#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
A2M	2	genome.wustl.edu	37	12	9268504	9268504	+	5'UTR	SNP	C	C	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:9268504C>G	ENST00000318602.7	-	0	249					NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin						blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	TCCCTACAATCCATCTGGTCC	0.468																																																	0													71.0	63.0	65.0					12																	9268504		692	1591	2283	SO:0001623	5_prime_UTR_variant	0			BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.-59G>C	12.37:g.9268504C>G			Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	RNA	SNP	-	NULL	ENST00000318602.7	37	NULL	CCDS44827.1	12																																																																																			A2M	-	-	ENSG00000175899		0.468	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2M	HGNC	protein_coding	OTTHUMT00000317233.2	-	0.00	25	0	C	NM_000014		9268504	-1	tier1	-	no_errors	ENST00000467091	ensembl	human	known	74_37	rna	21.88	25	7	SNP	0.000	G
ABCB4	5244	genome.wustl.edu	37	7	87046712	87046712	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:87046712A>C	ENST00000265723.4	-	21	2709	c.2598T>G	c.(2596-2598)atT>atG	p.I866M	ABCB4_ENST00000358400.3_Missense_Mutation_p.I866M|ABCB4_ENST00000359206.3_Missense_Mutation_p.I866M|ABCB4_ENST00000545634.1_Missense_Mutation_p.I866M|ABCB4_ENST00000453593.1_Missense_Mutation_p.I866M	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	866	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	ACACAGCAATAATTGGAACAA	0.358																																																	0													109.0	105.0	107.0					7																	87046712		2203	4300	6503	SO:0001583	missense	0			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.2598T>G	7.37:g.87046712A>C	ENSP00000265723:p.Ile866Met		A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,pfam_Zeta_toxin_domain,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.I866M	ENST00000265723.4	37	c.2598	CCDS5606.1	7	.	.	.	.	.	.	.	.	.	.	A	17.16	3.318849	0.60524	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.90261	-2.64;-2.64;-2.64;-2.64;-2.64	5.82	-4.95	0.03048	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.215859	0.47093	D	0.000259	D	0.92450	0.7603	M	0.79475	2.455	0.38293	D	0.942778	P;P;P	0.39748	0.511;0.686;0.562	B;P;P	0.57152	0.334;0.602;0.814	D	0.90351	0.4366	10	0.62326	D	0.03	-6.1267	10.8172	0.46583	0.3899:0.0:0.5154:0.0947	.	866;866;866	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	M	866	ENSP00000352135:I866M;ENSP00000351172:I866M;ENSP00000265723:I866M;ENSP00000392983:I866M;ENSP00000437465:I866M	ENSP00000265723:I866M	I	-	3	3	ABCB4	86884648	0.982000	0.34865	0.540000	0.28089	0.694000	0.40290	0.067000	0.14510	-0.654000	0.05394	-0.341000	0.08007	ATT	ABCB4	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000005471		0.358	ABCB4-002	KNOWN	basic|CCDS	protein_coding	ABCB4	HGNC	protein_coding	OTTHUMT00000336083.1	-	0.00	30	0	A	NM_000443		87046712	-1	tier1	-	no_errors	ENST00000265723	ensembl	human	known	74_37	missense	17.86	46	10	SNP	0.796	C
ABCC9	10060	genome.wustl.edu	37	12	22086848	22086848	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:22086848C>T	ENST00000261201.4	-	2	151	c.152G>A	c.(151-153)aGc>aAc	p.S51N	ABCC9_ENST00000345162.2_Missense_Mutation_p.S51N|ABCC9_ENST00000538350.1_Missense_Mutation_p.S51N|ABCC9_ENST00000326684.4_Missense_Mutation_p.S51N|ABCC9_ENST00000261200.4_Missense_Mutation_p.S51N	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	51					defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	TGAGCTTTGGCTCCCCCACCC	0.378																																																	0													145.0	127.0	133.0					12																	22086848		2203	4300	6503	SO:0001583	missense	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.152G>A	12.37:g.22086848C>T	ENSP00000261201:p.Ser51Asn		O60707	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2	p.S51N	ENST00000261201.4	37	c.152	CCDS8694.1	12	.	.	.	.	.	.	.	.	.	.	C	22.3	4.268147	0.80469	.	.	ENSG00000069431	ENST00000261200;ENST00000261201;ENST00000345162;ENST00000326684;ENST00000538350	D;D;D;D;D	0.96913	-4.17;-4.17;-4.17;-4.17;-4.17	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	D	0.96944	0.9002	M	0.70595	2.14	0.54753	D	0.999986	D;P;D;P	0.54964	0.969;0.917;0.957;0.763	P;P;P;P	0.59357	0.856;0.713;0.71;0.463	D	0.95371	0.8464	10	0.21540	T	0.41	-19.8613	14.5142	0.67809	0.0:0.8527:0.1473:0.0	.	51;51;51;51	G3V1N6;Q8N4N7;O60706;O60706-2	.;.;ABCC9_HUMAN;.	N	51	ENSP00000261200:S51N;ENSP00000261201:S51N;ENSP00000261202:S51N;ENSP00000317518:S51N;ENSP00000442604:S51N	ENSP00000261200:S51N	S	-	2	0	ABCC9	21978115	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	5.743000	0.68655	2.573000	0.86826	0.471000	0.43371	AGC	ABCC9	-	NULL	ENSG00000069431		0.378	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	-	0.00	44	0	C	NM_005691		22086848	-1	tier1	-	no_errors	ENST00000261200	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
ACSM2A	123876	genome.wustl.edu	37	16	20480934	20480934	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr16:20480934C>T	ENST00000573854.1	+	4	603	c.489C>T	c.(487-489)gtC>gtT	p.V163V	ACSM2A_ENST00000219054.6_Silent_p.V163V|ACSM2A_ENST00000424070.1_Silent_p.V163V|ACSM2A_ENST00000417235.2_Silent_p.V84V|ACSM2A_ENST00000575690.1_Silent_p.V163V|ACSM2A_ENST00000575558.1_3'UTR|ACSM2A_ENST00000396104.2_Silent_p.V163V|ACSM2A_ENST00000536134.1_5'UTR	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	163					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						GGGATGAAGTCATCCAAGAAG	0.453																																																	0													67.0	67.0	67.0					16																	20480934		2203	4295	6498	SO:0001819	synonymous_variant	0			AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.489C>T	16.37:g.20480934C>T			B3KTT9|O75202	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.V163	ENST00000573854.1	37	c.489	CCDS32401.1	16																																																																																			ACSM2A	-	pfam_AMP-dep_Synth/Lig	ENSG00000183747		0.453	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM2A	HGNC	protein_coding	OTTHUMT00000436764.1	-	0.00	71	0	C	NM_001010845		20480934	+1	tier1	-	no_errors	ENST00000219054	ensembl	human	known	74_37	silent	32.31	44	21	SNP	0.350	T
ADAM29	11086	genome.wustl.edu	37	4	175898111	175898111	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:175898111T>G	ENST00000359240.3	+	5	2105	c.1435T>G	c.(1435-1437)Ttt>Gtt	p.F479V	ADAM29_ENST00000445694.1_Missense_Mutation_p.F479V|ADAM29_ENST00000514159.1_Missense_Mutation_p.F479V|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000404450.4_Missense_Mutation_p.F479V	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	479	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CCCAGATGACTTTTATGTGGA	0.463																																					Ovarian(140;1727 1835 21805 25838 41440)												0													105.0	100.0	102.0					4																	175898111		2203	4300	6503	SO:0001583	missense	0			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.1435T>G	4.37:g.175898111T>G	ENSP00000352177:p.Phe479Val		Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.F479V	ENST00000359240.3	37	c.1435	CCDS3823.1	4	.	.	.	.	.	.	.	.	.	.	T	0.034	-1.314766	0.01331	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.10099	2.91;2.91;2.91;2.91	3.69	1.84	0.25277	Blood coagulation inhibitor, Disintegrin (5);	0.861893	0.09295	N	0.821841	T	0.01976	0.0062	N	0.00069	-2.28	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.41448	-0.9508	9	.	.	.	.	10.2953	0.43620	0.0:0.0:0.599:0.401	.	479	Q9UKF5	ADA29_HUMAN	V	479	ENSP00000352177:F479V;ENSP00000414544:F479V;ENSP00000384229:F479V;ENSP00000423517:F479V	.	F	+	1	0	ADAM29	176134686	0.272000	0.24172	0.042000	0.18584	0.032000	0.12392	0.332000	0.19751	0.464000	0.27142	-0.155000	0.13514	TTT	ADAM29	-	pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin	ENSG00000168594		0.463	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ADAM29	HGNC	protein_coding		-	0.00	25	0	T			175898111	+1	tier1	-	no_errors	ENST00000359240	ensembl	human	known	74_37	missense	32.00	17	8	SNP	0.420	G
ADAMTS19	171019	genome.wustl.edu	37	5	128864278	128864278	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:128864278A>C	ENST00000274487.4	+	6	1363	c.1218A>C	c.(1216-1218)gaA>gaC	p.E406D	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	406	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GGCAACATGAAGAATTTGGCA	0.363																																																	0													89.0	93.0	91.0					5																	128864278		2203	4300	6503	SO:0001583	missense	0			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1218A>C	5.37:g.128864278A>C	ENSP00000274487:p.Glu406Asp			Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_PLAC,pfam_Pept_M10_metallopeptidase,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.E406D	ENST00000274487.4	37	c.1218	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	A	16.56	3.156688	0.57259	.	.	ENSG00000145808	ENST00000274487	T	0.63913	-0.07	4.02	4.02	0.46733	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.082423	0.48767	D	0.000180	T	0.51058	0.1652	N	0.04018	-0.295	0.44547	D	0.997506	D	0.57571	0.98	P	0.61658	0.892	T	0.49399	-0.8944	9	.	.	.	.	8.7373	0.34537	0.9125:0.0:0.0875:0.0	.	406	Q8TE59	ATS19_HUMAN	D	406	ENSP00000274487:E406D	.	E	+	3	2	ADAMTS19	128892177	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.409000	0.34680	2.045000	0.60652	0.529000	0.55759	GAA	ADAMTS19	-	pfam_Peptidase_M12B,pfam_Pept_M10_metallopeptidase,pfscan_Peptidase_M12B	ENSG00000145808		0.363	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	HGNC	protein_coding	OTTHUMT00000250979.2	-	0.00	56	0	A	NM_133638		128864278	+1	tier1	-	no_errors	ENST00000274487	ensembl	human	known	74_37	missense	31.51	50	23	SNP	1.000	C
ADCY1	107	genome.wustl.edu	37	7	45725592	45725592	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:45725592A>T	ENST00000297323.7	+	13	2127	c.2105A>T	c.(2104-2106)aAg>aTg	p.K702M		NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	702					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	TGGAGCTCCAAGCCCAACAGT	0.652																																																	0													54.0	43.0	47.0					7																	45725592		2203	4300	6503	SO:0001583	missense	0			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.2105A>T	7.37:g.45725592A>T	ENSP00000297323:p.Lys702Met		A4D2L8|Q75MI1	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.K702M	ENST00000297323.7	37	c.2105	CCDS34631.1	7	.	.	.	.	.	.	.	.	.	.	A	11.68	1.711560	0.30322	.	.	ENSG00000164742	ENST00000297323;ENST00000545300	T	0.37752	1.18	3.8	0.181	0.15073	.	0.594103	0.16744	N	0.201323	T	0.14960	0.0361	N	0.08118	0	0.09310	N	1	B	0.23058	0.079	B	0.15484	0.013	T	0.17440	-1.0369	10	0.30078	T	0.28	.	6.1343	0.20223	0.6047:0.0:0.3953:0.0	.	702	Q08828	ADCY1_HUMAN	M	702	ENSP00000297323:K702M	ENSP00000297323:K702M	K	+	2	0	ADCY1	45692117	0.998000	0.40836	0.036000	0.18154	0.938000	0.57974	3.023000	0.49666	0.162000	0.19483	0.379000	0.24179	AAG	ADCY1	-	NULL	ENSG00000164742		0.652	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY1	HGNC	protein_coding	OTTHUMT00000340055.2	-	0.00	28	0	A	NM_021116		45725592	+1	tier1	-	no_errors	ENST00000297323	ensembl	human	known	74_37	missense	21.74	17	5	SNP	0.012	T
ADGB	79747	genome.wustl.edu	37	6	147014047	147014047	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:147014047G>C	ENST00000397944.3	+	12	1649	c.1573G>C	c.(1573-1575)Gaa>Caa	p.E525Q	ADGB_ENST00000367493.3_5'UTR	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	525					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						AATTCCAACAGAAATGTAAGT	0.333																																																	0													73.0	66.0	68.0					6																	147014047		692	1574	2266	SO:0001583	missense	0			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.1573G>C	6.37:g.147014047G>C	ENSP00000381036:p.Glu525Gln		Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,superfamily_Globin-like,smart_Peptidase_C2_calpain_cat,pfscan_IQ_motif_EF-hand-BS,pfscan_Peptidase_C2_calpain_cat	p.E525Q	ENST00000397944.3	37	c.1573		6	.	.	.	.	.	.	.	.	.	.	G	8.447	0.852282	0.17106	.	.	ENSG00000118492	ENST00000397944	T	0.33216	1.42	5.52	2.72	0.32119	Peptidase C2, calpain, catalytic domain (1);	0.822795	0.10841	N	0.628270	T	0.10981	0.0268	L	0.57536	1.79	0.30058	N	0.81116	B	0.31485	0.325	B	0.22753	0.041	T	0.14476	-1.0471	10	0.34782	T	0.22	-21.9485	6.7629	0.23550	0.1507:0.0:0.7044:0.1449	.	525	Q8N7X0	CAN7L_HUMAN	Q	525	ENSP00000381036:E525Q	ENSP00000381036:E525Q	E	+	1	0	C6orf103	147055740	1.000000	0.71417	0.989000	0.46669	0.488000	0.33401	1.144000	0.31565	0.664000	0.31047	0.655000	0.94253	GAA	ADGB	-	smart_Peptidase_C2_calpain_cat	ENSG00000118492		0.333	ADGB-009	KNOWN	basic|appris_principal	protein_coding	ADGB	HGNC	protein_coding	OTTHUMT00000376350.2	-	0.00	63	0	G	NM_024694		147014047	+1	tier1	-	no_errors	ENST00000397944	ensembl	human	known	74_37	missense	42.50	46	34	SNP	0.986	C
AKAP3	10566	genome.wustl.edu	37	12	4736754	4736754	+	Silent	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:4736754G>A	ENST00000545990.2	-	5	1838	c.1314C>T	c.(1312-1314)ccC>ccT	p.P438P	AKAP3_ENST00000228850.1_Silent_p.P438P|RP11-500M8.7_ENST00000536588.1_Intron	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	438					acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						CCTCTGATTTGGGTTCAGAAT	0.403																																																	0													119.0	119.0	119.0					12																	4736754		2203	4300	6503	SO:0001819	synonymous_variant	0			U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.1314C>T	12.37:g.4736754G>A			O75945|Q86X01|Q9UM61	Silent	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.P438	ENST00000545990.2	37	c.1314	CCDS8531.1	12																																																																																			AKAP3	-	pfam_AKAP_110_C,smart_AKAP_110	ENSG00000111254		0.403	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP3	HGNC	protein_coding	OTTHUMT00000398911.2	-	0.00	16	0	G	NM_006422		4736754	-1	tier1	-	no_errors	ENST00000228850	ensembl	human	known	74_37	silent	33.33	20	10	SNP	0.049	A
AKAP6	9472	genome.wustl.edu	37	14	33291901	33291901	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr14:33291901C>G	ENST00000280979.4	+	13	5052	c.4882C>G	c.(4882-4884)Cta>Gta	p.L1628V	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1628	Ser-rich.				action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		AGTTGGTGAACTAAGTAAAAG	0.398																																					Melanoma(49;821 1200 7288 13647 42351)												0													60.0	63.0	62.0					14																	33291901		2203	4300	6503	SO:0001583	missense	0			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.4882C>G	14.37:g.33291901C>G	ENSP00000280979:p.Leu1628Val		A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.L1628V	ENST00000280979.4	37	c.4882	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	C	14.47	2.546122	0.45383	.	.	ENSG00000151320	ENST00000280979	T	0.17054	2.3	5.98	3.21	0.36854	.	0.066522	0.64402	D	0.000010	T	0.37919	0.1021	M	0.72894	2.215	0.80722	D	1	D	0.69078	0.997	D	0.78314	0.991	T	0.17471	-1.0368	10	0.87932	D	0	-6.4978	10.9346	0.47239	0.0:0.7993:0.0:0.2007	.	1628	Q13023	AKAP6_HUMAN	V	1628	ENSP00000280979:L1628V	ENSP00000280979:L1628V	L	+	1	2	AKAP6	32361652	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.041000	0.49807	0.877000	0.35895	-0.145000	0.13849	CTA	AKAP6	-	NULL	ENSG00000151320		0.398	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	-	0.00	16	0	C	NM_004274		33291901	+1	tier1	-	no_errors	ENST00000280979	ensembl	human	known	74_37	missense	25.00	15	5	SNP	1.000	G
ALCAM	214	genome.wustl.edu	37	3	105086285	105086285	+	Silent	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:105086285G>A	ENST00000306107.5	+	1	533	c.33G>A	c.(31-33)ctG>ctA	p.L11L	ALCAM_ENST00000472644.2_Silent_p.L11L	NM_001627.3	NP_001618.2	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule	11					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|motor neuron axon guidance (GO:0008045)|signal transduction (GO:0007165)	axon (GO:0030424)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	receptor binding (GO:0005102)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						CCTGCCGTCTGCTCTTCTGCC	0.652																																																	0													89.0	86.0	87.0					3																	105086285		2203	4300	6503	SO:0001819	synonymous_variant	0			AK054632	CCDS33810.1, CCDS58841.1	3q13.1	2013-01-29	2002-08-08		ENSG00000170017	ENSG00000170017		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	400	protein-coding gene	gene with protein product		601662	"""activated leucocyte cell adhesion molecule"""			7760007	Standard	NM_001627		Approved	CD166, MEMD	uc003dvx.3	Q13740	OTTHUMG00000159192	ENST00000306107.5:c.33G>A	3.37:g.105086285G>A			B2RNS3|B4DTU0|O60892|Q1HGM8|Q1HGM9|Q6PEY4|Q6ZS95	Silent	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_sub2,pfscan_Ig-like_dom	p.L11	ENST00000306107.5	37	c.33	CCDS33810.1	3																																																																																			ALCAM	-	NULL	ENSG00000170017		0.652	ALCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALCAM	HGNC	protein_coding	OTTHUMT00000353764.1	-	0.00	36	0	G	NM_001627		105086285	+1	tier1	-	no_errors	ENST00000306107	ensembl	human	known	74_37	silent	20.00	48	12	SNP	1.000	A
ALDH1L1	10840	genome.wustl.edu	37	3	125876244	125876244	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:125876244T>C	ENST00000393434.2	-	4	819	c.470A>G	c.(469-471)gAc>gGc	p.D157G	ALDH1L1_ENST00000273450.3_Missense_Mutation_p.D167G|ALDH1L1_ENST00000413612.1_5'Flank|U1_ENST00000606575.1_RNA|ALDH1L1_ENST00000472186.1_Missense_Mutation_p.D157G|ALDH1L1_ENST00000455064.2_5'UTR|ALDH1L1_ENST00000452905.2_Intron|ALDH1L1_ENST00000393431.2_Missense_Mutation_p.D157G	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	157	GART.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	CACGGTGTCGTCCGGGAGCAC	0.617																																																	0													97.0	89.0	92.0					3																	125876244		2203	4300	6503	SO:0001583	missense	0			AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.470A>G	3.37:g.125876244T>C	ENSP00000377083:p.Asp157Gly		B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.D157G	ENST00000393434.2	37	c.470	CCDS3034.1	3	.	.	.	.	.	.	.	.	.	.	T	16.47	3.133191	0.56828	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000393434;ENST00000393431;ENST00000490367;ENST00000460368;ENST00000488356	T;T;T;T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08;-1.08;-1.08;-1.08	4.39	4.39	0.52855	Formyl transferase, N-terminal (3);	0.121842	0.52532	D	0.000063	T	0.78842	0.4347	L	0.48642	1.525	0.80722	D	1	P;P;P	0.46142	0.873;0.86;0.873	P;P;P	0.51945	0.685;0.679;0.685	T	0.80859	-0.1194	10	0.72032	D	0.01	.	11.5973	0.50981	0.0:0.0:0.0:1.0	.	209;64;157	Q59G10;Q9UFA9;O75891	.;.;AL1L1_HUMAN	G	167;157;157;157;157;157;157	ENSP00000273450:D167G;ENSP00000420293:D157G;ENSP00000377083:D157G;ENSP00000377081:D157G;ENSP00000418711:D157G;ENSP00000419826:D157G;ENSP00000419955:D157G	ENSP00000273450:D167G	D	-	2	0	ALDH1L1	127358934	1.000000	0.71417	0.316000	0.25252	0.016000	0.09150	7.608000	0.82898	1.845000	0.53610	0.383000	0.25322	GAC	ALDH1L1	-	pfam_Formyl_transf_N,superfamily_Formyl_transf_N,pirsf_10_FTHF_DH	ENSG00000144908		0.617	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L1	HGNC	protein_coding	OTTHUMT00000354391.1	-	0.00	38	0	T	NM_012190		125876244	-1	tier1	-	no_errors	ENST00000393434	ensembl	human	known	74_37	missense	22.22	42	12	SNP	0.915	C
ALG13	79868	genome.wustl.edu	37	X	110951378	110951378	+	Silent	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:110951378G>A	ENST00000394780.3	+	4	519	c.507G>A	c.(505-507)ctG>ctA	p.L169L	ALG13_ENST00000251943.4_Silent_p.L65L|ALG13-AS1_ENST00000430794.1_RNA	NM_001099922.2|NM_001257231.1	NP_001093392.1|NP_001244160.1	Q9NP73	ALG13_HUMAN	ALG13, UDP-N-acetylglucosaminyltransferase subunit	169	Deubiquitinase activity.				cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipid glycosylation (GO:0030259)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	carbohydrate binding (GO:0030246)|cysteine-type peptidase activity (GO:0008234)|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity (GO:0004577)|poly(A) RNA binding (GO:0044822)			endometrium(2)|lung(10)|skin(1)	13						CCGGATACCTGCATAAGCAAG	0.527																																																	0													122.0	101.0	108.0					X																	110951378		1568	3582	5150	SO:0001819	synonymous_variant	0			AF220051	CCDS14559.1, CCDS55477.1, CCDS59173.1, CCDS76011.1, CCDS76012.1, CCDS76013.1	Xq23	2014-02-24	2013-02-21	2006-11-07	ENSG00000101901	ENSG00000101901	2.4.1.141	"""Tudor domain containing"", ""OTU domain containing"""	30881	protein-coding gene	gene with protein product	"""tudor domain containing 13"", ""N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase"""	300776	"""glycosyltransferase 28 domain containing 1"", ""chromosome X open reading frame 45"", ""asparagine-linked glycosylation 13 homolog (S. cerevisiae)"""	GLT28D1, CXorf45		12477932	Standard	NM_018466		Approved	MDS031, YGL047W, FLJ23018, TDRD13	uc011msy.2	Q9NP73	OTTHUMG00000022209	ENST00000394780.3:c.507G>A	X.37:g.110951378G>A			B1AKD6|B1AKM1|B2R5L5|B7Z6J0|B7Z804|B7Z847|B7Z9A8|B7ZAJ1|B7ZB57|Q17RC3|Q5JXY9|Q9H5U8	Silent	SNP	pfam_OTU,pfscan_OTU,pfscan_Tudor	p.L65	ENST00000394780.3	37	c.195	CCDS55477.1	X																																																																																			ALG13	-	NULL	ENSG00000101901		0.527	ALG13-011	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ALG13	HGNC	protein_coding	OTTHUMT00000272895.1		0.00	39	0	G	NM_018466		110951378	+1			no_errors	ENST00000251943	ensembl	human	known	74_37	silent	8.16	45	4	SNP	1.000	A
ALS2	57679	genome.wustl.edu	37	2	202598174	202598175	+	Intron	INS	-	-	A	rs202183857|rs78633310	byFrequency	TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:202598174_202598175insA	ENST00000264276.6	-	13	2790				ALS2_ENST00000457679.2_Intron	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)						behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						AGAGGCAGAGGAAAAAAAAATT	0.307																																																	0																																										SO:0001627	intron_variant	0			AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.2418-13->T	2.37:g.202598183_202598183dupA			Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	RNA	INS	-	NULL	ENST00000264276.6	37	NULL	CCDS42800.1	2																																																																																			ALS2	-	-	ENSG00000003393		0.307	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2	HGNC	protein_coding	OTTHUMT00000335562.3		0.00	29	0	-	NM_020919		202598175	-1	tier1		no_errors	ENST00000494017	ensembl	human	known	74_37	rna	16.67	15	3	INS	0.001:0.002	A
ANGPT1	284	genome.wustl.edu	37	8	108297012	108297012	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:108297012T>C	ENST00000520734.1	-	6	788	c.503A>G	c.(502-504)cAg>cGg	p.Q168R	ANGPT1_ENST00000520052.1_Missense_Mutation_p.Q167R|ANGPT1_ENST00000518386.1_Intron			Q15389	ANGP1_HUMAN	angiopoietin 1	368					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			GTACTGCCTCTGACTGGTAAT	0.408																																																	0													118.0	102.0	107.0					8																	108297012		2203	4300	6503	SO:0001583	missense	0			D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.503A>G	8.37:g.108297012T>C	ENSP00000430750:p.Gln168Arg		Q5HYA0	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.Q368R	ENST00000520734.1	37	c.1103		8	.	.	.	.	.	.	.	.	.	.	T	15.13	2.740838	0.49151	.	.	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000520734;ENST00000520052	T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11	5.73	5.73	0.89815	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.048650	0.85682	D	0.000000	T	0.72309	0.3444	L	0.42487	1.325	0.80722	D	1	B;B;B	0.09022	0.0;0.002;0.002	B;B;B	0.14578	0.005;0.011;0.011	T	0.66999	-0.5781	10	0.37606	T	0.19	.	16.0098	0.80391	0.0:0.0:0.0:1.0	.	167;368;368	E7ERK4;Q5HYA0;Q15389	.;.;ANGP1_HUMAN	R	368;367;168;167	ENSP00000428340:Q368R;ENSP00000297450:Q367R;ENSP00000430750:Q168R;ENSP00000429349:Q167R	ENSP00000297450:Q367R	Q	-	2	0	ANGPT1	108366188	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.242000	0.72376	2.187000	0.69744	0.528000	0.53228	CAG	ANGPT1	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000154188		0.408	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	ANGPT1	HGNC	protein_coding	OTTHUMT00000380428.2	-	0.00	52	0	T	NM_001146, NM_139290		108297012	-1	tier1	-	no_errors	ENST00000517746	ensembl	human	known	74_37	missense	34.12	56	29	SNP	1.000	C
ANK2	287	genome.wustl.edu	37	4	114274919	114274919	+	Silent	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:114274919A>G	ENST00000357077.4	+	38	5198	c.5145A>G	c.(5143-5145)aaA>aaG	p.K1715K	ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000264366.6_Silent_p.K1682K	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1715					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AGAAACAAAAAGAGGAAGGTT	0.418																																																	0													132.0	140.0	137.0					4																	114274919		2203	4300	6503	SO:0001819	synonymous_variant	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.5145A>G	4.37:g.114274919A>G			Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.K1715	ENST00000357077.4	37	c.5145	CCDS3702.1	4																																																																																			ANK2	-	NULL	ENSG00000145362		0.418	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	-	0.00	20	0	A	NM_001148		114274919	+1	tier1	-	no_errors	ENST00000357077	ensembl	human	known	74_37	silent	69.23	4	9	SNP	0.762	G
ANKRD13A	88455	genome.wustl.edu	37	12	110463586	110463586	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:110463586C>T	ENST00000261739.4	+	8	1007	c.841C>T	c.(841-843)Cgc>Tgc	p.R281C		NM_033121.1	NP_149112.1	Q8IZ07	AN13A_HUMAN	ankyrin repeat domain 13A	281						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(8)|lung(3)|urinary_tract(1)	16						CACCAAAATACGCACAGAACA	0.408																																																	0													176.0	165.0	168.0					12																	110463586		2203	4300	6503	SO:0001583	missense	0			AF064604	CCDS9140.1	12q24.12	2013-01-10	2006-06-30	2006-06-30		ENSG00000076513		"""Ankyrin repeat domain containing"""	21268	protein-coding gene	gene with protein product		615123	"""ankyrin repeat domain 13"""	ANKRD13		10508479	Standard	NM_033121		Approved	NY-REN-25	uc001tpx.3	Q8IZ07	OTTHUMG00000169314	ENST00000261739.4:c.841C>T	12.37:g.110463586C>T	ENSP00000261739:p.Arg281Cys		O60736	Missense_Mutation	SNP	pfam_ANKRD13,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ubiquitin-int_motif,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin-int_motif	p.R281C	ENST00000261739.4	37	c.841	CCDS9140.1	12	.	.	.	.	.	.	.	.	.	.	C	24.5	4.538970	0.85917	.	.	ENSG00000076513	ENST00000261738;ENST00000261739;ENST00000546476	T	0.61392	0.11	5.74	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.78654	0.4317	M	0.90369	3.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.82121	-0.0614	10	0.87932	D	0	-0.1186	11.7478	0.51830	0.3108:0.6892:0.0:0.0	.	281;281	B4DYP5;Q8IZ07	.;AN13A_HUMAN	C	66;281;52	ENSP00000261739:R281C	ENSP00000261738:R66C	R	+	1	0	ANKRD13A	108947969	0.886000	0.30341	0.994000	0.49952	0.966000	0.64601	1.444000	0.35068	2.716000	0.92895	0.561000	0.74099	CGC	ANKRD13A	-	pfam_ANKRD13	ENSG00000076513		0.408	ANKRD13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD13A	HGNC	protein_coding	OTTHUMT00000403430.1	-	0.00	62	0	C	NM_033121		110463586	+1	tier1	-	no_errors	ENST00000261739	ensembl	human	known	74_37	missense	13.43	58	9	SNP	1.000	T
ANKLE2	23141	genome.wustl.edu	37	12	133306451	133306451	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:133306451C>G	ENST00000357997.5	-	11	2386	c.2297G>C	c.(2296-2298)aGa>aCa	p.R766T	ANKLE2_ENST00000539605.1_Missense_Mutation_p.R704T|ANKLE2_ENST00000542657.1_Missense_Mutation_p.R121T|ANKLE2_ENST00000542282.1_Missense_Mutation_p.R121T|ANKLE2_ENST00000542374.1_Intron	NM_015114.1	NP_055929.1	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	766					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|negative regulation of phosphorylation (GO:0042326)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(2)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(20)|ovary(1)|urinary_tract(2)	45	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		TGCATTGATTCTTGAAGTCAG	0.428																																																	0													166.0	159.0	161.0					12																	133306451		1950	4154	6104	SO:0001583	missense	0			AB014592	CCDS41869.1	12q24.33	2013-01-11	2008-03-25	2008-03-25	ENSG00000176915	ENSG00000176915		"""Ankyrin repeat domain containing"""	29101	protein-coding gene	gene with protein product	"""LEM domain containing 7"""		"""KIAA0692"""	KIAA0692		9734811	Standard	XM_005266159		Approved	LEMD7, Lem4	uc001ukx.2	Q86XL3	OTTHUMG00000168046	ENST00000357997.5:c.2297G>C	12.37:g.133306451C>G	ENSP00000350686:p.Arg766Thr		A8KAG3|B3KN97|B3KSF8|O75176|Q6P6A5|Q8TAZ9|Q96DH4	Missense_Mutation	SNP	pfam_LEM_dom,superfamily_LEM/LEM-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Ribosomal_L9/RNase_H1_N,pfscan_LEM_dom	p.R766T	ENST00000357997.5	37	c.2297	CCDS41869.1	12	.	.	.	.	.	.	.	.	.	.	C	12.78	2.039298	0.35989	.	.	ENSG00000176915	ENST00000539605;ENST00000357997;ENST00000542282;ENST00000542657;ENST00000538766	T;T;T;T;T	0.46819	1.89;1.88;0.86;0.86;0.86	5.74	3.92	0.45320	.	0.853734	0.11244	N	0.584364	T	0.41166	0.1147	L	0.59436	1.845	0.09310	N	0.999998	B	0.18741	0.03	B	0.17433	0.018	T	0.38693	-0.9649	10	0.08381	T	0.77	-8.1009	10.0955	0.42473	0.0:0.786:0.0:0.214	.	766	Q86XL3	ANKL2_HUMAN	T	704;766;121;121;121	ENSP00000446268:R704T;ENSP00000350686:R766T;ENSP00000437807:R121T;ENSP00000438551:R121T;ENSP00000445760:R121T	ENSP00000350686:R766T	R	-	2	0	ANKLE2	131816524	0.000000	0.05858	0.001000	0.08648	0.222000	0.24845	0.611000	0.24268	0.894000	0.36317	0.645000	0.84053	AGA	ANKLE2	-	NULL	ENSG00000176915		0.428	ANKLE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE2	HGNC	protein_coding	OTTHUMT00000397712.1	-	0.00	63	0	C			133306451	-1	tier1	-	no_errors	ENST00000357997	ensembl	human	known	74_37	missense	13.33	65	10	SNP	0.001	G
ANTXRL	195977	genome.wustl.edu	37	10	47701173	47701173	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:47701173C>T	ENST00000447511.2	+	17	2014	c.1749C>T	c.(1747-1749)tgC>tgT	p.C583C	ANTXRL_ENST00000537271.1_Missense_Mutation_p.P531S	NM_001278688.1	NP_001265617.1	A6NF34	ANTRL_HUMAN	anthrax toxin receptor-like	583						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)										GCCGGGAGTGCCTCCCCCTCA	0.642																																																	0																																										SO:0001819	synonymous_variant	0				CCDS60524.1	10q11.22	2014-04-11			ENSG00000198250	ENSG00000274209			27277	protein-coding gene	gene with protein product							Standard	NM_001278688		Approved			A6NF34	OTTHUMG00000188318	ENST00000447511.2:c.1749C>T	10.37:g.47701173C>T			H3BPS2	Missense_Mutation	SNP	pfam_Anthrax_toxin_rcpt_extracel,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.P531S	ENST00000447511.2	37	c.1591		10																																																																																			ANTXRL	-	NULL	ENSG00000198250		0.642	ANTXRL-002	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	ANTXRL	HGNC	protein_coding	OTTHUMT00000047862.2	-	0.00	42	0	C	XM_113625		47701173	+1	tier1	-	no_errors	ENST00000537271	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.000	T
AOX1	316	genome.wustl.edu	37	2	201473732	201473732	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:201473732C>T	ENST00000374700.2	+	11	1174	c.933C>T	c.(931-933)agC>agT	p.S311S		NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	311	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	CTGGTCTCAGCCTAGCCCAGG	0.468																																																	0													77.0	71.0	73.0					2																	201473732		2203	4300	6503	SO:0001819	synonymous_variant	0			AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.933C>T	2.37:g.201473732C>T			O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Silent	SNP	pfam_AldOxase/xan_DH_Mopterin-bd,pfam_Mopterin_DH_FAD-bd,pfam_Ald_Oxase/Xan_DH_a/b,pfam_2Fe-2S-bd,pfam_CO_DH_flav_C,pfam_2Fe-2S_ferredoxin-type,superfamily_AldOxase/xan_DH_Mopterin-bd,superfamily_FAD-bd_2,superfamily_Ald_Oxase/Xan_DH_a/b,superfamily_2Fe-2S-bd,superfamily_CO_DH_flav_C,superfamily_2Fe-2S_ferredoxin-type,pirsf_Ald_Oxase/xanthine_DH,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Aldehyde_oxidase	p.S311	ENST00000374700.2	37	c.933	CCDS33360.1	2																																																																																			AOX1	-	pfam_Mopterin_DH_FAD-bd,superfamily_FAD-bd_2,pirsf_Ald_Oxase/xanthine_DH,tigrfam_Aldehyde_oxidase	ENSG00000138356		0.468	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOX1	HGNC	protein_coding	OTTHUMT00000335844.1	-	0.00	21	0	C	NM_001159		201473732	+1	tier1	-	no_errors	ENST00000374700	ensembl	human	known	74_37	silent	14.29	24	4	SNP	1.000	T
AP2A2	161	genome.wustl.edu	37	11	1009801	1009801	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:1009801C>A	ENST00000448903.2	+	21	2867	c.2726C>A	c.(2725-2727)cCg>cAg	p.P909Q	AP2A2_ENST00000534328.1_Intron|AP2A2_ENST00000332231.5_Missense_Mutation_p.P910Q	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	909					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		CGCTTGGAGCCGAACCTGCAA	0.498																																																	0													28.0	30.0	29.0					11																	1009801		1746	3738	5484	SO:0001583	missense	0			AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.2726C>A	11.37:g.1009801C>A	ENSP00000413234:p.Pro909Gln		O75403|Q53ET1|Q96SI8	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a-adaptin_app_sub_C,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu	p.P910Q	ENST00000448903.2	37	c.2729	CCDS44512.1	11	.	.	.	.	.	.	.	.	.	.	C	22.7	4.325801	0.81580	.	.	ENSG00000183020	ENST00000417081;ENST00000448903;ENST00000332231;ENST00000529125;ENST00000452310	T;T	0.19394	2.15;2.15	3.99	3.99	0.46301	Coatomer/calthrin adaptor appendage, C-terminal subdomain (1);Clathrin alpha-adaptin/coatomer adaptor, appendage, C-terminal subdomain (1);Clathrin adaptor, alpha-adaptin, appendage, C-terminal subdomain (1);	0.000000	0.85682	D	0.000000	T	0.55705	0.1937	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68758	-0.5324	10	0.87932	D	0	-31.0722	17.3624	0.87355	0.0:1.0:0.0:0.0	.	909	O94973	AP2A2_HUMAN	Q	323;909;910;646;649	ENSP00000413234:P909Q;ENSP00000327694:P910Q	ENSP00000327694:P910Q	P	+	2	0	AP2A2	999801	1.000000	0.71417	0.958000	0.39756	0.949000	0.60115	7.230000	0.78097	2.522000	0.85027	0.579000	0.79373	CCG	AP2A2	-	pfam_Clathrin_a-adaptin_app_sub_C,superfamily_Coatomer/calthrin_app_sub_C,pirsf_AP2_complex_asu	ENSG00000183020		0.498	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP2A2	HGNC	protein_coding	OTTHUMT00000385431.2	-	0.00	34	0	C	NM_012305		1009801	+1	tier1	-	no_errors	ENST00000332231	ensembl	human	known	74_37	missense	8.89	40	4	SNP	1.000	A
APH1B	83464	genome.wustl.edu	37	15	63594591	63594591	+	Missense_Mutation	SNP	G	G	A	rs200752222		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr15:63594591G>A	ENST00000261879.5	+	5	596	c.526G>A	c.(526-528)Gta>Ata	p.V176I	APH1B_ENST00000560716.1_3'UTR|APH1B_ENST00000380343.4_Missense_Mutation_p.V135I	NM_001145646.1|NM_031301.3	NP_001139118.1|NP_112591.2	Q8WW43	APH1B_HUMAN	APH1B gamma secretase subunit	176					apoptotic signaling pathway (GO:0097190)|membrane protein intracellular domain proteolysis (GO:0031293)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)	peptidase activity (GO:0008233)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	12						CTGGGGCATTGTATTTTTTGA	0.498																																																	0													308.0	286.0	293.0					15																	63594591		2203	4300	6503	SO:0001583	missense	0			AY358698	CCDS10184.1, CCDS45276.1	15q22.2	2013-05-01	2013-05-01		ENSG00000138613	ENSG00000138613			24080	protein-coding gene	gene with protein product		607630	"""anterior pharynx defective 1 homolog B (C. elegans)"""			12110170, 11230166	Standard	NM_031301		Approved	PSFL, APH-1B, DKFZp564D0372	uc002ama.3	Q8WW43	OTTHUMG00000132863	ENST00000261879.5:c.526G>A	15.37:g.63594591G>A	ENSP00000261879:p.Val176Ile		A8K589|Q564N3|Q6UWQ1|Q9H0S0	Missense_Mutation	SNP	pfam_Aph-1	p.V176I	ENST00000261879.5	37	c.526	CCDS10184.1	15	.	.	.	.	.	.	.	.	.	.	G	1.520	-0.547193	0.04024	.	.	ENSG00000138613	ENST00000380343;ENST00000261879	T;T	0.38401	1.14;1.14	5.36	1.09	0.20402	.	0.299674	0.30302	N	0.009926	T	0.16214	0.0390	N	0.16233	0.39	0.28565	N	0.9109	B;B	0.15719	0.014;0.014	B;B	0.20184	0.028;0.028	T	0.34875	-0.9811	10	0.02654	T	1	-2.3603	7.4455	0.27209	0.4001:0.0:0.5998:0.0	.	135;176	Q564N3;Q8WW43	.;APH1B_HUMAN	I	135;176	ENSP00000369700:V135I;ENSP00000261879:V176I	ENSP00000261879:V176I	V	+	1	0	APH1B	61381644	0.985000	0.35326	0.017000	0.16124	0.761000	0.43186	0.881000	0.28173	0.005000	0.14708	-0.157000	0.13467	GTA	APH1B	-	pfam_Aph-1	ENSG00000138613		0.498	APH1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APH1B	HGNC	protein_coding	OTTHUMT00000256337.1		0.00	29	0	G	NM_031301		63594591	+1			no_errors	ENST00000261879	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.468	A
AR	367	genome.wustl.edu	37	X	66863160	66863160	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:66863160G>A	ENST00000374690.3	+	2	2203	c.1679G>A	c.(1678-1680)tGc>tAc	p.C560Y	AR_ENST00000396044.3_Missense_Mutation_p.C560Y|AR_ENST00000504326.1_Missense_Mutation_p.C560Y|AR_ENST00000513847.1_3'UTR|AR_ENST00000396043.2_Missense_Mutation_p.C28Y	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	559	Interaction with LPXN.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CAGAAGACCTGCCTGATCTGT	0.478									Androgen Insensitivity Syndrome																																								0			GRCh37	CM920069	AR	M							147.0	121.0	130.0					X																	66863160		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.1679G>A	X.37:g.66863160G>A	ENSP00000363822:p.Cys560Tyr		A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt	p.C560Y	ENST00000374690.3	37	c.1679	CCDS14387.1	X	.	.	.	.	.	.	.	.	.	.	G	23.0	4.362937	0.82353	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000504326;ENST00000396044;ENST00000396043	D;D;D;D	0.99902	-7.66;-7.66;-7.66;-7.66	5.37	5.37	0.77165	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.000000	0.85682	D	0.000000	D	0.99926	0.9966	H	0.98178	4.165	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.97110	0.998;0.998;1.0;0.999	D	0.95966	0.8966	10	0.87932	D	0	.	15.4234	0.75031	0.0:0.0:1.0:0.0	.	560;560;28;559	E7EVX6;D3YPQ2;F1D8N5;P10275	.;.;.;ANDR_HUMAN	Y	370;560;560;560;28	ENSP00000363822:C560Y;ENSP00000421155:C560Y;ENSP00000379359:C560Y;ENSP00000379358:C28Y	ENSP00000363822:C560Y	C	+	2	0	AR	66779885	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.642000	0.98461	2.234000	0.73211	0.523000	0.50628	TGC	AR	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt	ENSG00000169083		0.478	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	HGNC	protein_coding	OTTHUMT00000057007.1	-	0.00	47	0	G	NM_000044		66863160	+1	tier1	-	no_errors	ENST00000374690	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	A
