVT1|D3DPR3|E9PJ76|Q96IC8	Frame_Shift_Del	DEL	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.G9fs	ENST00000373374.3	37	c.24	CCDS381.1	1																																																																																			CSMD2	-	NULL	ENSG00000121904		0.557	C1orf94-001	KNOWN	basic|CCDS	protein_coding	CSMD2	HGNC	protein_coding	OTTHUMT00000011463.2		0.00	56	0	G	NM_032884		34631391	-1	tier1		no_errors	ENST00000241312	ensembl	human	known	74_37	frame_shift_del	5.00	38	2	DEL	0.021	-
CST2	1470	genome.wustl.edu	37	20	23804666	23804666	+	Silent	SNP	T	T	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr20:23804666T>C	ENST00000304725.2	-	3	487	c.417A>G	c.(415-417)caA>caG	p.Q139Q		NM_001322.2	NP_001313.1	P09228	CYTT_HUMAN	cystatin SA	139					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|cervix(1)|large_intestine(1)|liver(1)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	10						CCTAGGCTTCTTGACACCTGG	0.567																																					Pancreas(193;496 3017 22514 29918)												0													125.0	104.0	111.0					20																	23804666		2203	4300	6503	SO:0001819	synonymous_variant	0			M19671	CCDS13161.1	20p11.2	2007-11-29			ENSG00000170369	ENSG00000170369			2474	protein-coding gene	gene with protein product	"""cystatin 2"""	123856					Standard	NM_001322		Approved		uc002wtq.1	P09228	OTTHUMG00000032086	ENST00000304725.2:c.417A>G	20.37:g.23804666T>C			Q9UCQ7	Silent	SNP	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.Q139	ENST00000304725.2	37	c.417	CCDS13161.1	20																																																																																			CST2	-	smart_Prot_inh_cystat	ENSG00000170369		0.567	CST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CST2	HGNC	protein_coding	OTTHUMT00000078352.2	-	0.00	75	0	T			23804666	-1	tier1	-	no_errors	ENST00000304725	ensembl	human	known	74_37	silent	5.36	106	6	SNP	0.000	C
DCTN4	51164	genome.wustl.edu	37	5	150095148	150095148	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr5:150095148T>C	ENST00000447998.2	-	12	1263	c.1148A>G	c.(1147-1149)cAa>cGa	p.Q383R	DCTN4_ENST00000446090.2_Missense_Mutation_p.Q390R|DCTN4_ENST00000424236.1_Missense_Mutation_p.Q326R	NM_016221.3	NP_057305.1	Q9UJW0	DCTN4_HUMAN	dynactin 4 (p62)	383					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	10		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGAAAGTCTTGAGGTTCTGC	0.483																																																	0													150.0	122.0	131.0					5																	150095148		2203	4300	6503	SO:0001583	missense	0			AF195120	CCDS4310.1, CCDS47310.1, CCDS47311.1	5q31-q32	2008-05-23			ENSG00000132912	ENSG00000132912			15518	protein-coding gene	gene with protein product		614758				10843801, 16554302	Standard	NM_016221		Approved		uc010jhi.3	Q9UJW0	OTTHUMG00000130079	ENST00000447998.2:c.1148A>G	5.37:g.150095148T>C	ENSP00000416968:p.Gln383Arg		B3KWW0|D3DQH0|E5RGT5|Q8TAN8	Missense_Mutation	SNP	pfam_Dynactin_p62	p.Q390R	ENST00000447998.2	37	c.1169	CCDS4310.1	5	.	.	.	.	.	.	.	.	.	.	T	13.70	2.314200	0.40996	.	.	ENSG00000132912	ENST00000447998;ENST00000424236;ENST00000446090	T;T;T	0.22336	1.96;1.96;1.96	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.20047	0.0482	L	0.39020	1.185	0.80722	D	1	B;P	0.35468	0.447;0.503	B;B	0.37833	0.168;0.259	T	0.04178	-1.0971	10	0.15499	T	0.54	-11.4695	16.5602	0.84551	0.0:0.0:0.0:1.0	.	390;383	Q9UJW0-3;Q9UJW0	.;DCTN4_HUMAN	R	383;326;390	ENSP00000416968:Q383R;ENSP00000411251:Q326R;ENSP00000414906:Q390R	ENSP00000411251:Q326R	Q	-	2	0	DCTN4	150075341	1.000000	0.71417	0.999000	0.59377	0.094000	0.18550	5.721000	0.68477	2.367000	0.80283	0.528000	0.53228	CAA	DCTN4	-	pfam_Dynactin_p62	ENSG00000132912		0.483	DCTN4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCTN4	HGNC	protein_coding	OTTHUMT00000252372.1	-	0.00	40	0	T			150095148	-1	tier1	-	no_errors	ENST00000446090	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	C
DCUN1D4	23142	genome.wustl.edu	37	4	52777318	52777318	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr4:52777318C>T	ENST00000334635.5	+	9	878	c.698C>T	c.(697-699)cCa>cTa	p.P233L	DCUN1D4_ENST00000451288.2_Missense_Mutation_p.P277L|DCUN1D4_ENST00000381437.4_Missense_Mutation_p.P173L|DCUN1D4_ENST00000381441.3_Intron	NM_001040402.1	NP_001035492.1	Q92564	DCNL4_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 4	233	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.					nucleus (GO:0005634)				endometrium(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	9			GBM - Glioblastoma multiforme(4;1.93e-11)|LUSC - Lung squamous cell carcinoma(32;0.00654)			CCCCTTTTTCCAGTTTTTCAC	0.373																																																	0													114.0	111.0	112.0					4																	52777318		2203	4300	6503	SO:0001583	missense	0			D87466	CCDS3487.2, CCDS33982.1, CCDS75123.1	4q11	2013-06-10	2013-06-10		ENSG00000109184	ENSG00000109184			28998	protein-coding gene	gene with protein product		612977	"""DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)"""			15988528	Standard	XM_005265731		Approved	KIAA0276	uc003gze.3	Q92564	OTTHUMG00000128700	ENST00000334635.5:c.698C>T	4.37:g.52777318C>T	ENSP00000334625:p.Pro233Leu		B4DH25|Q7Z3F3|Q7Z6B8	Missense_Mutation	SNP	pfam_PONY_dom	p.P277L	ENST00000334635.5	37	c.830	CCDS33982.1	4	.	.	.	.	.	.	.	.	.	.	C	31	5.100932	0.94245	.	.	ENSG00000109184	ENST00000334635;ENST00000381437;ENST00000451288;ENST00000510808	T;T;T	0.66815	-0.23;-0.23;-0.23	5.97	5.97	0.96955	Domain of unknown function DUF298 (2);	0.000000	0.85682	D	0.000000	T	0.80681	0.4669	M	0.77103	2.36	0.80722	D	1	P;P	0.51240	0.943;0.891	P;P	0.57009	0.811;0.628	T	0.81417	-0.0942	10	0.66056	D	0.02	-14.0658	19.4269	0.94746	0.0:1.0:0.0:0.0	.	277;233	B4DH25;Q92564	.;DCNL4_HUMAN	L	233;173;277;43	ENSP00000334625:P233L;ENSP00000370846:P173L;ENSP00000389900:P277L	ENSP00000334625:P233L	P	+	2	0	DCUN1D4	52472075	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.836000	0.97738	0.655000	0.94253	CCA	DCUN1D4	-	pfam_PONY_dom	ENSG00000109184		0.373	DCUN1D4-001	KNOWN	basic|CCDS	protein_coding	DCUN1D4	HGNC	protein_coding	OTTHUMT00000250599.2	-	0.00	99	0	C	NM_015115		52777318	+1	tier1	-	no_errors	ENST00000451288	ensembl	human	known	74_37	missense	29.73	52	22	SNP	1.000	T
DDX42	11325	genome.wustl.edu	37	17	61887894	61887894	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr17:61887894C>G	ENST00000578681.1	+	13	1875	c.1274C>G	c.(1273-1275)gCa>gGa	p.A425G	DDX42_ENST00000583590.1_Missense_Mutation_p.A425G|DDX42_ENST00000359353.5_Missense_Mutation_p.A306G|DDX42_ENST00000389924.2_Missense_Mutation_p.A425G|DDX42_ENST00000457800.2_Missense_Mutation_p.A425G	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42	425	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						CGATCCATAGCAAGTCATGTT	0.353																																																	0													115.0	107.0	110.0					17																	61887894		2203	4300	6503	SO:0001583	missense	0			BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3		ENST00000578681.1:c.1274C>G	17.37:g.61887894C>G	ENSP00000464050:p.Ala425Gly		A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.A425G	ENST00000578681.1	37	c.1274	CCDS32704.1	17	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768336	0.90020	.	.	ENSG00000198231	ENST00000389924;ENST00000457800;ENST00000359353	T;T	0.15487	2.42;2.42	5.79	5.79	0.91817	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.35799	0.0944	L	0.48935	1.535	0.80722	D	1	D	0.60160	0.987	D	0.63192	0.912	T	0.01452	-1.1351	10	0.72032	D	0.01	-12.4862	19.0293	0.92948	0.0:1.0:0.0:0.0	.	425	Q86XP3	DDX42_HUMAN	G	425;425;161	ENSP00000374574:A425G;ENSP00000390121:A425G	ENSP00000352308:A161G	A	+	2	0	DDX42	59241626	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.702000	0.84576	2.739000	0.93911	0.655000	0.94253	GCA	DDX42	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000198231		0.353	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX42	HGNC	protein_coding	OTTHUMT00000444368.1	-	0.00	46	0	C	NM_007372		61887894	+1	tier1	-	no_errors	ENST00000389924	ensembl	human	known	74_37	missense	37.21	27	16	SNP	1.000	G
DHRS4L1	728635	genome.wustl.edu	37	14	24507011	24507011	+	RNA	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr14:24507011G>T	ENST00000558293.1	+	0	176					NR_102693.1																						GTAGTCAGCCGCCGGAAGCAG	0.642																																																	0													34.0	35.0	34.0					14																	24507011		2203	4300	6503			0																															14.37:g.24507011G>T				RNA	SNP	-	NULL	ENST00000558293.1	37	NULL		14	.	.	.	.	.	.	.	.	.	.	-	7.686	0.689971	0.15039	.	.	ENSG00000225766	ENST00000397065	.	.	.	3.32	3.32	0.38043	NAD(P)-binding domain (1);	.	.	.	.	T	0.35566	0.0936	N	0.11870	0.19	.	.	.	B	0.12630	0.006	B	0.13407	0.009	T	0.49513	-0.8932	7	0.72032	D	0.01	.	12.5473	0.56208	0.0:0.0:1.0:0.0	.	63	P0CG22	DR4L1_HUMAN	L	63	.	ENSP00000380255:R63L	R	+	2	0	AL136295.1	23576851	1.000000	0.71417	1.000000	0.80357	0.012000	0.07955	7.937000	0.87672	1.864000	0.54056	0.400000	0.26472	CGC	RP11-468E2.9	-	-	ENSG00000225766		0.642	RP11-468E2.9-005	KNOWN	basic	processed_transcript	DHRS4L1	Clone_based_vega_gene	pseudogene	OTTHUMT00000417272.1	-	0.00	62	0	G			24507011	+1	tier1	-	no_errors	ENST00000558682	ensembl	human	known	74_37	rna	29.73	26	11	SNP	1.000	T
DMD	1756	genome.wustl.edu	37	X	31187701	31187701	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chrX:31187701delA	ENST00000357033.4	-	74	10618	c.10412delT	c.(10411-10413)ttafs	p.L3471fs	DMD_ENST00000474231.1_Frame_Shift_Del_p.L1011fs|DMD_ENST00000359836.1_Frame_Shift_Del_p.L998fs|DMD_ENST00000378702.4_Frame_Shift_Del_p.L403fs|DMD_ENST00000378677.2_Frame_Shift_Del_p.L3467fs|DMD_ENST00000361471.4_Frame_Shift_Del_p.L390fs|DMD_ENST00000378680.2_Intron|DMD_ENST00000378707.3_Frame_Shift_Del_p.L1011fs|DMD_ENST00000541735.1_Intron|DMD_ENST00000343523.2_Intron|DMD_ENST00000378723.3_Frame_Shift_Del_p.L403fs	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3471	Binds to SNTB1.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ATGCTGGATTAACAAATGTTC	0.443																																																	0			GRCh37	CM054661	DMD	M							42.0	37.0	39.0					X																	31187701		2202	4300	6502	SO:0001589	frameshift_variant	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.10412delT	X.37:g.31187701delA	ENSP00000354923:p.Leu3471fs		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Frame_Shift_Del	DEL	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.L3471fs	ENST00000357033.4	37	c.10412	CCDS14233.1	X																																																																																			DMD	-	pirsf_Dystrophin/utrophin	ENSG00000198947		0.443	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2		0.00	39	0	A	NM_004006		31187701	-1	tier1		no_errors	ENST00000357033	ensembl	human	known	74_37	frame_shift_del	12.82	68	10	DEL	1.000	-
DNAH6	1768	genome.wustl.edu	37	2	84806758	84806758	+	Silent	SNP	A	A	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:84806758A>T	ENST00000237449.6	+	13	2192	c.2184A>T	c.(2182-2184)acA>acT	p.T728T	DNAH6_ENST00000398278.2_Silent_p.T728T|DNAH6_ENST00000389394.3_Silent_p.T728T			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	728	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						CTACTACCACAGAATATGTTC	0.348																																																	0													111.0	105.0	107.0					2																	84806758		2203	4300	6503	SO:0001819	synonymous_variant	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.2184A>T	2.37:g.84806758A>T			A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.T728	ENST00000237449.6	37	c.2184	CCDS46348.1	2																																																																																			DNAH6	-	NULL	ENSG00000115423		0.348	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	-	0.00	52	0	A	NM_001370		84806758	+1	tier1	-	no_errors	ENST00000237449	ensembl	human	known	74_37	silent	68.00	16	34	SNP	1.000	T
DNAJC15	29103	genome.wustl.edu	37	13	43643083	43643083	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr13:43643083A>T	ENST00000379221.2	+	3	602	c.178A>T	c.(178-180)Atc>Ttc	p.I60F	DNAJC15_ENST00000474320.1_3'UTR	NM_013238.2	NP_037370.2	Q9Y5T4	DJC15_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 15	60					cellular response to starvation (GO:0009267)|negative regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902957)|negative regulation of protein complex assembly (GO:0031333)|protein transport (GO:0015031)|regulation of lipid metabolic process (GO:0019216)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|kidney(1)|urinary_tract(1)	4		Lung NSC(96;4.3e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0737)		CGCATTTCGGATCTGGAAACC	0.333																																																	0													102.0	97.0	99.0					13																	43643083		2203	4300	6503	SO:0001583	missense	0			AF126743	CCDS9388.1	13q14.1	2011-09-02	2005-06-30	2005-06-30	ENSG00000120675	ENSG00000120675		"""Heat shock proteins / DNAJ (HSP40)"""	20325	protein-coding gene	gene with protein product		615339	"""DnaJ (Hsp40) homolog, subfamily D, member 1"""	DNAJD1		11358853	Standard	NM_013238		Approved	MCJ	uc001uyy.3	Q9Y5T4	OTTHUMG00000016813	ENST00000379221.2:c.178A>T	13.37:g.43643083A>T	ENSP00000368523:p.Ile60Phe		B2R4L0|Q5T219|Q6X963	Missense_Mutation	SNP	pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain	p.I60F	ENST00000379221.2	37	c.178	CCDS9388.1	13	.	.	.	.	.	.	.	.	.	.	A	6.697	0.497193	0.12762	.	.	ENSG00000120675	ENST00000379221	T	0.44881	0.91	5.05	1.27	0.21489	.	0.265778	0.36268	N	0.002683	T	0.24005	0.0581	L	0.42245	1.32	0.38679	D	0.952481	B	0.09022	0.002	B	0.06405	0.002	T	0.10730	-1.0617	10	0.10111	T	0.7	-11.2009	1.4314	0.02334	0.3549:0.2849:0.2407:0.1195	.	60	Q9Y5T4	DJC15_HUMAN	F	60	ENSP00000368523:I60F	ENSP00000368523:I60F	I	+	1	0	DNAJC15	42541083	0.963000	0.33076	0.999000	0.59377	0.982000	0.71751	0.707000	0.25704	0.076000	0.16826	0.528000	0.53228	ATC	DNAJC15	-	NULL	ENSG00000120675		0.333	DNAJC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC15	HGNC	protein_coding	OTTHUMT00000044709.2	-	0.00	40	0	A	NM_013238		43643083	+1	tier1	-	no_errors	ENST00000379221	ensembl	human	known	74_37	missense	12.07	51	7	SNP	0.964	T
DNAJC18	202052	genome.wustl.edu	37	5	138778159	138778159	+	5'Flank	SNP	G	G	T	rs577894197		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr5:138778159G>T	ENST00000302060.5	-	0	0				DNAJC18_ENST00000505268.1_5'UTR	NM_152686.3	NP_689899.1	Q9H819	DJC18_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 18							integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CAGGGAAAAGGTCTGGAGGTA	0.517													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21460	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001631	upstream_gene_variant	0			AK024054	CCDS4214.1	5q31.2	2011-09-02		2005-08-09	ENSG00000170464	ENSG00000170464		"""Heat shock proteins / DNAJ (HSP40)"""	28429	protein-coding gene	gene with protein product							Standard	NM_152686		Approved	MGC29463	uc003len.3	Q9H819	OTTHUMG00000129225		5.37:g.138778159G>T	Exception_encountered			RNA	SNP	-	NULL	ENST00000302060.5	37	NULL	CCDS4214.1	5																																																																																			DNAJC18	-	-	ENSG00000170464		0.517	DNAJC18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC18	HGNC	protein_coding	OTTHUMT00000374191.1	-	0.00	68	0	G	NM_152686		138778159	-1	tier1	-	no_errors	ENST00000505268	ensembl	human	known	74_37	rna	74.51	13	38	SNP	0.025	T
DNASE1	1773	genome.wustl.edu	37	16	3706656	3706656	+	Missense_Mutation	SNP	C	C	T	rs199986334		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr16:3706656C>T	ENST00000246949.5	+	5	3547	c.338C>T	c.(337-339)gCg>gTg	p.A113V	DNASE1_ENST00000407479.1_Missense_Mutation_p.A113V|DNASE1_ENST00000414110.2_Missense_Mutation_p.R34W	NM_005223.3	NP_005214.2	P24855	DNAS1_HUMAN	deoxyribonuclease I	113					apoptotic process (GO:0006915)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	deoxyribonuclease I activity (GO:0004530)			lung(1)	1		Ovarian(90;0.0261)		Kidney(780;0.0556)		CAGGTGTCTGCGGTGGACAGC	0.647																																																	0													44.0	39.0	41.0					16																	3706656		2196	4300	6496	SO:0001583	missense	0				CCDS10507.1	16p13.3	2008-02-05			ENSG00000213918	ENSG00000213918	3.1.21.1		2956	protein-coding gene	gene with protein product		125505		DNL1		2349940	Standard	XM_005255148		Approved		uc002cvr.3	P24855	OTTHUMG00000129426	ENST00000246949.5:c.338C>T	16.37:g.3706656C>T	ENSP00000246949:p.Ala113Val		B4DV35|Q14UU9|Q14UV0	Missense_Mutation	SNP	pirsf_DNase_I,pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_DNase_I,prints_DNase_I	p.A113V	ENST00000246949.5	37	c.338	CCDS10507.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.007|0.007	-1.950326|-1.950326	0.00475|0.00475	.|.	.|.	ENSG00000213918|ENSG00000213918	ENST00000407479;ENST00000246949|ENST00000414110	T;T|T	0.37058|0.52295	1.22;1.22|0.67	5.49|5.49	1.99|1.99	0.26369|0.26369	Endonuclease/exonuclease/phosphatase (2);|.	0.449068|.	0.23307|.	N|.	0.049611|.	T|T	0.11110|0.11110	0.0271|0.0271	N|N	0.00044|0.00044	-2.46|-2.46	0.20975|0.20975	N|N	0.999811|0.999811	B|.	0.06786|.	0.001|.	B|.	0.04013|.	0.001|.	T|T	0.30995|0.30995	-0.9959|-0.9959	10|7	0.02654|0.62326	T|D	1|0.03	-0.4948|-0.4948	8.1685|8.1685	0.31241|0.31241	0.0:0.2279:0.0:0.7721|0.0:0.2279:0.0:0.7721	.|.	113|.	P24855|.	DNAS1_HUMAN|.	V|W	113|34	ENSP00000385905:A113V;ENSP00000246949:A113V|ENSP00000416699:R34W	ENSP00000246949:A113V|ENSP00000416699:R34W	A|R	+|+	2|1	0|2	DNASE1|DNASE1	3646657|3646657	0.918000|0.918000	0.31147|0.31147	0.004000|0.004000	0.12327|0.12327	0.050000|0.050000	0.14768|0.14768	1.578000|1.578000	0.36525|0.36525	0.064000|0.064000	0.16427|0.16427	-1.456000|-1.456000	0.01031|0.01031	GCG|CGG	DNASE1	-	pirsf_DNase_I,pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_DNase_I,prints_DNase_I	ENSG00000213918		0.647	DNASE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNASE1	HGNC	protein_coding	OTTHUMT00000251585.2	-	0.00	29	0	C			3706656	+1	tier1	rs199986334	no_errors	ENST00000246949	ensembl	human	known	74_37	missense	29.03	22	9	SNP	0.071	T
DOCK7	85440	genome.wustl.edu	37	1	62971450	62971450	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:62971450C>A	ENST00000340370.5	-	35	4438	c.4421G>T	c.(4420-4422)gGt>gTt	p.G1474V	DOCK7_ENST00000251157.5_Missense_Mutation_p.G1496V	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1505					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						TAGCACTCCACCAAGAATGCT	0.373																																																	0													143.0	115.0	124.0					1																	62971450		2203	4300	6503	SO:0001583	missense	0				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.4421G>T	1.37:g.62971450C>A	ENSP00000340742:p.Gly1474Val		Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,superfamily_ARM-type_fold	p.G1496V	ENST00000340370.5	37	c.4487	CCDS30734.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.2|25.2	4.618666|4.618666	0.87460|0.87460	.|.	.|.	ENSG00000116641|ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370;ENST00000395441|ENST00000454575	T;T|.	0.54071|.	0.59;0.59|.	5.06|5.06	5.06|5.06	0.68205|0.68205	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77350|0.77350	0.4117|0.4117	M|M	0.77486|0.77486	2.375|2.375	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	0.994;0.995;0.997;0.997;1.0;0.996|.	D;P;D;D;D;D|.	0.70487|.	0.959;0.905;0.946;0.909;0.969;0.958|.	T|T	0.78181|0.78181	-0.2304|-0.2304	10|5	0.62326|.	D|.	0.03|.	.|.	18.4148|18.4148	0.90565|0.90565	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1505;1496;1474;1465;1465;1496|.	Q96N67;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6|.	DOCK7_HUMAN;.;.;.;.;.|.	V|C	1505;1496;1474;235|667	ENSP00000251157:G1496V;ENSP00000340742:G1474V|.	ENSP00000251157:G1496V|.	G|W	-|-	2|3	0|0	DOCK7|DOCK7	62744038|62744038	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.951000|0.951000	0.60555|0.60555	7.818000|7.818000	0.86416|0.86416	2.339000|2.339000	0.79563|0.79563	0.591000|0.591000	0.81541|0.81541	GGT|TGG	DOCK7	-	superfamily_ARM-type_fold	ENSG00000116641		0.373	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK7	HGNC	protein_coding	OTTHUMT00000036806.1	-	0.00	66	0	C	NM_033407		62971450	-1	tier1	-	no_errors	ENST00000251157	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	A
DPYS	1807	genome.wustl.edu	37	8	105456530	105456530	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr8:105456530C>A	ENST00000351513.2	-	4	871	c.739G>T	c.(739-741)Gtg>Ttg	p.V247L		NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	247					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			ATCACATGCACAATGTAGAGA	0.542																																																	0													121.0	98.0	105.0					8																	105456530		2203	4300	6503	SO:0001583	missense	0			D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.739G>T	8.37:g.105456530C>A	ENSP00000276651:p.Val247Leu			Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.V247L	ENST00000351513.2	37	c.739	CCDS6302.1	8	.	.	.	.	.	.	.	.	.	.	C	24.8	4.567260	0.86439	.	.	ENSG00000147647	ENST00000351513	D	0.90004	-2.6	5.89	5.89	0.94794	Amidohydrolase 1 (1);	0.000000	0.85682	D	0.000000	D	0.93805	0.8019	M	0.85299	2.745	0.80722	D	1	P	0.35155	0.487	P	0.47102	0.537	D	0.93379	0.6742	10	0.87932	D	0	-27.2866	20.2576	0.98430	0.0:1.0:0.0:0.0	.	247	Q14117	DPYS_HUMAN	L	247	ENSP00000276651:V247L	ENSP00000276651:V247L	V	-	1	0	DPYS	105525706	1.000000	0.71417	0.966000	0.40874	0.605000	0.37080	7.337000	0.79256	2.783000	0.95769	0.655000	0.94253	GTG	DPYS	-	pfam_Amidohydro_1,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000147647		0.542	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYS	HGNC	protein_coding	OTTHUMT00000380814.1	-	0.00	47	0	C	NM_001385		105456530	-1	tier1	-	no_errors	ENST00000351513	ensembl	human	known	74_37	missense	9.64	75	8	SNP	1.000	A
DR1	1810	genome.wustl.edu	37	1	93826185	93826185	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:93826185G>C	ENST00000370272.4	+	3	1278	c.520G>C	c.(520-522)Gat>Cat	p.D174H	DR1_ENST00000481583.1_3'UTR|DR1_ENST00000370267.1_Missense_Mutation_p.D174H	NM_001938.2	NP_001929.1	Q01658	NC2B_HUMAN	down-regulator of transcription 1, TBP-binding (negative cofactor 2)	174					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(3)|large_intestine(1)	4		all_lung(203;0.00252)|Lung NSC(277;0.011)|Melanoma(281;0.155)		all cancers(265;0.0032)|GBM - Glioblastoma multiforme(16;0.0165)|Epithelial(280;0.0977)		AGAAGATGATGATGATATCTG	0.413																																																	0													67.0	66.0	67.0					1																	93826185		2203	4300	6503	SO:0001583	missense	0			M97388	CCDS744.1	1p22.1	2008-02-05			ENSG00000117505	ENSG00000117505			3017	protein-coding gene	gene with protein product		601482				1339312, 9040789	Standard	NM_001938		Approved	NC2, NC2-BETA	uc001dpu.3	Q01658	OTTHUMG00000010862	ENST00000370272.4:c.520G>C	1.37:g.93826185G>C	ENSP00000359295:p.Asp174His			Missense_Mutation	SNP	pfam_CBFA_NFYB_domain,superfamily_Histone-fold,prints_Transcrpt_fac_NFYB/HAP3	p.D174H	ENST00000370272.4	37	c.520	CCDS744.1	1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.911856	0.52439	.	.	ENSG00000117505	ENST00000370272;ENST00000370267	T;T	0.38077	1.16;1.16	5.5	5.5	0.81552	.	0.088762	0.85682	D	0.000000	T	0.14184	0.0343	N	0.08118	0	0.80722	D	1	B	0.27450	0.179	B	0.26094	0.066	T	0.10776	-1.0615	10	0.87932	D	0	-16.0889	19.372	0.94492	0.0:0.0:1.0:0.0	.	174	Q01658	NC2B_HUMAN	H	174	ENSP00000359295:D174H;ENSP00000359290:D174H	ENSP00000359290:D174H	D	+	1	0	DR1	93598773	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.882000	0.92420	2.582000	0.87167	0.585000	0.79938	GAT	DR1	-	NULL	ENSG00000117505		0.413	DR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DR1	HGNC	protein_coding	OTTHUMT00000029976.2	-	0.00	44	0	G	NM_001938		93826185	+1	tier1	-	no_errors	ENST00000370267	ensembl	human	known	74_37	missense	20.00	20	5	SNP	1.000	C
DST	667	genome.wustl.edu	37	6	56365903	56365903	+	Missense_Mutation	SNP	A	A	G	rs575226488		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr6:56365903A>G	ENST00000361203.3	-	75	18918	c.18911T>C	c.(18910-18912)aTt>aCt	p.I6304T	DST_ENST00000370754.5_Missense_Mutation_p.I6593T|DST_ENST00000370788.2_Missense_Mutation_p.I4218T|DST_ENST00000244364.6_Missense_Mutation_p.I4001T|DST_ENST00000370769.4_Missense_Mutation_p.I6415T|DST_ENST00000446842.2_Missense_Mutation_p.I6089T|DST_ENST00000421834.2_Missense_Mutation_p.I4327T|DST_ENST00000312431.6_3'UTR|DST_ENST00000340834.4_5'UTR			Q03001	DYST_HUMAN	dystonin	6303					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTCAATTTCAATGGCTTTAGG	0.453													A|||	1	0.000199681	0.0	0.0	5008	,	,		16812	0.0		0.001	False		,,,				2504	0.0																0													114.0	110.0	111.0					6																	56365903		1959	4143	6102	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.18911T>C	6.37:g.56365903A>G	ENSP00000354508:p.Ile6304Thr		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.I6593T	ENST00000361203.3	37	c.19778		6	.	.	.	.	.	.	.	.	.	.	A	19.63	3.863597	0.71949	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7;0.7	5.88	5.88	0.94601	.	0.000000	0.53938	D	0.000049	T	0.66117	0.2757	M	0.83012	2.62	0.33464	D	0.585359	D;D;D;D;D	0.89917	0.998;1.0;0.998;0.978;0.993	D;D;D;P;D	0.85130	0.997;0.992;0.949;0.871;0.975	T	0.71203	-0.4662	9	0.56958	D	0.05	.	16.2744	0.82636	1.0:0.0:0.0:0.0	.	4327;6415;6593;6413;4001	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	T	4001;6593;6415;4327;6089;4218;6304	ENSP00000244364:I4001T;ENSP00000359790:I6593T;ENSP00000359805:I6415T;ENSP00000400883:I4327T;ENSP00000393645:I6089T;ENSP00000359824:I4218T;ENSP00000354508:I6304T	ENSP00000244364:I4001T	I	-	2	0	DST	56473862	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.336000	0.96533	2.237000	0.73441	0.482000	0.46254	ATT	DST	-	pfam_Spectrin_repeat,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000151914		0.453	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	62	0	A	NM_001723		56365903	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	missense	7.32	76	6	SNP	1.000	G
DTNA	1837	genome.wustl.edu	37	18	32470619	32470619	+	3'UTR	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr18:32470619G>A	ENST00000444659.1	+	0	5154				DTNA_ENST00000598334.1_3'UTR|DTNA_ENST00000269190.7_3'UTR|DTNA_ENST00000399097.3_3'UTR|DTNA_ENST00000592449.1_3'UTR|DTNA_ENST00000283365.9_3'UTR|DTNA_ENST00000399121.5_3'UTR|DTNA_ENST00000595022.1_3'UTR	NM_001390.4	NP_001381.2	Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha						neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						TGGGATTCAGGAAACAGTTGT	0.478																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000444659.1:c.*2921G>A	18.37:g.32470619G>A			A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	RNA	SNP	-	NULL	ENST00000444659.1	37	NULL		18																																																																																			DTNA	-	-	ENSG00000134769		0.478	DTNA-205	KNOWN	basic|appris_candidate_longest	protein_coding	DTNA	HGNC	protein_coding		-	0.00	53	0	G	NM_001390		32470619	+1	tier1	-	no_errors	ENST00000592449	ensembl	human	known	74_37	rna	44.44	30	24	SNP	1.000	A
EFCAB12	90288	genome.wustl.edu	37	3	129134203	129134203	+	Silent	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr3:129134203C>T	ENST00000505956.1	-	4	885	c.723G>A	c.(721-723)gtG>gtA	p.V241V	EFCAB12_ENST00000326085.3_Silent_p.V241V	NM_207307.1	NP_997190.1	Q6NXP0	EFC12_HUMAN	EF-hand calcium binding domain 12	241							calcium ion binding (GO:0005509)										TGAGGTAGATCACTATATCCT	0.522																																																	0													160.0	159.0	159.0					3																	129134203		2057	4191	6248	SO:0001819	synonymous_variant	0			AK096099	CCDS54638.1	3q21.3	2013-01-10	2012-07-20	2012-07-20	ENSG00000172771	ENSG00000172771		"""EF-hand domain containing"""	28061	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 25"""	C3orf25			Standard	NM_207307		Approved		uc003emg.3	Q6NXP0	OTTHUMG00000159464	ENST00000505956.1:c.723G>A	3.37:g.129134203C>T			Q69YX4	Silent	SNP	pfscan_EF_hand_dom	p.V241	ENST00000505956.1	37	c.723	CCDS54638.1	3																																																																																			EFCAB12	-	NULL	ENSG00000172771		0.522	EFCAB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB12	HGNC	protein_coding	OTTHUMT00000355530.1	-	0.00	48	0	C	NM_207307		129134203	-1	tier1	-	no_errors	ENST00000326085	ensembl	human	known	74_37	silent	41.46	24	17	SNP	0.510	T
EFR3A	23167	genome.wustl.edu	37	8	133023251	133023251	+	3'UTR	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr8:133023251A>G	ENST00000254624.5	+	0	2800				EFR3A_ENST00000334503.4_3'UTR|EFR3A_ENST00000521940.1_3'UTR|EFR3A_ENST00000519656.1_3'UTR	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)							extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			GAAAATAATGATGGAACATAT	0.308																																																	0																																										SO:0001624	3_prime_UTR_variant	0			D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.*109A>G	8.37:g.133023251A>G			A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	RNA	SNP	-	NULL	ENST00000254624.5	37	NULL	CCDS34942.2	8																																																																																			EFR3A	-	-	ENSG00000132294		0.308	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFR3A	HGNC	protein_coding	OTTHUMT00000318886.1	-	0.00	26	0	A	NM_015137		133023251	+1	tier1	-	no_errors	ENST00000521940	ensembl	human	known	74_37	rna	21.21	26	7	SNP	0.000	G
ELK3	2004	genome.wustl.edu	37	12	96641176	96641176	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr12:96641176C>G	ENST00000228741.3	+	3	992	c.666C>G	c.(664-666)atC>atG	p.I222M	ELK3_ENST00000552142.1_Intron	NM_005230.2	NP_005221.2	P41970	ELK3_HUMAN	ELK3, ETS-domain protein (SRF accessory protein 2)	222					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|wound healing (GO:0042060)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	purine-rich negative regulatory element binding (GO:0032422)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(5)|ovary(2)|prostate(1)|stomach(2)	20	all_cancers(2;0.00173)					CGGCCAAGATCTCCTCTTTAA	0.617																																																	0													67.0	75.0	72.0					12																	96641176		2203	4300	6503	SO:0001583	missense	0			BC017371	CCDS9060.1	12q23	2006-12-30				ENSG00000111145			3325	protein-coding gene	gene with protein product		600247				7851904	Standard	NM_005230		Approved	ERP, NET, SAP2	uc001teo.1	P41970		ENST00000228741.3:c.666C>G	12.37:g.96641176C>G	ENSP00000228741:p.Ile222Met		B2R6S6|Q6FG57|Q6GU29|Q9UD17	Missense_Mutation	SNP	pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.I222M	ENST00000228741.3	37	c.666	CCDS9060.1	12	.	.	.	.	.	.	.	.	.	.	C	10.29	1.309595	0.23821	.	.	ENSG00000111145	ENST00000228741	T	0.30714	1.52	5.55	3.57	0.40892	.	0.475010	0.24204	N	0.040593	T	0.22003	0.0530	L	0.44542	1.39	0.80722	D	1	B	0.29716	0.255	B	0.29440	0.102	T	0.06232	-1.0838	10	0.34782	T	0.22	.	5.0445	0.14477	0.2563:0.5545:0.1134:0.0758	.	222	P41970	ELK3_HUMAN	M	222	ENSP00000228741:I222M	ENSP00000228741:I222M	I	+	3	3	ELK3	95165307	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	1.038000	0.30254	1.306000	0.44926	0.462000	0.41574	ATC	ELK3	-	NULL	ENSG00000111145		0.617	ELK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELK3	HGNC	protein_coding	OTTHUMT00000408694.1	-	0.00	64	0	C	NM_005230		96641176	+1	tier1	-	no_errors	ENST00000228741	ensembl	human	known	74_37	missense	52.11	34	37	SNP	1.000	G
E2F4	1874	genome.wustl.edu	37	16	67233891	67233891	+	IGR	SNP	T	T	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr16:67233891T>C	ENST00000379378.3	+	0	2096				ELMO3_ENST00000393997.2_Missense_Mutation_p.L130P|ELMO3_ENST00000571638.1_3'UTR|ELMO3_ENST00000477898.1_5'UTR|ELMO3_ENST00000360833.1_Intron|MIR328_ENST00000385213.1_RNA	NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding						blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		ATCCTGTGCCTCAGCACGGCC	0.677																																																	0													45.0	47.0	46.0					16																	67233891		2008	4157	6165	SO:0001628	intergenic_variant	0			BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975		16.37:g.67233891T>C			A6NGR8|B5BU56|Q12991|Q15328	Missense_Mutation	SNP	pfam_DUF3361,pfam_Engulfment_cell_motility_ELMO,superfamily_ARM-type_fold	p.L130P	ENST00000379378.3	37	c.389	CCDS32464.1	16	.	.	.	.	.	.	.	.	.	.	T	25.2	4.611985	0.87258	.	.	ENSG00000102890	ENST00000393997	T	0.40756	1.02	5.16	5.16	0.70880	.	0.000000	0.64402	U	0.000002	T	0.66025	0.2748	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71517	-0.4569	10	0.87932	D	0	-18.7993	13.8876	0.63717	0.0:0.0:0.0:1.0	.	130	Q96BJ8-3	.	P	130	ENSP00000377566:L130P	ENSP00000377566:L130P	L	+	2	0	ELMO3	65791392	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	5.122000	0.64697	1.968000	0.57251	0.374000	0.22700	CTC	ELMO3	-	NULL	ENSG00000102890		0.677	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ELMO3	HGNC	protein_coding	OTTHUMT00000421565.1	-	0.00	75	0	T	NM_001950		67233891	+1	tier1	-	no_errors	ENST00000393997	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	C
EML4	27436	genome.wustl.edu	37	2	42490326	42490326	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:42490326G>A	ENST00000318522.5	+	5	783	c.521G>A	c.(520-522)cGa>cAa	p.R174Q	EML4_ENST00000401738.3_Missense_Mutation_p.R174Q|EML4_ENST00000402711.2_Missense_Mutation_p.R116Q	NM_019063.3	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	174					microtubule-based process (GO:0007017)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|mitotic spindle (GO:0072686)			EML4/ALK(543)	NS(2)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	12						AGCATAAAACGACCATCACCA	0.318			T	ALK	NSCLC																																			Dom	yes		2	2p21	27436	echinoderm microtubule associated protein like 4		E	0													64.0	63.0	64.0					2																	42490326		2203	4300	6503	SO:0001583	missense	0			AF177377	CCDS1807.1, CCDS46266.1	2p21	2013-01-10		2002-02-15	ENSG00000143924	ENSG00000143924		"""WD repeat domain containing"""	1316	protein-coding gene	gene with protein product		607442		C2orf2			Standard	NM_019063		Approved	ROPP120, ELP120	uc002rsi.3	Q9HC35	OTTHUMG00000128603	ENST00000318522.5:c.521G>A	2.37:g.42490326G>A	ENSP00000320663:p.Arg174Gln		A6H8Y6|B2RBK3|B2RTW7|B5MCW9|Q3SWW0|Q53R29|Q53TW8|Q6PJ45|Q9NV40	Missense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R174Q	ENST00000318522.5	37	c.521	CCDS1807.1	2	.	.	.	.	.	.	.	.	.	.	G	15.68	2.905442	0.52333	.	.	ENSG00000143924	ENST00000318522;ENST00000402711;ENST00000401738	T;T;D	0.97752	0.97;1.04;-4.52	5.36	4.46	0.54185	.	0.291939	0.23107	N	0.051849	D	0.95834	0.8644	L	0.57536	1.79	0.80722	D	1	B;B	0.12630	0.006;0.006	B;B	0.12156	0.007;0.007	D	0.93547	0.6883	10	0.49607	T	0.09	-0.2523	11.2706	0.49136	0.1568:0.0:0.8432:0.0	.	116;174	B5MCW9;Q9HC35	.;EMAL4_HUMAN	Q	174;116;174	ENSP00000320663:R174Q;ENSP00000385059:R116Q;ENSP00000384939:R174Q	ENSP00000320663:R174Q	R	+	2	0	EML4	42343830	1.000000	0.71417	0.980000	0.43619	0.895000	0.52256	2.425000	0.44723	1.219000	0.43474	0.558000	0.71614	CGA	EML4	-	NULL	ENSG00000143924		0.318	EML4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EML4	HGNC	protein_coding	OTTHUMT00000250463.3	-	0.00	56	0	G	NM_019063		42490326	+1	tier1	-	no_errors	ENST00000318522	ensembl	human	known	74_37	missense	12.20	36	5	SNP	0.997	A
NEK11	79858	genome.wustl.edu	37	3	130830517	130830517	+	Intron	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr3:130830517A>G	ENST00000510769.1	+	4	708				NEK11_ENST00000426022.2_Intron|NEK11_ENST00000508196.1_Intron|AC121332.1_ENST00000390784.1_RNA|NEK11_ENST00000510688.1_Intron|NEK11_ENST00000429253.2_Intron|NEK11_ENST00000383366.4_Intron|NEK11_ENST00000507910.1_Intron|NEK11_ENST00000511262.1_Intron|NEK11_ENST00000412440.2_Intron|NEK11_ENST00000356918.4_Intron					NIMA-related kinase 11											breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|stomach(1)|urinary_tract(2)	33						ttcctcatctattagattggt	0.363																																																	0																																										SO:0001627	intron_variant	0			AK027148	CCDS3069.1, CCDS46915.1, CCDS54639.1	3q22.1	2012-11-15	2012-11-15		ENSG00000114670	ENSG00000114670			18593	protein-coding gene	gene with protein product		609779	"""NIMA (never in mitosis gene a)- related kinase 11"""				Standard	NM_024800		Approved	FLJ23495	uc003eny.3	Q8NG66	OTTHUMG00000159654	ENST00000510769.1:c.455+1752A>G	3.37:g.130830517A>G				RNA	SNP	-	NULL	ENST00000510769.1	37	NULL		3																																																																																			AC121332.1	-	-	ENSG00000212073		0.363	NEK11-005	NOVEL	basic|exp_conf	protein_coding	ENSG00000212073	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000356757.1	-	0.00	9	0	A	NM_024800		130830517	-1	tier1	-	no_errors	ENST00000390784	ensembl	human	novel	74_37	rna	50.00	5	5	SNP	0.088	G
Unknown	0	genome.wustl.edu	37	GL000212.1	65516	65516	+	IGR	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chrGL000212.1:65516C>G								None (None upstream) : None (None downstream)																							AGGACGCCGCCCAGGGCATCG	0.632																																																	0																																										SO:0001628	intergenic_variant	0																															GL000212.1.37:g.65516C>G				Missense_Mutation	SNP	NULL	p.P422R		37	c.1265		GL000212.1																																																																																			AL356585.1	-	NULL	ENSG00000212857	0	0.632					ENSG00000212857	Clone_based_ensembl_gene			-	0.00	93	0	C			65516	+1	tier1	-	no_errors	ENST00000391545	ensembl	human	known	74_37	missense	11.29	110	14	SNP	NULL	G
LOC101927587	101927587	genome.wustl.edu	37	1	84259637	84259638	+	lincRNA	INS	-	-	A	rs111685871|rs558985896		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:84259637_84259638insA	ENST00000439186.1	+	0	163				AL035706.1_ENST00000411299.1_RNA|RP11-475O6.1_ENST00000417975.1_lincRNA																							gtaatggcaTTAAAAAAAAAAC	0.317																																																	0																																												0																															1.37:g.84259647_84259647dupA				RNA	INS	-	NULL	ENST00000439186.1	37	NULL		1																																																																																			AL035706.1	-	-	ENSG00000223231		0.317	RP5-836J3.1-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000223231	Clone_based_ensembl_gene	lincRNA	OTTHUMT00000027497.1		0.00	37	0	-			84259638	+1	tier1		no_errors	ENST00000411299	ensembl	human	novel	74_37	rna	17.86	23	5	INS	0.082:0.062	A
AL358813.2	0	genome.wustl.edu	37	1	149673265	149673265	+	5'Flank	SNP	C	C	G	rs71620900	byFrequency	TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:149673265C>G	ENST00000369173.2	+	0	0				RP11-353N4.4_ENST00000443602.2_lincRNA|RNU1-68P_ENST00000517116.1_RNA|RP11-353N4.5_ENST00000608683.1_lincRNA																							CGGGTCGCCGCGTCCGGAGCC	0.697																																																	0																																										SO:0001631	upstream_gene_variant	0																															1.37:g.149673265C>G	Exception_encountered			RNA	SNP	-	NULL	ENST00000369173.2	37	NULL		1																																																																																			RP11-353N4.4	-	-	ENSG00000223759		0.697	AL358813.2-201	NOVEL	basic|appris_principal	protein_coding	ENSG00000223759	Clone_based_vega_gene	protein_coding		-	0.00	19	0	C			149673265	+1	tier1	-	no_errors	ENST00000443602	ensembl	human	known	74_37	rna	33.33	5	3	SNP	0.001	G
RP11-508N22.8	0	genome.wustl.edu	37	10	38501263	38501263	+	RNA	SNP	T	T	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr10:38501263T>C	ENST00000423162.1	+	0	768																											CAAGACAAAGTTTTCTATAGT	0.373																																																	0																																												0																															10.37:g.38501263T>C				RNA	SNP	-	NULL	ENST00000423162.1	37	NULL		10																																																																																			RP11-508N22.8	-	-	ENSG00000224761		0.373	RP11-508N22.8-001	KNOWN	basic	processed_transcript	ENSG00000224761	Clone_based_vega_gene	processed_transcript	OTTHUMT00000047629.1	-	0.00	20	0	T			38501263	+1	tier1	-	no_errors	ENST00000423162	ensembl	human	known	74_37	rna	33.33	16	8	SNP	0.998	C
RP11-640M9.2	0	genome.wustl.edu	37	1	144598750	144598750	+	RNA	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:144598750G>T	ENST00000419820.1	+	0	678																											CACACGGTGTGGGCCGAATGA	0.527																																																	0																																												0																															1.37:g.144598750G>T				RNA	SNP	-	NULL	ENST00000419820.1	37	NULL		1																																																																																			RP11-640M9.2	-	-	ENSG00000225241		0.527	RP11-640M9.2-011	KNOWN	basic	processed_transcript	ENSG00000225241	Clone_based_vega_gene	pseudogene	OTTHUMT00000038365.1	-	0.00	56	0	G			144598750	+1	tier1	-	no_errors	ENST00000419820	ensembl	human	known	74_37	rna	7.69	48	4	SNP	0.003	T
AC003101.1	0	genome.wustl.edu	37	17	29898272	29898272	+	Silent	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr17:29898272C>T	ENST00000412403.1	+	1	112	c.108C>T	c.(106-108)caC>caT	p.H36H																								CGGCTACTCACTTGGGCCTCC	0.627																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000412403.1:c.108C>T	17.37:g.29898272C>T				Silent	SNP	NULL	p.H36	ENST00000412403.1	37	c.108		17																																																																																			AC003101.1	-	NULL	ENSG00000228768		0.627	AC003101.1-001	PUTATIVE	basic|appris_principal	protein_coding	ENSG00000228768	Clone_based_vega_gene	protein_coding	OTTHUMT00000256194.1	-	0.00	57	0	C			29898272	+1	tier1	-	no_errors	ENST00000412403	ensembl	human	putative	74_37	silent	9.76	37	4	SNP	0.000	T
FAM78B	149297	genome.wustl.edu	37	1	166028225	166028225	+	Silent	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:166028225C>T	ENST00000595430.1	-	1	484	c.243G>A	c.(241-243)gaG>gaA	p.E81E																								ACTCAGGTGGCTCTGCAGAAA	0.493																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000595430.1:c.243G>A	1.37:g.166028225C>T				Silent	SNP	NULL	p.E81	ENST00000595430.1	37	c.243		1																																																																																			AL626787.1	-	NULL	ENSG00000267884		0.493	AL626787.1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000267884	Clone_based_ensembl_gene	protein_coding		-	0.00	72	0	C			166028225	-1	tier1	-	no_errors	ENST00000595430	ensembl	human	known	74_37	silent	40.23	52	35	SNP	0.347	T
EPB41L4B	54566	genome.wustl.edu	37	9	112017826	112017826	+	Silent	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr9:112017826G>A	ENST00000374566.3	-	11	1651	c.1134C>T	c.(1132-1134)tcC>tcT	p.S378S	EPB41L4B_ENST00000374557.4_Silent_p.S378S	NM_019114.3	NP_061987.3	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	378					actomyosin structure organization (GO:0031032)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)	structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGATAAAGTCGGATCTATTGG	0.507																																																	0													102.0	97.0	99.0					9																	112017826		1943	4143	6086	SO:0001819	synonymous_variant	0			AB032179	CCDS43859.1, CCDS43860.1	9q22.1-q22.3	2008-02-05			ENSG00000095203	ENSG00000095203			19818	protein-coding gene	gene with protein product		610340				10783258	Standard	NM_018424		Approved	EHM2	uc004bdz.1	Q9H329	OTTHUMG00000020470	ENST00000374566.3:c.1134C>T	9.37:g.112017826G>A			Q5T4G5|Q5T4G6|Q9H328|Q9P2V3	Silent	SNP	pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.S378	ENST00000374566.3	37	c.1134	CCDS43859.1	9																																																																																			EPB41L4B	-	NULL	ENSG00000095203		0.507	EPB41L4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L4B	HGNC	protein_coding	OTTHUMT00000053592.1	-	0.00	38	0	G	NM_018424		112017826	-1	tier1	-	no_errors	ENST00000374566	ensembl	human	known	74_37	silent	5.80	65	4	SNP	0.000	A
ESPNP	284729	genome.wustl.edu	37	1	17046464	17046464	+	RNA	SNP	G	G	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:17046464G>C	ENST00000492551.1	-	0	188					NR_026567.1				espin pseudogene																		CTTACTCAGGGTAGTGCCTGA	0.627																																																	0																																												0			AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17046464G>C				RNA	SNP	-	NULL	ENST00000492551.1	37	NULL		1																																																																																			ESPNP	-	-	ENSG00000268869		0.627	ESPNP-002	KNOWN	basic	processed_transcript	ESPNP	HGNC	pseudogene	OTTHUMT00000326311.1	-	0.00	202	0	G			17046464	-1	tier1	-	no_errors	ENST00000492551	ensembl	human	known	74_37	rna	6.60	183	13	SNP	0.997	C
EXO1	9156	genome.wustl.edu	37	1	242016687	242016687	+	Silent	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:242016687A>G	ENST00000366548.3	+	6	902	c.309A>G	c.(307-309)ggA>ggG	p.G103G	EXO1_ENST00000348581.5_Silent_p.G103G|EXO1_ENST00000518483.1_Silent_p.G103G|EXO1_ENST00000493702.1_3'UTR	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	103					DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			TTCTTAAGGGAAAGCAACTTC	0.398								Editing and processing nucleases																																									0													84.0	90.0	88.0					1																	242016687		2203	4300	6503	SO:0001819	synonymous_variant	0			AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.309A>G	1.37:g.242016687A>G			O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Silent	SNP	pfam_XPG-I_dom,pfam_XPG_DNA_repair_N,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG-I_dom,smart_HhH2,prints_XPG/Rad2	p.G103	ENST00000366548.3	37	c.309	CCDS1620.1	1																																																																																			EXO1	-	NULL	ENSG00000174371		0.398	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXO1	HGNC	protein_coding	OTTHUMT00000096405.1	-	0.00	35	0	A	NM_006027		242016687	+1	tier1	-	no_errors	ENST00000348581	ensembl	human	known	74_37	silent	29.41	36	15	SNP	1.000	G
EXOSC2	23404	genome.wustl.edu	37	9	133573186	133573186	+	Intron	DEL	T	T	-			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr9:133573186delT	ENST00000372358.5	+	3	341				EXOSC2_ENST00000372352.3_Intron|EXOSC2_ENST00000372351.3_Intron|EXOSC2_ENST00000546165.1_Intron			Q13868	EXOS2_HUMAN	exosome component 2						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|7S RNA binding (GO:0008312)			breast(1)|endometrium(1)|large_intestine(3)|ovary(1)	6		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(13;0.0588)		OV - Ovarian serous cystadenocarcinoma(145;0.000324)		CTGGTTCATGttttttttttt	0.458																																					Pancreas(134;1683 1824 10118 27928 31640)												0																																										SO:0001627	intron_variant	0			AK001916	CCDS6935.1, CCDS65160.1, CCDS65161.1	9q34	2008-02-05			ENSG00000130713	ENSG00000130713			17097	protein-coding gene	gene with protein product	"""homolog of yeast RRP4 (ribosomal RNA processing 4), 3' 5' exoribonuclease (RRP4)"""	602238				8600032, 1538749	Standard	XM_005272176		Approved	hRrp4p, Rrp4p, RRP4, p7	uc004bzu.2	Q13868	OTTHUMG00000020811	ENST00000372358.5:c.270+172T>-	9.37:g.133573186delT			A3KFL3|B4DKK6|Q9NUY4	RNA	DEL	-	NULL	ENST00000372358.5	37	NULL	CCDS6935.1	9																																																																																			EXOSC2	-	-	ENSG00000130713		0.458	EXOSC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOSC2	HGNC	protein_coding	OTTHUMT00000054673.1		0.00	16	0	T	NM_014285		133573186	+1	tier1		no_errors	ENST00000430138	ensembl	human	known	74_37	rna	12.50	14	2	DEL	0.001	-
F8	2157	genome.wustl.edu	37	X	154227789	154227789	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chrX:154227789A>T	ENST00000360256.4	-	2	430	c.230T>A	c.(229-231)cTt>cAt	p.L77H		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	77	F5/8 type A 1.|Plastocyanin-like 1.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GATGTTGAAAAGGTGATCCGT	0.398																																																	0			GRCh37	CM053251	F8	M							169.0	150.0	156.0					X																	154227789		2203	4300	6503	SO:0001583	missense	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.230T>A	X.37:g.154227789A>T	ENSP00000353393:p.Leu77His		Q14286|Q5HY69	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.L77H	ENST00000360256.4	37	c.230	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	A	10.03	1.238163	0.22711	.	.	ENSG00000185010	ENST00000360256;ENST00000423959;ENST00000453950	D;D;D	0.98937	-5.25;-5.25;-5.25	5.0	2.41	0.29592	Cupredoxin (2);	0.283910	0.33834	N	0.004519	D	0.97929	0.9319	L	0.50333	1.59	0.09310	N	1	B;D	0.89917	0.024;1.0	B;D	0.70487	0.009;0.969	D	0.93296	0.6672	10	0.31617	T	0.26	-7.0293	5.1093	0.14800	0.6339:0.1848:0.0:0.1813	.	42;77	B1B0G8;P00451	.;FA8_HUMAN	H	77;42;71	ENSP00000353393:L77H;ENSP00000409446:L42H;ENSP00000389153:L71H	ENSP00000353393:L77H	L	-	2	0	F8	153880983	0.999000	0.42202	0.951000	0.38953	0.631000	0.37964	1.329000	0.33770	0.563000	0.29222	0.235000	0.17854	CTT	F8	-	superfamily_Cupredoxin	ENSG00000185010		0.398	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4	-	0.00	50	0	A			154227789	-1	tier1	-	no_errors	ENST00000360256	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.172	T
FAM132B	151176	genome.wustl.edu	37	2	239071418	239071418	+	Silent	SNP	C	C	T	rs371593126		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:239071418C>T	ENST00000546354.1	+	3	363	c.363C>T	c.(361-363)ggC>ggT	p.G121G				Q4G0M1	ERFE_HUMAN	family with sequence similarity 132, member B	121	Pro-rich.				cellular iron ion homeostasis (GO:0006879)|positive regulation of fatty acid transport (GO:2000193)|regulation of fatty acid metabolic process (GO:0019217)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)										GTCCCCAGGGCCCCCCAGGCC	0.672																																																	0																																										SO:0001819	synonymous_variant	0			AK094353		2q37.3	2012-04-12			ENSG00000178752	ENSG00000178752			26727	protein-coding gene	gene with protein product	"""myonectin"""	615099				22351773	Standard	XM_006710143		Approved	FLJ37034, CTRP15, C1QTNF15	uc002vxt.3	Q4G0M1	OTTHUMG00000152901	ENST00000546354.1:c.363C>T	2.37:g.239071418C>T			W8S2M9	Silent	SNP	superfamily_Tumour_necrosis_fac-like_dom	p.G121	ENST00000546354.1	37	c.363		2																																																																																			FAM132B	-	NULL	ENSG00000178752		0.672	FAM132B-008	PUTATIVE	basic|appris_principal	protein_coding	FAM132B	HGNC	protein_coding	OTTHUMT00000328509.2	-	0.00	36	0	C	XM_001127207		239071418	+1	tier1	-	no_errors	ENST00000546354	ensembl	human	putative	74_37	silent	20.90	51	14	SNP	0.362	T