ARFGEF2	10564	genome.wustl.edu	37	20	47570297	47570297	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr20:47570297G>A	ENST00000371917.4	+	6	808	c.808G>A	c.(808-810)Gca>Aca	p.A270T		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	270					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AAATGGAGACGCACCCAGAGA	0.483																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)												0													79.0	77.0	78.0					20																	47570297		2203	4300	6503	SO:0001583	missense	0			AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.808G>A	20.37:g.47570297G>A	ENSP00000360985:p.Ala270Thr		Q5TFT9|Q9NTS1	Missense_Mutation	SNP	pfam_Sec7_dom,pfam_DUF1981_Sec7_assoc,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.A270T	ENST00000371917.4	37	c.808	CCDS13411.1	20	.	.	.	.	.	.	.	.	.	.	G	3.366	-0.129488	0.06753	.	.	ENSG00000124198	ENST00000538445;ENST00000371917	T	0.22539	1.95	5.76	1.63	0.23807	Armadillo-type fold (1);	0.865213	0.10550	N	0.661607	T	0.10078	0.0247	N	0.19112	0.55	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.39603	-0.9606	10	0.02654	T	1	.	5.9422	0.19199	0.226:0.1369:0.6371:0.0	.	270	Q9Y6D5	BIG2_HUMAN	T	270	ENSP00000360985:A270T	ENSP00000360985:A270T	A	+	1	0	ARFGEF2	47003704	0.000000	0.05858	0.000000	0.03702	0.110000	0.19582	0.288000	0.18939	0.149000	0.19098	-0.137000	0.14449	GCA	ARFGEF2	-	superfamily_ARM-type_fold	ENSG00000124198		0.483	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF2	HGNC	protein_coding	OTTHUMT00000079627.1	-	0.00	37	0	G	NM_006420		47570297	+1	tier1	-	no_errors	ENST00000371917	ensembl	human	known	74_37	missense	24.29	53	17	SNP	0.000	A
ARHGAP19	84986	genome.wustl.edu	37	10	99006069	99006069	+	Missense_Mutation	SNP	G	G	A	rs372891158		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:99006069G>A	ENST00000358531.4	-	7	981	c.953C>T	c.(952-954)gCg>gTg	p.A318V	ARHGAP19-SLIT1_ENST00000358308.3_Missense_Mutation_p.A289V|ARHGAP19_ENST00000487035.1_5'UTR|ARHGAP19_ENST00000355366.5_Missense_Mutation_p.A309V|ARHGAP19-SLIT1_ENST00000453547.2_Missense_Mutation_p.A318V|ARHGAP19-SLIT1_ENST00000316676.8_Missense_Mutation_p.A318V|ARHGAP19_ENST00000371027.1_Missense_Mutation_p.A309V	NM_001204300.1|NM_032900.5	NP_001191229.1|NP_116289.4	Q14CB8	RHG19_HUMAN	Rho GTPase activating protein 19	318					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|urinary_tract(1)	13		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)		GTGCAATCTCGCACACTCCCG	0.433																																																	0								G	VAL/ALA,VAL/ALA	0,4406		0,0,2203	76.0	73.0	74.0		866,953	5.7	1.0	10		74	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ARHGAP19	NM_001204300.1,NM_032900.5	64,64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	289/466,318/495	99006069	1,13005	2203	4300	6503	SO:0001583	missense	0			AK074122	CCDS7454.2, CCDS58092.1, CCDS73175.1	10q24.2	2011-06-29			ENSG00000213390	ENSG00000213390		"""Rho GTPase activating proteins"""	23724	protein-coding gene	gene with protein product		611587					Standard	NM_032900		Approved	FLJ00194, MGC14258	uc001knb.3	Q14CB8	OTTHUMG00000018845	ENST00000358531.4:c.953C>T	10.37:g.99006069G>A	ENSP00000351333:p.Ala318Val		A1XCP1|B4DZR1|Q14CF2|Q5J8M2|Q5T460|Q5T462|Q68DG6|Q8N9X1|Q8NF34|Q8TEK1	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.A318V	ENST00000358531.4	37	c.953	CCDS7454.2	10	.	.	.	.	.	.	.	.	.	.	G	13.30	2.196646	0.38806	0.0	1.16E-4	ENSG00000213390	ENST00000453547;ENST00000316676;ENST00000355366;ENST00000358531;ENST00000371027;ENST00000393817;ENST00000358308	T;T;T;T;T;T	0.11604	3.18;3.2;3.21;3.2;3.21;2.76	5.66	5.66	0.87406	.	0.000000	0.85682	U	0.000000	T	0.16471	0.0396	N	0.19112	0.55	0.51767	D	0.999934	D;D;D	0.89917	0.999;0.999;1.0	D;P;D	0.65233	0.933;0.843;0.925	T	0.01961	-1.1239	10	0.02654	T	1	-7.3623	19.7515	0.96270	0.0:0.0:1.0:0.0	.	289;318;309	Q14CB8-6;Q14CB8;Q14CB8-3	.;RHG19_HUMAN;.	V	318;318;309;318;309;137;289	ENSP00000414774:A318V;ENSP00000324468:A318V;ENSP00000347526:A309V;ENSP00000351333:A318V;ENSP00000360066:A309V;ENSP00000351058:A289V	ENSP00000324468:A318V	A	-	2	0	ARHGAP19	98996059	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	6.333000	0.72939	2.650000	0.89964	0.650000	0.86243	GCG	ARHGAP19-SLIT1	-	NULL	ENSG00000269891		0.433	ARHGAP19-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP19-SLIT1	HGNC	protein_coding	OTTHUMT00000049647.2	-	0.00	23	0	G	NM_032900		99006069	-1	tier1	-	no_errors	ENST00000453547	ensembl	human	known	74_37	missense	26.47	25	9	SNP	1.000	A
ARHGAP23	57636	genome.wustl.edu	37	17	36666573	36666573	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:36666573G>T	ENST00000431231.2	+	24	3909	c.3841G>T	c.(3841-3843)Gag>Tag	p.E1281*	ARHGAP23_ENST00000443378.1_Nonsense_Mutation_p.E1187*	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	1281					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						CGAGCGTAGCGAGCTGAGCCA	0.741																																																	0													2.0	3.0	3.0					17																	36666573		540	1368	1908	SO:0001587	stop_gained	0			AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.3841G>T	17.37:g.36666573G>T	ENSP00000393539:p.Glu1281*			Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_PDZ,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.E1281*	ENST00000431231.2	37	c.3841	CCDS56027.1	17	.	.	.	.	.	.	.	.	.	.	G	40	7.916436	0.98560	.	.	ENSG00000225485	ENST00000431231;ENST00000443378	.	.	.	3.35	3.35	0.38373	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	13.4609	0.61227	0.0:0.0:1.0:0.0	.	.	.	.	X	1281;1187	.	ENSP00000393539:E1281X	E	+	1	0	ARHGAP23	33920099	1.000000	0.71417	1.000000	0.80357	0.294000	0.27393	3.915000	0.56409	1.423000	0.47198	0.289000	0.19496	GAG	ARHGAP23	-	NULL	ENSG00000225485		0.741	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP23	HGNC	protein_coding	OTTHUMT00000441789.1	-	0.00	9	0	G	XM_290799		36666573	+1	tier1	-	no_errors	ENST00000431231	ensembl	human	known	74_37	nonsense	50.00	6	6	SNP	1.000	T
ARHGAP28	79822	genome.wustl.edu	37	18	6882152	6882152	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr18:6882152T>C	ENST00000383472.4	+	11	1411	c.1307T>C	c.(1306-1308)cTt>cCt	p.L436P	ARHGAP28_ENST00000532996.1_Missense_Mutation_p.L259P|ARHGAP28_ENST00000531294.1_Missense_Mutation_p.L272P|ARHGAP28_ENST00000314319.3_Missense_Mutation_p.L277P|ARHGAP28_ENST00000262227.3_Missense_Mutation_p.L384P|ARHGAP28_ENST00000419673.2_Missense_Mutation_p.L277P|ARHGAP28_ENST00000418986.1_Missense_Mutation_p.L277P|ARHGAP28_ENST00000400091.2_Missense_Mutation_p.L436P			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	436	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)	p.L436P(1)|p.L277P(1)|p.L436R(1)|p.L277R(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				CGTGAAGAACTTGATGCCAAG	0.378																																																	4	Substitution - Missense(4)	large_intestine(4)											151.0	146.0	148.0					18																	6882152		2203	4300	6503	SO:0001583	missense	0			BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.1307T>C	18.37:g.6882152T>C	ENSP00000372964:p.Leu436Pro		A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.L436P	ENST00000383472.4	37	c.1307		18	.	.	.	.	.	.	.	.	.	.	T	20.5	4.004380	0.74932	.	.	ENSG00000088756	ENST00000400091;ENST00000262227;ENST00000419673;ENST00000531294;ENST00000314319;ENST00000418986;ENST00000532996;ENST00000383472	T;T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86;1.86	5.68	5.68	0.88126	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.151215	0.44285	D	0.000463	T	0.60702	0.2289	M	0.91612	3.225	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.998;0.997	T	0.70718	-0.4795	10	0.87932	D	0	.	15.9369	0.79717	0.0:0.0:0.0:1.0	.	436;268;277;384	Q9P2N2;E9PRP2;F6VKJ9;Q9P2N2-2	RHG28_HUMAN;.;.;.	P	436;384;277;272;277;277;268;259	ENSP00000382963:L436P;ENSP00000262227:L384P;ENSP00000392660:L277P;ENSP00000437262:L272P;ENSP00000313506:L277P;ENSP00000406907:L277P	ENSP00000262227:L384P	L	+	2	0	ARHGAP28	6872152	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.655000	0.74392	2.172000	0.68678	0.533000	0.62120	CTT	ARHGAP28	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000088756		0.378	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	ARHGAP28	HGNC	protein_coding	OTTHUMT00000442123.3	-	0.00	41	0	T	XM_371108		6882152	+1	tier1	-	no_errors	ENST00000400091	ensembl	human	known	74_37	missense	28.38	53	21	SNP	1.000	C
ASB6	140459	genome.wustl.edu	37	9	132400502	132400502	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:132400502C>T	ENST00000277458.4	-	6	998	c.833G>A	c.(832-834)cGc>cAc	p.R278H	RP11-483H20.4_ENST00000455074.1_RNA|ASB6_ENST00000450050.2_Missense_Mutation_p.R199H|ASB6_ENST00000277459.4_3'UTR	NM_017873.3	NP_060343.1	Q9NWX5	ASB6_HUMAN	ankyrin repeat and SOCS box containing 6	278					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				NS(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	15		Ovarian(14;0.00556)				CAGGAGGAAGCGCAGGAGAGG	0.622																																																	0													53.0	50.0	51.0					9																	132400502		2203	4300	6503	SO:0001583	missense	0				CCDS6924.1, CCDS6925.1, CCDS75919.1	9q34.13	2013-01-10	2011-01-25		ENSG00000148331	ENSG00000148331		"""Ankyrin repeat domain containing"""	17181	protein-coding gene	gene with protein product		615051	"""ankyrin repeat and SOCS box-containing 6"""				Standard	NM_017873		Approved		uc004byf.2	Q9NWX5	OTTHUMG00000020787	ENST00000277458.4:c.833G>A	9.37:g.132400502C>T	ENSP00000277458:p.Arg278His		Q5SZB7|Q9BV15	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.R278H	ENST00000277458.4	37	c.833	CCDS6924.1	9	.	.	.	.	.	.	.	.	.	.	C	17.52	3.410311	0.62399	.	.	ENSG00000148331	ENST00000277458;ENST00000450050	T;T	0.55760	0.5;0.5	4.65	3.73	0.42828	Ankyrin repeat-containing domain (2);	0.239981	0.42821	D	0.000646	T	0.45256	0.1333	L	0.27053	0.805	0.38339	D	0.944027	P;D;P	0.52996	0.923;0.957;0.824	B;P;B	0.46339	0.333;0.513;0.333	T	0.55528	-0.8127	10	0.72032	D	0.01	-23.9582	13.7927	0.63152	0.0:0.845:0.155:0.0	.	199;278;278	B4DRC4;A8K9U2;Q9NWX5	.;.;ASB6_HUMAN	H	278;199	ENSP00000277458:R278H;ENSP00000416172:R199H	ENSP00000277458:R278H	R	-	2	0	ASB6	131440323	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.046000	0.49846	1.137000	0.42214	0.462000	0.41574	CGC	ASB6	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt	ENSG00000148331		0.622	ASB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB6	HGNC	protein_coding	OTTHUMT00000054594.1		0.00	44	0	C	NM_017873		132400502	-1			no_errors	ENST00000277458	ensembl	human	known	74_37	missense	11.76	15	2	SNP	1.000	T
ASH1L	55870	genome.wustl.edu	37	1	155450308	155450308	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:155450308A>G	ENST00000368346.3	-	3	2992	c.2353T>C	c.(2353-2355)Tcc>Ccc	p.S785P	ASH1L_ENST00000392403.3_Missense_Mutation_p.S785P			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	785					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GGAGCTGTGGATTTGCTCAAC	0.403																																																	0													156.0	154.0	155.0					1																	155450308		2203	4298	6501	SO:0001583	missense	0			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.2353T>C	1.37:g.155450308A>G	ENSP00000357330:p.Ser785Pro		Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.S785P	ENST00000368346.3	37	c.2353		1	.	.	.	.	.	.	.	.	.	.	A	10.64	1.407894	0.25378	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.89939	-2.59;-2.59	5.44	5.44	0.79542	.	0.206894	0.35124	N	0.003438	T	0.69744	0.3145	N	0.14661	0.345	0.80722	D	1	B;B	0.11235	0.002;0.004	B;B	0.10450	0.002;0.005	T	0.69343	-0.5170	10	0.42905	T	0.14	.	10.673	0.45770	0.7197:0.2803:0.0:0.0	.	785;785	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	P	785	ENSP00000357330:S785P;ENSP00000376204:S785P	ENSP00000357330:S785P	S	-	1	0	ASH1L	153716932	0.972000	0.33761	0.997000	0.53966	0.994000	0.84299	0.623000	0.24447	2.287000	0.76781	0.528000	0.53228	TCC	ASH1L	-	NULL	ENSG00000116539		0.403	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	HGNC	protein_coding	OTTHUMT00000039400.1	-	0.00	40	0	A	NM_018489		155450308	-1	tier1	-	no_errors	ENST00000368346	ensembl	human	known	74_37	missense	7.84	46	4	SNP	0.995	G
ASPM	259266	genome.wustl.edu	37	1	197091057	197091057	+	Silent	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:197091057G>C	ENST00000367409.4	-	16	4114	c.3858C>G	c.(3856-3858)ctC>ctG	p.L1286L	ASPM_ENST00000367408.1_Silent_p.L536L|ASPM_ENST00000294732.7_Silent_p.L1286L	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	1286					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						GATGGCGTTTGAGATCTGTTT	0.308																																																	0													118.0	119.0	118.0					1																	197091057		2203	4299	6502	SO:0001819	synonymous_variant	0			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.3858C>G	1.37:g.197091057G>C			Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Silent	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.L1286	ENST00000367409.4	37	c.3858	CCDS1389.1	1																																																																																			ASPM	-	superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_IQ_motif_EF-hand-BS	ENSG00000066279		0.308	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1	-	0.00	47	0	G	NM_018136		197091057	-1	tier1	-	no_errors	ENST00000367409	ensembl	human	known	74_37	silent	29.31	41	17	SNP	0.004	C
ASXL3	80816	genome.wustl.edu	37	18	31318535	31318535	+	Silent	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr18:31318535T>C	ENST00000269197.5	+	11	1167	c.1167T>C	c.(1165-1167)acT>acC	p.T389T		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	389					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CATGTGGGACTTCTGGCCTTC	0.483																																																	0													62.0	64.0	64.0					18																	31318535		1931	4144	6075	SO:0001819	synonymous_variant	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.1167T>C	18.37:g.31318535T>C			Q6ZMX6|Q96MU3|Q9UFC5	Silent	SNP	superfamily_Znf_FYVE_PHD	p.T389	ENST00000269197.5	37	c.1167	CCDS45847.1	18																																																																																			ASXL3	-	NULL	ENSG00000141431		0.483	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	-	0.00	61	0	T			31318535	+1	tier1	-	no_errors	ENST00000269197	ensembl	human	known	74_37	silent	30.77	27	12	SNP	0.660	C
ATG13	9776	genome.wustl.edu	37	11	46681022	46681022	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:46681022delC	ENST00000434074.1	+	10	1465	c.776delC	c.(775-777)tccfs	p.S259fs	ATG13_ENST00000529655.1_Frame_Shift_Del_p.S259fs|ATG13_ENST00000530500.1_Frame_Shift_Del_p.S180fs|ATG13_ENST00000526508.1_Frame_Shift_Del_p.S259fs|ATG13_ENST00000312040.4_Frame_Shift_Del_p.S259fs|ATG13_ENST00000524625.1_Frame_Shift_Del_p.S259fs|ATG13_ENST00000528494.1_Frame_Shift_Del_p.S259fs|ATG13_ENST00000359513.4_Frame_Shift_Del_p.S259fs|ATG13_ENST00000451945.1_Frame_Shift_Del_p.S259fs	NM_001205120.1	NP_001192049.1	O75143	ATG13_HUMAN	autophagy related 13	259					autophagic vacuole assembly (GO:0000045)	ATG1/UKL1 signaling complex (GO:0034273)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)|ULK1-ATG13-FIP200 complex (GO:0070969)	protein kinase binding (GO:0019901)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|prostate(1)|skin(1)	15						TTTTCCACCTCCCCACCATCC	0.443																																																	0													83.0	75.0	77.0					11																	46681022		2201	4299	6500	SO:0001589	frameshift_variant	0			AB014552	CCDS7921.1, CCDS44582.1, CCDS55760.1, CCDS55761.1	11p11.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000175224	ENSG00000175224			29091	protein-coding gene	gene with protein product		615088	"""KIAA0652"", ""ATG13 autophagy related 13 homolog (S. cerevisiae)"""	KIAA0652		15169610, 18339812, 17204848	Standard	NM_001205120		Approved		uc001nda.3	O75143	OTTHUMG00000166538	ENST00000434074.1:c.776delC	11.37:g.46681022delC	ENSP00000400642:p.Ser259fs		B4DFI4|D3DQQ1|D3DQQ2|E9PQZ8|Q53EN6|Q9BRL3|Q9H8B0	Frame_Shift_Del	DEL	pfam_Autophagy-rel_p13	p.P260fs	ENST00000434074.1	37	c.776	CCDS44582.1	11																																																																																			ATG13	-	NULL	ENSG00000175224		0.443	ATG13-202	KNOWN	basic|CCDS	protein_coding	ATG13	HGNC	protein_coding	OTTHUMT00000390300.2		0.00	40	0	C	NM_014741		46681022	+1	tier1		no_errors	ENST00000312040	ensembl	human	known	74_37	frame_shift_del	5.26	36	2	DEL	1.000	-
ATG4D	84971	genome.wustl.edu	37	19	10662891	10662891	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:10662891G>A	ENST00000309469.4	+	9	1306	c.1133G>A	c.(1132-1134)tGc>tAc	p.C378Y	RNU7-140P_ENST00000459546.1_RNA|MIR1238_ENST00000408483.1_RNA|ATG4D_ENST00000540862.1_Missense_Mutation_p.C45Y	NM_032885.4	NP_116274.3	Q86TL0	ATG4D_HUMAN	autophagy related 4D, cysteine peptidase	378					apoptotic process (GO:0006915)|autophagy (GO:0006914)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	19			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			TCCTTCCACTGCACCTCGCCC	0.622																																																	0													86.0	82.0	83.0					19																	10662891		2203	4300	6503	SO:0001583	missense	0			AJ312332	CCDS12241.1	19p13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000130734	ENSG00000130734			20789	protein-coding gene	gene with protein product		611340	"""AUT-like 4, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog D (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog D (S. cerevisiae)"""	AUTL4, APG4D		12446702	Standard	NM_032885		Approved	APG4-D	uc002mov.3	Q86TL0	OTTHUMG00000180582	ENST00000309469.4:c.1133G>A	19.37:g.10662891G>A	ENSP00000311318:p.Cys378Tyr		Q969K0	Missense_Mutation	SNP	pfam_Peptidase_C54	p.C378Y	ENST00000309469.4	37	c.1133	CCDS12241.1	19	.	.	.	.	.	.	.	.	.	.	G	25.3	4.627196	0.87560	.	.	ENSG00000130734	ENST00000309469;ENST00000540862	T	0.48836	0.8	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.76062	0.3935	M	0.91768	3.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.81411	-0.0945	10	0.66056	D	0.02	-17.2164	18.0197	0.89252	0.0:0.0:1.0:0.0	.	315;378	B4DGM8;Q86TL0	.;ATG4D_HUMAN	Y	378;45	ENSP00000311318:C378Y	ENSP00000311318:C378Y	C	+	2	0	ATG4D	10523891	1.000000	0.71417	0.999000	0.59377	0.776000	0.43924	9.404000	0.97306	2.635000	0.89317	0.561000	0.74099	TGC	ATG4D	-	pfam_Peptidase_C54	ENSG00000130734		0.622	ATG4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG4D	HGNC	protein_coding	OTTHUMT00000452022.1		0.00	68	0	G	NM_032885		10662891	+1			no_errors	ENST00000309469	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	A
ATG7	10533	genome.wustl.edu	37	3	11399890	11399890	+	Splice_Site	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:11399890A>G	ENST00000354449.3	+	13	1309		c.e13-1		ATG7_ENST00000446450.2_Splice_Site|ATG7_ENST00000354956.5_Splice_Site	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7						adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						GTGTTTCCCTAGAATGCCAGA	0.498																																																	0													197.0	186.0	190.0					3																	11399890		2203	4300	6503	SO:0001630	splice_region_variant	0			AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740	ENST00000354449.3:c.1285-1A>G	3.37:g.11399890A>G			B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Splice_Site	SNP	-	e12-2	ENST00000354449.3	37	c.1285-2	CCDS2605.1	3	.	.	.	.	.	.	.	.	.	.	A	21.3	4.129528	0.77549	.	.	ENSG00000197548	ENST00000446450;ENST00000354956;ENST00000354449	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6945	0.77484	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATG7	11374890	1.000000	0.71417	0.920000	0.36463	0.806000	0.45545	8.786000	0.91826	2.118000	0.64928	0.533000	0.62120	.	ATG7	-	-	ENSG00000197548		0.498	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG7	HGNC	protein_coding	OTTHUMT00000251951.3	-	0.00	45	0	A	NM_006395	Intron	11399890	+1	tier1	-	no_errors	ENST00000354449	ensembl	human	known	74_37	splice_site	8.33	43	4	SNP	0.999	G
ATP5C1	509	genome.wustl.edu	37	10	7841141	7841142	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:7841141_7841142delAG	ENST00000356708.7	+	4	491_492	c.412_413delAG	c.(412-414)agafs	p.R138fs	ATP5C1_ENST00000335698.4_Frame_Shift_Del_p.R138fs|ATP5C1_ENST00000541227.1_Frame_Shift_Del_p.R91fs|ATP5C1_ENST00000493053.1_3'UTR	NM_001001973.1	NP_001001973.1	P36542	ATPG_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1	138					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, catalytic core F(1) (GO:0000275)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	16						TGACAAAATCAGAGGCATACTT	0.332																																					Melanoma(143;1012 1820 16249 30920 33158)												0																																										SO:0001589	frameshift_variant	0			D16561	CCDS7081.1, CCDS31142.1	10p14	2012-10-12			ENSG00000165629	ENSG00000165629		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	833	protein-coding gene	gene with protein product		108729		ATP5CL1, ATP5C		8168843, 8227057	Standard	NM_005174		Approved		uc001iju.3	P36542	OTTHUMG00000017639	ENST00000356708.7:c.412_413delAG	10.37:g.7841143_7841144delAG	ENSP00000349142:p.Arg138fs		A8KA31|Q5VYP3|Q6I9V2|Q96AS8	Frame_Shift_Del	DEL	pfam_ATPase_F1-cplx_gsu,superfamily_ATPase_F1_gsu_dom,prints_ATPase_F1-cplx_gsu,tigrfam_ATPase_F1-cplx_gsu	p.G139fs	ENST00000356708.7	37	c.412_413	CCDS31142.1	10																																																																																			ATP5C1	-	pfam_ATPase_F1-cplx_gsu,superfamily_ATPase_F1_gsu_dom,tigrfam_ATPase_F1-cplx_gsu	ENSG00000165629		0.332	ATP5C1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP5C1	HGNC	protein_coding	OTTHUMT00000046708.1		0.00	71	0	AG	NM_005174		7841142	+1	tier1		no_errors	ENST00000356708	ensembl	human	known	74_37	frame_shift_del	17.11	63	13	DEL	1.000:1.000	-
ATRNL1	26033	genome.wustl.edu	37	10	117059709	117059709	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:117059709A>T	ENST00000355044.3	+	16	2707	c.2581A>T	c.(2581-2583)Aat>Tat	p.N861Y	ATRNL1_ENST00000303745.7_5'Flank|ATRNL1_ENST00000423111.2_5'Flank	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	861	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CTTAAAAGCTAATCCTTGTAC	0.428																																																	0													81.0	79.0	80.0					10																	117059709		2203	4300	6503	SO:0001583	missense	0			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2581A>T	10.37:g.117059709A>T	ENSP00000347152:p.Asn861Tyr		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_Plexin_repeat,pfam_CUB_dom,pfam_EGF_extracell,superfamily_C-type_lectin_fold,superfamily_CUB_dom,superfamily_Plexin-like_fold,smart_EG-like_dom,smart_CUB_dom,smart_Plexin-like_fold,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.N861Y	ENST00000355044.3	37	c.2581	CCDS7592.1	10	.	.	.	.	.	.	.	.	.	.	A	12.02	1.811812	0.32053	.	.	ENSG00000107518	ENST00000355044	T	0.18810	2.19	5.45	5.45	0.79879	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.000000	0.85682	D	0.000000	T	0.22475	0.0542	L	0.32530	0.975	0.80722	D	1	D	0.54397	0.966	P	0.47299	0.543	T	0.01273	-1.1399	10	0.30078	T	0.28	-14.9003	15.8142	0.78586	1.0:0.0:0.0:0.0	.	861	Q5VV63	ATRN1_HUMAN	Y	861	ENSP00000347152:N861Y	ENSP00000347152:N861Y	N	+	1	0	ATRNL1	117049699	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.203000	0.77864	2.197000	0.70478	0.477000	0.44152	AAT	ATRNL1	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000107518		0.428	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRNL1	HGNC	protein_coding	OTTHUMT00000050507.3	-	0.00	54	0	A	XM_049349		117059709	+1	tier1	-	no_errors	ENST00000355044	ensembl	human	known	74_37	missense	20.83	38	10	SNP	1.000	T
ATRNL1	26033	genome.wustl.edu	37	10	117075097	117075097	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:117075097A>C	ENST00000355044.3	+	18	3014	c.2888A>C	c.(2887-2889)gAt>gCt	p.D963A	ATRNL1_ENST00000303745.7_5'UTR|ATRNL1_ENST00000423111.2_Missense_Mutation_p.D60A	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	963	PSI 5.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TGGTGCAATGATCCTAGTAAT	0.443																																																	0													130.0	113.0	119.0					10																	117075097		2203	4300	6503	SO:0001583	missense	0			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2888A>C	10.37:g.117075097A>C	ENSP00000347152:p.Asp963Ala		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_Plexin_repeat,pfam_CUB_dom,pfam_EGF_extracell,superfamily_C-type_lectin_fold,superfamily_CUB_dom,superfamily_Plexin-like_fold,smart_EG-like_dom,smart_CUB_dom,smart_Plexin-like_fold,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.D963A	ENST00000355044.3	37	c.2888	CCDS7592.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.3|24.3	4.511192|4.511192	0.85389|0.85389	.|.	.|.	ENSG00000107518|ENSG00000107518	ENST00000355044;ENST00000423111|ENST00000526373	T;D|.	0.85258|.	2.21;-1.96|.	5.34|5.34	5.34|5.34	0.76211|0.76211	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.77758|.	0.4178|.	M|M	0.82517|0.82517	2.595|2.595	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.998;0.998|.	T|.	0.79918|.	-0.1600|.	10|.	0.87932|.	D|.	0|.	-25.956|-25.956	15.3184|15.3184	0.74102|0.74102	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	60;963|.	B4DH41;Q5VV63|.	.;ATRN1_HUMAN|.	A|C	963;60|92	ENSP00000347152:D963A;ENSP00000409624:D60A|.	ENSP00000347152:D963A|.	D|X	+|+	2|3	0|0	ATRNL1|ATRNL1	117065087|117065087	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.210000|9.210000	0.95106|0.95106	2.031000|2.031000	0.59945|0.59945	0.374000|0.374000	0.22700|0.22700	GAT|TGA	ATRNL1	-	pfam_Plexin_repeat,superfamily_Plexin-like_fold,smart_Plexin-like_fold	ENSG00000107518		0.443	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRNL1	HGNC	protein_coding	OTTHUMT00000050507.3	-	0.00	39	0	A	XM_049349		117075097	+1	tier1	-	no_errors	ENST00000355044	ensembl	human	known	74_37	missense	10.00	53	6	SNP	1.000	C
ATXN1L	342371	genome.wustl.edu	37	16	71885137	71885137	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr16:71885137A>T	ENST00000427980.2	+	3	1787	c.1494A>T	c.(1492-1494)gaA>gaT	p.E498D	ATXN1L_ENST00000569119.1_Intron	NM_001137675.3	NP_001131147.1	P0C7T5	ATX1L_HUMAN	ataxin 1-like	498	AXH. {ECO:0000255|PROSITE- ProRule:PRU00496}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)	4						GCAGTGCCGAAGTGAGCGGGG	0.567																																																	0													88.0	89.0	89.0					16																	71885137		692	1591	2283	SO:0001583	missense	0				CCDS45523.1	16q22.2	2014-09-04			ENSG00000224470	ENSG00000224470			33279	protein-coding gene	gene with protein product	"""brother of ataxin 1"""	614301				16121196, 17322884, 21475249	Standard	NM_001137675		Approved	BOAT1	uc002fbd.3	P0C7T5	OTTHUMG00000176872	ENST00000427980.2:c.1494A>T	16.37:g.71885137A>T	ENSP00000415822:p.Glu498Asp			Missense_Mutation	SNP	pfam_Ataxin-1_HBP1,superfamily_Ataxin-1_HBP1,smart_Ataxin_AXH_dom,pfscan_Ataxin-1_HBP1	p.E498D	ENST00000427980.2	37	c.1494	CCDS45523.1	16	.	.	.	.	.	.	.	.	.	.	A	16.42	3.118449	0.56505	.	.	ENSG00000224470	ENST00000427980	T	0.38722	1.12	5.61	3.06	0.35304	Ataxin-1/HBP1 module (AXH) (3);	.	.	.	.	T	0.46964	0.1420	L	0.35487	1.065	0.46336	D	0.998992	D	0.57899	0.981	D	0.69824	0.966	T	0.43114	-0.9411	9	0.62326	D	0.03	-1.1469	6.1364	0.20235	0.7057:0.0:0.2943:0.0	.	498	P0C7T5	ATX1L_HUMAN	D	498	ENSP00000415822:E498D	ENSP00000415822:E498D	E	+	3	2	ATXN1L	70442638	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.513000	0.53414	1.067000	0.40740	0.454000	0.30748	GAA	ATXN1L	-	pfam_Ataxin-1_HBP1,superfamily_Ataxin-1_HBP1,smart_Ataxin_AXH_dom,pfscan_Ataxin-1_HBP1	ENSG00000224470		0.567	ATXN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN1L	HGNC	protein_coding	OTTHUMT00000434171.1	-	0.00	38	0	A	NM_001137675.2		71885137	+1	tier1	-	no_errors	ENST00000427980	ensembl	human	known	74_37	missense	26.67	22	8	SNP	1.000	T
AXL	558	genome.wustl.edu	37	19	41765522	41765522	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:41765522C>T	ENST00000301178.4	+	20	2588	c.2398C>T	c.(2398-2400)Cgg>Tgg	p.R800W	HNRNPUL1_ENST00000595018.1_5'Flank|AXL_ENST00000359092.3_Missense_Mutation_p.R791W|HNRNPUL1_ENST00000352456.3_5'Flank|AXL_ENST00000593513.1_Missense_Mutation_p.R532W	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	800	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						TACAGAGCTGCGGGAAGATTT	0.547																																																	0													69.0	73.0	72.0					19																	41765522		2203	4300	6503	SO:0001583	missense	0			M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.2398C>T	19.37:g.41765522C>T	ENSP00000301178:p.Arg800Trp		Q8N5L2|Q9UD27	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R800W	ENST00000301178.4	37	c.2398	CCDS12575.1	19	.	.	.	.	.	.	.	.	.	.	C	20.2	3.953759	0.73902	.	.	ENSG00000167601	ENST00000301178;ENST00000359092	T;T	0.62639	0.01;0.01	4.85	3.8	0.43715	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.146245	0.45606	D	0.000351	T	0.73729	0.3624	M	0.71581	2.175	0.36365	D	0.860967	D;D	0.89917	1.0;1.0	D;D	0.81914	0.992;0.995	T	0.78748	-0.2083	10	0.87932	D	0	-28.3811	7.201	0.25881	0.1719:0.7409:0.0:0.0872	.	791;800	P30530-2;P30530	.;UFO_HUMAN	W	800;791	ENSP00000301178:R800W;ENSP00000351995:R791W	ENSP00000301178:R800W	R	+	1	2	AXL	46457362	0.760000	0.28428	0.992000	0.48379	0.995000	0.86356	1.508000	0.35769	1.224000	0.43551	0.591000	0.81541	CGG	AXL	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000167601		0.547	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AXL	HGNC	protein_coding	OTTHUMT00000463323.2	-	0.00	43	0	C			41765522	+1	tier1	-	no_errors	ENST00000301178	ensembl	human	known	74_37	missense	9.84	55	6	SNP	0.999	T
BAMBI	25805	genome.wustl.edu	37	10	28971215	28971215	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:28971215A>G	ENST00000375533.3	+	3	1224	c.668A>G	c.(667-669)gAg>gGg	p.E223G		NM_012342.2	NP_036474.1	Q13145	BAMBI_HUMAN	BMP and activin membrane-bound inhibitor	223					cell migration (GO:0016477)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell shape (GO:0008360)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|type II transforming growth factor beta receptor binding (GO:0005114)			central_nervous_system(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	17						AGTGGGCACGAGAACTGCTGT	0.517																																																	0													106.0	98.0	100.0					10																	28971215		2203	4300	6503	SO:0001583	missense	0			U23070	CCDS7162.1	10p12.3-p11.2	2013-07-23	2013-07-23		ENSG00000095739	ENSG00000095739			30251	protein-coding gene	gene with protein product		604444	"""BMP and activin membrane-bound inhibitor homolog (Xenopus laevis)"""			8621228, 19758997	Standard	NM_012342		Approved	NMA	uc001iuj.1	Q13145	OTTHUMG00000017874	ENST00000375533.3:c.668A>G	10.37:g.28971215A>G	ENSP00000364683:p.Glu223Gly			Missense_Mutation	SNP	pfam_BMP/activin_membr-bound_inhib,pfam_Activin_rcpt,pirsf_BMP/activin_membr-bound_inhib	p.E223G	ENST00000375533.3	37	c.668	CCDS7162.1	10	.	.	.	.	.	.	.	.	.	.	A	24.4	4.532801	0.85812	.	.	ENSG00000095739	ENST00000375533;ENST00000542444	.	.	.	5.92	5.92	0.95590	.	0.043447	0.85682	D	0.000000	T	0.75199	0.3817	L	0.51422	1.61	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.77321	-0.2631	9	0.87932	D	0	.	16.3662	0.83325	1.0:0.0:0.0:0.0	.	223	Q13145	BAMBI_HUMAN	G	223;210	.	ENSP00000364683:E223G	E	+	2	0	BAMBI	29011221	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.901000	0.92560	2.274000	0.75844	0.533000	0.62120	GAG	BAMBI	-	pirsf_BMP/activin_membr-bound_inhib	ENSG00000095739		0.517	BAMBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAMBI	HGNC	protein_coding	OTTHUMT00000047374.1	-	0.00	52	0	A	NM_012342		28971215	+1	tier1	-	no_errors	ENST00000375533	ensembl	human	known	74_37	missense	28.85	37	15	SNP	1.000	G
BDP1	55814	genome.wustl.edu	37	5	70805440	70805440	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:70805440G>T	ENST00000358731.4	+	17	2784	c.2521G>T	c.(2521-2523)Ggg>Tgg	p.G841W	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	841	9 X 55 AA repeats of G-R-R-X-I-S-P-X-E-N- G-X-E-E-V-K-P-X-X-E-M-E-T-D-L-K-X-T-G-R- E-X-X-X-R-E-K-T-X-E-X-X-D-A-X-E-E-I-D-X- D-L-E-E-T.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TCTTGTCTCTGGGGAAATGGC	0.418																																																	0													94.0	89.0	91.0					5																	70805440		1842	4103	5945	SO:0001583	missense	0			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.2521G>T	5.37:g.70805440G>T	ENSP00000351575:p.Gly841Trp		Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.G841W	ENST00000358731.4	37	c.2521	CCDS43328.1	5	.	.	.	.	.	.	.	.	.	.	G	14.98	2.697931	0.48307	.	.	ENSG00000145734	ENST00000358731;ENST00000451951	T	0.17370	2.28	4.92	3.1	0.35709	.	0.400428	0.21392	N	0.075291	T	0.31327	0.0793	L	0.53249	1.67	0.22127	N	0.99934	D;D;D	0.89917	0.997;0.999;1.0	D;D;D	0.76575	0.958;0.969;0.988	T	0.04579	-1.0941	10	0.66056	D	0.02	.	6.5859	0.22620	0.0967:0.1811:0.7222:0.0	.	841;841;841	A6H8Y1;A6H8Y1-2;A6H8Y1-4	BDP1_HUMAN;.;.	W	841;421	ENSP00000351575:G841W	ENSP00000351575:G841W	G	+	1	0	BDP1	70841196	0.142000	0.22610	0.009000	0.14445	0.127000	0.20565	1.291000	0.33330	0.639000	0.30564	0.467000	0.42956	GGG	BDP1	-	NULL	ENSG00000145734		0.418	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BDP1	HGNC	protein_coding	OTTHUMT00000374681.2		0.00	35	0	G	NM_018429		70805440	+1			no_errors	ENST00000358731	ensembl	human	known	74_37	missense	7.69	24	2	SNP	0.074	T
BICC1	80114	genome.wustl.edu	37	10	60573843	60573843	+	Intron	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:60573843A>C	ENST00000373886.3	+	18	2537				BICC1_ENST00000263103.1_Missense_Mutation_p.K503T	NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1						multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						TCTGACTTCAAGTGCTTGGTG	0.458																																																	0																																										SO:0001627	intron_variant	0			AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.2533+97A>C	10.37:g.60573843A>C				Missense_Mutation	SNP	NULL	p.K503T	ENST00000373886.3	37	c.1508	CCDS31206.1	10	.	.	.	.	.	.	.	.	.	.	A	7.577	0.667941	0.14710	.	.	ENSG00000122870	ENST00000263103	T	0.49720	0.77	3.92	1.59	0.23543	.	.	.	.	.	T	0.27454	0.0674	.	.	.	0.09310	N	1	B	0.19583	0.037	B	0.16289	0.015	T	0.19224	-1.0312	7	.	.	.	.	5.4408	0.16507	0.769:0.0:0.231:0.0	.	797	E7EU62	.	T	503	ENSP00000263103:K503T	.	K	+	2	0	BICC1	60243849	0.000000	0.05858	0.005000	0.12908	0.303000	0.27691	0.314000	0.19432	0.341000	0.23771	-0.290000	0.09829	AAG	BICC1	-	NULL	ENSG00000122870		0.458	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BICC1	HGNC	protein_coding	OTTHUMT00000048150.2	-	0.00	23	0	A	NM_025044		60573843	+1	tier1	-	no_errors	ENST00000263103	ensembl	human	known	74_37	missense	21.15	41	11	SNP	0.004	C
BMS1P8	653557	genome.wustl.edu	37	16	33499001	33499001	+	RNA	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr16:33499001A>C	ENST00000565156.1	-	0	91									BMS1 pseudogene 8																		TAATAAATGAAGTGTTCTTGA	0.299																																																	0																																												0					16p11.2	2013-09-20			ENSG00000260518	ENSG00000260518			49152	pseudogene	pseudogene							Standard	NG_011420		Approved				OTTHUMG00000176352		16.37:g.33499001A>C				RNA	SNP	-	NULL	ENST00000565156.1	37	NULL		16																																																																																			BMS1P8	-	-	ENSG00000260518		0.299	BMS1P8-003	KNOWN	basic	processed_transcript	BMS1P8	HGNC	pseudogene	OTTHUMT00000431810.1	-	0.00	319	0	A			33499001	-1	tier1	-	no_errors	ENST00000565156	ensembl	human	known	74_37	rna	25.85	152	53	SNP	0.997	C
BOC	91653	genome.wustl.edu	37	3	112969758	112969758	+	Intron	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:112969758G>T	ENST00000495514.1	+	4	1080				BOC_ENST00000485230.1_Missense_Mutation_p.A152S|BOC_ENST00000355385.3_Intron|BOC_ENST00000273395.4_Intron|BOC_ENST00000484034.1_Missense_Mutation_p.A152S			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			CACCATTCATGCTGCCTCTTG	0.537																																																	0																																										SO:0001627	intron_variant	0			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.376+78G>T	3.37:g.112969758G>T			A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A152S	ENST00000495514.1	37	c.454	CCDS2971.1	3	.	.	.	.	.	.	.	.	.	.	g	13.50	2.254510	0.39896	.	.	ENSG00000144857	ENST00000485230;ENST00000484034	T;T	0.55234	0.53;0.53	4.45	-4.5	0.03493	.	.	.	.	.	T	0.29556	0.0737	.	.	.	0.09310	N	1	B	0.14012	0.009	B	0.10450	0.005	T	0.22417	-1.0217	7	.	.	.	.	6.8563	0.24042	0.2099:0.4192:0.3709:0.0	.	152	Q96DN7	.	S	152	ENSP00000420154:A152S;ENSP00000417337:A152S	.	A	+	1	0	BOC	114452448	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.113000	0.10774	-0.518000	0.06452	0.298000	0.19748	GCT	BOC	-	NULL	ENSG00000144857		0.537	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BOC	HGNC	protein_coding	OTTHUMT00000354485.3		0.00	22	0	G	NM_033254		112969758	+1			no_errors	ENST00000484034	ensembl	human	putative	74_37	missense	10.81	33	4	SNP	0.000	T
BRD9	65980	genome.wustl.edu	37	5	889728	889728	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:889728C>T	ENST00000467963.1	-	4	601	c.435G>A	c.(433-435)ctG>ctA	p.L145L	BRD9_ENST00000494422.1_5'Flank|BRD9_ENST00000435709.2_Silent_p.L29L|BRD9_ENST00000388890.4_Silent_p.L29L|BRD9_ENST00000323510.4_Silent_p.L29L|BRD9_ENST00000483173.1_Nonsense_Mutation_p.W94*	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	145					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			GGAAGTGTTCCAGGAGTTGCT	0.468																																																	0													105.0	102.0	103.0					5																	889728		2203	4300	6503	SO:0001819	synonymous_variant	0			AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.435G>A	5.37:g.889728C>T			A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Nonsense_Mutation	SNP	pfam_DUF3512,pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.W94*	ENST00000467963.1	37	c.281	CCDS34127.2	5	.	.	.	.	.	.	.	.	.	.	C	16.55	3.155182	0.57259	.	.	ENSG00000028310	ENST00000483173	.	.	.	5.47	-4.79	0.03200	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.8378	0.08902	0.0886:0.4665:0.1766:0.2683	.	.	.	.	X	94	.	ENSP00000419845:W94X	W	-	2	0	BRD9	942728	0.774000	0.28592	0.038000	0.18304	0.135000	0.20990	-0.206000	0.09398	-0.741000	0.04797	0.563000	0.77884	TGG	BRD9	-	superfamily_Bromodomain,smart_Bromodomain	ENSG00000028310		0.468	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD9	HGNC	protein_coding	OTTHUMT00000354113.1	-	0.00	25	0	C	NM_023924		889728	-1	tier1	-	no_errors	ENST00000483173	ensembl	human	novel	74_37	nonsense	10.00	36	4	SNP	0.691	T
BRINP1	1620	genome.wustl.edu	37	9	122004356	122004356	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:122004356T>A	ENST00000265922.3	-	4	1009	c.548A>T	c.(547-549)cAt>cTt	p.H183L	BRINP1_ENST00000373964.2_Missense_Mutation_p.H183L	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	183	MACPF.				cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											CTGGATCTCATGAAGCCTCCT	0.502																																																	0													186.0	154.0	165.0					9																	122004356		2203	4300	6503	SO:0001583	missense	0			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.548A>T	9.37:g.122004356T>A	ENSP00000265922:p.His183Leu		Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.H183L	ENST00000265922.3	37	c.548	CCDS6822.1	9	.	.	.	.	.	.	.	.	.	.	T	32	5.114168	0.94339	.	.	ENSG00000078725	ENST00000373969;ENST00000265922;ENST00000373964	T;T	0.53857	2.26;0.6	5.64	5.64	0.86602	Membrane attack complex component/perforin (MACPF) domain (1);	0.000000	0.85682	D	0.000000	T	0.70351	0.3214	M	0.64404	1.975	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.79108	0.986;0.992	T	0.73347	-0.4011	10	0.87932	D	0	-17.0859	16.152	0.81629	0.0:0.0:0.0:1.0	.	183;183	O60477-2;O60477	.;DBC1_HUMAN	L	183	ENSP00000265922:H183L;ENSP00000363075:H183L	ENSP00000265922:H183L	H	-	2	0	DBC1	121044177	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.997000	0.88414	2.279000	0.76181	0.459000	0.35465	CAT	BRINP1	-	smart_MACPF	ENSG00000078725		0.502	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP1	HGNC	protein_coding	OTTHUMT00000055440.2	-	0.00	61	0	T	NM_014618		122004356	-1	tier1	-	no_errors	ENST00000265922	ensembl	human	known	74_37	missense	15.25	50	9	SNP	1.000	A
MALRD1	340895	genome.wustl.edu	37	10	19616518	19616518	+	Silent	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:19616518T>G	ENST00000454679.2	+	8	1491	c.1491T>G	c.(1489-1491)acT>acG	p.T497T				Q5VYJ5	MALR1_HUMAN		497	MAM 3. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cholesterol homeostasis (GO:0042632)|negative regulation of bile acid biosynthetic process (GO:0070858)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				breast(1)|lung(2)	3						ATAACGTTACTTCTAAATTGT	0.378																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000454679.2:c.1491T>G	10.37:g.19616518T>G			B7ZBP2	Silent	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_LDrepeatLR_classA_rpt,prints_MAM_dom	p.T497	ENST00000454679.2	37	c.1491		10																																																																																			C10orf112	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom	ENSG00000204740		0.378	C10orf112-201	KNOWN	basic|appris_principal	protein_coding	C10orf112	HGNC	protein_coding		-	0.00	50	0	T			19616518	+1	tier1	-	no_errors	ENST00000454679	ensembl	human	known	74_37	silent	17.54	47	10	SNP	0.330	G
C11orf21	29125	genome.wustl.edu	37	11	2322980	2322980	+	Intron	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:2322980G>T	ENST00000381153.3	-	1	305				TSPAN32_ENST00000381121.3_5'Flank|TSPAN32_ENST00000451520.2_5'Flank|C11orf21_ENST00000470369.1_5'UTR|TSPAN32_ENST00000182290.4_5'Flank			Q9P2W6	CK021_HUMAN	chromosome 11 open reading frame 21							cytoplasm (GO:0005737)											AGGACGGGGAGCTCACCTCCT	0.607											OREG0003773	type=REGULATORY REGION|Gene=TSPAN32|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													71.0	80.0	77.0					11																	2322980		692	1591	2283	SO:0001627	intron_variant	0			AB029488	CCDS44518.1	11p15.5	2012-08-09			ENSG00000110665	ENSG00000110665			13231	protein-coding gene	gene with protein product		611033				11054561	Standard	NM_001142946		Approved		uc009ydj.2	Q9P2W6	OTTHUMG00000009759	ENST00000381153.3:c.53+5C>A	11.37:g.2322980G>T		602		RNA	SNP	-	NULL	ENST00000381153.3	37	NULL		11																																																																																			C11orf21	-	-	ENSG00000110665		0.607	C11orf21-001	KNOWN	basic	protein_coding	C11orf21	HGNC	protein_coding	OTTHUMT00000026908.2	-	0.00	47	0	G	NM_001142946		2322980	-1	tier1	-	no_errors	ENST00000470369	ensembl	human	known	74_37	rna	31.25	44	20	SNP	0.003	T
C12orf40	283461	genome.wustl.edu	37	12	40114981	40114981	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:40114981C>T	ENST00000324616.5	+	13	2041	c.1887C>T	c.(1885-1887)tgC>tgT	p.C629C		NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	629										breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						TTTCTCTTTGCAACCTTGAAA	0.363																																																	0													127.0	120.0	122.0					12																	40114981		1883	4123	6006	SO:0001819	synonymous_variant	0			AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.1887C>T	12.37:g.40114981C>T			B7WNU1|Q8IXY6|Q8N818|V9HW02	Silent	SNP	NULL	p.C629	ENST00000324616.5	37	c.1887	CCDS41770.1	12																																																																																			C12orf40	-	NULL	ENSG00000180116		0.363	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf40	HGNC	protein_coding	OTTHUMT00000257664.2	-	0.00	26	0	C	NM_173599		40114981	+1	tier1	-	no_errors	ENST00000324616	ensembl	human	known	74_37	silent	9.26	49	5	SNP	0.000	T
C14orf23	387978	genome.wustl.edu	37	14	29261305	29261305	+	Silent	SNP	A	A	C	rs202195469|rs200251419		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr14:29261305A>C	ENST00000399387.4	+	3	446	c.342A>C	c.(340-342)ctA>ctC	p.L114L	C14orf23_ENST00000548213.1_Intron|C14orf23_ENST00000550266.1_Intron					chromosome 14 open reading frame 23											central_nervous_system(1)	1						CTTCAGCACTAAAAAAAACAA	0.378																																																	0																																										SO:0001819	synonymous_variant	0					14q11.2	2013-01-15			ENSG00000186960	ENSG00000186960			19828	other	unknown							Standard	NR_026731		Approved		uc001wqf.3	Q86U37	OTTHUMG00000029410	ENST00000399387.4:c.342A>C	14.37:g.29261305A>C				Silent	SNP	NULL	p.L114	ENST00000399387.4	37	c.342		14																																																																																			C14orf23	-	NULL	ENSG00000186960		0.378	C14orf23-003	KNOWN	basic|appris_candidate_longest	protein_coding	C14orf23	HGNC	protein_coding	OTTHUMT00000134019.2		0.00	45	0	A	NR_026731		29261305	+1			no_errors	ENST00000399387	ensembl	human	known	74_37	silent	6.45	29	2	SNP	0.707	C
C1orf162	128346	genome.wustl.edu	37	1	112020392	112020392	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:112020392G>T	ENST00000343534.5	+	5	572	c.322G>T	c.(322-324)Gcc>Tcc	p.A108S	C1orf162_ENST00000464591.1_Intron|C1orf162_ENST00000369718.3_Missense_Mutation_p.A83S	NM_174896.2	NP_777556.1	Q8NEQ5	CA162_HUMAN	chromosome 1 open reading frame 162	108						integral component of membrane (GO:0016021)				NS(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	5		all_cancers(81;0.00116)|all_epithelial(167;0.000761)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0236)|Colorectal(144;0.0286)|all cancers(265;0.0572)|Epithelial(280;0.0862)|COAD - Colon adenocarcinoma(174;0.112)|LUSC - Lung squamous cell carcinoma(189;0.134)		AGATCCTCCAGCCAAGGTAAG	0.522																																																	0													105.0	106.0	105.0					1																	112020392		2203	4300	6503	SO:0001583	missense	0			BC017973	CCDS837.1, CCDS72837.1	1p13.2	2008-02-05			ENSG00000143110	ENSG00000143110			28344	protein-coding gene	gene with protein product						12477932	Standard	XM_005270475		Approved	MGC24133	uc001ebe.3	Q8NEQ5	OTTHUMG00000011750	ENST00000343534.5:c.322G>T	1.37:g.112020392G>T	ENSP00000344218:p.Ala108Ser		Q5QNZ1	Missense_Mutation	SNP	NULL	p.A108S	ENST00000343534.5	37	c.322	CCDS837.1	1	.	.	.	.	.	.	.	.	.	.	G	13.51	2.258484	0.39896	.	.	ENSG00000143110	ENST00000343534;ENST00000369718	T;T	0.53206	0.63;0.68	4.17	-1.13	0.09775	.	1.237250	0.05759	N	0.604518	T	0.15176	0.0366	L	0.27053	0.805	0.09310	N	1	P	0.36392	0.551	B	0.34779	0.189	T	0.24728	-1.0152	10	0.51188	T	0.08	-0.575	7.5464	0.27770	0.5444:0.0:0.4556:0.0	.	108	Q8NEQ5	CA162_HUMAN	S	108;83	ENSP00000344218:A108S;ENSP00000358732:A83S	ENSP00000344218:A108S	A	+	1	0	C1orf162	111821915	0.003000	0.15002	0.022000	0.16811	0.333000	0.28666	0.140000	0.16056	-0.190000	0.10465	0.563000	0.77884	GCC	C1orf162	-	NULL	ENSG00000143110		0.522	C1orf162-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C1orf162	HGNC	protein_coding	OTTHUMT00000032471.1		0.00	48	0	G	NM_174896		112020392	+1			no_errors	ENST00000343534	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.021	T
C1orf56	54964	genome.wustl.edu	37	1	151021185	151021185	+	Missense_Mutation	SNP	C	C	T	rs1132889	byFrequency	TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:151021185C>T	ENST00000368926.5	+	1	970	c.862C>T	c.(862-864)Ccc>Tcc	p.P288S	C1orf56_ENST00000465135.1_3'UTR	NM_017860.3	NP_060330.2	Q9BUN1	MENT_HUMAN	chromosome 1 open reading frame 56	288						cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|lung(3)|ovary(1)|prostate(1)	7	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CACCACTACCCCCTTCCCCAC	0.617											OREG0013793	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(146;891 3320 6873)												0													132.0	139.0	137.0					1																	151021185		2203	4300	6503	SO:0001583	missense	0			BC002469	CCDS980.1	1q21.2	2013-09-20			ENSG00000143443	ENSG00000143443			26045	protein-coding gene	gene with protein product	"""methylated in normal thymocytes"""					12975309, 22133874	Standard	NM_017860		Approved	FLJ20519, MENT	uc001ewn.3	Q9BUN1	OTTHUMG00000035159	ENST00000368926.5:c.862C>T	1.37:g.151021185C>T	ENSP00000357922:p.Pro288Ser	1737	B2RDU8|Q9NWZ4	Missense_Mutation	SNP	superfamily_Thrombospondin_1_rpt	p.P288S	ENST00000368926.5	37	c.862	CCDS980.1	1	.	.	.	.	.	.	.	.	.	.	C	6.207	0.406295	0.11754	.	.	ENSG00000143443	ENST00000368926	.	.	.	3.25	-5.11	0.02901	.	1.570890	0.03719	N	0.251553	T	0.03783	0.0107	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.16424	-1.0403	9	0.13853	T	0.58	-0.8005	6.3146	0.21184	0.2662:0.5421:0.0:0.1917	.	288	Q9BUN1	CA056_HUMAN	S	288	.	ENSP00000357922:P288S	P	+	1	0	C1orf56	149287809	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-2.385000	0.01062	-0.985000	0.03503	-0.423000	0.05987	CCC	C1orf56	-	NULL	ENSG00000143443		0.617	C1orf56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf56	HGNC	protein_coding	OTTHUMT00000085101.1		0.00	36	0	C	NM_017860		151021185	+1			no_errors	ENST00000368926	ensembl	human	known	74_37	missense	6.85	68	5	SNP	0.000	T
C1orf101	257044	genome.wustl.edu	37	1	244640841	244640841	+	Splice_Site	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:244640841A>G	ENST00000366534.4	+	3	168		c.e3-1		C1orf101_ENST00000366531.3_Splice_Site|C1orf101_ENST00000366533.4_Splice_Site|C1orf101_ENST00000473875.1_Splice_Site	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101							CatSper complex (GO:0036128)				NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			TTTCTTTTTTAGATTAAGTTA	0.313																																																	0													132.0	146.0	141.0					1																	244640841		2203	4297	6500	SO:0001630	splice_region_variant	0			BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.115-1A>G	1.37:g.244640841A>G			B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Splice_Site	SNP	-	e1-2	ENST00000366534.4	37	c.1-2	CCDS44340.1	1	.	.	.	.	.	.	.	.	.	.	A	14.40	2.525123	0.44969	.	.	ENSG00000179397	ENST00000391841;ENST00000366534;ENST00000366533;ENST00000428042	.	.	.	4.16	4.16	0.48862	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8759	0.41202	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C1orf101	242707464	0.999000	0.42202	0.975000	0.42487	0.693000	0.40251	3.323000	0.52014	2.113000	0.64589	0.533000	0.62120	.	C1orf101	-	-	ENSG00000179397		0.313	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	C1orf101	HGNC	protein_coding	OTTHUMT00000096701.1	-	0.00	50	0	A	NM_173807	Intron	244640841	+1	tier1	-	no_errors	ENST00000366531	ensembl	human	known	74_37	splice_site	8.77	52	5	SNP	0.988	G
C21orf58	54058	genome.wustl.edu	37	21	47734720	47734720	+	Silent	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr21:47734720G>C	ENST00000291691.7	-	5	1655	c.519C>G	c.(517-519)gcC>gcG	p.A173A	C21orf58_ENST00000397682.3_Silent_p.A67A|C21orf58_ENST00000397680.1_Silent_p.A67A|C21orf58_ENST00000397679.1_Silent_p.A67A|C21orf58_ENST00000397683.1_Silent_p.A67A	NM_058180.3	NP_478060.2	P58505	CU058_HUMAN	chromosome 21 open reading frame 58	173										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(1)|pancreas(1)	9	Breast(49;0.112)			Colorectal(79;0.239)		CTGGGGGCAGGGCTGACCCGA	0.692																																																	0													11.0	12.0	11.0					21																	47734720		2050	4083	6133	SO:0001819	synonymous_variant	0				CCDS13735.1, CCDS68229.1	21q22.3	2008-07-07			ENSG00000160298	ENSG00000160298			1300	protein-coding gene	gene with protein product							Standard	XM_005261149		Approved		uc002zjf.3	P58505	OTTHUMG00000090634	ENST00000291691.7:c.519C>G	21.37:g.47734720G>C			B3KPI1	Silent	SNP	NULL	p.A173	ENST00000291691.7	37	c.519	CCDS13735.1	21																																																																																			C21orf58	-	NULL	ENSG00000160298		0.692	C21orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf58	HGNC	protein_coding	OTTHUMT00000207283.1	-	0.00	78	0	G	NM_058180		47734720	-1	tier1	-	no_errors	ENST00000291691	ensembl	human	known	74_37	silent	34.43	40	21	SNP	0.000	C
C7orf66	154907	genome.wustl.edu	37	7	108524266	108524266	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:108524266A>G	ENST00000379007.2	-	2	200	c.146T>C	c.(145-147)cTc>cCc	p.L49P		NM_001024607.1	NP_001019778.1	A4D0T2	CG066_HUMAN	chromosome 7 open reading frame 66	49						integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	15						AAAACACTTGAGAAGGCATGA	0.428																																																	0													146.0	127.0	133.0					7																	108524266		2203	4300	6503	SO:0001583	missense	0			AF103078	CCDS34735.1	7q31.1	2009-03-06			ENSG00000205174	ENSG00000205174			33712	protein-coding gene	gene with protein product							Standard	NM_001024607		Approved		uc003vfo.3	A4D0T2	OTTHUMG00000154867	ENST00000379007.2:c.146T>C	7.37:g.108524266A>G	ENSP00000368292:p.Leu49Pro			Missense_Mutation	SNP	NULL	p.L49P	ENST00000379007.2	37	c.146	CCDS34735.1	7	.	.	.	.	.	.	.	.	.	.	A	11.70	1.716203	0.30413	.	.	ENSG00000205174	ENST00000379007	.	.	.	3.87	0.202	0.15190	.	.	.	.	.	T	0.18341	0.0440	N	0.08118	0	0.09310	N	1	B	0.27013	0.166	B	0.34873	0.191	T	0.37865	-0.9687	7	.	.	.	.	5.859	0.18736	0.6209:0.0:0.3791:0.0	.	49	A4D0T2	CG066_HUMAN	P	49	.	.	L	-	2	0	C7orf66	108311502	0.000000	0.05858	0.001000	0.08648	0.505000	0.33919	-0.095000	0.11077	0.026000	0.15269	0.460000	0.39030	CTC	C7orf66	-	NULL	ENSG00000205174		0.428	C7orf66-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	C7orf66	HGNC	protein_coding	OTTHUMT00000337420.1	-	0.00	29	0	A	NM_001024607		108524266	-1	tier1	-	no_errors	ENST00000379007	ensembl	human	putative	74_37	missense	22.86	26	8	SNP	0.001	G
FAM167A	83648	genome.wustl.edu	37	8	11295948	11295948	+	Intron	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:11295948A>T	ENST00000528897.1	-	2	1001				FAM167A_ENST00000534308.1_Intron|FAM167A_ENST00000531564.1_Intron|FAM167A_ENST00000284486.4_Intron|C8orf12_ENST00000533578.1_Missense_Mutation_p.D71V|C8orf12_ENST00000284481.3_Missense_Mutation_p.D71V			Q96KS9	F167A_HUMAN	family with sequence similarity 167, member A											breast(1)|endometrium(1)|large_intestine(4)|lung(2)|prostate(1)	9						ATTCTAGGAGATTCTATGCTA	0.398																																																	0																																										SO:0001627	intron_variant	0				CCDS5981.1	8p23-p22	2010-08-27	2008-06-11	2008-06-11	ENSG00000154319	ENSG00000154319			15549	protein-coding gene	gene with protein product		610085	"""chromosome 8 open reading frame 13"""	C8orf13			Standard	NM_053279		Approved		uc003wtw.2	Q96KS9	OTTHUMG00000129361	ENST00000528897.1:c.381+5591T>A	8.37:g.11295948A>T			A8K3T9|Q3SXY1|Q3SXY3|Q8N3M3|Q9NSR0	Missense_Mutation	SNP	NULL	p.D71V	ENST00000528897.1	37	c.212	CCDS5981.1	8	.	.	.	.	.	.	.	.	.	.	A	1.732	-0.494021	0.04322	.	.	ENSG00000184608	ENST00000284481;ENST00000533578	.	.	.	1.72	1.72	0.24424	.	.	.	.	.	T	0.39963	0.1098	.	.	.	0.20489	N	0.999893	.	.	.	.	.	.	T	0.36383	-0.9750	5	0.87932	D	0	.	5.6569	0.17647	1.0:0.0:0.0:0.0	.	.	.	.	V	71	.	ENSP00000284481:D71V	D	+	2	0	C8orf12	11333358	0.019000	0.18553	0.041000	0.18516	0.045000	0.14185	1.996000	0.40776	1.064000	0.40671	0.486000	0.48141	GAT	C8orf12	-	NULL	ENSG00000184608		0.398	FAM167A-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	C8orf12	HGNC	protein_coding	OTTHUMT00000383901.1	-	0.00	82	0	A			11295948	+1	tier1	-	no_errors	ENST00000284481	ensembl	human	known	74_37	missense	18.57	57	13	SNP	0.067	T
CABIN1	23523	genome.wustl.edu	37	22	24483514	24483514	+	Missense_Mutation	SNP	G	G	A	rs148592192		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr22:24483514G>A	ENST00000398319.2	+	23	3758	c.3373G>A	c.(3373-3375)Gtc>Atc	p.V1125I	CABIN1_ENST00000405822.2_Missense_Mutation_p.V1075I|CABIN1_ENST00000263119.5_Missense_Mutation_p.V1125I	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1125					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TGCCACGCCCGTCTTGAACTG	0.577																																																	0								G	ILE/VAL,ILE/VAL,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	96.0	79.0	85.0		3373,3223,3373	4.1	0.7	22	dbSNP_134	85	0,8600		0,0,4300	no	missense,missense,missense	CABIN1	NM_001199281.1,NM_001201429.1,NM_012295.3	29,29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	1125/2221,1075/2171,1125/2221	24483514	1,13005	2203	4300	6503	SO:0001583	missense	0			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.3373G>A	22.37:g.24483514G>A	ENSP00000381364:p.Val1125Ile		G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	pfam_MEF2_binding,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.V1125I	ENST00000398319.2	37	c.3373	CCDS13823.1	22	.	.	.	.	.	.	.	.	.	.	G	15.79	2.938576	0.52972	2.27E-4	0.0	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319	T;T;T	0.75589	-0.95;-0.95;-0.95	5.1	4.09	0.47781	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.64260	0.2582	L	0.42245	1.32	0.80722	D	1	B;B	0.30793	0.295;0.036	B;B	0.17433	0.018;0.008	T	0.64437	-0.6408	10	0.48119	T	0.1	.	13.0002	0.58670	0.078:0.0:0.922:0.0	.	1075;1125	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	I	1125;1075;1125	ENSP00000263119:V1125I;ENSP00000384694:V1075I;ENSP00000381364:V1125I	ENSP00000263119:V1125I	V	+	1	0	CABIN1	22813514	1.000000	0.71417	0.708000	0.30435	0.331000	0.28603	7.919000	0.87513	1.318000	0.45170	-0.142000	0.14014	GTC	CABIN1	-	NULL	ENSG00000099991		0.577	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABIN1	HGNC	protein_coding	OTTHUMT00000320161.2	-	0.00	17	0	G	NM_012295		24483514	+1	tier1	rs148592192	no_errors	ENST00000263119	ensembl	human	known	74_37	missense	20.00	24	6	SNP	0.996	A
CABYR	26256	genome.wustl.edu	37	18	21736850	21736850	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr18:21736850G>C	ENST00000399481.2	+	2	1243	c.1091G>C	c.(1090-1092)gGt>gCt	p.G364A	CABYR_ENST00000399496.3_Intron|CABYR_ENST00000399499.1_Intron|CABYR_ENST00000415309.2_Intron|RP11-799B12.4_ENST00000583267.1_lincRNA|CABYR_ENST00000581397.1_Intron|CABYR_ENST00000327201.6_Intron			O75952	CABYR_HUMAN	calcium binding tyrosine-(Y)-phosphorylation regulated	462					epithelial cilium movement (GO:0003351)|sperm capacitation (GO:0048240)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|protein heterodimerization activity (GO:0046982)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)	11	all_cancers(21;9.13e-05)|all_epithelial(16;5.49e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0305)|Ovarian(20;0.17)					GTGCACTCAGGTACATCTGTA	0.522																																																	0													53.0	56.0	55.0					18																	21736850		2203	4300	6503	SO:0001583	missense	0			AF088868	CCDS11881.1, CCDS11882.1, CCDS11883.1, CCDS42420.1, CCDS45840.1	18q11.2	2009-08-06	2007-11-22		ENSG00000154040	ENSG00000154040			15569	protein-coding gene	gene with protein product	"""fibrousheathin 2"", ""cancer/testis antigen 88"""	612135				11820818, 17317841, 16139264	Standard	NM_012189		Approved	FSP-2, CBP86, CT88	uc002kux.3	O75952	OTTHUMG00000037365	ENST00000399481.2:c.1091G>C	18.37:g.21736850G>C	ENSP00000382404:p.Gly364Ala		B2R857|Q8WXW5|Q9HAY3|Q9HAY4|Q9HAY5|Q9HCY9	Missense_Mutation	SNP	pfam_cAMP_dep_PK_reg_su_I/II_a/b,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,smart_cAMP_dep_PK_reg_su_I/II_a/b	p.G462A	ENST00000399481.2	37	c.1385		18	.	.	.	.	.	.	.	.	.	.	G	5.849	0.340890	0.11069	.	.	ENSG00000154040	ENST00000399481	T	0.35048	1.33	4.12	0.948	0.19561	.	0.843607	0.09904	N	0.740651	T	0.13756	0.0333	N	0.04508	-0.205	0.09310	N	1	B;B	0.16802	0.019;0.011	B;B	0.17098	0.017;0.007	T	0.29761	-1.0001	9	.	.	.	-0.0495	2.0375	0.03543	0.1152:0.1852:0.4807:0.2188	.	444;462	O75952-2;O75952	.;CABYR_HUMAN	A	364	ENSP00000382404:G364A	.	G	+	2	0	CABYR	19990848	0.007000	0.16637	0.001000	0.08648	0.096000	0.18686	0.361000	0.20267	0.392000	0.25172	0.591000	0.81541	GGT	CABYR	-	NULL	ENSG00000154040		0.522	CABYR-201	KNOWN	basic	protein_coding	CABYR	HGNC	protein_coding		-	0.00	42	0	G	NM_153770		21736850	+1	tier1	-	no_errors	ENST00000463087	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.000	C
CACNA1G	8913	genome.wustl.edu	37	17	48649272	48649272	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:48649272C>T	ENST00000359106.5	+	5	620	c.620C>T	c.(619-621)aCg>aTg	p.T207M	CACNA1G_ENST00000515165.1_Missense_Mutation_p.T207M|CACNA1G_ENST00000515765.1_Missense_Mutation_p.T207M|CACNA1G_ENST00000507896.1_Missense_Mutation_p.T207M|CACNA1G_ENST00000507336.1_Missense_Mutation_p.T207M|CACNA1G_ENST00000354983.4_Missense_Mutation_p.T207M|CACNA1G_ENST00000515411.1_Missense_Mutation_p.T207M|CACNA1G_ENST00000416767.4_Missense_Mutation_p.T207M|CACNA1G_ENST00000514717.1_Missense_Mutation_p.T207M|CACNA1G_ENST00000429973.2_Missense_Mutation_p.T207M|CACNA1G_ENST00000514181.1_Missense_Mutation_p.T207M|CACNA1G_ENST00000512389.1_Missense_Mutation_p.T207M|CACNA1G_ENST00000442258.2_Missense_Mutation_p.T207M|CACNA1G_ENST00000513964.1_Missense_Mutation_p.T207M|CACNA1G_ENST00000510366.1_Missense_Mutation_p.T207M|CACNA1G_ENST00000503485.1_Missense_Mutation_p.T207M|CACNA1G_ENST00000502264.1_Missense_Mutation_p.T207M|CACNA1G_ENST00000507510.2_Missense_Mutation_p.T207M|CACNA1G_ENST00000505165.1_Missense_Mutation_p.T207M|CACNA1G_ENST00000514079.1_Missense_Mutation_p.T207M|CACNA1G_ENST00000510115.1_Missense_Mutation_p.T207M|CACNA1G_ENST00000352832.5_Missense_Mutation_p.T207M|CACNA1G_ENST00000507609.1_Missense_Mutation_p.T207M|CACNA1G_ENST00000513689.2_Missense_Mutation_p.T207M|CACNA1G_ENST00000358244.5_Missense_Mutation_p.T207M|CACNA1G_ENST00000360761.4_Missense_Mutation_p.T207M	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	207					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	CTGCTGGATACGCTGCCCATG	0.652																																																	0													97.0	99.0	98.0					17																	48649272		2162	4259	6421	SO:0001583	missense	0			AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.620C>T	17.37:g.48649272C>T	ENSP00000352011:p.Thr207Met		D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.T207M	ENST00000359106.5	37	c.620	CCDS45730.1	17	.	.	.	.	.	.	.	.	.	.	c	22.2	4.256730	0.80246	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000416767;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98437	-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93	4.45	4.45	0.53987	Ion transport (1);	0.128498	0.56097	D	0.000026	D	0.99105	0.9692	M	0.90019	3.08	0.58432	D	0.999999	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.999;0.999;0.998;1.0;0.998;0.999;1.0;0.999;0.997;0.998;0.999;1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0;0.999;0.999;1.0;0.998;0.999;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.91635	0.954;0.975;0.953;0.999;0.954;0.939;0.999;0.977;0.939;0.938;0.97;0.961;0.989;0.982;0.97;0.964;0.982;0.999;0.982;0.975;0.938;0.977;0.945;0.973;0.999;0.968	D	0.99357	1.0916	10	0.87932	D	0	.	17.6318	0.88111	0.0:1.0:0.0:0.0	.	207;207;207;207;207;207;207;207;207;207;207;207;207;207;207;207;207;207;207;207;207;207;207;207;207;207	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13;O43497-11	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.;.	M	207	ENSP00000353990:T207M;ENSP00000339302:T207M;ENSP00000392390:T207M;ENSP00000347078:T207M;ENSP00000409759:T207M;ENSP00000425522:T207M;ENSP00000426261:T207M;ENSP00000425451:T207M;ENSP00000422407:T207M;ENSP00000426814:T207M;ENSP00000427238:T207M;ENSP00000423112:T207M;ENSP00000420918:T207M;ENSP00000426172:T207M;ENSP00000423045:T207M;ENSP00000427173:T207M;ENSP00000426098:T207M;ENSP00000425698:T207M;ENSP00000426232:T207M;ENSP00000423317:T207M;ENSP00000350979:T207M;ENSP00000352011:T207M;ENSP00000414388:T207M;ENSP00000423155:T207M;ENSP00000422268:T207M;ENSP00000421518:T207M	ENSP00000339302:T207M	T	+	2	0	CACNA1G	46004271	1.000000	0.71417	0.960000	0.40013	0.710000	0.40934	7.278000	0.78587	2.464000	0.83262	0.505000	0.49811	ACG	CACNA1G	-	pfam_Ion_trans_dom	ENSG00000006283		0.652	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	CACNA1G	HGNC	protein_coding	OTTHUMT00000367895.1		0.00	34	0	C	NM_018896		48649272	+1			no_errors	ENST00000359106	ensembl	human	known	74_37	missense	6.82	41	3	SNP	1.000	T
CACNG4	27092	genome.wustl.edu	37	17	65026647	65026647	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:65026647C>T	ENST00000262138.3	+	4	513	c.511C>T	c.(511-513)Cgg>Tgg	p.R171W	AC005544.1_ENST00000375684.1_5'Flank|RP11-74H8.1_ENST00000579138.1_RNA	NM_014405.3	NP_055220.1	Q9UBN1	CCG4_HUMAN	calcium channel, voltage-dependent, gamma subunit 4	171					membrane depolarization (GO:0051899)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(3)	19	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			GAGTGACAAGCGGGACGAAGA	0.532																																																	0													129.0	123.0	125.0					17																	65026647		2203	4300	6503	SO:0001583	missense	0			AH008289	CCDS11667.1	17q24	2006-01-23				ENSG00000075461		"""Calcium channel subunits"""	1408	protein-coding gene	gene with protein product		606404				10613843	Standard	NM_014405		Approved	MGC11138, MGC24983	uc002jft.2	Q9UBN1		ENST00000262138.3:c.511C>T	17.37:g.65026647C>T	ENSP00000262138:p.Arg171Trp		B2RCK0	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_g4su,prints_VDCC_gsu,prints_Claudin	p.R171W	ENST00000262138.3	37	c.511	CCDS11667.1	17	.	.	.	.	.	.	.	.	.	.	C	17.10	3.303152	0.60195	.	.	ENSG00000075461	ENST00000262138	D	0.89196	-2.48	4.9	3.87	0.44632	.	0.171381	0.44097	D	0.000483	D	0.91978	0.7459	L	0.58101	1.795	0.45515	D	0.998475	D	0.89917	1.0	D	0.70935	0.971	D	0.90782	0.4680	10	0.36615	T	0.2	-5.9882	13.5039	0.61474	0.2493:0.7507:0.0:0.0	.	171	Q9UBN1	CCG4_HUMAN	W	171	ENSP00000262138:R171W	ENSP00000262138:R171W	R	+	1	2	CACNG4	62457109	0.910000	0.30920	0.994000	0.49952	0.942000	0.58702	0.196000	0.17176	2.285000	0.76669	0.556000	0.70494	CGG	CACNG4	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000075461		0.532	CACNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG4	HGNC	protein_coding	OTTHUMT00000447036.1		0.00	53	0	C	NM_014405		65026647	+1			no_errors	ENST00000262138	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.951	T
CACNG4	27092	genome.wustl.edu	37	17	65026680	65026680	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:65026680G>T	ENST00000262138.3	+	4	546	c.544G>T	c.(544-546)Ggc>Tgc	p.G182C	AC005544.1_ENST00000375684.1_5'Flank|RP11-74H8.1_ENST00000579138.1_RNA	NM_014405.3	NP_055220.1	Q9UBN1	CCG4_HUMAN	calcium channel, voltage-dependent, gamma subunit 4	182					membrane depolarization (GO:0051899)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(3)	19	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			TTACAACTACGGCTGGTCTTT	0.453																																																	0													100.0	94.0	96.0					17																	65026680		2203	4300	6503	SO:0001583	missense	0			AH008289	CCDS11667.1	17q24	2006-01-23				ENSG00000075461		"""Calcium channel subunits"""	1408	protein-coding gene	gene with protein product		606404				10613843	Standard	NM_014405		Approved	MGC11138, MGC24983	uc002jft.2	Q9UBN1		ENST00000262138.3:c.544G>T	17.37:g.65026680G>T	ENSP00000262138:p.Gly182Cys		B2RCK0	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_g4su,prints_VDCC_gsu,prints_Claudin	p.G182C	ENST00000262138.3	37	c.544	CCDS11667.1	17	.	.	.	.	.	.	.	.	.	.	G	24.8	4.570177	0.86542	.	.	ENSG00000075461	ENST00000262138	D	0.94897	-3.55	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.97387	0.9145	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98235	1.0485	10	0.87932	D	0	-31.9591	18.1618	0.89710	0.0:0.0:1.0:0.0	.	182	Q9UBN1	CCG4_HUMAN	C	182	ENSP00000262138:G182C	ENSP00000262138:G182C	G	+	1	0	CACNG4	62457142	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	9.314000	0.96306	2.285000	0.76669	0.556000	0.70494	GGC	CACNG4	-	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_gsu,prints_Claudin	ENSG00000075461		0.453	CACNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG4	HGNC	protein_coding	OTTHUMT00000447036.1	-	0.00	50	0	G	NM_014405		65026680	+1	tier1	-	no_errors	ENST00000262138	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
CACTIN	58509	genome.wustl.edu	37	19	3624103	3624103	+	Silent	SNP	C	C	T	rs376574412		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:3624103C>T	ENST00000429344.2	-	2	277	c.225G>A	c.(223-225)ccG>ccA	p.P75P	CACTIN_ENST00000248420.5_Silent_p.P75P|CACTIN_ENST00000221899.3_Silent_p.P7P	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	75					cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										ACTTGGGCCGCGGGGGGCTCC	0.672																																																	0								C	,	0,3938		0,0,1969	62.0	72.0	69.0		225,225	-8.8	0.0	19		69	1,8183		0,1,4091	no	coding-synonymous,coding-synonymous	C19orf29	NM_001080543.1,NM_021231.1	,	0,1,6060	TT,TC,CC		0.0122,0.0,0.0082	,	75/759,75/759	3624103	1,12121	1969	4092	6061	SO:0001819	synonymous_variant	0			BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.225G>A	19.37:g.3624103C>T			A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Silent	SNP	pfam_Cactin_dom,pfam_Cactin_C	p.P7	ENST00000429344.2	37	c.21	CCDS45920.1	19																																																																																			CACTIN	-	NULL	ENSG00000105298		0.672	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	CACTIN	HGNC	protein_coding	OTTHUMT00000457370.2	-	0.00	45	0	C			3624103	-1	tier1	-	no_errors	ENST00000221899	ensembl	human	known	74_37	silent	29.41	24	10	SNP	0.000	T
CAPN14	440854	genome.wustl.edu	37	2	31428227	31428227	+	Silent	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:31428227G>A	ENST00000403897.3	-	2	228	c.87C>T	c.(85-87)gaC>gaT	p.D29D	CAPN14_ENST00000444918.2_Silent_p.D29D	NM_001145122.1	NP_001138594.1	A8MX76	CAN14_HUMAN	calpain 14	29					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)|skin(1)|stomach(2)	7						GGGCCTCAAAGTCCTGTTGGG	0.617																																																	0													46.0	54.0	52.0					2																	31428227		692	1591	2283	SO:0001819	synonymous_variant	0			AC015980	CCDS46254.1	2p23.1-p21	2013-01-10			ENSG00000214711	ENSG00000214711		"""EF-hand domain containing"""	16664	protein-coding gene	gene with protein product		610229				11675017	Standard	NM_001145122		Approved		uc010yms.2	A8MX76	OTTHUMG00000152039	ENST00000403897.3:c.87C>T	2.37:g.31428227G>A			B3KRU9	Silent	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,prints_Calpain_cysteine_protease,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat	p.D29	ENST00000403897.3	37	c.87	CCDS46254.1	2																																																																																			CAPN14	-	smart_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	ENSG00000214711		0.617	CAPN14-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CAPN14	HGNC	protein_coding	OTTHUMT00000325010.1		0.00	48	0	G	NM_001145122		31428227	-1			no_errors	ENST00000444918	ensembl	human	known	74_37	silent	5.48	69	4	SNP	1.000	A
CARM1	10498	genome.wustl.edu	37	19	11018787	11018787	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:11018787G>A	ENST00000327064.4	+	3	609	c.419G>A	c.(418-420)cGg>cAg	p.R140Q	CARM1_ENST00000344150.4_Missense_Mutation_p.R140Q	NM_199141.1	NP_954592.1	Q86X55	CARM1_HUMAN	coactivator-associated arginine methyltransferase 1	140					cellular lipid metabolic process (GO:0044255)|endochondral bone morphogenesis (GO:0060350)|histone H3-R17 methylation (GO:0034971)|histone H3-R2 methylation (GO:0034970)|histone methylation (GO:0016571)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of protein binding (GO:0032091)|pathogenesis (GO:0009405)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-R17 specific) (GO:0035642)|histone-arginine N-methyltransferase activity (GO:0008469)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|lysine-acetylated histone binding (GO:0070577)|protein methyltransferase activity (GO:0008276)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	13						TTCAGCGAGCGGACGGAGGAG	0.642																																																	0													139.0	124.0	129.0					19																	11018787		2203	4300	6503	SO:0001583	missense	0			AF055027	CCDS12250.1	19p13.2	2010-10-11			ENSG00000142453	ENSG00000142453		"""Protein arginine methyltransferases"""	23393	protein-coding gene	gene with protein product		603934				10381882, 11724789	Standard	NM_199141		Approved	PRMT4	uc002mpz.3	Q86X55		ENST00000327064.4:c.419G>A	19.37:g.11018787G>A	ENSP00000325690:p.Arg140Gln		A6NN38	Missense_Mutation	SNP	pfam_Histone-Arg_MeTrfase_N,pfam_Arg_MeTrfase,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom,pfam_mo5U34_MeTrfas-like,pfam_Methyltransf_11	p.R140Q	ENST00000327064.4	37	c.419	CCDS12250.1	19	.	.	.	.	.	.	.	.	.	.	G	32	5.180660	0.94846	.	.	ENSG00000142453	ENST00000327064;ENST00000344150	T;T	0.31510	1.49;1.51	5.43	4.4	0.53042	.	0.057943	0.64402	D	0.000003	T	0.41834	0.1176	M	0.83483	2.645	0.58432	D	0.999999	D	0.58970	0.984	P	0.45119	0.47	T	0.52660	-0.8546	10	0.56958	D	0.05	-4.2615	13.3439	0.60561	0.078:0.0:0.922:0.0	.	140	Q86X55	CARM1_HUMAN	Q	140	ENSP00000325690:R140Q;ENSP00000340934:R140Q	ENSP00000325690:R140Q	R	+	2	0	CARM1	10879787	1.000000	0.71417	0.978000	0.43139	0.861000	0.49209	8.927000	0.92846	1.424000	0.47217	0.563000	0.77884	CGG	CARM1	-	NULL	ENSG00000142453		0.642	CARM1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CARM1	HGNC	protein_coding	OTTHUMT00000452625.1	-	0.00	29	0	G	XM_032719		11018787	+1	tier1	-	no_errors	ENST00000327064	ensembl	human	known	74_37	missense	16.67	30	6	SNP	1.000	A
CASS4	57091	genome.wustl.edu	37	20	55027698	55027698	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr20:55027698C>T	ENST00000360314.3	+	6	1691	c.1466C>T	c.(1465-1467)tCt>tTt	p.S489F	CASS4_ENST00000434344.1_Intron|CASS4_ENST00000371336.3_Missense_Mutation_p.S489F	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	489					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)			breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						ATAGAAGAATCTGTAAGAGAA	0.493																																																	0													66.0	66.0	66.0					20																	55027698		2203	4300	6503	SO:0001583	missense	0			AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.1466C>T	20.37:g.55027698C>T	ENSP00000353462:p.Ser489Phe		E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	SNP	pfam_Serine_rich,pfam_CAS_DUF3513,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.S489F	ENST00000360314.3	37	c.1466	CCDS33492.1	20	.	.	.	.	.	.	.	.	.	.	C	26.1	4.709452	0.89018	.	.	ENSG00000087589	ENST00000360314;ENST00000371336	T;T	0.25250	1.81;1.81	5.87	5.87	0.94306	Serine rich protein interaction (1);Signal transduction histidine kinase, subgroup 1, dimerisation/phosphoacceptor domain (1);	0.051812	0.85682	D	0.000000	T	0.50701	0.1631	L	0.56769	1.78	0.58432	D	0.999992	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.985;0.99;0.994	T	0.32981	-0.9886	10	0.52906	T	0.07	-16.7834	20.5827	0.99408	0.0:1.0:0.0:0.0	.	435;489;489	B4DII4;Q9NQ75-2;Q9NQ75	.;.;CASS4_HUMAN	F	489	ENSP00000353462:S489F;ENSP00000360387:S489F	ENSP00000353462:S489F	S	+	2	0	CASS4	54461105	0.907000	0.30839	0.012000	0.15200	0.989000	0.77384	5.284000	0.65627	2.941000	0.99782	0.655000	0.94253	TCT	CASS4	-	pfam_Serine_rich	ENSG00000087589		0.493	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASS4	HGNC	protein_coding	OTTHUMT00000079789.2	-	0.00	31	0	C	NM_020356		55027698	+1	tier1	-	no_errors	ENST00000360314	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.863	T
CAV1	857	genome.wustl.edu	37	7	116199131	116199131	+	Silent	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:116199131C>A	ENST00000341049.2	+	3	605	c.327C>A	c.(325-327)atC>atA	p.I109I	CAV1_ENST00000393470.1_Silent_p.I98I|CAV1_ENST00000393468.1_Silent_p.I78I|CAV1_ENST00000405348.1_Silent_p.I78I|CAV1_ENST00000393467.1_Silent_p.I78I	NM_001753.4	NP_001744.2	Q03135	CAV1_HUMAN	caveolin 1, caveolae protein, 22kDa	109					angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion transport (GO:0006816)|caveola assembly (GO:0070836)|caveolin-mediated endocytosis (GO:0072584)|cellular calcium ion homeostasis (GO:0006874)|cellular response to hyperoxia (GO:0071455)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol transport (GO:0030301)|cytosolic calcium ion homeostasis (GO:0051480)|inactivation of MAPK activity (GO:0000188)|lactation (GO:0007595)|leukocyte migration (GO:0050900)|lipid storage (GO:0019915)|maintenance of protein location in cell (GO:0032507)|mammary gland development (GO:0030879)|mammary gland involution (GO:0060056)|MAPK cascade (GO:0000165)|membrane depolarization (GO:0051899)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of pinocytosis (GO:0048550)|negative regulation of protein binding (GO:0032091)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|nitric oxide homeostasis (GO:0033484)|nitric oxide metabolic process (GO:0046209)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of vasoconstriction (GO:0045907)|protein homooligomerization (GO:0051260)|protein localization (GO:0008104)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)|regulation of blood coagulation (GO:0030193)|regulation of fatty acid metabolic process (GO:0019217)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidase activity (GO:0052547)|regulation of smooth muscle contraction (GO:0006940)|regulation of the force of heart contraction by chemical signal (GO:0003057)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to ischemia (GO:0002931)|response to progesterone (GO:0032570)|skeletal muscle tissue development (GO:0007519)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|vasculogenesis (GO:0001570)|vasoconstriction (GO:0042310)|vesicle organization (GO:0016050)|viral process (GO:0016032)	acrosomal membrane (GO:0002080)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell cortex (GO:0005938)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lipid particle (GO:0005811)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cholesterol binding (GO:0015485)|enzyme binding (GO:0019899)|nitric-oxide synthase binding (GO:0050998)|patched binding (GO:0005113)|peptidase activator activity (GO:0016504)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)			TCTTTGGCATCCCGATGGCAC	0.493																																																	0													176.0	129.0	145.0					7																	116199131		2203	4300	6503	SO:0001819	synonymous_variant	0			AF125348	CCDS5767.1, CCDS55156.1	7q31	2006-02-09	2002-08-29		ENSG00000105974	ENSG00000105974			1527	protein-coding gene	gene with protein product		601047	"""caveolin 1, caveolae protein, 22kD"""	CAV		10087206	Standard	NM_001753		Approved		uc003vif.2	Q03135	OTTHUMG00000023413	ENST00000341049.2:c.327C>A	7.37:g.116199131C>A			Q9UGP1|Q9UNG1|Q9UQH6	Silent	SNP	pfam_Caveolin	p.I109	ENST00000341049.2	37	c.327	CCDS5767.1	7																																																																																			CAV1	-	pfam_Caveolin	ENSG00000105974		0.493	CAV1-001	KNOWN	basic|CCDS	protein_coding	CAV1	HGNC	protein_coding	OTTHUMT00000059734.4	-	0.00	42	0	C	NM_001753		116199131	+1	tier1	-	no_errors	ENST00000341049	ensembl	human	known	74_37	silent	8.00	46	4	SNP	0.954	A
CCDC149	91050	genome.wustl.edu	37	4	24833262	24833262	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:24833262C>T	ENST00000389609.4	-	10	974	c.831G>A	c.(829-831)ctG>ctA	p.L277L	CCDC149_ENST00000504487.1_Silent_p.L277L|CCDC149_ENST00000502801.1_Intron|CCDC149_ENST00000428116.2_Intron	NM_173463.4	NP_775734.2	Q6ZUS6	CC149_HUMAN	coiled-coil domain containing 149	222										cervix(1)|endometrium(1)|large_intestine(2)|lung(3)	7		Breast(46;0.173)				CCTCAGATAGCAGATCCTGAA	0.433																																																	0													97.0	89.0	92.0					4																	24833262		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33967.1, CCDS47036.1, CCDS33967.2	4p15.2	2008-03-03				ENSG00000181982			25405	protein-coding gene	gene with protein product						17457313	Standard	NM_173463		Approved	DKFZp761B107	uc003grc.3	Q6ZUS6		ENST00000389609.4:c.831G>A	4.37:g.24833262C>T			A6NJE7|B4DK90|B4DZG3|G5EA04|Q6NW41|Q8N3K8	Silent	SNP	pfam_Coiled-coil_dom-contain_pr_149	p.L277	ENST00000389609.4	37	c.831	CCDS33967.2	4																																																																																			CCDC149	-	pfam_Coiled-coil_dom-contain_pr_149	ENSG00000181982		0.433	CCDC149-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	CCDC149	HGNC	protein_coding	OTTHUMT00000360157.1	-	0.00	47	0	C	NM_173463		24833262	-1	tier1	-	no_errors	ENST00000504487	ensembl	human	known	74_37	silent	13.79	25	4	SNP	1.000	T