AC026369.1	0	genome.wustl.edu	37	12	147969	147969	+	IGR	DEL	T	T	-	rs199686077	byFrequency	TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr12:147969delT	ENST00000594563.1	+	0	129				FAM138D_ENST00000320165.5_lincRNA																							acaatggaagtttatttctca	0.408													|||unknown(NO_COVERAGE)	1693	0.338059	0.3638	0.3487	5008	,	,		33777	0.2589		0.3668	False		,,,				2504	0.3476																0																																										SO:0001628	intergenic_variant	0																															12.37:g.147969delT				RNA	DEL	-	NULL	ENST00000594563.1	37	NULL		12																																																																																			FAM138D	-	-	ENSG00000206114		0.408	AC026369.1-201	NOVEL	basic|appris_principal	protein_coding	FAM138D	HGNC	protein_coding			0.00	8	0	T			147969	-1	tier1		no_errors	ENST00000320165	ensembl	human	known	74_37	rna	55.56	4	5	DEL	0.003	-
FAM175B	23172	genome.wustl.edu	37	10	126490414	126490414	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr10:126490414T>G	ENST00000298492.5	+	1	61	c.16T>G	c.(16-18)Tcg>Gcg	p.S6A		NM_032182.3	NP_115558.3	Q15018	F175B_HUMAN	family with sequence similarity 175, member B	6	MPN-like.				cellular response to freezing (GO:0071497)	BRISC complex (GO:0070552)|cytoplasm (GO:0005737)	polyubiquitin binding (GO:0031593)			NS(1)	1						GGCGTCCATTTCGGGCTACAC	0.662																																																	0													96.0	106.0	103.0					10																	126490414		1961	4138	6099	SO:0001583	missense	0			D63877	CCDS31308.2	10q26.2	2013-01-24	2008-07-02	2008-07-02	ENSG00000165660	ENSG00000165660			28975	protein-coding gene	gene with protein product	"""Abraxas brother"""	611144	"""KIAA0157"""	KIAA0157		8590280	Standard	NM_032182		Approved	Em:AC068896.4, ABRO1	uc001lib.4	Q15018	OTTHUMG00000019218	ENST00000298492.5:c.16T>G	10.37:g.126490414T>G	ENSP00000298492:p.Ser6Ala		B4DKR2|Q96H11	Missense_Mutation	SNP	prints_FAM175_BRISC_cplx_Abro1_su,prints_FAM175	p.S6A	ENST00000298492.5	37	c.16	CCDS31308.2	10	.	.	.	.	.	.	.	.	.	.	T	29.1	4.975206	0.92919	.	.	ENSG00000165660	ENST00000298492	T	0.49139	0.79	4.51	4.51	0.55191	.	0.090008	0.46758	D	0.000264	T	0.66790	0.2825	M	0.74647	2.275	0.48975	D	0.999736	D	0.56035	0.974	D	0.70487	0.969	T	0.71170	-0.4671	10	0.72032	D	0.01	-21.4627	13.2226	0.59896	0.0:0.0:0.0:1.0	.	6	Q15018	F175B_HUMAN	A	6	ENSP00000298492:S6A	ENSP00000298492:S6A	S	+	1	0	FAM175B	126480404	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.659000	0.74412	2.008000	0.58898	0.460000	0.39030	TCG	FAM175B	-	prints_FAM175_BRISC_cplx_Abro1_su,prints_FAM175	ENSG00000165660		0.662	FAM175B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM175B	HGNC	protein_coding	OTTHUMT00000050891.2	-	0.00	37	0	T	NM_032182		126490414	+1	tier1	-	no_errors	ENST00000298492	ensembl	human	known	74_37	missense	28.00	18	7	SNP	1.000	G
FAM196B	100131897	genome.wustl.edu	37	5	169291415	169291415	+	Silent	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr5:169291415C>T	ENST00000377365.3	-	4	2851	c.1470G>A	c.(1468-1470)ttG>ttA	p.L490L	DOCK2_ENST00000256935.8_Intron|DOCK2_ENST00000523351.1_Intron|DOCK2_ENST00000540750.1_Intron|DOCK2_ENST00000520908.1_Intron	NM_001129891.1	NP_001123363.1	A6NMK8	F196B_HUMAN	family with sequence similarity 196, member B	490										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)|skin(1)	5						CCAGACTCTGCAAAACTTCAT	0.517																																																	0													94.0	83.0	86.0					5																	169291415		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS47336.1	5q35.1	2010-02-17	2009-09-11	2009-09-11	ENSG00000204767	ENSG00000204767			37271	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 57"""	C5orf57			Standard	NM_001129891		Approved		uc003mag.2	A6NMK8	OTTHUMG00000163083	ENST00000377365.3:c.1470G>A	5.37:g.169291415C>T				Silent	SNP	NULL	p.L490	ENST00000377365.3	37	c.1470	CCDS47336.1	5																																																																																			FAM196B	-	NULL	ENSG00000204767		0.517	FAM196B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM196B	HGNC	protein_coding	OTTHUMT00000371629.1	-	0.00	36	0	C	NM_001129891		169291415	-1	tier1	-	no_errors	ENST00000377365	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.995	T
FAM65A	79567	genome.wustl.edu	37	16	67574524	67574524	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr16:67574524C>T	ENST00000379312.3	+	10	851	c.730C>T	c.(730-732)Cga>Tga	p.R244*	CTD-2012K14.4_ENST00000564717.1_RNA|CTD-2012K14.3_ENST00000563083.1_RNA|FAM65A_ENST00000422602.2_Nonsense_Mutation_p.R260*|FAM65A_ENST00000566522.1_3'UTR|FAM65A_ENST00000540839.3_Nonsense_Mutation_p.R260*|FAM65A_ENST00000042381.4_Nonsense_Mutation_p.R240*|FAM65A_ENST00000428437.2_Nonsense_Mutation_p.R254*|CTD-2012K14.2_ENST00000567122.1_RNA	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	244						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		ACTACGGGGCCGAATTGAGGG	0.537																																																	0													197.0	177.0	184.0					16																	67574524		2198	4300	6498	SO:0001587	stop_gained	0			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.730C>T	16.37:g.67574524C>T	ENSP00000368614:p.Arg244*		B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Nonsense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_HR1_rho-bd	p.R260*	ENST00000379312.3	37	c.778	CCDS54028.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.086332|5.086332	0.94100|0.94100	.|.	.|.	ENSG00000039523|ENSG00000039523	ENST00000428437|ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	.|.	.|.	.|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	.|0.056764	.|0.64402	.|D	.|0.000001	T|.	0.52757|.	0.1754|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.42275|.	-0.9461|.	3|.	.|0.07175	.|T	.|0.84	-14.5104|-14.5104	19.2134|19.2134	0.93766|0.93766	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	L|X	234|244;240;260;254	.|.	.|ENSP00000042381:R240X	P|R	+|+	2|1	0|2	FAM65A|FAM65A	66132025|66132025	0.984000|0.984000	0.35163|0.35163	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	2.630000|2.630000	0.46494|0.46494	2.553000|2.553000	0.86117|0.86117	0.555000|0.555000	0.69702|0.69702	CCG|CGA	FAM65A	-	NULL	ENSG00000039523		0.537	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM65A	HGNC	protein_coding	OTTHUMT00000268866.3	-	0.00	52	0	C	NM_024519		67574524	+1	tier1	-	no_errors	ENST00000422602	ensembl	human	known	74_37	nonsense	43.33	17	13	SNP	1.000	T
FBXO43	286151	genome.wustl.edu	37	8	101149869	101149869	+	Missense_Mutation	SNP	C	C	T	rs376141364	byFrequency	TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr8:101149869C>T	ENST00000428847.2	-	3	1914	c.1598G>A	c.(1597-1599)cGt>cAt	p.R533H		NM_001029860.3	NP_001025031.2	Q4G163	FBX43_HUMAN	F-box protein 43	533	F-box.				meiotic nuclear division (GO:0007126)|negative regulation of meiosis (GO:0045835)|negative regulation of protein catabolic process (GO:0042177)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(5)|lung(14)|prostate(1)|skin(5)|urinary_tract(1)	31	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			AACAATTTCACGCCAATTTCT	0.303													C|||	2	0.000399361	0.0	0.0	5008	,	,		18003	0.0		0.0	False		,,,				2504	0.002																0								C	HIS/ARG	0,3636		0,0,1818	114.0	105.0	108.0		1598	5.8	1.0	8		108	1,8141		0,1,4070	no	missense	FBXO43	NM_001029860.3	29	0,1,5888	TT,TC,CC		0.0123,0.0,0.0085	probably-damaging	533/709	101149869	1,11777	1818	4071	5889	SO:0001583	missense	0			BC028709	CCDS47904.1	8q22.3	2004-08-24			ENSG00000156509	ENSG00000156509		"""F-boxes /  ""other"""""	28521	protein-coding gene	gene with protein product		609110					Standard	NR_036491		Approved	Fbx43	uc003yjd.3	Q4G163	OTTHUMG00000164803	ENST00000428847.2:c.1598G>A	8.37:g.101149869C>T	ENSP00000403293:p.Arg533His			Missense_Mutation	SNP	pfam_Znf_C6HC,superfamily_F-box_dom,smart_Znf_C6HC	p.R533H	ENST00000428847.2	37	c.1598	CCDS47904.1	8	.	.	.	.	.	.	.	.	.	.	C	26.1	4.701514	0.88924	0.0	1.23E-4	ENSG00000156509	ENST00000428847	T	0.59772	0.24	5.77	5.77	0.91146	.	0.105066	0.64402	D	0.000004	T	0.77824	0.4188	M	0.76002	2.32	0.50313	D	0.999868	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.982	T	0.78513	-0.2175	10	0.87932	D	0	-16.4866	20.3627	0.98863	0.0:1.0:0.0:0.0	.	499;533	C9J908;Q4G163	.;FBX43_HUMAN	H	533	ENSP00000403293:R533H	ENSP00000403293:R533H	R	-	2	0	FBXO43	101219045	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.015000	0.49599	2.885000	0.99019	0.655000	0.94253	CGT	FBXO43	-	superfamily_F-box_dom	ENSG00000156509		0.303	FBXO43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO43	HGNC	protein_coding	OTTHUMT00000380380.1	-	0.00	84	0	C	XM_209918		101149869	-1	tier1	-	no_errors	ENST00000428847	ensembl	human	known	74_37	missense	15.35	193	35	SNP	1.000	T
FDXACB1	91893	genome.wustl.edu	37	11	111749828	111749828	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr11:111749828C>A	ENST00000260257.4	-	1	76	c.29G>T	c.(28-30)gGg>gTg	p.G10V	C11orf1_ENST00000530214.1_5'Flank|ALG9_ENST00000524880.1_Missense_Mutation_p.G10V|C11orf1_ENST00000260276.3_5'Flank|C11orf1_ENST00000528125.1_Intron|FDXACB1_ENST00000542429.1_5'Flank|ALG9_ENST00000527377.1_5'Flank|C11orf1_ENST00000529270.1_5'Flank	NM_138378.2	NP_612387.1	Q9BRP7	FDXA1_HUMAN	ferredoxin-fold anticodon binding domain containing 1	10					phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA processing (GO:0008033)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(3)	19						ATTCCCCTCCCCAACCAACAG	0.642											OREG0010943|OREG0021330	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)|type=TRANSCRIPTION FACTOR BINDING SITE|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip); Conservation found by scanning with a motif model																																					0													29.0	39.0	36.0					11																	111749828		1985	4160	6145	SO:0001583	missense	0				CCDS44729.1	11q23.1	2011-04-15			ENSG00000255561	ENSG00000255561			25110	protein-coding gene	gene with protein product	"""hypothetical protein BC006136"""						Standard	NR_038364		Approved	LOC91893, hCG_2033039	uc001pmc.4	Q9BRP7	OTTHUMG00000166795	ENST00000260257.4:c.29G>T	11.37:g.111749828C>A	ENSP00000260257:p.Gly10Val	1437	A0PJW7|B4DUU2	Missense_Mutation	SNP	pfam_DUF2431,pfam_PheS_beta_Fdx_antiC-bd,superfamily_PheS_beta_Fdx_antiC-bd,smart_PheS_beta_Fdx_antiC-bd	p.G10V	ENST00000260257.4	37	c.29	CCDS44729.1	11	.	.	.	.	.	.	.	.	.	.	C	33	5.194740	0.94960	.	.	ENSG00000086848;ENSG00000255561	ENST00000428306;ENST00000260257	T	0.80566	-1.39	6.17	6.17	0.99709	Domain of unknown function DUF2431 (1);	0.047639	0.85682	D	0.000000	D	0.92404	0.7589	H	0.95079	3.62	0.80722	D	1	D	0.71674	0.998	D	0.66351	0.943	D	0.93828	0.7125	10	0.87932	D	0	.	16.2235	0.82274	0.1331:0.8669:0.0:0.0	.	10	Q9BRP7	FDXA1_HUMAN	V	10	ENSP00000260257:G10V	ENSP00000387627:G10V	G	-	2	0	FDXACB1;ALG9	111255038	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.276000	0.72601	2.941000	0.99782	0.655000	0.94253	GGG	FDXACB1	-	pfam_DUF2431	ENSG00000255561		0.642	FDXACB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FDXACB1	HGNC	protein_coding	OTTHUMT00000391497.1	-	0.00	94	0	C	NM_138378		111749828	-1	tier1	-	no_errors	ENST00000260257	ensembl	human	known	74_37	missense	23.29	56	17	SNP	1.000	A
FDXR	2232	genome.wustl.edu	37	17	72862650	72862650	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr17:72862650C>T	ENST00000293195.5	-	4	389	c.311G>A	c.(310-312)cGc>cAc	p.R104H	FDXR_ENST00000583917.1_Missense_Mutation_p.R105H|FDXR_ENST00000581969.1_5'UTR|FDXR_ENST00000442102.2_Missense_Mutation_p.R147H|FDXR_ENST00000582944.1_Missense_Mutation_p.R96H|FDXR_ENST00000420580.2_Intron|FDXR_ENST00000413947.2_Missense_Mutation_p.R135H|FDXR_ENST00000544854.1_Missense_Mutation_p.R52H|FDXR_ENST00000581530.1_Missense_Mutation_p.R104H|FDXR_ENST00000455107.2_Missense_Mutation_p.R60H	NM_001258014.1|NM_004110.3|NM_024417.2	NP_001244943.1|NP_004101.2|NP_077728.2	P22570	ADRO_HUMAN	ferredoxin reductase	104					cholesterol metabolic process (GO:0008203)|generation of precursor metabolites and energy (GO:0006091)|NADPH oxidation (GO:0070995)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ferredoxin-NADP+ reductase activity (GO:0004324)|NADPH binding (GO:0070402)|NADPH-adrenodoxin reductase activity (GO:0015039)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16	all_lung(278;0.172)|Lung NSC(278;0.207)				Flavin adenine dinucleotide(DB03147)	GAAGGCACAGCGGCCAGAATG	0.642																																																	0													41.0	34.0	37.0					17																	72862650		2203	4299	6502	SO:0001583	missense	0			J03826	CCDS11707.1, CCDS58591.1, CCDS58592.1, CCDS58593.1, CCDS58594.1, CCDS58595.1, CCDS58596.1	17q25.1	2013-06-18			ENSG00000161513	ENSG00000161513	1.18.1.6		3642	protein-coding gene	gene with protein product	"""adrenodoxin-NADP(+) reductase"", ""adrenodoxin reductase"""	103270		ADXR		2969697	Standard	NM_001258014		Approved		uc010wrl.2	P22570	OTTHUMG00000179026	ENST00000293195.5:c.311G>A	17.37:g.72862650C>T	ENSP00000293195:p.Arg104His		B4DDI7|B4DHX5|B4DQQ4|B4DX24|B7Z7G2|E7EQC1|Q13716|Q4PJI0|Q9BU12	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	p.R104H	ENST00000293195.5	37	c.311	CCDS58593.1	17	.	.	.	.	.	.	.	.	.	.	C	17.97	3.519524	0.64634	.	.	ENSG00000161513	ENST00000544854;ENST00000293195;ENST00000455107;ENST00000442102;ENST00000413947	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.59878	0.2226	M	0.80982	2.52	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.994;0.997;0.994;1.0;0.994;0.999	D;D;D;P;P;P;D;P;P	0.91635	0.997;0.999;0.998;0.786;0.878;0.666;0.998;0.666;0.871	T	0.65800	-0.6080	10	0.72032	D	0.01	-8.6728	18.0275	0.89273	0.0:1.0:0.0:0.0	.	147;135;102;52;135;104;96;104;104	B4DHX5;E7EQC1;B4DDI9;B7Z7G2;B4DDI7;Q6GSK2;B4DX24;P22570;P22570-2	.;.;.;.;.;.;.;ADRO_HUMAN;.	H	52;104;60;147;135	ENSP00000445432:R52H;ENSP00000293195:R104H;ENSP00000390875:R60H;ENSP00000416515:R147H;ENSP00000408595:R135H	ENSP00000293195:R104H	R	-	2	0	FDXR	70374245	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	5.779000	0.68948	2.362000	0.80069	0.561000	0.74099	CGC	FDXR	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	ENSG00000161513		0.642	FDXR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FDXR	HGNC	protein_coding	OTTHUMT00000444449.1	-	0.00	31	0	C	NM_004110		72862650	-1	tier1	-	no_errors	ENST00000581530	ensembl	human	known	74_37	missense	50.00	15	15	SNP	1.000	T
FLG	2312	genome.wustl.edu	37	1	152276167	152276167	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:152276167C>G	ENST00000368799.1	-	3	11230	c.11195G>C	c.(11194-11196)gGa>gCa	p.G3732A	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3732	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGTCTTCCTCCAGTACTGGG	0.612									Ichthyosis																																								0													224.0	229.0	227.0					1																	152276167		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.11195G>C	1.37:g.152276167C>G	ENSP00000357789:p.Gly3732Ala		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.G3732A	ENST00000368799.1	37	c.11195	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	4.938	0.174300	0.09391	.	.	ENSG00000143631	ENST00000368799	T	0.01629	4.72	3.76	1.83	0.25207	.	.	.	.	.	T	0.00468	0.0015	L	0.38838	1.175	0.09310	N	1	B	0.27656	0.184	B	0.29267	0.1	T	0.43540	-0.9385	9	0.08599	T	0.76	.	5.1646	0.15079	0.0:0.6692:0.2124:0.1184	.	3732	P20930	FILA_HUMAN	A	3732	ENSP00000357789:G3732A	ENSP00000357789:G3732A	G	-	2	0	FLG	150542791	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	-2.146000	0.01294	0.377000	0.24735	0.552000	0.68991	GGA	FLG	-	NULL	ENSG00000143631		0.612	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	165	0	C	NM_002016		152276167	-1	tier1	-	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	47.10	82	73	SNP	0.002	G
FN1	2335	genome.wustl.edu	37	2	216284107	216284107	+	Splice_Site	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:216284107G>A	ENST00000359671.1	-	12	1942	c.1677C>T	c.(1675-1677)gaC>gaT	p.D559D	FN1_ENST00000432072.2_Splice_Site_p.D559D|FN1_ENST00000357009.2_Splice_Site_p.D559D|FN1_ENST00000354785.4_Splice_Site_p.D559D|FN1_ENST00000323926.6_Splice_Site_p.D559D|FN1_ENST00000356005.4_Splice_Site_p.D559D|FN1_ENST00000446046.1_Splice_Site_p.D559D|FN1_ENST00000421182.1_Splice_Site_p.D559D|FN1_ENST00000346544.3_Splice_Site_p.D559D|FN1_ENST00000345488.5_Splice_Site_p.D559D|FN1_ENST00000336916.4_Splice_Site_p.D559D|FN1_ENST00000443816.1_Splice_Site_p.D559D|FN1_ENST00000426059.1_Splice_Site_p.D559D|FN1_ENST00000357867.4_Splice_Site_p.D559D			P02751	FINC_HUMAN	fibronectin 1	559	Collagen-binding.|Fibronectin type-I 9. {ECO:0000255|PROSITE-ProRule:PRU00478}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CCTGGCATTGGTCTAAAATAC	0.388																																																	0													87.0	82.0	84.0					2																	216284107		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.1676-1C>T	2.37:g.216284107G>A			B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibronectin_type1,pfam_FN_type2_col-bd,superfamily_Kringle-like,superfamily_Fibronectin_type3,smart_Fibronectin_type1,smart_FN_type2_col-bd,smart_Fibronectin_type3,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Fibronectin_type3	p.D559	ENST00000359671.1	37	c.1677		2																																																																																			FN1	-	smart_Fibronectin_type1,pfscan_Fibronectin_type1	ENSG00000115414		0.388	FN1-204	KNOWN	basic	protein_coding	FN1	HGNC	protein_coding		-	0.00	51	0	G	NM_212476	Silent	216284107	-1	tier1	-	no_errors	ENST00000354785	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.998	A
GDI2	2665	genome.wustl.edu	37	10	5810380	5810380	+	Intron	SNP	G	G	A	rs374553844		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr10:5810380G>A	ENST00000380191.4	-	8	1110				GDI2_ENST00000479928.1_5'UTR|GDI2_ENST00000380132.4_Intron|GDI2_ENST00000380181.3_Intron	NM_001115156.1|NM_001494.3	NP_001108628.1|NP_001485.2	P50395	GDIB_HUMAN	GDP dissociation inhibitor 2						protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|Rab GDP-dissociation inhibitor activity (GO:0005093)|Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|large_intestine(1)|lung(6)|urinary_tract(1)	10						acactgaagcggacaaggata	0.413																																																	0								G	,	0,4406		0,0,2203	36.0	33.0	34.0		,	-5.5	0.0	10		34	5,8595	4.3+/-15.6	0,5,4295	no	intron,intron	GDI2	NM_001115156.1,NM_001494.3	,	0,5,6498	AA,AG,GG		0.0581,0.0,0.0384	,	,	5810380	5,13001	2203	4300	6503	SO:0001627	intron_variant	0			D13988	CCDS7071.1, CCDS44352.1	10p15	2010-03-16			ENSG00000057608	ENSG00000057608			4227	protein-coding gene	gene with protein product	"""rab GDP-dissociation"""	600767				9434952	Standard	NM_001494		Approved	RABGDIB	uc001iil.4	P50395	OTTHUMG00000017607	ENST00000380191.4:c.820-33C>T	10.37:g.5810380G>A			O43928|Q5SX88|Q9UQM6	RNA	SNP	-	NULL	ENST00000380191.4	37	NULL	CCDS7071.1	10																																																																																			GDI2	-	-	ENSG00000057608		0.413	GDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDI2	HGNC	protein_coding	OTTHUMT00000046580.1	-	0.00	35	0	G	NM_001494		5810380	-1	tier1	-	no_errors	ENST00000479928	ensembl	human	known	74_37	rna	27.91	31	12	SNP	0.000	A
GMPR	2766	genome.wustl.edu	37	6	16247147	16247147	+	Silent	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr6:16247147C>T	ENST00000259727.4	+	2	276	c.162C>T	c.(160-162)aaC>aaT	p.N54N		NM_006877.3	NP_006868.3	P36959	GMPR1_HUMAN	guanosine monophosphate reductase	54					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to cold (GO:0009409)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|GMP reductase complex (GO:1902560)	GMP reductase activity (GO:0003920)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	20	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)				TCGTGGCCAACATGGACACTG	0.483																																																	0													131.0	119.0	123.0					6																	16247147		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4537.1	6p23	2009-07-10			ENSG00000137198	ENSG00000137198	1.7.1.7		4376	protein-coding gene	gene with protein product		139265				2194676	Standard	NM_006877		Approved		uc003nbs.3	P36959	OTTHUMG00000014302	ENST00000259727.4:c.162C>T	6.37:g.16247147C>T			Q96HQ6	Silent	SNP	pfam_IMP_DH_GMPRt,pirsf_GMP_reduct1,tigrfam_GMP_reduct1	p.N54	ENST00000259727.4	37	c.162	CCDS4537.1	6																																																																																			GMPR	-	pfam_IMP_DH_GMPRt,pirsf_GMP_reduct1,tigrfam_GMP_reduct1	ENSG00000137198		0.483	GMPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMPR	HGNC	protein_coding	OTTHUMT00000039942.2	-	0.00	54	0	C			16247147	+1	tier1	-	no_errors	ENST00000259727	ensembl	human	known	74_37	silent	21.79	60	17	SNP	1.000	T
GOLGA8S	653061	genome.wustl.edu	37	15	23608879	23608879	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr15:23608879C>T	ENST00000562295.1	+	15	1310	c.1310C>T	c.(1309-1311)cCt>cTt	p.P437L	RN7SL536P_ENST00000491146.2_RNA|AC100756.1_ENST00000459602.1_RNA					golgin A8 family, member S																		CGGCCCATTCCTAGCATCCCA	0.622																																																	0																																										SO:0001583	missense	0					15q11.2	2013-01-17			ENSG00000261739	ENSG00000261739			44409	other	unknown							Standard	NR_038843		Approved		uc021sfv.2		OTTHUMG00000176415	ENST00000562295.1:c.1310C>T	15.37:g.23608879C>T	ENSP00000455298:p.Pro437Leu			Missense_Mutation	SNP	NULL	p.P437L	ENST00000562295.1	37	c.1310		15																																																																																			GOLGA8S	-	NULL	ENSG00000261739		0.622	GOLGA8S-001	NOVEL	basic|appris_principal	protein_coding	GOLGA8S	HGNC	protein_coding	OTTHUMT00000431934.1	-	0.00	51	0	C	NR_038843		23608879	+1	tier1	-	no_errors	ENST00000562295	ensembl	human	novel	74_37	missense	81.94	13	59	SNP	0.039	T
GOLGA8A	23015	genome.wustl.edu	37	15	34679187	34679187	+	Silent	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr15:34679187C>A	ENST00000432566.2	-	1	53	c.54G>T	c.(52-54)ggG>ggT	p.G18G	GOLGA8A_ENST00000360553.3_Intron|GOLGA8A_ENST00000359187.4_Intron|GOLGA8A_ENST00000543376.1_5'UTR			A7E2F4	GOG8A_HUMAN	golgin A8 family, member A	18						Golgi apparatus (GO:0005794)|membrane (GO:0016020)							all_lung(180;2.78e-08)		all cancers(64;8.27e-19)|GBM - Glioblastoma multiforme(113;6.98e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		ATGTTCTGTCCCCCTCAGTGT	0.502																																																	0																																										SO:0001819	synonymous_variant	0			BX648160	CCDS10038.1	15q14	2011-10-25	2010-02-12		ENSG00000175265	ENSG00000175265			31972	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 8A"""			10660574, 10677249	Standard	NM_181077		Approved	GM88, GOLGIN-67	uc001zii.3	A7E2F4	OTTHUMG00000129447	ENST00000432566.2:c.54G>T	15.37:g.34679187C>A			A7MCY9|B7ZMK5|O94937|Q52M46|Q68DK6|Q9NZG8|Q9NZW0|Q9NZW3	Silent	SNP	NULL	p.G18	ENST00000432566.2	37	c.54		15																																																																																			GOLGA8A	-	NULL	ENSG00000175265		0.502	GOLGA8A-202	KNOWN	basic	protein_coding	GOLGA8A	HGNC	protein_coding		-	0.00	118	0	C	NM_181076		34679187	-1	tier1	-	no_errors	ENST00000432566	ensembl	human	known	74_37	silent	12.28	50	7	SNP	0.001	A
GOLGB1	2804	genome.wustl.edu	37	3	121415546	121415546	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr3:121415546G>T	ENST00000340645.5	-	13	3934	c.3809C>A	c.(3808-3810)gCc>gAc	p.A1270D	GOLGB1_ENST00000393667.3_Missense_Mutation_p.A1275D	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1270					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		CTGTTCTGTGGCTTTGAATAA	0.478																																																	0													165.0	151.0	156.0					3																	121415546		2203	4300	6503	SO:0001583	missense	0			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.3809C>A	3.37:g.121415546G>T	ENSP00000341848:p.Ala1270Asp		B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.A1270D	ENST00000340645.5	37	c.3809	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	G	7.494	0.651203	0.14516	.	.	ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517	T;T;T	0.24350	2.48;2.46;1.86	5.88	3.88	0.44766	.	0.644287	0.14477	N	0.317211	T	0.20740	0.0499	L	0.40543	1.245	0.09310	N	1	B;B;B;B;B	0.21606	0.058;0.058;0.015;0.015;0.001	B;B;B;B;B	0.25884	0.064;0.064;0.013;0.013;0.003	T	0.29458	-1.0011	10	0.14252	T	0.57	.	10.6072	0.45400	0.0:0.2173:0.6451:0.1376	.	1195;1234;1275;1275;1270	F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.;.;.;.;GOGB1_HUMAN	D	1270;1275;1234	ENSP00000341848:A1270D;ENSP00000377275:A1275D;ENSP00000418231:A1234D	ENSP00000341848:A1270D	A	-	2	0	GOLGB1	122898236	0.023000	0.18921	0.307000	0.25127	0.837000	0.47467	1.186000	0.32078	0.614000	0.30107	0.655000	0.94253	GCC	GOLGB1	-	NULL	ENSG00000173230		0.478	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	-	0.00	44	0	G	NM_004487		121415546	-1	tier1	-	no_errors	ENST00000340645	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.067	T
GON4L	54856	genome.wustl.edu	37	1	155735241	155735241	+	Silent	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:155735241C>T	ENST00000368331.1	-	21	4071	c.4023G>A	c.(4021-4023)gaG>gaA	p.E1341E	GON4L_ENST00000437809.1_Silent_p.E1341E|GON4L_ENST00000271883.5_Silent_p.E1341E|GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000361040.5_Silent_p.E1341E	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1341					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					AAATATCACGCTCAGGGGATC	0.483																																																	0													113.0	108.0	110.0					1																	155735241		2203	4300	6503	SO:0001819	synonymous_variant	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4023G>A	1.37:g.155735241C>T			B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	pfam_PAH,superfamily_PAH,superfamily_Homeodomain-like,pfscan_Myb-like_dom	p.E1341	ENST00000368331.1	37	c.4023		1																																																																																			GON4L	-	NULL	ENSG00000116580		0.483	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding		-	0.00	47	0	C	NM_032292		155735241	-1	tier1	-	no_errors	ENST00000368331	ensembl	human	known	74_37	silent	12.50	56	8	SNP	0.025	T
GPC5	2262	genome.wustl.edu	37	13	92797095	92797095	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr13:92797095A>T	ENST00000377067.3	+	7	1786	c.1414A>T	c.(1414-1416)Aga>Tga	p.R472*		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	472					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				GTTACAGGGTAGATCACCCAA	0.388																																																	0													140.0	134.0	136.0					13																	92797095		2203	4300	6503	SO:0001587	stop_gained	0			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1414A>T	13.37:g.92797095A>T	ENSP00000366267:p.Arg472*		B2R726|O60436|Q9BX27	Nonsense_Mutation	SNP	pfam_Glypican	p.R472*	ENST00000377067.3	37	c.1414	CCDS9468.1	13	.	.	.	.	.	.	.	.	.	.	A	40	8.387584	0.98789	.	.	ENSG00000179399	ENST00000377067	.	.	.	5.67	-0.0369	0.13886	.	0.795939	0.11244	N	0.584369	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.3047	8.1072	0.30892	0.4588:0.41:0.0:0.1312	.	.	.	.	X	472	.	ENSP00000366267:R472X	R	+	1	2	GPC5	91595096	0.986000	0.35501	0.214000	0.23707	0.770000	0.43624	2.993000	0.49425	-0.198000	0.10333	-0.472000	0.04984	AGA	GPC5	-	pfam_Glypican	ENSG00000179399		0.388	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC5	HGNC	protein_coding	OTTHUMT00000045454.1	-	0.00	79	0	A	NM_004466		92797095	+1	tier1	-	no_errors	ENST00000377067	ensembl	human	known	74_37	nonsense	43.33	51	39	SNP	0.440	T
GPHN	10243	genome.wustl.edu	37	14	67346678	67346678	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr14:67346678C>T	ENST00000315266.5	+	5	1437	c.316C>T	c.(316-318)Cgg>Tgg	p.R106W	GPHN_ENST00000305960.9_Missense_Mutation_p.R75W|GPHN_ENST00000543237.1_Missense_Mutation_p.R119W|GPHN_ENST00000459628.1_Missense_Mutation_p.R88W|GPHN_ENST00000478722.1_Missense_Mutation_p.R106W|GPHN_ENST00000544752.2_3'UTR	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	106	MPT Mo-transferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)	p.R106W(1)		large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		AGTAATAGAACGGGAAGCACC	0.408			T	MLL	AL																																			Dom	yes		14	14q24	10243	gephyrin (GPH)		L	1	Substitution - Missense(1)	large_intestine(1)											88.0	82.0	84.0					14																	67346678		2203	4300	6503	SO:0001583	missense	0			AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.316C>T	14.37:g.67346678C>T	ENSP00000312771:p.Arg106Trp		Q9H4E9|Q9P2G2	Missense_Mutation	SNP	pfam_Mopterin-bd_dom,pfam_MoeA_linker/N,pfam_MoeA_C_domain_IV,superfamily_MoeA_linker/N,superfamily_Mopterin-bd_dom,superfamily_MoeA_C_domain_IV,smart_Mopterin-bd_dom,tigrfam_Mo_cofactor_synthesis	p.R106W	ENST00000315266.5	37	c.316	CCDS32103.1	14	.	.	.	.	.	.	.	.	.	.	C	32	5.169766	0.94768	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000459628;ENST00000543237;ENST00000305960;ENST00000555456	T;T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2;-1.2	4.93	4.93	0.64822	Molybdenum cofactor synthesis (1);Molybdopterin binding (4);	0.000000	0.85682	D	0.000000	D	0.91050	0.7184	M	0.92367	3.3	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.992;1.0;0.999;0.95;0.99	D	0.93249	0.6633	10	0.87932	D	0	-4.4638	18.4954	0.90863	0.0:1.0:0.0:0.0	.	75;119;106;106;88	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2;G3V582	.;.;GEPH_HUMAN;.;.	W	106;106;88;119;75;39	ENSP00000312771:R106W;ENSP00000417901:R106W;ENSP00000452220:R88W;ENSP00000438404:R119W;ENSP00000303019:R75W;ENSP00000450706:R39W	ENSP00000303019:R75W	R	+	1	2	GPHN	66416431	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.839000	0.55835	2.440000	0.82611	0.655000	0.94253	CGG	GPHN	-	pfam_Mopterin-bd_dom,superfamily_Mopterin-bd_dom,smart_Mopterin-bd_dom,tigrfam_Mo_cofactor_synthesis	ENSG00000171723		0.408	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	GPHN	HGNC	protein_coding	OTTHUMT00000074299.2	-	0.00	38	0	C	NM_020806		67346678	+1	tier1	-	no_errors	ENST00000478722	ensembl	human	known	74_37	missense	48.39	16	15	SNP	1.000	T
GPR149	344758	genome.wustl.edu	37	3	154146552	154146554	+	Missense_Mutation	TNP	CCC	CCC	AAG	rs200348882		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr3:154146552_154146554CCC>AAG	ENST00000389740.2	-	1	950_952	c.851_853GGG>CTT	c.(850-855)gGGGct>gCTTct	p.284_285GA>AS		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	284					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			CAGGCTTCAGCCCCAGCGGCAGC	0.665																																																	0																																										SO:0001583	missense	0			AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.851_853GGG>CTT	3.37:g.154146552CCC>AAG	ENSP00000374390:p.G284_A285delinsAS			Missense_Mutation|Silent|Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.A285S|p.G284|p.G284A	ENST00000389740.2	37	c.853|c.852|c.851	CCDS43162.1	3																																																																																			GPR149	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000174948		0.665	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR149	HGNC	protein_coding	OTTHUMT00000353430.1	-	0.00	40|40|39	0	C	XM_293580		154146552|154146553|154146554	-1	tier1	-	no_errors	ENST00000389740	ensembl	human	known	74_37	missense|silent|missense	39.39	20	13	SNP	0.885|0.890|0.048	A|A|G
GTPBP4	23560	genome.wustl.edu	37	10	1053056	1053056	+	Silent	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr10:1053056G>A	ENST00000360803.4	+	10	1183	c.1101G>A	c.(1099-1101)agG>agA	p.R367R	GTPBP4_ENST00000491635.1_3'UTR|GTPBP4_ENST00000545048.1_Silent_p.R320R|GTPBP4_ENST00000538293.1_Silent_p.R251R	NM_012341.2	NP_036473.2	Q9BZE4	NOG1_HUMAN	GTP binding protein 4	367					GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of collagen binding (GO:0033342)|negative regulation of DNA replication (GO:0008156)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein stabilization (GO:0050821)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(1)	21		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		TCCCAACCAGGAGGGACGATA	0.537																																																	0													92.0	78.0	83.0					10																	1053056		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001548	CCDS31132.1	10p15-p14	2007-07-27			ENSG00000107937	ENSG00000107937			21535	protein-coding gene	gene with protein product	"""G protein-binding protein CRFG"", "" GTP-binding protein"""					11316846	Standard	NM_012341		Approved	CRFG, NGB, FLJ10690, FLJ10686, NOG1	uc001ift.3	Q9BZE4	OTTHUMG00000017538	ENST00000360803.4:c.1101G>A	10.37:g.1053056G>A			B3KMC5|B4DY13|B7Z7A3|O95446|Q5T3R8|Q9NVJ8	Silent	SNP	pfam_NOG1_Rossman_fold_dom,pfam_NOG_C,pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,pfam_MIRO-like,superfamily_P-loop_NTPase,prints_GTP_binding_domain,tigrfam_Small_GTP-bd_dom	p.R367	ENST00000360803.4	37	c.1101	CCDS31132.1	10																																																																																			GTPBP4	-	NULL	ENSG00000107937		0.537	GTPBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP4	HGNC	protein_coding	OTTHUMT00000046412.1	-	0.00	56	0	G	NM_012341		1053056	+1	tier1	-	no_errors	ENST00000360803	ensembl	human	known	74_37	silent	24.66	55	18	SNP	0.999	A
HCN1	348980	genome.wustl.edu	37	5	45262095	45262095	+	Silent	SNP	A	A	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr5:45262095A>T	ENST00000303230.4	-	8	2658	c.2601T>A	c.(2599-2601)ctT>ctA	p.L867L		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	867					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						ATTCTCTTGGAAGAGCAGCTG	0.547																																																	0													72.0	86.0	81.0					5																	45262095		2203	4300	6503	SO:0001819	synonymous_variant	0			AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.2601T>A	5.37:g.45262095A>T				Silent	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.L867	ENST00000303230.4	37	c.2601	CCDS3952.1	5																																																																																			HCN1	-	NULL	ENSG00000164588		0.547	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN1	HGNC	protein_coding	OTTHUMT00000253847.1	-	0.00	70	0	A	NM_021072		45262095	-1	tier1	-	no_errors	ENST00000303230	ensembl	human	known	74_37	silent	62.61	43	72	SNP	0.577	T
HCN4	10021	genome.wustl.edu	37	15	73635767	73635767	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr15:73635767G>A	ENST00000261917.3	-	2	2161	c.1168C>T	c.(1168-1170)Cgc>Tgc	p.R390C	RP11-272D12.1_ENST00000557981.1_RNA|RP11-272D12.1_ENST00000558742.1_RNA	NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	390					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.R390C(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		CGGGAGAGGCGTAACAGGCGT	0.572																																																	1	Substitution - Missense(1)	endometrium(1)											76.0	60.0	65.0					15																	73635767		2198	4297	6495	SO:0001583	missense	0			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.1168C>T	15.37:g.73635767G>A	ENSP00000261917:p.Arg390Cys		Q9UMQ7	Missense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,pfscan_cNMP-bd_dom	p.R390C	ENST00000261917.3	37	c.1168	CCDS10248.1	15	.	.	.	.	.	.	.	.	.	.	G	15.92	2.975976	0.53720	.	.	ENSG00000138622	ENST00000261917	D	0.98849	-5.18	5.34	4.41	0.53225	Ion transport (1);	.	.	.	.	D	0.99324	0.9763	H	0.94620	3.56	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98829	1.0750	9	0.87932	D	0	.	13.62	0.62132	0.0:0.0:0.7195:0.2805	.	390	Q9Y3Q4	HCN4_HUMAN	C	390	ENSP00000261917:R390C	ENSP00000261917:R390C	R	-	1	0	HCN4	71422820	1.000000	0.71417	0.973000	0.42090	0.796000	0.44982	4.527000	0.60573	1.355000	0.45865	0.655000	0.94253	CGC	HCN4	-	pfam_Ion_trans_dom	ENSG00000138622		0.572	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN4	HGNC	protein_coding	OTTHUMT00000268900.2	-	0.00	31	0	G	NM_005477		73635767	-1	tier1	-	no_errors	ENST00000261917	ensembl	human	known	74_37	missense	20.83	19	5	SNP	1.000	A
HECTD2	143279	genome.wustl.edu	37	10	93257887	93257887	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr10:93257887A>G	ENST00000298068.5	+	16	1797	c.1703A>G	c.(1702-1704)gAa>gGa	p.E568G	HECTD2_ENST00000371667.1_Missense_Mutation_p.E218G|HECTD2_ENST00000536715.1_Missense_Mutation_p.E157G|HECTD2_ENST00000446394.1_Missense_Mutation_p.E572G	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	568	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						GGATTAAGTGAACTCTTATCA	0.308																																					NSCLC(12;376 469 1699 39910 41417)												0													84.0	86.0	85.0					10																	93257887		2203	4294	6497	SO:0001583	missense	0			AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.1703A>G	10.37:g.93257887A>G	ENSP00000298068:p.Glu568Gly		Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	p.E572G	ENST00000298068.5	37	c.1715	CCDS7414.1	10	.	.	.	.	.	.	.	.	.	.	A	17.93	3.509745	0.64522	.	.	ENSG00000165338	ENST00000446394;ENST00000298068;ENST00000536715;ENST00000371667	T;T;T;T	0.59224	0.28;0.28;0.28;0.28	5.47	5.47	0.80525	HECT (4);	0.000000	0.85682	D	0.000000	T	0.73837	0.3638	M	0.65975	2.015	0.58432	D	0.999997	B;D	0.76494	0.27;0.999	B;D	0.72982	0.179;0.979	T	0.76900	-0.2788	10	0.72032	D	0.01	.	15.225	0.73345	1.0:0.0:0.0:0.0	.	572;568	E7ERR3;Q5U5R9	.;HECD2_HUMAN	G	572;568;157;218	ENSP00000401023:E572G;ENSP00000298068:E568G;ENSP00000439687:E157G;ENSP00000360731:E218G	ENSP00000298068:E568G	E	+	2	0	HECTD2	93247867	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.944000	0.87722	2.080000	0.62538	0.454000	0.30748	GAA	HECTD2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000165338		0.308	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD2	HGNC	protein_coding	OTTHUMT00000098620.1	-	0.00	43	0	A			93257887	+1	tier1	-	no_errors	ENST00000446394	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	G
HECTD4	283450	genome.wustl.edu	37	12	112717041	112717041	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr12:112717041A>G	ENST00000430131.2	-	9	1641	c.496T>C	c.(496-498)Tct>Cct	p.S166P	HECTD4_ENST00000550722.1_Missense_Mutation_p.S416P|HECTD4_ENST00000377560.5_Missense_Mutation_p.S416P			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	166					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.S416P(1)|p.S166P(1)									CTTTTTAAAGATGACAAACCA	0.398																																																	2	Substitution - Missense(2)	prostate(2)											72.0	71.0	71.0					12																	112717041		1846	4085	5931	SO:0001583	missense	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.496T>C	12.37:g.112717041A>G	ENSP00000404379:p.Ser166Pro		L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.S416P	ENST00000430131.2	37	c.1246		12	.	.	.	.	.	.	.	.	.	.	A	19.50	3.840147	0.71488	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.52295	0.73;0.72;0.67	5.54	5.54	0.83059	.	.	.	.	.	T	0.51805	0.1696	N	0.14661	0.345	0.48632	D	0.999686	D	0.54601	0.967	D	0.65874	0.939	T	0.60094	-0.7330	9	0.87932	D	0	.	15.6803	0.77364	1.0:0.0:0.0:0.0	.	166	Q9Y4D8	K0614_HUMAN	P	416;166;416	ENSP00000366783:S416P;ENSP00000404379:S166P;ENSP00000449784:S416P	ENSP00000366783:S416P	S	-	1	0	C12orf51	111201424	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	8.879000	0.92398	2.115000	0.64714	0.482000	0.46254	TCT	HECTD4	-	NULL	ENSG00000173064		0.398	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		-	0.00	57	0	A	NM_173813		112717041	-1	tier1	-	no_errors	ENST00000377560	ensembl	human	known	74_37	missense	14.29	54	9	SNP	1.000	G
HIST1H3D	8351	genome.wustl.edu	37	6	26197330	26197330	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr6:26197330C>A	ENST00000356476.2	-	1	148	c.149G>T	c.(148-150)cGc>cTc	p.R50L	HIST1H3D_ENST00000377831.5_Missense_Mutation_p.R50L|HIST1H2BF_ENST00000359985.1_5'Flank			P68431	H31_HUMAN	histone cluster 1, H3d	50					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)	14		all_hematologic(11;0.196)				GCGGATCTCGCGCAGAGCCAC	0.637																																					GBM(108;3816 4467)												0													46.0	50.0	49.0					6																	26197330		2203	4300	6503	SO:0001583	missense	0			Z80784	CCDS4590.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197409	ENSG00000197409		"""Histones / Replication-dependent"""	4767	protein-coding gene	gene with protein product		602811	"""H3 histone family, member B"", ""histone 1, H3d"""	H3FB		9119399, 12408966	Standard	NM_003530		Approved	H3/b	uc003ngv.4	P68431	OTTHUMG00000014433	ENST00000356476.2:c.149G>T	6.37:g.26197330C>A	ENSP00000366999:p.Arg50Leu		A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.R50L	ENST00000356476.2	37	c.149	CCDS4590.1	6	.	.	.	.	.	.	.	.	.	.	.	14.46	2.542014	0.45280	.	.	ENSG00000197409	ENST00000356476;ENST00000377831	T;T	0.49139	0.79;0.79	4.29	3.4	0.38934	.	.	.	.	.	T	0.47488	0.1448	.	.	.	0.34610	D	0.7175	.	.	.	.	.	.	T	0.55897	-0.8068	6	0.87932	D	0	.	13.3994	0.60874	0.0:0.8408:0.1592:0.0	.	.	.	.	L	50	ENSP00000366999:R50L;ENSP00000367062:R50L	ENSP00000366999:R50L	R	-	2	0	HIST1H3D	26305309	1.000000	0.71417	1.000000	0.80357	0.197000	0.23852	4.519000	0.60517	0.890000	0.36211	-0.176000	0.13171	CGC	HIST1H3D	-	superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000197409		0.637	HIST1H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3D	HGNC	protein_coding	OTTHUMT00000040096.1	-	0.00	108	0	C	NM_003530		26197330	-1	tier1	-	no_errors	ENST00000356476	ensembl	human	known	74_37	missense	29.93	96	41	SNP	1.000	A
HNRNPR	10236	genome.wustl.edu	37	1	23636558	23636558	+	3'UTR	SNP	T	T	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:23636558T>C	ENST00000374612.1	-	0	2414				HNRNPR_ENST00000478691.1_3'UTR|HNRNPR_ENST00000374616.3_3'UTR|HNRNPR_ENST00000476660.1_5'UTR|HNRNPR_ENST00000302271.6_3'UTR	NM_001102398.1|NM_005826.3	NP_001095868.1|NP_005817.1	O43390	HNRPR_HUMAN	heterogeneous nuclear ribonucleoprotein R						gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)		CACTAGCTTGTATTTTTATTT	0.284																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF000364	CCDS232.1, CCDS44085.1, CCDS60020.1, CCDS72726.1, CCDS72727.1	1p36.12	2013-02-12		2007-08-16	ENSG00000125944	ENSG00000125944		"""RNA binding motif (RRM) containing"""	5047	protein-coding gene	gene with protein product		607201		HNRPR		9421497	Standard	XM_005245711		Approved	hnRNP-R	uc001bgp.4	O43390	OTTHUMG00000003224	ENST00000374612.1:c.*389A>G	1.37:g.23636558T>C			Q2L7G6|Q5TEH1|Q9BV64|S4R3J4	RNA	SNP	-	NULL	ENST00000374612.1	37	NULL	CCDS232.1	1																																																																																			HNRNPR	-	-	ENSG00000125944		0.284	HNRNPR-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	HNRNPR	HGNC	protein_coding	OTTHUMT00000008889.1	-	0.00	15	0	T	NM_005826		23636558	-1	tier1	-	no_errors	ENST00000476660	ensembl	human	known	74_37	rna	55.00	9	11	SNP	1.000	C
HS3ST4	9951	genome.wustl.edu	37	16	26147420	26147420	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr16:26147420T>C	ENST00000331351.5	+	2	1614	c.1222T>C	c.(1222-1224)Tgc>Cgc	p.C408R	HS3ST4_ENST00000475436.1_3'UTR	NM_006040.2	NP_006031.2	Q9Y661	HS3S4_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 4	408					heparan sulfate proteoglycan metabolic process (GO:0030201)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(2)|endometrium(3)|large_intestine(1)|lung(9)	15				GBM - Glioblastoma multiforme(48;0.0988)		TGCCCCGAGGTGCTTAGGCAA	0.473																																																	0													54.0	50.0	51.0					16																	26147420		1568	3582	5150	SO:0001583	missense	0			AF105378	CCDS53995.1	16p11.2	2008-03-12			ENSG00000182601	ENSG00000182601	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5200	protein-coding gene	gene with protein product		604059				9988767	Standard	NM_006040		Approved	3OST4	uc002dof.3	Q9Y661	OTTHUMG00000059978	ENST00000331351.5:c.1222T>C	16.37:g.26147420T>C	ENSP00000330606:p.Cys408Arg		Q5QI42|Q8NDC2	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.C408R	ENST00000331351.5	37	c.1222	CCDS53995.1	16	.	.	.	.	.	.	.	.	.	.	T	21.3	4.123229	0.77436	.	.	ENSG00000182601	ENST00000331351	D	0.82893	-1.66	5.56	5.56	0.83823	Sulfotransferase domain (1);	0.000000	0.85682	U	0.000000	D	0.93880	0.8042	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95619	0.8679	10	0.87932	D	0	.	14.8801	0.70525	0.0:0.0:0.0:1.0	.	408	Q9Y661	HS3S4_HUMAN	R	408	ENSP00000330606:C408R	ENSP00000330606:C408R	C	+	1	0	HS3ST4	26054921	1.000000	0.71417	0.850000	0.33497	0.995000	0.86356	8.004000	0.88535	2.102000	0.63906	0.533000	0.62120	TGC	HS3ST4	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	ENSG00000182601		0.473	HS3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST4	HGNC	protein_coding	OTTHUMT00000133286.2	-	0.00	47	0	T	NM_006040		26147420	+1	tier1	-	no_errors	ENST00000331351	ensembl	human	known	74_37	missense	25.00	18	6	SNP	1.000	C
HSD17B7P2	158160	genome.wustl.edu	37	10	38651199	38651199	+	RNA	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr10:38651199C>A	ENST00000494540.1	+	0	346					NR_003086.1				hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2																		CCGTATATATCTAAATGCTGG	0.353																																																	0																																												0					10p11.1	2011-06-29			ENSG00000099251	ENSG00000099251			28120	pseudogene	pseudogene						10544267	Standard	NR_003086		Approved	HSD17B7, bA291L22.1	uc010qex.1		OTTHUMG00000017993		10.37:g.38651199C>A				RNA	SNP	-	NULL	ENST00000494540.1	37	NULL		10																																																																																			HSD17B7P2	-	-	ENSG00000099251		0.353	HSD17B7P2-001	KNOWN	basic	processed_transcript	HSD17B7P2	HGNC	pseudogene	OTTHUMT00000047631.2	-	0.00	120	0	C	NR_003086		38651199	+1	tier1	-	no_errors	ENST00000494540	ensembl	human	known	74_37	rna	53.15	52	59	SNP	0.970	A
HTATSF1	27336	genome.wustl.edu	37	X	135585059	135585059	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chrX:135585059G>C	ENST00000218364.4	+	5	867	c.693G>C	c.(691-693)aaG>aaC	p.K231N	HTATSF1_ENST00000535601.1_Missense_Mutation_p.K231N	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	231	Poly-Lys.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					AGAAGAAGAAGAAGTGCAAAG	0.323																																																	0													98.0	102.0	101.0					X																	135585059		2203	4299	6502	SO:0001583	missense	0			U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.693G>C	X.37:g.135585059G>C	ENSP00000218364:p.Lys231Asn		D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K231N	ENST00000218364.4	37	c.693	CCDS14657.1	X	.	.	.	.	.	.	.	.	.	.	G	15.35	2.808286	0.50421	.	.	ENSG00000102241	ENST00000535601;ENST00000448450;ENST00000218364;ENST00000415377	T;T	0.26518	1.73;1.73	5.5	2.82	0.32997	.	0.000000	0.85682	D	0.000000	T	0.42854	0.1221	M	0.64997	1.995	0.58432	D	0.999996	D	0.76494	0.999	D	0.67548	0.952	T	0.11108	-1.0601	10	0.49607	T	0.09	-14.4967	10.3388	0.43864	0.2189:0.0:0.7811:0.0	.	231	O43719	HTSF1_HUMAN	N	231	ENSP00000442699:K231N;ENSP00000218364:K231N	ENSP00000218364:K231N	K	+	3	2	HTATSF1	135412725	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	4.230000	0.58632	0.175000	0.19841	0.468000	0.43344	AAG	HTATSF1	-	NULL	ENSG00000102241		0.323	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTATSF1	HGNC	protein_coding	OTTHUMT00000058497.1	-	0.00	59	0	G	NM_014500		135585059	+1	tier1	-	no_errors	ENST00000218364	ensembl	human	known	74_37	missense	5.49	86	5	SNP	1.000	C
HTR1A	3350	genome.wustl.edu	37	5	63256806	63256806	+	Silent	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr5:63256806G>T	ENST00000323865.3	-	1	974	c.741C>A	c.(739-741)gcC>gcA	p.A247A	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	247					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	TGGGCTGCGGGGCGGGAGATG	0.642																																																	0													56.0	58.0	57.0					5																	63256806		2203	4300	6503	SO:0001819	synonymous_variant	0			AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.741C>A	5.37:g.63256806G>T			Q6LAE7	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_5HT1A_rcpt,prints_GPCR_Rhodpsn,prints_5HT_rcpt,prints_NPY_rcpt	p.A247	ENST00000323865.3	37	c.741	CCDS34168.1	5																																																																																			HTR1A	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000178394		0.642	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1A	HGNC	protein_coding	OTTHUMT00000368397.1	-	0.00	55	0	G	NM_000524		63256806	-1	tier1	-	no_errors	ENST00000323865	ensembl	human	known	74_37	silent	44.90	27	22	SNP	0.012	T
HTR2A	3356	genome.wustl.edu	37	13	47466612	47466612	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr13:47466612C>T	ENST00000378688.4	-	2	657	c.526G>A	c.(526-528)Gcc>Acc	p.A176T	HTR2A_ENST00000542664.1_Missense_Mutation_p.A176T|HTR2A_ENST00000543956.1_Missense_Mutation_p.A92T			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	176					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.A176T(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TTCTGGATGGCGACGTAGCGG	0.527																																																	1	Substitution - Missense(1)	kidney(1)											247.0	238.0	241.0					13																	47466612		2203	4300	6503	SO:0001583	missense	0			X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.526G>A	13.37:g.47466612C>T	ENSP00000367959:p.Ala176Thr		B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_5HT2A_rcpt,prints_GPCR_Rhodpsn,prints_5HT_rcpt	p.A176T	ENST00000378688.4	37	c.526	CCDS9405.1	13	.	.	.	.	.	.	.	.	.	.	C	36	5.860701	0.97036	.	.	ENSG00000102468	ENST00000378688;ENST00000543956;ENST00000542664	T;T;T	0.53423	0.62;0.62;0.62	6.16	6.16	0.99307	GPCR, rhodopsin-like superfamily (1);	0.056380	0.64402	D	0.000001	T	0.80894	0.4711	H	0.96805	3.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.964;0.994	D	0.86003	0.1496	10	0.87932	D	0	.	19.848	0.96722	0.0:1.0:0.0:0.0	.	92;176	F5GWE8;P28223	.;5HT2A_HUMAN	T	176;92;176	ENSP00000367959:A176T;ENSP00000441861:A92T;ENSP00000437737:A176T	ENSP00000367959:A176T	A	-	1	0	HTR2A	46364613	1.000000	0.71417	0.971000	0.41717	0.959000	0.62525	7.736000	0.84948	2.937000	0.99478	0.650000	0.86243	GCC	HTR2A	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000102468		0.527	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR2A	HGNC	protein_coding	OTTHUMT00000044835.3	-	0.00	50	0	C	NM_000621		47466612	-1	tier1	-	no_errors	ENST00000378688	ensembl	human	known	74_37	missense	6.94	67	5	SNP	1.000	T
HTT	3064	genome.wustl.edu	37	4	3225799	3225799	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr4:3225799C>T	ENST00000355072.5	+	56	7851	c.7706C>T	c.(7705-7707)gCc>gTc	p.A2569V		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2569					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)	p.A2569V(1)		breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GAGAATATTGCCACCCATCAT	0.478																																																	1	Substitution - Missense(1)	skin(1)											137.0	147.0	144.0					4																	3225799		2115	4244	6359	SO:0001583	missense	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.7706C>T	4.37:g.3225799C>T	ENSP00000347184:p.Ala2569Val		Q9UQB7	Missense_Mutation	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.A2569V	ENST00000355072.5	37	c.7706	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	C	16.23	3.063993	0.55432	.	.	ENSG00000197386	ENST00000355072	T	0.05925	3.37	5.53	5.53	0.82687	.	0.275956	0.35013	N	0.003510	T	0.09949	0.0244	L	0.44542	1.39	0.49299	D	0.999774	B	0.33583	0.418	B	0.36134	0.218	T	0.11372	-1.0590	10	0.42905	T	0.14	.	19.4679	0.94950	0.0:1.0:0.0:0.0	.	2569	P42858	HD_HUMAN	V	2569	ENSP00000347184:A2569V	ENSP00000347184:A2569V	A	+	2	0	HTT	3195597	1.000000	0.71417	0.997000	0.53966	0.669000	0.39330	4.420000	0.59841	2.611000	0.88343	0.650000	0.86243	GCC	HTT	-	NULL	ENSG00000197386		0.478	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2	-	0.00	61	0	C	NM_002111		3225799	+1	tier1	-	no_errors	ENST00000355072	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
HYDIN	54768	genome.wustl.edu	37	16	70902609	70902609	+	Missense_Mutation	SNP	C	C	T	rs543925506		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr16:70902609C>T	ENST00000393567.2	-	66	11324	c.11174G>A	c.(11173-11175)cGg>cAg	p.R3725Q	SNORD112_ENST00000515891.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3725					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GCACCTGATCCGCATATTCTT	0.547																																																	0													48.0	46.0	47.0					16																	70902609		1940	4138	6078	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.11174G>A	16.37:g.70902609C>T	ENSP00000377197:p.Arg3725Gln		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_PapD-like	p.R3725Q	ENST00000393567.2	37	c.11174	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	7.379	0.628404	0.14257	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00882	5.58	5.03	0.405	0.16361	.	1.822540	0.04312	U	0.349221	T	0.00666	0.0022	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.48969	-0.8987	10	0.13470	T	0.59	.	0.1882	0.00131	0.2306:0.2777:0.2156:0.276	.	3724	F8WD23	.	Q	3725;3724	ENSP00000377197:R3725Q	ENSP00000313052:R3724Q	R	-	2	0	HYDIN	69460110	0.000000	0.05858	0.082000	0.20525	0.719000	0.41307	-0.181000	0.09740	0.169000	0.19679	0.511000	0.50034	CGG	HYDIN	-	NULL	ENSG00000157423		0.547	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	-	0.00	48	0	C			70902609	-1	tier1	-	no_errors	ENST00000393567	ensembl	human	putative	74_37	missense	44.12	19	15	SNP	0.000	T
IARS	3376	genome.wustl.edu	37	9	95004464	95004464	+	Missense_Mutation	SNP	T	T	C	rs376036840		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr9:95004464T>C	ENST00000375643.3	-	29	3415	c.3149A>G	c.(3148-3150)gAt>gGt	p.D1050G	IARS_ENST00000375627.1_Missense_Mutation_p.D103G|IARS_ENST00000375629.3_Missense_Mutation_p.D103G|IARS_ENST00000443024.2_Missense_Mutation_p.D1050G|IARS_ENST00000447699.2_Missense_Mutation_p.D940G|IARS_ENST00000474340.1_5'UTR	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	1050					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	AAGGACTTTATCCGATGGAGA	0.388																																																	0													148.0	146.0	146.0					9																	95004464		2203	4300	6503	SO:0001583	missense	0			AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.3149A>G	9.37:g.95004464T>C	ENSP00000364794:p.Asp1050Gly		A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Missense_Mutation	SNP	pfam_aa-tRNA-synth_Ia,pfam_V/L/I-tRNA-synth_anticodon-bd,pfam_Methionyl/Leucyl_tRNA_Synth,superfamily_Val/Leu/Ile-tRNA-synth_edit,superfamily_tRNAsynth_1a_anticodon-bd,prints_Ile-tRNA-ligase,tigrfam_Ile-tRNA-ligase	p.D1050G	ENST00000375643.3	37	c.3149	CCDS6694.1	9	.	.	.	.	.	.	.	.	.	.	T	8.952	0.968416	0.18659	.	.	ENSG00000196305	ENST00000375643;ENST00000375629;ENST00000443024;ENST00000447699;ENST00000375660;ENST00000375627	T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93	6.05	4.93	0.64822	.	0.416196	0.31531	N	0.007496	T	0.24122	0.0584	N	0.13168	0.305	0.34625	D	0.718959	B;B;B	0.13594	0.008;0.0;0.0	B;B;B	0.15052	0.012;0.001;0.001	T	0.24512	-1.0158	10	0.29301	T	0.29	-15.9675	8.6557	0.34062	0.0:0.143:0.0:0.857	.	560;1050;895	F5H1M4;P41252;Q6P0M4	.;SYIC_HUMAN;.	G	1050;103;1050;940;1050;103	ENSP00000364794:D1050G;ENSP00000364780:D103G;ENSP00000406448:D1050G;ENSP00000415020:D940G;ENSP00000364778:D103G	ENSP00000364778:D103G	D	-	2	0	IARS	94044285	1.000000	0.71417	0.960000	0.40013	0.109000	0.19521	1.668000	0.37481	2.311000	0.77944	0.528000	0.53228	GAT	IARS	-	NULL	ENSG00000196305		0.388	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IARS	HGNC	protein_coding	OTTHUMT00000053059.2	-	0.00	60	0	T	NM_002161		95004464	-1	tier1	-	no_errors	ENST00000375643	ensembl	human	known	74_37	missense	14.55	47	8	SNP	0.998	C
IFT140	9742	genome.wustl.edu	37	16	1576005	1576005	+	Missense_Mutation	SNP	C	C	T	rs150498538	byFrequency	TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr16:1576005C>T	ENST00000426508.2	-	21	3014	c.2651G>A	c.(2650-2652)cGg>cAg	p.R884Q	IFT140_ENST00000361339.5_Missense_Mutation_p.R78Q|TMEM204_ENST00000253934.5_5'Flank	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	884					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				CTCCTGCCACCGGCCCGCAGC	0.667																																																	0								C	GLN/ARG	0,4390		0,0,2195	38.0	36.0	37.0		2651	3.9	1.0	16	dbSNP_134	37	3,8591		0,3,4294	yes	missense	IFT140	NM_014714.3	43	0,3,6489	TT,TC,CC		0.0349,0.0,0.0231	benign	884/1463	1576005	3,12981	2195	4297	6492	SO:0001583	missense	0			AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.2651G>A	16.37:g.1576005C>T	ENSP00000406012:p.Arg884Gln		A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R884Q	ENST00000426508.2	37	c.2651	CCDS10439.1	16	.	.	.	.	.	.	.	.	.	.	C	2.044	-0.419267	0.04766	0.0	3.49E-4	ENSG00000187535	ENST00000397417;ENST00000361339;ENST00000426508	T;T	0.55588	0.51;0.51	5.03	3.93	0.45458	.	0.067424	0.64402	N	0.000010	T	0.16385	0.0394	N	0.00510	-1.415	0.27314	N	0.957232	B;B	0.10296	0.0;0.003	B;B	0.08055	0.0;0.003	T	0.26710	-1.0095	10	0.06099	T	0.92	.	9.5058	0.39046	0.0:0.0814:0.0:0.9186	.	884;571	Q96RY7;B4DR58	IF140_HUMAN;.	Q	884;78;884	ENSP00000354895:R78Q;ENSP00000406012:R884Q	ENSP00000354895:R78Q	R	-	2	0	IFT140	1516006	1.000000	0.71417	0.987000	0.45799	0.022000	0.10575	4.102000	0.57776	0.886000	0.36113	-0.340000	0.08031	CGG	IFT140	-	NULL	ENSG00000187535		0.667	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT140	HGNC	protein_coding	OTTHUMT00000250438.2	-	0.00	60	0	C	NM_014714		1576005	-1	tier1	rs150498538	no_errors	ENST00000426508	ensembl	human	known	74_37	missense	8.62	53	5	SNP	1.000	T
IFT172	26160	genome.wustl.edu	37	2	27669161	27669161	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:27669161T>C	ENST00000260570.3	-	43	4824	c.4721A>G	c.(4720-4722)gAc>gGc	p.D1574G	KRTCAP3_ENST00000543753.1_Intron	NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	1574					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)		p.D1574G(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					GAAGGCTTTGTCTACAGGTAG	0.473																																																	1	Substitution - Missense(1)	large_intestine(1)											92.0	84.0	87.0					2																	27669161		2203	4300	6503	SO:0001583	missense	0			AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.4721A>G	2.37:g.27669161T>C	ENSP00000260570:p.Asp1574Gly		A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat	p.D1574G	ENST00000260570.3	37	c.4721	CCDS1755.1	2	.	.	.	.	.	.	.	.	.	.	T	23.5	4.428223	0.83667	.	.	ENSG00000138002	ENST00000260570	T	0.72167	-0.63	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	D	0.85089	0.5617	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87584	0.2486	10	0.87932	D	0	-20.7145	12.422	0.55525	0.0:0.0:0.0:1.0	.	1574	Q9UG01	IF172_HUMAN	G	1574	ENSP00000260570:D1574G	ENSP00000260570:D1574G	D	-	2	0	IFT172	27522665	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.122000	0.77169	1.974000	0.57490	0.459000	0.35465	GAC	IFT172	-	NULL	ENSG00000138002		0.473	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT172	HGNC	protein_coding	OTTHUMT00000250213.2	-	0.00	44	0	T	NM_015662		27669161	-1	tier1	-	no_errors	ENST00000260570	ensembl	human	known	74_37	missense	43.40	30	23	SNP	1.000	C
IPPK	64768	genome.wustl.edu	37	9	95400468	95400468	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr9:95400468G>T	ENST00000287996.3	-	9	1007	c.731C>A	c.(730-732)tCc>tAc	p.S244Y	IPPK_ENST00000375522.1_5'Flank	NM_022755.5	NP_073592.1	Q9H8X2	IPPK_HUMAN	inositol 1,3,4,5,6-pentakisphosphate 2-kinase	244					inositol phosphate metabolic process (GO:0043647)|inositol phosphorylation (GO:0052746)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|inositol pentakisphosphate 2-kinase activity (GO:0035299)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(2)|urinary_tract(1)	15						CAGGCCGTTGGAAGGGAAGAA	0.622																																																	0													63.0	63.0	63.0					9																	95400468		2203	4300	6503	SO:0001583	missense	0			AK023225	CCDS6699.1	9q22.31	2010-12-02	2005-10-20	2005-10-20	ENSG00000127080	ENSG00000127080			14645	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 12"""	C9orf12		12084730	Standard	NM_022755		Approved	INSP5K2, FLJ13163, IP5K, IPK1	uc004asl.1	Q9H8X2	OTTHUMG00000020231	ENST00000287996.3:c.731C>A	9.37:g.95400468G>T	ENSP00000287996:p.Ser244Tyr		Q5T9F7|Q9H7V8	Missense_Mutation	SNP	pfam_Ins_P5_2-kin	p.S244Y	ENST00000287996.3	37	c.731	CCDS6699.1	9	.	.	.	.	.	.	.	.	.	.	G	16.77	3.213670	0.58452	.	.	ENSG00000127080	ENST00000287996	T	0.32753	1.44	5.24	4.35	0.52113	.	0.235720	0.44483	D	0.000453	T	0.33206	0.0855	L	0.34521	1.04	0.80722	D	1	D	0.61080	0.989	P	0.58077	0.832	T	0.08391	-1.0724	10	0.02654	T	1	-14.8032	14.1794	0.65564	0.0725:0.0:0.9275:0.0	.	244	Q9H8X2	IPPK_HUMAN	Y	244	ENSP00000287996:S244Y	ENSP00000287996:S244Y	S	-	2	0	IPPK	94440289	1.000000	0.71417	0.316000	0.25252	0.342000	0.28953	4.346000	0.59367	1.357000	0.45904	-0.258000	0.10820	TCC	IPPK	-	pfam_Ins_P5_2-kin	ENSG00000127080		0.622	IPPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPPK	HGNC	protein_coding	OTTHUMT00000053101.1	-	0.00	55	0	G	NM_022755		95400468	-1	tier1	-	no_errors	ENST00000287996	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.964	T
IQCE	23288	genome.wustl.edu	37	7	2623316	2623316	+	Silent	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr7:2623316G>T	ENST00000402050.2	+	10	931	c.747G>T	c.(745-747)cgG>cgT	p.R249R	IQCE_ENST00000497572.1_3'UTR|IQCE_ENST00000404984.1_Silent_p.R198R|IQCE_ENST00000438376.2_Silent_p.R233R|IQCE_ENST00000325979.7_Silent_p.R184R	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	249						mitochondrion (GO:0005739)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		AAGAGATGCGGATCGCCATGG	0.637																																																	0													63.0	67.0	66.0					7																	2623316		2064	4201	6265	SO:0001819	synonymous_variant	0			AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.747G>T	7.37:g.2623316G>T			Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Silent	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.R249	ENST00000402050.2	37	c.747	CCDS43542.1	7																																																																																			IQCE	-	NULL	ENSG00000106012		0.637	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IQCE	HGNC	protein_coding	OTTHUMT00000325063.2	-	0.00	33	0	G	NM_152558		2623316	+1	tier1	-	no_errors	ENST00000402050	ensembl	human	known	74_37	silent	32.79	41	20	SNP	0.913	T
ITGA4	3676	genome.wustl.edu	37	2	182400231	182400231	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:182400231A>G	ENST00000397033.2	+	28	3506	c.3076A>G	c.(3076-3078)Aac>Gac	p.N1026D		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	1026					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	GAGTTATATCAACAGTAAAAG	0.318																																																	0													138.0	138.0	138.0					2																	182400231		1824	4080	5904	SO:0001583	missense	0				CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.3076A>G	2.37:g.182400231A>G	ENSP00000380227:p.Asn1026Asp		D3DPG4|Q7Z4L6	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.N1026D	ENST00000397033.2	37	c.3076	CCDS42788.1	2	.	.	.	.	.	.	.	.	.	.	A	12.27	1.887331	0.33348	.	.	ENSG00000115232	ENST00000397033	T	0.64438	-0.1	5.24	4.09	0.47781	.	0.233745	0.51477	D	0.000100	T	0.38374	0.1038	N	0.08118	0	0.30186	N	0.799913	B	0.06786	0.001	B	0.08055	0.003	T	0.28744	-1.0034	10	0.25106	T	0.35	.	10.4156	0.44320	0.9233:0.0:0.0767:0.0	.	1026	P13612	ITA4_HUMAN	D	1026	ENSP00000380227:N1026D	ENSP00000380227:N1026D	N	+	1	0	ITGA4	182108476	1.000000	0.71417	0.888000	0.34837	0.419000	0.31324	3.403000	0.52615	1.966000	0.57179	0.460000	0.39030	AAC	ITGA4	-	NULL	ENSG00000115232		0.318	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA4	HGNC	protein_coding	OTTHUMT00000334427.1	-	0.00	37	0	A			182400231	+1	tier1	-	no_errors	ENST00000397033	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.964	G
ITGAL	3683	genome.wustl.edu	37	16	30506164	30506164	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr16:30506164G>T	ENST00000356798.6	+	13	1676	c.1496G>T	c.(1495-1497)aGa>aTa	p.R499I	ITGAL_ENST00000433423.2_Intron|ITGAL_ENST00000358164.5_Missense_Mutation_p.R416I|ITGAL_ENST00000568012.1_3'UTR	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	499					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	ATCTACCAGAGAAGACAGGTG	0.582																																					NSCLC(110;1462 1641 3311 33990 49495)												0													67.0	68.0	68.0					16																	30506164		2197	4300	6497	SO:0001583	missense	0				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.1496G>T	16.37:g.30506164G>T	ENSP00000349252:p.Arg499Ile		O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.R499I	ENST00000356798.6	37	c.1496	CCDS32433.1	16	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910861	0.52439	.	.	ENSG00000005844	ENST00000356798;ENST00000358164	T;T	0.11063	2.81;2.81	5.71	1.62	0.23740	.	0.325943	0.26489	N	0.024083	T	0.11239	0.0274	L	0.31804	0.96	0.09310	N	0.999997	P;B	0.52577	0.954;0.415	P;B	0.50617	0.646;0.147	T	0.11372	-1.0590	10	0.51188	T	0.08	.	7.6787	0.28500	0.3358:0.0:0.6642:0.0	.	416;499	Q96HB1;P20701	.;ITAL_HUMAN	I	499;416	ENSP00000349252:R499I;ENSP00000350886:R416I	ENSP00000349252:R499I	R	+	2	0	ITGAL	30413665	0.000000	0.05858	0.247000	0.24249	0.461000	0.32589	0.025000	0.13577	0.091000	0.17302	0.655000	0.94253	AGA	ITGAL	-	smart_Int_alpha_beta-p	ENSG00000005844		0.582	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAL	HGNC	protein_coding	OTTHUMT00000434508.2	-	0.00	71	0	G			30506164	+1	tier1	-	no_errors	ENST00000356798	ensembl	human	known	74_37	missense	7.58	61	5	SNP	0.049	T
KAT6B	23522	genome.wustl.edu	37	10	76729794	76729794	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr10:76729794delG	ENST00000287239.4	+	6	1352	c.863delG	c.(862-864)tgtfs	p.C288fs	KAT6B_ENST00000372711.1_Frame_Shift_Del_p.C288fs|KAT6B_ENST00000372714.1_Frame_Shift_Del_p.C288fs|KAT6B_ENST00000372725.1_Frame_Shift_Del_p.C288fs|KAT6B_ENST00000372724.1_Frame_Shift_Del_p.C288fs	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	288					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										ATGCTTTTTTGTGATTCCTGT	0.318																																																	0													63.0	61.0	61.0					10																	76729794		2203	4300	6503	SO:0001589	frameshift_variant	0			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.863delG	10.37:g.76729794delG	ENSP00000287239:p.Cys288fs		O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Frame_Shift_Del	DEL	pfam_MOZ_SAS,pfam_Znf_PHD-finger,pfam_Histone_H1/H5_H15,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5_H15,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.C288fs	ENST00000287239.4	37	c.863	CCDS7345.1	10																																																																																			KAT6B	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000156650		0.318	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6B	HGNC	protein_coding	OTTHUMT00000048771.1		0.00	72	0	G	NM_012330		76729794	+1	tier1		no_errors	ENST00000287239	ensembl	human	known	74_37	frame_shift_del	18.75	39	9	DEL	1.000	-
KCNJ12	3768	genome.wustl.edu	37	17	21319344	21319344	+	Silent	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr17:21319344G>A	ENST00000583088.1	+	3	1585	c.690G>A	c.(688-690)gcG>gcA	p.A230A	KCNJ12_ENST00000331718.5_Silent_p.A230A	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	230					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	ATGTGCGCGCGCAGCTCATCA	0.642										Prostate(3;0.18)																																							0													88.0	69.0	76.0					17																	21319344		2203	4300	6503	SO:0001819	synonymous_variant	0			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.690G>A	17.37:g.21319344G>A			O43401|Q15756|Q8NG63	Silent	SNP	pfam_K_chnl_inward-rec_Kir,pfam_K_chnl_inward-rec_Kir_N,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.2	p.A230	ENST00000583088.1	37	c.690	CCDS11219.1	17																																																																																			KCNJ12	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir	ENSG00000184185		0.642	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ12	HGNC	protein_coding	OTTHUMT00000255060.2	-	0.00	91	0	G	NM_021012		21319344	+1	tier1	-	no_errors	ENST00000331718	ensembl	human	known	74_37	silent	13.89	62	10	SNP	0.992	A
KCNK10	54207	genome.wustl.edu	37	14	88693816	88693816	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr14:88693816A>T	ENST00000340700.5	-	4	1020	c.569T>A	c.(568-570)tTt>tAt	p.F190Y	KCNK10_ENST00000319231.5_Missense_Mutation_p.F195Y|KCNK10_ENST00000312350.5_Missense_Mutation_p.F195Y	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	190					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						TGGAATTCCAAAGATGGCATA	0.428																																																	0													121.0	125.0	124.0					14																	88693816		2203	4300	6503	SO:0001583	missense	0			AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.569T>A	14.37:g.88693816A>T	ENSP00000343104:p.Phe190Tyr		B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TASK	p.F195Y	ENST00000340700.5	37	c.584	CCDS9880.1	14	.	.	.	.	.	.	.	.	.	.	A	34	5.396220	0.96009	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231	T;T;T	0.32272	1.46;1.46;1.46	6.17	6.17	0.99709	Ion transport 2 (1);	0.044338	0.85682	D	0.000000	T	0.57140	0.2033	M	0.75085	2.285	0.80722	D	1	D;D;D	0.71674	0.996;0.998;0.99	D;D;P	0.71870	0.953;0.975;0.845	T	0.60311	-0.7288	10	0.87932	D	0	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	190;195;195	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	Y	190;195;195	ENSP00000343104:F190Y;ENSP00000310568:F195Y;ENSP00000312811:F195Y	ENSP00000310568:F195Y	F	-	2	0	KCNK10	87763569	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.339000	0.96797	2.371000	0.80710	0.533000	0.62120	TTT	KCNK10	-	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl	ENSG00000100433		0.428	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK10	HGNC	protein_coding	OTTHUMT00000410167.1	-	0.00	43	0	A	NM_021161		88693816	-1	tier1	-	no_errors	ENST00000312350	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
KIF15	56992	genome.wustl.edu	37	3	44847376	44847376	+	Silent	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr3:44847376G>A	ENST00000326047.4	+	16	2018	c.1869G>A	c.(1867-1869)ttG>ttA	p.L623L	KIF15_ENST00000425755.1_Silent_p.L258L	NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	623					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		TTCAGTCTTTGCAAAAAGCGA	0.348																																																	0													106.0	122.0	117.0					3																	44847376		2203	4300	6503	SO:0001819	synonymous_variant	0			AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.1869G>A	3.37:g.44847376G>A			Q17RV9|Q69YL6|Q96JX7|Q9H280	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L623	ENST00000326047.4	37	c.1869	CCDS33744.1	3																																																																																			KIF15	-	NULL	ENSG00000163808		0.348	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF15	HGNC	protein_coding	OTTHUMT00000343831.2	-	0.00	65	0	G			44847376	+1	tier1	-	no_errors	ENST00000326047	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.996	A
KMO	8564	genome.wustl.edu	37	1	241695726	241695727	+	5'UTR	INS	-	-	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:241695726_241695727insA	ENST00000366559.4	+	0	293_294				KMO_ENST00000366557.4_5'UTR|KMO_ENST00000366558.3_5'UTR|KMO_ENST00000484628.1_3'UTR	NM_003679.4	NP_003670.2			kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)											NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			CAATAATTGTGAAAAATACTTC	0.386																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF056032	CCDS1618.1	1q42-q44	2010-11-23			ENSG00000117009	ENSG00000117009	1.14.13.9		6381	protein-coding gene	gene with protein product		603538				9237672	Standard	NM_003679		Approved		uc009xgp.3	O15229	OTTHUMG00000039635	ENST00000366559.4:c.-18->A	1.37:g.241695731_241695731dupA				RNA	INS	-	NULL	ENST00000366559.4	37	NULL	CCDS1618.1	1																																																																																			KMO	-	-	ENSG00000117009		0.386	KMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMO	HGNC	protein_coding	OTTHUMT00000095612.1		0.00	49	0	-	NM_003679		241695727	+1	tier1		no_errors	ENST00000477907	ensembl	human	known	74_37	rna	9.59	66	7	INS	0.000:0.000	A
KRT80	144501	genome.wustl.edu	37	12	52585450	52585450	+	Silent	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr12:52585450C>A	ENST00000394815.2	-	1	334	c.237G>T	c.(235-237)ctG>ctT	p.L79L	KRT80_ENST00000313234.5_Silent_p.L79L	NM_182507.2	NP_872313.2	Q6KB66	K2C80_HUMAN	keratin 80	79	Head.					cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(2)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.108)		CCTGGTTCTTCAGCTGCTGAA	0.562																																					GBM(178;2309 2916 15678 35873)												0													70.0	77.0	74.0					12																	52585450		1975	4166	6141	SO:0001819	synonymous_variant	0			BX537567	CCDS8821.2, CCDS41784.1	12q13.13	2013-01-16			ENSG00000167767	ENSG00000167767		"""-"", ""Intermediate filaments type II, keratins (basic)"""	27056	protein-coding gene	gene with protein product		611161				16831889	Standard	NM_001081492		Approved	KB20	uc001rzx.3	Q6KB66	OTTHUMG00000150193	ENST00000394815.2:c.237G>T	12.37:g.52585450C>A			Q6P1A5|Q7Z3Q0	Silent	SNP	pfam_IF,prints_Keratin_II,prints_Keratin_I	p.L79	ENST00000394815.2	37	c.237	CCDS8821.2	12																																																																																			KRT80	-	NULL	ENSG00000167767		0.562	KRT80-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KRT80	HGNC	protein_coding	OTTHUMT00000316757.1	-	0.00	54	0	C	NM_182507		52585450	-1	tier1	-	no_errors	ENST00000394815	ensembl	human	known	74_37	silent	15.91	37	7	SNP	1.000	A
KRT7	3855	genome.wustl.edu	37	12	52635270	52635270	+	Silent	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr12:52635270G>A	ENST00000331817.5	+	5	891	c.708G>A	c.(706-708)ctG>ctA	p.L236L		NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	236	Coil 1B.|Rod.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	TGACAGAGCTGCAGTCCCAGA	0.582																																																	0													85.0	73.0	77.0					12																	52635270		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.708G>A	12.37:g.52635270G>A			Q92676|Q9BUD8|Q9Y3R7	Silent	SNP	pfam_IF,superfamily_Prefoldin,superfamily_Chorismate_mutase_type_II,prints_Keratin_II	p.L236	ENST00000331817.5	37	c.708	CCDS8822.1	12																																																																																			KRT7	-	pfam_IF,superfamily_Prefoldin	ENSG00000135480		0.582	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT7	HGNC	protein_coding	OTTHUMT00000404897.1	-	0.00	73	0	G	NM_005556		52635270	+1	tier1	-	no_errors	ENST00000331817	ensembl	human	known	74_37	silent	9.26	49	5	SNP	1.000	A
KRTAP21-3	100288323	genome.wustl.edu	37	21	32091050	32091051	+	Missense_Mutation	DNP	CA	CA	AG			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C|A	C|A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr21:32091050_32091051CA>AG	ENST00000444335.1	-	1	44_45	c.27_28TG>CT	c.(25-30)tgTGgg>tgCTgg	p.G10W		NM_001164435.1	NP_001157907.1	Q3LHN1	KR213_HUMAN	keratin associated protein 21-3	10						intermediate filament (GO:0005882)											CCACAGCTCCCACACACACTTT	0.406																																																	0																																										SO:0001583	missense	0			AB180042	CCDS54481.1	21q22.11	2011-02-24			ENSG00000231068	ENSG00000231068		"""Keratin associated proteins"""	34216	protein-coding gene	gene with protein product							Standard	NM_001164435		Approved		uc021wii.1	Q3LHN1	OTTHUMG00000125533	ENST00000444335.1:c.27_28delinsAG	21.37:g.32091050_32091051delinsAG	ENSP00000404517:p.Gly10Trp			Missense_Mutation|Silent	SNP	NULL	p.G10W|p.C9	ENST00000444335.1	37	c.28|c.27	CCDS54481.1	21																																																																																			KRTAP21-3	-	NULL	ENSG00000231068		0.406	KRTAP21-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP21-3	HGNC	protein_coding	OTTHUMT00000246864.1	-	0.00	40|39	0	C|A	XM_002343741		32091050|32091051	-1	tier1	-	no_errors	ENST00000444335	ensembl	human	known	74_37	missense|silent	22.50	31	9	SNP	0.091|0.086	A|G
LAMB1	3912	genome.wustl.edu	37	7	107642184	107642184	+	Intron	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr7:107642184G>A	ENST00000222399.6	-	3	268				LAMB1_ENST00000393560.1_Intron|U3_ENST00000458938.1_RNA|LAMB1_ENST00000393561.1_Missense_Mutation_p.P35L	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						CAGGGCTGCGGGAAGGACAGG	0.647																																																	0													11.0	13.0	13.0					7																	107642184		2191	4282	6473	SO:0001627	intron_variant	0			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.38-6C>T	7.37:g.107642184G>A			Q14D91	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Prefoldin,superfamily_t-SNARE,superfamily_P-loop_NTPase,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.P35L	ENST00000222399.6	37	c.104	CCDS5750.1	7	.	.	.	.	.	.	.	.	.	.	G	15.76	2.927593	0.52759	.	.	ENSG00000091136	ENST00000393561	T	0.30182	1.54	4.44	-0.00475	0.14020	.	.	.	.	.	T	0.09686	0.0238	.	.	.	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.33007	-0.9885	8	0.06099	T	0.92	.	1.3402	0.02153	0.3562:0.1408:0.3598:0.1432	.	35	G3XAI2	.	L	35	ENSP00000377191:P35L	ENSP00000377191:P35L	P	-	2	0	LAMB1	107429420	0.009000	0.17119	0.003000	0.11579	0.582000	0.36321	0.759000	0.26461	0.163000	0.19507	0.462000	0.41574	CCC	LAMB1	-	NULL	ENSG00000091136		0.647	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	HGNC	protein_coding	OTTHUMT00000314584.1	-	0.00	73	0	G	NM_002291		107642184	-1	tier1	-	no_errors	ENST00000393561	ensembl	human	novel	74_37	missense	47.06	36	32	SNP	0.000	A
LAMC3	10319	genome.wustl.edu	37	9	133967161	133967161	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr9:133967161C>T	ENST00000361069.4	+	28	4848	c.4715C>T	c.(4714-4716)gCc>gTc	p.A1572V	LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	1572	Domain II and I.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GAGAACTGTGCCAGCTGGCAG	0.632																																																	0													37.0	37.0	37.0					9																	133967161		2203	4300	6503	SO:0001583	missense	0			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.4715C>T	9.37:g.133967161C>T	ENSP00000354360:p.Ala1572Val		B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_B_type_IV,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.A1572V	ENST00000361069.4	37	c.4715	CCDS6938.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.20|16.20	3.055293|3.055293	0.55325|0.55325	.|.	.|.	ENSG00000050555|ENSG00000050555	ENST00000361069;ENST00000355048|ENST00000320021;ENST00000355452	T|.	0.27104|.	1.69|.	5.23|5.23	4.32|4.32	0.51571|0.51571	.|.	0.286819|.	0.28296|.	N|.	0.015880|.	T|T	0.53722|0.53722	0.1814|0.1814	M|M	0.67953|0.67953	2.075|2.075	0.27248|0.27248	N|N	0.958969|0.958969	D;P|.	0.57257|.	0.979;0.915|.	P;B|.	0.56563|.	0.801;0.321|.	T|T	0.45977|0.45977	-0.9224|-0.9224	10|6	0.44086|0.31617	T|T	0.13|0.26	.|.	11.1752|11.1752	0.48595|0.48595	0.1841:0.8159:0.0:0.0|0.1841:0.8159:0.0:0.0	.|.	253;1572|.	Q9UF61;Q9Y6N6|.	.;LAMC3_HUMAN|.	V|S	1572;1584|510;254	ENSP00000354360:A1572V|.	ENSP00000347156:A1584V|ENSP00000325873:P510S	A|P	+|+	2|1	0|0	LAMC3|LAMC3	132956982|132956982	0.997000|0.997000	0.39634|0.39634	0.989000|0.989000	0.46669|0.46669	0.073000|0.073000	0.16967|0.16967	4.235000|4.235000	0.58666|0.58666	1.188000|1.188000	0.43014|0.43014	-0.182000|-0.182000	0.12963|0.12963	GCC|CCA	LAMC3	-	NULL	ENSG00000050555		0.632	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	HGNC	protein_coding	OTTHUMT00000054717.3	-	0.00	91	0	C	NM_006059		133967161	+1	tier1	-	no_errors	ENST00000361069	ensembl	human	known	74_37	missense	16.24	98	19	SNP	1.000	T
LAMC3	10319	genome.wustl.edu	37	9	133967312	133967313	+	3'UTR	INS	-	-	CC	rs386416363		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr9:133967312_133967313insCC	ENST00000361069.4	+	0	4999_5000				LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3						astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GTGGATAGTCACTCCCTGCCGA	0.594																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.*139->CC	9.37:g.133967312_133967313insCC			B1APX9|B1APY0|Q59H72	RNA	INS	-	NULL	ENST00000361069.4	37	NULL	CCDS6938.1	9																																																																																			LAMC3	-	-	ENSG00000050555		0.594	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	HGNC	protein_coding	OTTHUMT00000054717.3		0.00	29	0	-	NM_006059		133967313	+1	tier1		no_errors	ENST00000462567	ensembl	human	known	74_37	rna	6.82	41	3	INS	0.001:0.000	CC
LIG1	3978	genome.wustl.edu	37	19	48647140	48647140	+	Splice_Site	SNP	T	T	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:48647140T>A	ENST00000263274.7	-	10	1276	c.857A>T	c.(856-858)aAg>aTg	p.K286M	LIG1_ENST00000427526.2_Splice_Site_p.K255M|CTC-453G23.4_ENST00000594589.1_RNA|LIG1_ENST00000536218.1_Splice_Site_p.K218M	NM_000234.1	NP_000225.1	P18858	DNLI1_HUMAN	ligase I, DNA, ATP-dependent	286					anatomical structure morphogenesis (GO:0009653)|base-excision repair (GO:0006284)|cell division (GO:0051301)|DNA biosynthetic process (GO:0071897)|DNA ligation involved in DNA repair (GO:0051103)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to hydrogen peroxide (GO:0042542)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(22)|prostate(2)|skin(1)	44		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	GAAACCTCACTTCTGGCCCGG	0.547								Nucleotide excision repair (NER)																																									0													126.0	131.0	129.0					19																	48647140		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS12711.1, CCDS74409.1, CCDS74410.1	19q13.2-q13.3	2014-09-17				ENSG00000105486	6.5.1.1		6598	protein-coding gene	gene with protein product		126391					Standard	XM_005258934		Approved		uc002pia.1	P18858		ENST00000263274.7:c.857+1A>T	19.37:g.48647140T>A			B2RAI8|Q2TB12|Q32P23	Missense_Mutation	SNP	pfam_DNA_ligase_ATP-dep_cent,pfam_DNA_ligase_ATP-dep_N,pfam_DNA_ligase_ATP-dep_C,superfamily_DNA_ligase_ATP-dep_N,superfamily_NA-bd_OB-fold,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	p.K286M	ENST00000263274.7	37	c.857	CCDS12711.1	19	.	.	.	.	.	.	.	.	.	.	T	18.11	3.550511	0.65311	.	.	ENSG00000105486	ENST00000263274;ENST00000544761;ENST00000427526;ENST00000536218;ENST00000542460	T;T;T;T	0.20738	2.05;2.05;2.05;2.05	4.88	2.77	0.32553	DNA ligase, ATP-dependent, N-terminal (2);	0.278062	0.39210	N	0.001426	T	0.27559	0.0677	L	0.53249	1.67	0.47153	D	0.999336	B;P;P	0.41102	0.35;0.738;0.479	B;P;B	0.51055	0.26;0.657;0.26	T	0.01874	-1.1256	9	.	.	.	-24.8221	6.9085	0.24323	0.0:0.2024:0.0:0.7976	.	255;218;286	B4DTU4;F5GZ28;P18858	.;.;DNLI1_HUMAN	M	286;317;255;218;254	ENSP00000263274:K286M;ENSP00000442841:K255M;ENSP00000441531:K218M;ENSP00000445928:K254M	.	K	-	2	0	LIG1	53338952	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	0.930000	0.28858	0.950000	0.37743	0.533000	0.62120	AAG	LIG1	-	superfamily_DNA_ligase_ATP-dep_N	ENSG00000105486		0.547	LIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG1	HGNC	protein_coding	OTTHUMT00000465575.1	-	0.00	55	0	T	NM_000234	Missense_Mutation	48647140	-1	tier1	-	no_errors	ENST00000263274	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	A
LINC00466	199899	genome.wustl.edu	37	1	63728322	63728322	+	lincRNA	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:63728322G>A	ENST00000455304.2	-	0	191									long intergenic non-protein coding RNA 466																		GCACATGCACGGCACCATCTT	0.522																																																	0																																												0					1p31.3	2012-10-12			ENSG00000224209	ENSG00000224209		"""Long non-coding RNAs"""	27294	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_038252		Approved		uc001daw.2		OTTHUMG00000009143		1.37:g.63728322G>A				RNA	SNP	-	NULL	ENST00000455304.2	37	NULL		1																																																																																			LINC00466	-	-	ENSG00000224209		0.522	LINC00466-001	KNOWN	basic	lincRNA	LINC00466	HGNC	lincRNA	OTTHUMT00000025337.2	-	0.00	18	0	G	NR_038252		63728322	-1	tier1	-	no_errors	ENST00000436475	ensembl	human	known	74_37	rna	20.00	12	3	SNP	0.977	A
LMAN1L	79748	genome.wustl.edu	37	15	75112434	75112434	+	Silent	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr15:75112434C>T	ENST00000309664.5	+	7	907	c.768C>T	c.(766-768)agC>agT	p.S256S	RP11-414J4.2_ENST00000564823.1_RNA|LMAN1L_ENST00000379709.3_Intron	NM_021819.2	NP_068591.2	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like	256						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GTGAGCCCAGCCCAGAGGTGA	0.602																																																	0													182.0	131.0	148.0					15																	75112434		2197	4296	6493	SO:0001819	synonymous_variant	0			AF303398	CCDS10270.1	15q24.1	2005-08-05			ENSG00000140506	ENSG00000140506			6632	protein-coding gene	gene with protein product		609548				11255007	Standard	NM_021819		Approved	ERGL, ERGIC-53L	uc002ayt.1	Q9HAT1	OTTHUMG00000142813	ENST00000309664.5:c.768C>T	15.37:g.75112434C>T			Q6UWN2	Silent	SNP	pfam_Lectin_leg,superfamily_ConA-like_lec_gl_sf	p.S256	ENST00000309664.5	37	c.768	CCDS10270.1	15																																																																																			LMAN1L	-	superfamily_ConA-like_lec_gl_sf	ENSG00000140506		0.602	LMAN1L-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	LMAN1L	HGNC	protein_coding	OTTHUMT00000286397.4	-	0.00	46	0	C			75112434	+1	tier1	-	no_errors	ENST00000309664	ensembl	human	known	74_37	silent	17.24	24	5	SNP	0.069	T
LMOD2	442721	genome.wustl.edu	37	7	123296217	123296217	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr7:123296217A>G	ENST00000458573.2	+	1	357	c.200A>G	c.(199-201)gAg>gGg	p.E67G	LMOD2_ENST00000456238.2_Missense_Mutation_p.E67G	NM_207163.1	NP_997046.1	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	67	Glu-rich.					cytoskeleton (GO:0005856)											TTCAGCAGAGAGGCACTGATG	0.532																																																	0													43.0	48.0	47.0					7																	123296217		1870	4094	5964	SO:0001583	missense	0			AC006333	CCDS47693.1	7q31.32	2008-08-08			ENSG00000170807	ENSG00000170807			6648	protein-coding gene	gene with protein product		608006					Standard	NM_207163		Approved		uc003vky.2	Q6P5Q4	OTTHUMG00000157149	ENST00000458573.2:c.200A>G	7.37:g.123296217A>G	ENSP00000411932:p.Glu67Gly		A4D0W9|A4D0Y2|Q8WVJ8	Missense_Mutation	SNP	pfam_Tropomodulin,pfscan_WH2_dom	p.E67G	ENST00000458573.2	37	c.200	CCDS47693.1	7	.	.	.	.	.	.	.	.	.	.	A	19.65	3.867203	0.72065	.	.	ENSG00000170807	ENST00000458573;ENST00000444702;ENST00000332074;ENST00000456238	T;T	0.34667	1.35;1.35	5.67	5.67	0.87782	.	0.000000	0.37178	N	0.002209	T	0.56529	0.1991	M	0.73217	2.22	0.47862	D	0.999533	P	0.48162	0.906	P	0.57720	0.826	T	0.60403	-0.7270	10	0.87932	D	0	-14.3688	15.909	0.79456	1.0:0.0:0.0:0.0	.	67	Q6P5Q4	LMOD2_HUMAN	G	67	ENSP00000411932:E67G;ENSP00000398975:E67G	ENSP00000405123:E67G	E	+	2	0	LMOD2	123083453	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.217000	0.72218	2.155000	0.67459	0.459000	0.35465	GAG	LMOD2	-	pfam_Tropomodulin	ENSG00000170807		0.532	LMOD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LMOD2	HGNC	protein_coding	OTTHUMT00000348525.1	-	0.00	55	0	A			123296217	+1	tier1	-	no_errors	ENST00000458573	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	G
RP11-435B5.5	0	genome.wustl.edu	37	1	143391573	143391573	+	lincRNA	SNP	T	T	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:143391573T>A	ENST00000428624.1	+	0	1789				RP11-435B5.4_ENST00000423249.1_lincRNA																							TGCAGTTTGATGATCTTATGG	0.303																																																	0																																												0																															1.37:g.143391573T>A				RNA	SNP	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			RP11-435B5.5	-	-	ENSG00000238261		0.303	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	Clone_based_vega_gene	lincRNA	OTTHUMT00000037971.1	-	0.00	242	0	T			143391573	+1	tier1	-	no_errors	ENST00000412492	ensembl	human	known	74_37	rna	41.27	37	26	SNP	0.967	A
SLC25A18	83733	genome.wustl.edu	37	22	18070659	18070659	+	Intron	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr22:18070659G>A	ENST00000327451.6	+	9	1113				SLC25A18_ENST00000399813.1_Intron|AC004019.13_ENST00000443935.1_RNA	NM_031481.1	NP_113669.1	Q9H1K4	GHC2_HUMAN	solute carrier family 25 (glutamate carrier), member 18							integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	symporter activity (GO:0015293)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)	18				Lung(27;0.124)		AGGGCAGCTCGGAGCTCAGTG	0.537																																					Colon(118;1560 1625 18964 29606 50093)												0													172.0	135.0	147.0					22																	18070659		2203	4300	6503	SO:0001627	intron_variant	0			AY008285	CCDS13744.1	22q11.2	2013-05-22	2012-03-29		ENSG00000182902	ENSG00000182902		"""Solute carriers"""	10988	protein-coding gene	gene with protein product		609303	"""solute carrier family 25 (mitochondrial carrier), member 18"""			11381032, 11897791	Standard	NM_031481		Approved		uc002zmp.1	Q9H1K4	OTTHUMG00000150089	ENST00000327451.6:c.576-32G>A	22.37:g.18070659G>A				RNA	SNP	-	NULL	ENST00000327451.6	37	NULL	CCDS13744.1	22																																																																																			AC004019.13	-	-	ENSG00000236754		0.537	SLC25A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101929372	Clone_based_vega_gene	protein_coding	OTTHUMT00000316214.3	-	0.00	47	0	G	NM_031481		18070659	-1	tier1	-	no_errors	ENST00000443935	ensembl	human	known	74_37	rna	79.59	10	39	SNP	0.000	A
LINC01347	731275	genome.wustl.edu	37	1	243254755	243254755	+	lincRNA	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:243254755C>A	ENST00000417964.1	-	0	509																											GTCCACGGTACCCCCATGATG	0.438																																																	0																																												0																															1.37:g.243254755C>A				RNA	SNP	-	NULL	ENST00000417964.1	37	NULL		1																																																																																			RP11-261C10.3	-	-	ENSG00000214837		0.438	RP11-261C10.3-006	KNOWN	basic	lincRNA	LOC101929966	Clone_based_vega_gene	lincRNA	OTTHUMT00000096168.1	-	0.00	32	0	C			243254755	-1	tier1	-	no_errors	ENST00000427210	ensembl	human	known	74_37	rna	14.71	29	5	SNP	0.154	A
LINC01168	399829	genome.wustl.edu	37	10	134788843	134788843	+	lincRNA	SNP	G	G	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr10:134788843G>C	ENST00000461291.2	+	0	4239					NR_046231.1																						GAGGGTTGAGGCTGCCTCGGC	0.662																																																	0																																												0																															10.37:g.134788843G>C				RNA	SNP	-	NULL	ENST00000461291.2	37	NULL		10																																																																																			RP13-137A17.6	-	-	ENSG00000240707		0.662	RP13-137A17.6-001	KNOWN	basic	lincRNA	LOC399829	Clone_based_vega_gene	lincRNA	OTTHUMT00000349546.2	-	0.00	41	0	G			134788843	+1	tier1	-	no_errors	ENST00000461291	ensembl	human	known	74_37	rna	11.43	31	4	SNP	0.001	C
LOXHD1	125336	genome.wustl.edu	37	18	44102117	44102117	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr18:44102117C>T	ENST00000398722.4	-	25	4197	c.4198G>A	c.(4198-4200)Gtg>Atg	p.V1400M	LOXHD1_ENST00000300591.6_Missense_Mutation_p.V567M|LOXHD1_ENST00000579038.1_Missense_Mutation_p.V471M|LOXHD1_ENST00000441551.2_Missense_Mutation_p.V1472M|LOXHD1_ENST00000536736.1_Missense_Mutation_p.V1678M|LOXHD1_ENST00000582408.1_Missense_Mutation_p.V567M|LOXHD1_ENST00000441893.2_Missense_Mutation_p.V611M			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1400	PLAT 10. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						AACTCCTCCACAGAGCCACGG	0.562																																																	0													102.0	96.0	98.0					18																	44102117		692	1591	2283	SO:0001583	missense	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.4198G>A	18.37:g.44102117C>T	ENSP00000381707:p.Val1400Met		B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.V1678M	ENST00000398722.4	37	c.5032		18	.	.	.	.	.	.	.	.	.	.	C	10.17	1.277545	0.23307	.	.	ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000536736;ENST00000441893;ENST00000335730	T;T;T;T	0.78595	-0.14;-0.14;-1.19;1.42	5.01	5.01	0.66863	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.159387	0.43919	D	0.000514	D	0.85159	0.5633	L	0.49640	1.575	0.37323	D	0.90963	D;B;P;D	0.71674	0.998;0.244;0.891;0.998	D;B;P;D	0.83275	0.989;0.132;0.487;0.996	D	0.85303	0.1074	10	0.34782	T	0.22	.	18.6932	0.91590	0.0:1.0:0.0:0.0	.	1678;611;1400;1400	F5GZB4;F8WA52;Q8IVV2-2;Q8IVV2	.;.;.;LOXH1_HUMAN	M	567;1400;1678;611;1400	ENSP00000300591:V567M;ENSP00000381707:V1400M;ENSP00000444586:V1678M;ENSP00000409062:V611M	ENSP00000300591:V567M	V	-	1	0	LOXHD1	42356115	0.998000	0.40836	0.948000	0.38648	0.427000	0.31564	3.594000	0.54008	2.497000	0.84241	0.555000	0.69702	GTG	LOXHD1	-	superfamily_Lipase_LipOase	ENSG00000167210		0.562	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		-	0.00	30	0	C	NM_144612		44102117	-1	tier1	-	no_errors	ENST00000536736	ensembl	human	known	74_37	missense	35.29	22	12	SNP	0.994	T
LRBA	987	genome.wustl.edu	37	4	151935672	151935672	+	Silent	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr4:151935672G>A	ENST00000357115.3	-	2	366	c.123C>T	c.(121-123)atC>atT	p.I41I	LRBA_ENST00000510413.1_Silent_p.I41I|LRBA_ENST00000507224.1_Silent_p.I41I|LRBA_ENST00000535741.1_Silent_p.I41I	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	41						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TGATGCCCCTGATGGGGAGCC	0.512																																																	0													60.0	55.0	56.0					4																	151935672		2203	4300	6503	SO:0001819	synonymous_variant	0			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.123C>T	4.37:g.151935672G>A			Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Silent	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom	p.I41	ENST00000357115.3	37	c.123	CCDS3773.1	4																																																																																			LRBA	-	NULL	ENSG00000198589		0.512	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	HGNC	protein_coding	OTTHUMT00000364939.1	-	0.00	27	0	G			151935672	-1	tier1	-	no_errors	ENST00000357115	ensembl	human	known	74_37	silent	29.03	22	9	SNP	1.000	A
LRRC8B	23507	genome.wustl.edu	37	1	90050026	90050026	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:90050026G>A	ENST00000330947.2	+	5	2177	c.1817G>A	c.(1816-1818)aGc>aAc	p.S606N	RP5-1007M22.2_ENST00000443562.1_RNA|LRRC8B_ENST00000358200.4_Missense_Mutation_p.S606N|LRRC8B_ENST00000439853.1_Missense_Mutation_p.S606N	NM_001134476.1	NP_001127948.1	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member B	606					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	26		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		TCCATTTTCAGCCTGAATAAT	0.393																																																	0													70.0	72.0	71.0					1																	90050026		2203	4300	6503	SO:0001583	missense	0			AF385436	CCDS724.1	1p22.2	2008-02-05			ENSG00000197147	ENSG00000197147			30692	protein-coding gene	gene with protein product	"""T cell activation leucine repeat rich protein"""	612888				9039502	Standard	NM_015350		Approved	TA-LRRP, KIAA0231	uc001dni.3	Q6P9F7	OTTHUMG00000010129	ENST00000330947.2:c.1817G>A	1.37:g.90050026G>A	ENSP00000332674:p.Ser606Asn		D3DT28|Q6UY21|Q8N106|Q92627	Missense_Mutation	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S606N	ENST00000330947.2	37	c.1817	CCDS724.1	1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.720965	0.68959	.	.	ENSG00000197147	ENST00000330947;ENST00000358200;ENST00000439853	T;T;T	0.58060	0.36;0.36;0.36	5.31	5.31	0.75309	.	0.058857	0.64402	D	0.000002	T	0.27900	0.0687	N	0.13098	0.295	0.45354	D	0.998349	P	0.45348	0.856	P	0.44897	0.463	T	0.05451	-1.0884	9	.	.	.	.	15.9014	0.79380	0.0:0.1446:0.8554:0.0	.	606	Q6P9F7	LRC8B_HUMAN	N	606	ENSP00000332674:S606N;ENSP00000350933:S606N;ENSP00000400704:S606N	.	S	+	2	0	LRRC8B	89822614	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.362000	0.66098	2.633000	0.89246	0.655000	0.94253	AGC	LRRC8B	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000197147		0.393	LRRC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8B	HGNC	protein_coding	OTTHUMT00000028008.1	-	0.00	44	0	G	NM_015350		90050026	+1	tier1	-	no_errors	ENST00000330947	ensembl	human	known	74_37	missense	17.39	38	8	SNP	1.000	A
LRRIQ1	84125	genome.wustl.edu	37	12	85450311	85450311	+	Silent	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr12:85450311G>A	ENST00000393217.2	+	8	1801	c.1740G>A	c.(1738-1740)caG>caA	p.Q580Q		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	580										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		ATAATCAGCAGAAAAAGATAC	0.294																																																	0													31.0	32.0	32.0					12																	85450311		2188	4267	6455	SO:0001819	synonymous_variant	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.1740G>A	12.37:g.85450311G>A			Q567P4|Q9BS17|Q9HA36	Silent	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.Q580	ENST00000393217.2	37	c.1740	CCDS41816.1	12																																																																																			LRRIQ1	-	NULL	ENSG00000133640		0.294	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	-	0.00	30	0	G	NM_032165		85450311	+1	tier1	-	no_errors	ENST00000393217	ensembl	human	known	74_37	silent	13.04	20	3	SNP	0.003	A
MAGEA11	4110	genome.wustl.edu	37	X	148797718	148797718	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chrX:148797718G>T	ENST00000355220.5	+	5	674	c.572G>T	c.(571-573)aGc>aTc	p.S191I	MAGEA11_ENST00000333104.4_Missense_Mutation_p.S162I	NM_005366.4	NP_005357.2	P43364	MAGAB_HUMAN	melanoma antigen family A, 11	191			S -> R (in dbSNP:rs2233049).			cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	9	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					ATCTTTGGGAGCCTATCTGAT	0.547																																																	0													70.0	63.0	65.0					X																	148797718		2203	4300	6503	SO:0001583	missense	0				CCDS48180.1	Xq28	2009-03-13			ENSG00000185247	ENSG00000185247			6798	protein-coding gene	gene with protein product	"""MAGE-11 antigen"", ""melanoma-associated antigen 11"", ""cancer/testis antigen family 1, member 11"""	300344		MAGE11		8575766	Standard	NM_001011544		Approved	MAGE-11, MAGEA-11, MGC10511, CT1.11	uc004fdq.3	P43364	OTTHUMG00000022633	ENST00000355220.5:c.572G>T	X.37:g.148797718G>T	ENSP00000347358:p.Ser191Ile		Q5ETU4|Q6ZRZ5	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.S191I	ENST00000355220.5	37	c.572	CCDS48180.1	X	.	.	.	.	.	.	.	.	.	.	N	10.09	1.255208	0.22965	.	.	ENSG00000185247	ENST00000412632;ENST00000333104;ENST00000355220	T;T;T	0.05580	3.42;3.42;3.42	0.871	-0.0826	0.13697	Melanoma associated antigen, MAGE, N-terminal (1);	.	.	.	.	T	0.12860	0.0312	L	0.61036	1.89	0.09310	N	1	P;P	0.46859	0.866;0.885	P;P	0.53722	0.461;0.733	T	0.13737	-1.0498	8	0.72032	D	0.01	.	.	.	.	.	162;191	G5E962;P43364	.;MAGAB_HUMAN	I	162;162;191	ENSP00000391496:S162I;ENSP00000328177:S162I;ENSP00000347358:S191I	ENSP00000328177:S162I	S	+	2	0	MAGEA11	148576687	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.211000	0.09332	-0.102000	0.12197	-0.435000	0.05868	AGC	MAGEA11	-	pfam_Melanoma_ass_antigen_N	ENSG00000185247		0.547	MAGEA11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEA11	HGNC	protein_coding	OTTHUMT00000058725.4	-	0.00	32	0	G	NM_005366		148797718	+1	tier1	-	no_errors	ENST00000355220	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.002	T