CCDC33	80125	genome.wustl.edu	37	15	74623044	74623044	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr15:74623044G>C	ENST00000398814.3	+	13	1928	c.1497G>C	c.(1495-1497)atG>atC	p.M499I	CCDC33_ENST00000321288.5_Missense_Mutation_p.M702I|CCDC33_ENST00000268082.4_Missense_Mutation_p.M92I|CCDC33_ENST00000558821.1_Missense_Mutation_p.M92I	NM_025055.3	NP_079331.3	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33	702										breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						AGCTGGATATGAAGAAACTGA	0.562																																																	0													82.0	83.0	83.0					15																	74623044		1995	4181	6176	SO:0001583	missense	0			BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000398814.3:c.1497G>C	15.37:g.74623044G>C	ENSP00000381795:p.Met499Ile		A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom	p.M702I	ENST00000398814.3	37	c.2106	CCDS42058.1	15	.	.	.	.	.	.	.	.	.	.	G	4.758	0.141007	0.09083	.	.	ENSG00000140481	ENST00000321288;ENST00000398814;ENST00000321374;ENST00000268082	T;T;T;T	0.34667	1.35;2.28;1.94;1.93	4.51	2.47	0.30058	.	0.583788	0.18481	N	0.139928	T	0.33440	0.0863	M	0.70595	2.14	0.09310	N	1	B;B;B;B	0.12630	0.004;0.006;0.005;0.002	B;B;B;B	0.13407	0.009;0.007;0.002;0.003	T	0.22312	-1.0220	10	0.35671	T	0.21	.	6.8055	0.23774	0.1006:0.1786:0.7208:0.0	.	92;92;702;499	Q8N5R6-4;Q8N5R6-5;C9JFX2;Q8N5R6-6	.;.;.;.	I	702;499;92;92	ENSP00000325012:M702I;ENSP00000381795:M499I;ENSP00000325661:M92I;ENSP00000268082:M92I	ENSP00000268082:M92I	M	+	3	0	CCDC33	72410097	0.095000	0.21747	0.735000	0.30896	0.489000	0.33432	0.989000	0.29629	0.900000	0.36469	-0.397000	0.06425	ATG	CCDC33	-	NULL	ENSG00000140481		0.562	CCDC33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC33	HGNC	protein_coding	OTTHUMT00000419491.2	-	0.00	36	0	G	NM_182791		74623044	+1	tier1	-	no_errors	ENST00000321288	ensembl	human	known	74_37	missense	19.23	42	10	SNP	0.117	C
CCL8	6355	genome.wustl.edu	37	17	32646540	32646540	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:32646540T>G	ENST00000394620.1	+	1	486	c.20T>G	c.(19-21)cTt>cGt	p.L7R		NM_005623.2	NP_005614.2	P80075	CCL8_HUMAN	chemokine (C-C motif) ligand 8	7					calcium ion transport (GO:0006816)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|exocytosis (GO:0006887)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of catalytic activity (GO:0043085)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemokine activity (GO:0008009)|heparin binding (GO:0008201)|phospholipase activator activity (GO:0016004)|protein kinase activity (GO:0004672)			NS(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Ovarian(249;0.0443)|Breast(31;0.151)				TCTGCAGCGCTTCTGTGCCTG	0.532																																																	0													76.0	69.0	72.0					17																	32646540		2203	4300	6503	SO:0001583	missense	0			X99886	CCDS11280.1	17q11.2	2013-02-25	2002-08-22	2002-08-23	ENSG00000108700	ENSG00000108700		"""Chemokine ligands"", ""Endogenous ligands"""	10635	protein-coding gene	gene with protein product		602283	"""small inducible cytokine subfamily A (Cys-Cys), member 8 (monocyte chemotactic protein 2)"""	SCYA8		9119400	Standard	NM_005623		Approved	MCP-2, HC14	uc002hib.3	P80075	OTTHUMG00000132883	ENST00000394620.1:c.20T>G	17.37:g.32646540T>G	ENSP00000378118:p.Leu7Arg		A0AV77|P78388	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.L7R	ENST00000394620.1	37	c.20	CCDS11280.1	17	.	.	.	.	.	.	.	.	.	.	T	14.20	2.463823	0.43736	.	.	ENSG00000108700	ENST00000394620;ENST00000225840	.	.	.	4.75	2.35	0.29111	.	1.083250	0.07343	N	0.881106	T	0.64778	0.2629	.	.	.	0.09310	N	1	D	0.76494	0.999	D	0.67900	0.954	T	0.47222	-0.9134	8	0.87932	D	0	.	8.8489	0.35188	0.0:0.0:0.3708:0.6292	.	7	P80075	CCL8_HUMAN	R	17;7	.	ENSP00000225840:L7R	L	+	2	0	CCL8	29670653	0.138000	0.22547	0.001000	0.08648	0.008000	0.06430	2.114000	0.41911	0.215000	0.20761	0.533000	0.62120	CTT	CCL8	-	NULL	ENSG00000108700		0.532	CCL8-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	CCL8	HGNC	protein_coding	OTTHUMT00000256376.2	-	0.00	27	0	T	NM_005623		32646540	+1	tier1	-	no_errors	ENST00000394620	ensembl	human	known	74_37	missense	23.68	29	9	SNP	0.000	G
CCRN4L	25819	genome.wustl.edu	37	4	139964386	139964386	+	Missense_Mutation	SNP	G	G	A	rs200904457		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:139964386G>A	ENST00000280614.2	+	2	542	c.349G>A	c.(349-351)Gtc>Atc	p.V117I	ELF2_ENST00000515489.1_Intron	NM_012118.2	NP_036250.2	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like (S. cerevisiae)	117					circadian regulation of gene expression (GO:0032922)|cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of gene expression (GO:0010629)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|regulation of circadian rhythm (GO:0042752)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|response to extracellular stimulus (GO:0009991)|response to lipopolysaccharide (GO:0032496)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A)-specific ribonuclease activity (GO:0004535)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(2)|large_intestine(3)|lung(3)|ovary(1)	9	all_hematologic(180;0.162)					ATGCAGGGCCGTCCTGCACAC	0.557																																					Ovarian(144;566 1842 19130 21379 22209)												0								G	ILE/VAL	0,4406		0,0,2203	89.0	88.0	89.0		349	4.0	0.9	4		89	1,8599	1.2+/-3.3	0,1,4299	yes	missense	CCRN4L	NM_012118.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	117/432	139964386	1,13005	2203	4300	6503	SO:0001583	missense	0			AF183961	CCDS3743.1	4q31.1	2014-06-18	2001-11-28		ENSG00000151014	ENSG00000151014			14254	protein-coding gene	gene with protein product		608468	"""CCR4-like (carbon catabolite repression 4, S.cerevisiae)"""			10521507	Standard	NM_012118		Approved	CCR4L, Ccr4c	uc003ihl.3	Q9UK39	OTTHUMG00000161271	ENST00000280614.2:c.349G>A	4.37:g.139964386G>A	ENSP00000280614:p.Val117Ile		D3DNY5|Q14D51|Q9HD93|Q9HD94|Q9HD95	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.V117I	ENST00000280614.2	37	c.349	CCDS3743.1	4	.	.	.	.	.	.	.	.	.	.	G	14.85	2.657995	0.47467	0.0	1.16E-4	ENSG00000151014	ENST00000280614	T	0.30981	1.51	4.87	4.03	0.46877	.	0.285590	0.34133	N	0.004222	T	0.28200	0.0696	L	0.53249	1.67	0.80722	D	1	B;B	0.25667	0.008;0.131	B;B	0.17433	0.003;0.018	T	0.04427	-1.0952	9	.	.	.	-24.869	13.3954	0.60849	0.0767:0.0:0.9233:0.0	.	117;117	Q9UK39;Q8WTX0	NOCT_HUMAN;.	I	117	ENSP00000280614:V117I	.	V	+	1	0	CCRN4L	140183836	1.000000	0.71417	0.908000	0.35775	0.974000	0.67602	5.958000	0.70330	1.064000	0.40671	-0.228000	0.12330	GTC	CCRN4L	-	NULL	ENSG00000151014		0.557	CCRN4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCRN4L	HGNC	protein_coding	OTTHUMT00000257231.3		0.00	27	0	G	NM_012118		139964386	+1			no_errors	ENST00000280614	ensembl	human	known	74_37	missense	9.30	39	4	SNP	0.996	A
CD109	135228	genome.wustl.edu	37	6	74475784	74475784	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:74475784A>T	ENST00000287097.5	+	11	1351	c.1239A>T	c.(1237-1239)gaA>gaT	p.E413D	CD109_ENST00000422508.2_Missense_Mutation_p.E336D|CD109_ENST00000437994.2_Missense_Mutation_p.E413D			Q6YHK3	CD109_HUMAN	CD109 molecule	413					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						AGAAAATGGAAGCTGTTCAGA	0.393																																																	0													104.0	101.0	102.0					6																	74475784		2203	4300	6503	SO:0001583	missense	0			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.1239A>T	6.37:g.74475784A>T	ENSP00000287097:p.Glu413Asp		A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.E413D	ENST00000287097.5	37	c.1239	CCDS4982.1	6	.	.	.	.	.	.	.	.	.	.	A	7.610	0.674631	0.14841	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.22539	1.95;2.16;1.96	4.69	-0.721	0.11189	.	1.292470	0.04764	N	0.426772	T	0.04048	0.0113	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.10450	0.004;0.002;0.005;0.002	T	0.35500	-0.9786	10	0.15952	T	0.53	.	2.5238	0.04686	0.5477:0.2283:0.0866:0.1374	.	336;413;413;413	Q6YHK3-2;Q6YHK3-3;Q6YHK3-4;Q6YHK3	.;.;.;CD109_HUMAN	D	413;336;413	ENSP00000388062:E413D;ENSP00000404475:E336D;ENSP00000287097:E413D	ENSP00000287097:E413D	E	+	3	2	CD109	74532505	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	0.648000	0.24828	-0.183000	0.10585	0.379000	0.24179	GAA	CD109	-	NULL	ENSG00000156535		0.393	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD109	HGNC	protein_coding	OTTHUMT00000041230.3	-	0.00	30	0	A	NM_133493		74475784	+1	tier1	-	no_errors	ENST00000287097	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.000	T
CDH12	1010	genome.wustl.edu	37	5	21783471	21783471	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:21783471T>G	ENST00000382254.1	-	11	2475	c.1389A>C	c.(1387-1389)aaA>aaC	p.K463N	CDH12_ENST00000522262.1_Missense_Mutation_p.K423N|CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000504376.2_Missense_Mutation_p.K463N	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	463	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						ACTTACTAACTTTACTCGCAA	0.368										HNSCC(59;0.17)																																							0													147.0	144.0	145.0					5																	21783471		2203	4300	6503	SO:0001583	missense	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1389A>C	5.37:g.21783471T>G	ENSP00000371689:p.Lys463Asn		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K463N	ENST00000382254.1	37	c.1389	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	T	18.99	3.739737	0.69304	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.59364	0.27;0.27;0.27	5.54	5.54	0.83059	Cadherin (4);Cadherin-like (1);	0.043371	0.85682	D	0.000000	T	0.53206	0.1782	N	0.02158	-0.66	0.80722	D	1	P;D	0.89917	0.888;1.0	P;D	0.87578	0.602;0.998	T	0.71076	-0.4697	10	0.87932	D	0	.	15.6752	0.77311	0.0:0.0:0.0:1.0	.	423;463	B7Z2U6;P55289	.;CAD12_HUMAN	N	463;463;423	ENSP00000423577:K463N;ENSP00000371689:K463N;ENSP00000428786:K423N	ENSP00000371689:K463N	K	-	3	2	CDH12	21819228	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.857000	0.69525	2.099000	0.63709	0.533000	0.62120	AAA	CDH12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000154162		0.368	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	-	0.00	34	0	T	NM_004061		21783471	-1	tier1	-	no_errors	ENST00000382254	ensembl	human	known	74_37	missense	16.22	31	6	SNP	1.000	G
CELSR2	1952	genome.wustl.edu	37	1	109792735	109792736	+	In_Frame_Ins	INS	-	-	CGC	rs377757908|rs59201433|rs144034706	byFrequency	TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:109792735_109792736insCGC	ENST00000271332.3	+	1	95_96	c.34_35insCGC	c.(34-36)acg>aCGCcg	p.16_17insP		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	16					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCCCCTCCCAACgccgccgccg	0.752														2846	0.568291	0.4198	0.6311	5008	,	,		10222	0.5298		0.7276	False		,,,				2504	0.6002				NSCLC(158;1285 2011 34800 34852 42084)												0										1363,1439		473,417,511						3.0	0.1		dbSNP_130	6	4135,1897		1679,777,560	no	coding	CELSR2	NM_001408.2		2152,1194,1071	A1A1,A1R,RR		31.4489,48.6438,37.7632				5498,3336				SO:0001652	inframe_insertion	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.47_49dupCGC	1.37:g.109792742_109792744dupCGC	ENSP00000271332:p.Pro16_Pro16dup		Q5T2Y7|Q92566	In_Frame_Ins	INS	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.16in_frame_insP	ENST00000271332.3	37	c.34_35	CCDS796.1	1																																																																																			CELSR2	-	NULL	ENSG00000143126		0.752	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1		0.00	9	0	-	NM_001408		109792736	+1	tier1		no_errors	ENST00000271332	ensembl	human	known	74_37	in_frame_ins	77.78	2	7	INS	0.060:0.468	CGC
CHRM2	1129	genome.wustl.edu	37	7	136700570	136700570	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:136700570T>C	ENST00000445907.2	+	3	1486	c.958T>C	c.(958-960)Tct>Cct	p.S320P	hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000586239.1_RNA|CHRM2_ENST00000402486.3_Missense_Mutation_p.S320P|CHRM2_ENST00000453373.1_Missense_Mutation_p.S320P|CHRM2_ENST00000320658.5_Missense_Mutation_p.S320P|hsa-mir-490_ENST00000597642.1_RNA|hsa-mir-490_ENST00000598184.1_RNA|CHRM2_ENST00000397608.3_Missense_Mutation_p.S320P|CHRM2_ENST00000401861.1_Missense_Mutation_p.S320P|hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000425981.2_RNA	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	320					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	AGATGAGAACTCTAAGCAAAC	0.463																																																	0													100.0	101.0	101.0					7																	136700570		2203	4300	6503	SO:0001583	missense	0				CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.958T>C	7.37:g.136700570T>C	ENSP00000399745:p.Ser320Pro		Q4VBK6|Q9P1X9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M2_rcpt,prints_Musac_Ach_rcpt,prints_GPCR_Rhodpsn	p.S320P	ENST00000445907.2	37	c.958	CCDS5843.1	7	.	.	.	.	.	.	.	.	.	.	T	14.92	2.680879	0.47886	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05	5.4	5.4	0.78164	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000009	T	0.67933	0.2946	M	0.84326	2.69	0.58432	D	0.999999	B	0.21452	0.056	B	0.30646	0.118	T	0.65647	-0.6117	10	0.28530	T	0.3	-12.9837	15.427	0.75061	0.0:0.0:0.0:1.0	.	320	P08172	ACM2_HUMAN	P	320	ENSP00000399745:S320P;ENSP00000415386:S320P;ENSP00000319984:S320P;ENSP00000380733:S320P;ENSP00000384937:S320P;ENSP00000384401:S320P	ENSP00000319984:S320P	S	+	1	0	CHRM2	136351110	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.052000	0.57420	2.055000	0.61198	0.533000	0.62120	TCT	CHRM2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M2_rcpt	ENSG00000181072		0.463	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM2	HGNC	protein_coding	OTTHUMT00000341010.1	-	0.00	30	0	T			136700570	+1	tier1	-	no_errors	ENST00000320658	ensembl	human	known	74_37	missense	15.15	28	5	SNP	1.000	C
CLCN7	1186	genome.wustl.edu	37	16	1515268	1515268	+	Splice_Site	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr16:1515268C>A	ENST00000382745.4	-	2	818	c.213G>T	c.(211-213)ccG>ccT	p.P71P	CLCN7_ENST00000262318.8_Intron|CLCN7_ENST00000448525.1_Intron|CLCN7_ENST00000566812.1_5'Flank|LA16c-390E6.3_ENST00000563223.1_RNA	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	71					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				CCCAACTCACCGGGTCCAAAA	0.587																																																	0													112.0	76.0	89.0					16																	1515268		2199	4300	6499	SO:0001630	splice_region_variant	0			Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.213+1G>T	16.37:g.1515268C>A			A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Silent	SNP	pfam_Cl-channel_volt-gated,pfam_CBS_dom,superfamily_Cl-channel_core,smart_CBS_dom,prints_Cl-channel_volt-gated,prints_Cl_channel-7	p.P71	ENST00000382745.4	37	c.213	CCDS32361.1	16																																																																																			CLCN7	-	NULL	ENSG00000103249		0.587	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN7	HGNC	protein_coding	OTTHUMT00000103598.2	-	0.00	20	0	C	NM_001287	Silent	1515268	-1	tier1	-	no_errors	ENST00000382745	ensembl	human	known	74_37	silent	20.00	12	3	SNP	1.000	A
CLDN17	26285	genome.wustl.edu	37	21	31538834	31538834	+	Silent	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr21:31538834A>G	ENST00000286808.3	-	1	137	c.102T>C	c.(100-102)gcT>gcC	p.A34A		NM_012131.2	NP_036263.1	P56750	CLD17_HUMAN	claudin 17	34					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	23						TGCCAACAAAAGCTGATACTC	0.502																																																	0													68.0	71.0	70.0					21																	31538834		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ250712	CCDS13586.1	21q22.1	2008-07-31			ENSG00000156282	ENSG00000156282		"""Claudins"""	2038	protein-coding gene	gene with protein product						12736707	Standard	NM_012131		Approved	MGC126552, MGC126554	uc011acv.2	P56750	OTTHUMG00000081873	ENST00000286808.3:c.102T>C	21.37:g.31538834A>G			Q3MJB5|Q6UY37	Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin14,prints_Claudin8	p.A34	ENST00000286808.3	37	c.102	CCDS13586.1	21																																																																																			CLDN17	-	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin14	ENSG00000156282		0.502	CLDN17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN17	HGNC	protein_coding	OTTHUMT00000182261.1	-	0.00	21	0	A	NM_012131		31538834	-1	tier1	-	no_errors	ENST00000286808	ensembl	human	known	74_37	silent	28.00	36	14	SNP	0.966	G
CLEC6A	93978	genome.wustl.edu	37	12	8628756	8628756	+	Silent	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:8628756T>C	ENST00000382073.3	+	5	591	c.405T>C	c.(403-405)tcT>tcC	p.S135S		NM_001007033.1	NP_001007034.1	Q6EIG7	CLC6A_HUMAN	C-type lectin domain family 6, member A	135	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				defense response to fungus (GO:0050832)|innate immune response (GO:0045087)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|large_intestine(2)|lung(7)	10	Lung SC(5;0.184)					agtcattttcttattttctgg	0.393																																																	0													76.0	76.0	76.0					12																	8628756		2203	4300	6503	SO:0001819	synonymous_variant	0			AY321309	CCDS31739.1	12p13	2005-09-21	2005-02-09	2005-02-11	ENSG00000205846	ENSG00000205846		"""C-type lectin domain containing"""	14556	protein-coding gene	gene with protein product		613579	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 10"""	CLECSF10			Standard	NM_001007033		Approved	dectin-2	uc001qum.1	Q6EIG7	OTTHUMG00000168672	ENST00000382073.3:c.405T>C	12.37:g.8628756T>C			A2RUK3	Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.S135	ENST00000382073.3	37	c.405	CCDS31739.1	12																																																																																			CLEC6A	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000205846		0.393	CLEC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC6A	HGNC	protein_coding	OTTHUMT00000400562.1	-	0.00	45	0	T	NM_001007033		8628756	+1	tier1	-	no_errors	ENST00000382073	ensembl	human	known	74_37	silent	26.09	34	12	SNP	0.946	C
CLSTN2	64084	genome.wustl.edu	37	3	140282817	140282817	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:140282817G>A	ENST00000458420.3	+	16	2687	c.2497G>A	c.(2497-2499)Gcc>Acc	p.A833T		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	833					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CCCAAGCATTGCCACAGTGGT	0.522										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)												0													311.0	273.0	286.0					3																	140282817		2203	4300	6503	SO:0001583	missense	0			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2497G>A	3.37:g.140282817G>A	ENSP00000402460:p.Ala833Thr		B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A833T	ENST00000458420.3	37	c.2497	CCDS3112.1	3	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831912	0.71258	.	.	ENSG00000158258	ENST00000458420	T	0.38560	1.13	5.62	5.62	0.85841	.	0.048813	0.85682	D	0.000000	T	0.51432	0.1674	L	0.52011	1.625	0.80722	D	1	D	0.62365	0.991	P	0.53490	0.727	T	0.42982	-0.9419	9	.	.	.	-8.0607	17.1533	0.86783	0.0:0.0:1.0:0.0	.	833	Q9H4D0	CSTN2_HUMAN	T	833	ENSP00000402460:A833T	.	A	+	1	0	CLSTN2	141765507	1.000000	0.71417	0.998000	0.56505	0.007000	0.05969	8.061000	0.89467	2.647000	0.89833	0.650000	0.86243	GCC	CLSTN2	-	NULL	ENSG00000158258		0.522	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN2	HGNC	protein_coding	OTTHUMT00000359393.3	-	0.00	51	0	G	NM_022131		140282817	+1	tier1	-	no_errors	ENST00000458420	ensembl	human	known	74_37	missense	5.33	70	4	SNP	1.000	A
CNBD2	140894	genome.wustl.edu	37	20	34571994	34571994	+	Silent	SNP	C	C	T	rs375944438		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr20:34571994C>T	ENST00000373973.3	+	5	671	c.498C>T	c.(496-498)gaC>gaT	p.D166D	CNBD2_ENST00000538900.1_Silent_p.D166D|CNBD2_ENST00000349339.1_Silent_p.D166D			Q96M20	CNBD2_HUMAN	cyclic nucleotide binding domain containing 2	166																	TAACCAAGGACGAGGATGGCA	0.537													T|||	1	0.000199681	0.0	0.0	5008	,	,		21812	0.0		0.0	False		,,,				2504	0.001																0								T	,	0,4406		0,0,2203	132.0	106.0	115.0		498,498	-4.3	0.0	20		115	2,8598	819.2+/-406.8	0,2,4298	no	coding-synonymous,coding-synonymous	C20orf152	NM_001207076.1,NM_080834.2	,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,	166/424,166/573	34571994	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AL359828	CCDS13270.1, CCDS56189.1	20q11.23	2012-11-15	2012-11-15	2012-11-15	ENSG00000149646	ENSG00000149646			16145	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 152"", ""cyclic nucleotide (cNMP) binding domain containing 1"""	C20orf152, CNMPD1		11780052	Standard	NM_080834		Approved	dJ954P9.1	uc002xer.1	Q96M20	OTTHUMG00000032371	ENST00000373973.3:c.498C>T	20.37:g.34571994C>T			Q14C79|Q5JWY7|Q5T3S1|Q9BR36|Q9BWY5	Silent	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.D166	ENST00000373973.3	37	c.498		20																																																																																			CNBD2	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000149646		0.537	CNBD2-001	KNOWN	basic|appris_candidate_longest	protein_coding	CNBD2	HGNC	protein_coding	OTTHUMT00000078960.2	-	0.00	55	0	C	NM_080834		34571994	+1	tier1	-	no_errors	ENST00000373973	ensembl	human	known	74_37	silent	27.12	43	16	SNP	0.050	T
CNTN4	152330	genome.wustl.edu	37	3	3030058	3030058	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:3030058G>A	ENST00000397461.1	+	13	1772	c.1388G>A	c.(1387-1389)aGa>aAa	p.R463K	CNTN4_ENST00000427331.1_Missense_Mutation_p.R463K|CNTN4_ENST00000397459.2_Missense_Mutation_p.R135K|CNTN4_ENST00000475817.1_3'UTR|CNTN4_ENST00000448906.2_Missense_Mutation_p.R135K|CNTN4_ENST00000358480.3_Missense_Mutation_p.R244K|CNTN4_ENST00000418658.1_Missense_Mutation_p.R463K	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	463	Ig-like C2-type 5.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		GGAAACCTCAGAATCATCAAC	0.363																																																	0													88.0	88.0	88.0					3																	3030058		2203	4300	6503	SO:0001583	missense	0			AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.1388G>A	3.37:g.3030058G>A	ENSP00000380602:p.Arg463Lys		B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R463K	ENST00000397461.1	37	c.1388	CCDS43041.1	3	.	.	.	.	.	.	.	.	.	.	G	12.30	1.896375	0.33442	.	.	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331;ENST00000358480;ENST00000397459;ENST00000448906	T;T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32;-0.32;-0.32	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.51261	0.1664	L	0.28694	0.88	0.45594	D	0.998537	B;B;B	0.13594	0.0;0.001;0.008	B;B;B	0.20384	0.005;0.013;0.029	T	0.43180	-0.9407	10	0.12766	T	0.61	.	10.7153	0.46008	0.1415:0.0:0.8585:0.0	.	463;463;463	Q8IWV2-3;B3KTK4;Q8IWV2	.;.;CNTN4_HUMAN	K	463;463;463;244;135;135	ENSP00000396010:R463K;ENSP00000380602:R463K;ENSP00000413642:R463K;ENSP00000351267:R244K;ENSP00000380600:R135K;ENSP00000392077:R135K	ENSP00000351267:R244K	R	+	2	0	CNTN4	3005058	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.399000	0.59703	2.885000	0.99019	0.655000	0.94253	AGA	CNTN4	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000144619		0.363	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN4	HGNC	protein_coding	OTTHUMT00000239236.2	-	0.00	52	0	G			3030058	+1	tier1	-	no_errors	ENST00000397461	ensembl	human	known	74_37	missense	13.51	64	10	SNP	0.997	A
COL22A1	169044	genome.wustl.edu	37	8	139668162	139668162	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:139668162C>A	ENST00000303045.6	-	45	3757	c.3311G>T	c.(3310-3312)gGg>gTg	p.G1104V	COL22A1_ENST00000435777.1_Missense_Mutation_p.G1084V|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1104	Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			ATTTATGTCCCCTGGAGACAG	0.388										HNSCC(7;0.00092)																																							0													202.0	205.0	204.0					8																	139668162		2203	4300	6503	SO:0001583	missense	0			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.3311G>T	8.37:g.139668162C>A	ENSP00000303153:p.Gly1104Val		B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.G1104V	ENST00000303045.6	37	c.3311	CCDS6376.1	8	.	.	.	.	.	.	.	.	.	.	C	10.52	1.372928	0.24857	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.97016	-3.51;-4.21	5.28	-1.92	0.07618	.	0.395551	0.21251	N	0.077657	D	0.92818	0.7716	N	0.20610	0.595	0.42249	D	0.991969	P;P	0.50272	0.933;0.89	P;P	0.52957	0.714;0.521	D	0.88044	0.2783	10	0.29301	T	0.29	.	10.8146	0.46569	0.0:0.4455:0.0:0.5545	.	1084;1104	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	V	1104;1084;797	ENSP00000303153:G1104V;ENSP00000387655:G1084V	ENSP00000303153:G1104V	G	-	2	0	COL22A1	139737344	0.309000	0.24518	0.991000	0.47740	0.694000	0.40290	-0.263000	0.08670	-0.328000	0.08539	-0.140000	0.14226	GGG	COL22A1	-	NULL	ENSG00000169436		0.388	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	-	0.00	39	0	C	XM_291257		139668162	-1	tier1	-	no_errors	ENST00000303045	ensembl	human	known	74_37	missense	9.62	47	5	SNP	0.991	A
COL22A1	169044	genome.wustl.edu	37	8	139833602	139833602	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:139833602C>A	ENST00000303045.6	-	7	1468	c.1022G>T	c.(1021-1023)gGt>gTt	p.G341V	COL22A1_ENST00000435777.1_Missense_Mutation_p.G341V	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	341	Laminin G-like.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TTTCATGGCACCCACAGCGTT	0.582										HNSCC(7;0.00092)																																							0													157.0	154.0	155.0					8																	139833602		2203	4300	6503	SO:0001583	missense	0			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.1022G>T	8.37:g.139833602C>A	ENSP00000303153:p.Gly341Val		B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.G341V	ENST00000303045.6	37	c.1022	CCDS6376.1	8	.	.	.	.	.	.	.	.	.	.	C	20.4	3.982974	0.74474	.	.	ENSG00000169436	ENST00000303045;ENST00000435777	T;T	0.14022	2.54;2.54	5.51	5.51	0.81932	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.51477	D	0.000100	T	0.43188	0.1236	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.32481	-0.9905	9	.	.	.	.	18.4798	0.90807	0.0:1.0:0.0:0.0	.	341	Q8NFW1	COMA1_HUMAN	V	341	ENSP00000303153:G341V;ENSP00000387655:G341V	.	G	-	2	0	COL22A1	139902784	1.000000	0.71417	0.945000	0.38365	0.376000	0.30014	7.542000	0.82095	2.616000	0.88540	0.558000	0.71614	GGT	COL22A1	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	ENSG00000169436		0.582	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	-	0.00	49	0	C	XM_291257		139833602	-1	tier1	-	no_errors	ENST00000303045	ensembl	human	known	74_37	missense	21.31	48	13	SNP	1.000	A
COL4A3	1285	genome.wustl.edu	37	2	228162548	228162548	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:228162548G>T	ENST00000396578.3	+	42	3886	c.3724G>T	c.(3724-3726)Ggt>Tgt	p.G1242C	AC097662.2_ENST00000396588.2_RNA|AC097662.2_ENST00000433324.1_RNA|AC097662.2_ENST00000439598.2_RNA|COL4A3_ENST00000468753.1_3'UTR	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	1242	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		AGGAAATCGTGGTCCACCAGG	0.498																																																	0													20.0	23.0	22.0					2																	228162548		1877	4106	5983	SO:0001583	missense	0				CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.3724G>T	2.37:g.228162548G>T	ENSP00000379823:p.Gly1242Cys		Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G1242C	ENST00000396578.3	37	c.3724	CCDS42829.1	2	.	.	.	.	.	.	.	.	.	.	G	11.74	1.728582	0.30593	.	.	ENSG00000169031	ENST00000396578;ENST00000328380;ENST00000335583;ENST00000396574;ENST00000315699	D	0.98822	-5.16	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000014	D	0.99453	0.9806	H	0.95850	3.73	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98433	1.0583	10	0.87932	D	0	.	17.6566	0.88179	0.0:0.0:1.0:0.0	.	1242;1242;1242;1242	Q01955-5;Q01955-4;Q01955-2;Q01955	.;.;.;CO4A3_HUMAN	C	1242	ENSP00000379823:G1242C	ENSP00000323334:G1242C	G	+	1	0	COL4A3	227870792	1.000000	0.71417	0.418000	0.26571	0.015000	0.08874	5.606000	0.67641	2.618000	0.88619	0.462000	0.41574	GGT	COL4A3	-	pfam_Collagen	ENSG00000169031		0.498	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A3	HGNC	protein_coding	OTTHUMT00000331409.2	-	0.00	45	0	G	NM_000091		228162548	+1	tier1	-	no_errors	ENST00000396578	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.961	T
COL5A1	1289	genome.wustl.edu	37	9	137715273	137715273	+	Silent	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:137715273C>A	ENST00000371817.3	+	61	5070	c.4656C>A	c.(4654-4656)ggC>ggA	p.G1552G		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1552	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GTCCAACTGGCCCGAAGGGTG	0.602																																																	0													105.0	122.0	116.0					9																	137715273		2203	4300	6503	SO:0001819	synonymous_variant	0			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.4656C>A	9.37:g.137715273C>A			Q15094|Q5SUX4	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.G1552	ENST00000371817.3	37	c.4656	CCDS6982.1	9																																																																																			COL5A1	-	pfam_Collagen	ENSG00000130635		0.602	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A1	HGNC	protein_coding	OTTHUMT00000054954.2	-	0.00	49	0	C	NM_000093		137715273	+1	tier1	-	no_errors	ENST00000371817	ensembl	human	known	74_37	silent	13.21	46	7	SNP	1.000	A
COL7A1	1294	genome.wustl.edu	37	3	48619360	48619360	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:48619360C>T	ENST00000328333.8	-	47	4759	c.4652G>A	c.(4651-4653)gGa>gAa	p.G1551E	MIR711_ENST00000390201.1_RNA|COL7A1_ENST00000454817.1_Missense_Mutation_p.G1551E	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	1551	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TCCTTTGGGTCCAGCAACAGC	0.517																																																	0													209.0	217.0	214.0					3																	48619360		2203	4300	6503	SO:0001583	missense	0			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.4652G>A	3.37:g.48619360C>T	ENSP00000332371:p.Gly1551Glu		Q14054|Q16507	Missense_Mutation	SNP	pfam_Collagen,pfam_Fibronectin_type3,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.G1551E	ENST00000328333.8	37	c.4652	CCDS2773.1	3	.	.	.	.	.	.	.	.	.	.	C	8.521	0.868689	0.17322	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	D;D	0.97924	-4.61;-4.61	4.38	2.44	0.29823	.	0.000000	0.46145	D	0.000305	D	0.98563	0.9520	M	0.91663	3.23	0.31939	N	0.611171	D	0.89917	1.0	D	0.91635	0.999	D	0.96806	0.9593	10	0.87932	D	0	.	7.4413	0.27185	0.0:0.7324:0.1697:0.0979	.	1551	Q02388	CO7A1_HUMAN	E	1551	ENSP00000332371:G1551E;ENSP00000412569:G1551E	ENSP00000332371:G1551E	G	-	2	0	COL7A1	48594364	0.236000	0.23804	0.981000	0.43875	0.167000	0.22549	2.934000	0.48956	1.200000	0.43188	-0.136000	0.14681	GGA	COL7A1	-	NULL	ENSG00000114270		0.517	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	HGNC	protein_coding	OTTHUMT00000257519.1	-	0.00	27	0	C	NM_000094		48619360	-1	tier1	-	no_errors	ENST00000328333	ensembl	human	known	74_37	missense	12.50	42	6	SNP	0.829	T
COL6A6	131873	genome.wustl.edu	37	3	130367915	130367915	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:130367915A>G	ENST00000358511.6	+	32	5273	c.5242A>G	c.(5242-5244)Aaa>Gaa	p.K1748E	COL6A6_ENST00000453409.2_Missense_Mutation_p.K1748E	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1748	Nonhelical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TCTTTTAGGAAAACCGGAATG	0.413																																																	0													26.0	26.0	26.0					3																	130367915		1873	4097	5970	SO:0001583	missense	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.5242A>G	3.37:g.130367915A>G	ENSP00000351310:p.Lys1748Glu		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.K1748E	ENST00000358511.6	37	c.5242	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	A	3.699	-0.061866	0.07317	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.89343	-2.47;-2.5	5.09	2.7	0.31948	.	.	.	.	.	T	0.76335	0.3973	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.56920	-0.7899	9	0.02654	T	1	.	8.5983	0.33729	0.8353:0.0:0.1647:0.0	.	1748	A6NMZ7	CO6A6_HUMAN	E	1748	ENSP00000351310:K1748E;ENSP00000399236:K1748E	ENSP00000351310:K1748E	K	+	1	0	COL6A6	131850605	0.386000	0.25180	0.026000	0.17262	0.633000	0.38033	1.359000	0.34113	0.291000	0.22468	-0.464000	0.05259	AAA	COL6A6	-	NULL	ENSG00000206384		0.413	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	-	0.00	21	0	A	NM_001102608		130367915	+1	tier1	-	no_errors	ENST00000358511	ensembl	human	known	74_37	missense	22.58	24	7	SNP	0.255	G
COPA	1314	genome.wustl.edu	37	1	160262334	160262334	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:160262334C>T	ENST00000241704.7	-	28	3129	c.2900G>A	c.(2899-2901)cGc>cAc	p.R967H	COPA_ENST00000368069.3_Missense_Mutation_p.R976H	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	967					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)	p.R976H(2)|p.R967H(2)		central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ATAGGTTGTGCGGCCTCGGGC	0.502																																																	4	Substitution - Missense(4)	urinary_tract(2)|kidney(2)											168.0	155.0	159.0					1																	160262334		2203	4300	6503	SO:0001583	missense	0			U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.2900G>A	1.37:g.160262334C>T	ENSP00000241704:p.Arg967His		Q5T201|Q8IXZ9	Missense_Mutation	SNP	pfam_Coatomer_asu_C,pfam_Coatomer_WD-assoc_reg,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Coatomer_asu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R976H	ENST00000241704.7	37	c.2927	CCDS1202.1	1	.	.	.	.	.	.	.	.	.	.	C	18.70	3.679953	0.68042	.	.	ENSG00000122218	ENST00000368069;ENST00000241704	T;T	0.49139	0.79;0.79	6.17	6.17	0.99709	Coatomer, alpha subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.58119	0.2100	L	0.58428	1.81	0.80722	D	1	B;D	0.89917	0.224;1.0	B;D	0.72982	0.062;0.979	T	0.41627	-0.9498	10	0.24483	T	0.36	-15.0506	19.4432	0.94831	0.0:1.0:0.0:0.0	.	967;976	P53621;P53621-2	COPA_HUMAN;.	H	976;967	ENSP00000357048:R976H;ENSP00000241704:R967H	ENSP00000241704:R967H	R	-	2	0	COPA	158528958	1.000000	0.71417	0.993000	0.49108	0.977000	0.68977	7.567000	0.82357	2.941000	0.99782	0.655000	0.94253	CGC	COPA	-	pfam_Coatomer_asu_C,pirsf_Coatomer_asu	ENSG00000122218		0.502	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COPA	HGNC	protein_coding	OTTHUMT00000080638.1		0.00	35	0	C	NM_004371		160262334	-1			no_errors	ENST00000368069	ensembl	human	known	74_37	missense	6.00	47	3	SNP	1.000	T
CRB1	23418	genome.wustl.edu	37	1	197313525	197313525	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:197313525G>T	ENST00000367400.3	+	3	902	c.767G>T	c.(766-768)gGg>gTg	p.G256V	CRB1_ENST00000543483.1_5'UTR|CRB1_ENST00000535699.1_Missense_Mutation_p.G187V|CRB1_ENST00000367399.2_Intron|CRB1_ENST00000538660.1_Missense_Mutation_p.G256V	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	256	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						GGATTCCTGGGGGATCACTGT	0.502																																																	0													241.0	218.0	226.0					1																	197313525		2203	4300	6503	SO:0001583	missense	0				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.767G>T	1.37:g.197313525G>T	ENSP00000356370:p.Gly256Val		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.G256V	ENST00000367400.3	37	c.767	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.822435	0.50739	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400	D;D;D	0.98249	-4.82;-4.82;-4.82	5.35	3.37	0.38596	EGF (1);EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.99263	0.9743	H	0.96208	3.785	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.997	D;D;D;D	0.97110	1.0;0.987;1.0;0.984	D	0.99066	1.0832	9	0.87932	D	0	.	15.2522	0.73556	0.0:0.2671:0.7329:0.0	.	256;187;256;281	B7Z5T2;F5H0L2;P82279;Q59H36	.;.;CRUM1_HUMAN;.	V	187;256;256	ENSP00000438786:G187V;ENSP00000438091:G256V;ENSP00000356370:G256V	ENSP00000356370:G256V	G	+	2	0	CRB1	195580148	1.000000	0.71417	0.007000	0.13788	0.380000	0.30137	7.320000	0.79064	0.547000	0.28938	0.650000	0.86243	GGG	CRB1	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000134376		0.502	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	HGNC	protein_coding	OTTHUMT00000086565.2	-	0.00	63	0	G	NM_201253		197313525	+1	tier1	-	no_errors	ENST00000367400	ensembl	human	known	74_37	missense	38.37	53	33	SNP	0.976	T
CR1	1378	genome.wustl.edu	37	1	207737337	207737337	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:207737337C>G	ENST00000367049.4	+	22	3715	c.3715C>G	c.(3715-3717)Cgc>Ggc	p.R1239G	CR1_ENST00000367053.1_Missense_Mutation_p.R789G|CR1_ENST00000367051.1_Missense_Mutation_p.R789G|CR1_ENST00000400960.2_Missense_Mutation_p.R789G|CR1_ENST00000367052.1_Intron|RP11-78B10.2_ENST00000597497.1_RNA	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	789	Sushi 19. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TGCGTCTATGCGCTGCACACC	0.547																																																	0													36.0	82.0	71.0					1																	207737337		1327	4041	5368	SO:0001583	missense	0			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.3715C>G	1.37:g.207737337C>G	ENSP00000356016:p.Arg1239Gly		Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.R1239G	ENST00000367049.4	37	c.3715	CCDS44308.1	1	.	.	.	.	.	.	.	.	.	.	c	7.539	0.660294	0.14645	.	.	ENSG00000203710	ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	3.12	-0.123	0.13527	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.63710	0.2534	M	0.62088	1.915	0.09310	N	1	P;P	0.50819	0.71;0.939	B;P	0.55923	0.345;0.787	T	0.52555	-0.8560	9	0.23302	T	0.38	.	4.1326	0.10156	0.0:0.5622:0.1922:0.2456	.	789;1239	P17927;E9PDY4	CR1_HUMAN;.	G	789;789;789;1239	ENSP00000356018:R789G;ENSP00000356020:R789G;ENSP00000383744:R789G;ENSP00000356016:R1239G	ENSP00000356016:R1239G	R	+	1	0	CR1	205803960	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.971000	0.03806	-0.122000	0.11766	0.194000	0.17425	CGC	CR1	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000203710		0.547	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1	HGNC	protein_coding	OTTHUMT00000382527.1	-	0.00	163	0	C	NM_000573		207737337	+1	tier1	-	no_errors	ENST00000367049	ensembl	human	known	74_37	missense	45.41	101	84	SNP	0.003	G
CRTAC1	55118	genome.wustl.edu	37	10	99677288	99677288	+	Silent	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:99677288C>A	ENST00000370597.3	-	5	1039	c.684G>T	c.(682-684)gtG>gtT	p.V228V	CRTAC1_ENST00000370591.2_Silent_p.V228V|CRTAC1_ENST00000298819.4_Silent_p.V228V	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	228						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		CCTCAGCAGCCACATCTCTGA	0.597																																																	0													44.0	40.0	42.0					10																	99677288		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.684G>T	10.37:g.99677288C>A			B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Silent	SNP	pfam_FG-GAP,pfam_UnbV_ASPIC,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom	p.V228	ENST00000370597.3	37	c.684	CCDS31266.1	10																																																																																			CRTAC1	-	NULL	ENSG00000095713		0.597	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	CRTAC1	HGNC	protein_coding	OTTHUMT00000049754.1	-	0.00	45	0	C	NM_018058		99677288	-1	tier1	-	no_errors	ENST00000370597	ensembl	human	known	74_37	silent	15.38	44	8	SNP	1.000	A