MAP2K6	5608	genome.wustl.edu	37	17	67515468	67515468	+	Silent	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr17:67515468A>G	ENST00000590474.1	+	5	548	c.261A>G	c.(259-261)acA>acG	p.T87T	MAP2K6_ENST00000589647.1_Silent_p.T31T	NM_002758.3	NP_002749.2	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6	87	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|cardiac muscle contraction (GO:0060048)|cell cycle arrest (GO:0007050)|cellular response to sorbitol (GO:0072709)|DNA damage induced protein phosphorylation (GO:0006975)|innate immune response (GO:0045087)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to ischemia (GO:0002931)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	20	Breast(10;6.05e-10)					TCCGAGCCACAGTAAATAGCC	0.473																																																	0													131.0	122.0	125.0					17																	67515468		2203	4300	6503	SO:0001819	synonymous_variant	0			U39064	CCDS11686.1	17q	2011-06-09						"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6846	protein-coding gene	gene with protein product	"""protein kinase, mitogen-activated, kinase 6 (MAP kinase kinase 6)"""	601254		PRKMK6		8621675	Standard	XM_005257515		Approved	MEK6, MKK6, SAPKK3, MAPKK6	uc002jij.3	P52564		ENST00000590474.1:c.261A>G	17.37:g.67515468A>G				Missense_Mutation	SNP	NULL	p.S67G	ENST00000590474.1	37	c.199	CCDS11686.1	17																																																																																			MAP2K6	-	NULL	ENSG00000108984		0.473	MAP2K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K6	HGNC	protein_coding	OTTHUMT00000450689.1	-	0.00	67	0	A	NM_002758		67515468	+1	tier1	-	no_errors	ENST00000359094	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.200	G
MECOM	2122	genome.wustl.edu	37	3	168833396	168833396	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr3:168833396G>A	ENST00000464456.1	-	7	2900	c.1700C>T	c.(1699-1701)aCt>aTt	p.T567I	MECOM_ENST00000460814.1_Missense_Mutation_p.T567I|MECOM_ENST00000494292.1_Missense_Mutation_p.T755I|MECOM_ENST00000472280.1_Missense_Mutation_p.T568I|MECOM_ENST00000392736.3_Missense_Mutation_p.T567I|MECOM_ENST00000433243.2_Missense_Mutation_p.T568I|MECOM_ENST00000264674.3_Missense_Mutation_p.T632I|MECOM_ENST00000468789.1_Missense_Mutation_p.T567I	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						GGGGACTGGAGTCAAGGGCTT	0.542																																																	0													180.0	166.0	171.0					3																	168833396		2203	4300	6503	SO:0001583	missense	0			S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.1700C>T	3.37:g.168833396G>A	ENSP00000419770:p.Thr567Ile		Q13466|Q6FH90	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.T755I	ENST00000464456.1	37	c.2264	CCDS54669.1	3	.	.	.	.	.	.	.	.	.	.	G	7.141	0.581867	0.13749	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243;ENST00000492586	T;T;T;T;T;T;T;T;T	0.07800	3.41;3.41;3.41;3.51;3.42;3.41;3.41;3.51;3.16	5.61	5.61	0.85477	.	0.651166	0.14119	N	0.340152	T	0.16811	0.0404	L	0.50333	1.59	0.58432	D	0.999998	P;P;P;P;P	0.50943	0.94;0.731;0.722;0.731;0.771	P;B;B;B;B	0.47528	0.549;0.369;0.243;0.369;0.261	T	0.01096	-1.1453	10	0.52906	T	0.07	-12.9398	19.6299	0.95698	0.0:0.0:1.0:0.0	.	755;568;755;632;567	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	I	632;567;567;568;755;567;567;568;218	ENSP00000264674:T632I;ENSP00000376493:T567I;ENSP00000419770:T567I;ENSP00000420048:T568I;ENSP00000417899:T755I;ENSP00000419995:T567I;ENSP00000420466:T567I;ENSP00000394302:T568I;ENSP00000417506:T218I	ENSP00000264674:T632I	T	-	2	0	MECOM	170316090	1.000000	0.71417	0.994000	0.49952	0.009000	0.06853	7.561000	0.82288	2.639000	0.89480	0.655000	0.94253	ACT	MECOM	-	NULL	ENSG00000085276		0.542	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	MECOM	HGNC	protein_coding	OTTHUMT00000351519.1	-	0.00	56	0	G	NM_005241, NM_004991		168833396	-1	tier1	-	no_errors	ENST00000494292	ensembl	human	known	74_37	missense	23.68	29	9	SNP	1.000	A
MFF	56947	genome.wustl.edu	37	2	228205046	228205046	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:228205046G>T	ENST00000353339.3	+	6	909	c.468G>T	c.(466-468)atG>atT	p.M156I	MFF_ENST00000524634.1_Start_Codon_SNP_p.M1I|MFF_ENST00000476924.1_3'UTR|MFF_ENST00000337110.7_Missense_Mutation_p.M130I|MFF_ENST00000409616.1_Missense_Mutation_p.M130I|MFF_ENST00000354503.6_Missense_Mutation_p.M130I|MFF_ENST00000409565.1_Missense_Mutation_p.M130I|MFF_ENST00000349901.7_Missense_Mutation_p.M130I|MFF_ENST00000304593.9_Missense_Mutation_p.M130I|MFF_ENST00000392059.1_Missense_Mutation_p.M156I	NM_001277061.1	NP_001263990.1	Q9GZY8	MFF_HUMAN	mitochondrial fission factor	156					mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|peroxisome fission (GO:0016559)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of mitochondrial membrane (GO:0032592)|mitochondrial outer membrane (GO:0005741)|peroxisome (GO:0005777)|synapse (GO:0045202)	protein homodimerization activity (GO:0042803)			breast(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(4)|stomach(2)	21						AGCGGTCTATGAGTGAAAATG	0.408																																																	0													88.0	82.0	84.0					2																	228205046		2203	4300	6503	SO:0001583	missense	0			AF258660	CCDS2465.1, CCDS63139.1, CCDS63140.1, CCDS63141.1, CCDS63142.1, CCDS74662.1	2q36	2008-05-29	2008-05-29	2008-05-29	ENSG00000168958	ENSG00000168958			24858	protein-coding gene	gene with protein product		614785	"""chromosome 2 open reading frame 33"""	C2orf33		18353969	Standard	NM_001277061		Approved	GL004	uc002voy.4	Q9GZY8	OTTHUMG00000133180	ENST00000353339.3:c.468G>T	2.37:g.228205046G>T	ENSP00000302037:p.Met156Ile		Q567U1|Q658R6|Q9BVZ1|Q9H690|Q9NRG8	Missense_Mutation	SNP	pfam_FATE/Miff/Tango-11	p.M156I	ENST00000353339.3	37	c.468	CCDS2465.1	2	.	.	.	.	.	.	.	.	.	.	G	17.11	3.304972	0.60305	.	.	ENSG00000168958	ENST00000304593;ENST00000353339;ENST00000354503;ENST00000530359;ENST00000531278;ENST00000409565;ENST00000452930;ENST00000409616;ENST00000337110;ENST00000534203;ENST00000524634;ENST00000349901;ENST00000392059;ENST00000456345	T;T	0.30448	1.53;1.53	5.95	5.95	0.96441	.	0.133303	0.64402	D	0.000001	T	0.37652	0.1011	L	0.47716	1.5	0.37751	D	0.925974	B;P;B;B;B;P	0.45348	0.274;0.57;0.07;0.27;0.366;0.856	B;B;B;B;B;P	0.49887	0.079;0.169;0.033;0.136;0.071;0.625	T	0.07481	-1.0770	10	0.21540	T	0.41	-12.4608	15.8273	0.78725	0.0:0.135:0.865:0.0	.	130;130;130;130;130;156	Q9GZY8-4;Q9GZY8-3;Q9GZY8-5;C9JHF5;Q9GZY8-2;Q9GZY8	.;.;.;.;.;MFF_HUMAN	I	130;156;130;1;1;130;130;130;130;1;1;130;156;13	ENSP00000302037:M156I;ENSP00000375912:M156I	ENSP00000304898:M130I	M	+	3	0	MFF	227913290	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.806000	0.62569	2.824000	0.97209	0.655000	0.94253	ATG	MFF	-	pfam_FATE/Miff/Tango-11	ENSG00000168958		0.408	MFF-001	KNOWN	basic|CCDS	protein_coding	MFF	HGNC	protein_coding	OTTHUMT00000256887.2	-	0.00	72	0	G	NM_020194		228205046	+1	tier1	-	no_errors	ENST00000353339	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
MIR606	693191	genome.wustl.edu	37	10	77312217	77312217	+	RNA	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr10:77312217G>T	ENST00000384851.1	+	0	2					NR_030337.1				microRNA 606																		aattttcactgtatccttggt	0.403																																																	0													35.0	31.0	32.0					10																	77312217		1547	3545	5092			0					10q22.2	2011-09-12		2008-12-18	ENSG00000207583	ENSG00000207583		"""ncRNAs / Micro RNAs"""	32862	non-coding RNA	RNA, micro				MIRN606			Standard	NR_030337		Approved	hsa-mir-606					10.37:g.77312217G>T				RNA	SNP	-	NULL	ENST00000384851.1	37	NULL		10																																																																																			MIR606	-	-	ENSG00000207583		0.403	MIR606-201	KNOWN	basic	miRNA	MIR606	HGNC	miRNA		-	0.00	62	0	G	NR_030337		77312217	+1	tier1	-	no_errors	ENST00000384851	ensembl	human	known	74_37	rna	46.15	28	24	SNP	0.000	T
MON2	23041	genome.wustl.edu	37	12	62931429	62931429	+	Silent	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr12:62931429G>A	ENST00000393632.2	+	16	2452	c.2061G>A	c.(2059-2061)gcG>gcA	p.A687A	MON2_ENST00000552738.1_Silent_p.A664A|MON2_ENST00000552115.1_Silent_p.A687A|MON2_ENST00000393630.3_Silent_p.A687A|MON2_ENST00000546600.1_Silent_p.A687A|MON2_ENST00000393629.2_Silent_p.A687A|MON2_ENST00000280379.6_Silent_p.A687A	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	687					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TTAACTTGGCGCATTGCCATG	0.338																																																	0													127.0	123.0	124.0					12																	62931429		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.2061G>A	12.37:g.62931429G>A			A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Silent	SNP	pfam_DUF1981_Sec7_assoc,superfamily_ARM-type_fold	p.A687	ENST00000393632.2	37	c.2061	CCDS31849.1	12																																																																																			MON2	-	NULL	ENSG00000061987		0.338	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON2	HGNC	protein_coding	OTTHUMT00000406767.3	-	0.00	40	0	G	NM_015026		62931429	+1	tier1	-	no_errors	ENST00000393630	ensembl	human	known	74_37	silent	31.82	15	7	SNP	0.762	A
MROH2B	133558	genome.wustl.edu	37	5	41045948	41045948	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr5:41045948T>A	ENST00000399564.4	-	18	2186	c.1736A>T	c.(1735-1737)aAa>aTa	p.K579I	MROH2B_ENST00000506092.2_Missense_Mutation_p.K134I	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	579																	TAAGGATTCTTTGAGCAACTG	0.378																																																	0													187.0	177.0	180.0					5																	41045948		1943	4145	6088	SO:0001583	missense	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.1736A>T	5.37:g.41045948T>A	ENSP00000382476:p.Lys579Ile		Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.K579I	ENST00000399564.4	37	c.1736	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	T	19.70	3.875813	0.72180	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.08896	3.04;3.04	5.51	2.97	0.34412	Armadillo-type fold (1);	0.125947	0.35903	N	0.002913	T	0.11965	0.0291	L	0.44542	1.39	0.32673	N	0.51659	D	0.58268	0.982	P	0.55545	0.778	T	0.05241	-1.0897	10	0.62326	D	0.03	.	4.1056	0.10035	0.0:0.1096:0.214:0.6764	.	579	Q7Z745	HTRB2_HUMAN	I	134;284;579	ENSP00000441504:K134I;ENSP00000382476:K579I	ENSP00000296803:K284I	K	-	2	0	HEATR7B2	41081705	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	1.444000	0.35068	2.085000	0.62840	0.477000	0.44152	AAA	MROH2B	-	superfamily_ARM-type_fold	ENSG00000171495		0.378	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH2B	HGNC	protein_coding	OTTHUMT00000367558.2	-	0.00	69	0	T	NM_173489		41045948	-1	tier1	-	no_errors	ENST00000399564	ensembl	human	known	74_37	missense	13.25	72	11	SNP	1.000	A
MRPS18B	28973	genome.wustl.edu	37	6	30585679	30585679	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr6:30585679C>G	ENST00000259873.4	+	1	194	c.37C>G	c.(37-39)Ctt>Gtt	p.L13V	AL662800.1_ENST00000410962.1_RNA|MRPS18B_ENST00000472229.1_3'UTR|MRPS18B_ENST00000506373.2_Missense_Mutation_p.L13V|PPP1R10_ENST00000376511.2_5'Flank|PPP1R10_ENST00000484449.1_5'Flank	NM_014046.3	NP_054765.1	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B	13					translation (GO:0006412)	cell junction (GO:0030054)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(2)	13						GCTGAGGCGGCTTCCTATGCT	0.493																																																	0													195.0	167.0	176.0					6																	30585679		2203	4300	6503	SO:0001583	missense	0			AF100761	CCDS4682.1	6p21	2012-09-13			ENSG00000204568	ENSG00000204568		"""Mitochondrial ribosomal proteins / small subunits"""	14516	protein-coding gene	gene with protein product		611982				11279123	Standard	NM_014046		Approved	MRPS18-2, PTD017, C6orf14, HSPC183	uc003nqo.2	Q9Y676	OTTHUMG00000031268	ENST00000259873.4:c.37C>G	6.37:g.30585679C>G	ENSP00000259873:p.Leu13Val		A6NDQ0|Q659G4|Q9BS27	Missense_Mutation	SNP	pfam_Ribosomal_S18,superfamily_Ribosomal_S18	p.L13V	ENST00000259873.4	37	c.37	CCDS4682.1	6	.	.	.	.	.	.	.	.	.	.	C	8.448	0.852412	0.17106	.	.	ENSG00000204568	ENST00000259873;ENST00000506373;ENST00000376508	T	0.46063	0.88	5.35	-1.6	0.08426	.	1.193380	0.05808	N	0.613496	T	0.09069	0.0224	L	0.36672	1.1	0.09310	N	1	B;B;B	0.10296	0.003;0.002;0.001	B;B;B	0.11329	0.006;0.004;0.003	T	0.18650	-1.0330	10	0.07482	T	0.82	.	5.3573	0.16067	0.0:0.2421:0.4453:0.3126	.	13;13;13	B4DFG6;Q5STN0;Q9Y676	.;.;RT18B_HUMAN	V	13	ENSP00000259873:L13V	ENSP00000259873:L13V	L	+	1	0	MRPS18B	30693658	0.000000	0.05858	0.001000	0.08648	0.129000	0.20672	-1.627000	0.02033	-0.528000	0.06366	0.655000	0.94253	CTT	MRPS18B	-	NULL	ENSG00000204568		0.493	MRPS18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS18B	HGNC	protein_coding	OTTHUMT00000076584.2	-	0.00	29	0	C			30585679	+1	tier1	-	no_errors	ENST00000259873	ensembl	human	known	74_37	missense	66.67	26	52	SNP	0.002	G
MT-ND5	4540	genome.wustl.edu	37	M	12465	12466	+	Frame_Shift_Ins	INS	-	-	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chrM:12465_12466insT	ENST00000361567.2	+	1	129_130	c.129_130insT	c.(130-132)tttfs	p.F44fs	MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	44					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						GTCGCATCCACCTTTATTATCA	0.436																																																	0																																										SO:0001589	frameshift_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.132dupT	M.37:g.12465_12466insT	ENSP00000354813:p.Phe44fs		Q34773|Q8WCY3	Frame_Shift_Ins	INS	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.I44fs	ENST00000361567.2	37	c.129_130		MT																																																																																			MT-ND5	-	tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.436	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding			0.00	23	0	-	YP_003024036		12466	+1	tier1		no_errors	ENST00000361567	ensembl	human	known	74_37	frame_shift_ins	33.33	4	2	INS	NULL	T
MT-ND2	4536	genome.wustl.edu	37	M	1669	1669	+	5'Flank	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chrM:1669G>A	ENST00000361453.3	+	0	0				MT-ND1_ENST00000361390.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						CTTGACCGCTCTGAGCTAAAC	0.433																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.1669G>A	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			MT-TV	-	-	ENSG00000210077		0.433	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-TV	HGNC	protein_coding		-	0.00	19	0	G	YP_003024027		1669	+1	tier1	-	no_errors	ENST00000387342	ensembl	human	known	74_37	rna	50.00	5	5	SNP	NULL	A
MT-ND5	4540	genome.wustl.edu	37	M	13813	13813	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chrM:13813G>A	ENST00000361567.2	+	1	1477	c.1477G>A	c.(1477-1479)Gtc>Atc	p.V493I	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	493					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CAGCCCTCGCTGTCACTTTCC	0.443																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1477G>A	M.37:g.13813G>A	ENSP00000354813:p.Val493Ile		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.V493I	ENST00000361567.2	37	c.1477		MT																																																																																			MT-ND5	-	pfam_NADH_DH_su5_C,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.443	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	29	0	G	YP_003024036		13813	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	100.00	0	6	SNP	NULL	A
MTSS1L	92154	genome.wustl.edu	37	16	70698625	70698625	+	Missense_Mutation	SNP	C	C	G	rs139508787		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr16:70698625C>G	ENST00000338779.6	-	14	1621	c.1347G>C	c.(1345-1347)atG>atC	p.M449I	FLJ00418_ENST00000597002.1_5'UTR	NM_138383.2	NP_612392.1	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	449					filopodium assembly (GO:0046847)|signal transduction (GO:0007165)					breast(1)|central_nervous_system(2)|endometrium(1)|liver(1)|lung(1)|skin(1)	7						GCGTCAGCACCATGGCCAGGT	0.667																																																	0													37.0	32.0	34.0					16																	70698625		2198	4300	6498	SO:0001583	missense	0				CCDS32476.1	16q22.1	2008-12-16				ENSG00000132613			25094	protein-coding gene	gene with protein product	"""actin-bundling protein with BAIAP2 homology"""					12477932	Standard	XM_006721335		Approved	ABBA-1, LOC92154	uc002ezj.3	Q765P7		ENST00000338779.6:c.1347G>C	16.37:g.70698625C>G	ENSP00000341171:p.Met449Ile		A6NJI7|Q9BUA8	Missense_Mutation	SNP	pfam_IRSp53/MIM_homology_IMD	p.M449I	ENST00000338779.6	37	c.1347	CCDS32476.1	16	.	.	.	.	.	.	.	.	.	.	C	15.08	2.727870	0.48833	.	.	ENSG00000132613	ENST00000338779	T	0.31247	1.5	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.33440	0.0863	M	0.63428	1.95	0.53005	D	0.999963	B	0.22909	0.077	B	0.23150	0.044	T	0.12218	-1.0556	10	0.21014	T	0.42	-30.4334	17.6541	0.88173	0.0:1.0:0.0:0.0	.	449	Q765P7	MTSSL_HUMAN	I	449	ENSP00000341171:M449I	ENSP00000341171:M449I	M	-	3	0	MTSS1L	69256126	1.000000	0.71417	1.000000	0.80357	0.314000	0.28054	6.061000	0.71148	2.245000	0.73994	0.462000	0.41574	ATG	MTSS1L	-	NULL	ENSG00000132613		0.667	MTSS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTSS1L	HGNC	protein_coding	OTTHUMT00000434927.3	-	0.00	39	0	C	NM_138383		70698625	-1	tier1	-	no_errors	ENST00000338779	ensembl	human	known	74_37	missense	31.82	15	7	SNP	1.000	G
MVB12B	89853	genome.wustl.edu	37	9	129266969	129266969	+	3'UTR	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr9:129266969C>G	ENST00000361171.3	+	0	2468				MVB12B_ENST00000485886.1_3'UTR	NM_033446.2	NP_258257.1	Q9H7P6	MB12B_HUMAN	multivesicular body subunit 12B						protein transport (GO:0015031)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytosol (GO:0005829)|early endosome (GO:0005769)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	lipid binding (GO:0008289)										GTCTCCAGGCCCCAGGCCTCT	0.642																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK000001	CCDS35142.1	9q34.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000196814	ENSG00000196814			23368	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 28"", ""family with sequence similarity 125, member B"""	C9orf28, FAM125B		18005716, 20654576, 22232651	Standard	NM_033446		Approved	FLJ00001	uc004bqh.2	Q9H7P6	OTTHUMG00000020687	ENST00000361171.3:c.*1427C>G	9.37:g.129266969C>G			Q8N6S7	RNA	SNP	-	NULL	ENST00000361171.3	37	NULL	CCDS35142.1	9																																																																																			MVB12B	-	-	ENSG00000196814		0.642	MVB12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MVB12B	HGNC	protein_coding	OTTHUMT00000054110.1	-	0.00	85	0	C	XM_088525		129266969	+1	tier1	-	no_errors	ENST00000485886	ensembl	human	known	74_37	rna	11.70	83	11	SNP	0.004	G
MYBPC3	4607	genome.wustl.edu	37	11	47372892	47372892	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr11:47372892G>T	ENST00000545968.1	-	2	244	c.190C>A	c.(190-192)Cat>Aat	p.H64N	MYBPC3_ENST00000399249.2_Missense_Mutation_p.H64N|MYBPC3_ENST00000256993.4_Missense_Mutation_p.H64N	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	64					cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		GTCAGCGTATGCCGTGTGCCC	0.632																																																	0			GRCh37	CD043683	MYBPC3	D							40.0	44.0	43.0					11																	47372892		2194	4287	6481	SO:0001583	missense	0			X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.190C>A	11.37:g.47372892G>T	ENSP00000442795:p.His64Asn		A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.H64N	ENST00000545968.1	37	c.190	CCDS53621.1	11	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124961	0.56613	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	T;T;T	0.42900	0.96;0.96;0.96	4.27	4.27	0.50696	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.66925	0.2839	M	0.86651	2.83	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.68059	-0.5509	9	0.19590	T	0.45	.	16.8841	0.86071	0.0:0.0:1.0:0.0	.	64	Q14896	MYPC3_HUMAN	N	64	ENSP00000442795:H64N;ENSP00000382193:H64N;ENSP00000256993:H64N	ENSP00000256993:H64N	H	-	1	0	MYBPC3	47329468	1.000000	0.71417	0.937000	0.37676	0.010000	0.07245	7.449000	0.80643	2.218000	0.71995	0.467000	0.42956	CAT	MYBPC3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2	ENSG00000134571		0.632	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYBPC3	HGNC	protein_coding	OTTHUMT00000392271.3	-	0.00	48	0	G			47372892	-1	tier1	-	no_errors	ENST00000399249	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
MYH6	4624	genome.wustl.edu	37	14	23869922	23869922	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr14:23869922A>T	ENST00000356287.3	-	12	1435	c.1406T>A	c.(1405-1407)tTc>tAc	p.F469Y	MYH6_ENST00000405093.3_Missense_Mutation_p.F469Y			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	469	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		ACTCACGTCGAAGATCTCGAA	0.557																																																	0													85.0	75.0	78.0					14																	23869922		2203	4300	6503	SO:0001583	missense	0			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.1406T>A	14.37:g.23869922A>T	ENSP00000348634:p.Phe469Tyr		A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.F469Y	ENST00000356287.3	37	c.1406	CCDS9600.1	14	.	.	.	.	.	.	.	.	.	.	.	19.39	3.818241	0.71028	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.90324	-2.65;-2.65	4.03	4.03	0.46877	Myosin head, motor domain (3);	.	.	.	.	D	0.96803	0.8956	H	0.98314	4.2	0.58432	D	0.999992	P;P	0.38729	0.644;0.644	P;P	0.56278	0.795;0.795	D	0.97607	1.0127	9	0.87932	D	0	.	12.5034	0.55968	1.0:0.0:0.0:0.0	.	469;469	D9YZU2;P13533	.;MYH6_HUMAN	Y	469	ENSP00000386041:F469Y;ENSP00000348634:F469Y	ENSP00000348634:F469Y	F	-	2	0	MYH6	22939762	1.000000	0.71417	0.871000	0.34182	0.335000	0.28730	5.571000	0.67404	1.610000	0.50200	0.473000	0.43528	TTC	MYH6	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000197616		0.557	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	HGNC	protein_coding	OTTHUMT00000071796.3	-	0.00	43	0	A			23869922	-1	tier1	-	no_errors	ENST00000356287	ensembl	human	known	74_37	missense	22.58	24	7	SNP	1.000	T
MYO9B	4650	genome.wustl.edu	37	19	17294679	17294680	+	Splice_Site	INS	-	-	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:17294679_17294680insA	ENST00000594824.1	+	16	2520		c.e16+2		MYO9B_ENST00000397274.2_Splice_Site|MYO9B_ENST00000595618.1_Splice_Site			Q13459	MYO9B_HUMAN	myosin IXB						actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.?(2)		breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						ATTCCAAAGGTAAAAAAAAAAA	0.411																																																	2	Unknown(2)	soft_tissue(2)																																								SO:0001630	splice_region_variant	0				CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.2373+2->A	19.37:g.17294690_17294690dupA			O75314|Q9NUJ2|Q9UHN0	Splice_Site	INS	-	e15+2	ENST00000594824.1	37	c.2373+2_2373+1		19																																																																																			MYO9B	-	-	ENSG00000099331		0.411	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	MYO9B	HGNC	protein_coding	OTTHUMT00000463236.1		0.00	47	0	-		Intron	17294680	+1	tier1		no_errors	ENST00000594824	ensembl	human	known	74_37	splice_site_ins	9.68	28	3	INS	1.000:1.000	A
NCAN	1463	genome.wustl.edu	37	19	19338672	19338672	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:19338672C>T	ENST00000252575.6	+	8	2342	c.2243C>T	c.(2242-2244)aCg>aTg	p.T748M	NCAN_ENST00000538881.1_Missense_Mutation_p.T199M	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	748					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	ACTGAGCCAACGGGCCTCAGG	0.587																																																	0													64.0	69.0	67.0					19																	19338672		2203	4300	6503	SO:0001583	missense	0			AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.2243C>T	19.37:g.19338672C>T	ENSP00000252575:p.Thr748Met		Q9UPK6	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Sushi_SCR_CCP,pfam_Ig_V-set,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Link,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link,prints_AntifreezeII	p.T748M	ENST00000252575.6	37	c.2243	CCDS12397.1	19	.	.	.	.	.	.	.	.	.	.	C	6.790	0.514698	0.12944	.	.	ENSG00000130287	ENST00000539499;ENST00000252575;ENST00000538881	D;D	0.86297	-1.84;-2.1	3.23	-2.85	0.05734	.	0.862963	0.09498	N	0.794019	T	0.70263	0.3204	N	0.08118	0	0.09310	N	1	B;B	0.24258	0.1;0.008	B;B	0.10450	0.005;0.002	T	0.56347	-0.7994	10	0.46703	T	0.11	.	7.7279	0.28771	0.0:0.3614:0.0:0.6386	.	762;748	Q4LE67;O14594	.;NCAN_HUMAN	M	762;748;199	ENSP00000252575:T748M;ENSP00000442202:T199M	ENSP00000252575:T748M	T	+	2	0	NCAN	19199672	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.442000	0.06871	-0.498000	0.06632	-1.090000	0.02178	ACG	NCAN	-	NULL	ENSG00000130287		0.587	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAN	HGNC	protein_coding	OTTHUMT00000460111.2	-	0.00	38	0	C	NM_004386		19338672	+1	tier1	-	no_errors	ENST00000252575	ensembl	human	known	74_37	missense	39.13	14	9	SNP	0.000	T
NCAPG2	54892	genome.wustl.edu	37	7	158483335	158483335	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr7:158483335T>A	ENST00000409423.1	-	6	634	c.462A>T	c.(460-462)aaA>aaT	p.K154N	NCAPG2_ENST00000449727.2_Missense_Mutation_p.K154N|NCAPG2_ENST00000479022.1_5'Flank|NCAPG2_ENST00000409339.3_Missense_Mutation_p.K154N|NCAPG2_ENST00000275830.10_5'Flank|NCAPG2_ENST00000356309.3_Missense_Mutation_p.K154N	NM_001281932.1	NP_001268861.1	Q86XI2	CNDG2_HUMAN	non-SMC condensin II complex, subunit G2	154					chromosome condensation (GO:0030261)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	39	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		CAGGCAGGCCTTTCTCCCACC	0.393																																																	0													129.0	124.0	126.0					7																	158483335		1915	4119	6034	SO:0001583	missense	0			BC043404	CCDS43686.1, CCDS64816.1	7q36.3	2006-09-04	2006-09-04	2006-09-04	ENSG00000146918	ENSG00000146918			21904	protein-coding gene	gene with protein product		608532	"""leucine zipper protein 5"""	LUZP5		14532007	Standard	NM_001281933		Approved	FLJ20311, MTB, CAP-G2, hCAP-G2	uc003wnv.1	Q86XI2	OTTHUMG00000151438	ENST00000409423.1:c.462A>T	7.37:g.158483335T>A	ENSP00000386569:p.Lys154Asn		A4D228|Q7Z3J9|Q8WUG8|Q9BRX6|Q9H8S2|Q9H9K6	Missense_Mutation	SNP	pfam_Condensin2_G2,superfamily_ARM-type_fold	p.K154N	ENST00000409423.1	37	c.462	CCDS43686.1	7	.	.	.	.	.	.	.	.	.	.	T	17.30	3.353906	0.61293	.	.	ENSG00000146918	ENST00000356309;ENST00000409423;ENST00000409339;ENST00000449727	T;T;T;T	0.35973	1.28;1.28;1.28;1.28	5.12	1.62	0.23740	Armadillo-type fold (1);	0.196730	0.52532	D	0.000070	T	0.40743	0.1129	L	0.46157	1.445	0.37075	D	0.898715	D;D	0.57257	0.979;0.964	P;P	0.56700	0.804;0.642	T	0.34179	-0.9839	10	0.41790	T	0.15	-14.1474	8.0013	0.30299	0.0:0.4415:0.0:0.5585	.	154;154	Q86XI2-2;Q86XI2	.;CNDG2_HUMAN	N	154	ENSP00000348657:K154N;ENSP00000386569:K154N;ENSP00000387007:K154N;ENSP00000388326:K154N	ENSP00000348657:K154N	K	-	3	2	NCAPG2	158176096	1.000000	0.71417	0.924000	0.36721	0.979000	0.70002	1.217000	0.32455	0.105000	0.17753	-0.361000	0.07541	AAA	NCAPG2	-	superfamily_ARM-type_fold	ENSG00000146918		0.393	NCAPG2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NCAPG2	HGNC	protein_coding	OTTHUMT00000327111.1	-	0.00	68	0	T	NM_017760		158483335	-1	tier1	-	no_errors	ENST00000409339	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.988	A
NEO1	4756	genome.wustl.edu	37	15	73547071	73547071	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr15:73547071C>T	ENST00000339362.5	+	14	2440	c.1993C>T	c.(1993-1995)Cag>Tag	p.Q665*	NEO1_ENST00000261908.6_Nonsense_Mutation_p.Q665*|RP11-272D12.2_ENST00000560337.1_RNA|NEO1_ENST00000558964.1_Nonsense_Mutation_p.Q665*|NEO1_ENST00000560262.1_Nonsense_Mutation_p.Q665*			Q92859	NEO1_HUMAN	neogenin 1	665	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						ACAAAATGGGCAGATTACTGG	0.468																																																	0													141.0	141.0	141.0					15																	73547071		2198	4297	6495	SO:0001587	stop_gained	0			U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.1993C>T	15.37:g.73547071C>T	ENSP00000341198:p.Gln665*		B7ZKM9|B7ZKN0|O00340|Q17RX1	Nonsense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.Q665*	ENST00000339362.5	37	c.1993	CCDS10247.1	15	.	.	.	.	.	.	.	.	.	.	c	41	8.600544	0.98879	.	.	ENSG00000067141	ENST00000339362;ENST00000379842;ENST00000261908	.	.	.	5.23	2.22	0.28083	.	0.422707	0.27253	N	0.020220	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	0.0786	16.3946	0.83586	0.0:0.6613:0.3387:0.0	.	.	.	.	X	665;403;665	.	ENSP00000261908:Q665X	Q	+	1	0	NEO1	71334124	0.953000	0.32496	0.864000	0.33941	0.911000	0.54048	1.855000	0.39378	0.184000	0.20083	0.655000	0.94253	CAG	NEO1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000067141		0.468	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEO1	HGNC	protein_coding	OTTHUMT00000257472.2	-	0.00	59	0	C	NM_002499		73547071	+1	tier1	-	no_errors	ENST00000261908	ensembl	human	known	74_37	nonsense	9.76	37	4	SNP	0.954	T
NLRP2	55655	genome.wustl.edu	37	19	55494867	55494867	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:55494867G>C	ENST00000543010.1	+	6	1944	c.1801G>C	c.(1801-1803)Gac>Cac	p.D601H	NLRP2_ENST00000448584.2_Missense_Mutation_p.D601H|NLRP2_ENST00000537859.1_Missense_Mutation_p.D579H|NLRP2_ENST00000391721.4_Missense_Mutation_p.D577H|NLRP2_ENST00000263437.6_Missense_Mutation_p.D598H|NLRP2_ENST00000538819.1_Missense_Mutation_p.D577H|NLRP2_ENST00000427260.2_Missense_Mutation_p.D578H|NLRP2_ENST00000339757.7_Missense_Mutation_p.D579H	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	601					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		AACGGTGACAGACCTGCAGGA	0.527																																																	0													104.0	89.0	94.0					19																	55494867		2203	4300	6503	SO:0001583	missense	0			AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.1801G>C	19.37:g.55494867G>C	ENSP00000445135:p.Asp601His		B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.D601H	ENST00000543010.1	37	c.1801	CCDS12913.1	19	.	.	.	.	.	.	.	.	.	.	G	11.68	1.709695	0.30322	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.75154	-0.86;-0.82;-0.81;-0.86;-0.81;-0.91;-0.82;-0.86	1.94	1.94	0.25998	.	1.002550	0.08048	N	0.996147	T	0.81987	0.4939	M	0.65975	2.015	0.09310	N	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.74674	0.938;0.984;0.965;0.984;0.965	T	0.66480	-0.5913	10	0.30078	T	0.28	.	7.4225	0.27079	0.0:0.0:1.0:0.0	.	578;579;598;577;601	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	H	601;577;579;601;579;578;577;598	ENSP00000445135:D601H;ENSP00000375601:D577H;ENSP00000344074:D579H;ENSP00000409370:D601H;ENSP00000440601:D579H;ENSP00000402474:D578H;ENSP00000441133:D577H;ENSP00000263437:D598H	ENSP00000263437:D598H	D	+	1	0	NLRP2	60186679	.	.	0.001000	0.08648	0.003000	0.03518	.	.	1.412000	0.46977	0.561000	0.74099	GAC	NLRP2	-	NULL	ENSG00000022556		0.527	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP2	HGNC	protein_coding	OTTHUMT00000396152.1	-	0.00	60	0	G	NM_017852		55494867	+1	tier1	-	no_errors	ENST00000448584	ensembl	human	known	74_37	missense	11.29	55	7	SNP	0.001	C
NUP205	23165	genome.wustl.edu	37	7	135279313	135279313	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr7:135279313G>A	ENST00000285968.6	+	13	1875	c.1849G>A	c.(1849-1851)Gca>Aca	p.A617T	NUP205_ENST00000440390.2_Intron	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	617					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						TGCTCGCTTGGCACTCTGTGA	0.413																																																	0													98.0	99.0	99.0					7																	135279313		2203	4300	6503	SO:0001583	missense	0			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.1849G>A	7.37:g.135279313G>A	ENSP00000285968:p.Ala617Thr		A6H8X3|Q86YC1	Missense_Mutation	SNP	pfam_Nup186/Nup192/Nup205	p.A617T	ENST00000285968.6	37	c.1849	CCDS34759.1	7	.	.	.	.	.	.	.	.	.	.	G	17.93	3.509262	0.64522	.	.	ENSG00000155561	ENST00000285968	T	0.34072	1.38	5.36	4.48	0.54585	.	0.000000	0.85682	D	0.000000	T	0.42471	0.1204	L	0.56769	1.78	0.80722	D	1	P	0.43788	0.817	P	0.47744	0.556	T	0.19160	-1.0314	10	0.22109	T	0.4	-0.0567	14.2415	0.65959	0.0722:0.0:0.9278:0.0	.	617	Q92621	NU205_HUMAN	T	617	ENSP00000285968:A617T	ENSP00000285968:A617T	A	+	1	0	NUP205	134929853	1.000000	0.71417	0.753000	0.31225	0.526000	0.34562	6.584000	0.74057	1.240000	0.43803	-0.137000	0.14449	GCA	NUP205	-	pfam_Nup186/Nup192/Nup205	ENSG00000155561		0.413	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP205	HGNC	protein_coding	OTTHUMT00000340358.1	-	0.00	47	0	G			135279313	+1	tier1	-	no_errors	ENST00000285968	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	A
OC90	729330	genome.wustl.edu	37	8	133053334	133053334	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr8:133053334T>A	ENST00000443356.2	-	6	500	c.414A>T	c.(412-414)aaA>aaT	p.K138N	OC90_ENST00000262283.5_Missense_Mutation_p.K334N|OC90_ENST00000603859.1_Missense_Mutation_p.K138N|OC90_ENST00000254627.3_Missense_Mutation_p.K138N			Q02509	OC90_HUMAN	otoconin 90	138	Phospholipase A2-like 1.				lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(23)|ovary(2)|prostate(1)|skin(1)	37	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			CTGTGCTAAGTTTGGCGGGGT	0.582																																																	0													129.0	128.0	128.0					8																	133053334		1989	4163	6152	SO:0001583	missense	0			Z14310	CCDS47919.1	8q24.22	2011-03-01			ENSG00000253117	ENSG00000253117			8100	protein-coding gene	gene with protein product		601658		PLA2L		10329003, 9860971	Standard	NM_001080399		Approved		uc011lix.1	Q02509	OTTHUMG00000164672	ENST00000443356.2:c.414A>T	8.37:g.133053334T>A	ENSP00000390050:p.Lys138Asn		B4DNG8	Missense_Mutation	SNP	pfam_PLipase_A2_dom,superfamily_PLipase_A2_dom,smart_PLipase_A2_dom,prints_PLipase_A2	p.K138N	ENST00000443356.2	37	c.414		8	.	.	.	.	.	.	.	.	.	.	T	13.72	2.320886	0.41096	.	.	ENSG00000253117;ENSG00000253117;ENSG00000258417	ENST00000254627;ENST00000443356;ENST00000262283	T;T;T	0.26660	1.72;1.72;1.72	5.61	1.27	0.21489	Phospholipase A2 (3);	0.497863	0.19903	N	0.103479	T	0.41994	0.1183	M	0.71581	2.175	0.30891	N	0.730344	D;D	0.60575	0.985;0.988	P;D	0.65140	0.888;0.932	T	0.43032	-0.9416	10	0.27082	T	0.32	-28.82	10.279	0.43528	0.0:0.5658:0.0:0.4342	.	138;138	Q02509-2;Q02509	.;OC90_HUMAN	N	138;138;334	ENSP00000254627:K138N;ENSP00000390050:K138N;ENSP00000262283:K334N	ENSP00000254627:K138N	K	-	3	2	RP11-240B13.2;OC90	133122516	1.000000	0.71417	0.754000	0.31244	0.148000	0.21650	0.877000	0.28106	0.334000	0.23590	-0.229000	0.12294	AAA	OC90	-	pfam_PLipase_A2_dom,superfamily_PLipase_A2_dom,smart_PLipase_A2_dom	ENSG00000258417		0.582	OC90-201	KNOWN	basic	protein_coding	OC90	Uniprot_gn	protein_coding		-	0.00	32	0	T	NM_001080399		133053334	-1	tier1	-	no_errors	ENST00000443356	ensembl	human	known	74_37	missense	34.48	38	20	SNP	0.887	A
OR13C2	392376	genome.wustl.edu	37	9	107367644	107367644	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr9:107367644T>C	ENST00000542196.1	-	1	307	c.265A>G	c.(265-267)Aga>Gga	p.R89G		NM_001004481.1	NP_001004481.1	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C, member 2	89						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						ATGGTCTTTCTTTCTGAAAGG	0.522																																																	0													62.0	63.0	63.0					9																	107367644		2203	4297	6500	SO:0001583	missense	0				CCDS35092.1	9q31.1	2012-10-03			ENSG00000257019	ENSG00000276119		"""GPCR / Class A : Olfactory receptors"""	14701	protein-coding gene	gene with protein product							Standard	NM_001004481		Approved		uc011lvq.2	Q8NGS9	OTTHUMG00000020415	ENST00000542196.1:c.265A>G	9.37:g.107367644T>C	ENSP00000438815:p.Arg89Gly		B9EGV8|Q6IF54	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R89G	ENST00000542196.1	37	c.265	CCDS35092.1	9	.	.	.	.	.	.	.	.	.	.	T	5.328	0.245891	0.10077	.	.	ENSG00000257019	ENST00000542196	T	0.01335	5.0	3.39	0.896	0.19253	GPCR, rhodopsin-like superfamily (1);	0.179567	0.26518	U	0.023929	T	0.01353	0.0044	L	0.39633	1.23	0.09310	N	1	B	0.10296	0.003	B	0.15484	0.013	T	0.45056	-0.9287	10	0.62326	D	0.03	.	4.3644	0.11218	0.0:0.122:0.2047:0.6733	.	89	Q8NGS9	O13C2_HUMAN	G	89	ENSP00000438815:R89G	ENSP00000438815:R89G	R	-	1	2	OR13C2	106407465	0.000000	0.05858	0.120000	0.21714	0.363000	0.29612	-0.088000	0.11198	1.409000	0.46915	0.379000	0.24179	AGA	OR13C2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000257019		0.522	OR13C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C2	HGNC	protein_coding	OTTHUMT00000053489.2	-	0.00	47	0	T	NM_001004481		107367644	-1	tier1	-	no_errors	ENST00000542196	ensembl	human	known	74_37	missense	25.45	41	14	SNP	0.000	C
OR1D2	4991	genome.wustl.edu	37	17	2995688	2995688	+	Silent	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr17:2995688G>A	ENST00000331459.1	-	1	602	c.603C>T	c.(601-603)gcC>gcT	p.A201A		NM_002548.2	NP_002539.2	P34982	OR1D2_HUMAN	olfactory receptor, family 1, subfamily D, member 2	201					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|protein import into nucleus, translocation (GO:0000060)|sensory perception of smell (GO:0007608)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(2)|lung(10)|ovary(1)	15						AGCAGCCTGTGGCAATCAGCA	0.428																																																	0													117.0	107.0	110.0					17																	2995688		2203	4300	6503	SO:0001819	synonymous_variant	0			U04678	CCDS11019.1	17p13.3	2012-08-09			ENSG00000184166	ENSG00000184166		"""GPCR / Class A : Olfactory receptors"""	8183	protein-coding gene	gene with protein product		164342		OLFR1		1370859, 1840504	Standard	NM_002548		Approved	OR17-4	uc010vrb.2	P34982	OTTHUMG00000090619	ENST00000331459.1:c.603C>T	17.37:g.2995688G>A			Q6IFL8|Q96RA4|Q9UM78	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A201	ENST00000331459.1	37	c.603	CCDS11019.1	17																																																																																			OR1D2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000184166		0.428	OR1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1D2	HGNC	protein_coding	OTTHUMT00000207207.1	-	0.00	58	0	G	NM_002548		2995688	-1	tier1	-	no_errors	ENST00000331459	ensembl	human	known	74_37	silent	12.82	34	5	SNP	0.000	A
OR1G1	8390	genome.wustl.edu	37	17	3030711	3030711	+	Silent	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr17:3030711G>A	ENST00000328890.2	-	1	164	c.135C>T	c.(133-135)atC>atT	p.I45I		NM_003555.1	NP_003546.1	P47890	OR1G1_HUMAN	olfactory receptor, family 1, subfamily G, member 1	45					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(3)|skin(3)	11						TGACTAGAATGATGAGGAGGT	0.527																																					Colon(127;1481 1654 8243 19426 50557)												0													113.0	102.0	106.0					17																	3030711		2203	4300	6503	SO:0001819	synonymous_variant	0			U04689	CCDS11020.1	17p13.3	2012-08-09			ENSG00000183024	ENSG00000183024		"""GPCR / Class A : Olfactory receptors"""	8204	protein-coding gene	gene with protein product				OR1G2		8004088, 9500546	Standard	NM_003555		Approved	OR17-209	uc002fvc.1	P47890	OTTHUMG00000090618	ENST00000328890.2:c.135C>T	17.37:g.3030711G>A			Q4VBM1|Q6IFL9|Q9UM76	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I45	ENST00000328890.2	37	c.135	CCDS11020.1	17																																																																																			OR1G1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000183024		0.527	OR1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1G1	HGNC	protein_coding	OTTHUMT00000207206.2	-	0.00	35	0	G			3030711	-1	tier1	-	no_errors	ENST00000328890	ensembl	human	known	74_37	silent	37.14	22	13	SNP	0.187	A
OR2T7	81458	genome.wustl.edu	37	1	248604961	248604961	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:248604961C>G	ENST00000460972.3	+	1	454	c.454C>G	c.(454-456)Ccc>Gcc	p.P152A				P0C7T2	OR2T7_HUMAN	olfactory receptor, family 2, subfamily T, member 7	152						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										CTTGCTCACCCCCGTCACCAT	0.582																																																	0																																										SO:0001583	missense	0					1q44	2013-09-05		2004-03-10	ENSG00000227152	ENSG00000227152		"""GPCR / Class A : Olfactory receptors"""	15019	protein-coding gene	gene with protein product				OR2T7P			Standard	NG_004272		Approved	OST723		P0C7T2	OTTHUMG00000040449	ENST00000460972.3:c.454C>G	1.37:g.248604961C>G	ENSP00000475521:p.Pro152Ala			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P152A	ENST00000460972.3	37	c.454		1																																																																																			OR2T7	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000227152		0.582	OR2T7-001	KNOWN	basic|appris_principal	protein_coding	OR2T7	HGNC	protein_coding	OTTHUMT00000097345.3	-	0.00	47	0	C			248604961	+1	tier1	-	no_errors	ENST00000460972	ensembl	human	known	74_37	missense	27.42	45	17	SNP	0.000	G
OR2T34	127068	genome.wustl.edu	37	1	248737683	248737683	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:248737683C>T	ENST00000328782.2	-	1	397	c.376G>A	c.(376-378)Gac>Aac	p.D126N		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCATATCGGTCATAGGCCATG	0.557																																																	0													29.0	31.0	30.0					1																	248737683		2135	4235	6370	SO:0001583	missense	0			BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.376G>A	1.37:g.248737683C>T	ENSP00000330904:p.Asp126Asn		B2RNJ8|Q6IEY5|Q96R31	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D126N	ENST00000328782.2	37	c.376	CCDS31120.1	1	.	.	.	.	.	.	.	.	.	.	.	18.49	3.634287	0.67130	.	.	ENSG00000183310	ENST00000328782	T	0.18016	2.24	2.34	2.34	0.29019	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.42517	0.1206	H	0.95780	3.72	0.31239	N	0.69545	P	0.51653	0.947	P	0.51324	0.666	T	0.60393	-0.7272	9	0.72032	D	0.01	.	11.5675	0.50813	0.0:1.0:0.0:0.0	.	126	Q8NGX1	O2T34_HUMAN	N	126	ENSP00000330904:D126N	ENSP00000330904:D126N	D	-	1	0	OR2T34	246804306	1.000000	0.71417	0.520000	0.27837	0.156000	0.22039	5.936000	0.70153	1.154000	0.42482	0.389000	0.25775	GAC	OR2T34	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000183310		0.557	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T34	HGNC	protein_coding	OTTHUMT00000097138.1	-	0.00	58	0	C	NM_001001821		248737683	-1	tier1	-	no_errors	ENST00000328782	ensembl	human	known	74_37	missense	11.11	96	12	SNP	1.000	T
PBRM1	55193	genome.wustl.edu	37	3	52663017	52663017	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr3:52663017C>G	ENST00000296302.7	-	12	1337	c.1336G>C	c.(1336-1338)Gat>Cat	p.D446H	PBRM1_ENST00000394830.3_Missense_Mutation_p.D446H|PBRM1_ENST00000409057.1_Missense_Mutation_p.D446H|PBRM1_ENST00000410007.1_Missense_Mutation_p.D446H|PBRM1_ENST00000409767.1_Missense_Mutation_p.D446H|PBRM1_ENST00000337303.4_Missense_Mutation_p.D446H|PBRM1_ENST00000409114.3_Missense_Mutation_p.D446H|PBRM1_ENST00000356770.4_Missense_Mutation_p.D414H			Q86U86	PB1_HUMAN	polybromo 1	446	Bromo 3. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCCAAATGATCTAAAGTTTCA	0.328			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													82.0	75.0	77.0					3																	52663017		2203	4300	6503	SO:0001583	missense	0			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1336G>C	3.37:g.52663017C>G	ENSP00000296302:p.Asp446His		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	pfam_Bromodomain,pfam_BAH_dom,pfam_HMG_box_dom,superfamily_Bromodomain,superfamily_HMG_box_dom,smart_Bromodomain,smart_BAH_dom,smart_HMG_box_dom,pfscan_BAH_dom,pfscan_HMG_box_dom,pfscan_Bromodomain,prints_Bromodomain	p.D446H	ENST00000296302.7	37	c.1336		3	.	.	.	.	.	.	.	.	.	.	C	23.6	4.436873	0.83885	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	T;T;T;T;T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56;1.56;1.56;1.56;1.56	5.38	5.38	0.77491	Bromodomain (6);Bromodomain, conserved site (1);	0.052468	0.85682	D	0.000000	T	0.44074	0.1276	L	0.31845	0.965	0.80722	D	1	B;D;D;B;P;D;D;D;D	0.71674	0.05;0.981;0.991;0.318;0.94;0.991;0.998;0.976;0.976	B;P;P;B;P;P;P;P;P	0.61132	0.015;0.623;0.686;0.046;0.596;0.825;0.884;0.686;0.686	T	0.34700	-0.9818	10	0.59425	D	0.04	-8.5918	19.1293	0.93399	0.0:1.0:0.0:0.0	.	446;446;446;446;446;446;446;414;446	Q86U86-9;Q86U86-6;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;.;PB1_HUMAN;.;.	H	414;446;446;446;446;446;446;446;446;390	ENSP00000349213:D414H;ENSP00000378307:D446H;ENSP00000296302:D446H;ENSP00000338302:D446H;ENSP00000386593:D446H;ENSP00000386529:D446H;ENSP00000386643:D446H;ENSP00000386601:D446H;ENSP00000387775:D446H;ENSP00000397662:D390H	ENSP00000296302:D446H	D	-	1	0	PBRM1	52638057	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.487000	0.81328	2.532000	0.85374	0.467000	0.42956	GAT	PBRM1	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	ENSG00000163939		0.328	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	PBRM1	HGNC	protein_coding	OTTHUMT00000327232.1	-	0.00	48	0	C	NM_018165		52663017	-1	tier1	-	no_errors	ENST00000296302	ensembl	human	known	74_37	missense	21.62	29	8	SNP	1.000	G
OR5K3	403277	genome.wustl.edu	37	3	98109982	98109982	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr3:98109982T>C	ENST00000383695.1	+	1	473	c.473T>C	c.(472-474)aTt>aCt	p.I158T	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005516.1	NP_001005516.1	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K, member 3	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|prostate(1)|skin(1)|urinary_tract(1)	27						CATCCCATGATTGAAGTAGAG	0.423																																																	0													158.0	151.0	153.0					3																	98109982		2203	4300	6503	SO:0001583	missense	0				CCDS33803.1	3q11.2	2013-09-23			ENSG00000206536	ENSG00000206536		"""GPCR / Class A : Olfactory receptors"""	31290	protein-coding gene	gene with protein product							Standard	NM_001005516		Approved		uc011bgw.2	A6NET4	OTTHUMG00000160077	ENST00000383695.1:c.473T>C	3.37:g.98109982T>C	ENSP00000373194:p.Ile158Thr			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I158T	ENST00000383695.1	37	c.473	CCDS33803.1	3	.	.	.	.	.	.	.	.	.	.	T	2.737	-0.263096	0.05754	.	.	ENSG00000206536	ENST00000383695	T	0.38077	1.16	5.15	5.15	0.70609	GPCR, rhodopsin-like superfamily (1);	0.151633	0.30791	N	0.008879	T	0.31544	0.0800	L	0.45228	1.405	0.09310	N	1	B	0.22983	0.078	B	0.24006	0.05	T	0.21690	-1.0238	10	0.45353	T	0.12	-39.748	11.6377	0.51213	0.0:0.0:0.0:1.0	.	158	A6NET4	OR5K3_HUMAN	T	158	ENSP00000373194:I158T	ENSP00000373194:I158T	I	+	2	0	OR5K3	99592672	0.002000	0.14202	0.010000	0.14722	0.059000	0.15707	1.277000	0.33167	2.043000	0.60533	0.491000	0.48974	ATT	OR5K3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000206536		0.423	OR5K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5K3	HGNC	protein_coding	OTTHUMT00000359110.1	-	0.00	39	0	T			98109982	+1	tier1	-	no_errors	ENST00000383695	ensembl	human	known	74_37	missense	56.76	16	21	SNP	0.004	C
PBXIP1	57326	genome.wustl.edu	37	1	154924334	154924334	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:154924334G>A	ENST00000368463.3	-	3	186	c.115C>T	c.(115-117)Cag>Tag	p.Q39*	PBXIP1_ENST00000498553.1_Intron|PBXIP1_ENST00000539880.1_Intron|PBXIP1_ENST00000368460.3_Nonsense_Mutation_p.Q39*|PBXIP1_ENST00000542459.1_Intron|PBXIP1_ENST00000368465.1_Nonsense_Mutation_p.Q10*	NM_020524.2	NP_065385.2	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein 1	39					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)	cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)	p.Q39*(1)		breast(1)|kidney(2)|large_intestine(6)|lung(13)|prostate(1)|urinary_tract(1)	24	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TGAGGGGCCTGCAGGGCTCTC	0.587																																																	1	Substitution - Nonsense(1)	large_intestine(1)											115.0	121.0	119.0					1																	154924334		2203	4300	6503	SO:0001587	stop_gained	0			AF221521	CCDS1074.1	1q22	2008-02-05	2007-01-30		ENSG00000163346	ENSG00000163346			21199	protein-coding gene	gene with protein product			"""pre-B-cell leukemia transcription factor interacting protein 1"""			7505766, 10825160	Standard	NM_020524		Approved	HPIP	uc001ffr.3	Q96AQ6	OTTHUMG00000037369	ENST00000368463.3:c.115C>T	1.37:g.154924334G>A	ENSP00000357448:p.Gln39*		Q5T174|Q5T176|Q9H8X6|Q9HA02|Q9HD85	Nonsense_Mutation	SNP	NULL	p.Q39*	ENST00000368463.3	37	c.115	CCDS1074.1	1	.	.	.	.	.	.	.	.	.	.	G	12.79	2.042308	0.35989	.	.	ENSG00000163346	ENST00000368465;ENST00000368463;ENST00000351146;ENST00000368460	.	.	.	4.67	1.74	0.24563	.	1.095830	0.07120	N	0.843794	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-2.3962	3.9578	0.09398	0.1993:0.0:0.6132:0.1875	.	.	.	.	X	10;39;39;39	.	ENSP00000295523:Q39X	Q	-	1	0	PBXIP1	153190958	0.004000	0.15560	0.000000	0.03702	0.017000	0.09413	1.417000	0.34770	0.191000	0.20236	-0.324000	0.08512	CAG	PBXIP1	-	NULL	ENSG00000163346		0.587	PBXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PBXIP1	HGNC	protein_coding	OTTHUMT00000090943.1	-	0.00	46	0	G	NM_020524		154924334	-1	tier1	-	no_errors	ENST00000490230	ensembl	human	known	74_37	nonsense	7.27	51	4	SNP	0.001	A
PCDHA8	56140	genome.wustl.edu	37	5	140221555	140221555	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr5:140221555delG	ENST00000531613.1	+	1	649	c.649delG	c.(649-651)gggfs	p.G218fs	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000378123.3_Frame_Shift_Del_p.G218fs|PCDHA3_ENST00000522353.2_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	218	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCCACAGATGGGGGCAAACC	0.478																																																	0													53.0	54.0	54.0					5																	140221555		2203	4299	6502	SO:0001589	frameshift_variant	0			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.649delG	5.37:g.140221555delG	ENSP00000434655:p.Gly218fs		B9EGT7|O75281	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G218fs	ENST00000531613.1	37	c.649	CCDS54919.1	5																																																																																			PCDHA8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204962		0.478	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	HGNC	protein_coding	OTTHUMT00000372830.2		0.00	15	0	G	NM_018911		140221555	+1	tier1		no_errors	ENST00000531613	ensembl	human	known	74_37	frame_shift_del	76.67	7	23	DEL	1.000	-
PCDHA10	56139	genome.wustl.edu	37	5	140237609	140237609	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr5:140237609C>T	ENST00000307360.5	+	1	1976	c.1976C>T	c.(1975-1977)aCg>aTg	p.T659M	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA8_ENST00000531613.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	659	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGTCGCTGACGGCCACGGCC	0.682																																																	0													15.0	20.0	18.0					5																	140237609		1319	2285	3604	SO:0001583	missense	0			AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.1976C>T	5.37:g.140237609C>T	ENSP00000304234:p.Thr659Met		A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.T659M	ENST00000307360.5	37	c.1976	CCDS54921.1	5	.	.	.	.	.	.	.	.	.	.	C	9.663	1.144710	0.21288	.	.	ENSG00000250120	ENST00000307360	T	0.54675	0.56	3.49	1.62	0.23740	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.44829	0.1312	M	0.68317	2.08	0.23720	N	0.99702	P;P	0.51147	0.942;0.637	B;B	0.36378	0.197;0.223	T	0.37126	-0.9719	9	0.72032	D	0.01	.	8.5147	0.33239	0.0:0.8021:0.0:0.1979	.	659;659	Q9Y5I2-3;Q9Y5I2	.;PCDAA_HUMAN	M	659	ENSP00000304234:T659M	ENSP00000304234:T659M	T	+	2	0	PCDHA10	140217793	0.072000	0.21174	0.948000	0.38648	0.416000	0.31233	1.728000	0.38105	0.259000	0.21709	0.491000	0.48974	ACG	PCDHA10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000250120		0.682	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA10	HGNC	protein_coding	OTTHUMT00000372895.2	-	0.00	83	0	C	NM_018901		140237609	+1	tier1	-	no_errors	ENST00000307360	ensembl	human	known	74_37	missense	28.33	42	17	SNP	0.990	T
PCDHGB7	56099	genome.wustl.edu	37	5	140798971	140798971	+	Silent	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr5:140798971C>T	ENST00000398594.2	+	1	1545	c.1545C>T	c.(1543-1545)ttC>ttT	p.F515F	PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	515	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGTGGTGTTCGCGCAGCGCG	0.682																																																	0													55.0	61.0	59.0					5																	140798971		2121	4226	6347	SO:0001819	synonymous_variant	0			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1545C>T	5.37:g.140798971C>T			Q9UN63	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F515	ENST00000398594.2	37	c.1545	CCDS47293.1	5																																																																																			PCDHGB7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000254122		0.682	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB7	HGNC	protein_coding	OTTHUMT00000376973.1	-	0.00	42	0	C	NM_018927		140798971	+1	tier1	-	no_errors	ENST00000398594	ensembl	human	known	74_37	silent	32.14	19	9	SNP	1.000	T
PDE4DIP	9659	genome.wustl.edu	37	1	144852193	144852193	+	3'UTR	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:144852193C>T	ENST00000369354.3	-	0	7495				PDE4DIP_ENST00000530740.1_3'UTR|PDE4DIP_ENST00000369356.4_3'UTR|PDE4DIP_ENST00000313382.9_3'UTR|PDE4DIP_ENST00000369359.4_3'UTR|PDE4DIP_ENST00000524974.1_5'UTR			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GTGCAAACTACGCATCTTTTT	0.502			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0																																										SO:0001624	3_prime_UTR_variant	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.*265G>A	1.37:g.144852193C>T			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	RNA	SNP	-	NULL	ENST00000369354.3	37	NULL	CCDS30824.1	1																																																																																			PDE4DIP	-	-	ENSG00000178104		0.502	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	-	0.00	38	0	C	NM_022359		144852193	-1	tier1	-	no_errors	ENST00000524974	ensembl	human	known	74_37	rna	56.67	26	34	SNP	0.000	T
PHAX	51808	genome.wustl.edu	37	5	125936740	125936740	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr5:125936740T>A	ENST00000297540.4	+	1	781	c.86T>A	c.(85-87)cTg>cAg	p.L29Q	PHAX_ENST00000514725.1_3'UTR	NM_032177.3	NP_115553.2	Q9H814	PHAX_HUMAN	phosphorylated adaptor for RNA export	29	Necessary for interaction with CBP80. {ECO:0000250}.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|protein transport (GO:0015031)|RNA metabolic process (GO:0016070)|snRNA export from nucleus (GO:0006408)|spliceosomal snRNP assembly (GO:0000387)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA binding (GO:0003723)|toxic substance binding (GO:0015643)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	8						GACAGGCCGCTGCAATTGCCA	0.677																																																	0													40.0	33.0	36.0					5																	125936740		2203	4300	6503	SO:0001583	missense	0			AK023255	CCDS4138.1	5q23.2	2011-05-24	2008-10-01	2008-10-01	ENSG00000164902	ENSG00000164902			10241	protein-coding gene	gene with protein product		604924	"""RNA U, small nuclear RNA export adaptor (phosphorylation regulated)"""	RNUXA		10786834	Standard	NM_032177		Approved	FLJ13193	uc003kua.2	Q9H814	OTTHUMG00000163273	ENST00000297540.4:c.86T>A	5.37:g.125936740T>A	ENSP00000297540:p.Leu29Gln		Q9H8W1	Missense_Mutation	SNP	pfam_PHAX_RNA-binding_domain	p.L29Q	ENST00000297540.4	37	c.86	CCDS4138.1	5	.	.	.	.	.	.	.	.	.	.	T	7.973	0.749579	0.15778	.	.	ENSG00000164902	ENST00000297540;ENST00000456348	T	0.41758	0.99	4.61	2.27	0.28462	.	0.295747	0.22654	U	0.057282	T	0.22859	0.0552	L	0.28274	0.84	0.24896	N	0.992134	B	0.11235	0.004	B	0.06405	0.002	T	0.11012	-1.0605	10	0.13470	T	0.59	-31.9546	5.8099	0.18460	0.0:0.1909:0.0:0.8091	.	29	Q9H814	PHAX_HUMAN	Q	29	ENSP00000297540:L29Q	ENSP00000297540:L29Q	L	+	2	0	PHAX	125964639	0.027000	0.19231	0.996000	0.52242	0.531000	0.34715	-0.446000	0.06837	1.687000	0.51057	0.460000	0.39030	CTG	PHAX	-	NULL	ENSG00000164902		0.677	PHAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHAX	HGNC	protein_coding	OTTHUMT00000250924.1	-	0.00	41	0	T	NM_032177		125936740	+1	tier1	-	no_errors	ENST00000297540	ensembl	human	known	74_37	missense	14.81	23	4	SNP	0.747	A
PHF3	23469	genome.wustl.edu	37	6	64421949	64421949	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr6:64421949G>T	ENST00000262043.3	+	16	4805	c.4465G>T	c.(4465-4467)Gaa>Taa	p.E1489*	PHF3_ENST00000393387.1_Nonsense_Mutation_p.E1489*			Q92576	PHF3_HUMAN	PHD finger protein 3	1489					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			GTCAGTGATGGAACAAAACAC	0.378																																					GBM(135;136 1820 29512 34071 46235)												0													53.0	56.0	55.0					6																	64421949		2203	4300	6503	SO:0001587	stop_gained	0			AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.4465G>T	6.37:g.64421949G>T	ENSP00000262043:p.Glu1489*		A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Nonsense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.E1489*	ENST00000262043.3	37	c.4465	CCDS4966.1	6	.	.	.	.	.	.	.	.	.	.	G	42	9.224351	0.99106	.	.	ENSG00000118482	ENST00000515594;ENST00000262043;ENST00000393387	.	.	.	5.96	5.96	0.96718	.	0.000000	0.40728	N	0.001031	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-24.26	15.521	0.75866	0.0677:0.0:0.9323:0.0	.	.	.	.	X	758;1489;1489	.	ENSP00000262043:E1489X	E	+	1	0	PHF3	64479908	0.996000	0.38824	0.940000	0.37924	0.891000	0.51852	2.668000	0.46816	2.813000	0.96785	0.655000	0.94253	GAA	PHF3	-	NULL	ENSG00000118482		0.378	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF3	HGNC	protein_coding	OTTHUMT00000041086.2	-	0.00	27	0	G			64421949	+1	tier1	-	no_errors	ENST00000262043	ensembl	human	known	74_37	nonsense	75.86	7	22	SNP	0.913	T
PIAS4	51588	genome.wustl.edu	37	19	4013274	4013274	+	Silent	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:4013274C>G	ENST00000262971.2	+	2	496	c.381C>G	c.(379-381)ctC>ctG	p.L127L		NM_015897.2	NP_056981.2	Q8N2W9	PIAS4_HUMAN	protein inhibitor of activated STAT, 4	127	PINIT. {ECO:0000255|PROSITE- ProRule:PRU00799}.				negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of keratinocyte apoptotic process (GO:1902174)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(3)	17				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAAGACCCTCAAGCCAGAAG	0.592																																																	0													50.0	49.0	49.0					19																	4013274		2203	4299	6502	SO:0001819	synonymous_variant	0			AF077952	CCDS12118.1	19p13.3	2011-10-11						"""Zinc fingers, MIZ-type"""	17002	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 6"""	605989				9724754	Standard	NM_015897		Approved	Piasg, PIASY, FLJ12419, ZMIZ6	uc002lzg.3	Q8N2W9		ENST00000262971.2:c.381C>G	19.37:g.4013274C>G			O75926|Q96G19|Q9UN16	Silent	SNP	pfam_Znf_MIZ,smart_SAP_dom,pfscan_Znf_MIZ,pfscan_SAP_dom	p.L127	ENST00000262971.2	37	c.381	CCDS12118.1	19																																																																																			PIAS4	-	NULL	ENSG00000105229		0.592	PIAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS4	HGNC	protein_coding	OTTHUMT00000457496.1	-	0.00	102	0	C	NM_015897		4013274	+1	tier1	-	no_errors	ENST00000262971	ensembl	human	known	74_37	silent	6.96	107	8	SNP	0.790	G
PIGS	94005	genome.wustl.edu	37	17	26887182	26887182	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr17:26887182T>A	ENST00000308360.7	-	7	1079	c.704A>T	c.(703-705)aAc>aTc	p.N235I	PIGS_ENST00000465444.1_5'UTR|PIGS_ENST00000543734.1_Missense_Mutation_p.N174I|PIGS_ENST00000395346.2_Missense_Mutation_p.N227I	NM_033198.3	NP_149975.1	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class S	235					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					GGGGTCTGGGTTGAGTAAACT	0.547																																																	0													83.0	72.0	76.0					17																	26887182		2203	4300	6503	SO:0001583	missense	0				CCDS11235.1	17p13.2	2013-02-26	2006-06-28		ENSG00000087111	ENSG00000087111		"""Phosphatidylinositol glycan anchor biosynthesis"""	14937	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610271	"""phosphatidylinositol glycan, class S"""				Standard	NM_033198		Approved		uc002hbo.2	Q96S52	OTTHUMG00000132604	ENST00000308360.7:c.704A>T	17.37:g.26887182T>A	ENSP00000309430:p.Asn235Ile		Q6UVX6	Missense_Mutation	SNP	pfam_PtdIno-glycan_biosynth_class_S	p.N235I	ENST00000308360.7	37	c.704	CCDS11235.1	17	.	.	.	.	.	.	.	.	.	.	T	29.5	5.009090	0.93346	.	.	ENSG00000087111	ENST00000395346;ENST00000308360;ENST00000543734	T;T;T	0.53640	0.61;0.61;0.61	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.68632	0.3022	M	0.86953	2.85	0.80722	D	1	D;D	0.57899	0.981;0.976	P;P	0.56343	0.796;0.693	T	0.73341	-0.4013	10	0.49607	T	0.09	-28.6257	16.4323	0.83853	0.0:0.0:0.0:1.0	.	235;227	Q96S52;Q96S52-2	PIGS_HUMAN;.	I	227;235;174	ENSP00000378755:N227I;ENSP00000309430:N235I;ENSP00000438447:N174I	ENSP00000309430:N235I	N	-	2	0	PIGS	23911309	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.719000	0.68462	2.281000	0.76405	0.528000	0.53228	AAC	PIGS	-	pfam_PtdIno-glycan_biosynth_class_S	ENSG00000087111		0.547	PIGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGS	HGNC	protein_coding	OTTHUMT00000255833.3	-	0.00	22	0	T	NM_033198		26887182	-1	tier1	-	no_errors	ENST00000308360	ensembl	human	known	74_37	missense	53.12	15	17	SNP	1.000	A
PKHD1L1	93035	genome.wustl.edu	37	8	110477101	110477101	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr8:110477101G>C	ENST00000378402.5	+	49	8144	c.8040G>C	c.(8038-8040)gaG>gaC	p.E2680D		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2680					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ATAACTATGAGGCTGGAATTG	0.433										HNSCC(38;0.096)																																							0													94.0	94.0	94.0					8																	110477101		1860	4120	5980	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.8040G>C	8.37:g.110477101G>C	ENSP00000367655:p.Glu2680Asp		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.E2680D	ENST00000378402.5	37	c.8040	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	7.061	0.566345	0.13560	.	.	ENSG00000205038	ENST00000378402	T	0.80566	-1.39	5.78	2.78	0.32641	.	0.123943	0.53938	D	0.000044	T	0.54743	0.1877	N	0.08118	0	0.24350	N	0.994922	B	0.06786	0.001	B	0.08055	0.003	T	0.33497	-0.9866	10	0.12103	T	0.63	.	4.5212	0.11960	0.1835:0.0:0.5378:0.2787	.	2680	Q86WI1	PKHL1_HUMAN	D	2680	ENSP00000367655:E2680D	ENSP00000367655:E2680D	E	+	3	2	PKHD1L1	110546277	0.999000	0.42202	0.999000	0.59377	0.982000	0.71751	0.505000	0.22642	0.807000	0.34208	-0.119000	0.15052	GAG	PKHD1L1	-	smart_PbH1	ENSG00000205038		0.433	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	32	0	G	NM_177531		110477101	+1	tier1	-	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	29.11	56	23	SNP	1.000	C
PLCL2	23228	genome.wustl.edu	37	3	17051594	17051594	+	Nonsense_Mutation	SNP	T	T	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr3:17051594T>G	ENST00000418129.2	+	2	843	c.378T>G	c.(376-378)taT>taG	p.Y126*	PLCL2_ENST00000396755.2_Nonsense_Mutation_p.Y126*|PLCL2_ENST00000432376.1_Nonsense_Mutation_p.Y126*|PLCL2_ENST00000460467.1_Intron	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	252					B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						TAATTTCTTATGGAAAACATA	0.393																																																	0													101.0	103.0	103.0					3																	17051594		2203	4300	6503	SO:0001587	stop_gained	0			AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.378T>G	3.37:g.17051594T>G	ENSP00000409637:p.Tyr126*		A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Nonsense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.Y126*	ENST00000418129.2	37	c.378	CCDS33713.1	3	.	.	.	.	.	.	.	.	.	.	T	38	7.179519	0.98118	.	.	ENSG00000154822	ENST00000418129;ENST00000285094;ENST00000396755;ENST00000432376	.	.	.	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.513	0.44872	0.0:0.0759:0.0:0.9241	.	.	.	.	X	126;253;126;126	.	.	Y	+	3	2	PLCL2	17026598	0.973000	0.33851	1.000000	0.80357	0.986000	0.74619	0.101000	0.15251	2.028000	0.59812	0.459000	0.35465	TAT	PLCL2	-	smart_Pleckstrin_homology	ENSG00000154822		0.393	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL2	HGNC	protein_coding	OTTHUMT00000340250.3	-	0.00	31	0	T			17051594	+1	tier1	-	no_errors	ENST00000418129	ensembl	human	known	74_37	nonsense	10.87	41	5	SNP	1.000	G
PLEC	5339	genome.wustl.edu	37	8	144996861	144996863	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	CTC	CTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr8:144996861_144996863delCTC	ENST00000322810.4	-	31	7814_7816	c.7645_7647delGAG	c.(7645-7647)gagdel	p.E2549del	PLEC_ENST00000345136.3_In_Frame_Del_p.E2412del|PLEC_ENST00000357649.2_In_Frame_Del_p.E2416del|PLEC_ENST00000356346.3_In_Frame_Del_p.E2398del|PLEC_ENST00000398774.2_In_Frame_Del_p.E2380del|PLEC_ENST00000436759.2_In_Frame_Del_p.E2439del|PLEC_ENST00000354589.3_In_Frame_Del_p.E2412del|PLEC_ENST00000527096.1_In_Frame_Del_p.E2435del|PLEC_ENST00000354958.2_In_Frame_Del_p.E2390del	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2549	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TCTCACCGATCTCCTCCGCCTGC	0.67																																																	0																																										SO:0001651	inframe_deletion	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.7645_7647delGAG	8.37:g.144996864_144996866delCTC	ENSP00000323856:p.Glu2549del		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	In_Frame_Del	DEL	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.E2549in_frame_del	ENST00000322810.4	37	c.7647_7645	CCDS43772.1	8																																																																																			PLEC	-	NULL	ENSG00000178209		0.670	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1		0.00	38	0	CTC	NM_000445		144996863	-1	tier1		no_errors	ENST00000322810	ensembl	human	known	74_37	in_frame_del	50.00	7	7	DEL	1.000:1.000:1.000	-
PLEKHA8P1	51054	genome.wustl.edu	37	12	45567893	45567893	+	RNA	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr12:45567893G>A	ENST00000256692.5	-	0	792					NR_037144.1		O95397	PKHA9_HUMAN	pleckstrin homology domain containing, family A member 8 pseudogene 1							cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						ATAATAGGATGTTTCATCTTG	0.423																																																	0													147.0	136.0	140.0					12																	45567893		2203	4300	6503			0			AF103731		12q12	2010-11-24	2010-11-24	2010-11-24	ENSG00000134297	ENSG00000134297			30222	pseudogene	pseudogene	"""putative glycolipid transfer protein"""		"""pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 9"""	PLEKHA9		12477932	Standard	NR_037144		Approved	FLJ14156	uc001rom.2	O95397			12.37:g.45567893G>A				RNA	SNP	-	NULL	ENST00000256692.5	37	NULL		12																																																																																			PLEKHA8P1	-	-	ENSG00000134297		0.423	PLEKHA8P1-002	KNOWN	basic	processed_transcript	PLEKHA8P1	HGNC	pseudogene	OTTHUMT00000404814.1	-	0.00	82	0	G	NR_037144		45567893	-1	tier1	-	no_errors	ENST00000256692	ensembl	human	known	74_37	rna	38.71	38	24	SNP	0.824	A
PLEKHS1	79949	genome.wustl.edu	37	10	115540390	115540390	+	Silent	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr10:115540390A>G	ENST00000354462.3	+	6	605	c.447A>G	c.(445-447)ccA>ccG	p.P149P	PLEKHS1_ENST00000369312.4_Silent_p.P317P|PLEKHS1_ENST00000361048.1_3'UTR|PLEKHS1_ENST00000369309.1_Silent_p.P233P			Q5SXH7	PKHS1_HUMAN	pleckstrin homology domain containing, family S member 1	413																	GCAGGATCCCAAATTCAGAGA	0.418																																																	0													102.0	97.0	99.0					10																	115540390		2203	4300	6503	SO:0001819	synonymous_variant	0			AK027190	CCDS7583.1, CCDS53580.1, CCDS53581.1	10q26.11	2013-01-11	2012-05-31	2012-05-31	ENSG00000148735	ENSG00000148735		"""Pleckstrin homology (PH) domain containing"""	26285	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 81"""	C10orf81		12477932	Standard	NM_024889		Approved	FLJ23537, bA211N11.2	uc001lat.2	Q5SXH7	OTTHUMG00000019074	ENST00000354462.3:c.447A>G	10.37:g.115540390A>G			A8KA02|B3KX00|B6EDE1|Q5SXH8|Q5SXI0|Q6ZQR5|Q8NE42|Q9H5D9	Silent	SNP	NULL	p.P317	ENST00000354462.3	37	c.951		10																																																																																			PLEKHS1	-	NULL	ENSG00000148735		0.418	PLEKHS1-002	KNOWN	basic	protein_coding	PLEKHS1	HGNC	protein_coding	OTTHUMT00000050431.2	-	0.00	60	0	A	NM_024889		115540390	+1	tier1	-	no_errors	ENST00000369312	ensembl	human	known	74_37	silent	33.33	22	11	SNP	0.985	G
POSTN	10631	genome.wustl.edu	37	13	38154738	38154738	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr13:38154738T>A	ENST00000379747.4	-	11	1606	c.1489A>T	c.(1489-1491)Aaa>Taa	p.K497*	POSTN_ENST00000379742.4_Nonsense_Mutation_p.K497*|POSTN_ENST00000379743.4_Nonsense_Mutation_p.K497*|POSTN_ENST00000541179.1_Nonsense_Mutation_p.K497*|POSTN_ENST00000379749.4_Nonsense_Mutation_p.K497*|POSTN_ENST00000541481.1_Nonsense_Mutation_p.K497*	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	497	FAS1 4. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		TGGAGGGATTTCTCTGCTGGC	0.428																																																	0													312.0	294.0	300.0					13																	38154738		2203	4300	6503	SO:0001587	stop_gained	0			D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.1489A>T	13.37:g.38154738T>A	ENSP00000369071:p.Lys497*		B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Nonsense_Mutation	SNP	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfscan_EMI_domain,pfscan_FAS1_domain	p.K497*	ENST00000379747.4	37	c.1489	CCDS9364.1	13	.	.	.	.	.	.	.	.	.	.	T	39	7.876223	0.98539	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481	.	.	.	5.02	5.02	0.67125	.	0.101860	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.9629	15.0317	0.71713	0.0:0.0:0.0:1.0	.	.	.	.	X	497	.	ENSP00000369066:K497X	K	-	1	0	POSTN	37052738	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.688000	0.68227	2.000000	0.58554	0.455000	0.32223	AAA	POSTN	-	superfamily_FAS1_domain,pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfscan_FAS1_domain	ENSG00000133110		0.428	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	POSTN	HGNC	protein_coding	OTTHUMT00000044566.2	-	0.00	95	0	T	NM_006475		38154738	-1	tier1	-	no_errors	ENST00000379747	ensembl	human	known	74_37	nonsense	20.30	105	27	SNP	1.000	A
PPM1F	9647	genome.wustl.edu	37	22	22277676	22277676	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr22:22277676C>A	ENST00000263212.5	-	8	1259	c.1154G>T	c.(1153-1155)aGc>aTc	p.S385I	PPM1F_ENST00000407142.1_Missense_Mutation_p.S217I|PPM1F_ENST00000538191.1_Missense_Mutation_p.S281I	NM_014634.3	NP_055449.1	P49593	PPM1F_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1F	385					cellular response to drug (GO:0035690)|histone dephosphorylation (GO:0016576)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of stress fiber assembly (GO:0051496)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	calmodulin-dependent protein phosphatase activity (GO:0033192)|metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	12	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		ACGGAGCCCGCTGCCCTGCTG	0.652																																																	0													40.0	44.0	42.0					22																	22277676		2203	4300	6503	SO:0001583	missense	0			D13640	CCDS13796.1	22q11.22	2012-04-17	2010-03-05		ENSG00000100034	ENSG00000100034	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19388	protein-coding gene	gene with protein product	"""partner of PIX 2"", ""Ca(2+)/calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1F (PP2C domain containing)"""			11864573, 11559703	Standard	NM_014634		Approved	FEM-2, KIAA0015, POPX2, CaMKPase, CAMKP	uc002zvp.2	P49593	OTTHUMG00000150835	ENST00000263212.5:c.1154G>T	22.37:g.22277676C>A	ENSP00000263212:p.Ser385Ile		A8K6G3|B7Z2C3|Q96PM2	Missense_Mutation	SNP	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.S385I	ENST00000263212.5	37	c.1154	CCDS13796.1	22	.	.	.	.	.	.	.	.	.	.	C	13.86	2.364203	0.41902	.	.	ENSG00000100034	ENST00000263212;ENST00000407142;ENST00000406981;ENST00000538191	T;T;T	0.11495	2.77;2.77;2.77	5.3	1.56	0.23342	Protein phosphatase 2C-like (5);	0.694304	0.15577	N	0.255147	T	0.10981	0.0268	L	0.41632	1.29	0.09310	N	1	P;P	0.34562	0.457;0.457	B;B	0.41917	0.258;0.37	T	0.24119	-1.0169	10	0.62326	D	0.03	-28.2011	4.8009	0.13296	0.1495:0.4404:0.0:0.4102	.	281;385	B7Z2C3;P49593	.;PPM1F_HUMAN	I	385;217;217;281	ENSP00000263212:S385I;ENSP00000384930:S217I;ENSP00000439915:S281I	ENSP00000263212:S385I	S	-	2	0	PPM1F	20607676	0.000000	0.05858	0.221000	0.23827	0.521000	0.34408	0.676000	0.25247	0.185000	0.20105	0.655000	0.94253	AGC	PPM1F	-	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	ENSG00000100034		0.652	PPM1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1F	HGNC	protein_coding	OTTHUMT00000320267.2	-	0.00	73	0	C	NM_014634		22277676	-1	tier1	-	no_errors	ENST00000263212	ensembl	human	known	74_37	missense	37.84	46	28	SNP	0.000	A
PPP2R3A	5523	genome.wustl.edu	37	3	135742018	135742018	+	Intron	SNP	G	G	A	rs374006910		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr3:135742018G>A	ENST00000264977.3	+	3	2612				PPP2R3A_ENST00000490467.1_Intron|PPP2R3A_ENST00000334546.2_Missense_Mutation_p.R36Q	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha						eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TTTAAGAAGCGGCTGAAGTCA	0.388																																																	0								G	,,GLN/ARG	0,4406		0,0,2203	117.0	120.0	119.0		,,107	6.1	1.0	3		119	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron,missense	PPP2R3A	NM_001190447.1,NM_002718.4,NM_181897.2	,,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	,,36/530	135742018	1,13005	2203	4300	6503	SO:0001627	intron_variant	0			L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.1996-3656G>A	3.37:g.135742018G>A			A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.R36Q	ENST00000264977.3	37	c.107	CCDS3087.1	3	.	.	.	.	.	.	.	.	.	.	G	29.6	5.023515	0.93462	0.0	1.16E-4	ENSG00000073711	ENST00000334546	T	0.16073	2.37	6.07	6.07	0.98685	.	.	.	.	.	T	0.36386	0.0965	L	0.50333	1.59	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.01133	-1.1441	9	0.14656	T	0.56	.	19.6475	0.95784	0.0:0.0:1.0:0.0	.	36	Q06190-2	.	Q	36	ENSP00000334748:R36Q	ENSP00000334748:R36Q	R	+	2	0	PPP2R3A	137224708	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.414000	0.97362	2.885000	0.99019	0.655000	0.94253	CGG	PPP2R3A	-	NULL	ENSG00000073711		0.388	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R3A	HGNC	protein_coding	OTTHUMT00000357232.1	-	0.00	43	0	G	NM_002718		135742018	+1	tier1	-	no_errors	ENST00000334546	ensembl	human	known	74_37	missense	53.33	21	24	SNP	1.000	A
PRDM15	63977	genome.wustl.edu	37	21	43259951	43259951	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr21:43259951C>A	ENST00000269844.3	-	14	1860	c.1750G>T	c.(1750-1752)Ggc>Tgc	p.G584C	PRDM15_ENST00000422911.1_Missense_Mutation_p.G255C|PRDM15_ENST00000398548.1_Missense_Mutation_p.G255C|PRDM15_ENST00000447207.2_Missense_Mutation_p.G218C|PRDM15_ENST00000538201.1_Missense_Mutation_p.G218C	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	584					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						TCTAAGTGGCCCAACAGATGT	0.587																																																	0													77.0	77.0	77.0					21																	43259951		2203	4300	6503	SO:0001583	missense	0			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.1750G>T	21.37:g.43259951C>A	ENSP00000269844:p.Gly584Cys		E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.G584C	ENST00000269844.3	37	c.1750	CCDS13676.1	21	.	.	.	.	.	.	.	.	.	.	C	12.01	1.809563	0.31961	.	.	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844;ENST00000380489	T;T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58;-0.58	4.76	1.87	0.25490	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	.	.	.	.	T	0.67458	0.2895	L	0.38838	1.175	0.33155	D	0.546239	D;B;B	0.71674	0.998;0.004;0.001	P;B;B	0.60173	0.87;0.002;0.002	T	0.68428	-0.5411	9	0.38643	T	0.18	2.1383	2.4876	0.04602	0.214:0.4075:0.0:0.3785	.	584;255;255	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	C	255;255;218;218;584;218	ENSP00000408592:G255C;ENSP00000381556:G255C;ENSP00000444044:G218C;ENSP00000390245:G218C;ENSP00000269844:G584C	ENSP00000269844:G584C	G	-	1	0	PRDM15	42133020	1.000000	0.71417	0.079000	0.20413	0.802000	0.45316	1.372000	0.34261	0.530000	0.28619	0.655000	0.94253	GGC	PRDM15	-	smart_Znf_C2H2-like	ENSG00000141956		0.587	PRDM15-201	KNOWN	basic|CCDS	protein_coding	PRDM15	HGNC	protein_coding		-	0.00	37	0	C	NM_022115		43259951	-1	tier1	-	no_errors	ENST00000269844	ensembl	human	known	74_37	missense	24.00	19	6	SNP	0.981	A
PREP	5550	genome.wustl.edu	37	6	105825334	105825334	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr6:105825334C>T	ENST00000369110.3	-	3	373	c.181G>A	c.(181-183)Ggt>Agt	p.G61S		NM_002726.4	NP_002717.3	P48147	PPCE_HUMAN	prolyl endopeptidase	61					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	TTGTATAAACCTCTGATGGGA	0.378																																																	0													119.0	116.0	117.0					6																	105825334		2203	4300	6503	SO:0001583	missense	0				CCDS5053.1	6q22	2008-02-05			ENSG00000085377	ENSG00000085377	3.4.21.26		9358	protein-coding gene	gene with protein product		600400				7959018	Standard	NM_002726		Approved		uc003prc.3	P48147	OTTHUMG00000015297	ENST00000369110.3:c.181G>A	6.37:g.105825334C>T	ENSP00000358106:p.Gly61Ser		Q8N6D4	Missense_Mutation	SNP	pfam_Pept_S9A_N,pfam_Peptidase_S9,prints_Peptidase_S9A	p.G61S	ENST00000369110.3	37	c.181	CCDS5053.1	6	.	.	.	.	.	.	.	.	.	.	C	16.18	3.049375	0.55218	.	.	ENSG00000085377	ENST00000369110	T	0.43688	0.94	5.76	5.76	0.90799	Peptidase S9A/B/C, oligopeptidase, N-terminal beta-propeller (2);	0.203351	0.51477	D	0.000085	T	0.15132	0.0365	N	0.12471	0.22	0.49798	D	0.999826	B	0.06786	0.001	B	0.10450	0.005	T	0.03969	-1.0988	10	0.33940	T	0.23	-12.0161	15.4512	0.75274	0.0:0.8618:0.1382:0.0	.	61	P48147	PPCE_HUMAN	S	61	ENSP00000358106:G61S	ENSP00000358106:G61S	G	-	1	0	PREP	105932027	1.000000	0.71417	0.278000	0.24718	0.992000	0.81027	4.509000	0.60448	2.700000	0.92200	0.650000	0.86243	GGT	PREP	-	pfam_Pept_S9A_N	ENSG00000085377		0.378	PREP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREP	HGNC	protein_coding	OTTHUMT00000041658.1	-	0.00	77	0	C			105825334	-1	tier1	-	no_errors	ENST00000369110	ensembl	human	known	74_37	missense	11.36	78	10	SNP	1.000	T
PRKG1	5592	genome.wustl.edu	37	10	53822320	53822320	+	Silent	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr10:53822320A>G	ENST00000401604.2	+	7	1013	c.819A>G	c.(817-819)tcA>tcG	p.S273S	PRKG1_ENST00000373980.4_Silent_p.S288S|PRKG1_ENST00000373985.1_Silent_p.S261S|PRKG1_ENST00000373975.2_5'UTR			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	273	cGMP-binding, low affinity.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		GTGAAGACTCACCGAGTGAAG	0.398																																																	0													67.0	66.0	66.0					10																	53822320		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.819A>G	10.37:g.53822320A>G			A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Silent	SNP	pirsf_cGMP-dependent_protein_kinase,pfam_Prot_kinase_dom,pfam_cNMP-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,prints_cGMP_dep_kinase,prints_cAMP/cGMP_kin,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_dom	p.S288	ENST00000401604.2	37	c.864	CCDS44399.1	10																																																																																			PRKG1	-	pirsf_cGMP-dependent_protein_kinase,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000185532		0.398	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG1	HGNC	protein_coding		-	0.00	66	0	A			53822320	+1	tier1	-	no_errors	ENST00000373980	ensembl	human	known	74_37	silent	16.05	68	13	SNP	1.000	G
PRPF3	9129	genome.wustl.edu	37	1	150315759	150315759	+	Intron	SNP	G	G	A	rs372916275		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:150315759G>A	ENST00000324862.6	+	10	1447				PRPF3_ENST00000467329.1_Intron|PRPF3_ENST00000414970.2_Intron|PRPF3_ENST00000543398.1_Intron	NM_004698.2	NP_004689.1	O43395	PRPF3_HUMAN	pre-mRNA processing factor 3						mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 x U5 tri-snRNP complex (GO:0046540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		TTACTGCTTTGGTATACTAAT	0.373																																					Ovarian(168;1070 2670 5178 20729)												0													34.0	32.0	33.0					1																	150315759		2201	4298	6499	SO:0001627	intron_variant	0			AF001947	CCDS951.1	1q21.1	2013-07-16	2013-06-10		ENSG00000117360	ENSG00000117360			17348	protein-coding gene	gene with protein product		607301	"""retinitis pigmentosa 18 (autosomal dominant)"", ""PRP3 pre-mRNA processing factor 3 homolog (yeast)"", ""PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)"""	RP18			Standard	NM_004698		Approved	Prp3, hPrp3, SNRNP90	uc001eum.4	O43395	OTTHUMG00000012807	ENST00000324862.6:c.1283-26G>A	1.37:g.150315759G>A			B4DSY9|O43446|Q5VT54	RNA	SNP	-	NULL	ENST00000324862.6	37	NULL	CCDS951.1	1																																																																																			PRPF3	-	-	ENSG00000117360		0.373	PRPF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF3	HGNC	protein_coding	OTTHUMT00000035836.1	-	0.00	46	0	G	NM_004698		150315759	+1	tier1	-	no_errors	ENST00000493553	ensembl	human	known	74_37	rna	7.76	107	9	SNP	0.001	A
PSMC4	5704	genome.wustl.edu	37	19	40485723	40485723	+	Splice_Site	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:40485723G>T	ENST00000157812.2	+	7	871		c.e7-1		PSMC4_ENST00000455878.2_Splice_Site	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CCTGTCATCAGCTGCATTCAT	0.547																																					Colon(105;1478 1543 4034 6132 38638)												0													91.0	97.0	95.0					19																	40485723		2203	4300	6503	SO:0001630	splice_region_variant	0			U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.674-1G>T	19.37:g.40485723G>T			Q96FV5|Q9UBM3|Q9UEX3	Splice_Site	SNP	-	e7-1	ENST00000157812.2	37	c.674-1	CCDS12547.1	19	.	.	.	.	.	.	.	.	.	.	G	13.02	2.111809	0.37242	.	.	ENSG00000013275	ENST00000157812;ENST00000455878	.	.	.	6.05	6.05	0.98169	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0951	0.89487	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PSMC4	45177563	1.000000	0.71417	1.000000	0.80357	0.034000	0.12701	7.902000	0.87389	2.878000	0.98634	0.650000	0.86243	.	PSMC4	-	-	ENSG00000013275		0.547	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMC4	HGNC	protein_coding	OTTHUMT00000462485.1	-	0.00	56	0	G	NM_006503	Intron	40485723	+1	tier1	-	no_errors	ENST00000157812	ensembl	human	known	74_37	splice_site	7.02	53	4	SNP	1.000	T
INAFM1	255783	genome.wustl.edu	37	19	47778599	47778599	+	Silent	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:47778599C>A	ENST00000552360.2	+	1	458	c.423C>A	c.(421-423)ccC>ccA	p.P141P		NM_178511.5	NP_848606.3														skin(1)	1						GGCGAAGACCCGGGTAACTCT	0.697																																																	0													1.0	1.0	1.0					19																	47778599		223	548	771	SO:0001819	synonymous_variant	0																														ENST00000552360.2:c.423C>A	19.37:g.47778599C>A				Silent	SNP	NULL	p.P141	ENST00000552360.2	37	c.423	CCDS46131.1	19																																																																																			PRR24	-	NULL	ENSG00000257704		0.697	PRR24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR24	HGNC	protein_coding	OTTHUMT00000407505.2	-	0.00	26	0	C			47778599	+1	tier1	-	no_errors	ENST00000552360	ensembl	human	known	74_37	silent	12.50	28	4	SNP	0.058	A
PTCH2	8643	genome.wustl.edu	37	1	45292197	45292197	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:45292197G>A	ENST00000372192.3	-	18	3069	c.2939C>T	c.(2938-2940)gCt>gTt	p.A980V	PTCH2_ENST00000447098.2_Missense_Mutation_p.A980V	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	980					epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					GAGCAGCAGAGCACAGACGAG	0.632									Basal Cell Nevus syndrome																																								0													37.0	36.0	37.0					1																	45292197		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.2939C>T	1.37:g.45292197G>A	ENSP00000361266:p.Ala980Val		O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.A980V	ENST00000372192.3	37	c.2939	CCDS516.1	1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.157701	0.78114	.	.	ENSG00000117425	ENST00000447098;ENST00000372192	D;D	0.84944	-1.92;-1.92	4.17	4.17	0.49024	.	0.000000	0.50627	D	0.000119	D	0.90577	0.7046	M	0.64997	1.995	0.58432	D	0.999995	P;D	0.57899	0.846;0.981	P;D	0.66084	0.637;0.941	D	0.91094	0.4909	10	0.56958	D	0.05	-4.8842	17.7983	0.88579	0.0:0.0:1.0:0.0	.	980;980	Q9Y6C5-2;Q9Y6C5	.;PTC2_HUMAN	V	980	ENSP00000389703:A980V;ENSP00000361266:A980V	ENSP00000361266:A980V	A	-	2	0	PTCH2	45064784	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	7.265000	0.78442	2.608000	0.88229	0.655000	0.94253	GCT	PTCH2	-	pfam_Patched,tigrfam_TM_rcpt_patched	ENSG00000117425		0.632	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCH2	HGNC	protein_coding	OTTHUMT00000023428.4	-	0.00	40	0	G	NM_003738		45292197	-1	tier1	-	no_errors	ENST00000372192	ensembl	human	known	74_37	missense	31.25	22	10	SNP	1.000	A
PTDSS1	9791	genome.wustl.edu	37	8	97316374	97316374	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr8:97316374G>C	ENST00000517309.1	+	7	1185	c.859G>C	c.(859-861)Gta>Cta	p.V287L	PTDSS1_ENST00000518776.1_3'UTR|PTDSS1_ENST00000522072.1_Missense_Mutation_p.V84L|PTDSS1_ENST00000455950.2_Missense_Mutation_p.V141L	NM_014754.1	NP_055569.1	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	287					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|stomach(1)	29	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	TTTTCAGAGAGTAGCTGGAGT	0.418																																																	0													193.0	191.0	192.0					8																	97316374		2203	4300	6503	SO:0001583	missense	0			D14694	CCDS6271.1	8q22	2008-05-02			ENSG00000156471	ENSG00000156471			9587	protein-coding gene	gene with protein product		612792					Standard	NM_014754		Approved	KIAA0024, PSSA, PSS1	uc003yht.1	P48651	OTTHUMG00000164687	ENST00000517309.1:c.859G>C	8.37:g.97316374G>C	ENSP00000430548:p.Val287Leu		E5RFC5|Q9BUQ5	Missense_Mutation	SNP	pfam_PSS	p.V287L	ENST00000517309.1	37	c.859	CCDS6271.1	8	.	.	.	.	.	.	.	.	.	.	G	14.22	2.471333	0.43942	.	.	ENSG00000156471	ENST00000517309;ENST00000455950;ENST00000522072	T;T;T	0.43688	1.0;0.99;0.94	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.27027	0.0662	N	0.05124	-0.11	0.58432	D	0.999995	B	0.06786	0.001	B	0.11329	0.006	T	0.05699	-1.0869	10	0.36615	T	0.2	-17.9526	18.2631	0.90043	0.0:0.0:1.0:0.0	.	287	P48651	PTSS1_HUMAN	L	287;141;84	ENSP00000430548:V287L;ENSP00000401248:V141L;ENSP00000430928:V84L	ENSP00000401248:V141L	V	+	1	0	PTDSS1	97385550	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	5.177000	0.65032	2.746000	0.94184	0.655000	0.94253	GTA	PTDSS1	-	pfam_PSS	ENSG00000156471		0.418	PTDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTDSS1	HGNC	protein_coding	OTTHUMT00000379743.2	-	0.00	38	0	G			97316374	+1	tier1	-	no_errors	ENST00000517309	ensembl	human	known	74_37	missense	5.30	125	7	SNP	1.000	C
PTGES2	80142	genome.wustl.edu	37	9	130887621	130887621	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr9:130887621delA	ENST00000338961.6	-	2	1123	c.379delT	c.(379-381)tacfs	p.Y127fs	PTGES2_ENST00000483625.1_5'UTR|PTGES2_ENST00000277462.5_5'UTR|AL590708.2_ENST00000443493.1_5'Flank	NM_001256335.1|NM_025072.6	NP_001243264.1|NP_079348.1	Q9H7Z7	PGES2_HUMAN	prostaglandin E synthase 2	127	Glutaredoxin. {ECO:0000255|PROSITE- ProRule:PRU00686}.				cell redox homeostasis (GO:0045454)|positive regulation of transcription, DNA-templated (GO:0045893)|prostaglandin biosynthetic process (GO:0001516)|secretion (GO:0046903)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|glutathione binding (GO:0043295)|heme binding (GO:0020037)|lyase activity (GO:0016829)|prostaglandin-E synthase activity (GO:0050220)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(1)|lung(2)	4						ACCACCTGGTAGGGCAGGGCA	0.607																																																	0													82.0	70.0	74.0					9																	130887621		2203	4300	6503	SO:0001589	frameshift_variant	0			AK024100	CCDS6891.1	9q34.12	2008-05-06	2002-06-13	2002-06-14	ENSG00000148334	ENSG00000148334			17822	protein-coding gene	gene with protein product		608152	"""chromosome 9 open reading frame 15"""	C9orf15		11866447	Standard	NM_025072		Approved	FLJ14038	uc004bti.4	Q9H7Z7	OTTHUMG00000020730	ENST00000338961.6:c.379delT	9.37:g.130887621delA	ENSP00000345341:p.Tyr127fs		Q53EW9|Q5SYV6|Q96GI0|Q96GL2	Frame_Shift_Del	DEL	pfam_Glutaredoxin,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold	p.Y127fs	ENST00000338961.6	37	c.379	CCDS6891.1	9																																																																																			PTGES2	-	pfam_Glutaredoxin,superfamily_Thioredoxin-like_fold	ENSG00000148334		0.607	PTGES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGES2	HGNC	protein_coding	OTTHUMT00000054339.1		0.00	55	0	A			130887621	-1	tier1		no_errors	ENST00000338961	ensembl	human	known	74_37	frame_shift_del	10.53	17	2	DEL	1.000	-
PTPRJ	5795	genome.wustl.edu	37	11	48157714	48157714	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr11:48157714G>A	ENST00000418331.2	+	9	2091	c.1739G>A	c.(1738-1740)gGc>gAc	p.G580D		NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	580	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						TCCAAGCATGGCTCTAACCAC	0.522																																																	0													141.0	123.0	129.0					11																	48157714		2201	4298	6499	SO:0001583	missense	0			U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.1739G>A	11.37:g.48157714G>A	ENSP00000400010:p.Gly580Asp		Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.G580D	ENST00000418331.2	37	c.1739	CCDS7945.1	11	.	.	.	.	.	.	.	.	.	.	G	10.37	1.331109	0.24167	.	.	ENSG00000149177	ENST00000418331	T	0.59772	0.24	5.31	2.22	0.28083	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50701	0.1631	L	0.50333	1.59	0.20563	N	0.999889	P	0.45768	0.866	P	0.46208	0.507	T	0.33292	-0.9874	9	0.28530	T	0.3	.	4.5544	0.12130	0.0875:0.1513:0.6056:0.1556	.	580	Q12913	PTPRJ_HUMAN	D	580	ENSP00000400010:G580D	ENSP00000400010:G580D	G	+	2	0	PTPRJ	48114290	0.000000	0.05858	0.068000	0.19968	0.087000	0.18053	-0.094000	0.11094	0.733000	0.32492	0.650000	0.86243	GGC	PTPRJ	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000149177		0.522	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRJ	HGNC	protein_coding	OTTHUMT00000390525.1	-	0.00	39	0	G			48157714	+1	tier1	-	no_errors	ENST00000418331	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.014	A
PYHIN1	149628	genome.wustl.edu	37	1	158911856	158911856	+	Silent	SNP	A	A	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:158911856A>C	ENST00000368140.1	+	5	914	c.669A>C	c.(667-669)acA>acC	p.T223T	PYHIN1_ENST00000368138.3_Silent_p.T214T|PYHIN1_ENST00000485134.1_3'UTR|PYHIN1_ENST00000392252.3_Silent_p.T214T|PYHIN1_ENST00000392254.2_Silent_p.T223T	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	223	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					TAAATGCAACAAAAGTATTTA	0.393																																																	0													69.0	70.0	70.0					1																	158911856		2203	4300	6503	SO:0001819	synonymous_variant	0			AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.669A>C	1.37:g.158911856A>C			Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Silent	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN,pfscan_HIN200/IF120x	p.T223	ENST00000368140.1	37	c.669	CCDS1178.1	1																																																																																			PYHIN1	-	pfam_HIN200/IF120x,pfscan_HIN200/IF120x	ENSG00000163564		0.393	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PYHIN1	HGNC	protein_coding	OTTHUMT00000090110.1	-	0.00	49	0	A	NM_152501		158911856	+1	tier1	-	no_errors	ENST00000368140	ensembl	human	known	74_37	silent	57.41	23	31	SNP	0.001	C
RACGAP1	29127	genome.wustl.edu	37	12	50388107	50388107	+	Silent	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr12:50388107G>T	ENST00000427314.2	-	14	1369	c.1146C>A	c.(1144-1146)ggC>ggA	p.G382G	RACGAP1_ENST00000454520.2_Silent_p.G382G|RACGAP1_ENST00000312377.5_Silent_p.G382G|RACGAP1_ENST00000551016.1_Silent_p.G382G|RACGAP1_ENST00000547905.1_Silent_p.G382G|RACGAP1_ENST00000548961.1_5'Flank|RACGAP1_ENST00000434422.1_Silent_p.G382G|RACGAP1_ENST00000547061.1_5'Flank	NM_013277.3	NP_037409.2			Rac GTPase activating protein 1											cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(6)	14						TCCTATACAGGCCTGTCTATT	0.403																																																	0													99.0	104.0	102.0					12																	50388107		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8795.1	12q13	2004-05-17				ENSG00000161800			9804	protein-coding gene	gene with protein product		604980				9497316	Standard	NM_013277		Approved	MgcRacGAP	uc001rvs.2	Q9H0H5		ENST00000427314.2:c.1146C>A	12.37:g.50388107G>T				Silent	SNP	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Rho_GTPase_activation_prot,superfamily_Regulat_G_prot_signal_superfam,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.G382	ENST00000427314.2	37	c.1146	CCDS8795.1	12																																																																																			RACGAP1	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000161800		0.403	RACGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RACGAP1	HGNC	protein_coding	OTTHUMT00000405997.1	-	0.00	34	0	G	NM_013277		50388107	-1	tier1	-	no_errors	ENST00000312377	ensembl	human	known	74_37	silent	12.90	27	4	SNP	0.805	T
RAF1	5894	genome.wustl.edu	37	3	12653482	12653482	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr3:12653482C>A	ENST00000251849.4	-	3	726	c.287G>T	c.(286-288)tGt>tTt	p.C96F	RAF1_ENST00000542177.1_Intron|RAF1_ENST00000442415.2_Missense_Mutation_p.C96F|RAF1_ENST00000534997.1_5'Flank	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	96	RBD. {ECO:0000255|PROSITE- ProRule:PRU00262}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	GAACACTGCACAGCACTCTGG	0.448			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																															Dom	yes		3	3p25	5894	v-raf-1 murine leukemia viral oncogene homolog 1		M	0													176.0	169.0	172.0					3																	12653482		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.287G>T	3.37:g.12653482C>A	ENSP00000251849:p.Cys96Phe		B0LPH8|B2R5N3|Q15278|Q9UC20	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Raf-like_ras-bd,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,smart_Raf-like_ras-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Raf-like_ras-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_DAG/PE-bd	p.C96F	ENST00000251849.4	37	c.287	CCDS2612.1	3	.	.	.	.	.	.	.	.	.	.	C	26.9	4.786259	0.90282	.	.	ENSG00000132155	ENST00000251849;ENST00000442415;ENST00000432427	D;D;T	0.85013	-1.85;-1.93;-1.22	5.77	5.77	0.91146	Raf-like Ras-binding (3);	0.000000	0.85682	D	0.000000	D	0.93334	0.7875	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93551	0.6886	10	0.87932	D	0	.	19.9922	0.97370	0.0:1.0:0.0:0.0	.	96	P04049	RAF1_HUMAN	F	96;96;8	ENSP00000251849:C96F;ENSP00000401888:C96F;ENSP00000398591:C8F	ENSP00000251849:C96F	C	-	2	0	RAF1	12628482	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.810000	0.86072	2.740000	0.93945	0.557000	0.71058	TGT	RAF1	-	pfam_Raf-like_ras-bd,smart_Raf-like_ras-bd,pfscan_Raf-like_ras-bd	ENSG00000132155		0.448	RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAF1	HGNC	protein_coding	OTTHUMT00000252015.2	-	0.00	35	0	C	NM_002880		12653482	-1	tier1	-	no_errors	ENST00000442415	ensembl	human	known	74_37	missense	16.13	26	5	SNP	1.000	A
RGS14	10636	genome.wustl.edu	37	5	176794472	176794472	+	Missense_Mutation	SNP	C	C	T	rs572106520		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr5:176794472C>T	ENST00000408923.3	+	6	729	c.541C>T	c.(541-543)Cgc>Tgc	p.R181C		NM_006480.4	NP_006471.2	O43566	RGS14_HUMAN	regulator of G-protein signaling 14	181	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				cell division (GO:0051301)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitotic nuclear division (GO:0007067)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of synaptic plasticity (GO:0031914)|nucleocytoplasmic transport (GO:0006913)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neurogenesis (GO:0050769)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to oxidative stress (GO:0006979)|spindle organization (GO:0007051)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual learning (GO:0008542)|zygote asymmetric cell division (GO:0010070)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|microtubule (GO:0005874)|nuclear body (GO:0016604)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|spindle (GO:0005819)|spindle pole (GO:0000922)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|microtubule binding (GO:0008017)|receptor signaling complex scaffold activity (GO:0030159)|receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(3)|upper_aerodigestive_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCGCTGTACCGCGAGTGCCT	0.677																																					NSCLC(47;353 1896 28036)												0													22.0	24.0	23.0					5																	176794472		1997	4168	6165	SO:0001583	missense	0			AF037195	CCDS43405.1	5q35.3	2008-02-05	2007-08-14		ENSG00000169220	ENSG00000169220		"""Regulators of G-protein signaling"""	9996	protein-coding gene	gene with protein product		602513	"""regulator of G-protein signalling 14"""				Standard	NM_006480		Approved		uc003mgf.3	O43566	OTTHUMG00000163324	ENST00000408923.3:c.541C>T	5.37:g.176794472C>T	ENSP00000386229:p.Arg181Cys		O43565|Q506M1|Q6ZWA4|Q8TD62	Missense_Mutation	SNP	pfam_Raf-like_ras-bd,pfam_RGS_dom,pfam_GoLoco_motif,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_Raf-like_ras-bd,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_Raf-like_ras-bd,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.R181C	ENST00000408923.3	37	c.541	CCDS43405.1	5	.	.	.	.	.	.	.	.	.	.	C	36	5.922858	0.97110	.	.	ENSG00000169220	ENST00000408923	T	0.01998	4.51	4.5	4.5	0.54988	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.156527	0.45606	D	0.000346	T	0.10380	0.0254	M	0.71581	2.175	0.80722	D	1	D;D;D	0.71674	0.998;0.994;0.993	P;P;P	0.60068	0.736;0.502;0.868	T	0.01212	-1.1417	10	0.87932	D	0	-13.3491	17.3879	0.87422	0.0:1.0:0.0:0.0	.	28;28;181	O43566-5;O43566-4;O43566	.;.;RGS14_HUMAN	C	181	ENSP00000386229:R181C	ENSP00000386229:R181C	R	+	1	0	RGS14	176727078	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.731000	0.84895	2.344000	0.79699	0.313000	0.20887	CGC	RGS14	-	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam	ENSG00000169220		0.677	RGS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS14	HGNC	protein_coding	OTTHUMT00000372676.1	-	0.00	31	0	C	NM_006480		176794472	+1	tier1	-	no_errors	ENST00000408923	ensembl	human	known	74_37	missense	6.74	83	6	SNP	1.000	T
RGS2	5997	genome.wustl.edu	37	1	192780357	192780357	+	Intron	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:192780357C>T	ENST00000235382.5	+	4	472					NM_002923.3	NP_002914.1	P41220	RGS2_HUMAN	regulator of G-protein signaling 2						brown fat cell differentiation (GO:0050873)|cell cycle (GO:0007049)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phospholipase activity (GO:0010519)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of microtubule polymerization (GO:0031116)|regulation of adrenergic receptor signaling pathway (GO:0071877)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of translation (GO:0006417)|relaxation of cardiac muscle (GO:0055119)|relaxation of vascular smooth muscle (GO:0060087)|spermatogenesis (GO:0007283)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			large_intestine(3)|lung(1)|urinary_tract(1)	5						AAGGACAAAGCGGGCTAGGAG	0.383																																					Pancreas(71;51 2183 4981)												0																																										SO:0001627	intron_variant	0			L13463	CCDS1377.1	1q31	2014-06-19	2014-06-19		ENSG00000116741	ENSG00000116741		"""Regulators of G-protein signaling"", ""Endogenous ligands"""	9998	protein-coding gene	gene with protein product		600861	"""regulator of G-protein signalling 2, 24kD"", ""regulator of G-protein signalling 2, 24kDa"", ""regulator of G-protein signaling 2, 24kDa"""	G0S8		8179820	Standard	NM_002923		Approved		uc001gsl.3	P41220	OTTHUMG00000035600	ENST00000235382.5:c.441+80C>T	1.37:g.192780357C>T			Q6I9U5	RNA	SNP	-	NULL	ENST00000235382.5	37	NULL	CCDS1377.1	1																																																																																			RGS2	-	-	ENSG00000116741		0.383	RGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS2	HGNC	protein_coding	OTTHUMT00000086396.1	-	0.00	28	0	C	NM_002923		192780357	+1	tier1	-	no_errors	ENST00000464302	ensembl	human	known	74_37	rna	30.43	32	14	SNP	0.000	T
Unknown	0	genome.wustl.edu	37	GL000220.1	118152	118152	+	IGR	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chrGL000220.1:118152C>A								None (None upstream) : None (None downstream)																							ccgccccccccctccacgcgc	0.811																																																	0																																										SO:0001628	intergenic_variant	0																															GL000220.1.37:g.118152C>A				RNA	SNP	-	NULL		37	NULL		GL000220.1																																																																																			RNA28S5	-	-	ENSG00000266658	0	0.811					RNA28S5	HGNC			-	0.00	83	0	C			118152	+1	tier1	-	no_errors	ENST00000607521	ensembl	human	known	74_37	rna	22.58	24	7	SNP	NULL	A