CSMD2	114784	genome.wustl.edu	37	1	34164354	34164354	+	Splice_Site	SNP	G	G	A	rs543673574	byFrequency	TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:34164354G>A	ENST00000373380.1	-	3	763	c.543C>T	c.(541-543)gtC>gtT	p.V181V	CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373381.4_Splice_Site_p.V1308V			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1268	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V1268V(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCCTCCTACCGACACAGGTGG	0.612													G|||	2	0.000399361	0.0015	0.0	5008	,	,		18447	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	large_intestine(1)											58.0	60.0	59.0					1																	34164354		2203	4300	6503	SO:0001630	splice_region_variant	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.544+1C>T	1.37:g.34164354G>A			B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.V1308	ENST00000373380.1	37	c.3924		1																																																																																			CSMD2	-	superfamily_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000121904		0.612	CSMD2-002	KNOWN	basic	protein_coding	CSMD2	HGNC	protein_coding	OTTHUMT00000030635.4		0.00	30	0	G	NM_052896	Silent	34164354	-1			no_errors	ENST00000373381	ensembl	human	known	74_37	silent	9.52	19	2	SNP	0.345	A
CRYZ	1429	genome.wustl.edu	37	1	75185054	75185054	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:75185054T>A	ENST00000340866.5	-	4	354	c.267A>T	c.(265-267)aaA>aaT	p.K89N	CRYZ_ENST00000417775.1_Missense_Mutation_p.K89N|CRYZ_ENST00000370871.3_Missense_Mutation_p.K89N|CRYZ_ENST00000370872.3_Intron	NM_001889.3	NP_001880.2	Q08257	QOR_HUMAN	crystallin, zeta (quinone reductase)	89					protein homotetramerization (GO:0051289)|visual perception (GO:0007601)|xenobiotic catabolic process (GO:0042178)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	mRNA 3'-UTR binding (GO:0003730)|NADPH binding (GO:0070402)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)	p.K89N(1)		NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)	10					Dicoumarol(DB00266)	CTCTGTCACCTTTCTAGGGGA	0.373																																																	1	Substitution - Missense(1)	lung(1)											64.0	62.0	62.0					1																	75185054		2203	4300	6503	SO:0001583	missense	0				CCDS665.1, CCDS44162.1, CCDS44163.1	1p31.1	2013-02-14			ENSG00000116791	ENSG00000116791			2419	protein-coding gene	gene with protein product		123691					Standard	NM_001889		Approved		uc001dgj.3	Q08257	OTTHUMG00000009620	ENST00000340866.5:c.267A>T	1.37:g.75185054T>A	ENSP00000339399:p.Lys89Asn		A6NN60|D3DQ76|Q53FT0|Q59EU7|Q5HYE7|Q6NSK9	Missense_Mutation	SNP	pfam_ADH_C,pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	p.K89N	ENST00000340866.5	37	c.267	CCDS665.1	1	.	.	.	.	.	.	.	.	.	.	T	7.701	0.693010	0.15039	.	.	ENSG00000116791	ENST00000340866;ENST00000417775;ENST00000370871;ENST00000370870;ENST00000441120	T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94	5.16	2.75	0.32379	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.249756	0.47093	D	0.000256	T	0.32164	0.0820	M	0.62723	1.935	0.42985	D	0.994472	P;P	0.48407	0.91;0.645	P;P	0.50860	0.652;0.565	T	0.06267	-1.0836	10	0.30854	T	0.27	.	9.8318	0.40946	0.0:0.1448:0.0:0.8552	.	89;89	A6NN60;Q08257	.;QOR_HUMAN	N	89	ENSP00000339399:K89N;ENSP00000399805:K89N;ENSP00000359908:K89N;ENSP00000359907:K89N;ENSP00000404289:K89N	ENSP00000339399:K89N	K	-	3	2	CRYZ	74957642	1.000000	0.71417	1.000000	0.80357	0.045000	0.14185	2.159000	0.42339	0.345000	0.23873	-0.579000	0.04138	AAA	CRYZ	-	pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	ENSG00000116791		0.373	CRYZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYZ	HGNC	protein_coding	OTTHUMT00000026514.1		0.00	27	0	T			75185054	-1			no_errors	ENST00000340866	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
CSMD3	114788	genome.wustl.edu	37	8	113662429	113662429	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:113662429T>C	ENST00000297405.5	-	19	3398	c.3154A>G	c.(3154-3156)Aaa>Gaa	p.K1052E	CSMD3_ENST00000352409.3_Missense_Mutation_p.K1052E|CSMD3_ENST00000343508.3_Missense_Mutation_p.K1012E|CSMD3_ENST00000455883.2_Missense_Mutation_p.K948E	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1052	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CAGTGGTTTTTTTCGCATAGA	0.393										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													112.0	111.0	111.0					8																	113662429		2203	4300	6503	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3154A>G	8.37:g.113662429T>C	ENSP00000297405:p.Lys1052Glu		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.K1052E	ENST00000297405.5	37	c.3154	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	T	15.99	2.996446	0.54147	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03	5.74	5.74	0.90152	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.59018	0.2163	N	0.10782	0.045	0.31564	N	0.657146	D;D;B	0.76494	0.999;0.999;0.185	D;D;B	0.87578	0.997;0.998;0.281	T	0.54925	-0.8220	10	0.02654	T	1	.	16.0365	0.80635	0.0:0.0:0.0:1.0	.	948;1052;1012	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	E	1012;1052;392;948;1052	ENSP00000345799:K1012E;ENSP00000297405:K1052E;ENSP00000341558:K392E;ENSP00000412263:K948E;ENSP00000343124:K1052E	ENSP00000297405:K1052E	K	-	1	0	CSMD3	113731605	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	6.249000	0.72427	2.196000	0.70406	0.459000	0.35465	AAA	CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.393	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	52	0	T	NM_052900		113662429	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	32.00	34	16	SNP	1.000	C
CSMD3	114788	genome.wustl.edu	37	8	114111188	114111188	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:114111188T>A	ENST00000297405.5	-	5	958	c.714A>T	c.(712-714)gaA>gaT	p.E238D	CSMD3_ENST00000519485.1_5'UTR|CSMD3_ENST00000352409.3_Missense_Mutation_p.E238D|CSMD3_ENST00000343508.3_Missense_Mutation_p.E198D|CSMD3_ENST00000455883.2_Missense_Mutation_p.E238D	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	238						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CACAAGCATCTTCAGCTGTTA	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													97.0	86.0	89.0					8																	114111188		2203	4299	6502	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.714A>T	8.37:g.114111188T>A	ENSP00000297405:p.Glu238Asp		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.E238D	ENST00000297405.5	37	c.714	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	T	11.74	1.730053	0.30684	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	T;T;T;T	0.24151	1.87;1.87;1.87;1.87	5.1	5.1	0.69264	CUB (1);	0.076277	0.51477	D	0.000097	T	0.33818	0.0876	L	0.38175	1.15	0.27722	N	0.945093	B;B;D;B	0.59767	0.001;0.004;0.986;0.069	B;B;D;B	0.69654	0.003;0.006;0.965;0.091	T	0.11817	-1.0572	10	0.13853	T	0.58	.	10.0213	0.42044	0.0:0.0869:0.0:0.9131	.	238;238;238;198	Q7Z407-3;Q7Z407-4;Q7Z407;Q7Z407-2	.;.;CSMD3_HUMAN;.	D	198;238;238;238	ENSP00000345799:E198D;ENSP00000297405:E238D;ENSP00000412263:E238D;ENSP00000343124:E238D	ENSP00000297405:E238D	E	-	3	2	CSMD3	114180364	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.394000	0.44450	2.055000	0.61198	0.482000	0.46254	GAA	CSMD3	-	NULL	ENSG00000164796		0.353	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	38	0	T	NM_052900		114111188	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	A
CUBN	8029	genome.wustl.edu	37	10	16960677	16960677	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:16960677C>G	ENST00000377833.4	-	45	7009	c.6944G>C	c.(6943-6945)aGa>aCa	p.R2315T		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2315	CUB 16. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGATCGAAATCTCAAATACAT	0.413																																																	0													71.0	63.0	66.0					10																	16960677		2203	4300	6503	SO:0001583	missense	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.6944G>C	10.37:g.16960677C>G	ENSP00000367064:p.Arg2315Thr		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB_dom,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.R2315T	ENST00000377833.4	37	c.6944	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	C	20.9	4.068547	0.76301	.	.	ENSG00000107611	ENST00000377833	T	0.34667	1.35	5.6	4.69	0.59074	CUB (5);	0.139606	0.32244	N	0.006376	T	0.53481	0.1799	L	0.55017	1.72	0.80722	D	1	D	0.71674	0.998	D	0.72982	0.979	T	0.53158	-0.8478	10	0.48119	T	0.1	.	13.5873	0.61940	0.0:0.9245:0.0:0.0755	.	2315	O60494	CUBN_HUMAN	T	2315	ENSP00000367064:R2315T	ENSP00000367064:R2315T	R	-	2	0	CUBN	17000683	1.000000	0.71417	0.975000	0.42487	0.851000	0.48451	4.382000	0.59594	1.330000	0.45394	0.650000	0.86243	AGA	CUBN	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000107611		0.413	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	-	0.00	43	0	C	NM_001081		16960677	-1	tier1	-	no_errors	ENST00000377833	ensembl	human	known	74_37	missense	14.71	58	10	SNP	1.000	G
CUL9	23113	genome.wustl.edu	37	6	43168191	43168191	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:43168191C>T	ENST00000252050.4	+	15	3486	c.3402C>T	c.(3400-3402)atC>atT	p.I1134I	CUL9_ENST00000354495.3_Silent_p.I1024I|CUL9_ENST00000372647.2_Silent_p.I1134I	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1134					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						TGGGCCAGATCGAAGACCACA	0.522																																																	0													243.0	216.0	226.0					6																	43168191		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.3402C>T	6.37:g.43168191C>T			O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	pfam_Cullin_N,pfam_CPH_domain,pfam_Znf_C6HC,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_Cullin_homology,superfamily_ARM-type_fold,superfamily_UBA-like,smart_Cullin_neddylation_domain,smart_Znf_C6HC,pfscan_Znf_RING,pfscan_Cullin_homology	p.I1134	ENST00000252050.4	37	c.3402	CCDS4890.1	6																																																																																			CUL9	-	superfamily_Galactose-bd-like	ENSG00000112659		0.522	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL9	HGNC	protein_coding	OTTHUMT00000040582.2	-	0.00	49	0	C	NM_015089		43168191	+1	tier1	-	no_errors	ENST00000252050	ensembl	human	known	74_37	silent	11.59	145	19	SNP	0.266	T
CUX1	1523	genome.wustl.edu	37	7	101923380	101923380	+	Missense_Mutation	SNP	C	C	T	rs146049827	byFrequency	TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:101923380C>T	ENST00000437600.4	+	19	2078	c.1726C>T	c.(1726-1728)Cgc>Tgc	p.R576C	CUX1_ENST00000547394.2_Missense_Mutation_p.R562C|CUX1_ENST00000425244.2_Missense_Mutation_p.R532C|CUX1_ENST00000292538.4_Missense_Mutation_p.R578C|CUX1_ENST00000393824.3_Missense_Mutation_p.R539C|CUX1_ENST00000560541.1_3'UTR	NM_181500.2	NP_852477.1	P39880	CUX1_HUMAN	cut-like homeobox 1	0					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						GTACGAGGAGCGCCTGGACCC	0.677													C|||	3	0.000599042	0.0015	0.0014	5008	,	,		16439	0.0		0.0	False		,,,				2504	0.0																0								C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	7,4399	12.9+/-30.5	0,7,2196	88.0	74.0	79.0		1684,1594,1615,1732,1726	2.7	1.0	7	dbSNP_134	79	0,8600		0,0,4300	yes	missense,missense,missense,missense,missense	CUX1	NM_001202544.1,NM_001202545.1,NM_001202546.1,NM_001913.3,NM_181500.2	180,180,180,180,180	0,7,6496	TT,TC,CC		0.0,0.1589,0.0538	,,,,	562/663,532/633,539/640,578/679,576/677	101923380	7,12999	2203	4300	6503	SO:0001583	missense	0			M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000437600.4:c.1726C>T	7.37:g.101923380C>T	ENSP00000414091:p.Arg576Cys		B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	pfam_CASP_C,superfamily_LemA-like_dom	p.R578C	ENST00000437600.4	37	c.1732	CCDS47672.1	7	.	.	.	.	.	.	.	.	.	.	C	19.65	3.866851	0.72065	0.001589	0.0	ENSG00000257923	ENST00000292538;ENST00000547394;ENST00000425244;ENST00000437600	T;T;T;T	0.34072	1.38;1.38;1.38;1.38	3.56	2.67	0.31697	CASP, C-terminal (1);	.	.	.	.	T	0.57858	0.2082	M	0.77103	2.36	0.35953	D	0.834063	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.78314	0.991;0.981;0.922;0.953;0.981	T	0.68758	-0.5324	9	0.72032	D	0.01	.	11.2641	0.49099	0.0:0.9088:0.0:0.0912	.	539;532;562;576;578	B4DZZ2;B3KV79;G3V1Z6;Q13948-2;Q13948	.;.;.;.;CASP_HUMAN	C	578;562;532;576	ENSP00000292538:R578C;ENSP00000449371:R562C;ENSP00000409745:R532C;ENSP00000414091:R576C	ENSP00000292538:R578C	R	+	1	0	CUX1	101710100	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.846000	0.62860	0.851000	0.35264	0.556000	0.70494	CGC	CUX1	-	pfam_CASP_C	ENSG00000257923		0.677	CUX1-003	KNOWN	basic|CCDS	protein_coding	CUX1	HGNC	protein_coding	OTTHUMT00000347534.3		0.00	59	0	C	NM_001913		101923380	+1			no_errors	ENST00000292538	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
CXorf30	645090	genome.wustl.edu	37	X	36337395	36337395	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:36337395A>G	ENST00000378657.4	+	11	1402	c.754A>G	c.(754-756)Aga>Gga	p.R252G		NM_001098843.4	NP_001092313.2	A6PW82	CX030_HUMAN	chromosome X open reading frame 30	252										breast(1)|lung(2)|stomach(1)	4						TTCTGCCTTCAGATTTAGTTC	0.353																																																	0													193.0	147.0	161.0					X																	36337395		692	1591	2283	SO:0001583	missense	0				CCDS55396.1	Xp21.1	2014-08-07			ENSG00000205081	ENSG00000205081			27298	protein-coding gene	gene with protein product							Standard	NM_001098843		Approved		uc011mkc.3	A6PW82	OTTHUMG00000021353	ENST00000378657.4:c.754A>G	X.37:g.36337395A>G	ENSP00000367926:p.Arg252Gly			Missense_Mutation	SNP	NULL	p.R252G	ENST00000378657.4	37	c.754	CCDS55396.1	X	.	.	.	.	.	.	.	.	.	.	A	8.852	0.944863	0.18356	.	.	ENSG00000205081	ENST00000378653;ENST00000378657	T;T	0.23348	1.92;1.91	4.32	-2.56	0.06268	.	1.065480	0.07517	N	0.909852	T	0.12433	0.0302	L	0.34521	1.04	0.09310	N	1	P	0.38020	0.615	B	0.27500	0.08	T	0.21177	-1.0253	10	0.22109	T	0.4	-0.2969	3.8762	0.09058	0.24:0.5297:0.0948:0.1355	.	252	A6PW82	CX030_HUMAN	G	537;252	ENSP00000367922:R537G;ENSP00000367926:R252G	ENSP00000367922:R537G	R	+	1	2	CXorf30	36247316	0.016000	0.18221	0.000000	0.03702	0.006000	0.05464	-0.073000	0.11468	-0.648000	0.05437	-1.439000	0.01073	AGA	CXorf30	-	NULL	ENSG00000205081		0.353	CXorf30-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf30	HGNC	protein_coding		-	0.00	38	0	A	NP_001092313		36337395	+1	tier1	-	no_errors	ENST00000378657	ensembl	human	known	74_37	missense	38.71	19	12	SNP	0.000	G
CYLC1	1538	genome.wustl.edu	37	X	83129284	83129284	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:83129284A>C	ENST00000329312.4	+	4	1605	c.1568A>C	c.(1567-1569)gAa>gCa	p.E523A		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	523					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						ACTGATGCTGAATTTGATGAA	0.363																																																	0													80.0	70.0	74.0					X																	83129284		2202	4298	6500	SO:0001583	missense	0			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1568A>C	X.37:g.83129284A>C	ENSP00000331556:p.Glu523Ala		A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	NULL	p.E523A	ENST00000329312.4	37	c.1568	CCDS35341.1	X	.	.	.	.	.	.	.	.	.	.	a	5.574	0.290658	0.10567	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.46063	0.88	3.01	1.8	0.24995	.	.	.	.	.	T	0.37625	0.1010	M	0.62723	1.935	0.09310	N	1	B;B	0.23316	0.034;0.083	B;B	0.30105	0.111;0.085	T	0.33777	-0.9855	9	0.25751	T	0.34	-3.1332	5.6813	0.17778	0.7234:0.2766:0.0:0.0	.	523;523	P35663;F5H4V5	CYLC1_HUMAN;.	A	523	ENSP00000331556:E523A	ENSP00000331556:E523A	E	+	2	0	CYLC1	83015940	0.016000	0.18221	0.006000	0.13384	0.021000	0.10359	0.672000	0.25187	0.396000	0.25283	0.486000	0.48141	GAA	CYLC1	-	NULL	ENSG00000183035		0.363	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYLC1	HGNC	protein_coding	OTTHUMT00000057371.1	-	0.00	32	0	A	NM_021118		83129284	+1	tier1	-	no_errors	ENST00000329312	ensembl	human	known	74_37	missense	37.50	10	6	SNP	0.006	C
DCDC2	51473	genome.wustl.edu	37	6	24301967	24301967	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:24301967G>T	ENST00000378454.3	-	4	834	c.533C>A	c.(532-534)aCt>aAt	p.T178N		NM_001195610.1|NM_016356.3	NP_001182539.1|NP_057440.2	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	178	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				cellular defense response (GO:0006968)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|neuron migration (GO:0001764)|visual learning (GO:0008542)					breast(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32		Ovarian(999;0.101)				GCTCCTCAGAGTGATTTTTTC	0.448																																																	0													175.0	172.0	173.0					6																	24301967		2203	4300	6503	SO:0001583	missense	0			AB032980	CCDS4550.1	6p22.1	2008-02-05			ENSG00000146038	ENSG00000146038			18141	protein-coding gene	gene with protein product		605755				10601354, 10574461	Standard	NM_001195610		Approved	RU2, KIAA1154, DCDC2A	uc003ndx.3	Q9UHG0	OTTHUMG00000016275	ENST00000378454.3:c.533C>A	6.37:g.24301967G>T	ENSP00000367715:p.Thr178Asn		Q5VTR8|Q5VTR9|Q86W35|Q9UFD1|Q9UHG1|Q9ULR6	Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.T178N	ENST00000378454.3	37	c.533	CCDS4550.1	6	.	.	.	.	.	.	.	.	.	.	G	15.72	2.915652	0.52546	.	.	ENSG00000146038	ENST00000378454	D	0.92805	-3.11	5.87	5.87	0.94306	Doublecortin domain (5);	0.400694	0.30752	N	0.008957	T	0.78136	0.4236	N	0.04090	-0.28	0.80722	D	1	P	0.40302	0.712	B	0.41440	0.357	T	0.80845	-0.1200	10	0.28530	T	0.3	-6.0199	15.3178	0.74095	0.0:0.0:0.8602:0.1398	.	178	Q9UHG0	DCDC2_HUMAN	N	178	ENSP00000367715:T178N	ENSP00000367715:T178N	T	-	2	0	DCDC2	24409946	0.992000	0.36948	0.933000	0.37362	0.978000	0.69477	4.255000	0.58804	2.941000	0.99782	0.655000	0.94253	ACT	DCDC2	-	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	ENSG00000146038		0.448	DCDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCDC2	HGNC	protein_coding	OTTHUMT00000043604.1		0.00	55	0	G	NM_016356		24301967	-1			no_errors	ENST00000378454	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.866	T
DAXX	1616	genome.wustl.edu	37	6	33289323	33289323	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:33289323G>A	ENST00000374542.5	-	3	433	c.229C>T	c.(229-231)Cag>Tag	p.Q77*	DAXX_ENST00000414083.2_Nonsense_Mutation_p.Q2*|DAXX_ENST00000266000.6_Nonsense_Mutation_p.Q77*|DAXX_ENST00000477162.1_Intron	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	77	Necessary for interaction with USP7 and ATRX.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						TCTGCTGTCTGCATCTTACAA	0.547			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																			Rec	yes		6	6p21.3	1616	death-domain associated protein		E	0													52.0	56.0	55.0					6																	33289323		2203	4300	6503	SO:0001587	stop_gained	0			AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.229C>T	6.37:g.33289323G>A	ENSP00000363668:p.Gln77*		B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Nonsense_Mutation	SNP	pfam_Daxx	p.Q77*	ENST00000374542.5	37	c.229	CCDS4776.1	6	.	.	.	.	.	.	.	.	.	.	G	13.66	2.302795	0.40795	.	.	ENSG00000204209	ENST00000266000;ENST00000374542;ENST00000414083;ENST00000446403;ENST00000453407	.	.	.	5.12	3.33	0.38152	.	0.650754	0.15987	N	0.235029	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	-1.6159	8.9185	0.35596	0.0833:0.1497:0.767:0.0	.	.	.	.	X	77;77;2;77;77	.	ENSP00000266000:Q77X	Q	-	1	0	DAXX	33397301	0.984000	0.35163	0.494000	0.27515	0.019000	0.09904	2.565000	0.45939	0.733000	0.32492	0.549000	0.68633	CAG	DAXX	-	pfam_Daxx	ENSG00000204209		0.547	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAXX	HGNC	protein_coding	OTTHUMT00000076403.1	-	0.00	29	0	G			33289323	-1	tier1	-	no_errors	ENST00000266000	ensembl	human	known	74_37	nonsense	13.04	19	3	SNP	0.925	A
DCHS1	8642	genome.wustl.edu	37	11	6647158	6647158	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:6647158C>A	ENST00000299441.3	-	17	7135	c.6724G>T	c.(6724-6726)Gaa>Taa	p.E2242*		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2242	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CACCGTGTTTCAGCCCAGATC	0.592																																																	0													164.0	144.0	150.0					11																	6647158		2201	4296	6497	SO:0001587	stop_gained	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.6724G>T	11.37:g.6647158C>A	ENSP00000299441:p.Glu2242*		O15098	Nonsense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E2242*	ENST00000299441.3	37	c.6724	CCDS7771.1	11	.	.	.	.	.	.	.	.	.	.	C	48	14.700711	0.99806	.	.	ENSG00000166341	ENST00000299441	.	.	.	4.9	4.9	0.64082	.	0.138039	0.32836	N	0.005592	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	12.0793	0.53662	0.0:0.7134:0.2866:0.0	.	.	.	.	X	2242	.	ENSP00000299441:E2242X	E	-	1	0	DCHS1	6603734	1.000000	0.71417	0.959000	0.39883	0.839000	0.47603	5.266000	0.65525	2.549000	0.85964	0.563000	0.77884	GAA	DCHS1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000166341		0.592	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1	-	0.00	42	0	C	NM_003737		6647158	-1	tier1	-	no_errors	ENST00000299441	ensembl	human	known	74_37	nonsense	16.33	41	8	SNP	0.985	A
DCHS1	8642	genome.wustl.edu	37	11	6662746	6662748	+	In_Frame_Del	DEL	CAG	CAG	-	rs370785084|rs372916982		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:6662746_6662748delCAG	ENST00000299441.3	-	2	508_510	c.97_99delCTG	c.(97-99)ctgdel	p.L33del		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	33					branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L33_G34insL(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCCCAGCCCCcagcagcagcagc	0.635																																																	1	Insertion - In frame(1)	prostate(1)								54,415,3471		8,0,38,73,269,1582						5.3	1.0		dbSNP_130	8	588,630,6394		117,13,341,89,439,2807	no	codingComplex	DCHS1	NM_003737.2		125,13,379,162,708,4389	A1A1,A1A2,A1R,A2A2,A2R,RR		16.0011,11.9036,14.6035				642,1045,9865				SO:0001651	inframe_deletion	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.97_99delCTG	11.37:g.6662755_6662757delCAG	ENSP00000299441:p.Leu33del		O15098	In_Frame_Del	DEL	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L33in_frame_del	ENST00000299441.3	37	c.99_97	CCDS7771.1	11																																																																																			DCHS1	-	NULL	ENSG00000166341		0.635	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1		0.00	51	0	CAG	NM_003737		6662748	-1	tier1		no_errors	ENST00000299441	ensembl	human	known	74_37	in_frame_del	9.84	55	6	DEL	1.000:1.000:1.000	-
DDX42	11325	genome.wustl.edu	37	17	61883937	61883937	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:61883937C>T	ENST00000578681.1	+	9	1370	c.769C>T	c.(769-771)Cat>Tat	p.H257Y	DDX42_ENST00000583590.1_Missense_Mutation_p.H257Y|DDX42_ENST00000359353.5_Missense_Mutation_p.H138Y|DDX42_ENST00000457800.2_Missense_Mutation_p.H257Y|DDX42_ENST00000389924.2_Missense_Mutation_p.H257Y	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42	257					protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						TAGCTTTGCTCATTTTGGGTT	0.423																																																	0													136.0	122.0	127.0					17																	61883937		2203	4300	6503	SO:0001583	missense	0			BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3		ENST00000578681.1:c.769C>T	17.37:g.61883937C>T	ENSP00000464050:p.His257Tyr		A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.H257Y	ENST00000578681.1	37	c.769	CCDS32704.1	17	.	.	.	.	.	.	.	.	.	.	C	21.8	4.203016	0.79127	.	.	ENSG00000198231	ENST00000389924;ENST00000457800	T;T	0.20598	2.06;2.06	5.8	5.8	0.92144	RNA helicase, DEAD-box type, Q motif (1);	0.000000	0.85682	D	0.000000	T	0.32466	0.0830	M	0.76727	2.345	0.80722	D	1	B	0.23937	0.094	B	0.27170	0.077	T	0.08186	-1.0734	10	0.66056	D	0.02	-15.7585	19.0575	0.93072	0.0:1.0:0.0:0.0	.	257	Q86XP3	DDX42_HUMAN	Y	257	ENSP00000374574:H257Y;ENSP00000390121:H257Y	ENSP00000374574:H257Y	H	+	1	0	DDX42	59237669	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.758000	0.94735	0.563000	0.77884	CAT	DDX42	-	pfscan_RNA_helicase_DEAD_Q_motif	ENSG00000198231		0.423	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX42	HGNC	protein_coding	OTTHUMT00000444368.1	-	0.00	59	0	C	NM_007372		61883937	+1	tier1	-	no_errors	ENST00000389924	ensembl	human	known	74_37	missense	18.46	53	12	SNP	1.000	T
DHRS9	10170	genome.wustl.edu	37	2	169938085	169938085	+	5'UTR	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:169938085G>A	ENST00000327239.4	+	0	1498				DHRS9_ENST00000357546.2_5'UTR|DHRS9_ENST00000421653.1_Intron|DHRS9_ENST00000412271.1_5'UTR|DHRS9_ENST00000602501.1_5'UTR|DHRS9_ENST00000432060.2_Silent_p.G58G|DHRS9_ENST00000428522.1_5'UTR|DHRS9_ENST00000436483.2_5'UTR	NM_005771.4	NP_005762.2	Q9BPW9	DHRS9_HUMAN	dehydrogenase/reductase (SDR family) member 9						9-cis-retinoic acid biosynthetic process (GO:0042904)|androgen metabolic process (GO:0008209)|epithelial cell differentiation (GO:0030855)|progesterone metabolic process (GO:0042448)|retinol metabolic process (GO:0042572)	integral component of endoplasmic reticulum membrane (GO:0030176)	alcohol dehydrogenase (NAD) activity (GO:0004022)|racemase and epimerase activity (GO:0016854)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			breast(1)|endometrium(3)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						CACACACAGGGGGAAAAATGC	0.393																																																	0													85.0	83.0	84.0					2																	169938085		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AF067174	CCDS2231.1, CCDS74600.1	2q31.1	2011-09-14			ENSG00000073737	ENSG00000073737		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	16888	protein-coding gene	gene with protein product	"""NADP-dependent retinol dehydrogenase/reductase"", ""3-alpha hydroxysteroid dehydrogenase"", ""retinol dehydrogenase homolog"", ""short chain dehydrogenase/reductase family 9C, member 4"""	612131				11304534, 11294878, 19027726	Standard	NM_001142270		Approved	RDHL, 3alpha-HSD, RETSDR8, RDH15, SDR9C4	uc010zde.2	Q9BPW9	OTTHUMG00000132180	ENST00000327239.4:c.-7G>A	2.37:g.169938085G>A			B7Z416|D3DPC1|Q5RKX1|Q9NRA9|Q9NRB0	Silent	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.G58	ENST00000327239.4	37	c.174	CCDS2231.1	2																																																																																			DHRS9	-	NULL	ENSG00000073737		0.393	DHRS9-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRS9	HGNC	protein_coding	OTTHUMT00000333612.3	-	0.00	56	0	G	NM_005771		169938085	+1	tier1	-	no_errors	ENST00000432060	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.000	A
DHX35	60625	genome.wustl.edu	37	20	37634964	37634964	+	Missense_Mutation	SNP	G	G	A	rs376591273		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr20:37634964G>A	ENST00000252011.3	+	12	1220	c.1187G>A	c.(1186-1188)cGt>cAt	p.R396H	DHX35_ENST00000373323.4_Missense_Mutation_p.R365H|DHX35_ENST00000373325.2_Missense_Mutation_p.R396H	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	396	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				CGTGGTGGTCGTAGTCGCTCG	0.507																																																	0													172.0	165.0	167.0					20																	37634964		2203	4300	6503	SO:0001583	missense	0			AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.1187G>A	20.37:g.37634964G>A	ENSP00000252011:p.Arg396His		A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Missense_Mutation	SNP	pfam_DUF1605,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R396H	ENST00000252011.3	37	c.1187	CCDS13310.1	20	.	.	.	.	.	.	.	.	.	.	G	36	5.602948	0.96614	.	.	ENSG00000101452	ENST00000373325;ENST00000252011;ENST00000373323	D;D;D	0.94758	-3.51;-3.51;-3.51	5.82	5.82	0.92795	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.98444	0.9482	H	0.97186	3.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99060	1.0830	10	0.87932	D	0	.	20.0893	0.97812	0.0:0.0:1.0:0.0	.	365;396	F5GXM6;Q9H5Z1	.;DHX35_HUMAN	H	396;396;365	ENSP00000362422:R396H;ENSP00000252011:R396H;ENSP00000362420:R365H	ENSP00000252011:R396H	R	+	2	0	DHX35	37068378	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.751000	0.98889	2.761000	0.94854	0.655000	0.94253	CGT	DHX35	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C	ENSG00000101452		0.507	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX35	HGNC	protein_coding	OTTHUMT00000079212.2		0.00	43	0	G	NM_021931		37634964	+1			no_errors	ENST00000252011	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	A
DNAH3	55567	genome.wustl.edu	37	16	21073867	21073867	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr16:21073867C>T	ENST00000261383.3	-	25	3655	c.3656G>A	c.(3655-3657)gGc>gAc	p.G1219D	DNAH3_ENST00000415178.1_Missense_Mutation_p.G1219D	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1219	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GCTGATCATGCCCACAATTTC	0.443																																																	0													155.0	144.0	147.0					16																	21073867		2201	4300	6501	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.3656G>A	16.37:g.21073867C>T	ENSP00000261383:p.Gly1219Asp		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.G1219D	ENST00000261383.3	37	c.3656	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	23.1	4.369770	0.82573	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	T;T	0.63580	-0.05;-0.05	5.9	5.9	0.94986	Dynein heavy chain, domain-2 (1);	0.060791	0.64402	D	0.000004	D	0.84183	0.5416	M	0.89840	3.065	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.85978	0.1481	10	0.66056	D	0.02	.	20.2768	0.98488	0.0:1.0:0.0:0.0	.	1219	Q8TD57	DYH3_HUMAN	D	1219	ENSP00000261383:G1219D;ENSP00000394245:G1219D	ENSP00000261383:G1219D	G	-	2	0	DNAH3	20981368	1.000000	0.71417	0.998000	0.56505	0.864000	0.49448	5.786000	0.69006	2.797000	0.96272	0.655000	0.94253	GGC	DNAH3	-	pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase	ENSG00000158486		0.443	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	-	0.00	38	0	C	NM_017539		21073867	-1	tier1	-	no_errors	ENST00000261383	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
DNAJC16	23341	genome.wustl.edu	37	1	15870907	15870907	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:15870907C>T	ENST00000375847.3	+	5	752	c.588C>T	c.(586-588)ggC>ggT	p.G196G	DNAJC16_ENST00000375838.1_Silent_p.G196G|SCARNA21_ENST00000516057.1_RNA|DNAJC16_ENST00000375849.1_Silent_p.G196G	NM_015291.2	NP_056106.1	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	196	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(7)|urinary_tract(1)	18		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		TAGGAATTGGCGTGGTCCATG	0.463																																																	0													105.0	97.0	100.0					1																	15870907		2203	4300	6503	SO:0001819	synonymous_variant	0			AB023179	CCDS30606.1, CCDS72710.1	1p36.1	2011-09-02			ENSG00000116138	ENSG00000116138		"""Heat shock proteins / DNAJ (HSP40)"""	29157	protein-coding gene	gene with protein product							Standard	NM_015291		Approved	KIAA0962	uc001aws.3	Q9Y2G8	OTTHUMG00000002358	ENST00000375847.3:c.588C>T	1.37:g.15870907C>T			Q68D57|Q86X32|Q8N5P4	Silent	SNP	pfam_DnaJ_domain,pfam_Thioredoxin_domain,superfamily_DnaJ_domain,superfamily_Thioredoxin-like_fold,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.G196	ENST00000375847.3	37	c.588	CCDS30606.1	1																																																																																			DNAJC16	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	ENSG00000116138		0.463	DNAJC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC16	HGNC	protein_coding	OTTHUMT00000006764.1	-	0.00	43	0	C	NM_015291		15870907	+1	tier1	-	no_errors	ENST00000375847	ensembl	human	known	74_37	silent	8.16	45	4	SNP	0.048	T
DRD5	1816	genome.wustl.edu	37	4	9783698	9783698	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:9783698C>A	ENST00000304374.2	+	1	441	c.45C>A	c.(43-45)ttC>ttA	p.F15L		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	15					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)	p.F15L(1)		NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	CGGGGCAGTTCGCTCTATACC	0.721																																																	1	Substitution - Missense(1)	lung(1)											5.0	6.0	6.0					4																	9783698		2136	4193	6329	SO:0001583	missense	0			X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.45C>A	4.37:g.9783698C>A	ENSP00000306129:p.Phe15Leu		B2R9S3|Q8NEQ8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Dopamine_D5_rcpt,prints_Dopamine_rcpt	p.F15L	ENST00000304374.2	37	c.45	CCDS3405.1	4	.	.	.	.	.	.	.	.	.	.	c	0.009	-1.822476	0.00589	.	.	ENSG00000169676	ENST00000304374	T	0.63913	-0.07	3.63	-3.87	0.04218	.	1.021460	0.07841	N	0.963021	T	0.26484	0.0647	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20371	-1.0277	10	0.11485	T	0.65	.	5.1435	0.14971	0.1147:0.3142:0.4714:0.0997	.	15	P21918	DRD5_HUMAN	L	15	ENSP00000306129:F15L	ENSP00000306129:F15L	F	+	3	2	DRD5	9392796	0.000000	0.05858	0.000000	0.03702	0.183000	0.23260	-1.383000	0.02544	-0.617000	0.05664	0.305000	0.20034	TTC	DRD5	-	NULL	ENSG00000169676		0.721	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRD5	HGNC	protein_coding	OTTHUMT00000250293.1		0.00	18	0	C			9783698	+1			no_errors	ENST00000304374	ensembl	human	known	74_37	missense	6.98	40	3	SNP	0.000	A
DRD5	1816	genome.wustl.edu	37	4	9783701	9783701	+	Silent	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:9783701T>G	ENST00000304374.2	+	1	444	c.48T>G	c.(46-48)gcT>gcG	p.A16A		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	16					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)	p.A16A(1)		NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GGCAGTTCGCTCTATACCAGC	0.716																																																	1	Substitution - coding silent(1)	lung(1)											5.0	6.0	6.0					4																	9783701		2137	4200	6337	SO:0001819	synonymous_variant	0			X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.48T>G	4.37:g.9783701T>G			B2R9S3|Q8NEQ8	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Dopamine_D5_rcpt,prints_Dopamine_rcpt	p.A16	ENST00000304374.2	37	c.48	CCDS3405.1	4																																																																																			DRD5	-	NULL	ENSG00000169676		0.716	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRD5	HGNC	protein_coding	OTTHUMT00000250293.1		0.00	18	0	T			9783701	+1			no_errors	ENST00000304374	ensembl	human	known	74_37	silent	6.98	40	3	SNP	0.000	G
DSE	29940	genome.wustl.edu	37	6	116758015	116758015	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:116758015C>T	ENST00000331677.3	+	7	2828	c.2384C>T	c.(2383-2385)gCc>gTc	p.A795V	DSE_ENST00000537543.1_Missense_Mutation_p.A814V|DSE_ENST00000452085.3_Missense_Mutation_p.A795V|DSE_ENST00000359564.2_Missense_Mutation_p.A795V			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	795					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		AGGATTTTTGCCATATCACAG	0.468																																																	0													65.0	68.0	67.0					6																	116758015		2203	4300	6503	SO:0001583	missense	0			AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.2384C>T	6.37:g.116758015C>T	ENSP00000332151:p.Ala795Val		Q5R3K6	Missense_Mutation	SNP	superfamily_Chondroitin_lyas	p.A814V	ENST00000331677.3	37	c.2441	CCDS5107.1	6	.	.	.	.	.	.	.	.	.	.	C	15.24	2.774184	0.49786	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04	6.16	5.3	0.74995	.	0.152203	0.64402	N	0.000014	T	0.53769	0.1817	L	0.40543	1.245	0.53688	D	0.999978	P;P	0.44139	0.827;0.827	P;P	0.49192	0.602;0.602	T	0.62081	-0.6929	10	0.87932	D	0	-17.8037	15.6102	0.76710	0.0:0.9346:0.0:0.0654	.	814;795	B7Z765;Q9UL01	.;DSE_HUMAN	V	795;814;795;795	ENSP00000404049:A795V;ENSP00000441152:A814V;ENSP00000332151:A795V;ENSP00000352567:A795V	ENSP00000332151:A795V	A	+	2	0	DSE	116864708	1.000000	0.71417	1.000000	0.80357	0.330000	0.28571	5.717000	0.68446	1.628000	0.50416	-0.145000	0.13849	GCC	DSE	-	NULL	ENSG00000111817		0.468	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DSE	HGNC	protein_coding	OTTHUMT00000041940.2	-	0.00	24	0	C	NM_013352		116758015	+1	tier1	-	no_errors	ENST00000537543	ensembl	human	known	74_37	missense	21.74	18	5	SNP	1.000	T
DSG1	1828	genome.wustl.edu	37	18	28934607	28934607	+	Silent	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr18:28934607G>A	ENST00000257192.4	+	15	2660	c.2448G>A	c.(2446-2448)tcG>tcA	p.S816S	RP11-534N16.1_ENST00000581452.1_RNA|RP11-534N16.1_ENST00000578119.1_RNA|RP11-534N16.1_ENST00000578477.1_RNA|RP11-534N16.1_ENST00000581856.1_RNA|DSG1_ENST00000462981.2_Silent_p.S175S	NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	816					apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)	p.S816S(1)		NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			CCTATCCCTCGGGACCTGGTG	0.517																																																	1	Substitution - coding silent(1)	lung(1)											164.0	142.0	149.0					18																	28934607		2203	4300	6503	SO:0001819	synonymous_variant	0			X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.2448G>A	18.37:g.28934607G>A			B7Z845	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Desmoglein,prints_Cadherin,prints_Desmosomal_cadherin	p.S816	ENST00000257192.4	37	c.2448	CCDS11896.1	18																																																																																			DSG1	-	NULL	ENSG00000134760		0.517	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG1	HGNC	protein_coding	OTTHUMT00000254947.1	-	0.00	24	0	G	NM_001942		28934607	+1	tier1	-	no_errors	ENST00000257192	ensembl	human	known	74_37	silent	38.71	38	24	SNP	0.003	A
DST	667	genome.wustl.edu	37	6	56471114	56471114	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:56471114T>A	ENST00000361203.3	-	36	7686	c.7679A>T	c.(7678-7680)gAg>gTg	p.E2560V	DST_ENST00000421834.2_Intron|DST_ENST00000370754.5_Missense_Mutation_p.E2738V|DST_ENST00000244364.6_Intron|DST_ENST00000446842.2_Missense_Mutation_p.E2234V|DST_ENST00000370769.4_Missense_Mutation_p.E2560V|DST_ENST00000370788.2_Intron|DST_ENST00000312431.6_Missense_Mutation_p.E2560V			Q03001	DYST_HUMAN	dystonin	2560					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AGTTACATACTCTTCCTTTCT	0.363																																																	0													55.0	49.0	51.0					6																	56471114		1901	4118	6019	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.7679A>T	6.37:g.56471114T>A	ENSP00000354508:p.Glu2560Val		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.E2738V	ENST00000361203.3	37	c.8213		6	.	.	.	.	.	.	.	.	.	.	T	9.624	1.134531	0.21123	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000446842;ENST00000312431;ENST00000361203;ENST00000439203	T;T;T;D;T;T	0.84146	-0.31;-0.33;0.61;-1.81;-0.33;-0.62	4.01	2.78	0.32641	.	0.264744	0.25795	N	0.028248	T	0.77039	0.4072	.	.	.	0.34762	D	0.732858	P	0.52061	0.95	P	0.50708	0.648	T	0.76119	-0.3076	8	0.87932	D	0	.	3.2723	0.06886	0.2056:0.1115:0.0:0.6829	.	2234	Q03001-9	.	V	2738;2560;2234;2560;2560;2234	ENSP00000359790:E2738V;ENSP00000359805:E2560V;ENSP00000393645:E2234V;ENSP00000307959:E2560V;ENSP00000354508:E2560V;ENSP00000404924:E2234V	ENSP00000307959:E2560V	E	-	2	0	DST	56579073	0.127000	0.22367	0.021000	0.16686	0.379000	0.30106	2.127000	0.42035	0.660000	0.30964	0.374000	0.22700	GAG	DST	-	superfamily_ABC1_TM_dom	ENSG00000151914		0.363	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3		0.00	23	0	T	NM_001723		56471114	-1			no_errors	ENST00000370754	ensembl	human	known	74_37	missense	15.79	16	3	SNP	0.004	A
DST	667	genome.wustl.edu	37	6	56483314	56483314	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:56483314G>A	ENST00000370765.6	-	23	5625	c.5518C>T	c.(5518-5520)Cgt>Tgt	p.R1840C	DST_ENST00000421834.2_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000312431.6_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	6567					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.R1840S(4)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TCAACCTCACGCTTCTGGGCT	0.413																																																	4	Substitution - Missense(4)	lung(4)											145.0	139.0	141.0					6																	56483314		2203	4300	6503	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.5518C>T	6.37:g.56483314G>A	ENSP00000359801:p.Arg1840Cys		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_Spectrin_repeat,superfamily_Ig/albumin-bd,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.R1840C	ENST00000370765.6	37	c.5518	CCDS4959.1	6	.	.	.	.	.	.	.	.	.	.	G	2.020	-0.424894	0.04701	.	.	ENSG00000151914	ENST00000370765	T	0.12465	2.68	5.21	-0.487	0.12060	.	.	.	.	.	T	0.03520	0.0101	.	.	.	0.18873	N	0.999988	B	0.11235	0.004	B	0.04013	0.001	T	0.38090	-0.9677	7	0.56958	D	0.05	.	8.4578	0.32910	0.2468:0.0:0.6425:0.1107	.	1840	Q03001-3	.	C	1840	ENSP00000359801:R1840C	ENSP00000359801:R1840C	R	-	1	0	DST	56591273	0.000000	0.05858	0.013000	0.15412	0.153000	0.21895	0.229000	0.17833	0.021000	0.15133	-0.961000	0.02630	CGT	DST	-	NULL	ENSG00000151914		0.413	DST-010	KNOWN	basic|CCDS	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041027.2	-	0.00	36	0	G	NM_001723		56483314	-1	tier1	-	no_errors	ENST00000370765	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.013	A
CCPG1	9236	genome.wustl.edu	37	15	55647932	55647932	+	3'UTR	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr15:55647932A>G	ENST00000310958.6	-	0	6337				DYX1C1-CCPG1_ENST00000565113.1_RNA|CCPG1_ENST00000442196.3_3'UTR|CCPG1_ENST00000425574.3_3'UTR	NM_001204450.1|NM_001204451.1|NM_004748.4|NM_020739.3	NP_001191379.1|NP_001191380.1|NP_004739.3|NP_065790.2	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1						cell cycle (GO:0007049)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001106)	integral component of membrane (GO:0016021)				autonomic_ganglia(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|stomach(3)	30				all cancers(107;0.0354)		TTAAGAGGGCAGCAAATTCTT	0.353																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF212228	CCDS42039.1, CCDS55966.1, CCDS55967.1	15q21.1	2011-04-20				ENSG00000260916			24227	protein-coding gene	gene with protein product		611326				9383053, 10574462	Standard	NM_004748		Approved	KIAA1254, CPR8	uc010bfk.2	Q9ULG6		ENST00000310958.6:c.*3765T>C	15.37:g.55647932A>G			A0PJH3|A8K9T0|O14712|Q05DG4|Q5U5S7|Q8IYV8|Q9BY53|Q9HA17	RNA	SNP	-	NULL	ENST00000310958.6	37	NULL	CCDS42039.1	15																																																																																			DYX1C1-CCPG1	-	-	ENSG00000261771		0.353	CCPG1-001	KNOWN	basic|CCDS	protein_coding	DYX1C1-CCPG1	HGNC	protein_coding	OTTHUMT00000419850.1	-	0.00	24	0	A	NM_004748		55647932	-1	tier1	-	no_errors	ENST00000565113	ensembl	human	known	74_37	rna	14.81	23	4	SNP	1.000	G
ECT2L	345930	genome.wustl.edu	37	6	139134440	139134440	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:139134440C>T	ENST00000423192.1	+	2	190	c.29C>T	c.(28-30)gCc>gTc	p.A10V	ECT2L_ENST00000541398.1_5'Flank|ECT2L_ENST00000367682.2_Missense_Mutation_p.A10V			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	10							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						AGATTTAGTGCCTGGACACCT	0.383			"""N, Splice, Mis"""		ETP ALL																																			Rec	yes		6	6q24.1	345930	epithelial cell transforming sequence 2 oncogene-like		L	0													77.0	72.0	74.0					6																	139134440		1841	4086	5927	SO:0001583	missense	0				CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.29C>T	6.37:g.139134440C>T	ENSP00000387388:p.Ala10Val		B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Missense_Mutation	SNP	pfam_DH-domain,pfam_F-box_dom,superfamily_DH-domain,superfamily_F-box_dom,smart_DH-domain,pfscan_DH-domain	p.A10V	ENST00000423192.1	37	c.29	CCDS43508.1	6	.	.	.	.	.	.	.	.	.	.	C	16.79	3.220750	0.58560	.	.	ENSG00000203734	ENST00000423192;ENST00000401414;ENST00000367682	T;T;T	0.64438	-0.1;0.71;-0.1	6.08	6.08	0.98989	.	.	.	.	.	T	0.53077	0.1774	L	0.48642	1.525	0.80722	D	1	P	0.48294	0.908	P	0.44422	0.449	T	0.59627	-0.7419	9	0.72032	D	0.01	-3.8986	17.5889	0.87989	0.0:1.0:0.0:0.0	.	10	Q008S8	ECT2L_HUMAN	V	10	ENSP00000387388:A10V;ENSP00000385187:A10V;ENSP00000356655:A10V	ENSP00000356655:A10V	A	+	2	0	ECT2L	139176133	1.000000	0.71417	1.000000	0.80357	0.606000	0.37113	4.781000	0.62389	2.894000	0.99253	0.591000	0.81541	GCC	ECT2L	-	NULL	ENSG00000203734		0.383	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECT2L	HGNC	protein_coding	OTTHUMT00000042441.3	-	0.00	45	0	C	NM_001077706		139134440	+1	tier1	-	no_errors	ENST00000367682	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
EFTUD2	9343	genome.wustl.edu	37	17	42964094	42964094	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:42964094C>T	ENST00000426333.2	-	3	427	c.130G>A	c.(130-132)Gac>Aac	p.D44N	EFTUD2_ENST00000591382.1_Missense_Mutation_p.D44N|EFTUD2_ENST00000402521.3_Missense_Mutation_p.D9N|EFTUD2_ENST00000592576.1_Missense_Mutation_p.D44N|EFTUD2_ENST00000589211.1_5'UTR|RN7SL405P_ENST00000582502.1_RNA	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	44					gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				tctcctacgtcatcgtcgtcg	0.522																																					Ovarian(10;65 485 10258 29980 30707)												0													153.0	98.0	116.0					17																	42964094		2203	4300	6503	SO:0001583	missense	0			D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.130G>A	17.37:g.42964094C>T	ENSP00000392094:p.Asp44Asn		B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFG/EF2_IV,pfam_EFG_V,pfam_Transl_elong_EFTu/EF1A_2,pfam_MIRO-like,superfamily_P-loop_NTPase,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_B-barrel,superfamily_EFG_III-V,smart_Transl_elong_EFG/EF2_IV,smart_EFG_V,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.D44N	ENST00000426333.2	37	c.130	CCDS11489.1	17	.	.	.	.	.	.	.	.	.	.	C	17.51	3.407550	0.62399	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	T;T	0.72505	-0.52;-0.66	6.11	6.11	0.99139	.	0.204155	0.49916	D	0.000122	T	0.64091	0.2567	L	0.46885	1.475	0.58432	D	0.999999	B;B	0.10296	0.0;0.003	B;B	0.08055	0.0;0.003	T	0.56378	-0.7989	10	0.21014	T	0.42	-11.9682	15.4518	0.75279	0.1387:0.8613:0.0:0.0	.	44;44	B4DMC0;Q15029	.;U5S1_HUMAN	N	44;44;9	ENSP00000392094:D44N;ENSP00000385873:D9N	ENSP00000262414:D44N	D	-	1	0	EFTUD2	40319620	1.000000	0.71417	0.958000	0.39756	0.643000	0.38383	5.570000	0.67398	2.906000	0.99361	0.655000	0.94253	GAC	EFTUD2	-	NULL	ENSG00000108883		0.522	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EFTUD2	HGNC	protein_coding	OTTHUMT00000448672.1	-	0.00	31	0	C	NM_004247		42964094	-1	tier1	-	no_errors	ENST00000426333	ensembl	human	known	74_37	missense	20.45	35	9	SNP	1.000	T
ELMO2	63916	genome.wustl.edu	37	20	45003885	45003885	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr20:45003885A>T	ENST00000290246.6	-	13	1249	c.1055T>A	c.(1054-1056)cTg>cAg	p.L352Q	ELMO2_ENST00000352077.2_Missense_Mutation_p.L350Q|ELMO2_ENST00000445496.2_Missense_Mutation_p.L169Q|ELMO2_ENST00000439931.2_Missense_Mutation_p.L364Q|ELMO2_ENST00000454865.2_Missense_Mutation_p.L84Q|ELMO2_ENST00000396391.1_Missense_Mutation_p.L352Q|ELMO2_ENST00000488853.1_5'UTR|ELMO2_ENST00000372176.1_Missense_Mutation_p.L264Q	NM_133171.3	NP_573403.1	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	352	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				apoptotic process (GO:0006915)|cell chemotaxis (GO:0060326)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|urinary_tract(1)	16		Myeloproliferative disorder(115;0.0122)				GGTAAATCCCAGCATTTTGTA	0.527																																																	0													187.0	121.0	143.0					20																	45003885		2203	4300	6503	SO:0001583	missense	0			AF398886	CCDS13398.1	20q13	2010-03-18	2006-01-20		ENSG00000062598	ENSG00000062598		"""Engulfment and cell motility proteins"""	17233	protein-coding gene	gene with protein product		606421	"""engulfment and cell motility 2 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_133171		Approved	CED12, ELMO-2, CED-12, KIAA1834, FLJ11656	uc002xru.1	Q96JJ3	OTTHUMG00000033070	ENST00000290246.6:c.1055T>A	20.37:g.45003885A>T	ENSP00000290246:p.Leu352Gln		E1P5T3|Q5JVZ6|Q7Z5G9|Q96CJ2|Q96ME5|Q96PA9|Q9H938|Q9H9L5|Q9HAH0|Q9NQQ6	Missense_Mutation	SNP	pfam_DUF3361,pfam_Engulfment_cell_motility_ELMO,superfamily_ARM-type_fold	p.L364Q	ENST00000290246.6	37	c.1091	CCDS13398.1	20	.	.	.	.	.	.	.	.	.	.	A	24.6	4.554544	0.86231	.	.	ENSG00000062598	ENST00000290246;ENST00000372176;ENST00000396391;ENST00000439931;ENST00000445496;ENST00000454865;ENST00000352077;ENST00000425546	T;T;T;T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61	4.99	4.99	0.66335	Engulfment/cell motility, ELMO (2);	0.000000	0.85682	D	0.000000	T	0.71221	0.3314	M	0.84683	2.71	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.998;0.998;0.998;0.996	T	0.76945	-0.2771	10	0.87932	D	0	-15.5615	14.0317	0.64619	1.0:0.0:0.0:0.0	.	364;84;352;169;352	B4DRL5;B4DZ20;E9PBG2;B7Z1S8;Q96JJ3	.;.;.;.;ELMO2_HUMAN	Q	352;264;352;364;169;84;350;140	ENSP00000290246:L352Q;ENSP00000361249:L264Q;ENSP00000379673:L352Q;ENSP00000396519:L364Q;ENSP00000409920:L169Q;ENSP00000415641:L84Q;ENSP00000326172:L350Q;ENSP00000388962:L140Q	ENSP00000290246:L352Q	L	-	2	0	ELMO2	44437292	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	9.139000	0.94554	2.096000	0.63516	0.454000	0.30748	CTG	ELMO2	-	pfam_Engulfment_cell_motility_ELMO	ENSG00000062598		0.527	ELMO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELMO2	HGNC	protein_coding	OTTHUMT00000080466.1		0.00	43	0	A	NM_022086		45003885	-1			no_errors	ENST00000439931	ensembl	human	known	74_37	missense	6.25	45	3	SNP	1.000	T
EML2	24139	genome.wustl.edu	37	19	46128025	46128025	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:46128025C>T	ENST00000245925.3	-	9	843	c.793G>A	c.(793-795)Gac>Aac	p.D265N	EML2_ENST00000587152.1_Missense_Mutation_p.D466N|EML2_ENST00000536630.1_Missense_Mutation_p.D412N|EML2_ENST00000586902.1_5'UTR|EML2_ENST00000589876.1_Missense_Mutation_p.D265N	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	265	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		GTGACCACGTCGCCACCTTCC	0.527																																																	0													93.0	67.0	76.0					19																	46128025		2203	4300	6503	SO:0001583	missense	0			AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.793G>A	19.37:g.46128025C>T	ENSP00000245925:p.Asp265Asn		B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Missense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_Quinoprot_gluc/sorb_DH,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D466N	ENST00000245925.3	37	c.1396	CCDS12670.1	19	.	.	.	.	.	.	.	.	.	.	C	16.78	3.218375	0.58560	.	.	ENSG00000125746	ENST00000536630;ENST00000245925;ENST00000448055;ENST00000399594	T;T;T	0.28666	1.6;1.71;5.07	4.09	3.05	0.35203	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.27731	0.0682	M	0.75447	2.3	0.58432	D	0.999998	P;P;P;B	0.51240	0.846;0.599;0.943;0.258	B;B;B;B	0.35470	0.185;0.084;0.203;0.05	T	0.15838	-1.0423	10	0.49607	T	0.09	-4.2057	9.498	0.38999	0.0:0.8937:0.0:0.1063	.	265;431;412;265	B7Z918;B7Z3Q9;B7Z3I2;O95834	.;.;.;EMAL2_HUMAN	N	412;265;466;423	ENSP00000442365:D412N;ENSP00000245925:D265N;ENSP00000382503:D423N	ENSP00000245925:D265N	D	-	1	0	EML2	50819865	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.169000	0.77578	0.941000	0.37499	-0.142000	0.14014	GAC	EML2	-	superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000125746		0.527	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	EML2	HGNC	protein_coding	OTTHUMT00000459608.1	-	0.00	38	0	C	NM_012155		46128025	-1	tier1	-	no_errors	ENST00000587152	ensembl	human	known	74_37	missense	22.54	55	16	SNP	1.000	T
ENAM	10117	genome.wustl.edu	37	4	71503463	71503463	+	Intron	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:71503463G>T	ENST00000396073.3	+	8	815				ENAM_ENST00000472903.1_3'UTR	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin						amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)				haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			TGGCGGCATCGAACGTGGTTT	0.443																																																	0													118.0	114.0	115.0					4																	71503463		2203	4300	6503	SO:0001627	intron_variant	0			AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.535-44G>T	4.37:g.71503463G>T			Q17RI5|Q9H3D1	RNA	SNP	-	NULL	ENST00000396073.3	37	NULL	CCDS3544.2	4																																																																																			ENAM	-	-	ENSG00000132464		0.443	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENAM	HGNC	protein_coding	OTTHUMT00000252166.3	-	0.00	68	0	G	NM_031889		71503463	+1	tier1	-	no_errors	ENST00000472903	ensembl	human	known	74_37	rna	5.88	80	5	SNP	0.001	T
ENOX1	55068	genome.wustl.edu	37	13	43900627	43900627	+	Silent	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr13:43900627G>T	ENST00000261488.6	-	10	1648	c.1071C>A	c.(1069-1071)acC>acA	p.T357T	ENOX1_ENST00000540032.1_Silent_p.T170T|ENOX1_ENST00000412891.1_Silent_p.T357T	NM_001242863.1|NM_017993.3	NP_001229792.1|NP_060463.2	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	357					rhythmic process (GO:0048511)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(3)|large_intestine(7)|lung(18)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(1)	34		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		CTTTTTGTCTGGTAGAAGCGT	0.398																																																	0													130.0	120.0	124.0					13																	43900627		2203	4300	6503	SO:0001819	synonymous_variant	0			EF432052	CCDS9389.1	13q14.11	2013-02-12			ENSG00000120658	ENSG00000120658		"""RNA binding motif (RRM) containing"""	25474	protein-coding gene	gene with protein product		610914				11360993	Standard	NM_001127615		Approved	FLJ10094, PIG38, CNOX, cCNOX	uc001uza.4	Q8TC92	OTTHUMG00000016818	ENST00000261488.6:c.1071C>A	13.37:g.43900627G>T			A4GU15|A6NMH9|B7Z5K1|Q2TU81|Q5VT11|Q9NWE0	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.T357	ENST00000261488.6	37	c.1071	CCDS9389.1	13																																																																																			ENOX1	-	NULL	ENSG00000120658		0.398	ENOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENOX1	HGNC	protein_coding	OTTHUMT00000044717.2	-	0.00	43	0	G	NM_017993		43900627	-1	tier1	-	no_errors	ENST00000261488	ensembl	human	known	74_37	silent	8.51	43	4	SNP	1.000	T
LOC101927209	101927209	genome.wustl.edu	37	1	142620697	142620697	+	lincRNA	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:142620697T>G	ENST00000610091.1	-	0	6786				RP11-417J8.3_ENST00000426408.1_lincRNA																							TTGCATTAAATTATTAGATTA	0.204																																																	0																																												0																															1.37:g.142620697T>G				RNA	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			RP11-417J8.6	-	-	ENSG00000203849		0.204	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2	-	0.00	20	0	T			142620697	-1	tier1	-	no_errors	ENST00000369381	ensembl	human	known	74_37	rna	23.08	10	3	SNP	0.109	G
MGAT4EP	641515	genome.wustl.edu	37	1	202795198	202795198	+	Silent	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:202795198G>T	ENST00000330493.5	+	3	1655	c.564G>T	c.(562-564)gtG>gtT	p.V188V	RP11-480I12.4_ENST00000549576.1_Silent_p.V188V																							GCTCCATTGTGGAATGGGAGG	0.557																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000330493.5:c.564G>T	1.37:g.202795198G>T				Silent	SNP	pfam_Glyco_transf_54	p.V188	ENST00000330493.5	37	c.564		1																																																																																			RP11-480I12.4	-	NULL	ENSG00000184774		0.557	RP11-480I12.4-001	KNOWN	basic|appris_principal	protein_coding	ENSG00000184774	Clone_based_vega_gene	protein_coding	OTTHUMT00000099140.2	-	0.00	43	0	G			202795198	+1	tier1	-	no_errors	ENST00000330493	ensembl	human	known	74_37	silent	5.88	64	4	SNP	0.282	T
FOXP2	93986	genome.wustl.edu	37	7	114054522	114054522	+	5'UTR	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:114054522T>G	ENST00000393494.2	+	0	194				FOXP2_ENST00000462331.1_5'Flank|FOXP2_ENST00000350908.4_5'Flank|FOXP2_ENST00000393489.3_5'Flank|FOXP2_ENST00000403559.4_5'Flank|FOXP2_ENST00000408937.3_5'Flank|FOXP2_ENST00000393498.2_5'Flank|AC073626.2_ENST00000415146.1_RNA|FOXP2_ENST00000378237.3_5'Flank|FOXP2_ENST00000393500.3_Intron			O15409	FOXP2_HUMAN	forkhead box P2						camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						CATTGTTTACTTTACTGTAAA	0.343																																																	0																																										SO:0001623	5_prime_UTR_variant	0			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.-86T>G	7.37:g.114054522T>G			A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	RNA	SNP	-	NULL	ENST00000393494.2	37	NULL	CCDS5760.1	7																																																																																			AC073626.2	-	-	ENSG00000224595		0.343	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	ENSG00000224595	Clone_based_vega_gene	protein_coding	OTTHUMT00000317366.1	-	0.00	24	0	T	NM_014491		114054522	-1	tier1	-	no_errors	ENST00000415146	ensembl	human	known	74_37	rna	43.48	13	10	SNP	1.000	G
TMEM44	93109	genome.wustl.edu	37	3	194353786	194353786	+	Intron	SNP	C	C	G	rs1675956	byFrequency	TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:194353786C>G	ENST00000392432.2	-	1	343				TMEM44_ENST00000273580.7_Intron|TMEM44_ENST00000330115.3_Intron|TMEM44_ENST00000473092.1_Intron|TMEM44_ENST00000381975.3_Intron|AC046143.3_ENST00000447139.1_RNA|TMEM44_ENST00000347147.4_Intron	NM_001166305.1	NP_001159777.1	Q2T9K0	TMM44_HUMAN	transmembrane protein 44							integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|urinary_tract(1)	8	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		CCCGACAGCCCCCCGACCCGT	0.672																																																	0													7.0	9.0	8.0					3																	194353786		1876	3621	5497	SO:0001627	intron_variant	0			AL833026	CCDS3308.1, CCDS33921.1, CCDS3308.2, CCDS54698.1, CCDS54699.1	3q29	2005-08-16			ENSG00000145014	ENSG00000145014			25120	protein-coding gene	gene with protein product							Standard	NM_138399		Approved	DKFZp686O18124	uc010hzn.3	Q2T9K0	OTTHUMG00000156023	ENST00000392432.2:c.137+21G>C	3.37:g.194353786C>G			A1L3V7|B7ZLZ5|B7ZLZ6|C9JJ62|E9PGA9|Q0P6F7|Q6ZT47|Q8IXR1|Q8N4G3	RNA	SNP	-	NULL	ENST00000392432.2	37	NULL	CCDS54699.1	3																																																																																			AC046143.3	-	-	ENSG00000229334		0.672	TMEM44-002	KNOWN	basic|CCDS	protein_coding	ENSG00000229334	Clone_based_vega_gene	protein_coding	OTTHUMT00000342750.1	-	0.00	10	0	C	NM_138399		194353786	+1	tier1	rs1675956	no_errors	ENST00000447139	ensembl	human	known	74_37	rna	28.21	28	11	SNP	0.030	G
RP11-255H23.4	0	genome.wustl.edu	37	19	24014430	24014430	+	lincRNA	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:24014430G>T	ENST00000599944.1	-	0	150				RP11-255H23.2_ENST00000471224.1_RNA																							AAGACCTCTGGCCAGAGCAGG	0.318																																																	0																																												0																															19.37:g.24014430G>T				RNA	SNP	-	NULL	ENST00000599944.1	37	NULL		19																																																																																			RP11-255H23.2	-	-	ENSG00000233836		0.318	RP11-255H23.4-001	KNOWN	basic	lincRNA	ENSG00000233836	Clone_based_vega_gene	lincRNA	OTTHUMT00000466442.1	-	0.00	18	0	G			24014430	+1	tier1	-	no_errors	ENST00000471224	ensembl	human	known	74_37	rna	28.57	10	4	SNP	0.005	T
MTRNR2L1	100462977	genome.wustl.edu	37	17	22024357	22024357	+	IGR	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:22024357A>C	ENST00000540040.1	+	0	1555				RP11-846F4.12_ENST00000483901.2_RNA|MTND1P15_ENST00000579693.1_RNA	NM_001190452.1	NP_001177381.1			MT-RNR2-like 1																		GTTAATCTTAACTTAGGCCTT	0.468																																																	0																																										SO:0001628	intergenic_variant	0			CR612552	CCDS54097.1	17p11.2	2014-02-18			ENSG00000256618	ENSG00000256618			37155	protein-coding gene	gene with protein product	"""humanin-like 1"""					19477263	Standard	NM_001190452		Approved		uc002gzb.2	P0CJ68	OTTHUMG00000179068		17.37:g.22024357A>C				RNA	SNP	-	NULL	ENST00000540040.1	37	NULL	CCDS54097.1	17																																																																																			RP11-846F4.12	-	-	ENSG00000243655		0.468	MTRNR2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000243655	Clone_based_vega_gene	protein_coding	OTTHUMT00000444600.2	-	0.00	31	0	A	NM_001190452		22024357	-1	tier1	-	no_errors	ENST00000483901	ensembl	human	known	74_37	rna	23.33	23	7	SNP	0.961	C
ATR	545	genome.wustl.edu	37	3	142184163	142184164	+	Intron	INS	-	-	A	rs78538255|rs527832083		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:142184163_142184164insA	ENST00000350721.4	-	41	7019				ATR_ENST00000383101.3_Intron|RP11-383G6.3_ENST00000460977.1_RNA	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase						cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						TTGAGTTATGTAAAAAAAAAAA	0.243								Other conserved DNA damage response genes																																									0																																										SO:0001627	intron_variant	0			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.6898-81->T	3.37:g.142184174_142184174dupA			Q59HB2|Q7KYL3|Q93051|Q9BXK4	RNA	INS	-	NULL	ENST00000350721.4	37	NULL	CCDS3124.1	3																																																																																			RP11-383G6.3	-	-	ENSG00000244327		0.243	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000244327	Clone_based_vega_gene	protein_coding	OTTHUMT00000353995.2		0.00	45	0	-	NM_001184		142184164	-1	tier1		no_errors	ENST00000460977	ensembl	human	known	74_37	rna	11.25	71	9	INS	0.002:0.001	A
KHDRBS2	202559	genome.wustl.edu	37	6	62390861	62390861	+	3'UTR	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:62390861A>C	ENST00000281156.4	-	0	1335				RP1-240B8.3_ENST00000511849.2_RNA	NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		ACAGGTGGGAAGGACCTTCAA	0.473																																																	0													178.0	124.0	142.0					6																	62390861		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.*7T>G	6.37:g.62390861A>C			A8K7M8|Q8N4I4|Q8TCZ4	RNA	SNP	-	NULL	ENST00000281156.4	37	NULL	CCDS4963.1	6																																																																																			RP1-240B8.3	-	-	ENSG00000250686		0.473	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000250686	Clone_based_vega_gene	protein_coding	OTTHUMT00000041066.2	-	0.00	44	0	A	NM_152688		62390861	-1	tier1	-	no_errors	ENST00000511849	ensembl	human	known	74_37	rna	17.19	53	11	SNP	1.000	C
BNIP1	662	genome.wustl.edu	37	5	172571581	172571581	+	Missense_Mutation	SNP	C	C	G	rs141484846	byFrequency	TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:172571581C>G	ENST00000351486.5	+	1	64	c.33C>G	c.(31-33)atC>atG	p.I11M	CTC-209H22.3_ENST00000521251.1_RNA|BNIP1_ENST00000352523.6_Missense_Mutation_p.I11M|BNIP1_ENST00000393770.4_Missense_Mutation_p.I11M|BNIP1_ENST00000231668.9_Missense_Mutation_p.I11M	NM_001205.2	NP_001196.2	Q12981	SEC20_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 1	11					apoptotic process (GO:0006915)|autophagy (GO:0006914)|endoplasmic reticulum membrane fusion (GO:0016320)|endoplasmic reticulum organization (GO:0007029)|execution phase of apoptosis (GO:0097194)|negative regulation of apoptotic process (GO:0043066)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			breast(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|skin(1)	11	Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			ACGTCCGGATCTGTAACCAAG	0.592											OREG0017054	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													56.0	55.0	55.0					5																	172571581		2203	4300	6503	SO:0001583	missense	0			AF083957	CCDS4384.1, CCDS4385.1, CCDS4386.1, CCDS43400.1	5q33-q34	2008-02-05	2002-08-29		ENSG00000113734	ENSG00000113734			1082	protein-coding gene	gene with protein product		603291	"""BCL2/adenovirus E1B 19kD-interacting protein 1"""			7954800, 15272311	Standard	NM_013979		Approved	Nip1, SEC20	uc003mcj.4	Q12981	OTTHUMG00000130521	ENST00000351486.5:c.33C>G	5.37:g.172571581C>G	ENSP00000239215:p.Ile11Met	1901	D3DQM3|D3DQM4|D3DQM5|D3DQM6|O75622|O75623|O75624|Q6K044|Q96FG4	Splice_Site	SNP	-	NULL	ENST00000351486.5	37	c.NULL	CCDS4384.1	5	.	.	.	.	.	.	.	.	.	.	C	18.09	3.545872	0.65198	.	.	ENSG00000113734	ENST00000231668;ENST00000351486;ENST00000352523;ENST00000393770	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.07	1.01	0.19927	.	0.053759	0.64402	D	0.000001	T	0.36358	0.0964	M	0.67953	2.075	0.46564	D	0.999101	B;P;B;P	0.43024	0.055;0.798;0.079;0.69	B;B;B;B	0.38264	0.066;0.269;0.03;0.269	T	0.18147	-1.0346	10	0.54805	T	0.06	.	1.3918	0.02252	0.3557:0.3332:0.1158:0.1953	.	11;11;11;11	Q12981-2;Q12981-3;Q12981;Q12981-1	.;.;SEC20_HUMAN;.	M	11	ENSP00000231668:I11M;ENSP00000239215:I11M;ENSP00000239214:I11M;ENSP00000377365:I11M	ENSP00000231668:I11M	I	+	3	3	BNIP1	172504187	0.981000	0.34729	1.000000	0.80357	0.995000	0.86356	0.067000	0.14510	0.299000	0.22661	-0.182000	0.12963	ATC	CTC-209H22.3	-	-	ENSG00000253172		0.592	BNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000253172	Clone_based_vega_gene	protein_coding	OTTHUMT00000252939.1	-	0.00	58	0	C	NM_013979		172571581	-1	tier1	-	no_errors	ENST00000521251	ensembl	human	known	74_37	splice_site	9.43	48	5	SNP	0.996	G
ESR1	2099	genome.wustl.edu	37	6	152265466	152265466	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:152265466G>T	ENST00000206249.3	+	4	1281	c.919G>T	c.(919-921)Gcc>Tcc	p.A307S	ESR1_ENST00000482101.1_3'UTR|ESR1_ENST00000406599.1_Intron|ESR1_ENST00000427531.2_Missense_Mutation_p.A134S|ESR1_ENST00000338799.5_Missense_Mutation_p.A307S|ESR1_ENST00000443427.1_Missense_Mutation_p.A307S|ESR1_ENST00000440973.1_Missense_Mutation_p.A307S|ESR1_ENST00000456483.2_Intron	NM_000125.3	NP_000116.2	P03372	ESR1_HUMAN	estrogen receptor 1	307	Hinge.|Interaction with AKAP13.|Mediates interaction with DNTTIP2.|Self-association.				androgen metabolic process (GO:0008209)|antral ovarian follicle growth (GO:0001547)|cellular response to estradiol stimulus (GO:0071392)|chromatin remodeling (GO:0006338)|epithelial cell development (GO:0002064)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|gene expression (GO:0010467)|intracellular estrogen receptor signaling pathway (GO:0030520)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|male gonad development (GO:0008584)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of gene expression (GO:0010629)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcriptionally active chromatin (GO:0035327)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|estrogen-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0038052)|identical protein binding (GO:0042802)|nitric-oxide synthase regulator activity (GO:0030235)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Allylestrenol(DB01431)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Estropipate(DB04574)|Ethinyl Estradiol(DB00977)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Ospemifene(DB04938)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)|Trilostane(DB01108)	GAACAGCCTGGCCTTGTCCCT	0.572																																																	0													117.0	112.0	114.0					6																	152265466		2203	4300	6503	SO:0001583	missense	0			X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831		"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR		3754034	Standard	NM_000125		Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.919G>T	6.37:g.152265466G>T	ENSP00000206249:p.Ala307Ser		Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	Missense_Mutation	SNP	pfam_Oestr_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Oestr_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.A307S	ENST00000206249.3	37	c.919	CCDS5234.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.56|11.56	1.675335|1.675335	0.29783|0.29783	.|.	.|.	ENSG00000091831|ENSG00000091831	ENST00000440973;ENST00000338799;ENST00000431219;ENST00000443427;ENST00000206249;ENST00000431590;ENST00000544394|ENST00000427531	D;D;D;D;T|.	0.92249|.	-3.0;-3.0;-3.0;-3.0;1.38|.	5.66|5.66	5.66|5.66	0.87406|0.87406	Nuclear hormone receptor, ligand-binding (1);|.	0.356939|.	0.32190|.	N|.	0.006459|.	T|T	0.70491|0.70491	0.3230|0.3230	M|M	0.72118|0.72118	2.19|2.19	0.35474|0.35474	D|D	0.797552|0.797552	B;B;P;B;B;B|.	0.34815|.	0.307;0.001;0.47;0.024;0.046;0.027|.	B;B;P;B;B;B|.	0.44359|.	0.263;0.009;0.447;0.04;0.234;0.118|.	T|T	0.70597|0.70597	-0.4828|-0.4828	10|5	0.23891|.	T|.	0.37|.	.|.	19.7375|19.7375	0.96212|0.96212	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	211;88;49;306;307;307|.	B0QYW6;E7EVR3;Q9Y2W8;A8KAF4;G4XH65;P03372|.	.;.;.;.;.;ESR1_HUMAN|.	S|C	307;307;88;307;307;235;134|211	ENSP00000405330:A307S;ENSP00000342630:A307S;ENSP00000387500:A307S;ENSP00000206249:A307S;ENSP00000445454:A134S|.	ENSP00000206249:A307S|.	A|W	+|+	1|3	0|0	ESR1|ESR1	152307159|152307159	0.524000|0.524000	0.26282|0.26282	0.898000|0.898000	0.35279|0.35279	0.830000|0.830000	0.47004|0.47004	3.605000|3.605000	0.54088|0.54088	2.680000|2.680000	0.91292|0.91292	0.655000|0.655000	0.94253|0.94253	GCC|TGG	ESR1	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000091831		0.572	ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESR1	HGNC	protein_coding	OTTHUMT00000043308.1		0.00	43	0	G			152265466	+1			no_errors	ENST00000206249	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.971	T
ETAA1	54465	genome.wustl.edu	37	2	67631390	67631390	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:67631390A>T	ENST00000272342.5	+	5	1706	c.1576A>T	c.(1576-1578)Aca>Tca	p.T526S	ETAA1_ENST00000462772.1_Intron	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	526						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						AGCTTTGAACACAAGGTATTC	0.318																																																	0													35.0	37.0	37.0					2																	67631390		2198	4298	6496	SO:0001583	missense	0			AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.1576A>T	2.37:g.67631390A>T	ENSP00000272342:p.Thr526Ser		Q05BT7|Q53SC4	Missense_Mutation	SNP	NULL	p.T526S	ENST00000272342.5	37	c.1576	CCDS1882.1	2	.	.	.	.	.	.	.	.	.	.	A	0.175	-1.067362	0.01934	.	.	ENSG00000143971	ENST00000272342	T	0.18502	2.21	5.97	0.753	0.18404	.	0.802027	0.11925	N	0.516296	T	0.12092	0.0294	L	0.56769	1.78	0.09310	N	1	B	0.24823	0.112	B	0.23716	0.048	T	0.39292	-0.9621	10	0.09338	T	0.73	-15.5402	1.1913	0.01865	0.4442:0.2258:0.1266:0.2035	.	526	Q9NY74	ETAA1_HUMAN	S	526	ENSP00000272342:T526S	ENSP00000272342:T526S	T	+	1	0	ETAA1	67484894	0.000000	0.05858	0.002000	0.10522	0.014000	0.08584	0.351000	0.20096	0.136000	0.18733	-0.336000	0.08194	ACA	ETAA1	-	NULL	ENSG00000143971		0.318	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETAA1	HGNC	protein_coding	OTTHUMT00000251735.1	-	0.00	34	0	A	NM_019002		67631390	+1	tier1	-	no_errors	ENST00000272342	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.000	T
EVX2	344191	genome.wustl.edu	37	2	176948500	176948500	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:176948500A>G	ENST00000308618.4	-	1	141	c.5T>C	c.(4-6)aTg>aCg	p.M2T		NM_001080458.1	NP_001073927.1	Q03828	EVX2_HUMAN	even-skipped homeobox 2	2					limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(3)	16			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)		TATTCTTTCCATCATCTCAGC	0.507																																																	0													62.0	69.0	67.0					2																	176948500		2203	4300	6503	SO:0001583	missense	0				CCDS33333.1	2q31.1	2012-03-09	2007-02-15		ENSG00000174279	ENSG00000174279		"""Homeoboxes / ANTP class : HOXL subclass"""	3507	protein-coding gene	gene with protein product		142991	"""eve, even-skipped homeobox homolog 2 (Drosophila)"""			1675198	Standard	NM_001080458		Approved		uc010zeu.2	Q03828	OTTHUMG00000154173	ENST00000308618.4:c.5T>C	2.37:g.176948500A>G	ENSP00000312385:p.Met2Thr			Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Antifreeze_1,prints_Homeobox_metazoa	p.M2T	ENST00000308618.4	37	c.5	CCDS33333.1	2	.	.	.	.	.	.	.	.	.	.	A	16.13	3.036095	0.54896	.	.	ENSG00000174279	ENST00000308618	D	0.92699	-3.09	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.94023	0.8085	L	0.49126	1.545	0.80722	D	1	D	0.55800	0.973	P	0.61201	0.885	D	0.94636	0.7826	10	0.87932	D	0	-21.6336	15.6681	0.77247	1.0:0.0:0.0:0.0	.	2	Q03828	EVX2_HUMAN	T	2	ENSP00000312385:M2T	ENSP00000312385:M2T	M	-	2	0	EVX2	176656746	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.761000	0.91691	2.288000	0.76882	0.533000	0.62120	ATG	EVX2	-	NULL	ENSG00000174279		0.507	EVX2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	EVX2	HGNC	protein_coding	OTTHUMT00000359252.1	-	0.00	49	0	A			176948500	-1	tier1	-	no_errors	ENST00000308618	ensembl	human	known	74_37	missense	42.19	37	27	SNP	1.000	G
EXOC3L2	90332	genome.wustl.edu	37	19	45716562	45716562	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:45716562G>C	ENST00000252482.3	-	9	1022	c.995C>G	c.(994-996)gCc>gGc	p.A332G	AC006126.3_ENST00000591569.1_Intron|EXOC3L2_ENST00000413988.1_Missense_Mutation_p.A332G			Q2M3D2	EX3L2_HUMAN	exocyst complex component 3-like 2	332					exocytosis (GO:0006887)	exocyst (GO:0000145)				endometrium(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00883)		CTCCTGGCGGGCGGCTGTGTT	0.652																																																	0													39.0	42.0	41.0					19																	45716562		2203	4300	6503	SO:0001583	missense	0			AK093466	CCDS12657.1	19q13.32	2011-07-07			ENSG00000130201	ENSG00000130201			30162	protein-coding gene	gene with protein product						21566143	Standard	NM_138568		Approved	FLJ36147, XTP7	uc002pay.1	Q2M3D2	OTTHUMG00000155018	ENST00000252482.3:c.995C>G	19.37:g.45716562G>C	ENSP00000252482:p.Ala332Gly		Q8N9W2|Q96GV2	Missense_Mutation	SNP	pfam_Sec6,superfamily_Tet_transcr_reg_TetR-rel_C	p.A332G	ENST00000252482.3	37	c.995	CCDS12657.1	19	.	.	.	.	.	.	.	.	.	.	G	16.62	3.174347	0.57692	.	.	ENSG00000130201	ENST00000252482;ENST00000413988	T;T	0.07021	3.23;3.23	4.53	3.46	0.39613	.	0.233267	0.34802	N	0.003671	T	0.14098	0.0341	L	0.60455	1.87	0.24919	N	0.992	P	0.52170	0.951	P	0.51615	0.675	T	0.08351	-1.0726	10	0.23302	T	0.38	.	10.381	0.44113	0.0:0.1998:0.8002:0.0	.	332	Q2M3D2	EX3L2_HUMAN	G	332	ENSP00000252482:A332G;ENSP00000400713:A332G	ENSP00000252482:A332G	A	-	2	0	EXOC3L2	50408402	1.000000	0.71417	0.858000	0.33744	0.741000	0.42261	2.444000	0.44890	0.860000	0.35481	0.455000	0.32223	GCC	EXOC3L2	-	pfam_Sec6	ENSG00000130201		0.652	EXOC3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC3L2	HGNC	protein_coding	OTTHUMT00000338073.1	-	0.00	45	0	G	NM_138568		45716562	-1	tier1	-	no_errors	ENST00000252482	ensembl	human	known	74_37	missense	10.53	102	12	SNP	0.972	C
EYS	346007	genome.wustl.edu	37	6	65300762	65300762	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:65300762T>A	ENST00000370621.3	-	26	5524	c.4998A>T	c.(4996-4998)ttA>ttT	p.L1666F	EYS_ENST00000503581.1_Missense_Mutation_p.L1666F|EYS_ENST00000370616.2_Missense_Mutation_p.L1666F			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1666					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						GGACAATGGATAAACAAGTCT	0.313																																																	0													91.0	85.0	87.0					6																	65300762		692	1589	2281	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.4998A>T	6.37:g.65300762T>A	ENSP00000359655:p.Leu1666Phe		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.L1666F	ENST00000370621.3	37	c.4998		6	.	.	.	.	.	.	.	.	.	.	T	13.29	2.193306	0.38707	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.85339	-1.97;-1.94;-1.94	5.34	2.71	0.32032	.	.	.	.	.	T	0.58991	0.2161	N	0.08118	0	0.09310	N	1	P;P	0.44044	0.825;0.561	P;B	0.46253	0.509;0.178	T	0.55573	-0.8120	9	0.66056	D	0.02	.	4.7461	0.13038	0.2943:0.0809:0.0:0.6248	.	1666;1666	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	F	1666	ENSP00000424243:L1666F;ENSP00000359655:L1666F;ENSP00000359650:L1666F	ENSP00000359650:L1666F	L	-	3	2	EYS	65357483	0.029000	0.19370	0.007000	0.13788	0.963000	0.63663	1.150000	0.31639	0.941000	0.37499	0.482000	0.46254	TTA	EYS	-	NULL	ENSG00000188107		0.313	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	-	0.00	19	0	T	XM_294050		65300762	-1	tier1	-	no_errors	ENST00000370616	ensembl	human	known	74_37	missense	42.86	12	9	SNP	0.000	A
F11	2160	genome.wustl.edu	37	4	187206815	187206815	+	Missense_Mutation	SNP	G	G	A	rs373212439		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:187206815G>A	ENST00000403665.2	+	12	1680	c.1328G>A	c.(1327-1329)cGt>cAt	p.R443H	F11_ENST00000264692.4_Missense_Mutation_p.R391H|F11-AS1_ENST00000505103.1_RNA	NM_000128.3	NP_000119.1	P03951	FA11_HUMAN	coagulation factor XI	443	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	32		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	AAGATTTTGCGTGTCTACAGT	0.358													G|||	1	0.000199681	0.0	0.0	5008	,	,		17406	0.0		0.0	False		,,,				2504	0.001																0								G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	123.0	124.0	123.0		1328	3.1	1.0	4		123	0,8600		0,0,4300	no	missense	F11	NM_000128.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	443/626	187206815	1,13005	2203	4300	6503	SO:0001583	missense	0			M13142	CCDS3847.1	4q35	2008-08-01	2008-08-01		ENSG00000088926	ENSG00000088926	3.4.21.27		3529	protein-coding gene	gene with protein product	"""plasma thromboplastin antecedent"""	264900					Standard	NM_000128		Approved	FXI	uc003iza.1	P03951	OTTHUMG00000150311	ENST00000403665.2:c.1328G>A	4.37:g.187206815G>A	ENSP00000384957:p.Arg443His		D3DP64|Q4W5C2|Q9Y495	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_PAN-1_domain,superfamily_Trypsin-like_Pept_dom,smart_Apple,smart_Peptidase_S1,pfscan_Pan_app,pfscan_Peptidase_S1,prints_Apple,prints_Peptidase_S1A	p.R443H	ENST00000403665.2	37	c.1328	CCDS3847.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.52|13.52	2.261978|2.261978	0.39995|0.39995	2.27E-4|2.27E-4	0.0|0.0	ENSG00000088926|ENSG00000088926	ENST00000403665;ENST00000264692|ENST00000264691	D;D|.	0.89270|.	-2.49;-2.49|.	4.86|4.86	3.11|3.11	0.35812|0.35812	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);|.	0.278238|.	0.31673|.	N|.	0.007243|.	T|T	0.40448|0.40448	0.1117|0.1117	N|N	0.26130|0.26130	0.795|0.795	0.35915|0.35915	D|D	0.831388|0.831388	P|.	0.47841|.	0.901|.	B|.	0.34242|.	0.178|.	T|T	0.42749|0.42749	-0.9433|-0.9433	10|5	0.56958|.	D|.	0.05|.	.|.	6.4647|6.4647	0.21975|0.21975	0.1541:0.0:0.7015:0.1444|0.1541:0.0:0.7015:0.1444	.|.	443|.	P03951|.	FA11_HUMAN|.	H|M	443;391|9	ENSP00000384957:R443H;ENSP00000264692:R391H|.	ENSP00000264692:R391H|.	R|V	+|+	2|1	0|0	F11|F11	187443809|187443809	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.883000|0.883000	0.51084|0.51084	0.876000|0.876000	0.28092|0.28092	1.261000|1.261000	0.44149|0.44149	0.650000|0.650000	0.86243|0.86243	CGT|GTG	F11	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000088926		0.358	F11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F11	HGNC	protein_coding	OTTHUMT00000317519.4	-	0.00	63	0	G			187206815	+1	tier1	-	no_errors	ENST00000403665	ensembl	human	known	74_37	missense	32.61	31	15	SNP	1.000	A