RNF111	54778	genome.wustl.edu	37	15	59344540	59344540	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr15:59344540C>G	ENST00000557998.1	+	3	1204	c.917C>G	c.(916-918)tCc>tGc	p.S306C	RNF111_ENST00000559209.1_Missense_Mutation_p.S306C|RNF111_ENST00000348370.4_Missense_Mutation_p.S306C|RNF111_ENST00000434298.1_Missense_Mutation_p.S306C|RNF111_ENST00000561186.1_Missense_Mutation_p.S306C	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	306	Interaction with AXIN1.|Ser-rich.				gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		ATAGAAGCTTCCTCCACTCCC	0.388																																					NSCLC(72;983 1365 10746 34387 47081)												0													153.0	144.0	147.0					15																	59344540		2192	4291	6483	SO:0001583	missense	0			AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.917C>G	15.37:g.59344540C>G	ENSP00000452732:p.Ser306Cys		C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.S306C	ENST00000557998.1	37	c.917	CCDS58366.1	15	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098024	0.76870	.	.	ENSG00000157450	ENST00000348370;ENST00000434298	T;T	0.17370	2.28;2.28	5.47	4.55	0.56014	.	0.056504	0.64402	D	0.000001	T	0.29652	0.0740	L	0.36672	1.1	0.46028	D	0.998828	D;D;D	0.76494	0.999;0.998;0.999	D;P;D	0.63192	0.912;0.818;0.912	T	0.03403	-1.1040	10	0.87932	D	0	-5.6075	14.4293	0.67238	0.0:0.9286:0.0:0.0714	.	306;306;306	Q6ZNA4-3;Q6ZNA4;Q6ZNA4-2	.;RN111_HUMAN;.	C	306	ENSP00000288199:S306C;ENSP00000393641:S306C	ENSP00000288199:S306C	S	+	2	0	RNF111	57131832	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.984000	0.76186	1.296000	0.44742	0.514000	0.50259	TCC	RNF111	-	NULL	ENSG00000157450		0.388	RNF111-003	KNOWN	basic|CCDS	protein_coding	RNF111	HGNC	protein_coding	OTTHUMT00000416012.1	-	0.00	82	0	C	NM_017610		59344540	+1	tier1	-	no_errors	ENST00000434298	ensembl	human	known	74_37	missense	10.20	44	5	SNP	1.000	G
RNF19A	25897	genome.wustl.edu	37	8	101276403	101276403	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr8:101276403A>C	ENST00000519449.1	-	8	1643	c.1327T>G	c.(1327-1329)Tta>Gta	p.L443V	RNF19A_ENST00000341084.2_Missense_Mutation_p.L443V|RNF19A_ENST00000523255.1_Intron	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	443					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			ACATAAGCTAACATAATAGGA	0.363																																																	0													74.0	70.0	71.0					8																	101276403		2203	4300	6503	SO:0001583	missense	0			AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.1327T>G	8.37:g.101276403A>C	ENSP00000428968:p.Leu443Val		A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Missense_Mutation	SNP	pfam_Znf_C6HC,smart_Znf_RING,smart_Znf_C6HC,pfscan_Znf_RING	p.L443V	ENST00000519449.1	37	c.1327	CCDS6286.1	8	.	.	.	.	.	.	.	.	.	.	A	18.99	3.740597	0.69304	.	.	ENSG00000034677	ENST00000519449;ENST00000341084	D;D	0.88431	-2.38;-2.38	5.5	3.05	0.35203	.	0.137971	0.49916	D	0.000133	D	0.93249	0.7849	M	0.80616	2.505	0.58432	D	0.999997	D	0.69078	0.997	D	0.78314	0.991	D	0.91942	0.5564	10	0.66056	D	0.02	.	9.3	0.37840	0.7846:0.0:0.2154:0.0	.	443	Q9NV58	RN19A_HUMAN	V	443	ENSP00000428968:L443V;ENSP00000342667:L443V	ENSP00000342667:L443V	L	-	1	2	RNF19A	101345579	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.688000	0.37690	0.434000	0.26340	0.460000	0.39030	TTA	RNF19A	-	NULL	ENSG00000034677		0.363	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF19A	HGNC	protein_coding	OTTHUMT00000380004.1	-	0.00	50	0	A	NM_015435		101276403	-1	tier1	-	no_errors	ENST00000341084	ensembl	human	known	74_37	missense	7.27	102	8	SNP	1.000	C
RNF213	57674	genome.wustl.edu	37	17	78321682	78321682	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr17:78321682T>A	ENST00000582970.1	+	29	9690	c.9547T>A	c.(9547-9549)Tgg>Agg	p.W3183R	RNF213_ENST00000508628.2_Missense_Mutation_p.W3232R|RNF213_ENST00000336301.6_Missense_Mutation_p.W1256R	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3183					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCTGGAGAAATGGCAGAAGAG	0.488																																																	0													75.0	75.0	75.0					17																	78321682		2203	4300	6503	SO:0001583	missense	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.9547T>A	17.37:g.78321682T>A	ENSP00000464087:p.Trp3183Arg		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.W3183R	ENST00000582970.1	37	c.9547	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	T	7.137	0.580971	0.13686	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.15952	2.38	5.41	1.91	0.25777	.	0.408163	0.25820	N	0.028093	T	0.10508	0.0257	L	0.49350	1.555	0.22424	N	0.999117	B	0.16166	0.016	B	0.15052	0.012	T	0.31420	-0.9944	10	0.10377	T	0.69	.	0.8282	0.01125	0.24:0.1494:0.139:0.4716	.	1256	Q63HN8	RN213_HUMAN	R	3183;3232;1256	ENSP00000338218:W1256R	ENSP00000338218:W1256R	W	+	1	0	RNF213	75936277	0.985000	0.35326	0.481000	0.27354	0.401000	0.30781	1.874000	0.39568	0.414000	0.25790	0.460000	0.39030	TGG	RNF213	-	superfamily_P-loop_NTPase	ENSG00000173821		0.488	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	-	0.00	42	0	T	NM_020914		78321682	+1	tier1	-	no_errors	ENST00000582970	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.397	A
RNFT2	84900	genome.wustl.edu	37	12	117289548	117289549	+	3'UTR	INS	-	-	A	rs373885060		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr12:117289548_117289549insA	ENST00000257575.4	+	0	3863_3864				RNFT2_ENST00000407967.3_Intron|RNFT2_ENST00000319176.7_Frame_Shift_Ins_p.K256fs|RNFT2_ENST00000392549.2_Intron|RNFT2_ENST00000551251.1_Intron			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		agactctgtctaaaaaaaaaaa	0.505																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.*2296->A	12.37:g.117289559_117289559dupA			E9PAM7|Q96SU5	Frame_Shift_Ins	INS	NULL	p.K259fs	ENST00000257575.4	37	c.765_766	CCDS44987.1	12																																																																																			RNFT2	-	NULL	ENSG00000135119		0.505	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNFT2	HGNC	protein_coding	OTTHUMT00000320417.1		0.00	18	0	-	NM_032814		117289549	+1	tier1		no_errors	ENST00000319176	ensembl	human	putative	74_37	frame_shift_ins	41.67	7	5	INS	0.004:0.003	A
RPP30	10556	genome.wustl.edu	37	10	92638872	92638872	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr10:92638872A>C	ENST00000371703.3	+	5	594	c.323A>C	c.(322-324)aAg>aCg	p.K108T	RPP30_ENST00000413330.1_Missense_Mutation_p.K108T|Y_RNA_ENST00000410373.1_RNA	NM_006413.4	NP_006404.1	P78346	RPP30_HUMAN	ribonuclease P/MRP 30kDa subunit	108					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ribonuclease P activity (GO:0004526)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	8						GTTTTTCCAAAGACAGAAAAG	0.338																																																	0													89.0	93.0	91.0					10																	92638872		2203	4299	6502	SO:0001583	missense	0			BC006991	CCDS7411.1, CCDS44458.1	10q23.32-q23.33	2012-05-21			ENSG00000148688	ENSG00000148688			17688	protein-coding gene	gene with protein product		606115				9037013, 9308968	Standard	NM_006413		Approved	TSG15	uc001khd.2	P78346	OTTHUMG00000018733	ENST00000371703.3:c.323A>C	10.37:g.92638872A>C	ENSP00000360768:p.Lys108Thr		B2R799|E9PB02	Missense_Mutation	SNP	pfam_RNase_P_p30,superfamily_Pol/histidinol_Pase-like	p.K108T	ENST00000371703.3	37	c.323	CCDS7411.1	10	.	.	.	.	.	.	.	.	.	.	A	10.38	1.334865	0.24253	.	.	ENSG00000148688	ENST00000371703;ENST00000413330;ENST00000371705;ENST00000277882;ENST00000414836	T;T;T	0.38240	1.21;1.18;1.15	5.64	5.64	0.86602	Polymerase/histidinol phosphatase-like (1);	0.049615	0.85682	D	0.000000	T	0.22322	0.0538	N	0.04508	-0.205	0.58432	D	0.999997	B;B;B	0.31519	0.327;0.263;0.139	B;B;B	0.37346	0.191;0.247;0.127	T	0.18713	-1.0328	10	0.22109	T	0.4	-10.8045	14.8407	0.70220	1.0:0.0:0.0:0.0	.	108;108;108	B4DJR3;P78346;E9PB02	.;RPP30_HUMAN;.	T	108;108;108;130;62	ENSP00000360768:K108T;ENSP00000389182:K108T;ENSP00000277882:K130T	ENSP00000277882:K130T	K	+	2	0	RPP30	92628852	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.108000	0.71522	2.152000	0.67230	0.528000	0.53228	AAG	RPP30	-	pfam_RNase_P_p30,superfamily_Pol/histidinol_Pase-like	ENSG00000148688		0.338	RPP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPP30	HGNC	protein_coding	OTTHUMT00000049347.1	-	0.00	98	0	A	NM_006413		92638872	+1	tier1	-	no_errors	ENST00000413330	ensembl	human	known	74_37	missense	22.73	51	15	SNP	1.000	C
RPS5	6193	genome.wustl.edu	37	19	58904798	58904798	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:58904798G>A	ENST00000596046.1	+	3	1240	c.391G>A	c.(391-393)Gcc>Acc	p.A131T	RPS5_ENST00000601521.1_Missense_Mutation_p.A131T|RPS5_ENST00000598495.1_Missense_Mutation_p.A152T|RPS5_ENST00000196551.3_Missense_Mutation_p.A131T|AC012313.1_ENST00000601382.1_5'Flank|RPS5_ENST00000598098.1_Missense_Mutation_p.A61T			P46782	RS5_HUMAN	ribosomal protein S5	131					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational fidelity (GO:0006450)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|large_intestine(1)|lung(1)|prostate(1)	4		all_cancers(17;1.71e-22)|all_epithelial(17;1.69e-16)|Lung NSC(17;2.25e-06)|all_lung(17;9.97e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Breast(46;0.0194)|Ovarian(87;0.0443)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.171)|GBM - Glioblastoma multiforme(193;0.0323)|Lung(386;0.0543)|LUSC - Lung squamous cell carcinoma(496;0.176)		CATTGGGCGCGCCGGGACTGT	0.632																																																	0													76.0	66.0	69.0					19																	58904798		2203	4300	6503	SO:0001583	missense	0			U14970	CCDS12978.1	19q13.4	2011-04-05				ENSG00000083845		"""S ribosomal proteins"""	10426	protein-coding gene	gene with protein product	"""40S ribosomal protein S5"""	603630				7772601, 9582194	Standard	NM_001009		Approved	S5	uc002qsn.3	P46782		ENST00000596046.1:c.391G>A	19.37:g.58904798G>A	ENSP00000472985:p.Ala131Thr		B2R4T2|Q96BN0	Missense_Mutation	SNP	pfam_Ribosomal_S7_dom,superfamily_Ribosomal_S7_dom,tigrfam_Ribosomal_S5/S7_euk/arc	p.A131T	ENST00000596046.1	37	c.391	CCDS12978.1	19	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760810	0.69763	.	.	ENSG00000083845	ENST00000196551	.	.	.	4.78	4.78	0.61160	Ribosomal protein S7 domain (3);	0.055638	0.64402	D	0.000001	D	0.85336	0.5673	H	0.96080	3.765	0.80722	D	1	D	0.69078	0.997	P	0.59221	0.854	D	0.90368	0.4378	9	0.87932	D	0	-14.3151	15.6905	0.77446	0.0:0.0:1.0:0.0	.	131	P46782	RS5_HUMAN	T	131	.	ENSP00000196551:A131T	A	+	1	0	RPS5	63596610	1.000000	0.71417	0.982000	0.44146	0.639000	0.38242	8.383000	0.90157	2.389000	0.81357	0.655000	0.94253	GCC	RPS5	-	pfam_Ribosomal_S7_dom,superfamily_Ribosomal_S7_dom,tigrfam_Ribosomal_S5/S7_euk/arc	ENSG00000083845		0.632	RPS5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPS5	HGNC	protein_coding	OTTHUMT00000467016.1	-	0.00	51	0	G	NM_001009		58904798	+1	tier1	-	no_errors	ENST00000196551	ensembl	human	known	74_37	missense	48.68	39	37	SNP	1.000	A
RTEL1	51750	genome.wustl.edu	37	20	62322217	62322217	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr20:62322217G>A	ENST00000360203.5	+	27	2798	c.2473G>A	c.(2473-2475)Gtt>Att	p.V825I	RTEL1_ENST00000370003.1_Missense_Mutation_p.V70I|RTEL1_ENST00000370018.3_Missense_Mutation_p.V825I|RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.V825I|RTEL1_ENST00000318100.4_Missense_Mutation_p.V825I|RTEL1_ENST00000508582.2_Missense_Mutation_p.V849I					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			GCAGGAGCCAGTTCCTGCCCG	0.711																																																	0													21.0	26.0	24.0					20																	62322217		2177	4280	6457	SO:0001583	missense	0			AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.2473G>A	20.37:g.62322217G>A	ENSP00000353332:p.Val825Ile			Missense_Mutation	SNP	pfam_DEAD_2,superfamily_P-loop_NTPase,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.V825I	ENST00000360203.5	37	c.2473		20	.	.	.	.	.	.	.	.	.	.	G	7.991	0.753400	0.15778	.	.	ENSG00000258366	ENST00000370018;ENST00000318100;ENST00000508582;ENST00000360203;ENST00000425905;ENST00000370003	T;T;T;T;D;T	0.91577	2.97;2.97;2.97;2.97;-2.87;2.97	4.77	0.333	0.15943	.	1.771590	0.02575	N	0.098177	D	0.83700	0.5311	L	0.44542	1.39	0.09310	N	1	B;P;B;B	0.35272	0.001;0.493;0.0;0.0	B;B;B;B	0.30495	0.004;0.116;0.001;0.006	T	0.69277	-0.5187	10	0.30854	T	0.27	-0.5181	0.4612	0.00516	0.2396:0.1445:0.3189:0.297	.	849;70;825;825	Q9NZ71-7;Q9NZ71-5;Q9NZ71;Q9NZ71-6	.;.;RTEL1_HUMAN;.	I	825;825;849;825;218;70	ENSP00000359035:V825I;ENSP00000322287:V825I;ENSP00000424307:V849I;ENSP00000353332:V825I;ENSP00000388063:V218I;ENSP00000359020:V70I	ENSP00000353332:V825I	V	+	1	0	AL353715.1	61792661	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.084000	0.11268	0.047000	0.15862	-0.222000	0.12452	GTT	RTEL1	-	NULL	ENSG00000258366		0.711	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	RTEL1	HGNC	protein_coding	OTTHUMT00000289781.1	-	0.00	66	0	G	NM_032957		62322217	+1	tier1	-	no_errors	ENST00000318100	ensembl	human	known	74_37	missense	12.50	70	10	SNP	0.000	A
RTN4RL1	146760	genome.wustl.edu	37	17	1840653	1840653	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr17:1840653A>T	ENST00000331238.6	-	2	942	c.463T>A	c.(463-465)Tac>Aac	p.Y155N		NM_178568.2	NP_848663.1			reticulon 4 receptor-like 1											breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|prostate(2)|skin(1)	11						TCCTGCAGGTAGAGGTACTGC	0.607																																					GBM(68;949 1139 14865 32798 38342)												0													41.0	47.0	45.0					17																	1840653		2153	4252	6405	SO:0001583	missense	0			AF532859	CCDS45569.1	17p13.3	2008-02-05				ENSG00000185924			21329	protein-coding gene	gene with protein product	"""nogo-66 receptor homolog 2"""	610461					Standard	NM_178568		Approved	NGRH2, NgR3, DKFZp547J144	uc002ftp.3	Q86UN2		ENST00000331238.6:c.463T>A	17.37:g.1840653A>T	ENSP00000330631:p.Tyr155Asn			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.Y155N	ENST00000331238.6	37	c.463	CCDS45569.1	17	.	.	.	.	.	.	.	.	.	.	A	17.17	3.320151	0.60634	.	.	ENSG00000185924	ENST00000331238	T	0.53206	0.63	5.52	5.52	0.82312	.	0.000000	0.35739	N	0.003018	T	0.47173	0.1431	N	0.16233	0.39	0.52501	D	0.999952	P	0.51351	0.944	P	0.55871	0.786	T	0.42865	-0.9426	10	0.31617	T	0.26	.	15.6931	0.77469	1.0:0.0:0.0:0.0	.	155	Q86UN2	R4RL1_HUMAN	N	155	ENSP00000330631:Y155N	ENSP00000330631:Y155N	Y	-	1	0	RTN4RL1	1787403	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.572000	0.82409	2.110000	0.64415	0.524000	0.50904	TAC	RTN4RL1	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000185924		0.607	RTN4RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTN4RL1	HGNC	protein_coding	OTTHUMT00000450155.2	-	0.00	35	0	A	NM_178568		1840653	-1	tier1	-	no_errors	ENST00000331238	ensembl	human	known	74_37	missense	84.38	5	27	SNP	1.000	T
SAP130	79595	genome.wustl.edu	37	2	128699639	128699639	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:128699639G>T	ENST00000259235.3	-	20	3217	c.3088C>A	c.(3088-3090)Ctt>Att	p.L1030I	SAP130_ENST00000259234.6_Missense_Mutation_p.L1038I|SAP130_ENST00000357702.5_Missense_Mutation_p.L1065I	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	1030	Interactions with SIN3A and HDAC1.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		TTCTTGTTAAGCAGCTTCAGG	0.403																																																	0													176.0	157.0	164.0					2																	128699639		2203	4300	6503	SO:0001583	missense	0			BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.3088C>A	2.37:g.128699639G>T	ENSP00000259235:p.Leu1030Ile		B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Missense_Mutation	SNP	NULL	p.L1065I	ENST00000259235.3	37	c.3193	CCDS2153.1	2	.	.	.	.	.	.	.	.	.	.	.	15.86	2.957090	0.53293	.	.	ENSG00000136715	ENST00000357702;ENST00000259235;ENST00000259234	.	.	.	6.17	6.17	0.99709	.	0.061993	0.64402	D	0.000003	T	0.58177	0.2104	N	0.24115	0.695	0.80722	D	1	D;D;D;D	0.53619	0.961;0.961;0.961;0.961	P;P;P;P	0.52066	0.6;0.689;0.689;0.689	T	0.51787	-0.8661	9	0.31617	T	0.26	-17.7116	20.8794	0.99867	0.0:0.0:1.0:0.0	.	1065;1030;595;667	B7ZLM3;Q9H0E3;Q9H0E3-2;B3KRT9	.;SP130_HUMAN;.;.	I	1065;1030;1038	.	ENSP00000259234:L1038I	L	-	1	0	SAP130	128416109	1.000000	0.71417	0.215000	0.23724	0.001000	0.01503	5.230000	0.65321	2.941000	0.99782	0.655000	0.94253	CTT	SAP130	-	NULL	ENSG00000136715		0.403	SAP130-001	KNOWN	basic|CCDS	protein_coding	SAP130	HGNC	protein_coding	OTTHUMT00000254436.3	-	0.00	37	0	G	NM_024545		128699639	-1	tier1	-	no_errors	ENST00000357702	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
SATL1	340562	genome.wustl.edu	37	X	84363284	84363284	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chrX:84363284G>T	ENST00000395409.3	-	1	690	c.130C>A	c.(130-132)Cca>Aca	p.P44T	SATL1_ENST00000509231.1_Missense_Mutation_p.P231T|SATL1_ENST00000332921.5_Missense_Mutation_p.P44T			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	44	Gln-rich.						N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						CTAGTGTCTGGTTGCCTTATG	0.507																																																	0													282.0	201.0	228.0					X																	84363284		2203	4300	6503	SO:0001583	missense	0			BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.130C>A	X.37:g.84363284G>T	ENSP00000378804:p.Pro44Thr		A0AVK7|E9PB72|Q5H8V9	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase	p.P231T	ENST00000395409.3	37	c.691		X	.	.	.	.	.	.	.	.	.	.	-	7.167	0.586787	0.13749	.	.	ENSG00000184788	ENST00000395409;ENST00000332921;ENST00000509231	T;T;T	0.40225	1.04;1.04;1.04	2.8	-3.52	0.04682	.	1.615890	0.04341	N	0.354001	T	0.30727	0.0774	L	0.39898	1.24	0.09310	N	1	P;P	0.39094	0.528;0.659	B;B	0.44224	0.258;0.444	T	0.15407	-1.0438	10	0.07482	T	0.82	-4.9042	1.871	0.03208	0.1095:0.2918:0.3006:0.2981	.	44;231	Q86VE3;E9PB72	SATL1_HUMAN;.	T	44;44;231	ENSP00000378804:P44T;ENSP00000329115:P44T;ENSP00000425421:P231T	ENSP00000329115:P44T	P	-	1	0	SATL1	84249940	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.518000	0.06267	-1.118000	0.02961	0.436000	0.28706	CCA	SATL1	-	NULL	ENSG00000184788		0.507	SATL1-202	KNOWN	basic|appris_principal	protein_coding	SATL1	HGNC	protein_coding		-	0.00	44	0	G	XM_291339		84363284	-1	tier1	-	no_errors	ENST00000509231	ensembl	human	known	74_37	missense	25.64	29	10	SNP	0.001	T
SEC61A1	29927	genome.wustl.edu	37	3	127788844	127788844	+	3'UTR	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr3:127788844C>T	ENST00000243253.3	+	0	1954				SEC61A1_ENST00000424880.2_3'UTR|RUVBL1_ENST00000464873.1_Intron|SEC61A1_ENST00000483956.1_3'UTR	NM_013336.3	NP_037468.1	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit (S. cerevisiae)						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell growth (GO:0016049)|endoplasmic reticulum organization (GO:0007029)|posttranslational protein targeting to membrane (GO:0006620)|protein targeting to ER (GO:0045047)|response to interferon-gamma (GO:0034341)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)			central_nervous_system(1)|kidney(1)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|prostate(4)	21						CACCTGTTTCCCCACAAAGGG	0.463																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF077032	CCDS3046.1	3q21.3	2008-02-05			ENSG00000058262	ENSG00000058262			18276	protein-coding gene	gene with protein product		609213					Standard	NM_013336		Approved		uc003ekb.3	P61619	OTTHUMG00000159624	ENST00000243253.3:c.*339C>T	3.37:g.127788844C>T			P38378|P57726|Q5JPF8|Q8N0Z4|Q8N3U3|Q8NC71|Q9BU16|Q9Y2R3	RNA	SNP	-	NULL	ENST00000243253.3	37	NULL	CCDS3046.1	3																																																																																			SEC61A1	-	-	ENSG00000058262		0.463	SEC61A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC61A1	HGNC	protein_coding	OTTHUMT00000356541.2	-	0.00	42	0	C	NM_013336		127788844	+1	tier1	-	no_errors	ENST00000483956	ensembl	human	known	74_37	rna	37.93	18	11	SNP	0.010	T
SELE	6401	genome.wustl.edu	37	1	169702096	169702096	+	Silent	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:169702096G>T	ENST00000333360.7	-	3	220	c.81C>A	c.(79-81)tcC>tcA	p.S27S	SELE_ENST00000367779.4_Silent_p.S27S|SELE_ENST00000367782.4_Silent_p.S27S|SELE_ENST00000367775.1_Silent_p.S27S|SELE_ENST00000367777.1_Silent_p.S27S|C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367774.1_Silent_p.S27S|SELE_ENST00000367781.4_Silent_p.S27S|SELE_ENST00000367780.4_Silent_p.S27S|SELE_ENST00000367776.1_Silent_p.S27S	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	27	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	TAGCTTCCGTGGAGGTGTTGT	0.413																																																	0													111.0	104.0	107.0					1																	169702096		2203	4300	6503	SO:0001819	synonymous_variant	0			M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908		"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	Standard	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.81C>A	1.37:g.169702096G>T			A2RRD6|P16111	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_C-type_lectin,pfam_EG-like_dom,pfam_EGF_extracell,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_C-type_lectin,smart_EG-like_dom,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.S27	ENST00000333360.7	37	c.81	CCDS1283.1	1																																																																																			SELE	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000007908		0.413	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELE	HGNC	protein_coding	OTTHUMT00000084333.1	-	0.00	31	0	G	NM_000450		169702096	-1	tier1	-	no_errors	ENST00000333360	ensembl	human	known	74_37	silent	11.11	48	6	SNP	0.001	T
SEPHS1	22929	genome.wustl.edu	37	10	13371703	13371703	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr10:13371703C>G	ENST00000327347.5	-	6	1021	c.646G>C	c.(646-648)Gat>Cat	p.D216H	SEPHS1_ENST00000545675.1_Missense_Mutation_p.D216H|SEPHS1_ENST00000378614.4_Missense_Mutation_p.D216H|SEPHS1_ENST00000537130.1_Missense_Mutation_p.D149H	NM_001195602.1|NM_012247.4	NP_001182531.1|NP_036379.2	P49903	SPS1_HUMAN	selenophosphate synthetase 1	216					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|selenide, water dikinase activity (GO:0004756)			cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|stomach(1)	16						CTCACGATATCCAGCCACTGG	0.502																																																	0													56.0	40.0	45.0					10																	13371703		2203	4298	6501	SO:0001583	missense	0			BC000941	CCDS7098.1, CCDS55702.1, CCDS55703.1	10p14	2006-10-06			ENSG00000086475	ENSG00000086475			19685	protein-coding gene	gene with protein product		600902				7665581	Standard	NM_012247		Approved	SPS, SPS1	uc001imk.3	P49903	OTTHUMG00000017696	ENST00000327347.5:c.646G>C	10.37:g.13371703C>G	ENSP00000367893:p.Asp216His		B4DWK0|D3DRS9|D6PSQ9|Q5T5U8|Q5T5U9|Q9BVT4	Missense_Mutation	SNP	pfam_AIR_synth_C_dom,pfam_AIR_synth_N_dom,superfamily_AIR_synth_C_dom,superfamily_PurM_N-like,pirsf_SelD,tigrfam_SelD	p.D216H	ENST00000327347.5	37	c.646	CCDS7098.1	10	.	.	.	.	.	.	.	.	.	.	C	18.60	3.659614	0.67586	.	.	ENSG00000086475	ENST00000327347;ENST00000319684;ENST00000378614;ENST00000545675;ENST00000537130	T;T;T;T	0.41758	2.24;0.99;2.24;2.24	5.37	5.37	0.77165	AIR synthase-related protein, C-terminal (2);	0.042264	0.85682	D	0.000000	T	0.44350	0.1289	L	0.60845	1.875	0.80722	D	1	B;B;B;B;B;B	0.20887	0.049;0.033;0.02;0.02;0.02;0.005	B;B;B;B;B;B	0.15870	0.014;0.011;0.014;0.014;0.014;0.009	T	0.35325	-0.9793	10	0.52906	T	0.07	-18.3659	19.1025	0.93279	0.0:1.0:0.0:0.0	.	168;216;216;216;216;149	B4DLS1;Q5T5U9;P49903;D6PSQ9;D3DRS9;B4DWK0	.;.;SPS1_HUMAN;.;.;.	H	216;216;216;216;149	ENSP00000367893:D216H;ENSP00000367877:D216H;ENSP00000441119:D216H;ENSP00000442768:D149H	ENSP00000367887:D216H	D	-	1	0	SEPHS1	13411709	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.805000	0.86005	2.507000	0.84556	0.561000	0.74099	GAT	SEPHS1	-	pfam_AIR_synth_C_dom,superfamily_AIR_synth_C_dom,pirsf_SelD,tigrfam_SelD	ENSG00000086475		0.502	SEPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPHS1	HGNC	protein_coding	OTTHUMT00000046856.1	-	0.00	44	0	C	NM_012247		13371703	-1	tier1	-	no_errors	ENST00000327347	ensembl	human	known	74_37	missense	12.77	41	6	SNP	1.000	G
SERTAD4	56256	genome.wustl.edu	37	1	210407330	210407330	+	Intron	DEL	T	T	-	rs397861918|rs547634859|rs36086035	byFrequency	TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:210407330delT	ENST00000367012.3	+	1	213				SERTAD4-AS1_ENST00000437764.1_RNA|SERTAD4-AS1_ENST00000480052.1_RNA|SERTAD4-AS1_ENST00000475406.1_RNA	NM_019605.3	NP_062551.1	Q9NUC0	SRTD4_HUMAN	SERTA domain containing 4							nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0237)|all cancers(67;0.127)		GGAAACTTGGtttttttttta	0.458													|||unknown(HR)	2412	0.481629	0.4682	0.5447	5008	,	,		13850	0.5933		0.3907	False		,,,				2504	0.4335																0																																										SO:0001627	intron_variant	0			BC012083	CCDS1494.1	1q32.1-q41	2008-02-05			ENSG00000082497	ENSG00000082497			25236	protein-coding gene	gene with protein product						12477932	Standard	NM_019605		Approved	DJ667H12.2	uc001hhy.3	Q9NUC0	OTTHUMG00000036391	ENST00000367012.3:c.-18+974T>-	1.37:g.210407330delT			B2RD32	RNA	DEL	-	NULL	ENST00000367012.3	37	NULL	CCDS1494.1	1																																																																																			SERTAD4-AS1	-	-	ENSG00000203706		0.458	SERTAD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERTAD4-AS1	HGNC	protein_coding	OTTHUMT00000088577.1		0.00	10	0	T	NM_019605		210407330	-1	tier1		no_errors	ENST00000437764	ensembl	human	known	74_37	rna	23.53	13	4	DEL	0.837	-
SETX	23064	genome.wustl.edu	37	9	135205006	135205006	+	Missense_Mutation	SNP	G	G	T	rs882709	byFrequency	TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr9:135205006G>T	ENST00000224140.5	-	10	2161	c.1979C>A	c.(1978-1980)gCa>gAa	p.A660E	SETX_ENST00000393220.1_Missense_Mutation_p.A660E|SETX_ENST00000372169.2_Missense_Mutation_p.A660E	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	660			A -> G (in dbSNP:rs882709).		cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		AGTGTTATCTGCTTTGATCAA	0.378																																																	0													97.0	93.0	95.0					9																	135205006		2203	4299	6502	SO:0001583	missense	0			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.1979C>A	9.37:g.135205006G>T	ENSP00000224140:p.Ala660Glu		A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.A660E	ENST00000224140.5	37	c.1979	CCDS6947.1	9	.	.	.	.	.	.	.	.	.	.	G	11.93	1.784900	0.31593	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.87029	-2.12;-2.2;-1.82	5.37	2.12	0.27331	.	1.813340	0.03700	U	0.248429	D	0.84683	0.5526	L	0.32530	0.975	0.80722	P	0.0	P;B;P	0.48016	0.904;0.421;0.904	P;B;P	0.48227	0.571;0.157;0.571	T	0.73927	-0.3828	9	0.35671	T	0.21	.	6.9477	0.24528	0.1947:0.1851:0.6202:0.0	.	660;660;660	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	E	660	ENSP00000224140:A660E;ENSP00000361242:A660E;ENSP00000376913:A660E	ENSP00000224140:A660E	A	-	2	0	SETX	134194827	0.001000	0.12720	0.003000	0.11579	0.048000	0.14542	0.949000	0.29109	0.575000	0.29434	0.555000	0.69702	GCA	SETX	-	NULL	ENSG00000107290		0.378	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	HGNC	protein_coding	OTTHUMT00000054774.3	-	0.00	37	0	G	NM_015046		135205006	-1	tier1	-	no_errors	ENST00000372169	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.000	T
SEZ6L2	26470	genome.wustl.edu	37	16	29899040	29899040	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr16:29899040T>A	ENST00000308713.5	-	7	1665	c.1138A>T	c.(1138-1140)Att>Ttt	p.I380F	SEZ6L2_ENST00000350527.3_Missense_Mutation_p.I310F|SEZ6L2_ENST00000537485.1_Missense_Mutation_p.I336F|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.I266F|SEZ6L2_ENST00000562159.1_5'Flank	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	380	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GCTGCTTCAATGACCCAACGG	0.627																																																	0													65.0	60.0	62.0					16																	29899040		2197	4300	6497	SO:0001583	missense	0			AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.1138A>T	16.37:g.29899040T>A	ENSP00000312550:p.Ile380Phe		B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.I380F	ENST00000308713.5	37	c.1138	CCDS10659.1	16	.	.	.	.	.	.	.	.	.	.	T	26.7	4.761136	0.89932	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932;ENST00000537485	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.72	5.72	0.89469	CUB (4);	0.000000	0.56097	D	0.000025	T	0.77785	0.4182	M	0.82716	2.605	0.51482	D	0.999921	P;D;D;D;D;D	0.60160	0.93;0.987;0.987;0.985;0.987;0.985	P;P;P;P;P;P	0.58520	0.84;0.67;0.67;0.823;0.67;0.823	T	0.81801	-0.0766	10	0.87932	D	0	.	15.0362	0.71748	0.0:0.0:0.0:1.0	.	336;380;266;310;380;310	F5H293;B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;.;SE6L2_HUMAN;.	F	310;380;266;336	ENSP00000310206:I310F;ENSP00000312550:I380F;ENSP00000319215:I266F;ENSP00000439412:I336F	ENSP00000312550:I380F	I	-	1	0	SEZ6L2	29806541	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.854000	0.39368	2.196000	0.70406	0.454000	0.30748	ATT	SEZ6L2	-	superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000174938		0.627	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L2	HGNC	protein_coding	OTTHUMT00000255154.2	-	0.00	60	0	T	NM_012410		29899040	-1	tier1	-	no_errors	ENST00000308713	ensembl	human	known	74_37	missense	8.70	41	4	SNP	1.000	A
SFTPD	6441	genome.wustl.edu	37	10	81701225	81701225	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr10:81701225delC	ENST00000372292.3	-	6	636	c.596delG	c.(595-597)ggafs	p.G199fs		NM_003019.4	NP_003010.4	P35247	SFTPD_HUMAN	surfactant protein D	199	Collagen-like.				defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|lung alveolus development (GO:0048286)|macrophage chemotaxis (GO:0048246)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of phagocytosis (GO:0050766)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|regulation of cytokine production (GO:0001817)|respiratory gaseous exchange (GO:0007585)|surfactant homeostasis (GO:0043129)	collagen trimer (GO:0005581)|endocytic vesicle (GO:0030139)|extracellular region (GO:0005576)|lysosome (GO:0005764)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)			endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|skin(4)|urinary_tract(1)	17	Breast(12;0.000615)|Prostate(51;0.0095)|all_epithelial(25;0.027)		Epithelial(14;0.0244)|all cancers(16;0.0558)|Colorectal(32;0.109)			TCCCGGGGGTCCCCTGGCACC	0.537																																																	0													88.0	77.0	81.0					10																	81701225		2203	4300	6503	SO:0001589	frameshift_variant	0			L05485	CCDS7362.1	10q22.2-q23.1	2012-11-02	2008-08-26		ENSG00000133661	ENSG00000133661		"""Collectins"""	10803	protein-coding gene	gene with protein product		178635	"""surfactant, pulmonary-associated protein D"""	SFTP4		1898081, 1339284	Standard	NM_003019		Approved	SP-D, COLEC7	uc001kbh.3	P35247	OTTHUMG00000018590	ENST00000372292.3:c.596delG	10.37:g.81701225delC	ENSP00000361366:p.Gly199fs		Q5T0M3|Q6FH08|Q86YK9|Q8TCD8|Q9UCJ2|Q9UCJ3	Frame_Shift_Del	DEL	pfam_C-type_lectin,pfam_Collagen,pfam_Surfac_D-trimer,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.G199fs	ENST00000372292.3	37	c.596	CCDS7362.1	10																																																																																			SFTPD	-	pfam_Collagen	ENSG00000133661		0.537	SFTPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFTPD	HGNC	protein_coding	OTTHUMT00000049011.1		0.00	50	0	C			81701225	-1	tier1		no_errors	ENST00000372292	ensembl	human	known	74_37	frame_shift_del	7.14	39	3	DEL	0.996	-
SGSM1	129049	genome.wustl.edu	37	22	25294486	25294486	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr22:25294486A>G	ENST00000400359.4	+	20	2742	c.2735A>G	c.(2734-2736)aAc>aGc	p.N912S	SGSM1_ENST00000400358.4_Missense_Mutation_p.N857S|SNORD56_ENST00000362913.1_RNA	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	912	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						ACTTCTGCCAACGAGGTGTCC	0.572																																																	0													75.0	81.0	79.0					22																	25294486		2057	4194	6251	SO:0001583	missense	0			AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.2735A>G	22.37:g.25294486A>G	ENSP00000383212:p.Asn912Ser		A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	pfam_Run,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Run,smart_Rab-GTPase-TBC_dom,pfscan_Run,pfscan_Rab-GTPase-TBC_dom	p.N912S	ENST00000400359.4	37	c.2735	CCDS46674.1	22	.	.	.	.	.	.	.	.	.	.	A	4.899	0.167119	0.09339	.	.	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	T;T	0.06371	3.32;3.31	5.09	-3.87	0.04218	Rab-GAP/TBC domain (3);	0.516771	0.19521	U	0.112278	T	0.02571	0.0078	N	0.11560	0.145	0.19300	N	0.999979	B;B;B;B	0.28880	0.045;0.226;0.007;0.017	B;B;B;B	0.26969	0.026;0.075;0.009;0.009	T	0.47100	-0.9143	10	0.12430	T	0.62	-15.0922	10.5075	0.44842	0.2215:0.1677:0.6108:0.0	.	857;912;929;912	Q2NKQ1-4;C9J7S8;Q2NKQ1-3;Q2NKQ1	.;.;.;SGSM1_HUMAN	S	912;857;912	ENSP00000383211:N857S;ENSP00000383212:N912S	ENSP00000383211:N857S	N	+	2	0	SGSM1	23624486	0.744000	0.28250	0.470000	0.27216	0.977000	0.68977	0.947000	0.29082	-0.461000	0.06993	0.482000	0.46254	AAC	SGSM1	-	superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000167037		0.572	SGSM1-004	KNOWN	basic|CCDS	protein_coding	SGSM1	HGNC	protein_coding	OTTHUMT00000320282.1	-	0.00	25	0	A	XM_059318		25294486	+1	tier1	-	no_errors	ENST00000400359	ensembl	human	known	74_37	missense	77.27	5	17	SNP	0.289	G
SHISA7	729956	genome.wustl.edu	37	19	55951985	55951985	+	Frame_Shift_Del	DEL	G	G	-	rs375963988		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:55951985delG	ENST00000376325.4	-	2	818	c.819delC	c.(817-819)cccfs	p.P273fs		NM_001145176.1	NP_001138648.1	A6NL88	SHSA7_HUMAN	shisa family member 7	273						integral component of membrane (GO:0016021)				skin(1)	1						CACCGAGGTTGGGGGTCTTCA	0.692																																																	0													42.0	50.0	47.0					19																	55951985		692	1591	2283	SO:0001589	frameshift_variant	0				CCDS46193.1	19q13.42	2013-07-31	2013-07-31					"""Shisa homologs"""	35409	protein-coding gene	gene with protein product			"""shisa homolog 7 (Xenopus laevis)"""				Standard	NM_001145176		Approved		uc002qkz.3	A6NL88		ENST00000376325.4:c.819delC	19.37:g.55951985delG	ENSP00000365503:p.Pro273fs			Frame_Shift_Del	DEL	NULL	p.N274fs	ENST00000376325.4	37	c.819	CCDS46193.1	19																																																																																			SHISA7	-	NULL	ENSG00000187902		0.692	SHISA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SHISA7	HGNC	protein_coding	OTTHUMT00000334533.2		0.00	160	0	G	NM_001145176		55951985	-1	tier1		no_errors	ENST00000376325	ensembl	human	known	74_37	frame_shift_del	15.98	163	31	DEL	0.997	-
SLC35F3	148641	genome.wustl.edu	37	1	234040847	234040847	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:234040847C>A	ENST00000366618.3	+	1	169	c.24C>A	c.(22-24)agC>agA	p.S8R		NM_173508.2	NP_775779.1	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	0					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			AGTTTCCCAGCGGCGCACCCA	0.716																																																	0													21.0	22.0	22.0					1																	234040847		2179	4246	6425	SO:0001583	missense	0				CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366618.3:c.24C>A	1.37:g.234040847C>A	ENSP00000355577:p.Ser8Arg		Q5TDD6|Q8N9C9	Missense_Mutation	SNP	pfam_DMT,pfam_Tpt_PEP_trans_dom,pfam_SLC35_F1/F2/F6	p.S8R	ENST00000366618.3	37	c.24	CCDS1600.1	1	.	.	.	.	.	.	.	.	.	.	C	11.13	1.547875	0.27652	.	.	ENSG00000183780	ENST00000366618	T	0.47528	0.84	4.3	1.16	0.20824	.	1.966020	0.03099	U	0.160892	T	0.44435	0.1293	.	.	.	0.80722	D	1	B	0.20368	0.044	B	0.20184	0.028	T	0.14559	-1.0468	9	0.66056	D	0.02	-1.1785	10.731	0.46096	0.4991:0.5009:0.0:0.0	.	8	Q8IY50-2	.	R	8	ENSP00000355577:S8R	ENSP00000355577:S8R	S	+	3	2	SLC35F3	232107470	0.999000	0.42202	0.999000	0.59377	0.500000	0.33767	0.257000	0.18369	0.052000	0.16007	-0.537000	0.04273	AGC	SLC35F3	-	NULL	ENSG00000183780		0.716	SLC35F3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	SLC35F3	HGNC	protein_coding	OTTHUMT00000092579.2	-	0.00	29	0	C	NM_173508		234040847	+1	tier1	-	no_errors	ENST00000366618	ensembl	human	novel	74_37	missense	10.87	41	5	SNP	1.000	A
SLC43A2	124935	genome.wustl.edu	37	17	1494657	1494657	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr17:1494657C>T	ENST00000301335.5	-	8	925	c.837G>A	c.(835-837)atG>atA	p.M279I	SLC43A2_ENST00000382147.4_Missense_Mutation_p.M279I|SLC43A2_ENST00000574274.1_5'UTR|SLC43A2_ENST00000571650.1_Missense_Mutation_p.M279I|SLC43A2_ENST00000412517.3_Missense_Mutation_p.M142I	NM_001284498.1|NM_001284499.1	NP_001271427.1|NP_001271428.1	Q8N370	LAT4_HUMAN	solute carrier family 43 (amino acid system L transporter), member 2	279					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-amino acid transmembrane transporter activity (GO:0015179)			endometrium(4)|large_intestine(4)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (25;0.0883)		TGGCACTCCTCATGGAGCTGC	0.632																																																	0													75.0	69.0	71.0					17																	1494657		2203	4300	6503	SO:0001583	missense	0			BC027923	CCDS11006.1, CCDS67107.1, CCDS67108.1	17p13.3	2013-07-17	2013-07-17		ENSG00000167703	ENSG00000167703		"""Solute carriers"""	23087	protein-coding gene	gene with protein product		610791				23268354	Standard	NM_001284498		Approved	MGC34680	uc002fsv.3	Q8N370	OTTHUMG00000090345	ENST00000301335.5:c.837G>A	17.37:g.1494657C>T	ENSP00000301335:p.Met279Ile		B7Z6X9|C9JNU8|D3DTH9|Q5CD75|Q6IPM1|Q8NBX1|Q8NC21|Q8WZ00	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.M279I	ENST00000301335.5	37	c.837	CCDS11006.1	17	.	.	.	.	.	.	.	.	.	.	C	19.14	3.769413	0.69992	.	.	ENSG00000167703	ENST00000301335;ENST00000382147;ENST00000412517	T;T;T	0.29397	2.0;2.01;1.57	6.07	6.07	0.98685	Major facilitator superfamily domain, general substrate transporter (1);	0.071421	0.85682	D	0.000000	T	0.30262	0.0759	L	0.44542	1.39	0.80722	D	1	P;B;B;B	0.34587	0.458;0.023;0.002;0.001	B;B;B;B	0.31191	0.125;0.012;0.006;0.004	T	0.01951	-1.1241	10	0.33141	T	0.24	-3.5744	20.6439	0.99570	0.0:1.0:0.0:0.0	.	142;279;279;279	B7Z6X9;Q8N370-2;Q8N370;Q8N370-3	.;.;LAT4_HUMAN;.	I	279;279;142	ENSP00000301335:M279I;ENSP00000371582:M279I;ENSP00000408284:M142I	ENSP00000301335:M279I	M	-	3	0	SLC43A2	1441407	1.000000	0.71417	0.996000	0.52242	0.947000	0.59692	4.622000	0.61240	2.884000	0.98904	0.655000	0.94253	ATG	SLC43A2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000167703		0.632	SLC43A2-001	KNOWN	basic|CCDS	protein_coding	SLC43A2	HGNC	protein_coding	OTTHUMT00000206717.4	-	0.00	61	0	C	NM_152346		1494657	-1	tier1	-	no_errors	ENST00000382147	ensembl	human	known	74_37	missense	41.51	31	22	SNP	1.000	T
SMG1	23049	genome.wustl.edu	37	16	18937310	18937312	+	In_Frame_Del	DEL	GCC	GCC	-			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	GCC	GCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr16:18937310_18937312delGCC	ENST00000446231.2	-	1	464_466	c.52_54delGGC	c.(52-54)ggcdel	p.G18del	SMG1_ENST00000389467.3_In_Frame_Del_p.G18del|SMG1_ENST00000567737.1_5'UTR|CTD-2288F12.1_ENST00000565782.1_RNA			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	18	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						GATACTTGGTgccgccgccgccg	0.749																																																	0										68,1646		5,58,794						4.3	1.0			5	233,4695		15,203,2246	no	coding	SMG1	NM_015092.4		20,261,3040	A1A1,A1R,RR		4.7281,3.9673,4.5318				301,6341				SO:0001651	inframe_deletion	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.52_54delGGC	16.37:g.18937319_18937321delGCC	ENSP00000402515:p.Gly18del		O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	In_Frame_Del	DEL	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.G18in_frame_del	ENST00000446231.2	37	c.54_52	CCDS45430.1	16																																																																																			SMG1	-	NULL	ENSG00000157106		0.749	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1		0.00	28	0	GCC	NM_015092		18937312	-1	tier1		no_errors	ENST00000389467	ensembl	human	known	74_37	in_frame_del	7.69	24	2	DEL	1.000:1.000:1.000	-
SMO	6608	genome.wustl.edu	37	7	128850312	128850312	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr7:128850312G>T	ENST00000249373.3	+	9	1855	c.1575G>T	c.(1573-1575)atG>atT	p.M525I	RP11-286H14.8_ENST00000466717.1_RNA	NM_005631.4	NP_005622.1	Q99835	SMO_HUMAN	smoothened, frizzled class receptor	525					adenohypophysis development (GO:0021984)|anterior/posterior pattern specification (GO:0009952)|atrial septum morphogenesis (GO:0060413)|axon extension involved in axon guidance (GO:0048846)|canonical Wnt signaling pathway (GO:0060070)|cardioblast differentiation (GO:0010002)|cell fate specification (GO:0001708)|cellular response to cholesterol (GO:0071397)|central nervous system neuron differentiation (GO:0021953)|cerebellar cortex morphogenesis (GO:0021696)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|detection of cell density by contact stimulus involved in contact inhibition (GO:0060248)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|epithelial-mesenchymal cell signaling (GO:0060684)|exocrine pancreas development (GO:0031017)|facial nerve development (GO:0021561)|floor plate formation (GO:0021508)|forebrain morphogenesis (GO:0048853)|gonad development (GO:0008406)|hair follicle morphogenesis (GO:0031069)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal to epithelial transition involved in metanephric renal vesicle formation (GO:0072285)|midgut development (GO:0007494)|multicellular organism growth (GO:0035264)|muscle cell fate commitment (GO:0042693)|myoblast migration (GO:0051451)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of gene expression (GO:0010629)|negative regulation of hair follicle development (GO:0051799)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate commitment (GO:0048663)|neuron projection regeneration (GO:0031102)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|otolith morphogenesis (GO:0032474)|pancreas morphogenesis (GO:0061113)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of heart morphogenesis (GO:2000826)|regulation of stem cell maintenance (GO:2000036)|renal system development (GO:0072001)|semicircular canal morphogenesis (GO:0048752)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021910)|somite development (GO:0061053)|spermatogenesis (GO:0007283)|thalamus development (GO:0021794)|type B pancreatic cell development (GO:0003323)|vasculogenesis (GO:0001570)|ventral midline determination (GO:0007371)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	drug binding (GO:0008144)|G-protein coupled receptor activity (GO:0004930)|patched binding (GO:0005113)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			biliary_tract(1)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(14)|liver(1)|lung(11)|pancreas(2)|prostate(1)|skin(20)|upper_aerodigestive_tract(3)|urinary_tract(1)	64					Fluocinonide(DB01047)|Vismodegib(DB08828)	TGTTTGCCATGTTTGGAACTG	0.602			Mis		skin basal cell						OREG0018305	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																												Dom	yes		7	7q31-q32	6608	smoothened homolog (Drosophila)		E	0													147.0	126.0	133.0					7																	128850312		2203	4300	6503	SO:0001583	missense	0			U84401	CCDS5811.1	7q32.1	2014-01-29	2014-01-29	2003-01-17	ENSG00000128602	ENSG00000128602		"""GPCR / Class F : Frizzled receptors"""	11119	protein-coding gene	gene with protein product	"""frizzled family member 11"""	601500	"""smoothened (Drosophila) homolog"", ""smoothened homolog (Drosophila)"", ""smoothened, seven transmembrane spanning receptor"", ""smoothened, frizzled family receptor"""	SMOH		9628830	Standard	NM_005631		Approved	FZD11	uc003vor.3	Q99835	OTTHUMG00000158421	ENST00000249373.3:c.1575G>T	7.37:g.128850312G>T	ENSP00000249373:p.Met525Ile	1568	A4D1K5	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,pfam_GPCR_2_secretin-like,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.M525I	ENST00000249373.3	37	c.1575	CCDS5811.1	7	.	.	.	.	.	.	.	.	.	.	G	15.44	2.835472	0.50951	.	.	ENSG00000128602	ENST00000249373	T	0.81415	-1.49	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.78534	0.4298	L	0.45698	1.435	0.80722	D	1	P;P	0.39535	0.677;0.677	B;B	0.40199	0.322;0.322	T	0.77027	-0.2740	10	0.36615	T	0.2	.	18.8931	0.92413	0.0:0.0:1.0:0.0	.	525;525	A4D1K5;Q99835	.;SMO_HUMAN	I	525	ENSP00000249373:M525I	ENSP00000249373:M525I	M	+	3	0	SMO	128637548	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.547000	0.82146	2.723000	0.93209	0.511000	0.50034	ATG	SMO	-	pfam_Frizzled,prints_Frizzled	ENSG00000128602		0.602	SMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMO	HGNC	protein_coding	OTTHUMT00000350986.1	-	0.00	50	0	G	NM_005631		128850312	+1	tier1	-	no_errors	ENST00000249373	ensembl	human	known	74_37	missense	42.42	19	14	SNP	1.000	T
NOP58	51602	genome.wustl.edu	37	2	203157846	203157846	+	Intron	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:203157846C>G	ENST00000264279.5	+	9	1133				SNORD11B_ENST00000607707.1_RNA|SNORD11_ENST00000459124.1_RNA	NM_015934.3	NP_057018.1	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein						cell growth (GO:0016049)|rRNA processing (GO:0006364)|snRNP protein import into nucleus (GO:0006608)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(4)|prostate(2)	16						GTCACTACCTCTTCTGAGACA	0.358																																																	0													72.0	64.0	67.0					2																	203157846		876	1991	2867	SO:0001627	intron_variant	0				CCDS2353.1	2q33.1	2012-12-10	2012-12-10		ENSG00000055044	ENSG00000055044			29926	protein-coding gene	gene with protein product			"""NOP58 ribonucleoprotein homolog (yeast)"""			10606270, 10925205	Standard	NM_015934		Approved	NOP5, HSPC120	uc002uzb.3	Q9Y2X3	OTTHUMG00000132840	ENST00000264279.5:c.907+220C>G	2.37:g.203157846C>G			Q53SA4|Q6PK08|Q9P036|Q9UFN3	RNA	SNP	-	NULL	ENST00000264279.5	37	NULL	CCDS2353.1	2																																																																																			SNORD11	-	-	ENSG00000238317		0.358	NOP58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORD11	HGNC	protein_coding	OTTHUMT00000256313.2	-	0.00	34	0	C	NM_015934		203157846	+1	tier1	-	no_errors	ENST00000459124	ensembl	human	known	74_37	rna	37.50	29	18	SNP	1.000	G
SOHLH1	402381	genome.wustl.edu	37	9	138589389	138589389	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr9:138589389C>G	ENST00000298466.5	-	4	490	c.430G>C	c.(430-432)Gtg>Ctg	p.V144L	SOHLH1_ENST00000425225.1_Missense_Mutation_p.V144L	NM_001012415.2	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 1	144					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(5)|prostate(1)	12		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		GGGTCTGGCACACCTGCTTGA	0.557																																																	0													72.0	61.0	65.0					9																	138589389		2202	4300	6502	SO:0001583	missense	0			BC031861	CCDS35174.1, CCDS48054.1	9q34.3	2013-05-21	2006-03-16	2006-03-16	ENSG00000165643	ENSG00000165643		"""Basic helix-loop-helix proteins"""	27845	protein-coding gene	gene with protein product	"""spermatogenesis associated 27"""	610224	"""chromosome 9 open reading frame 157"""	C9orf157		12477932	Standard	NM_001012415		Approved	NOHLH, TEB2, bA100C15.3, bHLHe80, SPATA27	uc010nbe.3	Q5JUK2	OTTHUMG00000020915	ENST00000298466.5:c.430G>C	9.37:g.138589389C>G	ENSP00000298466:p.Val144Leu		C9JG81|Q5EE14|Q5EGC2|Q8NEE3	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.V144L	ENST00000298466.5	37	c.430	CCDS35174.1	9	.	.	.	.	.	.	.	.	.	.	C	13.79	2.342852	0.41498	.	.	ENSG00000165643	ENST00000298466;ENST00000425225	T;T	0.32515	1.45;1.48	4.24	-4.12	0.03916	.	1.589900	0.04446	N	0.371756	T	0.19685	0.0473	L	0.36672	1.1	0.09310	N	1	B;B	0.18741	0.03;0.018	B;B	0.20384	0.029;0.009	T	0.22556	-1.0213	10	0.34782	T	0.22	-0.2206	1.577	0.02626	0.153:0.1923:0.1515:0.5031	.	144;144	Q5JUK2-2;Q5JUK2	.;SOLH1_HUMAN	L	144	ENSP00000298466:V144L;ENSP00000404438:V144L	ENSP00000298466:V144L	V	-	1	0	SOHLH1	137729210	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.173000	0.03108	-0.437000	0.07243	-0.291000	0.09656	GTG	SOHLH1	-	NULL	ENSG00000165643		0.557	SOHLH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SOHLH1	HGNC	protein_coding	OTTHUMT00000055018.2	-	0.00	47	0	C	NM_001012415		138589389	-1	tier1	-	no_errors	ENST00000425225	ensembl	human	known	74_37	missense	30.00	35	15	SNP	0.000	G
SOX11	6664	genome.wustl.edu	37	2	5833176	5833176	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:5833176A>C	ENST00000322002.3	+	1	378	c.323A>C	c.(322-324)aAg>aCg	p.K108T	AC108025.2_ENST00000453678.1_RNA|AC107057.2_ENST00000458264.1_RNA|AC108025.2_ENST00000420221.1_RNA	NM_003108.3	NP_003099.1	P35716	SOX11_HUMAN	SRY (sex determining region Y)-box 11	108					cardiac ventricle formation (GO:0003211)|closure of optic fissure (GO:0061386)|cornea development in camera-type eye (GO:0061303)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|hard palate development (GO:0060022)|kidney development (GO:0001822)|lens morphogenesis in camera-type eye (GO:0002089)|limb bud formation (GO:0060174)|lung morphogenesis (GO:0060425)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural crest cell development (GO:0014032)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|neuron differentiation (GO:0030182)|noradrenergic neuron differentiation (GO:0003357)|oligodendrocyte development (GO:0014003)|outflow tract morphogenesis (GO:0003151)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of hippo signaling (GO:0035332)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lens epithelial cell proliferation (GO:2001111)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|signal transduction involved in cell cycle checkpoint (GO:0072395)|skeletal muscle cell differentiation (GO:0035914)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)|somite development (GO:0061053)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|translation (GO:0006412)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|translation factor activity, nucleic acid binding (GO:0008135)			central_nervous_system(5)|cervix(1)|endometrium(1)|liver(1)|lung(4)|stomach(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			OV - Ovarian serous cystadenocarcinoma(76;0.132)		CTGCGGCTCAAGCACATGGCC	0.627																																																	0													29.0	35.0	33.0					2																	5833176		2203	4300	6503	SO:0001583	missense	0				CCDS1654.1	2p25	2008-05-21			ENSG00000176887	ENSG00000176887		"""SRY (sex determining region Y)-boxes"""	11191	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 11"""	600898				8666406, 12637543	Standard	NM_003108		Approved		uc002qyj.3	P35716	OTTHUMG00000090333	ENST00000322002.3:c.323A>C	2.37:g.5833176A>C	ENSP00000322568:p.Lys108Thr		Q4ZFV8	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pirsf_SOX-12/11/4a,pfscan_HMG_box_dom	p.K108T	ENST00000322002.3	37	c.323	CCDS1654.1	2	.	.	.	.	.	.	.	.	.	.	A	22.5	4.293062	0.80914	.	.	ENSG00000176887	ENST00000322002	D	0.98164	-4.76	2.82	2.82	0.32997	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.64402	U	0.000001	D	0.98460	0.9487	M	0.79011	2.435	0.58432	D	0.999998	D	0.57571	0.98	D	0.67548	0.952	D	0.98160	1.0446	10	0.49607	T	0.09	.	11.2381	0.48953	1.0:0.0:0.0:0.0	.	108	P35716	SOX11_HUMAN	T	108	ENSP00000322568:K108T	ENSP00000322568:K108T	K	+	2	0	SOX11	5750627	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.691000	0.91279	1.271000	0.44313	0.391000	0.25812	AAG	SOX11	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pirsf_SOX-12/11/4a,pfscan_HMG_box_dom	ENSG00000176887		0.627	SOX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX11	HGNC	protein_coding	OTTHUMT00000206698.1	-	0.00	42	0	A	NM_003108		5833176	+1	tier1	-	no_errors	ENST00000322002	ensembl	human	known	74_37	missense	20.00	32	8	SNP	1.000	C
SP4	6671	genome.wustl.edu	37	7	21468977	21468977	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr7:21468977A>G	ENST00000222584.3	+	3	412	c.194A>G	c.(193-195)cAa>cGa	p.Q65R		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	65					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						GGTGAAAATCAAGCAACTGGA	0.453																																																	0													57.0	57.0	57.0					7																	21468977		2203	4300	6503	SO:0001583	missense	0				CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.194A>G	7.37:g.21468977A>G	ENSP00000222584:p.Gln65Arg		O60402|Q32M52	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q65R	ENST00000222584.3	37	c.194	CCDS5373.1	7	.	.	.	.	.	.	.	.	.	.	A	16.34	3.095345	0.56075	.	.	ENSG00000105866	ENST00000222584;ENST00000446800	T	0.08896	3.04	4.33	4.33	0.51752	.	0.181870	0.49305	D	0.000146	T	0.19327	0.0464	L	0.50333	1.59	0.52501	D	0.999957	D	0.54601	0.967	P	0.62382	0.901	T	0.01305	-1.1390	10	0.31617	T	0.26	.	13.6935	0.62562	1.0:0.0:0.0:0.0	.	65	Q02446	SP4_HUMAN	R	65	ENSP00000222584:Q65R	ENSP00000222584:Q65R	Q	+	2	0	SP4	21435502	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.761000	0.91691	1.817000	0.53016	0.460000	0.39030	CAA	SP4	-	NULL	ENSG00000105866		0.453	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP4	HGNC	protein_coding	OTTHUMT00000211617.2	-	0.00	65	0	A	NM_003112		21468977	+1	tier1	-	no_errors	ENST00000222584	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	G
SPIN1	10927	genome.wustl.edu	37	9	91090531	91090531	+	3'UTR	SNP	T	T	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr9:91090531T>C	ENST00000375859.3	+	0	1406				SPIN1_ENST00000541629.1_3'UTR|SPIN1_ENST00000469017.2_3'UTR	NM_006717.2	NP_006708.2	Q9Y657	SPIN1_HUMAN	spindlin 1						chromatin modification (GO:0016568)|gamete generation (GO:0007276)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|positive regulation of Wnt signaling pathway (GO:0030177)|rRNA transcription (GO:0009303)|Wnt signaling pathway (GO:0016055)	nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle (GO:0005819)	methylated histone binding (GO:0035064)			endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4						GCCGCCACAATGCAAGCATAG	0.313																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF317228	CCDS43843.1	9q22.1	2008-02-05	2007-01-03	2007-01-03	ENSG00000106723	ENSG00000106723			11243	protein-coding gene	gene with protein product		609936	"""spindlin"""	SPIN		16098913	Standard	NM_006717		Approved		uc004apy.3	Q9Y657	OTTHUMG00000020168	ENST00000375859.3:c.*339T>C	9.37:g.91090531T>C			A8K0X6|B3KRQ4|Q7KZJ8|Q9GZT2|Q9H0N7	RNA	SNP	-	NULL	ENST00000375859.3	37	NULL	CCDS43843.1	9																																																																																			SPIN1	-	-	ENSG00000106723		0.313	SPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIN1	HGNC	protein_coding	OTTHUMT00000052967.1	-	0.00	36	0	T	NM_006717		91090531	+1	tier1	-	no_errors	ENST00000469017	ensembl	human	known	74_37	rna	15.38	22	4	SNP	1.000	C
SRRM2	23524	genome.wustl.edu	37	16	2816429	2816429	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr16:2816429G>T	ENST00000301740.8	+	11	6449	c.5900G>T	c.(5899-5901)aGg>aTg	p.R1967M		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1967	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CCAGTAACCAGGAGGCGATCT	0.552																																																	0													64.0	65.0	64.0					16																	2816429		2198	4300	6498	SO:0001583	missense	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.5900G>T	16.37:g.2816429G>T	ENSP00000301740:p.Arg1967Met		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.R1967M	ENST00000301740.8	37	c.5900	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	G	10.10	1.256492	0.22965	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.26957	1.7	5.24	5.24	0.73138	.	0.000000	0.64402	D	0.000009	T	0.31199	0.0789	N	0.08118	0	0.32604	N	0.525576	D	0.65815	0.995	D	0.69142	0.962	T	0.46721	-0.9171	10	0.66056	D	0.02	-9.695	16.3084	0.82859	0.0:0.0:1.0:0.0	.	1967	Q9UQ35	SRRM2_HUMAN	M	1967;1967;1219	ENSP00000301740:R1967M	ENSP00000301740:R1967M	R	+	2	0	SRRM2	2756430	0.460000	0.25776	0.997000	0.53966	0.969000	0.65631	3.806000	0.55583	2.454000	0.82982	0.650000	0.86243	AGG	SRRM2	-	NULL	ENSG00000167978		0.552	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	-	0.00	35	0	G			2816429	+1	tier1	-	no_errors	ENST00000301740	ensembl	human	known	74_37	missense	12.90	27	4	SNP	0.881	T
SSPO	23145	genome.wustl.edu	37	7	149516491	149516491	+	RNA	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr7:149516491G>A	ENST00000378016.2	+	0	11894							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TGCGGAGTGGGCCAGCAGCGC	0.701																																																	0													15.0	20.0	18.0					7																	149516491		1962	4133	6095			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149516491G>A			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.701	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		-	0.00	18	0	G			149516491	+1	tier1	-	no_errors	ENST00000378016	ensembl	human	known	74_37	rna	57.89	8	11	SNP	1.000	A
SSPO	23145	genome.wustl.edu	37	7	149525763	149525763	+	RNA	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr7:149525763C>G	ENST00000378016.2	+	0	15022							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TGAGAGCTGCCTCTGCCTCAG	0.602																																																	0													19.0	25.0	23.0					7																	149525763		2084	4213	6297			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149525763C>G			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.602	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		-	0.00	30	0	C			149525763	+1	tier1	-	no_errors	ENST00000378016	ensembl	human	known	74_37	rna	13.79	25	4	SNP	0.990	G
STX12	23673	genome.wustl.edu	37	1	28138753	28138754	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:28138753_28138754delAG	ENST00000373943.4	+	6	675_676	c.550_551delAG	c.(550-552)agafs	p.R184fs		NM_177424.2	NP_803173.1	Q86Y82	STX12_HUMAN	syntaxin 12	184	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				cholesterol efflux (GO:0033344)|intracellular protein transport (GO:0006886)|protein stabilization (GO:0050821)|synaptic vesicle exocytosis (GO:0016079)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|phagocytic vesicle (GO:0045335)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			breast(1)|central_nervous_system(1)|large_intestine(3)|lung(3)	8		Colorectal(325;3.46e-05)|all_lung(284;9.43e-05)|Lung NSC(340;0.000185)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;3.96e-24)|Colorectal(126;3.46e-08)|COAD - Colon adenocarcinoma(152;1.83e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00258)|KIRC - Kidney renal clear cell carcinoma(1967;0.00302)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0649)		TATTAAAGAAAGAGAAACGGCA	0.48																																					Ovarian(5;5 342 2097 9488 34083)												0																																										SO:0001589	frameshift_variant	0			BC046999	CCDS310.1	1p35.3	2008-05-14			ENSG00000117758	ENSG00000117758			11430	protein-coding gene	gene with protein product		606892				9507000	Standard	NM_177424		Approved	STX13, STX14	uc001bou.4	Q86Y82	OTTHUMG00000003730	ENST00000373943.4:c.550_551delAG	1.37:g.28138755_28138756delAG	ENSP00000363054:p.Arg184fs		B1AJQ7|O95564	Frame_Shift_Del	DEL	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.E185fs	ENST00000373943.4	37	c.550_551	CCDS310.1	1																																																																																			STX12	-	pfam_T_SNARE_dom,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	ENSG00000117758		0.480	STX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX12	HGNC	protein_coding	OTTHUMT00000010519.1		0.00	22	0	AG	NM_177424		28138754	+1	tier1		no_errors	ENST00000373943	ensembl	human	known	74_37	frame_shift_del	22.58	24	7	DEL	1.000:1.000	-
SYCP1	6847	genome.wustl.edu	37	1	115537601	115537601	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:115537601delA	ENST00000369522.3	+	32	3132	c.2892delA	c.(2890-2892)agafs	p.R964fs	SYCP1_ENST00000369518.1_Frame_Shift_Del_p.R964fs|SYCP1_ENST00000477590.1_3'UTR	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	964	Arg/Lys-rich (basic).				chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAATGGATAGAAAAAAAAAAC	0.353																																																	0										97,41,4116		2,3,90,0,38,1994	42.0	47.0	45.0			5.1	1.0	1		47	108,62,8066		1,0,106,1,60,3950	no	codingComplex	SYCP1	NM_003176.2		3,3,196,1,98,5944	A1A1,A1A2,A1R,A2A2,A2R,RR		2.0641,3.244,2.466			115537601	205,103,12182	2200	4297	6497	SO:0001589	frameshift_variant	0			D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.2892delA	1.37:g.115537601delA	ENSP00000358535:p.Arg964fs		O14963|Q5VXJ6	Frame_Shift_Del	DEL	pfam_SCP-1	p.K967fs	ENST00000369522.3	37	c.2892	CCDS879.1	1																																																																																			SYCP1	-	NULL	ENSG00000198765		0.353	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP1	HGNC	protein_coding	OTTHUMT00000033386.1		0.00	35	0	A	NM_003176		115537601	+1	tier1		no_errors	ENST00000369518	ensembl	human	known	74_37	frame_shift_del	41.67	14	10	DEL	1.000	-
SYT4	6860	genome.wustl.edu	37	18	40850584	40850585	+	Missense_Mutation	DNP	CA	CA	TT			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C|A	C|A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr18:40850584_40850585CA>TT	ENST00000255224.3	-	4	1367_1368	c.999_1000TG>AA	c.(997-1002)caTGcc>caAAcc	p.333_334HA>QT	SYT4_ENST00000590752.1_Missense_Mutation_p.315_316HA>QT|SYT4_ENST00000586678.1_Intron	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	333	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						CTCTTTTTGGCATGGTACAGGT	0.446																																					NSCLC(85;81 1419 2855 22820 35912)												0																																										SO:0001583	missense	0			BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.999_1000delinsTT	18.37:g.40850584_40850585delinsTT	ENSP00000255224:p.H333_A334delinsQT		B4DEU3|Q9P2K4	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin	p.A334T|p.H333Q	ENST00000255224.3	37	c.1000|c.999	CCDS11922.1	18																																																																																			SYT4	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000132872		0.446	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT4	HGNC	protein_coding	OTTHUMT00000255851.2	-	0.00	62|63	0	C|A	NM_020783		40850584|40850585	-1	tier1	-	no_errors	ENST00000255224	ensembl	human	known	74_37	missense	34.00|33.33	33|34	17	SNP	1.000|0.999	T
SYTL2	54843	genome.wustl.edu	37	11	85438781	85438781	+	Intron	SNP	T	T	C	rs568790639		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr11:85438781T>C	ENST00000528231.1	-	7	1737				SYTL2_ENST00000527523.1_Intron|SYTL2_ENST00000359152.5_Silent_p.Q97Q|SYTL2_ENST00000354566.3_5'Flank|SYTL2_ENST00000525423.1_5'UTR|SYTL2_ENST00000316356.4_Intron|SYTL2_ENST00000524452.1_Intron|SYTL2_ENST00000389960.4_Intron	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		CTCGGGGATGTTGGAGGAATG	0.378													T|||	1	0.000199681	0.0008	0.0	5008	,	,		19947	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	0			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1459+157A>G	11.37:g.85438781T>C			B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.Q97	ENST00000528231.1	37	c.291	CCDS53688.1	11																																																																																			SYTL2	-	NULL	ENSG00000137501		0.378	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL2	HGNC	protein_coding	OTTHUMT00000392192.1	-	0.00	66	0	T	NM_206927		85438781	-1	tier1	-	no_errors	ENST00000359152	ensembl	human	known	74_37	silent	15.71	59	11	SNP	0.000	C
TBC1D10B	26000	genome.wustl.edu	37	16	30370588	30370588	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr16:30370588G>C	ENST00000409939.3	-	7	1627	c.1547C>G	c.(1546-1548)cCt>cGt	p.P516R	RP11-347C12.10_ENST00000563252.1_lincRNA	NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	516	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			GTAGAGCACAGGGTCAATGCG	0.627																																																	0													27.0	26.0	26.0					16																	30370588		2197	4294	6491	SO:0001583	missense	0			BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.1547C>G	16.37:g.30370588G>C	ENSP00000386538:p.Pro516Arg		B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.P516R	ENST00000409939.3	37	c.1547	CCDS10676.2	16	.	.	.	.	.	.	.	.	.	.	G	21.9	4.214702	0.79352	.	.	ENSG00000169221	ENST00000409939	T	0.26660	1.72	4.79	4.79	0.61399	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.63248	0.2495	H	0.94964	3.605	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75235	-0.3389	10	0.87932	D	0	.	16.7512	0.85487	0.0:0.0:1.0:0.0	.	516	Q4KMP7	TB10B_HUMAN	R	516	ENSP00000386538:P516R	ENSP00000386538:P516R	P	-	2	0	TBC1D10B	30278089	1.000000	0.71417	1.000000	0.80357	0.610000	0.37248	9.657000	0.98554	2.507000	0.84556	0.462000	0.41574	CCT	TBC1D10B	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000169221		0.627	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D10B	HGNC	protein_coding	OTTHUMT00000255527.3	-	0.00	45	0	G	NM_015527		30370588	-1	tier1	-	no_errors	ENST00000409939	ensembl	human	known	74_37	missense	36.67	19	11	SNP	1.000	C
TBC1D5	9779	genome.wustl.edu	37	3	17447964	17447964	+	Silent	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr3:17447964C>T	ENST00000253692.7	-	5	1886	c.222G>A	c.(220-222)caG>caA	p.Q74Q	TBC1D5_ENST00000446818.2_Silent_p.Q74Q|TBC1D5_ENST00000429924.2_Silent_p.Q26Q|TBC1D5_ENST00000414318.2_Intron|TBC1D5_ENST00000429383.4_Silent_p.Q74Q	NM_014744.2	NP_055559.1	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5	74						retromer complex (GO:0030904)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	36						TAATCCCCTTCTGCCTTATTG	0.363																																																	0													192.0	183.0	186.0					3																	17447964		2203	4300	6503	SO:0001819	synonymous_variant	0			D86965	CCDS33714.1, CCDS46770.1	3p24.3	2013-07-09			ENSG00000131374	ENSG00000131374			19166	protein-coding gene	gene with protein product		615740				19531583	Standard	NM_014744		Approved	KIAA0210	uc003cbe.3	Q92609	OTTHUMG00000155488	ENST00000253692.7:c.222G>A	3.37:g.17447964C>T			A6NP25|C9JP52	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.Q74	ENST00000253692.7	37	c.222	CCDS33714.1	3																																																																																			TBC1D5	-	superfamily_Rab-GTPase-TBC_dom	ENSG00000131374		0.363	TBC1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D5	HGNC	protein_coding	OTTHUMT00000340301.3	-	0.00	68	0	C	NM_014744		17447964	-1	tier1	-	no_errors	ENST00000253692	ensembl	human	known	74_37	silent	5.33	71	4	SNP	1.000	T
TBX15	6913	genome.wustl.edu	37	1	119427568	119427568	+	Silent	SNP	C	C	T	rs574411651		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:119427568C>T	ENST00000369429.3	-	8	1605	c.1596G>A	c.(1594-1596)ccG>ccA	p.P532P	TBX15_ENST00000207157.3_Silent_p.P426P			Q96SF7	TBX15_HUMAN	T-box 15	532					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		TCAGTTTTTCCGGGCTTGCAG	0.537													C|||	1	0.000199681	0.0	0.0	5008	,	,		20436	0.0		0.001	False		,,,				2504	0.0																0													92.0	85.0	88.0					1																	119427568		2203	4300	6503	SO:0001819	synonymous_variant	0			AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.1596G>A	1.37:g.119427568C>T			Q08E76|Q5JT54|Q5T9S7	Silent	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.P426	ENST00000369429.3	37	c.1278		1																																																																																			TBX15	-	NULL	ENSG00000092607		0.537	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	TBX15	HGNC	protein_coding	OTTHUMT00000034351.1	-	0.00	17	0	C	NM_152380		119427568	-1	tier1	-	no_errors	ENST00000207157	ensembl	human	known	74_37	silent	40.00	6	4	SNP	0.934	T
TENM2	57451	genome.wustl.edu	37	5	166712001	166712001	+	Silent	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr5:166712001C>T	ENST00000518659.1	+	1	198	c.159C>T	c.(157-159)agC>agT	p.S53S	TENM2_ENST00000545108.1_Silent_p.S53S|CTB-180C19.1_ENST00000521697.1_RNA	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	53	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										ACCATGACAGCAGGATGCACT	0.532																																																	0													90.0	87.0	88.0					5																	166712001		692	1591	2283	SO:0001819	synonymous_variant	0			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.159C>T	5.37:g.166712001C>T			Q9ULU2	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl_sf,superfamily_Cytokine_IL1-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.S53	ENST00000518659.1	37	c.159		5																																																																																			TENM2	-	pfam_Ten_N	ENSG00000145934		0.532	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	TENM2	HGNC	protein_coding	OTTHUMT00000376096.1	-	0.00	22	0	C	NM_001122679		166712001	+1	tier1	-	no_errors	ENST00000518659	ensembl	human	known	74_37	silent	29.41	12	5	SNP	1.000	T
TESC	54997	genome.wustl.edu	37	12	117484456	117484456	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr12:117484456G>T	ENST00000335209.7	-	6	613	c.427C>A	c.(427-429)Ctg>Atg	p.L143M	TESC_ENST00000541210.1_Missense_Mutation_p.L116M|TESC_ENST00000392545.4_Missense_Mutation_p.L196M|TESC_ENST00000535198.1_5'UTR			Q96BS2	CHP3_HUMAN	tescalcin	143	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cell differentiation (GO:0030154)|cellular response to retinoic acid (GO:0071300)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell proliferation (GO:0008285)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of sodium:proton antiporter activity (GO:0032417)|positive regulation of transcription, DNA-templated (GO:0045893)|protein maturation (GO:0051604)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of cell adhesion mediated by integrin (GO:0033628)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphatase inhibitor activity (GO:0019212)|protein homodimerization activity (GO:0042803)|protein kinase inhibitor activity (GO:0004860)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0297)		TTTCCCGACAGCAGCTCCTCG	0.677																																																	0													23.0	21.0	22.0					12																	117484456		2149	4172	6321	SO:0001583	missense	0			AF443207	CCDS9183.2, CCDS9183.3, CCDS53835.1	12q24.22	2013-01-10			ENSG00000088992	ENSG00000088992		"""EF-hand domain containing"""	26065	protein-coding gene	gene with protein product	"""calcineurin-like EF hand protein 3"""	611585				11145610, 11696366, 12809501, 14661968	Standard	NM_017899		Approved	TSC, FLJ20607, CHP3	uc001twh.3	Q96BS2	OTTHUMG00000144168	ENST00000335209.7:c.427C>A	12.37:g.117484456G>T	ENSP00000334785:p.Leu143Met		F5H1Y5|Q9NWT9	Nonsense_Mutation	SNP	pfscan_EF_hand_dom	p.C144*	ENST00000335209.7	37	c.432	CCDS9183.3	12	.	.	.	.	.	.	.	.	.	.	G	18.05	3.538052	0.65085	.	.	ENSG00000088992	ENST00000335209;ENST00000392545;ENST00000541210;ENST00000549210	T;T;T	0.63580	0.35;0.35;-0.05	5.0	4.12	0.48240	EF-hand-like domain (1);	0.096735	0.41605	U	0.000841	T	0.50343	0.1610	L	0.33093	0.98	0.51012	D	0.999906	P	0.41673	0.759	B	0.43225	0.412	T	0.51841	-0.8654	10	0.56958	D	0.05	-41.1465	5.8264	0.18556	0.1629:0.0:0.6808:0.1564	.	143	Q96BS2	TESC_HUMAN	M	143;196;116;26	ENSP00000334785:L143M;ENSP00000376328:L196M;ENSP00000445689:L116M	ENSP00000334785:L143M	L	-	1	2	TESC	115968839	1.000000	0.71417	0.952000	0.39060	0.013000	0.08279	4.907000	0.63300	1.338000	0.45544	-0.136000	0.14681	CTG	TESC	-	NULL	ENSG00000088992		0.677	TESC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TESC	HGNC	protein_coding	OTTHUMT00000291363.2	-	0.00	60	0	G	NM_017899		117484456	-1	tier1	-	no_errors	ENST00000470612	ensembl	human	known	74_37	nonsense	8.16	45	4	SNP	0.997	T
TET2	54790	genome.wustl.edu	37	4	106157775	106157775	+	Silent	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr4:106157775A>G	ENST00000540549.1	+	3	3536	c.2676A>G	c.(2674-2676)caA>caG	p.Q892Q	TET2_ENST00000513237.1_Silent_p.Q913Q|TET2_ENST00000380013.4_Silent_p.Q892Q|TET2_ENST00000305737.2_Silent_p.Q892Q|TET2_ENST00000545826.1_Silent_p.Q892Q|TET2_ENST00000394764.1_Silent_p.Q892Q|TET2_ENST00000413648.2_Silent_p.Q892Q			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	892	Gln-rich.				5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		AGTCACAACAAGCTTCAGTTC	0.398			"""Mis N, F"""		MDS																																			Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0													54.0	53.0	53.0					4																	106157775		2203	4300	6503	SO:0001819	synonymous_variant	0			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.2676A>G	4.37:g.106157775A>G			B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Silent	SNP	NULL	p.Q892	ENST00000540549.1	37	c.2676	CCDS47120.1	4																																																																																			TET2	-	NULL	ENSG00000168769		0.398	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	HGNC	protein_coding	OTTHUMT00000253952.2	-	0.00	32	0	A	NM_017628		106157775	+1	tier1	-	no_errors	ENST00000380013	ensembl	human	known	74_37	silent	20.83	19	5	SNP	0.429	G
TEX15	56154	genome.wustl.edu	37	8	30717534	30717534	+	5'UTR	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr8:30717534C>T	ENST00000523186.1	-	0	659							Q9BXT5	TEX15_HUMAN	testis expressed 15						fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TTATTTTTATCCACAGAAGGT	0.323																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000523186.1:c.-861G>A	8.37:g.30717534C>T				RNA	SNP	-	NULL	ENST00000523186.1	37	NULL		8																																																																																			TEX15	-	-	ENSG00000133863		0.323	TEX15-002	KNOWN	basic	processed_transcript	TEX15	HGNC	protein_coding	OTTHUMT00000376194.2	-	0.00	48	0	C			30717534	-1	tier1	-	no_errors	ENST00000523186	ensembl	human	known	74_37	rna	69.23	7	18	SNP	1.000	T
TGFBR3	7049	genome.wustl.edu	37	1	92185688	92185688	+	Missense_Mutation	SNP	C	C	A	rs373979895		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:92185688C>A	ENST00000525962.1	-	8	1236	c.1175G>T	c.(1174-1176)cGg>cTg	p.R392L	TGFBR3_ENST00000212355.4_Missense_Mutation_p.R392L|TGFBR3_ENST00000370399.2_Missense_Mutation_p.R391L			Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	392					blastocyst development (GO:0001824)|blood vessel development (GO:0001568)|BMP signaling pathway (GO:0030509)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cell growth (GO:0016049)|cell migration (GO:0016477)|definitive erythrocyte differentiation (GO:0060318)|definitive hemopoiesis (GO:0060216)|epithelial to mesenchymal transition (GO:0001837)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|negative regulation of cellular component movement (GO:0051271)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of protein binding (GO:0043393)|response to follicle-stimulating hormone (GO:0032354)|response to hypoxia (GO:0001666)|response to luteinizing hormone (GO:0034699)|response to prostaglandin E (GO:0034695)|transforming growth factor beta receptor complex assembly (GO:0007181)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	coreceptor activity (GO:0015026)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|PDZ domain binding (GO:0030165)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type III (GO:0070123)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(24)|ovary(3)|prostate(4)|skin(1)|stomach(1)|urinary_tract(3)	55		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		TTCCCCTCCCCGGATGGGCGG	0.587																																																	0													34.0	36.0	36.0					1																	92185688		2203	4300	6503	SO:0001583	missense	0			L07594	CCDS30770.1, CCDS55614.1	1p33-p32	2008-02-05	2007-02-15		ENSG00000069702	ENSG00000069702		"""Proteoglycans / Cell surface : Other"""	11774	protein-coding gene	gene with protein product	"""betaglycan proteoglycan"""	600742	"""transforming growth factor, beta receptor III (betaglycan, 300kDa)"""			1333192, 1319842	Standard	NM_001195684		Approved	betaglycan, BGCAN	uc001doh.3	Q03167	OTTHUMG00000010097	ENST00000525962.1:c.1175G>T	1.37:g.92185688C>A	ENSP00000436127:p.Arg392Leu		A0AUW8|A8K5N0|B9EG88|Q5T2T4|Q5U731|Q9UGI2	Missense_Mutation	SNP	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom,prints_ZP_dom	p.R392L	ENST00000525962.1	37	c.1175	CCDS30770.1	1	.	.	.	.	.	.	.	.	.	.	C	5.053	0.195432	0.09599	.	.	ENSG00000069702	ENST00000212355;ENST00000370399;ENST00000525962;ENST00000465892	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	5.62	-4.28	0.03732	.	0.630018	0.14244	N	0.331896	T	0.05273	0.0140	L	0.29908	0.895	0.09310	N	1	B;B;B	0.28400	0.006;0.21;0.133	B;B;B	0.26094	0.004;0.066;0.03	T	0.26360	-1.0105	10	0.41790	T	0.15	-0.0112	2.7981	0.05407	0.0954:0.3906:0.1878:0.3262	.	392;391;392	A8K5N0;Q03167-2;Q03167	.;.;TGBR3_HUMAN	L	392;391;392;391	ENSP00000212355:R392L;ENSP00000359426:R391L;ENSP00000436127:R392L;ENSP00000432638:R391L	ENSP00000212355:R392L	R	-	2	0	TGFBR3	91958276	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	-1.077000	0.03416	-0.950000	0.03659	-0.797000	0.03246	CGG	TGFBR3	-	NULL	ENSG00000069702		0.587	TGFBR3-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TGFBR3	HGNC	protein_coding	OTTHUMT00000382308.1	-	0.00	21	0	C	NM_003243		92185688	-1	tier1	-	no_errors	ENST00000212355	ensembl	human	known	74_37	missense	42.86	8	6	SNP	0.001	A
TLR3	7098	genome.wustl.edu	37	4	186997831	186997831	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr4:186997831C>A	ENST00000296795.3	+	2	162	c.58C>A	c.(58-60)Ctg>Atg	p.L20M		NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	20					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		CTTTGGGATGCTGTGTGCATC	0.463																																																	0													112.0	102.0	105.0					4																	186997831		2203	4300	6503	SO:0001583	missense	0			U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.58C>A	4.37:g.186997831C>A	ENSP00000296795:p.Leu20Met		B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Missense_Mutation	SNP	pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.L20M	ENST00000296795.3	37	c.58	CCDS3846.1	4	.	.	.	.	.	.	.	.	.	.	C	14.64	2.595874	0.46318	.	.	ENSG00000164342	ENST00000296795;ENST00000513189;ENST00000542020	T;T	0.36699	1.35;1.24	5.68	3.84	0.44239	.	0.729810	0.13234	N	0.403433	T	0.31420	0.0796	L	0.50333	1.59	0.09310	N	1	B	0.22683	0.073	B	0.26614	0.071	T	0.18999	-1.0319	10	0.38643	T	0.18	.	6.4916	0.22119	0.109:0.6256:0.1883:0.0771	.	20	O15455	TLR3_HUMAN	M	20	ENSP00000296795:L20M;ENSP00000423386:L20M	ENSP00000296795:L20M	L	+	1	2	TLR3	187234825	0.000000	0.05858	0.003000	0.11579	0.012000	0.07955	0.644000	0.24766	1.542000	0.49330	0.591000	0.81541	CTG	TLR3	-	NULL	ENSG00000164342		0.463	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR3	HGNC	protein_coding	OTTHUMT00000360313.4	-	0.00	40	0	C			186997831	+1	tier1	-	no_errors	ENST00000296795	ensembl	human	known	74_37	missense	18.60	35	8	SNP	0.000	A
TMC6	11322	genome.wustl.edu	37	17	76120698	76120700	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr17:76120698_76120700delCAG	ENST00000590602.1	-	8	955_957	c.796_798delCTG	c.(796-798)ctgdel	p.L266del	TMC6_ENST00000322914.3_In_Frame_Del_p.L266del|TMC6_ENST00000592076.1_5'Flank|TMC6_ENST00000392467.3_In_Frame_Del_p.L266del|TMC6_ENST00000589553.1_In_Frame_Del_p.L39del|TMC6_ENST00000306591.7_In_Frame_Del_p.L266del|TMC6_ENST00000591436.1_5'Flank|TMC6_ENST00000322933.4_5'UTR			Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	266				L -> P (in Ref. 2; AAP69874). {ECO:0000305}.	ion transport (GO:0006811)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	14			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TGAAGGCCACCAGCAGCAGCAGC	0.67																																																	0																																										SO:0001651	inframe_deletion	0			AY057379	CCDS32748.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000141524	ENSG00000141524			18021	protein-coding gene	gene with protein product		605828	"""epidermodysplasia verruciformis 1"""	EVER1		12426567	Standard	NM_007267		Approved	LAK-4P, EVIN1	uc002juk.2	Q7Z403	OTTHUMG00000177466	ENST00000590602.1:c.796_798delCTG	17.37:g.76120707_76120709delCAG	ENSP00000465261:p.Leu266del		O43284|Q45VJ2|Q8IU98|Q8IUI7|Q8IWU8|Q8TEQ7|Q9HAG5	In_Frame_Del	DEL	pfam_TMC	p.L266in_frame_del	ENST00000590602.1	37	c.798_796	CCDS32748.1	17																																																																																			TMC6	-	NULL	ENSG00000141524		0.670	TMC6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMC6	HGNC	protein_coding	OTTHUMT00000437146.1		0.00	14	0	CAG			76120700	-1	tier1		no_errors	ENST00000322914	ensembl	human	known	74_37	in_frame_del	28.57	10	4	DEL	0.377:0.372:0.237	-
TMEM132D	121256	genome.wustl.edu	37	12	129822245	129822245	+	Silent	SNP	A	A	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr12:129822245A>T	ENST00000422113.2	-	4	1559	c.1233T>A	c.(1231-1233)tcT>tcA	p.S411S		NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	411					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CTCCCAAGTCAGACGTGATCT	0.572																																																	0													164.0	142.0	150.0					12																	129822245		2203	4300	6503	SO:0001819	synonymous_variant	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1233T>A	12.37:g.129822245A>T			Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	NULL	p.S411	ENST00000422113.2	37	c.1233	CCDS9266.1	12																																																																																			TMEM132D	-	NULL	ENSG00000151952		0.572	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	-	0.00	28	0	A	NM_133448		129822245	-1	tier1	-	no_errors	ENST00000422113	ensembl	human	known	74_37	silent	45.16	17	14	SNP	0.002	T
TMEM218	219854	genome.wustl.edu	37	11	124967413	124967413	+	3'UTR	SNP	G	G	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr11:124967413G>C	ENST00000279968.4	-	0	760				TMEM218_ENST00000531909.1_3'UTR|TMEM218_ENST00000532156.1_3'UTR|TMEM218_ENST00000531262.1_5'UTR|TMEM218_ENST00000528724.1_3'UTR|TMEM218_ENST00000529609.1_3'UTR|TMEM218_ENST00000526175.1_3'UTR|TMEM218_ENST00000455225.1_3'UTR|TMEM218_ENST00000532407.1_3'UTR|TMEM218_ENST00000527766.1_3'UTR|TMEM218_ENST00000529583.1_3'UTR			A2RU14	TM218_HUMAN	transmembrane protein 218							integral component of membrane (GO:0016021)				breast(1)|large_intestine(2)|lung(1)|prostate(1)	5						CATGAGGGCTGTCAAAACAAG	0.463																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS31715.1	11q24.2	2008-08-08			ENSG00000150433	ENSG00000150433			27344	protein-coding gene	gene with protein product							Standard	NM_001258238		Approved		uc031qeu.1	A2RU14		ENST00000279968.4:c.*89C>G	11.37:g.124967413G>C			B7ZM48	RNA	SNP	-	NULL	ENST00000279968.4	37	NULL	CCDS31715.1	11																																																																																			TMEM218	-	-	ENSG00000150433		0.463	TMEM218-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	TMEM218	HGNC	protein_coding	OTTHUMT00000386849.1	-	0.00	17	0	G	NM_001080546		124967413	-1	tier1	-	no_errors	ENST00000531262	ensembl	human	known	74_37	rna	22.22	14	4	SNP	0.001	C
TNFRSF10B	8795	genome.wustl.edu	37	8	22886020	22886020	+	Missense_Mutation	SNP	A	A	T	rs13265018	byFrequency	TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr8:22886020A>T	ENST00000276431.4	-	5	856	c.572T>A	c.(571-573)gTc>gAc	p.V191D	TNFRSF10B_ENST00000519910.1_5'Flank|TNFRSF10B_ENST00000347739.3_Intron|TNFRSF10B_ENST00000542226.1_Intron	NM_003842.4|NM_147187.2	NP_003833.4|NP_671716.2	O14763	TR10B_HUMAN	tumor necrosis factor receptor superfamily, member 10b	191			V -> A (in dbSNP:rs13265018). {ECO:0000269|PubMed:10072170, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9285725, ECO:0000269|PubMed:9311998, ECO:0000269|PubMed:9373179}.		activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to endoplasmic reticulum stress (GO:0034976)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|TRAIL binding (GO:0045569)			NS(1)|endometrium(2)|large_intestine(7)|liver(1)|lung(3)|skin(1)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0179)|COAD - Colon adenocarcinoma(73;0.0703)		CACAGCTGGGACTTCCCCACT	0.562																																					GBM(94;1064 1342 1839 21060 42553)												0													153.0	138.0	143.0					8																	22886020		2203	4300	6503	SO:0001583	missense	0			AF012628	CCDS6035.1, CCDS6036.1	8p22-p21	2006-02-22			ENSG00000120889	ENSG00000120889		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11905	protein-coding gene	gene with protein product		603612				9285725, 9311998	Standard	NM_003842		Approved	DR5, KILLER, TRICK2A, TRAIL-R2, TRICKB, CD262	uc003xcu.2	O14763	OTTHUMG00000097826	ENST00000276431.4:c.572T>A	8.37:g.22886020A>T	ENSP00000276431:p.Val191Asp		O14720|O15508|O15517|O15531|Q6UXM8|Q7Z360|Q9BVE0	Missense_Mutation	SNP	pirsf_TNFR_10,pfam_Death_domain,pfam_TNFR/NGFR_Cys_rich_reg,superfamily_DEATH-like_dom,smart_TNFR/NGFR_Cys_rich_reg,smart_Death_domain,prints_TNFR_10,pfscan_Death_domain,pfscan_TNFR/NGFR_Cys_rich_reg	p.V191D	ENST00000276431.4	37	c.572	CCDS6035.1	8	.	.	.	.	.	.	.	.	.	.	N	9.260	1.042977	0.19748	.	.	ENSG00000120889	ENST00000276431	D	0.84146	-1.81	3.09	0.0155	0.14104	.	.	.	.	.	T	0.68044	0.2958	N	0.22421	0.69	0.80722	P	0.0	P	0.37500	0.597	B	0.27887	0.084	T	0.60821	-0.7187	8	0.46703	T	0.11	.	4.9773	0.14148	0.3353:0.1591:0.5056:0.0	.	191	O14763	TR10B_HUMAN	D	191	ENSP00000276431:V191D	ENSP00000276431:V191D	V	-	2	0	TNFRSF10B	22941965	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.086000	0.14935	-0.485000	0.06754	-2.318000	0.00253	GTC	TNFRSF10B	-	pirsf_TNFR_10	ENSG00000120889		0.562	TNFRSF10B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNFRSF10B	HGNC	protein_coding	OTTHUMT00000215099.2	-	0.00	34	0	A	NM_147187		22886020	-1	tier1	-	no_errors	ENST00000276431	ensembl	human	known	74_37	missense	69.57	5	32	SNP	0.000	T
TOP1	7150	genome.wustl.edu	37	20	39750349	39750349	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr20:39750349A>T	ENST00000361337.2	+	19	2214	c.1964A>T	c.(1963-1965)aAg>aTg	p.K655M	RP1-1J6.2_ENST00000454626.1_RNA	NM_003286.2	NP_003277.1	P11387	TOP1_HUMAN	topoisomerase (DNA) I	655					chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|DNA topological change (GO:0006265)|embryonic cleavage (GO:0040016)|phosphorylation (GO:0016310)|programmed cell death (GO:0012501)|response to drug (GO:0042493)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|replication fork protection complex (GO:0031298)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|poly(A) RNA binding (GO:0044822)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Sodium stibogluconate(DB05630)|Topotecan(DB01030)	GATGCCAAGAAGGAACAGCTA	0.458			T	NUP98	AML*																																			Dom	yes		20	20q12-q13.1	7150	topoisomerase (DNA) I		L	0													209.0	219.0	216.0					20																	39750349		2203	4300	6503	SO:0001583	missense	0				CCDS13312.1	20q12-q13.1	1990-06-22			ENSG00000198900	ENSG00000198900	5.99.1.2		11986	protein-coding gene	gene with protein product		126420					Standard	NM_003286		Approved		uc010ggd.1	P11387	OTTHUMG00000033057	ENST00000361337.2:c.1964A>T	20.37:g.39750349A>T	ENSP00000354522:p.Lys655Met		A8KA78|E1P5W3|O43256|Q12855|Q12856|Q15610|Q5TFY3|Q9UJN0	Missense_Mutation	SNP	pfam_TopoI_DNA-bd_euk,pfam_TopoI_cat_euk,superfamily_TopoI_DNA-bd_euk,superfamily_DNA_brk_join_enz,smart_TopoI_euk,prints_TopoI	p.K655M	ENST00000361337.2	37	c.1964	CCDS13312.1	20	.	.	.	.	.	.	.	.	.	.	A	26.3	4.723671	0.89298	.	.	ENSG00000198900	ENST00000361337	T	0.52754	0.65	5.91	5.91	0.95273	DNA breaking-rejoining enzyme, catalytic core (1);DNA topoisomerase I, C-terminal, eukaryotic-type (1);DNA topoisomerase I, catalytic core, alpha/beta subdomain, eukaryotic-type (1);DNA topoisomerases I, dispensable insert, eukaryotic-type (1);DNA topoisomerase I, catalytic core, eukaryotic-type (1);	0.169262	0.64402	D	0.000008	T	0.71779	0.3380	M	0.92459	3.31	0.80722	D	1	P	0.51791	0.948	P	0.55055	0.767	T	0.79831	-0.1637	10	0.87932	D	0	-18.8624	16.3483	0.83171	1.0:0.0:0.0:0.0	.	655	P11387	TOP1_HUMAN	M	655	ENSP00000354522:K655M	ENSP00000354522:K655M	K	+	2	0	TOP1	39183763	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.079000	0.71291	2.254000	0.74563	0.533000	0.62120	AAG	TOP1	-	pfam_TopoI_cat_euk,superfamily_DNA_brk_join_enz,smart_TopoI_euk	ENSG00000198900		0.458	TOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP1	HGNC	protein_coding	OTTHUMT00000080397.2	-	0.00	69	0	A			39750349	+1	tier1	-	no_errors	ENST00000361337	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	GRCh37	CM010465|CM900211	TP53	M	rs121912651						151.0	112.0	125.0					17																	7577539		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R248W	ENST00000269305.4	37	c.742	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	51	0	G	NM_000546		7577539	-1	tier1	rs121912651	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	78.38	8	29	SNP	1.000	A
TRIM66	9866	genome.wustl.edu	37	11	8646325	8646325	+	Silent	SNP	G	G	T	rs373665234		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr11:8646325G>T	ENST00000299550.6	-	11	2520	c.2326C>A	c.(2326-2328)Cga>Aga	p.R776R	TRIM66_ENST00000402157.2_Silent_p.R774R	NM_014818.1	NP_055633.1	O15016	TRI66_HUMAN	tripartite motif containing 66	776						aggresome (GO:0016235)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|kidney(1)|lung(1)|skin(2)	9						CCTGAAGTTCGGCCAGAACTG	0.552																																																	0								G		0,1384		0,0,692	31.0	29.0	30.0		2326	-2.0	0.0	11		30	1,3181		0,1,1590	no	coding-synonymous	TRIM66	NM_014818.1		0,1,2282	TT,TG,GG		0.0314,0.0,0.0219		776/1217	8646325	1,4565	692	1591	2283	SO:0001819	synonymous_variant	0			AB002296		11p15.4	2013-01-28	2011-01-25		ENSG00000166436	ENSG00000166436		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"""	29005	protein-coding gene	gene with protein product		612000	"""chromosome 11 open reading frame 29"", ""tripartite motif-containing 66"""	C11orf29		9205841	Standard	NM_014818		Approved	KIAA0298, TIF1D	uc010rbo.2	O15016	OTTHUMG00000150481	ENST00000299550.6:c.2326C>A	11.37:g.8646325G>T			Q9BQQ4	Silent	SNP	pfam_Bromodomain,pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_B-box,smart_Znf_PHD,smart_Bbox_C,smart_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Bromodomain	p.R776	ENST00000299550.6	37	c.2326		11																																																																																			TRIM66	-	NULL	ENSG00000166436		0.552	TRIM66-201	KNOWN	basic|appris_candidate	protein_coding	TRIM66	HGNC	protein_coding		-	0.00	8	0	G	XM_084529		8646325	-1	tier1	-	no_errors	ENST00000299550	ensembl	human	known	74_37	silent	25.00	15	5	SNP	0.001	T
TSHZ3	57616	genome.wustl.edu	37	19	31768323	31768323	+	Silent	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:31768323C>T	ENST00000240587.4	-	2	2703	c.2376G>A	c.(2374-2376)ttG>ttA	p.L792L		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	792					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TCCCTTTTGTCAAGTCTATGG	0.587																																																	0													96.0	81.0	86.0					19																	31768323		2203	4300	6503	SO:0001819	synonymous_variant	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2376G>A	19.37:g.31768323C>T			Q9H0G6|Q9P254	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.L792	ENST00000240587.4	37	c.2376	CCDS12421.2	19																																																																																			TSHZ3	-	NULL	ENSG00000121297		0.587	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2	-	0.00	46	0	C	NM_020856		31768323	-1	tier1	-	no_errors	ENST00000240587	ensembl	human	known	74_37	silent	32.08	36	17	SNP	1.000	T
TSNAX	7257	genome.wustl.edu	37	1	231664450	231664450	+	5'UTR	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:231664450C>G	ENST00000366639.4	+	0	52				RP11-295G20.2_ENST00000416221.1_RNA|RP11-295G20.2_ENST00000440665.1_RNA|TSNAX_ENST00000602825.1_3'UTR|RP11-295G20.2_ENST00000425412.1_RNA|RP11-295G20.2_ENST00000454631.1_RNA|TSNAX-DISC1_ENST00000602962.1_5'UTR|RP11-295G20.2_ENST00000450783.1_RNA	NM_005999.2	NP_005990.1	Q99598	TSNAX_HUMAN	translin-associated factor X						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		all_cancers(173;0.0395)|Acute lymphoblastic leukemia(190;3.76e-06)|Prostate(94;0.116)				GGCTGCAAAGCGTTTTTCTGC	0.647																																																	0																																										SO:0001623	5_prime_UTR_variant	0			X95073	CCDS1596.1	1q42.2	2008-02-05			ENSG00000116918	ENSG00000116918			12380	protein-coding gene	gene with protein product		602964				9013868	Standard	NM_005999		Approved	TRAX	uc001huw.3	Q99598	OTTHUMG00000039486	ENST00000366639.4:c.-107C>G	1.37:g.231664450C>G			B1APC6	RNA	SNP	-	NULL	ENST00000366639.4	37	NULL	CCDS1596.1	1																																																																																			TSNAX	-	-	ENSG00000116918		0.647	TSNAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSNAX	HGNC	protein_coding	OTTHUMT00000095267.2	-	0.00	45	0	C	NM_005999		231664450	+1	tier1	-	no_errors	ENST00000602825	ensembl	human	known	74_37	rna	21.43	44	12	SNP	0.000	G
TSNAXIP1	55815	genome.wustl.edu	37	16	67857617	67857617	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr16:67857617T>C	ENST00000388833.3	+	5	691	c.314T>C	c.(313-315)aTg>aCg	p.M105T	TSNAXIP1_ENST00000415766.3_Intron|TSNAXIP1_ENST00000562321.1_Intron|TSNAXIP1_ENST00000561639.1_Missense_Mutation_p.M159T	NM_018430.2	NP_060900.2			translin-associated factor X interacting protein 1											NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|prostate(1)|soft_tissue(1)|urinary_tract(1)	22		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00432)|Epithelial(162;0.0192)|all cancers(182;0.125)		TATGAGGGGATGCTGGGTAAG	0.493																																																	0													86.0	82.0	84.0					16																	67857617		1963	4170	6133	SO:0001583	missense	0			AF132730	CCDS10846.2, CCDS73903.1, CCDS73904.1	16q22.2	2008-02-05			ENSG00000102904	ENSG00000102904			18586	protein-coding gene	gene with protein product		607720				12036294	Standard	XM_005256051		Approved	TXI1	uc002euj.3	Q2TAA8	OTTHUMG00000137545	ENST00000388833.3:c.314T>C	16.37:g.67857617T>C	ENSP00000373485:p.Met105Thr			Missense_Mutation	SNP	NULL	p.M105T	ENST00000388833.3	37	c.314	CCDS10846.2	16	.	.	.	.	.	.	.	.	.	.	T	1.338	-0.594819	0.03771	.	.	ENSG00000102904	ENST00000388833	T	0.00940	5.52	5.05	1.24	0.21308	.	0.071658	0.52532	D	0.000061	T	0.00666	0.0022	L	0.27053	0.805	0.18873	N	0.999989	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.001	T	0.48917	-0.8992	10	0.17832	T	0.49	-27.3798	2.1471	0.03790	0.2359:0.3242:0.0:0.44	.	159;105	B4DXD0;Q2TAA8	.;TXIP1_HUMAN	T	105	ENSP00000373485:M105T	ENSP00000373485:M105T	M	+	2	0	TSNAXIP1	66415118	0.654000	0.27367	0.906000	0.35671	0.081000	0.17604	1.110000	0.31147	0.775000	0.33450	0.533000	0.62120	ATG	TSNAXIP1	-	NULL	ENSG00000102904		0.493	TSNAXIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TSNAXIP1	HGNC	protein_coding	OTTHUMT00000268876.2	-	0.00	45	0	T	NM_018430		67857617	+1	tier1	-	no_errors	ENST00000388833	ensembl	human	known	74_37	missense	21.21	26	7	SNP	0.342	C
TTC28	23331	genome.wustl.edu	37	22	28388879	28388879	+	Intron	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr22:28388879C>G	ENST00000397906.2	-	19	5618				TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000435348.1_RNA|TTC28-AS1_ENST00000424161.1_RNA|TTC28-AS1_ENST00000430525.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000428584.1_RNA|TTC28-AS1_ENST00000417497.1_RNA|TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000433317.1_RNA|TTC28-AS1_ENST00000430853.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28						mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						GTCCTCTAGGCGTGGCCACAC	0.622																																																	0													56.0	65.0	62.0					22																	28388879		692	1591	2283	SO:0001627	intron_variant	0			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.5477-228G>C	22.37:g.28388879C>G			K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	RNA	SNP	-	NULL	ENST00000397906.2	37	NULL	CCDS46678.1	22																																																																																			TTC28-AS1	-	-	ENSG00000235954		0.622	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28-AS1	HGNC	protein_coding	OTTHUMT00000320930.2	-	0.00	87	0	C	XM_929318		28388879	+1	tier1	-	no_errors	ENST00000428584	ensembl	human	known	74_37	rna	40.00	48	32	SNP	0.000	G
TTF1	7270	genome.wustl.edu	37	9	135277918	135277918	+	Silent	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr9:135277918G>A	ENST00000334270.2	-	2	330	c.291C>T	c.(289-291)gaC>gaT	p.D97D		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	97	N-terminal region (NRD). {ECO:0000250}.				chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.D97D(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		CTGCTTCCTCGTCCACCTCCA	0.373																																																	1	Substitution - coding silent(1)	endometrium(1)											146.0	139.0	142.0					9																	135277918		2203	4300	6503	SO:0001819	synonymous_variant	0			BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.291C>T	9.37:g.135277918G>A			A1L160|Q4VXF3|Q58EY2|Q6P5T5	Silent	SNP	superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.D97	ENST00000334270.2	37	c.291	CCDS6948.1	9																																																																																			TTF1	-	NULL	ENSG00000125482		0.373	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF1	HGNC	protein_coding	OTTHUMT00000054784.2	-	0.00	43	0	G	NM_007344		135277918	-1	tier1	-	no_errors	ENST00000334270	ensembl	human	known	74_37	silent	22.22	35	10	SNP	0.000	A
TTN	7273	genome.wustl.edu	37	2	179427214	179427214	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:179427214A>G	ENST00000591111.1	-	276	78946	c.78722T>C	c.(78721-78723)aTt>aCt	p.I26241T	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.I18942T|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.I18817T|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I27882T|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.I19009T|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.I25314T|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26241	Fibronectin type-III 91. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCCCACTTAATTGTAGCTGT	0.458																																																	0													66.0	65.0	66.0					2																	179427214		1901	4133	6034	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.78722T>C	2.37:g.179427214A>G	ENSP00000465570:p.Ile26241Thr		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.I25314T	ENST00000591111.1	37	c.75941		2	.	.	.	.	.	.	.	.	.	.	A	12.87	2.066633	0.36470	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	5.7	5.7	0.88788	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.52025	0.1709	M	0.63843	1.955	0.46678	D	0.999152	P;P;P;P	0.36354	0.549;0.549;0.549;0.549	B;B;B;B	0.34038	0.174;0.174;0.174;0.174	T	0.58418	-0.7640	9	0.87932	D	0	.	15.9431	0.79773	1.0:0.0:0.0:0.0	.	18817;18942;19009;26241	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	25314;18817;19009;18942;18815	ENSP00000343764:I25314T;ENSP00000434586:I18817T;ENSP00000340554:I19009T;ENSP00000352154:I18942T	ENSP00000340554:I19009T	I	-	2	0	TTN	179135460	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.339000	0.96797	2.167000	0.68274	0.533000	0.62120	ATT	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.458	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	80	0	A	NM_133378		179427214	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	10.99	81	10	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179535885	179535885	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:179535885G>A	ENST00000591111.1	-	152	34342	c.34118C>T	c.(34117-34119)tCt>tTt	p.S11373F	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.S11747F|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.S10446F|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	11373	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATTTTCTCAGATATCTCAGG	0.373																																																	0													109.0	94.0	99.0					2																	179535885		1792	4064	5856	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34118C>T	2.37:g.179535885G>A	ENSP00000465570:p.Ser11373Phe		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S10446F	ENST00000591111.1	37	c.31337		2	.	.	.	.	.	.	.	.	.	.	G	15.17	2.755425	0.49362	.	.	ENSG00000155657	ENST00000342992;ENST00000541862	T	0.63913	-0.07	5.93	5.93	0.95920	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.49338	0.1551	N	0.22421	0.69	0.58432	D	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.45934	-0.9227	9	0.87932	D	0	.	12.8079	0.57624	0.0772:0.0:0.9228:0.0	.	11373	Q8WZ42	TITIN_HUMAN	F	10446;49	ENSP00000343764:S10446F	ENSP00000343764:S10446F	S	-	2	0	TTN	179244130	0.001000	0.12720	0.947000	0.38551	0.979000	0.70002	0.902000	0.28459	2.814000	0.96858	0.563000	0.77884	TCT	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.373	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	85	0	G	NM_133378		179535885	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	16.88	62	13	SNP	0.540	A