FAM160A2	84067	genome.wustl.edu	37	11	6245219	6245219	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:6245219A>T	ENST00000449352.2	-	3	661	c.398T>A	c.(397-399)cTa>cAa	p.L133Q	FAM160A2_ENST00000265978.4_Missense_Mutation_p.L133Q|FAM160A2_ENST00000524416.1_Missense_Mutation_p.L133Q			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	133					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CATTTCAAATAGTTTCAGTTG	0.597																																																	0													47.0	44.0	45.0					11																	6245219		2201	4296	6497	SO:0001583	missense	0				CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.398T>A	11.37:g.6245219A>T	ENSP00000416918:p.Leu133Gln		Q9C0A4|Q9H0N3|Q9H624	Missense_Mutation	SNP	pfam_RetinoicA-induced_16-like	p.L133Q	ENST00000449352.2	37	c.398	CCDS44530.1	11	.	.	.	.	.	.	.	.	.	.	A	21.1	4.096987	0.76870	.	.	ENSG00000051009	ENST00000449352;ENST00000442917;ENST00000265978;ENST00000524416	T;T;T	0.33654	1.4;1.4;1.4	5.05	5.05	0.67936	.	0.000000	0.64402	D	0.000005	T	0.56992	0.2023	M	0.62723	1.935	0.58432	D	0.999992	D;D;D	0.89917	0.999;0.998;1.0	D;D;D	0.91635	0.986;0.986;0.999	T	0.60469	-0.7257	10	0.72032	D	0.01	-14.9996	14.1322	0.65263	1.0:0.0:0.0:0.0	.	133;133;133	E9PJK5;Q8N612;Q8N612-2	.;F16A2_HUMAN;.	Q	133;58;133;133	ENSP00000416918:L133Q;ENSP00000265978:L133Q;ENSP00000431773:L133Q	ENSP00000265978:L133Q	L	-	2	0	FAM160A2	6201795	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.104000	0.77024	2.135000	0.66039	0.533000	0.62120	CTA	FAM160A2	-	pfam_RetinoicA-induced_16-like	ENSG00000051009		0.597	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM160A2	HGNC	protein_coding	OTTHUMT00000383759.1		0.00	11	0	A	NM_032127		6245219	-1			no_errors	ENST00000265978	ensembl	human	known	74_37	missense	21.43	11	3	SNP	1.000	T
FAM169A	26049	genome.wustl.edu	37	5	74135905	74135905	+	Silent	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:74135905G>A	ENST00000389156.4	-	3	316	c.226C>T	c.(226-228)Ctg>Ttg	p.L76L	FAM169A_ENST00000510496.1_Silent_p.L76L|FAM169A_ENST00000380515.3_Silent_p.L76L	NM_015566.2	NP_056381.1	Q9Y6X4	F169A_HUMAN	family with sequence similarity 169, member A	76						membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	27						AGACCTGTCAGTGAATCTTCA	0.333																																																	0													59.0	56.0	57.0					5																	74135905		1797	4063	5860	SO:0001819	synonymous_variant	0				CCDS43330.1	5q13.3	2008-08-08			ENSG00000198780	ENSG00000198780			29138	protein-coding gene	gene with protein product		615769				10048485	Standard	NM_015566		Approved	KIAA0888	uc003kdm.4	Q9Y6X4	OTTHUMG00000162930	ENST00000389156.4:c.226C>T	5.37:g.74135905G>A			A8K1T9|Q6MZT0|Q9H989	Silent	SNP	NULL	p.L76	ENST00000389156.4	37	c.226	CCDS43330.1	5																																																																																			FAM169A	-	NULL	ENSG00000198780		0.333	FAM169A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM169A	HGNC	protein_coding	OTTHUMT00000371092.2		0.00	106	0	G			74135905	-1			no_errors	ENST00000389156	ensembl	human	known	74_37	silent	5.15	92	5	SNP	1.000	A
FAM47A	158724	genome.wustl.edu	37	X	34149661	34149662	+	Missense_Mutation	DNP	GG	GG	AC			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:34149661_34149662GG>AC	ENST00000346193.3	-	1	785_786	c.734_735CC>GT	c.(733-735)tCC>tGT	p.S245C		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	245	Pro-rich.							p.L235_H246delLRPEPPETGVSH(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GGCGGATATGGGACACTCCAGT	0.639																																																	1	Deletion - In frame(1)	ovary(1)																																								SO:0001583	missense	0			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.734_735delinsAC	X.37:g.34149661_34149662delinsAC	ENSP00000345029:p.Ser245Cys		A8K8I9|Q8TAA0	Silent|Missense_Mutation	SNP	NULL	p.S245|p.S245C	ENST00000346193.3	37	c.735|c.734	CCDS43926.1	X																																																																																			FAM47A	-	NULL	ENSG00000185448		0.639	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	HGNC	protein_coding	OTTHUMT00000056205.1	-	0.00	101	0	G	NM_203408		34149661|34149662	-1	tier1	-	no_errors	ENST00000346193	ensembl	human	known	74_37	silent|missense	5.17	110	6	SNP	0.001|0.002	A|C
FAM53C	51307	genome.wustl.edu	37	5	137680947	137680947	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:137680947C>T	ENST00000239906.5	+	4	998	c.570C>T	c.(568-570)agC>agT	p.S190S	FAM53C_ENST00000513056.1_Intron|FAM53C_ENST00000434981.2_Silent_p.S190S|FAM53C_ENST00000507506.1_3'UTR|RP11-256P1.1_ENST00000504539.1_RNA	NM_016605.2	NP_057689.1	Q9NYF3	FA53C_HUMAN	family with sequence similarity 53, member C	190										breast(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GACCCTACAGCCCTCCTTTCT	0.622																																																	0													169.0	182.0	177.0					5																	137680947		2203	4300	6503	SO:0001819	synonymous_variant	0			AF251040	CCDS4204.1	5q31	2008-02-05	2004-11-24	2004-11-26	ENSG00000120709	ENSG00000120709			1336	protein-coding gene	gene with protein product		609372	"""chromosome 5 open reading frame 6"""	C5orf6		11087669, 11161817	Standard	NM_001135647		Approved		uc003lcv.3	Q9NYF3	OTTHUMG00000129201	ENST00000239906.5:c.570C>T	5.37:g.137680947C>T			B2RDJ5|D3DQB9	Silent	SNP	NULL	p.S190	ENST00000239906.5	37	c.570	CCDS4204.1	5																																																																																			FAM53C	-	NULL	ENSG00000120709		0.622	FAM53C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM53C	HGNC	protein_coding	OTTHUMT00000251278.2	-	0.00	57	0	C	NM_016605		137680947	+1	tier1	-	no_errors	ENST00000239906	ensembl	human	known	74_37	silent	5.13	73	4	SNP	0.937	T
FAM86DP	692099	genome.wustl.edu	37	3	75470995	75470996	+	RNA	DNP	TG	TG	AT	rs199754293|rs201238417		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T|G	T|G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:75470995_75470996TG>AT	ENST00000459803.1	-	0	2145_2146					NR_024241.1				family with sequence similarity 86, member D, pseudogene																		TGATGTCAAGTGGGAGGCGGAG	0.594																																																	0																																												0			BC016686		3p12.3	2010-06-04	2010-06-04	2010-06-04	ENSG00000244026	ENSG00000244026			32659	pseudogene	pseudogene			"""family with sequence similarity 86, member D"""	FAM86D			Standard	NR_024241		Approved		uc003dpp.4		OTTHUMG00000158855	Exception_encountered	3.37:g.75470995_75470996delinsAT				RNA	SNP	-	NULL	ENST00000459803.1	37	NULL		3																																																																																			FAM86DP	-	-	ENSG00000244026		0.594	FAM86DP-003	KNOWN	basic	processed_transcript	FAM86DP	HGNC	pseudogene	OTTHUMT00000352425.1		0.00	34	0	T|G	NR_024241		75470995|75470996	-1			no_errors	ENST00000459803	ensembl	human	known	74_37	rna	16.67	25	5	SNP	0.000	A|T
FARP1	10160	genome.wustl.edu	37	13	99091107	99091107	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr13:99091107A>G	ENST00000319562.6	+	20	2589	c.2324A>G	c.(2323-2325)cAg>cGg	p.Q775R	FARP1_ENST00000376586.2_Missense_Mutation_p.Q806R|FARP1_ENST00000595437.1_Missense_Mutation_p.Q806R	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	775	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			AAGGGGCTCCAGCAGCGCATG	0.652																																																	0													71.0	69.0	70.0					13																	99091107		2203	4300	6503	SO:0001583	missense	0			AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.2324A>G	13.37:g.99091107A>G	ENSP00000322926:p.Gln775Arg		Q5JVI9|Q6IQ29	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM-adjacent,pfam_FERM_central,superfamily_DH-domain,superfamily_FERM_central,smart_Band_41_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_FERM_domain,pfscan_Pleckstrin_homology,pfscan_DH-domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.Q806R	ENST00000319562.6	37	c.2417	CCDS9487.1	13	.	.	.	.	.	.	.	.	.	.	A	26.2	4.715004	0.89112	.	.	ENSG00000152767	ENST00000376586;ENST00000319562	T;T	0.75821	-0.97;-0.97	5.6	5.6	0.85130	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.200003	0.45361	D	0.000377	D	0.85457	0.5701	M	0.72624	2.21	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.993;1.0	D	0.87165	0.2217	10	0.87932	D	0	.	15.7837	0.78286	1.0:0.0:0.0:0.0	.	775;806	Q9Y4F1;C9JME2	FARP1_HUMAN;.	R	806;775	ENSP00000365771:Q806R;ENSP00000322926:Q775R	ENSP00000322926:Q775R	Q	+	2	0	FARP1	97889108	1.000000	0.71417	0.928000	0.36995	0.991000	0.79684	9.335000	0.96500	2.120000	0.65058	0.533000	0.62120	CAG	FARP1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000152767		0.652	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARP1	HGNC	protein_coding	OTTHUMT00000045541.3	-	0.00	58	0	A	NM_005766		99091107	+1	tier1	-	no_errors	ENST00000376586	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	G
FAT3	120114	genome.wustl.edu	37	11	92600247	92600247	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:92600247A>C	ENST00000298047.6	+	21	12016	c.11999A>C	c.(11998-12000)aAc>aCc	p.N4000T	FAT3_ENST00000533797.1_Missense_Mutation_p.N335T|FAT3_ENST00000525166.1_Missense_Mutation_p.N3850T|FAT3_ENST00000409404.2_Missense_Mutation_p.N4000T			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	4000	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CCGCTGCAGAACAAGCGCAGC	0.652										TCGA Ovarian(4;0.039)																																							0													10.0	13.0	12.0					11																	92600247		2010	4169	6179	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.11999A>C	11.37:g.92600247A>C	ENSP00000298047:p.Asn4000Thr		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.N4000T	ENST00000298047.6	37	c.11999		11	.	.	.	.	.	.	.	.	.	.	A	15.79	2.938284	0.52972	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41	5.94	5.94	0.96194	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	.	.	.	.	T	0.69993	0.3173	L	0.52364	1.645	0.80722	D	1	P;B	0.52692	0.955;0.125	P;B	0.52454	0.699;0.082	T	0.65471	-0.6160	9	0.17369	T	0.5	.	16.3979	0.83621	1.0:0.0:0.0:0.0	.	4000;4000	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	T	4000;4000;3850;335	ENSP00000298047:N4000T;ENSP00000387040:N4000T;ENSP00000432586:N3850T;ENSP00000436399:N335T	ENSP00000298047:N4000T	N	+	2	0	FAT3	92239895	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.017000	0.76399	2.279000	0.76181	0.459000	0.35465	AAC	FAT3	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G	ENSG00000165323		0.652	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		-	0.00	37	0	A	NM_001008781		92600247	+1	tier1	-	no_errors	ENST00000298047	ensembl	human	known	74_37	missense	29.79	33	14	SNP	1.000	C
FBN2	2201	genome.wustl.edu	37	5	127671703	127671703	+	Missense_Mutation	SNP	G	G	A	rs368105987		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:127671703G>A	ENST00000508053.1	-	34	4675	c.3701C>T	c.(3700-3702)aCg>aTg	p.T1234M	FBN2_ENST00000507835.1_Missense_Mutation_p.T84M|FBN2_ENST00000262464.4_Missense_Mutation_p.T1234M|FBN2_ENST00000508989.1_Missense_Mutation_p.T1201M			P35556	FBN2_HUMAN	fibrillin 2	1234	EGF-like 18; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.T1234M(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GCGGTCTGGCGTAGCCTGATA	0.453													G|||	1	0.000199681	0.0	0.0	5008	,	,		20907	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	large_intestine(1)						G	MET/THR	0,4406		0,0,2203	85.0	76.0	79.0		3701	3.8	0.9	5		79	1,8599	1.2+/-3.3	0,1,4299	no	missense	FBN2	NM_001999.3	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1234/2913	127671703	1,13005	2203	4300	6503	SO:0001583	missense	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.3701C>T	5.37:g.127671703G>A	ENSP00000424571:p.Thr1234Met		B4DU01|Q59ES6	Missense_Mutation	SNP	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.T1234M	ENST00000508053.1	37	c.3701	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	G	17.28	3.350092	0.61183	0.0	1.16E-4	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000507835;ENST00000508989	D;D;D;D	0.92149	-2.98;-2.98;-2.98;-2.98	4.7	3.84	0.44239	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.072319	0.53938	N	0.000054	D	0.93756	0.8004	L	0.42008	1.315	0.51233	D	0.999919	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	D	0.94222	0.7468	10	0.87932	D	0	.	13.5342	0.61639	0.0755:0.0:0.9245:0.0	.	1201;1234	D6RJI3;P35556	.;FBN2_HUMAN	M	1234;1234;84;1201	ENSP00000262464:T1234M;ENSP00000424571:T1234M;ENSP00000426839:T84M;ENSP00000425596:T1201M	ENSP00000262464:T1234M	T	-	2	0	FBN2	127699602	1.000000	0.71417	0.871000	0.34182	0.516000	0.34256	6.566000	0.73978	1.361000	0.45981	-0.363000	0.07495	ACG	FBN2	-	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000138829		0.453	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	-	0.00	14	0	G	NM_001999		127671703	-1	tier1	-	no_errors	ENST00000262464	ensembl	human	known	74_37	missense	40.00	12	8	SNP	0.999	A
FBXO10	26267	genome.wustl.edu	37	9	37515946	37515946	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:37515946C>T	ENST00000432825.2	-	10	2699	c.2651G>A	c.(2650-2652)cGa>cAa	p.R884Q	FBXO10_ENST00000541829.1_Missense_Mutation_p.R409Q|RP11-613M10.8_ENST00000544475.1_5'UTR	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	884					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		GATGCATTCTCGGTTGTTTGA	0.517																																																	0													283.0	251.0	261.0					9																	37515946		1963	4162	6125	SO:0001583	missense	0			AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.2651G>A	9.37:g.37515946C>T	ENSP00000403802:p.Arg884Gln		Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_Pectin_lyase_fold/virulence,superfamily_F-box_dom,smart_F-box_dom,smart_PbH1,smart_Carb-bd_sugar_hydrolysis-dom,pfscan_F-box_dom,tigrfam_Para_beta_helix_rpt-2	p.R884Q	ENST00000432825.2	37	c.2651	CCDS47966.1	9	.	.	.	.	.	.	.	.	.	.	C	13.30	2.197097	0.38806	.	.	ENSG00000147912	ENST00000432825;ENST00000541829	T;T	0.80480	-1.38;-1.38	5.39	0.847	0.18961	Pectin lyase fold/virulence factor (1);	0.850234	0.10386	N	0.680962	T	0.55033	0.1895	N	0.03608	-0.345	0.25450	N	0.988018	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.10450	0.005;0.001;0.001	T	0.41088	-0.9528	10	0.12430	T	0.62	-1.3173	7.0273	0.24946	0.0:0.3617:0.0:0.6383	.	763;409;884	Q59F51;Q08AL4;Q9UK96	.;.;FBX10_HUMAN	Q	884;409	ENSP00000403802:R884Q;ENSP00000441307:R409Q	ENSP00000403802:R884Q	R	-	2	0	FBXO10	37505946	0.986000	0.35501	0.976000	0.42696	0.769000	0.43574	1.266000	0.33039	0.248000	0.21435	-0.254000	0.11334	CGA	FBXO10	-	superfamily_Pectin_lyase_fold/virulence	ENSG00000147912		0.517	FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO10	HGNC	protein_coding	OTTHUMT00000052472.3	-	0.00	27	0	C			37515946	-1	tier1	-	no_errors	ENST00000432825	ensembl	human	known	74_37	missense	22.03	46	13	SNP	0.889	T
FBXO10	26267	genome.wustl.edu	37	9	37516074	37516074	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:37516074C>G	ENST00000432825.2	-	10	2571	c.2523G>C	c.(2521-2523)aaG>aaC	p.K841N	FBXO10_ENST00000541829.1_Missense_Mutation_p.K366N|RP11-613M10.8_ENST00000544475.1_5'UTR	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	841					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.K847N(1)		breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		GGATCCGGTTCTTTATTACCT	0.542																																																	1	Substitution - Missense(1)	large_intestine(1)											62.0	55.0	57.0					9																	37516074		1898	4100	5998	SO:0001583	missense	0			AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.2523G>C	9.37:g.37516074C>G	ENSP00000403802:p.Lys841Asn		Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_Pectin_lyase_fold/virulence,superfamily_F-box_dom,smart_F-box_dom,smart_PbH1,smart_Carb-bd_sugar_hydrolysis-dom,pfscan_F-box_dom,tigrfam_Para_beta_helix_rpt-2	p.K841N	ENST00000432825.2	37	c.2523	CCDS47966.1	9	.	.	.	.	.	.	.	.	.	.	C	15.97	2.991148	0.54041	.	.	ENSG00000147912	ENST00000432825;ENST00000541829	T;T	0.73897	-0.79;-0.79	5.43	4.52	0.55395	Pectin lyase fold/virulence factor (1);Pectin lyase fold (1);	0.055023	0.64402	D	0.000003	T	0.68860	0.3047	N	0.19112	0.55	0.42656	D	0.993461	D;P;P	0.53312	0.959;0.901;0.901	P;P;P	0.55749	0.783;0.71;0.71	T	0.66933	-0.5798	10	0.33940	T	0.23	-31.462	9.8872	0.41268	0.0:0.8399:0.0:0.1601	.	720;366;841	Q59F51;Q08AL4;Q9UK96	.;.;FBX10_HUMAN	N	841;366	ENSP00000403802:K841N;ENSP00000441307:K366N	ENSP00000403802:K841N	K	-	3	2	FBXO10	37506074	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.983000	0.40648	2.552000	0.86080	0.511000	0.50034	AAG	FBXO10	-	superfamily_Pectin_lyase_fold/virulence,smart_PbH1	ENSG00000147912		0.542	FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO10	HGNC	protein_coding	OTTHUMT00000052472.3		0.00	12	0	C			37516074	-1			no_errors	ENST00000432825	ensembl	human	known	74_37	missense	15.38	22	4	SNP	1.000	G
FBXO43	286151	genome.wustl.edu	37	8	101146147	101146147	+	Silent	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:101146147T>C	ENST00000428847.2	-	5	2326	c.2010A>G	c.(2008-2010)ttA>ttG	p.L670L		NM_001029860.3	NP_001025031.2	Q4G163	FBX43_HUMAN	F-box protein 43	670					meiotic nuclear division (GO:0007126)|negative regulation of meiosis (GO:0045835)|negative regulation of protein catabolic process (GO:0042177)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(5)|lung(14)|prostate(1)|skin(5)|urinary_tract(1)	31	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			CACACAGACATAACACACAAA	0.473																																																	0													144.0	139.0	140.0					8																	101146147		1943	4145	6088	SO:0001819	synonymous_variant	0			BC028709	CCDS47904.1	8q22.3	2004-08-24			ENSG00000156509	ENSG00000156509		"""F-boxes /  ""other"""""	28521	protein-coding gene	gene with protein product		609110					Standard	NR_036491		Approved	Fbx43	uc003yjd.3	Q4G163	OTTHUMG00000164803	ENST00000428847.2:c.2010A>G	8.37:g.101146147T>C				Silent	SNP	pfam_Znf_C6HC,superfamily_F-box_dom,smart_Znf_C6HC	p.L670	ENST00000428847.2	37	c.2010	CCDS47904.1	8																																																																																			FBXO43	-	pfam_Znf_C6HC,smart_Znf_C6HC	ENSG00000156509		0.473	FBXO43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO43	HGNC	protein_coding	OTTHUMT00000380380.1		0.00	19	0	T	XM_209918		101146147	-1			no_errors	ENST00000428847	ensembl	human	known	74_37	silent	23.08	20	6	SNP	0.905	C
FCRL4	83417	genome.wustl.edu	37	1	157550165	157550165	+	Intron	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:157550165T>G	ENST00000271532.1	-	8	1385				FCRL4_ENST00000448509.2_Intron	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4						immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				AGACGCATTTTTGTCAGCAGA	0.448																																																	0													95.0	95.0	95.0					1																	157550165		2203	4300	6503	SO:0001627	intron_variant	0			AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.1250-27A>C	1.37:g.157550165T>G			Q96PJ3|Q96RE0	RNA	SNP	-	NULL	ENST00000271532.1	37	NULL	CCDS1166.1	1																																																																																			FCRL4	-	-	ENSG00000163518		0.448	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRL4	HGNC	protein_coding	OTTHUMT00000086180.1	-	0.00	18	0	T	NM_031282		157550165	-1	tier1	-	no_errors	ENST00000479869	ensembl	human	known	74_37	rna	28.85	37	15	SNP	0.000	G
FECH	2235	genome.wustl.edu	37	18	55247402	55247402	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr18:55247402G>A	ENST00000262093.5	-	2	248	c.97C>T	c.(97-99)Cca>Tca	p.P33S	FECH_ENST00000382873.3_Missense_Mutation_p.P33S|FECH_ENST00000585699.1_Intron	NM_000140.3|NM_001012515.2	NP_000131.2|NP_001012533.1	P22830	HEMH_HUMAN	ferrochelatase	33					cellular response to dexamethasone stimulus (GO:0071549)|cholesterol metabolic process (GO:0008203)|detection of UV (GO:0009589)|erythrocyte differentiation (GO:0030218)|generation of precursor metabolites and energy (GO:0006091)|heme biosynthetic process (GO:0006783)|iron ion homeostasis (GO:0055072)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|regulation of gene expression (GO:0010468)|regulation of hemoglobin biosynthetic process (GO:0046984)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to insecticide (GO:0017085)|response to lead ion (GO:0010288)|response to light stimulus (GO:0009416)|response to methylmercury (GO:0051597)|response to platinum ion (GO:0070541)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle assembly (GO:0034379)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)	2 iron, 2 sulfur cluster binding (GO:0051537)|ferrochelatase activity (GO:0004325)|ferrous iron binding (GO:0008198)|heme binding (GO:0020037)|iron-responsive element binding (GO:0030350)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	15		Colorectal(73;0.227)				CACCTCCATGGCTGACAGACC	0.522																																																	0													85.0	78.0	81.0					18																	55247402		2203	4300	6503	SO:0001583	missense	0			D00726	CCDS11964.1, CCDS32836.1	18q21.2-q21.3	2010-05-11	2010-05-11		ENSG00000066926	ENSG00000066926	4.99.1.1		3647	protein-coding gene	gene with protein product	"""protoporphyria"""	612386	"""ferrochelatase (protoporphyria)"""			1838349	Standard	NM_001012515		Approved		uc002lgp.4	P22830	OTTHUMG00000132740	ENST00000262093.5:c.97C>T	18.37:g.55247402G>A	ENSP00000262093:p.Pro33Ser		A8KA72|Q8IXN1|Q8NAN0	Missense_Mutation	SNP	pfam_Ferrochelatase,tigrfam_Ferrochelatase	p.P33S	ENST00000262093.5	37	c.97	CCDS11964.1	18	.	.	.	.	.	.	.	.	.	.	G	13.40	2.224736	0.39300	.	.	ENSG00000066926	ENST00000262093;ENST00000382873	D;D	0.97328	-4.34;-4.34	5.61	4.71	0.59529	.	0.604283	0.18286	N	0.145889	D	0.93383	0.7890	L	0.27053	0.805	0.28745	N	0.901731	B;P	0.38827	0.22;0.649	B;B	0.39258	0.054;0.295	D	0.87766	0.2602	10	0.19147	T	0.46	-5.418	13.8177	0.63301	0.0:0.1537:0.8463:0.0	.	33;33	P22830;P22830-2	HEMH_HUMAN;.	S	33	ENSP00000262093:P33S;ENSP00000372326:P33S	ENSP00000262093:P33S	P	-	1	0	FECH	53398400	0.309000	0.24518	0.992000	0.48379	0.125000	0.20455	3.504000	0.53347	1.447000	0.47661	0.655000	0.94253	CCA	FECH	-	NULL	ENSG00000066926		0.522	FECH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FECH	HGNC	protein_coding	OTTHUMT00000256098.1		0.00	35	0	G			55247402	-1			no_errors	ENST00000382873	ensembl	human	known	74_37	missense	13.33	26	4	SNP	0.958	A
FGFRL1	53834	genome.wustl.edu	37	4	1019055	1019056	+	Frame_Shift_Del	DEL	CA	CA	-	rs571486674|rs145808953		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:1019055_1019056delCA	ENST00000398484.2	+	8	2015_2016	c.1435_1436delCA	c.(1435-1437)cacfs	p.H479fs	FGFRL1_ENST00000504138.1_Frame_Shift_Del_p.H479fs|RP11-460I19.2_ENST00000503095.1_lincRNA|FGFRL1_ENST00000264748.6_Frame_Shift_Del_p.H479fs|FGFRL1_ENST00000510644.1_Frame_Shift_Del_p.H479fs			Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	479	His-rich.				diaphragm development (GO:0060539)|heart valve morphogenesis (GO:0003179)|negative regulation of cell proliferation (GO:0008285)|skeletal system development (GO:0001501)|ventricular septum morphogenesis (GO:0060412)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)			endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			cacagacatccacacacacaca	0.584																																																	0																																										SO:0001589	frameshift_variant	0				CCDS3344.1	4p16	2013-01-11			ENSG00000127418	ENSG00000127418		"""Immunoglobulin superfamily / I-set domain containing"""	3693	protein-coding gene	gene with protein product		605830					Standard	NM_021923		Approved		uc003gcg.3	Q8N441	OTTHUMG00000118998	ENST00000398484.2:c.1435_1436delCA	4.37:g.1019065_1019066delCA	ENSP00000381498:p.His479fs		B2RAU9|Q6PJN1|Q9BXN7|Q9H4D7	Frame_Shift_Del	DEL	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T482fs	ENST00000398484.2	37	c.1435_1436	CCDS3344.1	4																																																																																			FGFRL1	-	NULL	ENSG00000127418		0.584	FGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGFRL1	HGNC	protein_coding	OTTHUMT00000239195.2		0.00	27	0	CA	NM_021923		1019056	+1	tier1		no_errors	ENST00000264748	ensembl	human	known	74_37	frame_shift_del	11.76	30	4	DEL	1.000:1.000	-
FLG	2312	genome.wustl.edu	37	1	152283719	152283719	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:152283719T>G	ENST00000368799.1	-	3	3678	c.3643A>C	c.(3643-3645)Agt>Cgt	p.S1215R	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1215	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCTTGCACTTCTGGATCCT	0.552									Ichthyosis																																								0													355.0	350.0	351.0					1																	152283719		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3643A>C	1.37:g.152283719T>G	ENSP00000357789:p.Ser1215Arg		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.S1215R	ENST00000368799.1	37	c.3643	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	T	2.866	-0.235137	0.05983	.	.	ENSG00000143631	ENST00000368799	T	0.01821	4.62	0.835	-0.724	0.11177	.	.	.	.	.	T	0.00784	0.0026	M	0.73962	2.25	0.09310	N	1	P	0.39520	0.676	B	0.39706	0.307	T	0.43442	-0.9391	9	0.15952	T	0.53	.	3.4165	0.07377	0.0:0.6402:0.0:0.3598	.	1215	P20930	FILA_HUMAN	R	1215	ENSP00000357789:S1215R	ENSP00000357789:S1215R	S	-	1	0	FLG	150550343	.	.	0.002000	0.10522	0.123000	0.20343	.	.	-0.179000	0.10654	0.156000	0.16432	AGT	FLG	-	NULL	ENSG00000143631		0.552	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	144	0	T	NM_002016		152283719	-1	tier1	-	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	11.18	143	18	SNP	0.001	G
DMBT1P1	375940	genome.wustl.edu	37	10	124528869	124528869	+	RNA	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:124528869C>T	ENST00000439464.2	+	0	744					NR_003570.1																						GCTCTGCCTACAGGTAGGACT	0.398																																																	0																																												0																															10.37:g.124528869C>T				RNA	SNP	-	NULL	ENST00000439464.2	37	NULL		10																																																																																			RP11-318C4.2	-	-	ENSG00000176584		0.398	RP11-318C4.2-001	KNOWN	basic	processed_transcript	FLJ46361	Clone_based_vega_gene	pseudogene	OTTHUMT00000471298.1		0.00	24	0	C			124528869	+1			no_errors	ENST00000439464	ensembl	human	known	74_37	rna	9.30	39	4	SNP	0.826	T
FMN2	56776	genome.wustl.edu	37	1	240371277	240371277	+	Silent	SNP	T	T	G	rs200857897		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:240371277T>G	ENST00000319653.9	+	5	3395	c.3165T>G	c.(3163-3165)ccT>ccG	p.P1055P		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1055	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TACCCCCTCCTCCCCCTCTTC	0.736																																																	0													1.0	1.0	1.0					1																	240371277		683	1697	2380	SO:0001819	synonymous_variant	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3165T>G	1.37:g.240371277T>G			B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	pfam_FH2_Formin,pfam_Formin_homology_1,smart_FH2_Formin,pfscan_DEP_dom	p.P1055	ENST00000319653.9	37	c.3165	CCDS31069.2	1																																																																																			FMN2	-	pfam_Formin_homology_1,smart_FH2_Formin	ENSG00000155816		0.736	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2		0.00	32	0	T	XM_371352		240371277	+1			no_errors	ENST00000319653	ensembl	human	known	74_37	silent	12.50	32	5	SNP	0.034	G
FOXP4	116113	genome.wustl.edu	37	6	41555242	41555242	+	Silent	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:41555242G>T	ENST00000307972.4	+	6	876	c.864G>T	c.(862-864)cgG>cgT	p.R288R	FOXP4_ENST00000409208.1_Silent_p.R288R|FOXP4_ENST00000373063.3_Silent_p.R287R|FOXP4_ENST00000373057.3_Silent_p.R286R|FOXP4_ENST00000373060.1_Silent_p.R288R			Q8IVH2	FOXP4_HUMAN	forkhead box P4	288					embryonic foregut morphogenesis (GO:0048617)|heart development (GO:0007507)|lung secretory cell differentiation (GO:0061140)|negative regulation of lung goblet cell differentiation (GO:1901250)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					TCACATCTCGGAGAGACAGGT	0.672											OREG0004065	type=REGULATORY REGION|Gene=FOXP4|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													49.0	54.0	52.0					6																	41555242		2203	4300	6503	SO:0001819	synonymous_variant	0			AB080747	CCDS4856.1, CCDS34447.1, CCDS34448.1	6p21.1	2008-02-05			ENSG00000137166	ENSG00000137166		"""Forkhead boxes"""	20842	protein-coding gene	gene with protein product		608924					Standard	XM_006714991		Approved	FLJ40908	uc003oql.3	Q8IVH2	OTTHUMG00000014679	ENST00000307972.4:c.864G>T	6.37:g.41555242G>T		902	Q5W098|Q7Z7F8|Q8IW55|Q96E19	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.R288	ENST00000307972.4	37	c.864	CCDS34447.1	6																																																																																			FOXP4	-	NULL	ENSG00000137166		0.672	FOXP4-002	KNOWN	basic|CCDS	protein_coding	FOXP4	HGNC	protein_coding	OTTHUMT00000106767.1		0.00	26	0	G	NM_138457		41555242	+1			no_errors	ENST00000307972	ensembl	human	known	74_37	silent	6.94	67	5	SNP	1.000	T
FRAS1	80144	genome.wustl.edu	37	4	79461755	79461755	+	Missense_Mutation	SNP	G	G	A	rs375219965		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:79461755G>A	ENST00000264895.6	+	74	11956	c.11516G>A	c.(11515-11517)cGg>cAg	p.R3839Q		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3835					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TCAGGGCCCCGGGTCCAGCGC	0.562																																																	0								G	GLN/ARG	0,4026		0,0,2013	46.0	49.0	48.0		11516	6.1	1.0	4		48	1,8333		0,1,4166	no	missense	FRAS1	NM_025074.6	43	0,1,6179	AA,AG,GG		0.012,0.0,0.0081	probably-damaging	3839/4013	79461755	1,12359	2013	4167	6180	SO:0001583	missense	0			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.11516G>A	4.37:g.79461755G>A	ENSP00000264895:p.Arg3839Gln		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	pfam_Calx_beta,pfam_VWF_C,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_VWC_out,smart_VWF_C,smart_Furin_repeat,smart_EG-like_dom,smart_Calx_beta,pfscan_VWF_C	p.R3839Q	ENST00000264895.6	37	c.11516	CCDS54771.1	4	.	.	.	.	.	.	.	.	.	.	G	19.66	3.868951	0.72065	0.0	1.2E-4	ENSG00000138759	ENST00000264895	T	0.68765	-0.35	6.06	6.06	0.98353	.	0.063063	0.64402	D	0.000019	T	0.80854	0.4703	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.78119	-0.2328	10	0.46703	T	0.11	.	20.6243	0.99512	0.0:0.0:1.0:0.0	.	3839	E9PHH6	.	Q	3839	ENSP00000264895:R3839Q	ENSP00000264895:R3839Q	R	+	2	0	FRAS1	79680779	1.000000	0.71417	1.000000	0.80357	0.165000	0.22458	7.713000	0.84693	2.879000	0.98667	0.650000	0.86243	CGG	FRAS1	-	NULL	ENSG00000138759		0.562	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FRAS1	HGNC	protein_coding		-	0.00	17	0	G			79461755	+1	tier1	-	no_errors	ENST00000264895	ensembl	human	known	74_37	missense	23.08	20	6	SNP	1.000	A
FREM2	341640	genome.wustl.edu	37	13	39451335	39451335	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr13:39451335G>T	ENST00000280481.7	+	21	8842	c.8626G>T	c.(8626-8628)Gga>Tga	p.G2876*		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2876					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GTTGTCTGATGGATCCATGGG	0.433																																																	0													349.0	313.0	325.0					13																	39451335		2203	4300	6503	SO:0001587	stop_gained	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.8626G>T	13.37:g.39451335G>T	ENSP00000280481:p.Gly2876*		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Nonsense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.G2876*	ENST00000280481.7	37	c.8626	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	G	51	18.578065	0.99907	.	.	ENSG00000150893	ENST00000280481	.	.	.	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	20.3151	0.98650	0.0:0.0:1.0:0.0	.	.	.	.	X	2876	.	ENSP00000280481:G2876X	G	+	1	0	FREM2	38349335	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.809000	0.96659	0.467000	0.42956	GGA	FREM2	-	NULL	ENSG00000150893		0.433	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2		0.00	78	0	G	NM_207361		39451335	+1			no_errors	ENST00000280481	ensembl	human	known	74_37	nonsense	5.13	74	4	SNP	1.000	T
FRG2B	441581	genome.wustl.edu	37	10	135439803	135439803	+	Silent	SNP	C	C	T	rs202189720		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:135439803C>T	ENST00000425520.1	-	2	235	c.183G>A	c.(181-183)tcG>tcA	p.S61S	FRG2B_ENST00000443774.1_Silent_p.S62S	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	61						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		GATTGGGCTCCGATCCTGCTG	0.488																																																	0													1.0	1.0	1.0					10																	135439803		23	64	87	SO:0001819	synonymous_variant	0			AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.183G>A	10.37:g.135439803C>T			Q5VSQ1	Silent	SNP	NULL	p.S61	ENST00000425520.1	37	c.183	CCDS44502.1	10																																																																																			FRG2B	-	NULL	ENSG00000225899		0.488	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FRG2B	HGNC	protein_coding	OTTHUMT00000467780.1	-	0.00	15	0	C	NM_001080998		135439803	-1	tier1	rs202189720	no_errors	ENST00000425520	ensembl	human	known	74_37	silent	30.77	9	4	SNP	0.213	T
FRRS1	391059	genome.wustl.edu	37	1	100176454	100176454	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:100176454G>T	ENST00000414213.1	-	15	2133	c.1532C>A	c.(1531-1533)tCa>tAa	p.S511*	FRRS1_ENST00000492943.1_5'Flank|FRRS1_ENST00000287474.5_Nonsense_Mutation_p.S511*			Q6ZNA5	FRRS1_HUMAN	ferric-chelate reductase 1	511	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.					integral component of membrane (GO:0016021)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	26		all_epithelial(167;2.09e-06)|all_lung(203;0.000435)|Lung NSC(277;0.00201)		Epithelial(280;0.0718)|all cancers(265;0.126)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.206)		GGTTTTCCATGAATCAGGAAG	0.453																																																	0													90.0	80.0	83.0					1																	100176454		2203	4300	6503	SO:0001587	stop_gained	0			AK131302	CCDS30780.1	1p21.3	2009-11-30	2006-02-22	2006-02-22	ENSG00000156869	ENSG00000156869			27622	protein-coding gene	gene with protein product		611578	"""stromal cell derived factor receptor 2 homolog (mouse)"""	SDFR2			Standard	NM_001013660		Approved	SDR2	uc001dsh.1	Q6ZNA5	OTTHUMG00000010768	ENST00000414213.1:c.1532C>A	1.37:g.100176454G>T	ENSP00000393884:p.Ser511*		A6NLN7	Nonsense_Mutation	SNP	pfam_Reeler_dom,pfam_DOMON_domain,smart_DOMON_domain,smart_Cyt_b561/ferric_Rdtase_TM,pfscan_DOMON_domain,pfscan_Reeler_dom,pfscan_Cyt_b561/ferric_Rdtase_TM	p.S511*	ENST00000414213.1	37	c.1532		1	.	.	.	.	.	.	.	.	.	.	G	38	7.126256	0.98081	.	.	ENSG00000156869	ENST00000414213;ENST00000287474	.	.	.	5.61	5.61	0.85477	.	0.196968	0.42548	D	0.000691	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.9145	19.5966	0.95541	0.0:0.0:1.0:0.0	.	.	.	.	X	511	.	ENSP00000287474:S511X	S	-	2	0	FRRS1	99949042	1.000000	0.71417	0.011000	0.14972	0.128000	0.20619	5.098000	0.64548	2.802000	0.96397	0.655000	0.94253	TCA	FRRS1	-	pfscan_Cyt_b561/ferric_Rdtase_TM	ENSG00000156869		0.453	FRRS1-201	KNOWN	basic|appris_principal	protein_coding	FRRS1	HGNC	protein_coding		-	0.00	57	0	G	NM_001013660		100176454	-1	tier1	-	no_errors	ENST00000287474	ensembl	human	known	74_37	nonsense	7.14	51	4	SNP	0.268	T
FSCB	84075	genome.wustl.edu	37	14	44974292	44974292	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr14:44974292T>G	ENST00000340446.4	-	1	2190	c.1899A>C	c.(1897-1899)gaA>gaC	p.E633D	RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	633	Ala-rich.					sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		GAGGCTGAACTTCAGCGGGGG	0.652																																																	0													2.0	1.0	1.0					14																	44974292		682	1602	2284	SO:0001583	missense	0			AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.1899A>C	14.37:g.44974292T>G	ENSP00000344579:p.Glu633Asp		Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	NULL	p.E633D	ENST00000340446.4	37	c.1899	CCDS9679.1	14	.	.	.	.	.	.	.	.	.	.	T	10.01	1.234309	0.22626	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.14391	2.51	4.12	0.46	0.16684	.	.	.	.	.	T	0.11196	0.0273	L	0.50333	1.59	0.09310	N	1	B	0.14438	0.01	B	0.16289	0.015	T	0.33523	-0.9865	9	0.52906	T	0.07	-0.1119	2.4731	0.04569	0.3506:0.2004:0.0:0.449	.	633	Q5H9T9	FSCB_HUMAN	D	633;526	ENSP00000344579:E633D	ENSP00000344579:E633D	E	-	3	2	FSCB	44044042	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.184000	0.16939	0.255000	0.21593	-1.612000	0.00800	GAA	FSCB	-	NULL	ENSG00000189139		0.652	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	HGNC	protein_coding	OTTHUMT00000276788.1		0.00	59	0	T	NM_032135		44974292	-1			no_errors	ENST00000340446	ensembl	human	known	74_37	missense	7.94	58	5	SNP	0.000	G
GABPB1	2553	genome.wustl.edu	37	15	50592988	50592988	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr15:50592988G>T	ENST00000220429.8	-	6	899	c.731C>A	c.(730-732)cCa>cAa	p.P244Q	GABPB1_ENST00000359031.4_Missense_Mutation_p.P232Q|GABPB1_ENST00000380877.3_Missense_Mutation_p.P232Q|GABPB1_ENST00000396464.3_Missense_Mutation_p.P232Q|GABPB1_ENST00000543881.1_Missense_Mutation_p.P168Q|GABPB1_ENST00000429662.2_Missense_Mutation_p.P244Q|GABPB1_ENST00000560825.1_Missense_Mutation_p.P232Q			Q06547	GABP1_HUMAN	GA binding protein transcription factor, beta subunit 1	244					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(1)|large_intestine(7)|lung(5)	14						TTTCTAACCTGGAGTTTCTGA	0.453																																																	0													82.0	79.0	80.0					15																	50592988		2196	4295	6491	SO:0001583	missense	0			D13316	CCDS10135.1, CCDS10136.1, CCDS32239.1, CCDS45258.1	15q21.2	2013-01-10	2008-02-25	2008-02-25	ENSG00000104064	ENSG00000104064		"""Ankyrin repeat domain containing"""	4074	protein-coding gene	gene with protein product		600610	"""GA binding protein transcription factor, beta subunit 2"""	GABPB2		7958862	Standard	NM_016655		Approved	E4TF1-47, GABPB	uc001zyb.3	Q06547	OTTHUMG00000131642	ENST00000220429.8:c.731C>A	15.37:g.50592988G>T	ENSP00000220429:p.Pro244Gln		A8IE52|Q06545|Q12940|Q12941|Q12942|Q8IYD0	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.P244Q	ENST00000220429.8	37	c.731	CCDS32239.1	15	.	.	.	.	.	.	.	.	.	.	G	21.4	4.147577	0.77888	.	.	ENSG00000104064	ENST00000220429;ENST00000380877;ENST00000543881;ENST00000396464;ENST00000429662;ENST00000359031	T;T;T;T	0.66815	0.79;-0.23;-0.17;-0.23	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.73892	0.3645	N	0.22421	0.69	0.54753	D	0.999987	D;D;D;D;P	0.71674	0.995;0.99;0.963;0.998;0.936	P;P;P;D;P	0.78314	0.829;0.83;0.696;0.991;0.534	T	0.76490	-0.2940	10	0.66056	D	0.02	-16.9345	19.9403	0.97159	0.0:0.0:1.0:0.0	.	244;244;232;244;232	B7Z726;Q06547-3;Q06547-4;Q06547;Q06547-2	.;.;.;GABP1_HUMAN;.	Q	232;244;168;232;244;232	ENSP00000442500:P168Q;ENSP00000379728:P232Q;ENSP00000395771:P244Q;ENSP00000351923:P232Q	ENSP00000220429:P232Q	P	-	2	0	GABPB1	48380280	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.480000	0.81109	2.712000	0.92718	0.650000	0.86243	CCA	GABPB1	-	NULL	ENSG00000104064		0.453	GABPB1-005	KNOWN	basic|CCDS	protein_coding	GABPB1	HGNC	protein_coding	OTTHUMT00000418294.1		0.00	22	0	G			50592988	-1			no_errors	ENST00000220429	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