TTN	7273	genome.wustl.edu	37	2	179549103	179549103	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:179549103T>A	ENST00000591111.1	-	130	31949	c.31725A>T	c.(31723-31725)aaA>aaT	p.K10575N	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.K10892N|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K9648N|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAACAAGAACTTTTTCTTCCT	0.388																																																	0													112.0	103.0	106.0					2																	179549103		1826	4076	5902	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.31725A>T	2.37:g.179549103T>A	ENSP00000465570:p.Lys10575Asn		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K9648N	ENST00000591111.1	37	c.28944		2	.	.	.	.	.	.	.	.	.	.	T	13.52	2.261925	0.39995	.	.	ENSG00000155657	ENST00000342992	T	0.70282	-0.47	5.65	3.22	0.36961	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.57784	0.2077	N	0.19112	0.55	0.80722	D	1	P	0.35468	0.503	B	0.39299	0.296	T	0.57130	-0.7864	9	0.87932	D	0	.	9.9028	0.41357	0.0:0.2012:0.0:0.7988	.	10575	Q8WZ42	TITIN_HUMAN	N	9648	ENSP00000343764:K9648N	ENSP00000343764:K9648N	K	-	3	2	TTN	179257348	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.490000	0.35573	0.404000	0.25506	-0.314000	0.08810	AAA	TTN	-	pfam_PPAK_motif,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.388	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	51	0	T	NM_133378		179549103	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	13.95	74	12	SNP	1.000	A
P2RX6	9127	genome.wustl.edu	37	22	21368380	21368380	+	5'Flank	SNP	G	G	T	rs370083179|rs559472588	byFrequency	TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr22:21368380G>T	ENST00000413302.2	+	0	0				P2RX6_ENST00000402329.3_5'Flank|P2RX6_ENST00000336296.2_5'Flank|TUBA3FP_ENST00000422086.1_RNA|P2RX6_ENST00000401443.1_5'Flank|P2RX6_ENST00000591411.1_Intron|P2RX6_ENST00000443995.3_5'Flank			O15547	P2RX6_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 6						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|channel activity (GO:0015267)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|purinergic nucleotide receptor activity (GO:0001614)|transmembrane signaling receptor activity (GO:0004888)										TCCGTCTCTAGGTCGGAGTCT	0.682																																																	0																																										SO:0001631	upstream_gene_variant	0				CCDS13788.2, CCDS54504.1	22q11.21	2012-01-17	2008-03-28	2008-03-28	ENSG00000099957	ENSG00000099957		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8538	protein-coding gene	gene with protein product		608077	"""purinergic receptor P2X-like 1, orphan receptor"""	P2RXL1		9242461, 10591208, 8786426	Standard	NM_005446		Approved	P2XM, MGC129625, P2X6	uc010gsu.1	O15547	OTTHUMG00000150689		22.37:g.21368380G>T	Exception_encountered		F6V3D7|Q32MB6|Q58F04|Q6IC33|Q9UL50	RNA	SNP	-	NULL	ENST00000413302.2	37	NULL	CCDS13788.2	22																																																																																			TUBA3FP	-	-	ENSG00000161149		0.682	P2RX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA3FP	HGNC	protein_coding	OTTHUMT00000319625.2	-	0.00	70	0	G	NM_005446		21368380	-1	tier1	-	no_errors	ENST00000292748	ensembl	human	known	74_37	rna	6.15	61	4	SNP	0.001	T
TUBGCP2	10844	genome.wustl.edu	37	10	135097440	135097440	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr10:135097440C>G	ENST00000252936.3	-	13	2130	c.2091G>C	c.(2089-2091)atG>atC	p.M697I	TUBGCP2_ENST00000368562.1_Missense_Mutation_p.M290I|TUBGCP2_ENST00000543663.1_Missense_Mutation_p.M725I|TUBGCP2_ENST00000417178.2_Missense_Mutation_p.M567I|TUBGCP2_ENST00000368563.2_Missense_Mutation_p.M697I			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	697					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		CTTCAAACATCATGTAGTATT	0.478																																																	0													143.0	130.0	135.0					10																	135097440		2203	4300	6503	SO:0001583	missense	0			AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.2091G>C	10.37:g.135097440C>G	ENSP00000252936:p.Met697Ile		B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	pfam_TUBGCP,superfamily_Ocr	p.M725I	ENST00000252936.3	37	c.2175	CCDS7676.1	10	.	.	.	.	.	.	.	.	.	.	C	31	5.098836	0.94197	.	.	ENSG00000130640	ENST00000252936;ENST00000417178;ENST00000368563;ENST00000368562;ENST00000543663	T;T;T;T;T	0.05786	3.39;3.39;3.39;3.39;3.39	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.13329	0.0323	L	0.45228	1.405	0.80722	D	1	D;P;D	0.56746	0.959;0.927;0.977	P;P;P	0.61722	0.835;0.842;0.893	T	0.03364	-1.1044	10	0.02654	T	1	-52.143	17.1769	0.86844	0.0:1.0:0.0:0.0	.	725;725;697	F5H4L0;B7ZKL8;Q9BSJ2	.;.;GCP2_HUMAN	I	697;567;697;290;725	ENSP00000252936:M697I;ENSP00000395666:M567I;ENSP00000357551:M697I;ENSP00000357550:M290I;ENSP00000446093:M725I	ENSP00000252936:M697I	M	-	3	0	TUBGCP2	134947430	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.373000	0.79623	2.468000	0.83385	0.655000	0.94253	ATG	TUBGCP2	-	pfam_TUBGCP	ENSG00000130640		0.478	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP2	HGNC	protein_coding	OTTHUMT00000051148.1	-	0.00	68	0	C			135097440	-1	tier1	-	no_errors	ENST00000543663	ensembl	human	known	74_37	missense	45.83	26	22	SNP	1.000	G
TXK	7294	genome.wustl.edu	37	4	48114415	48114415	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr4:48114415C>T	ENST00000264316.4	-	4	374	c.289G>A	c.(289-291)Gaa>Aaa	p.E97K	RNU6-868P_ENST00000517241.1_RNA|TXK_ENST00000510457.1_5'UTR	NM_003328.2	NP_003319.2	P42681	TXK_HUMAN	TXK tyrosine kinase	97	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cytokine production (GO:0001816)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|T cell receptor signaling pathway (GO:0050852)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|RNA polymerase II regulatory region DNA binding (GO:0001012)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(2)	25						TTACAGGGTTCTCTGGGCAGA	0.488																																																	0													174.0	178.0	177.0					4																	48114415		2203	4300	6503	SO:0001583	missense	0			L27071	CCDS3480.1	4p12	2013-02-14	2003-04-01		ENSG00000074966	ENSG00000074966	2.7.10.1	"""SH2 domain containing"""	12434	protein-coding gene	gene with protein product		600058	"""PTK4 protein tyrosine kinase 4"""	PTK4		7951233, 7528718	Standard	NM_003328		Approved	TKL, PSCTK5, BTKL, RLK	uc003gxx.4	P42681	OTTHUMG00000102065	ENST00000264316.4:c.289G>A	4.37:g.48114415C>T	ENSP00000264316:p.Glu97Lys		Q14220	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.E97K	ENST00000264316.4	37	c.289	CCDS3480.1	4	.	.	.	.	.	.	.	.	.	.	C	16.96	3.265897	0.59540	.	.	ENSG00000074966	ENST00000264316;ENST00000506073	T;T	0.51071	0.72;0.72	5.12	5.12	0.69794	Src homology-3 domain (4);	0.075490	0.51477	D	0.000091	T	0.65964	0.2742	M	0.69523	2.12	0.80722	D	1	D;P	0.76494	0.999;0.624	D;B	0.79108	0.992;0.199	T	0.64433	-0.6409	10	0.40728	T	0.16	.	13.9414	0.64057	0.0:1.0:0.0:0.0	.	97;97	E7EQN8;P42681	.;TXK_HUMAN	K	97	ENSP00000264316:E97K;ENSP00000422798:E97K	ENSP00000264316:E97K	E	-	1	0	TXK	47809172	1.000000	0.71417	1.000000	0.80357	0.631000	0.37964	4.316000	0.59178	2.681000	0.91329	0.563000	0.77884	GAA	TXK	-	pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000074966		0.488	TXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXK	HGNC	protein_coding	OTTHUMT00000219869.7	-	0.00	56	0	C	NM_003328		48114415	-1	tier1	-	no_errors	ENST00000264316	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
UBE2NL	389898	genome.wustl.edu	37	X	142967287	142967287	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chrX:142967287G>A	ENST00000370494.1	+	1	115	c.85G>A	c.(85-87)Gaa>Aaa	p.E29K		NM_001012989.1	NP_001013007.1	Q5JXB2	UE2NL_HUMAN	ubiquitin-conjugating enzyme E2N-like (gene/pseudogene)	29						extracellular vesicular exosome (GO:0070062)	acid-amino acid ligase activity (GO:0016881)			breast(1)|endometrium(1)|large_intestine(8)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(192;6.56e-05)					AGAACCAGATGAAAGCAACGC	0.502																																																	0													81.0	79.0	80.0					X																	142967287		2203	4300	6503	SO:0001583	missense	0					Xq27.3	2014-06-11	2014-06-11		ENSG00000102069			"""Ubiquitin-conjugating enzymes E2"""	31710	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2N-like"""			20736409	Standard	NM_001012989		Approved		uc004fca.3	Q5JXB2	OTTHUMG00000022586	ENST00000370494.1:c.85G>A	X.37:g.142967287G>A	ENSP00000359525:p.Glu29Lys		E9KL27	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.E29K	ENST00000370494.1	37	c.85	CCDS35420.1	X	.	.	.	.	.	.	.	.	.	.	G	8.377	0.836752	0.16891	.	.	ENSG00000102069	ENST00000370494	T	0.73469	-0.75	1.1	1.1	0.20463	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.44097	U	0.000500	T	0.69214	0.3086	M	0.64170	1.965	0.80722	D	1	B	0.18610	0.029	B	0.30572	0.117	T	0.67027	-0.5774	10	0.54805	T	0.06	0.8666	7.8005	0.29172	0.0:0.0:1.0:0.0	.	29	Q5JXB2	UE2NL_HUMAN	K	29	ENSP00000359525:E29K	ENSP00000359525:E29K	E	+	1	0	UBE2NL	142794953	1.000000	0.71417	0.317000	0.25265	0.005000	0.04900	6.641000	0.74324	0.849000	0.35215	0.190000	0.17370	GAA	UBE2NL	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000102069		0.502	UBE2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2NL	HGNC	protein_coding	OTTHUMT00000058624.1	-	0.00	38	0	G	NM_001012989		142967287	+1	tier1	-	no_errors	ENST00000370494	ensembl	human	known	74_37	missense	45.00	22	18	SNP	1.000	A
UBR3	130507	genome.wustl.edu	37	2	170735085	170735085	+	Splice_Site	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:170735085G>T	ENST00000272793.5	+	5	1088		c.e5+1		UBR3_ENST00000418381.1_Splice_Site			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)						embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						TTCAGATGAGGTGAGATTTAA	0.303																																																	0													100.0	84.0	89.0					2																	170735085		692	1591	2283	SO:0001630	splice_region_variant	0			AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.1038+1G>T	2.37:g.170735085G>T			B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Splice_Site	SNP	-	e5+1	ENST00000272793.5	37	c.1038+1		2	.	.	.	.	.	.	.	.	.	.	G	21.1	4.090167	0.76756	.	.	ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5035	0.95105	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UBR3	170443331	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	6.355000	0.73041	2.674000	0.91012	0.655000	0.94253	.	UBR3	-	-	ENSG00000144357		0.303	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	UBR3	HGNC	protein_coding	OTTHUMT00000255290.2	-	0.00	81	0	G	NM_172070	Intron	170735085	+1	tier1	-	no_errors	ENST00000272793	ensembl	human	known	74_37	splice_site	6.52	86	6	SNP	1.000	T
USP3	9960	genome.wustl.edu	37	15	63866317	63866317	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr15:63866317T>A	ENST00000380324.3	+	10	1110	c.981T>A	c.(979-981)tgT>tgA	p.C327*	USP3-AS1_ENST00000559357.1_RNA|USP3-AS1_ENST00000559861.1_RNA|USP3_ENST00000558285.1_Nonsense_Mutation_p.C310*|USP3_ENST00000268049.7_Nonsense_Mutation_p.C305*|USP3-AS1_ENST00000560350.1_RNA|USP3_ENST00000536001.1_3'UTR|USP3_ENST00000559711.1_Nonsense_Mutation_p.C238*|USP3_ENST00000539772.1_Nonsense_Mutation_p.C78*|USP3_ENST00000540797.1_Nonsense_Mutation_p.C283*	NM_006537.3	NP_006528.2	Q9Y6I4	UBP3_HUMAN	ubiquitin specific peptidase 3	327	USP.				DNA repair (GO:0006281)|histone deubiquitination (GO:0016578)|mitotic cell cycle (GO:0000278)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear chromatin (GO:0000790)	histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(7)|lung(4)	14				GBM - Glioblastoma multiforme(80;0.0187)		GCCTCATATGTGGGACAGAAT	0.333																																																	0													102.0	99.0	100.0					15																	63866317		2203	4300	6503	SO:0001587	stop_gained	0			AF073344	CCDS32265.1, CCDS58370.1	15q22.3	2008-04-11	2005-08-08			ENSG00000140455		"""Ubiquitin-specific peptidases"""	12626	protein-coding gene	gene with protein product		604728	"""ubiquitin specific protease 3"""			12838346	Standard	NM_006537		Approved		uc002amf.4	Q9Y6I4		ENST00000380324.3:c.981T>A	15.37:g.63866317T>A	ENSP00000369681:p.Cys327*		B4DVU5|F5H1A6|Q8WVD0	Nonsense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.C327*	ENST00000380324.3	37	c.981	CCDS32265.1	15	.	.	.	.	.	.	.	.	.	.	T	28.2	4.903411	0.92035	.	.	ENSG00000140455	ENST00000540797;ENST00000380324;ENST00000268049;ENST00000539772;ENST00000536848;ENST00000538686	.	.	.	6.07	3.8	0.43715	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.2174	0.37355	0.0:0.2016:0.0:0.7984	.	.	.	.	X	283;327;305;78;242;158	.	ENSP00000268049:C305X	C	+	3	2	USP3	61653370	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.851000	0.48302	0.552000	0.29026	0.533000	0.62120	TGT	USP3	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000140455		0.333	USP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP3	HGNC	protein_coding	OTTHUMT00000417773.1	-	0.00	62	0	T			63866317	+1	tier1	-	no_errors	ENST00000380324	ensembl	human	known	74_37	nonsense	8.89	41	4	SNP	1.000	A
VPS72	6944	genome.wustl.edu	37	1	151156882	151156882	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:151156882C>T	ENST00000354473.4	-	4	509	c.473G>A	c.(472-474)cGa>cAa	p.R158Q	VPS72_ENST00000496809.1_5'UTR			Q15906	VPS72_HUMAN	vacuolar protein sorting 72 homolog (S. cerevisiae)	158					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGGCCCCTTTCGCCGTCTTGA	0.562																																					Pancreas(109;1131 2287 3209 24201)												0													95.0	99.0	97.0					1																	151156882		2203	4300	6503	SO:0001583	missense	0			D43642	CCDS989.1, CCDS59201.1	1q21	2008-02-05	2006-12-19	2005-09-08	ENSG00000163159	ENSG00000163159			11644	protein-coding gene	gene with protein product		600607	"""transcription factor-like 1"", ""vacuolar protein sorting 72 (yeast)"""	TCFL1		7702631	Standard	NM_001271087		Approved	YL-1, YL1, Swc2	uc001exe.2	Q15906	OTTHUMG00000012345	ENST00000354473.4:c.473G>A	1.37:g.151156882C>T	ENSP00000346464:p.Arg158Gln		A6NLK9|A6PW55|Q53GJ2|Q5U0R4	Missense_Mutation	SNP	pfam_YL1,pfam_YL1_C	p.R158Q	ENST00000354473.4	37	c.473	CCDS59201.1	1	.	.	.	.	.	.	.	.	.	.	.	17.56	3.421167	0.62622	.	.	ENSG00000163159	ENST00000368892;ENST00000354473	.	.	.	6.16	5.25	0.73442	.	0.063404	0.64402	D	0.000012	T	0.29491	0.0735	L	0.53671	1.685	0.52501	D	0.99995	B	0.30511	0.282	B	0.16289	0.015	T	0.32268	-0.9913	9	0.40728	T	0.16	-0.3238	6.0739	0.19905	0.0:0.6726:0.1656:0.1619	.	158	Q15906	VPS72_HUMAN	Q	158	.	ENSP00000346464:R158Q	R	-	2	0	VPS72	149423506	0.999000	0.42202	0.967000	0.41034	0.716000	0.41182	4.068000	0.57534	1.612000	0.50221	0.650000	0.86243	CGA	VPS72	-	pfam_YL1	ENSG00000163159		0.562	VPS72-002	NOVEL	mRNA_start_NF|basic|exp_conf|CCDS	protein_coding	VPS72	HGNC	protein_coding	OTTHUMT00000034394.3	-	0.00	45	0	C	NM_005997		151156882	-1	tier1	-	no_errors	ENST00000368892	ensembl	human	known	74_37	missense	39.19	44	29	SNP	0.988	T
VSTM2A	222008	genome.wustl.edu	37	7	54617688	54617688	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr7:54617688T>A	ENST00000407838.3	+	4	865	c.459T>A	c.(457-459)caT>caA	p.H153Q	VSTM2A_ENST00000402613.3_Missense_Mutation_p.H153Q|VSTM2A_ENST00000302287.3_Missense_Mutation_p.H153Q|VSTM2A_ENST00000404951.1_Missense_Mutation_p.H153Q|VSTM2A_ENST00000402026.2_Missense_Mutation_p.H152Q|VSTM2A_ENST00000498834.1_3'UTR	NM_182546.2	NP_872352.2	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2A	153						extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(12)|prostate(1)	16			STAD - Stomach adenocarcinoma(5;0.0525)			CCAACAGCCATGCCCGCAGAA	0.572																																																	0													58.0	56.0	57.0					7																	54617688		2203	4300	6503	SO:0001583	missense	0			BC028404	CCDS5512.2, CCDS75604.1	7p11.2	2013-01-11	2007-08-10	2007-08-10	ENSG00000170419	ENSG00000170419		"""Immunoglobulin superfamily / V-set domain containing"""	28499	protein-coding gene	gene with protein product			"""V-set and transmembrane domain containing 2"""	VSTM2		12477932	Standard	XM_006715663		Approved	MGC33530	uc010kzf.3	Q8TAG5	OTTHUMG00000129271	ENST00000407838.3:c.459T>A	7.37:g.54617688T>A	ENSP00000384967:p.His153Gln		A4D2E9|B5MC94	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.H152Q	ENST00000407838.3	37	c.456	CCDS5512.2	7	.	.	.	.	.	.	.	.	.	.	T	16.30	3.084119	0.55861	.	.	ENSG00000170419	ENST00000302287;ENST00000407838;ENST00000404951;ENST00000402026;ENST00000402613	T;T;T;T;T	0.44083	0.93;0.95;0.93;0.93;0.94	5.06	-8.27	0.01017	.	0.111137	0.64402	D	0.000008	T	0.49795	0.1578	M	0.64997	1.995	0.20638	N	0.999876	D;D;D	0.89917	0.999;1.0;0.998	D;D;D	0.83275	0.991;0.996;0.986	T	0.56673	-0.7940	10	0.14656	T	0.56	-28.5341	15.0006	0.71469	0.0:0.7338:0.1055:0.1607	.	153;153;153	Q8TAG5;Q8TAG5-2;B5MCX6	VTM2A_HUMAN;.;.	Q	153;153;153;152;153	ENSP00000303108:H153Q;ENSP00000384967:H153Q;ENSP00000384701:H153Q;ENSP00000385933:H152Q;ENSP00000384103:H153Q	ENSP00000303108:H153Q	H	+	3	2	VSTM2A	54585182	0.194000	0.23325	0.023000	0.16930	0.981000	0.71138	-0.295000	0.08298	-1.827000	0.01204	-0.408000	0.06270	CAT	VSTM2A	-	NULL	ENSG00000170419		0.572	VSTM2A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VSTM2A	HGNC	protein_coding	OTTHUMT00000318694.1	-	0.00	56	0	T	NM_182546		54617688	+1	tier1	-	no_errors	ENST00000402026	ensembl	human	known	74_37	missense	13.41	71	11	SNP	0.180	A
WDPCP	51057	genome.wustl.edu	37	2	63631537	63631537	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:63631537G>C	ENST00000272321.7	-	10	1608	c.1081C>G	c.(1081-1083)Cta>Gta	p.L361V	WDPCP_ENST00000398544.3_Missense_Mutation_p.L202V|WDPCP_ENST00000409562.3_Missense_Mutation_p.L361V|WDPCP_ENST00000409120.1_Missense_Mutation_p.L169V|WDPCP_ENST00000409199.1_Missense_Mutation_p.L169V|WDPCP_ENST00000409835.1_5'UTR	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector	361					auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						TAAAGAATTAGCGAAGAATCT	0.443																																																	0													118.0	112.0	114.0					2																	63631537		1925	4146	6071	SO:0001583	missense	0				CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.1081C>G	2.37:g.63631537G>C	ENSP00000272321:p.Leu361Val		Q53RW4|Q7Z2Z3	Missense_Mutation	SNP	pfam_DUF3312,superfamily_WD40_repeat_dom	p.L361V	ENST00000272321.7	37	c.1081	CCDS42688.1	2	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.063954	0.00386	.	.	ENSG00000143951	ENST00000272321;ENST00000409199;ENST00000409120;ENST00000398544;ENST00000409562	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	5.4	-0.99	0.10238	WD40/YVTN repeat-like-containing domain (1);	0.662303	0.14866	N	0.293831	T	0.13072	0.0317	N	0.02916	-0.46	0.09310	N	0.999999	B;B;B;B	0.13145	0.004;0.0;0.007;0.003	B;B;B;B	0.21708	0.016;0.001;0.036;0.007	T	0.27020	-1.0086	10	0.08381	T	0.77	-0.0876	2.7886	0.05381	0.0966:0.3333:0.3021:0.2679	.	169;361;361;202	E9PFG9;O95876-2;O95876;O95876-3	.;.;FRITZ_HUMAN;.	V	361;169;169;202;361	ENSP00000272321:L361V;ENSP00000386592:L169V;ENSP00000386769:L169V;ENSP00000381552:L202V;ENSP00000387222:L361V	ENSP00000272321:L361V	L	-	1	2	WDPCP	63485041	0.000000	0.05858	0.963000	0.40424	0.417000	0.31264	-2.689000	0.00832	-0.154000	0.11118	-0.340000	0.08031	CTA	WDPCP	-	pfam_DUF3312,superfamily_WD40_repeat_dom	ENSG00000143951		0.443	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WDPCP	HGNC	protein_coding	OTTHUMT00000326820.1	-	0.00	53	0	G	NM_015910		63631537	-1	tier1	-	no_errors	ENST00000272321	ensembl	human	known	74_37	missense	21.95	32	9	SNP	0.046	C
WDR31	114987	genome.wustl.edu	37	9	116082779	116082779	+	Splice_Site	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr9:116082779C>A	ENST00000374193.4	-	9	885		c.e9-1		WDR31_ENST00000374195.3_Splice_Site|WDR31_ENST00000461942.1_Splice_Site|WDR31_ENST00000341761.4_Splice_Site	NM_001012361.2|NM_145241.3	NP_001012361.1|NP_660284.1	Q8NA23	WDR31_HUMAN	WD repeat domain 31											NS(1)|large_intestine(1)|lung(2)|prostate(2)	6						GTCCCATAATCTGAAAGAGAT	0.458																																																	0													66.0	61.0	63.0					9																	116082779		2203	4300	6503	SO:0001630	splice_region_variant	0			BC012352	CCDS6792.1, CCDS35110.1	9q33.1	2013-01-09			ENSG00000148225	ENSG00000148225		"""WD repeat domain containing"""	21421	protein-coding gene	gene with protein product	"""similar to spermatid WD-repeat protein"""						Standard	NM_145241		Approved	FLJ35921	uc004bhb.3	Q8NA23	OTTHUMG00000020525	ENST00000374193.4:c.639-1G>T	9.37:g.116082779C>A			Q5W0T9|Q96EG8	Splice_Site	SNP	-	e7-1	ENST00000374193.4	37	c.639-1	CCDS35110.1	9	.	.	.	.	.	.	.	.	.	.	C	25.7	4.669665	0.88348	.	.	ENSG00000148225	ENST00000374193;ENST00000374195;ENST00000341761	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1813	0.93625	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	WDR31	115122600	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.843000	0.75384	2.771000	0.95319	0.563000	0.77884	.	WDR31	-	-	ENSG00000148225		0.458	WDR31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR31	HGNC	protein_coding	OTTHUMT00000053734.2	-	0.00	50	0	C	NM_145241	Intron	116082779	-1	tier1	-	no_errors	ENST00000374193	ensembl	human	known	74_37	splice_site	38.24	21	13	SNP	1.000	A
WDR92	116143	genome.wustl.edu	37	2	68384441	68384441	+	Silent	SNP	G	G	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr2:68384441G>T	ENST00000295121.6	-	1	251	c.135C>A	c.(133-135)gtC>gtA	p.V45V	WDR92_ENST00000492039.2_Intron|WDR92_ENST00000409164.1_Silent_p.V45V|WDR92_ENST00000406245.2_Intron|RP11-474G23.1_ENST00000406334.3_3'UTR|PNO1_ENST00000263657.2_5'Flank	NM_138458.3	NP_612467.1	Q96MX6	WDR92_HUMAN	WD repeat domain 92	45					apoptotic process (GO:0006915)|histone lysine methylation (GO:0034968)		methylated histone binding (GO:0035064)			endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|stomach(1)	12						ACAGCTGAATGACGCCGGTGC	0.607																																																	0													69.0	67.0	68.0					2																	68384441		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056303	CCDS1884.1, CCDS58712.1	2p14	2013-01-09			ENSG00000243667	ENSG00000243667		"""WD repeat domain containing"""	25176	protein-coding gene	gene with protein product		610729				16487927	Standard	NM_138458		Approved	FLJ31741, Monad	uc002see.2	Q96MX6	OTTHUMG00000152561	ENST00000295121.6:c.135C>A	2.37:g.68384441G>T			Q96CR6	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V45	ENST00000295121.6	37	c.135	CCDS1884.1	2																																																																																			WDR92	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom	ENSG00000243667		0.607	WDR92-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR92	HGNC	protein_coding	OTTHUMT00000251754.2	-	0.00	48	0	G	NM_138458		68384441	-1	tier1	-	no_errors	ENST00000295121	ensembl	human	known	74_37	silent	11.36	39	5	SNP	1.000	T
WDTC1	23038	genome.wustl.edu	37	1	27621107	27621108	+	Frame_Shift_Ins	INS	-	-	G	rs145339479		TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr1:27621107_27621108insG	ENST00000319394.3	+	9	1395_1396	c.860_861insG	c.(859-864)atggggfs	p.MG287fs	WDTC1_ENST00000361771.3_Frame_Shift_Ins_p.MG287fs	NM_001276252.1|NM_015023.3	NP_001263181.1|NP_055838.2	Q8N5D0	WDTC1_HUMAN	WD and tetratricopeptide repeats 1	287					cellular chemical homeostasis (GO:0055082)|cellular response to insulin stimulus (GO:0032869)|glucose metabolic process (GO:0006006)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell size (GO:0008361)	cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	21		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)		CTAGTCAACATGGGGGGGGAAC	0.54																																																	0										21,4245		0,21,2112						5.7	1.0			69	14,8240		0,14,4113	no	frameshift	WDTC1	NM_015023.3		0,35,6225	A1A1,A1R,RR		0.1696,0.4923,0.2796				35,12485				SO:0001589	frameshift_variant	0			AK023778	CCDS296.1, CCDS60044.1	1p35.3	2013-01-11			ENSG00000142784	ENSG00000142784		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29175	protein-coding gene	gene with protein product	"""adipose homolog (Drosophila)"", ""DDB1 and CUL4 associated factor 9"""					12717455, 19238144	Standard	NM_015023		Approved	KIAA1037, ADP, DCAF9	uc009vst.3	Q8N5D0	OTTHUMG00000004273	ENST00000319394.3:c.868dupG	1.37:g.27621115_27621115dupG	ENSP00000317971:p.Met287fs		D3DPL5|Q5SSC5|Q9NV87|Q9UPW4	Frame_Shift_Ins	INS	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,smart_TPR_repeat,pfscan_TPR-contain_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E290fs	ENST00000319394.3	37	c.860_861		1																																																																																			WDTC1	-	superfamily_WD40_repeat_dom	ENSG00000142784		0.540	WDTC1-201	KNOWN	basic|appris_candidate_longest	protein_coding	WDTC1	HGNC	protein_coding			0.00	39	0	-	NM_015023		27621108	+1	tier1		no_errors	ENST00000319394	ensembl	human	known	74_37	frame_shift_ins	18.52	22	5	INS	1.000:1.000	G
XKR4	114786	genome.wustl.edu	37	8	56436615	56436615	+	Silent	SNP	C	C	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr8:56436615C>A	ENST00000327381.6	+	3	1882	c.1782C>A	c.(1780-1782)gtC>gtA	p.V594V		NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	594						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			AAGAATCAGTCATTAAAATTG	0.488																																																	0													105.0	102.0	103.0					8																	56436615		2203	4300	6503	SO:0001819	synonymous_variant	0			AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1782C>A	8.37:g.56436615C>A			Q96PZ8	Silent	SNP	pfam_Transport_prot_XK	p.V594	ENST00000327381.6	37	c.1782	CCDS34893.1	8																																																																																			XKR4	-	NULL	ENSG00000206579		0.488	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR4	HGNC	protein_coding	OTTHUMT00000378129.2	-	0.00	59	0	C	NM_052898		56436615	+1	tier1	-	no_errors	ENST00000327381	ensembl	human	known	74_37	silent	48.72	20	19	SNP	1.000	A
ZBBX	79740	genome.wustl.edu	37	3	166958584	166958584	+	Silent	SNP	A	A	C			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr3:166958584A>C	ENST00000392766.2	-	21	2740	c.2400T>G	c.(2398-2400)acT>acG	p.T800T	ZBBX_ENST00000392764.1_Silent_p.T771T|ZBBX_ENST00000392767.2_Silent_p.T800T|ZBBX_ENST00000307529.5_Silent_p.T839T|ZBBX_ENST00000455345.2_Silent_p.T839T	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	800						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						ATAATCTTTAAGTACTCTTTG	0.388																																																	0													162.0	153.0	156.0					3																	166958584		1881	4105	5986	SO:0001819	synonymous_variant	0			AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.2400T>G	3.37:g.166958584A>C			A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Silent	SNP	pfam_Znf_B-box	p.T839	ENST00000392766.2	37	c.2517	CCDS3199.2	3																																																																																			ZBBX	-	NULL	ENSG00000169064		0.388	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZBBX	HGNC	protein_coding	OTTHUMT00000257657.3	-	0.00	71	0	A	NM_024687		166958584	-1	tier1	-	no_errors	ENST00000307529	ensembl	human	known	74_37	silent	41.86	25	18	SNP	0.001	C
ZFHX4	79776	genome.wustl.edu	37	8	77763904	77763904	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr8:77763904G>A	ENST00000521891.2	+	10	5195	c.4747G>A	c.(4747-4749)Gaa>Aaa	p.E1583K	ZFHX4_ENST00000050961.6_Missense_Mutation_p.E1538K|ZFHX4_ENST00000518282.1_Missense_Mutation_p.E1557K|ZFHX4_ENST00000455469.2_Missense_Mutation_p.E1538K	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1538					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGTCCCACAAGAAACCAACAG	0.428										HNSCC(33;0.089)																																							0													50.0	47.0	48.0					8																	77763904		1939	4170	6109	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.4747G>A	8.37:g.77763904G>A	ENSP00000430497:p.Glu1583Lys		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.E1583K	ENST00000521891.2	37	c.4747	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	G	15.49	2.849593	0.51270	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.50001	0.76;0.81;0.78;0.77	4.39	4.39	0.52855	.	0.000000	0.45606	U	0.000344	T	0.41766	0.1173	L	0.52573	1.65	0.80722	D	1	B;B;B	0.29301	0.155;0.241;0.241	B;B;B	0.29942	0.051;0.109;0.109	T	0.30679	-0.9970	10	0.08599	T	0.76	.	17.4993	0.87727	0.0:0.0:1.0:0.0	.	1538;1538;1583	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	K	1583;1583;1538;1538;1557	ENSP00000430497:E1583K;ENSP00000399605:E1538K;ENSP00000050961:E1538K;ENSP00000430848:E1557K	ENSP00000050961:E1538K	E	+	1	0	ZFHX4	77926459	1.000000	0.71417	0.996000	0.52242	0.827000	0.46813	9.601000	0.98297	2.438000	0.82558	0.555000	0.69702	GAA	ZFHX4	-	NULL	ENSG00000091656		0.428	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	-	0.00	23	0	G	NM_024721		77763904	+1	tier1	-	no_errors	ENST00000521891	ensembl	human	known	74_37	missense	68.18	7	15	SNP	1.000	A
ZNF101	94039	genome.wustl.edu	37	19	19790986	19790986	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:19790986T>G	ENST00000592502.1	+	4	1298	c.1188T>G	c.(1186-1188)tgT>tgG	p.C396W	ZNF101_ENST00000415784.2_Missense_Mutation_p.C276W			Q8IZC7	ZN101_HUMAN	zinc finger protein 101	396					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)	17						CCTTTGATTGTAAACAGTGTG	0.448																																																	0													75.0	71.0	72.0					19																	19790986		2203	4300	6503	SO:0001583	missense	0			AK097169	CCDS32971.1	19p13.11	2013-01-08	2004-02-10		ENSG00000181896	ENSG00000181896		"""Zinc fingers, C2H2-type"", ""-"""	12881	protein-coding gene	gene with protein product		603983	"""zinc finger protein 101 (Y2)"""			11441184	Standard	XM_005260165		Approved	HZF12, DKFZp570I0164	uc002nni.2	Q8IZC7	OTTHUMG00000167736	ENST00000592502.1:c.1188T>G	19.37:g.19790986T>G	ENSP00000468049:p.Cys396Trp		C9JU83|Q0VDG9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C396W	ENST00000592502.1	37	c.1188	CCDS32971.1	19	.	.	.	.	.	.	.	.	.	.	T	10.08	1.252924	0.22965	.	.	ENSG00000181896	ENST00000318110;ENST00000415440;ENST00000415784	D;D	0.85258	-1.96;-1.96	0.235	0.235	0.15431	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94994	0.8380	H	0.99789	4.78	0.19775	N	0.99996	D	0.89917	1.0	D	0.97110	1.0	D	0.84440	0.0582	8	.	.	.	.	4.8392	0.13481	0.0:2.0E-4:0.0:0.9998	.	396	Q8IZC7	ZN101_HUMAN	W	396;396;276	ENSP00000319716:C396W;ENSP00000400952:C276W	.	C	+	3	2	ZNF101	19651986	0.000000	0.05858	0.190000	0.23270	0.190000	0.23558	-0.340000	0.07821	0.263000	0.21812	0.260000	0.18958	TGT	ZNF101	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181896		0.448	ZNF101-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF101	HGNC	protein_coding	OTTHUMT00000460559.1	-	0.00	44	0	T	NM_033204		19790986	+1	tier1	-	no_errors	ENST00000318110	ensembl	human	known	74_37	missense	71.05	11	27	SNP	0.034	G
ZNF17	7565	genome.wustl.edu	37	19	57932734	57932734	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:57932734T>G	ENST00000601808.1	+	3	2087	c.1874T>G	c.(1873-1875)cTc>cGc	p.L625R	ZNF17_ENST00000307658.7_Missense_Mutation_p.L627R|AC004076.7_ENST00000597410.1_Intron	NM_006959.2	NP_008890.2	P17021	ZNF17_HUMAN	zinc finger protein 17	625					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		AACTCCAGCCTCATTAAACAT	0.418																																					Melanoma(149;1637 1853 29914 42869 44988)												0													51.0	55.0	53.0					19																	57932734		2196	4299	6495	SO:0001583	missense	0			X52341	CCDS42636.1	19q13.43	2013-01-08	2006-05-10			ENSG00000186272		"""Zinc fingers, C2H2-type"", ""-"""	12958	protein-coding gene	gene with protein product			"""zinc finger protein 17 (HPF3, KOX 10)"""			2115127, 2014798	Standard	NM_006959		Approved	HPF3, KOX10, KIAA1947, FLJ40864, FLJ46058, FLJ46615	uc002qoo.1	P17021		ENST00000601808.1:c.1874T>G	19.37:g.57932734T>G	ENSP00000471905:p.Leu625Arg		B3KXU2|B3KY20|Q8N7M1|Q8N893|Q8TF54	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L625R	ENST00000601808.1	37	c.1874	CCDS42636.1	19	.	.	.	.	.	.	.	.	.	.	T	13.29	2.194267	0.38806	.	.	ENSG00000186272	ENST00000307658	.	.	.	2.57	0.339	0.15979	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.68979	0.3060	M	0.92219	3.285	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.972	T	0.56288	-0.8004	8	0.87932	D	0	.	3.2203	0.06713	0.1793:0.2148:0.0:0.6059	.	627;625	P17021-2;P17021	.;ZNF17_HUMAN	R	625	.	ENSP00000302455:L625R	L	+	2	0	ZNF17	62624546	0.000000	0.05858	0.001000	0.08648	0.197000	0.23852	0.171000	0.16685	-0.125000	0.11703	0.460000	0.39030	CTC	ZNF17	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186272		0.418	ZNF17-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF17	HGNC	protein_coding	OTTHUMT00000466384.1	-	0.00	83	0	T	NM_006959		57932734	+1	tier1	-	no_errors	ENST00000601808	ensembl	human	known	74_37	missense	8.70	62	6	SNP	0.033	G
ZNF185	7739	genome.wustl.edu	37	X	152087569	152087569	+	Silent	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chrX:152087569C>T	ENST00000370268.4	+	7	511	c.474C>T	c.(472-474)acC>acT	p.T158T	ZNF185_ENST00000535861.1_Silent_p.T158T|ZNF185_ENST00000324823.6_Silent_p.T23T|ZNF185_ENST00000318529.8_Silent_p.T23T|ZNF185_ENST00000539731.1_Silent_p.T158T|ZNF185_ENST00000318504.7_Silent_p.T158T|ZNF185_ENST00000370270.2_Silent_p.T158T|ZNF185_ENST00000449285.2_Silent_p.T158T			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	158						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					CAGGGGACACCgaggaggagg	0.592													C|||	1	0.000264901	0.0	0.0	3775	,	,		13310	0.001		0.0	False		,,,				2504	0.0																0													55.0	53.0	54.0					X																	152087569		2032	4155	6187	SO:0001819	synonymous_variant	0			AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.474C>T	X.37:g.152087569C>T			A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	Silent	SNP	smart_Znf_LIM,pfscan_Znf_LIM	p.T158	ENST00000370268.4	37	c.474	CCDS48184.1	X	.	.	.	.	.	.	.	.	.	.	C	6.682	0.494419	0.12702	.	.	ENSG00000147394	ENST00000426821	.	.	.	4.83	-6.96	0.01622	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.243	1.1914	0.01865	0.2175:0.35:0.2613:0.1711	.	.	.	.	X	9	.	.	R	+	1	2	ZNF185	151838225	0.000000	0.05858	0.000000	0.03702	0.163000	0.22366	-2.463000	0.00996	-1.259000	0.02468	-0.395000	0.06472	CGA	ZNF185	-	NULL	ENSG00000147394		0.592	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF185	HGNC	protein_coding	OTTHUMT00000377480.1	-	0.00	19	0	C	NM_007150		152087569	+1	tier1	-	no_errors	ENST00000370270	ensembl	human	known	74_37	silent	64.71	5	11	SNP	0.000	T
ZNF345	25850	genome.wustl.edu	37	19	37368711	37368711	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:37368711T>G	ENST00000529555.1	+	2	1767	c.979T>G	c.(979-981)Tca>Gca	p.S327A	ZNF345_ENST00000432005.2_Intron|ZNF345_ENST00000420450.1_Missense_Mutation_p.S327A|ZNF345_ENST00000589046.1_Missense_Mutation_p.S327A|ZNF345_ENST00000526123.1_Intron			Q14585	ZN345_HUMAN	zinc finger protein 345	327					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|ovary(2)|prostate(1)	24	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TAGAAGTGGTTCAAAACTTAT	0.408																																																	0													75.0	81.0	79.0					19																	37368711		2203	4300	6503	SO:0001583	missense	0			X78933	CCDS12497.1	19q13.12	2013-01-08			ENSG00000251247	ENSG00000251247		"""Zinc fingers, C2H2-type"""	16367	protein-coding gene	gene with protein product						7865130	Standard	NM_003419		Approved	HZF10	uc002oey.4	Q14585	OTTHUMG00000048162	ENST00000529555.1:c.979T>G	19.37:g.37368711T>G	ENSP00000431202:p.Ser327Ala			Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S327A	ENST00000529555.1	37	c.979	CCDS12497.1	19	.	.	.	.	.	.	.	.	.	.	T	8.434	0.849260	0.17034	.	.	ENSG00000251247	ENST00000420450;ENST00000529555;ENST00000344705	T;T	0.01560	4.77;4.77	3.8	2.68	0.31781	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02083	0.0065	L	0.48642	1.525	0.09310	N	1	B	0.18741	0.03	B	0.12837	0.008	T	0.38373	-0.9664	9	0.42905	T	0.14	.	5.8793	0.18846	0.2345:0.0:0.0:0.7655	.	327	Q14585	ZN345_HUMAN	A	327;327;91	ENSP00000431216:S327A;ENSP00000431202:S327A	ENSP00000442320:S91A	S	+	1	0	ZNF345	42060551	0.000000	0.05858	1.000000	0.80357	0.990000	0.78478	-0.112000	0.10791	1.699000	0.51192	0.379000	0.24179	TCA	ZNF345	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000251247		0.408	ZNF345-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF345	HGNC	protein_coding	OTTHUMT00000388258.1	-	0.00	44	0	T			37368711	+1	tier1	-	no_errors	ENST00000420450	ensembl	human	known	74_37	missense	15.49	60	11	SNP	0.071	G
ZNF320	162967	genome.wustl.edu	37	19	53384008	53384008	+	Silent	SNP	A	A	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:53384008A>T	ENST00000595635.1	-	8	1872	c.1371T>A	c.(1369-1371)atT>atA	p.I457I	ZNF320_ENST00000391781.2_Silent_p.I457I|ZNF320_ENST00000597909.1_Intron|ZNF320_ENST00000600930.1_Intron	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320	457					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		TCTGATGCCTAATAAGGTGTG	0.413																																																	0													84.0	73.0	76.0					19																	53384008		2203	4300	6503	SO:0001819	synonymous_variant	0			AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.1371T>A	19.37:g.53384008A>T			Q8NDR6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I457	ENST00000595635.1	37	c.1371	CCDS33095.1	19																																																																																			ZNF320	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000182986		0.413	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF320	HGNC	protein_coding	OTTHUMT00000463771.1	-	0.00	73	0	A	NM_207333		53384008	-1	tier1	-	no_errors	ENST00000391781	ensembl	human	known	74_37	silent	67.61	23	48	SNP	0.000	T
ZNF492	57615	genome.wustl.edu	37	19	22836737	22836737	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:22836737A>G	ENST00000456783.2	+	3	294	c.50A>G	c.(49-51)aAg>aGg	p.K17R		NM_020855.2	NP_065906.1	Q9P255	ZN492_HUMAN	zinc finger protein 492	17	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				GCTGCCTCTAAGCCAGACCTG	0.403																																																	0													52.0	63.0	59.0					19																	22836737		2188	4276	6464	SO:0001583	missense	0			AB040906	CCDS46032.1	19p13.11	2013-01-08				ENSG00000229676		"""Zinc fingers, C2H2-type"""	23707	protein-coding gene	gene with protein product			"""zinc finger protein 115 (Y20)"""	ZNF115		10819331	Standard	NM_020855		Approved	KIAA1473	uc002nqw.3	Q9P255		ENST00000456783.2:c.50A>G	19.37:g.22836737A>G	ENSP00000413660:p.Lys17Arg		Q08EI7|Q08EI8	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K17R	ENST00000456783.2	37	c.50	CCDS46032.1	19	.	.	.	.	.	.	.	.	.	.	.	13.91	2.377066	0.42105	.	.	ENSG00000229676	ENST00000456783	T	0.00902	5.56	0.458	0.458	0.16670	Krueppel-associated box (3);	.	.	.	.	T	0.02970	0.0088	M	0.83118	2.625	0.09310	N	1	D	0.58268	0.982	P	0.52909	0.713	T	0.33497	-0.9866	8	0.66056	D	0.02	.	.	.	.	.	17	Q9P255	ZN492_HUMAN	R	17	ENSP00000413660:K17R	ENSP00000413660:K17R	K	+	2	0	ZNF492	22628577	0.971000	0.33674	0.381000	0.26106	0.364000	0.29643	1.268000	0.33062	0.407000	0.25591	0.397000	0.26171	AAG	ZNF492	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000229676		0.403	ZNF492-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF492	HGNC	protein_coding	OTTHUMT00000464581.1	-	0.00	116	0	A	NM_020855		22836737	+1	tier1	-	no_errors	ENST00000456783	ensembl	human	known	74_37	missense	25.40	47	16	SNP	0.455	G
ZNF415	55786	genome.wustl.edu	37	19	53611982	53611982	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:53611982G>A	ENST00000500065.4	-	4	1649	c.1316C>T	c.(1315-1317)cCt>cTt	p.P439L	ZNF415_ENST00000455735.2_Missense_Mutation_p.P487L|ZNF415_ENST00000448501.1_Missense_Mutation_p.P487L|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000421033.1_Missense_Mutation_p.P451L|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000243643.4_Missense_Mutation_p.P439L|ZNF415_ENST00000440291.1_Missense_Mutation_p.P426L|ZNF415_ENST00000601493.1_Missense_Mutation_p.P209L	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	487					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		ACACTTGTAAGGTTTCTCTCC	0.408																																																	0													151.0	141.0	144.0					19																	53611982		2203	4300	6503	SO:0001583	missense	0			AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.1316C>T	19.37:g.53611982G>A	ENSP00000439435:p.Pro439Leu		F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2	p.P487L	ENST00000500065.4	37	c.1460	CCDS54313.1	19	.	.	.	.	.	.	.	.	.	.	G	18.61	3.661844	0.67700	.	.	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	T;T;T;T;T;T	0.17054	2.3;2.3;2.3;2.3;2.3;2.3	2.61	1.52	0.23074	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.36054	0.0953	M	0.72479	2.2	0.36141	D	0.846778	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.85130	0.978;0.996;0.993;0.978;0.988;0.997	T	0.39231	-0.9624	9	0.66056	D	0.02	.	8.6958	0.34296	0.0:0.0:0.5969:0.4031	.	439;487;487;439;426;451	F5H287;B3KTG1;Q09FC8;Q09FC8-5;Q09FC8-4;Q09FC8-2	.;.;ZN415_HUMAN;.;.;.	L	439;439;487;451;487;426	ENSP00000243643:P439L;ENSP00000439435:P439L;ENSP00000396492:P487L;ENSP00000395055:P451L;ENSP00000388787:P487L;ENSP00000414601:P426L	ENSP00000243643:P439L	P	-	2	0	ZNF415	58303794	0.989000	0.36119	0.001000	0.08648	0.679000	0.39708	3.367000	0.52350	0.418000	0.25898	0.313000	0.20887	CCT	ZNF415	-	pfscan_Znf_C2H2	ENSG00000170954		0.408	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF415	HGNC	protein_coding	OTTHUMT00000464043.1	-	0.00	64	0	G	NM_018355		53611982	-1	tier1	-	no_errors	ENST00000448501	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.938	A
ZNF726	730087	genome.wustl.edu	37	19	24102806	24102806	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:24102806C>T	ENST00000334589.5	+	3	266	c.148C>T	c.(148-150)Cca>Tca	p.P50S	ZNF726_ENST00000531821.2_Missense_Mutation_p.P50S|CTB-92J24.3_ENST00000596326.1_RNA|ZNF726_ENST00000575986.1_Missense_Mutation_p.P50S|ZNF726_ENST00000322487.7_Missense_Mutation_p.P50S|ZNF726_ENST00000594466.1_Missense_Mutation_p.P50S|ZNF726_ENST00000525354.2_Missense_Mutation_p.P50S			A6NNF4	ZN726_HUMAN	zinc finger protein 726	50	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TGTCTCTAAGCCAGACCTCAT	0.383																																																	0																																										SO:0001583	missense	0			DQ036016, BC046415	CCDS59372.1	19p12	2013-01-08			ENSG00000213967	ENSG00000213967		"""Zinc fingers, C2H2-type"", ""-"""	32462	protein-coding gene	gene with protein product							Standard	NM_001244038		Approved		uc021urw.1	A6NNF4	OTTHUMG00000167681	ENST00000334589.5:c.148C>T	19.37:g.24102806C>T	ENSP00000334762:p.Pro50Ser		M0R0X8|Q86Y87	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P50S	ENST00000334589.5	37	c.148		19	.	.	.	.	.	.	.	.	.	.	c	10.51	1.371488	0.24771	.	.	ENSG00000213967	ENST00000525354;ENST00000334589;ENST00000531821;ENST00000322487	T;T;T;T	0.00966	5.49;5.49;5.49;5.49	1.14	1.14	0.20703	.	.	.	.	.	T	0.01320	0.0043	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.49254	-0.8959	6	0.56958	D	0.05	.	5.5905	0.17299	0.0:1.0:0.0:0.0	.	.	.	.	S	50	ENSP00000433319:P50S;ENSP00000334762:P50S;ENSP00000432583:P50S;ENSP00000317125:P50S	ENSP00000317125:P50S	P	+	1	0	ZNF726	23894646	0.538000	0.26394	0.010000	0.14722	0.687000	0.40016	1.017000	0.29989	0.588000	0.29660	0.430000	0.28490	CCA	ZNF726	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000213967		0.383	ZNF726-003	PUTATIVE	basic|exp_conf	protein_coding	ZNF726	HGNC	protein_coding	OTTHUMT00000395815.2	-	0.00	94	0	C	XM_001715134		24102806	+1	tier1	-	no_errors	ENST00000322487	ensembl	human	known	74_37	missense	7.02	52	4	SNP	0.005	T
ZNF599	148103	genome.wustl.edu	37	19	35250120	35250120	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:35250120T>A	ENST00000329285.8	-	4	1959	c.1586A>T	c.(1585-1587)cAc>cTc	p.H529L		NM_001007248.2	NP_001007249.1	Q96NL3	ZN599_HUMAN	zinc finger protein 599	529					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|skin(1)	24	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TTCTCCAGTGTGGATCCTATT	0.428																																																	0													106.0	107.0	106.0					19																	35250120		2203	4300	6503	SO:0001583	missense	0			AK055225	CCDS32991.1	19q13.13	2013-01-08				ENSG00000153896		"""Zinc fingers, C2H2-type"", ""-"""	26408	protein-coding gene	gene with protein product							Standard	NM_001007248		Approved	FLJ30663	uc010edn.1	Q96NL3		ENST00000329285.8:c.1586A>T	19.37:g.35250120T>A	ENSP00000333802:p.His529Leu		Q569K0|Q5PRG1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H529L	ENST00000329285.8	37	c.1586	CCDS32991.1	19	.	.	.	.	.	.	.	.	.	.	T	13.25	2.182403	0.38511	.	.	ENSG00000153896	ENST00000392231;ENST00000329285;ENST00000392229	T	0.67345	-0.26	2.58	2.58	0.30949	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.84857	0.5565	H	0.96208	3.785	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.86618	0.1877	9	0.87932	D	0	.	8.9704	0.35903	0.0:0.0:0.0:1.0	.	529	Q96NL3	ZN599_HUMAN	L	528;529;303	ENSP00000333802:H529L	ENSP00000333802:H529L	H	-	2	0	ZNF599	39941960	1.000000	0.71417	0.935000	0.37517	0.123000	0.20343	3.437000	0.52863	1.415000	0.47037	0.482000	0.46254	CAC	ZNF599	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000153896		0.428	ZNF599-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF599	HGNC	protein_coding	OTTHUMT00000460648.2	-	0.00	93	0	T	XM_086046		35250120	-1	tier1	-	no_errors	ENST00000329285	ensembl	human	known	74_37	missense	21.69	129	36	SNP	1.000	A
ZNF544	27300	genome.wustl.edu	37	19	58773550	58773550	+	Silent	SNP	G	G	A			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:58773550G>A	ENST00000596652.1	+	6	1812	c.1578G>A	c.(1576-1578)ggG>ggA	p.G526G	ZNF544_ENST00000595981.1_Intron|ZNF544_ENST00000600044.1_Silent_p.G498G|CTD-3138B18.5_ENST00000597230.1_RNA|ZNF544_ENST00000415203.2_Silent_p.G498G|ZNF544_ENST00000269829.4_Silent_p.G526G|ZNF544_ENST00000599227.1_3'UTR|CTD-3138B18.4_ENST00000600029.1_Intron|ZNF544_ENST00000596929.1_Intron|ZNF544_ENST00000599953.1_Silent_p.G384G|ZNF544_ENST00000600220.1_Silent_p.G498G|ZNF544_ENST00000596825.1_3'UTR			Q6NX49	ZN544_HUMAN	zinc finger protein 544	526					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		ACCTGTGTGGGAAATCCTTCT	0.443																																																	0													84.0	87.0	86.0					19																	58773550		2203	4300	6503	SO:0001819	synonymous_variant	0			AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.1578G>A	19.37:g.58773550G>A			A8K6J1|Q9UEX4	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G526	ENST00000596652.1	37	c.1578	CCDS12973.1	19																																																																																			ZNF544	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198131		0.443	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF544	HGNC	protein_coding	OTTHUMT00000466754.1	-	0.00	42	0	G	NM_014480		58773550	+1	tier1	-	no_errors	ENST00000269829	ensembl	human	known	74_37	silent	18.00	41	9	SNP	0.630	A
ZNF804B	219578	genome.wustl.edu	37	7	88965050	88965050	+	Silent	SNP	A	A	G			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr7:88965050A>G	ENST00000333190.4	+	4	3363	c.2754A>G	c.(2752-2754)ggA>ggG	p.G918G		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	918							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			CTGCAGAAGGAGAGAGGACCC	0.423										HNSCC(36;0.09)																																							0													99.0	105.0	103.0					7																	88965050		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.2754A>G	7.37:g.88965050A>G			B2RTV2|Q7Z714|Q96MN7	Silent	SNP	pfam_Znf_C2H2_jaz	p.G918	ENST00000333190.4	37	c.2754	CCDS5613.1	7																																																																																			ZNF804B	-	NULL	ENSG00000182348		0.423	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	-	0.00	54	0	A	NM_181646		88965050	+1	tier1	-	no_errors	ENST00000333190	ensembl	human	known	74_37	silent	33.33	22	11	SNP	0.003	G
ZNF85	7639	genome.wustl.edu	37	19	21132975	21132975	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GG-01A-11D-A37C-09	TCGA-2H-A9GG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e30cc78-6391-4fa7-9a12-e8811ec6b088	c2f3cff6-6730-4b99-9e89-aaead9912e18	g.chr19:21132975A>T	ENST00000328178.8	+	4	1768	c.1655A>T	c.(1654-1656)aAc>aTc	p.N552I	ZNF85_ENST00000601023.1_Missense_Mutation_p.N493I|ZNF85_ENST00000345030.6_Missense_Mutation_p.N519I	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	552					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						CAGTCCTCAAACCTTACTAAA	0.348																																																	0													31.0	34.0	33.0					19																	21132975		2188	4290	6478	SO:0001583	missense	0			U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.1655A>T	19.37:g.21132975A>T	ENSP00000329793:p.Asn552Ile		B9ZVP4|Q6NVI0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N552I	ENST00000328178.8	37	c.1655	CCDS32977.1	19	.	.	.	.	.	.	.	.	.	.	.	0.006	-2.043088	0.00398	.	.	ENSG00000105750	ENST00000328178;ENST00000345030;ENST00000421385	T;T	0.07567	3.18;3.18	1.34	-2.68	0.06041	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07413	0.0187	L	0.42632	1.34	0.09310	N	1	B;B;B	0.28439	0.212;0.122;0.115	B;B;B	0.33196	0.067;0.016;0.159	T	0.42916	-0.9423	9	0.18276	T	0.48	.	8.2402	0.31656	0.7324:0.2676:0.0:0.0	.	519;493;552	Q03923-2;Q49A12;Q03923	.;.;ZNF85_HUMAN	I	552;519;427	ENSP00000329793:N552I;ENSP00000342340:N519I	ENSP00000329793:N552I	N	+	2	0	ZNF85	20924815	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-5.530000	0.00115	-1.304000	0.02329	-0.691000	0.03719	AAC	ZNF85	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000105750		0.348	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF85	HGNC	protein_coding	OTTHUMT00000463430.1	-	0.00	52	0	A	NM_003429		21132975	+1	tier1	-	no_errors	ENST00000328178	ensembl	human	known	74_37	missense	47.50	21	19	SNP	0.001	T