GABRA2	2555	genome.wustl.edu	37	4	46314669	46314669	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:46314669G>C	ENST00000510861.1	-	5	493	c.320C>G	c.(319-321)cCt>cGt	p.P107R	GABRA2_ENST00000507069.1_Missense_Mutation_p.P107R|GABRA2_ENST00000356504.1_Missense_Mutation_p.P107R|GABRA2_ENST00000515082.1_Missense_Mutation_p.P107R|GABRA2_ENST00000540012.1_Missense_Mutation_p.P52R|GABRA2_ENST00000381620.4_Missense_Mutation_p.P107R|GABRA2_ENST00000514090.1_Missense_Mutation_p.P107R			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	107					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	GATATTCATAGGACCTTTAAA	0.279																																																	0													50.0	53.0	52.0					4																	46314669		2200	4299	6499	SO:0001583	missense	0				CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.320C>G	4.37:g.46314669G>C	ENSP00000421828:p.Pro107Arg		A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa2_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.P52R	ENST00000510861.1	37	c.155	CCDS3471.1	4	.	.	.	.	.	.	.	.	.	.	G	25.8	4.670309	0.88348	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069;ENST00000515082;ENST00000503806;ENST00000506961	T;T;T;T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17	5.95	5.95	0.96441	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.88187	0.6369	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.996;1.0	D	0.88171	0.2864	10	0.72032	D	0.01	.	19.3629	0.94448	0.0:0.0:1.0:0.0	.	52;107;107	B7Z1H8;G5E9Z6;P47869	.;.;GBRA2_HUMAN	R	107;107;107;107;52;107;107;107;107	ENSP00000421828:P107R;ENSP00000421300:P107R;ENSP00000371033:P107R;ENSP00000348897:P107R;ENSP00000444409:P52R;ENSP00000427603:P107R;ENSP00000423840:P107R;ENSP00000424362:P107R;ENSP00000424093:P107R	ENSP00000348897:P107R	P	-	2	0	GABRA2	46009426	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	9.869000	0.99810	2.817000	0.96982	0.563000	0.77884	CCT	GABRA2	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,tigrfam_Neur_channel	ENSG00000151834		0.279	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	GABRA2	HGNC	protein_coding	OTTHUMT00000360848.2	-	0.00	61	0	G			46314669	-1	tier1	-	no_errors	ENST00000540012	ensembl	human	known	74_37	missense	13.89	62	10	SNP	1.000	C
GAS2	2620	genome.wustl.edu	37	11	22696495	22696495	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:22696495G>A	ENST00000454584.2	+	2	385	c.80G>A	c.(79-81)aGc>aAc	p.S27N	GAS2_ENST00000433790.1_Missense_Mutation_p.S27N|GAS2_ENST00000278187.3_Missense_Mutation_p.S27N|GAS2_ENST00000533092.1_3'UTR	NM_001143830.1	NP_001137302.1	O43903	GAS2_HUMAN	growth arrest-specific 2	27					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|regulation of cell shape (GO:0008360)	actin filament (GO:0005884)|cytosol (GO:0005829)|membrane (GO:0016020)				breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(4)|stomach(1)	24						TGGCTAGCCAGCAGACATGAA	0.428																																																	0													85.0	84.0	85.0					11																	22696495		2203	4300	6503	SO:0001583	missense	0			BC040470	CCDS7858.1	11p14.3	2005-10-11			ENSG00000148935	ENSG00000148935			4167	protein-coding gene	gene with protein product		602835				9521882	Standard	NM_005256		Approved		uc001mqo.3	O43903	OTTHUMG00000166071	ENST00000454584.2:c.80G>A	11.37:g.22696495G>A	ENSP00000401145:p.Ser27Asn		B2R9C8|D3DQZ0|Q6ICV8|Q7Z3X8	Missense_Mutation	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.S27N	ENST00000454584.2	37	c.80	CCDS7858.1	11	.	.	.	.	.	.	.	.	.	.	G	15.33	2.801467	0.50315	.	.	ENSG00000148935	ENST00000528582;ENST00000454584;ENST00000533363;ENST00000278187;ENST00000534801;ENST00000532398;ENST00000433790	T;T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84;0.84	5.67	5.67	0.87782	Calponin homology domain (1);	0.042534	0.85682	D	0.000000	T	0.37598	0.1009	L	0.36672	1.1	0.42493	D	0.992903	P	0.36789	0.57	B	0.36567	0.228	T	0.14062	-1.0486	10	0.17832	T	0.49	-11.7018	13.6906	0.62544	0.0:0.0:0.8458:0.1542	.	27	O43903	GAS2_HUMAN	N	27	ENSP00000432584:S27N;ENSP00000401145:S27N;ENSP00000434478:S27N;ENSP00000278187:S27N;ENSP00000433182:S27N;ENSP00000435946:S27N;ENSP00000396708:S27N	ENSP00000278187:S27N	S	+	2	0	GAS2	22653071	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.234000	0.78134	2.659000	0.90383	0.655000	0.94253	AGC	GAS2	-	superfamily_CH-domain	ENSG00000148935		0.428	GAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2	HGNC	protein_coding	OTTHUMT00000387717.1		0.00	26	0	G	NM_177553		22696495	+1			no_errors	ENST00000278187	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	A
GKAP1	80318	genome.wustl.edu	37	9	86368199	86368199	+	Silent	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:86368199G>A	ENST00000376371.2	-	9	1214	c.814C>T	c.(814-816)Ctg>Ttg	p.L272L	GKAP1_ENST00000376365.3_Silent_p.L221L	NM_025211.3	NP_079487.2	Q5VSY0	GKAP1_HUMAN	G kinase anchoring protein 1	272					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)				endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)	14						ACATTTTTCAGCTTCTGGATT	0.313																																																	0													172.0	171.0	171.0					9																	86368199		2203	4297	6500	SO:0001819	synonymous_variant	0			BC014476	CCDS35049.1, CCDS47988.1	9q22.1	2008-02-05			ENSG00000165113	ENSG00000165113			17496	protein-coding gene	gene with protein product	"""cGMP-dependent protein kinase anchoring protein 42kDa"""	611356					Standard	NM_025211		Approved	GKAP42, FKSG21	uc004amy.3	Q5VSY0	OTTHUMG00000020106	ENST00000376371.2:c.814C>T	9.37:g.86368199G>A			Q96LI0|Q9BYI1|Q9BYI2|Q9H225	Silent	SNP	NULL	p.L272	ENST00000376371.2	37	c.814	CCDS35049.1	9																																																																																			GKAP1	-	NULL	ENSG00000165113		0.313	GKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GKAP1	HGNC	protein_coding	OTTHUMT00000052839.2		0.00	58	0	G	NM_025211		86368199	-1			no_errors	ENST00000376371	ensembl	human	known	74_37	silent	5.26	72	4	SNP	1.000	A
GLRB	2743	genome.wustl.edu	37	4	158041814	158041814	+	Splice_Site	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:158041814G>T	ENST00000264428.4	+	3	499	c.229G>T	c.(229-231)Ggc>Tgc	p.G77C	GLRB_ENST00000512619.1_Intron|GLRB_ENST00000541722.1_Splice_Site_p.G77C|GLRB_ENST00000509282.1_Splice_Site_p.G77C	NM_000824.4	NP_000815.1	P48167	GLRB_HUMAN	glycine receptor, beta	77					acrosome reaction (GO:0007340)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|extracellular-glycine-gated ion channel activity (GO:0016933)|glycine binding (GO:0016594)			central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(6)|skin(5)|upper_aerodigestive_tract(1)	27	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Enflurane(DB00228)|Glycine(DB00145)|Lindane(DB00431)	AAACTTCAAAGGTTTGTCTCC	0.338																																																	0													78.0	80.0	79.0					4																	158041814		2203	4300	6503	SO:0001630	splice_region_variant	0			U33267	CCDS3796.1, CCDS54813.1	4q31.3	2008-02-05			ENSG00000109738	ENSG00000109738			4329	protein-coding gene	gene with protein product		138492				9676428, 8717357	Standard	NM_000824		Approved		uc003ipj.2	P48167	OTTHUMG00000161954	ENST00000264428.4:c.229+1G>T	4.37:g.158041814G>T			A8K3K2|D3DP23|F5GWE1	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Glycine_rcpt_B,prints_GABAA_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.G77C	ENST00000264428.4	37	c.229	CCDS3796.1	4	.	.	.	.	.	.	.	.	.	.	G	21.5	4.154962	0.78114	.	.	ENSG00000109738	ENST00000264428;ENST00000541722;ENST00000509282	T;T;T	0.79940	-1.32;-1.32;-1.32	5.44	4.6	0.57074	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.90943	0.7153	M	0.89658	3.05	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.92735	0.6203	10	0.87932	D	0	.	14.2532	0.66033	0.072:0.0:0.928:0.0	.	77	P48167	GLRB_HUMAN	C	77	ENSP00000264428:G77C;ENSP00000441873:G77C;ENSP00000427186:G77C	ENSP00000264428:G77C	G	+	1	0	GLRB	158261264	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.225000	0.95219	1.438000	0.47492	0.484000	0.47621	GGC	GLRB	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000109738		0.338	GLRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLRB	HGNC	protein_coding	OTTHUMT00000366507.1	-	0.00	44	0	G	NM_000824	Missense_Mutation	158041814	+1	tier1	-	no_errors	ENST00000264428	ensembl	human	known	74_37	missense	15.91	37	7	SNP	1.000	T
GMEB1	10691	genome.wustl.edu	37	1	29041385	29041386	+	3'UTR	INS	-	-	A	rs372271712|rs559808019|rs528044464	byFrequency	TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:29041385_29041386insA	ENST00000294409.2	+	0	1912				GMEB1_ENST00000373816.1_3'UTR|GMEB1_ENST00000480454.1_3'UTR|GMEB1_ENST00000361872.4_3'UTR	NM_006582.3	NP_006573.2	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding protein 1						transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)	11		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		GACCCTTTTTTAAAAAAAAAAA	0.342																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF099013	CCDS327.1, CCDS328.1	1p35	2008-02-05			ENSG00000162419	ENSG00000162419			4370	protein-coding gene	gene with protein product		604409				10386584, 10523663	Standard	NM_006582		Approved	P96PIF, PIF96	uc001bra.3	Q9Y692	OTTHUMG00000003647	ENST00000294409.2:c.*100->A	1.37:g.29041396_29041396dupA			B1AT48|Q9NWH1|Q9UKD0	RNA	INS	-	NULL	ENST00000294409.2	37	NULL	CCDS327.1	1																																																																																			GMEB1	-	-	ENSG00000162419		0.342	GMEB1-003	KNOWN	basic|CCDS	protein_coding	GMEB1	HGNC	protein_coding	OTTHUMT00000010333.1		0.00	21	0	-	NM_006582		29041386	+1	tier1		no_errors	ENST00000480454	ensembl	human	known	74_37	rna	13.79	25	4	INS	0.437:0.252	A
GNA13	10672	genome.wustl.edu	37	17	63049639	63049639	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:63049639C>T	ENST00000439174.2	-	2	736	c.491G>A	c.(490-492)cGg>cAg	p.R164Q	GNA13_ENST00000541118.1_Missense_Mutation_p.R69Q|RP11-583F2.5_ENST00000581796.1_RNA	NM_006572.4	NP_006563.2	Q14344	GNA13_HUMAN	guanine nucleotide binding protein (G protein), alpha 13	164					activation of phospholipase D activity (GO:0031584)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|in utero embryonic development (GO:0001701)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	D5 dopamine receptor binding (GO:0031752)|G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 1 angiotensin receptor binding (GO:0031702)	p.R164Q(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(14)|kidney(2)|large_intestine(4)|lung(6)|urinary_tract(1)	34						TTCTCGACGCCGGTCATAGGC	0.408																																																	1	Substitution - Missense(1)	central_nervous_system(1)											84.0	89.0	87.0					17																	63049639		2203	4300	6503	SO:0001583	missense	0			L22075	CCDS11661.1, CCDS62302.1	17q24.1	2014-09-04			ENSG00000120063	ENSG00000120063			4381	protein-coding gene	gene with protein product		604406				7791744	Standard	NM_006572		Approved	G13, MGC46138	uc002jfc.3	Q14344	OTTHUMG00000179316	ENST00000439174.2:c.491G>A	17.37:g.63049639C>T	ENSP00000400717:p.Arg164Gln		B2R977|B7Z7R0|F5H1G8|Q8TD70	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_12	p.R164Q	ENST00000439174.2	37	c.491	CCDS11661.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.460789	0.96240	.	.	ENSG00000120063	ENST00000439174;ENST00000541118;ENST00000239138	D;D	0.90133	-2.62;-2.62	5.42	5.42	0.78866	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.94308	0.8171	L	0.55213	1.73	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.94670	0.7856	10	0.87932	D	0	.	19.2521	0.93929	0.0:1.0:0.0:0.0	.	164	Q14344	GNA13_HUMAN	Q	164;69;139	ENSP00000400717:R164Q;ENSP00000439647:R69Q	ENSP00000239138:R139Q	R	-	2	0	GNA13	60480101	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.542000	0.85734	0.655000	0.94253	CGG	GNA13	-	pfam_Gprotein_alpha_su,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su	ENSG00000120063		0.408	GNA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNA13	HGNC	protein_coding	OTTHUMT00000445720.1	-	0.00	35	0	C	NM_006572		63049639	-1	tier1	-	no_errors	ENST00000439174	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
GNRH1	2796	genome.wustl.edu	37	8	25276973	25276973	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:25276973T>C	ENST00000276414.4	-	3	1564	c.241A>G	c.(241-243)Agt>Ggt	p.S81G	GNRH1_ENST00000421054.2_Missense_Mutation_p.S81G	NM_000825.3	NP_000816.4	P01148	GON1_HUMAN	gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)	81					cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron migration (GO:2001223)|ovulation cycle (GO:0042698)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|response to corticosteroid (GO:0031960)|response to ethanol (GO:0045471)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	gonadotropin hormone-releasing hormone activity (GO:0005183)|hormone activity (GO:0005179)			large_intestine(1)	1		all_cancers(63;0.0423)|Ovarian(32;0.000626)|all_epithelial(46;0.0186)|Hepatocellular(4;0.114)|Breast(100;0.14)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0201)|Epithelial(17;1.25e-12)|Colorectal(74;0.0113)|COAD - Colon adenocarcinoma(73;0.0385)		TCAATCAGACTTTCCTGAAAA	0.313																																																	0													97.0	92.0	93.0					8																	25276973		1803	4069	5872	SO:0001583	missense	0			X01059	CCDS43725.1	8p21-p11.2	2013-02-26	2004-10-13		ENSG00000147437	ENSG00000147437		"""Endogenous ligands"""	4419	protein-coding gene	gene with protein product		152760	"""gonadotropin-releasing hormone 1 (leutinizing-releasing hormone)"""	GRH, GNRH, LHRH		6090951	Standard	NM_000825		Approved		uc003xem.4	P01148	OTTHUMG00000163852	ENST00000276414.4:c.241A>G	8.37:g.25276973T>C	ENSP00000276414:p.Ser81Gly		A0AVP0	Missense_Mutation	SNP	pfam_GnRH,prints_Gonadoliberin_I_precursor	p.S81G	ENST00000276414.4	37	c.241	CCDS43725.1	8	.	.	.	.	.	.	.	.	.	.	T	15.73	2.920097	0.52653	.	.	ENSG00000147437	ENST00000421054;ENST00000276414	T;T	0.52295	0.67;0.67	5.22	4.04	0.47022	.	0.066430	0.64402	D	0.000008	T	0.36771	0.0979	.	.	.	0.50813	D	0.999895	P	0.39282	0.666	B	0.35039	0.194	T	0.15093	-1.0449	9	0.45353	T	0.12	-7.2519	10.3677	0.44035	0.0:0.0:0.1641:0.8359	.	81	P01148	GON1_HUMAN	G	81	ENSP00000391280:S81G;ENSP00000276414:S81G	ENSP00000276414:S81G	S	-	1	0	GNRH1	25332890	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.072000	0.30678	0.903000	0.36546	0.377000	0.23210	AGT	GNRH1	-	prints_Gonadoliberin_I_precursor	ENSG00000147437		0.313	GNRH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNRH1	HGNC	protein_coding	OTTHUMT00000375982.1	-	0.00	41	0	T	NM_001083111		25276973	-1	tier1	-	no_errors	ENST00000276414	ensembl	human	known	74_37	missense	12.50	49	7	SNP	1.000	C
GOLGA3	2802	genome.wustl.edu	37	12	133378518	133378518	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:133378518G>T	ENST00000450791.2	-	7	1818	c.1635C>A	c.(1633-1635)agC>agA	p.S545R	GOLGA3_ENST00000537452.1_Missense_Mutation_p.S545R|GOLGA3_ENST00000456883.2_Missense_Mutation_p.S545R|GOLGA3_ENST00000204726.3_Missense_Mutation_p.S545R|GOLGA3_ENST00000545875.1_Missense_Mutation_p.S545R			Q08378	GOGA3_HUMAN	golgin A3	545	Gln-rich.				intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GCTGAAGCTGGCTCTGCAAGG	0.657																																																	0													39.0	35.0	36.0					12																	133378518		2203	4300	6503	SO:0001583	missense	0			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.1635C>A	12.37:g.133378518G>T	ENSP00000410378:p.Ser545Arg		A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	superfamily_Prefoldin	p.S545R	ENST00000450791.2	37	c.1635	CCDS9281.1	12	.	.	.	.	.	.	.	.	.	.	G	18.49	3.634705	0.67130	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22	5.8	4.92	0.64577	.	0.276513	0.51477	D	0.000089	T	0.68403	0.2997	N	0.19112	0.55	0.80722	D	1	P;P;P	0.51351	0.935;0.886;0.944	P;P;P	0.49226	0.591;0.495;0.603	T	0.64875	-0.6304	10	0.21540	T	0.41	.	10.7821	0.46384	0.1437:0.0:0.8563:0.0	.	545;545;545	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	R	545	ENSP00000204726:S545R;ENSP00000410378:S545R;ENSP00000409303:S545R;ENSP00000442143:S545R;ENSP00000442603:S545R	ENSP00000204726:S545R	S	-	3	2	GOLGA3	131888591	0.998000	0.40836	1.000000	0.80357	0.896000	0.52359	1.387000	0.34430	1.471000	0.48121	0.655000	0.94253	AGC	GOLGA3	-	NULL	ENSG00000090615		0.657	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA3	HGNC	protein_coding	OTTHUMT00000397569.2		0.00	26	0	G	NM_005895		133378518	-1			no_errors	ENST00000204726	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
GPATCH4	54865	genome.wustl.edu	37	1	156565052	156565052	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:156565052T>A	ENST00000438976.2	-	8	1111	c.1081A>T	c.(1081-1083)Act>Tct	p.T361S	GPATCH4_ENST00000368232.4_Missense_Mutation_p.T356S|GPATCH4_ENST00000497287.1_5'Flank			Q5T3I0	GPTC4_HUMAN	G patch domain containing 4	356							poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(3)|stomach(1)	17	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CACCTAAAAGTTTCCTCACCT	0.512																																																	0													191.0	191.0	191.0					1																	156565052		2203	4300	6503	SO:0001583	missense	0			BC056904	CCDS1146.1, CCDS44245.1	1q22	2013-01-28		2006-12-13	ENSG00000160818	ENSG00000160818		"""G patch domain containing"""	25982	protein-coding gene	gene with protein product				GPATC4		12477932	Standard	NM_015590		Approved	FLJ20249, DKFZP434F1735	uc001fpl.3	Q5T3I0	OTTHUMG00000033203	ENST00000438976.2:c.1081A>T	1.37:g.156565052T>A	ENSP00000396441:p.Thr361Ser		Q5T3I1|Q6ZUE7|Q8IWG8|Q9NXH4	Missense_Mutation	SNP	pfam_G_patch_dom,smart_G_patch_dom,pfscan_G_patch_dom	p.T361S	ENST00000438976.2	37	c.1081	CCDS44245.1	1	.	.	.	.	.	.	.	.	.	.	T	11.02	1.515900	0.27123	.	.	ENSG00000160818	ENST00000368232;ENST00000368229;ENST00000438976	.	.	.	4.23	-2.65	0.06095	.	0.922459	0.08880	N	0.880267	T	0.15003	0.0362	L	0.29908	0.895	0.09310	N	0.999999	B;B	0.22003	0.063;0.063	B;B	0.19666	0.026;0.026	T	0.32666	-0.9898	9	0.25106	T	0.35	-9.1235	12.933	0.58296	0.0:0.8006:0.0:0.1994	.	361;356	E9PAV9;Q5T3I0	.;GPTC4_HUMAN	S	356;356;361	.	ENSP00000357212:T356S	T	-	1	0	GPATCH4	154831676	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.744000	0.04839	-0.478000	0.06823	0.455000	0.32223	ACT	GPATCH4	-	NULL	ENSG00000160818		0.512	GPATCH4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPATCH4	HGNC	protein_coding	OTTHUMT00000386947.1		0.00	31	0	T	NM_017725		156565052	-1			no_errors	ENST00000438976	ensembl	human	known	74_37	missense	12.20	36	5	SNP	0.001	A
GPM6A	2823	genome.wustl.edu	37	4	176622760	176622760	+	Silent	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:176622760T>G	ENST00000280187.7	-	3	241	c.196A>C	c.(196-198)Aga>Cga	p.R66R	GPM6A_ENST00000506894.1_Silent_p.R55R|GPM6A_ENST00000393658.2_Silent_p.R66R|GPM6A_ENST00000515090.1_Silent_p.R59R	NM_005277.4	NP_005268.1	P51674	GPM6A_HUMAN	glycoprotein M6A	66					neural retina development (GO:0003407)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|positive regulation of filopodium assembly (GO:0051491)|stem cell differentiation (GO:0048863)|synapse assembly (GO:0007416)	axonal growth cone (GO:0044295)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium channel activity (GO:0005262)	p.R66R(1)		NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		CCAGCAGTTCTTGCCATCTCA	0.418																																																	1	Substitution - coding silent(1)	large_intestine(1)											161.0	151.0	155.0					4																	176622760		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3824.1, CCDS54822.1, CCDS58936.1	4q34	2008-08-29				ENSG00000150625			4460	protein-coding gene	gene with protein product		601275		GPM6		8661015, 18574501	Standard	NM_005277		Approved		uc003iug.4	P51674		ENST00000280187.7:c.196A>C	4.37:g.176622760T>G			B7Z642|E9PHI5|Q92602	Silent	SNP	pfam_Myelin_PLP,smart_Myelin_PLP,prints_Myelin_PLP	p.R66	ENST00000280187.7	37	c.196	CCDS3824.1	4																																																																																			GPM6A	-	pfam_Myelin_PLP	ENSG00000150625		0.418	GPM6A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPM6A	HGNC	protein_coding	OTTHUMT00000362163.1		0.00	39	0	T			176622760	-1			no_errors	ENST00000280187	ensembl	human	known	74_37	silent	5.00	38	2	SNP	1.000	G
GPR150	285601	genome.wustl.edu	37	5	94957074	94957074	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:94957074G>C	ENST00000380007.2	+	1	1293	c.1095G>C	c.(1093-1095)caG>caC	p.Q365H		NM_199243.1	NP_954713.1	Q8NGU9	GP150_HUMAN	G protein-coupled receptor 150	365						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			lung(2)	2		all_cancers(142;0.000462)|all_epithelial(76;2.44e-06)|all_lung(232;0.0318)|Lung NSC(167;0.041)|Ovarian(225;0.051)		all cancers(79;1.82e-16)		TCCGGCGACAGCTGCGGAAGC	0.731																																																	0													4.0	6.0	5.0					5																	94957074		1976	4004	5980	SO:0001583	missense	0			BC030197	CCDS4074.1	5q15	2012-08-21			ENSG00000178015	ENSG00000178015		"""GPCR / Class A : Orphans"""	23628	protein-coding gene	gene with protein product						12679517	Standard	NM_199243		Approved	PGR11	uc003kle.1	Q8NGU9	OTTHUMG00000121170	ENST00000380007.2:c.1095G>C	5.37:g.94957074G>C	ENSP00000369344:p.Gln365His			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.Q365H	ENST00000380007.2	37	c.1095	CCDS4074.1	5	.	.	.	.	.	.	.	.	.	.	G	4.075	0.011768	0.07912	.	.	ENSG00000178015	ENST00000380007	T	0.37235	1.21	4.16	2.33	0.28932	.	0.253950	0.20440	N	0.092292	T	0.17408	0.0418	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.16424	-1.0403	10	0.44086	T	0.13	-14.8275	7.4559	0.27266	0.0996:0.1812:0.7192:0.0	.	365	Q8NGU9	GP150_HUMAN	H	365	ENSP00000369344:Q365H	ENSP00000369344:Q365H	Q	+	3	2	GPR150	94982830	0.099000	0.21834	0.272000	0.24630	0.046000	0.14306	0.754000	0.26390	0.213000	0.20722	-0.244000	0.11960	CAG	GPR150	-	NULL	ENSG00000178015		0.731	GPR150-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR150	HGNC	protein_coding	OTTHUMT00000241657.2	-	0.00	16	0	G			94957074	+1	tier1	-	no_errors	ENST00000380007	ensembl	human	known	74_37	missense	20.00	16	4	SNP	0.014	C
GRIA1	2890	genome.wustl.edu	37	5	153026562	153026562	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:153026562T>G	ENST00000285900.5	+	3	638	c.295T>G	c.(295-297)Tcc>Gcc	p.S99A	GRIA1_ENST00000518783.1_Missense_Mutation_p.S109A|GRIA1_ENST00000518862.1_3'UTR|GRIA1_ENST00000448073.4_Missense_Mutation_p.S109A|GRIA1_ENST00000518142.1_Intron|GRIA1_ENST00000340592.5_Missense_Mutation_p.S99A|GRIA1_ENST00000521843.2_Missense_Mutation_p.S30A	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	99					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	CATGCTGACCTCCTTTTGTGG	0.488																																																	0													169.0	153.0	158.0					5																	153026562		2203	4300	6503	SO:0001583	missense	0				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.295T>G	5.37:g.153026562T>G	ENSP00000285900:p.Ser99Ala		B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.S109A	ENST00000285900.5	37	c.325	CCDS4322.1	5	.	.	.	.	.	.	.	.	.	.	T	27.1	4.801886	0.90538	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	D;D;D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8;-1.8;-1.8	5.35	5.35	0.76521	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.89815	0.6824	M	0.66378	2.025	0.80722	D	1	D;D;D;D;D	0.69078	0.994;0.994;0.994;0.993;0.997	D;D;D;D;D	0.85130	0.997;0.997;0.997;0.995;0.994	D	0.90929	0.4789	10	0.87932	D	0	.	14.5102	0.67780	0.0:0.0:0.0:1.0	.	109;109;109;99;99	E7ESV8;B7Z9G9;B7Z2W8;P42261-2;P42261	.;.;.;.;GRIA1_HUMAN	A	99;99;53;99;30;30;109;109	ENSP00000285900:S99A;ENSP00000339343:S99A;ENSP00000427864:S30A;ENSP00000442108:S30A;ENSP00000428994:S109A;ENSP00000415569:S109A	ENSP00000285900:S99A	S	+	1	0	GRIA1	153006755	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.796000	0.85898	2.027000	0.59764	0.533000	0.62120	TCC	GRIA1	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000155511		0.488	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	HGNC	protein_coding	OTTHUMT00000252456.3	-	0.00	70	0	T			153026562	+1	tier1	-	no_errors	ENST00000448073	ensembl	human	known	74_37	missense	30.86	56	25	SNP	1.000	G
GRIA4	2893	genome.wustl.edu	37	11	105483135	105483135	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:105483135C>T	ENST00000530497.1	+	2	221	c.221C>T	c.(220-222)gCc>gTc	p.A74V	GRIA4_ENST00000525187.1_Missense_Mutation_p.A74V|GRIA4_ENST00000527669.1_Missense_Mutation_p.A74V|GRIA4_ENST00000282499.5_Missense_Mutation_p.A74V|GRIA4_ENST00000393127.2_Missense_Mutation_p.A74V|GRIA4_ENST00000393125.2_Missense_Mutation_p.A74V|GRIA4_ENST00000428631.2_Missense_Mutation_p.A74V			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	74					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		ATTGAGACAGCCAACAGTTTT	0.393																																																	0													102.0	93.0	96.0					11																	105483135		2202	4299	6501	SO:0001583	missense	0			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.221C>T	11.37:g.105483135C>T	ENSP00000435775:p.Ala74Val		Q86XE8	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A74V	ENST00000530497.1	37	c.221	CCDS8333.1	11	.	.	.	.	.	.	.	.	.	.	C	23.0	4.365196	0.82463	.	.	ENSG00000152578	ENST00000527177;ENST00000393125;ENST00000531986;ENST00000282499;ENST00000393127;ENST00000527669;ENST00000525921;ENST00000428631;ENST00000531011;ENST00000530497;ENST00000525187	D;D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	5.81	5.81	0.92471	Extracellular ligand-binding receptor (1);	0.087447	0.48767	D	0.000170	T	0.80099	0.4561	L	0.50333	1.59	0.80722	D	1	B;P;P;B;P	0.48350	0.254;0.759;0.909;0.043;0.59	B;B;B;B;B	0.40636	0.047;0.226;0.335;0.035;0.178	T	0.76995	-0.2752	10	0.18276	T	0.48	.	20.0784	0.97758	0.0:1.0:0.0:0.0	.	74;74;104;74;74	P48058;G3V164;Q59GL7;Q86XE8;E9PQN1	GRIA4_HUMAN;.;.;.;.	V	74	ENSP00000376833:A74V;ENSP00000282499:A74V;ENSP00000376835:A74V;ENSP00000415551:A74V;ENSP00000432443:A74V;ENSP00000435775:A74V;ENSP00000432180:A74V	ENSP00000282499:A74V	A	+	2	0	GRIA4	104988345	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.736000	0.93811	0.655000	0.94253	GCC	GRIA4	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000152578		0.393	GRIA4-005	KNOWN	basic|CCDS	protein_coding	GRIA4	HGNC	protein_coding	OTTHUMT00000388593.1	-	0.00	35	0	C			105483135	+1	tier1	-	no_errors	ENST00000282499	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
GRXCR1	389207	genome.wustl.edu	37	4	42895333	42895333	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:42895333G>A	ENST00000399770.2	+	1	50	c.50G>A	c.(49-51)cGg>cAg	p.R17Q	RN7SKP82_ENST00000516786.1_RNA	NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	17					auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						CGGAAAGTCCGGTTTCGGATC	0.507																																																	0													106.0	114.0	111.0					4																	42895333		2018	4181	6199	SO:0001583	missense	0				CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.50G>A	4.37:g.42895333G>A	ENSP00000382670:p.Arg17Gln			Missense_Mutation	SNP	pfam_Glutaredoxin,superfamily_Thioredoxin-like_fold,superfamily_HSP_DnaJ_Cys-rich_dom	p.R17Q	ENST00000399770.2	37	c.50	CCDS43225.1	4	.	.	.	.	.	.	.	.	.	.	G	26.5	4.748413	0.89663	.	.	ENSG00000215203	ENST00000399770	T	0.28454	1.61	5.37	5.37	0.77165	.	0.000000	0.64402	U	0.000001	T	0.54581	0.1867	M	0.64404	1.975	0.58432	D	0.999998	D	0.89917	1.0	D	0.76575	0.988	T	0.55003	-0.8208	10	0.59425	D	0.04	2.609	18.1022	0.89509	0.0:0.0:1.0:0.0	.	17	A8MXD5	GRCR1_HUMAN	Q	17	ENSP00000382670:R17Q	ENSP00000382670:R17Q	R	+	2	0	GRXCR1	42590090	1.000000	0.71417	1.000000	0.80357	0.603000	0.37013	9.470000	0.97683	2.500000	0.84329	0.650000	0.86243	CGG	GRXCR1	-	NULL	ENSG00000215203		0.507	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRXCR1	HGNC	protein_coding	OTTHUMT00000360576.1	-	0.00	34	0	G	NM_001080476		42895333	+1	tier1	-	no_errors	ENST00000399770	ensembl	human	known	74_37	missense	11.32	47	6	SNP	1.000	A
GSTCD	79807	genome.wustl.edu	37	4	106638997	106638997	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:106638997T>A	ENST00000515279.1	+	2	447	c.227T>A	c.(226-228)aTt>aAt	p.I76N	GSTCD_ENST00000394728.3_Missense_Mutation_p.I76N|GSTCD_ENST00000515255.1_Intron|GSTCD_ENST00000394730.3_Intron|GSTCD_ENST00000360505.5_Missense_Mutation_p.I76N|GSTCD_ENST00000507281.1_Intron			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	76						extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		ATACAGATTATTTCAAGGCAG	0.388																																																	0													97.0	97.0	97.0					4																	106638997		2203	4300	6503	SO:0001583	missense	0			BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.227T>A	4.37:g.106638997T>A	ENSP00000422354:p.Ile76Asn		A8K8J0|A8MVD3|H9KV97|Q9H8S3	Missense_Mutation	SNP	pfam_rRNA_ssu_MeTfrase_G,pfam_Small_mtfrase_dom,superfamily_Glutathione-S-Trfase_C-like	p.I76N	ENST00000515279.1	37	c.227	CCDS43257.1	4	.	.	.	.	.	.	.	.	.	.	T	16.58	3.162936	0.57476	.	.	ENSG00000138780	ENST00000515279;ENST00000360505;ENST00000510865;ENST00000509336;ENST00000394728	.	.	.	5.55	4.37	0.52481	.	0.390561	0.27922	N	0.017302	T	0.49966	0.1588	M	0.78049	2.395	0.09310	N	0.999991	P;P	0.48834	0.916;0.813	P;P	0.46389	0.448;0.515	T	0.51172	-0.8739	9	0.87932	D	0	-18.703	11.2298	0.48905	0.0:0.0716:0.0:0.9284	.	76;76	Q8NEC7;D6RCC9	GSTCD_HUMAN;.	N	76	.	ENSP00000353695:I76N	I	+	2	0	GSTCD	106858446	0.180000	0.23148	0.002000	0.10522	0.923000	0.55619	2.620000	0.46410	0.961000	0.38030	0.533000	0.62120	ATT	GSTCD	-	NULL	ENSG00000138780		0.388	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	GSTCD	HGNC	protein_coding	OTTHUMT00000363981.1	-	0.00	59	0	T	NM_024751		106638997	+1	tier1	-	no_errors	ENST00000360505	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.039	A
HAND2	9464	genome.wustl.edu	37	4	174448555	174448555	+	Intron	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:174448555A>T	ENST00000359562.4	-	2	1495				HAND2-AS1_ENST00000515310.1_RNA|HAND2-AS1_ENST00000514673.1_RNA|HAND2_ENST00000505300.1_5'Flank|HAND2-AS1_ENST00000512099.1_RNA|HAND2-AS1_ENST00000507062.1_RNA	NM_021973.2	NP_068808.1	P61296	HAND2_HUMAN	heart and neural crest derivatives expressed 2						adult heart development (GO:0007512)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic process involved in heart morphogenesis (GO:0003278)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cardiac right ventricle formation (GO:0003219)|cartilage morphogenesis (GO:0060536)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|coronary artery morphogenesis (GO:0060982)|embryonic digit morphogenesis (GO:0042733)|heart development (GO:0007507)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mesenchymal cell proliferation (GO:0010463)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural crest cell development (GO:0014032)|noradrenergic neuron differentiation (GO:0003357)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peripheral nervous system neuron development (GO:0048935)|positive regulation of semaphorin-plexin signaling pathway involved in outflow tract morphogenesis (GO:2000764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in norepinephrine biosynthetic process (GO:2000763)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|sympathetic nervous system development (GO:0048485)|thymus development (GO:0048538)|tongue development (GO:0043586)|visceral serous pericardium development (GO:0061032)	nuclear chromatin (GO:0000790)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|E-box binding (GO:0070888)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	13		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.37e-18)|Epithelial(43;5.5e-17)|OV - Ovarian serous cystadenocarcinoma(60;3.3e-10)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		AGGGCGAGAAAAGTGGAAAGA	0.547																																																	0													66.0	71.0	69.0					4																	174448555		2203	4300	6503	SO:0001627	intron_variant	0			AF087941	CCDS3819.1	4q34.1	2014-08-12			ENSG00000164107	ENSG00000164107		"""Basic helix-loop-helix proteins"""	4808	protein-coding gene	gene with protein product		602407				9878849	Standard	NM_021973		Approved	dHand, Thing2, Hed, bHLHa26	uc003ith.1	P61296	OTTHUMG00000160775	ENST00000359562.4:c.556-29T>A	4.37:g.174448555A>T			B6ECG9|O95300|O95301|P97833|Q494T1	RNA	SNP	-	NULL	ENST00000359562.4	37	NULL	CCDS3819.1	4																																																																																			HAND2-AS1	-	-	ENSG00000237125		0.547	HAND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAND2-AS1	HGNC	protein_coding	OTTHUMT00000362241.3	-	0.00	64	0	A			174448555	+1	tier1	-	no_errors	ENST00000512099	ensembl	human	known	74_37	rna	30.00	35	15	SNP	0.001	T
HAX1	10456	genome.wustl.edu	37	1	154247904	154247904	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:154247904G>T	ENST00000328703.7	+	6	912	c.699G>T	c.(697-699)gaG>gaT	p.E233D	HAX1_ENST00000532105.1_Missense_Mutation_p.E105D|HAX1_ENST00000483970.2_Missense_Mutation_p.E241D|HAX1_ENST00000457918.2_Missense_Mutation_p.E185D	NM_006118.3	NP_006109.2	O00165	HAX1_HUMAN	HCLS1 associated protein X-1	233	Involved in ATP2A2 binding.|Involved in GNA13 binding.|Involved in HCLS1 binding.|Involved in PKD2 binding.|Required for localization in sarcoplasmic reticulum. {ECO:0000250}.				cellular response to cytokine stimulus (GO:0071345)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin filament polymerization (GO:0030833)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein targeting to mitochondrion (GO:1903214)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|lamellipodium (GO:0030027)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|sarcoplasmic reticulum (GO:0016529)|transcription factor complex (GO:0005667)	interleukin-1 binding (GO:0019966)|protein N-terminus binding (GO:0047485)			cervix(1)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	15	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGGACAGTGAGGGCCGGACAG	0.488									Kostmann syndrome																																								0													149.0	156.0	154.0					1																	154247904		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Kostmann Infantile Agranulocytosis, Severe Congenital Neutropenia, Congenital Agranulocytosis	U68566	CCDS1064.1, CCDS44230.1	1q21.3	2014-09-17			ENSG00000143575	ENSG00000143575			16915	protein-coding gene	gene with protein product	"""HCLS1 (and PKD2) associated protein"""	605998				9058808, 10760273	Standard	NM_006118		Approved	HS1BP1, HCLSBP1	uc001fes.3	O00165	OTTHUMG00000035978	ENST00000328703.7:c.699G>T	1.37:g.154247904G>T	ENSP00000329002:p.Glu233Asp		A8W4W9|A8W4X0|B4DUJ7|Q5VYD5|Q5VYD7|Q96AU4|Q9BS80	Missense_Mutation	SNP	pirsf_HS1--assoc_X-1	p.E241D	ENST00000328703.7	37	c.723	CCDS1064.1	1	.	.	.	.	.	.	.	.	.	.	G	16.41	3.116778	0.56505	.	.	ENSG00000143575	ENST00000328703;ENST00000457918;ENST00000483970;ENST00000435087;ENST00000532105	T;T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28;-1.28	5.13	-0.166	0.13351	.	0.419994	0.24220	N	0.040444	T	0.78444	0.4284	M	0.69248	2.105	0.34580	D	0.714369	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;D	0.87578	0.993;0.995;0.998;0.995	T	0.74624	-0.3603	10	0.56958	D	0.05	-3.9866	4.0211	0.09665	0.3488:0.0:0.495:0.1562	.	241;207;185;233	O00165-2;O00165-3;O00165-5;O00165	.;.;.;HAX1_HUMAN	D	233;185;241;237;105	ENSP00000329002:E233D;ENSP00000411448:E185D;ENSP00000435088:E241D;ENSP00000394920:E237D;ENSP00000433951:E105D	ENSP00000329002:E233D	E	+	3	2	HAX1	152514528	0.996000	0.38824	0.994000	0.49952	0.812000	0.45895	0.238000	0.18004	-0.064000	0.13043	-0.253000	0.11424	GAG	HAX1	-	pirsf_HS1--assoc_X-1	ENSG00000143575		0.488	HAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAX1	HGNC	protein_coding	OTTHUMT00000087650.1	-	0.00	54	0	G	NM_006118		154247904	+1	tier1	-	no_errors	ENST00000483970	ensembl	human	known	74_37	missense	5.81	81	5	SNP	0.996	T
BGLT3	103344929	genome.wustl.edu	37	11	5263438	5263438	+	RNA	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:5263438A>C	ENST00000564523.1	-	0	1988				HBBP1_ENST00000454892.1_RNA																							TCCTCGCTGAAGTGGGTTGCC	0.448																																																	0																																												0																															11.37:g.5263438A>C				RNA	SNP	-	NULL	ENST00000564523.1	37	NULL		11																																																																																			HBBP1	-	-	ENSG00000229988		0.448	CTD-2643I7.1-001	KNOWN	basic	sense_overlapping	HBBP1	HGNC	sense_overlapping	OTTHUMT00000422245.1	-	0.00	24	0	A			5263438	-1	tier1	-	no_errors	ENST00000454892	ensembl	human	known	74_37	rna	35.48	20	11	SNP	0.015	C
HCFC2	29915	genome.wustl.edu	37	12	104481790	104481790	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:104481790G>T	ENST00000229330.4	+	9	1362	c.1258G>T	c.(1258-1260)Ggc>Tgc	p.G420C		NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	420	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						TCACAGACAAGGCAGTAATAA	0.313																																					Esophageal Squamous(184;1814 2036 4771 6974 15702)												0													120.0	110.0	113.0					12																	104481790		2203	4300	6503	SO:0001583	missense	0			AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.1258G>T	12.37:g.104481790G>T	ENSP00000229330:p.Gly420Cys		B2R8Q5|C0H5X3	Missense_Mutation	SNP	pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.G420C	ENST00000229330.4	37	c.1258	CCDS9097.1	12	.	.	.	.	.	.	.	.	.	.	G	16.30	3.084372	0.55861	.	.	ENSG00000111727	ENST00000229330	T	0.01787	4.64	5.82	5.82	0.92795	Fibronectin, type III (3);	0.411602	0.20719	N	0.086942	T	0.02267	0.0070	L	0.29908	0.895	0.44579	D	0.997544	P	0.48640	0.913	B	0.41036	0.346	T	0.67550	-0.5642	10	0.41790	T	0.15	-3.8534	15.5852	0.76475	0.0:0.0:1.0:0.0	.	420	Q9Y5Z7	HCFC2_HUMAN	C	420	ENSP00000229330:G420C	ENSP00000229330:G420C	G	+	1	0	HCFC2	103005920	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.944000	0.49034	2.758000	0.94735	0.650000	0.86243	GGC	HCFC2	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000111727		0.313	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC2	HGNC	protein_coding	OTTHUMT00000407780.1	-	0.00	43	0	G	NM_013320		104481790	+1	tier1	-	no_errors	ENST00000229330	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
HEG1	57493	genome.wustl.edu	37	3	124732754	124732754	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:124732754G>T	ENST00000311127.4	-	6	1736	c.1669C>A	c.(1669-1671)Ctg>Atg	p.L557M	HEG1_ENST00000477536.1_5'UTR	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	557	Ser-rich.				cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						GTAGATGACAGGTAGGTGTGG	0.453																																																	0													121.0	116.0	117.0					3																	124732754		1980	4159	6139	SO:0001583	missense	0			AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.1669C>A	3.37:g.124732754G>T	ENSP00000311502:p.Leu557Met		Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	p.L557M	ENST00000311127.4	37	c.1669	CCDS46898.1	3	.	.	.	.	.	.	.	.	.	.	G	12.99	2.104396	0.37145	.	.	ENSG00000173706	ENST00000311127	D	0.88277	-2.36	5.38	-0.0207	0.13955	.	1.316200	0.06522	U	0.739879	T	0.78848	0.4348	N	0.22421	0.69	0.09310	N	1	P;P	0.48503	0.911;0.744	B;B	0.38562	0.276;0.212	T	0.70146	-0.4952	10	0.72032	D	0.01	.	4.427	0.11507	0.0:0.3184:0.1876:0.494	.	557;557	Q9ULI3-2;Q9ULI3	.;HEG1_HUMAN	M	557	ENSP00000311502:L557M	ENSP00000311502:L557M	L	-	1	2	HEG1	126215444	0.003000	0.15002	0.000000	0.03702	0.886000	0.51366	0.166000	0.16583	0.078000	0.16900	-0.995000	0.02519	CTG	HEG1	-	NULL	ENSG00000173706		0.453	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEG1	HGNC	protein_coding	OTTHUMT00000355732.2		0.00	21	0	G	XM_087386		124732754	-1			no_errors	ENST00000311127	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.001	T
HIST1H4B	8366	genome.wustl.edu	37	6	26027344	26027344	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:26027344C>T	ENST00000377364.3	-	1	136	c.137G>A	c.(136-138)cGa>cAa	p.R46Q		NM_003544.2	NP_003535.1	P62805	H4_HUMAN	histone cluster 1, H4b	46					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.R46Q(1)		large_intestine(4)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	13						ACCGGAAATTCGCTTAACCCC	0.572																																																	1	Substitution - Missense(1)	large_intestine(1)											77.0	69.0	72.0					6																	26027344		2203	4300	6503	SO:0001583	missense	0			X67081	CCDS4572.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000124529	ENSG00000278705		"""Histones / Replication-dependent"""	4789	protein-coding gene	gene with protein product		602829	"""H4 histone family, member I"", ""histone 1, H4b"""	H4FI		9119399, 12408966	Standard	NM_003544		Approved	H4/I	uc003nfr.3	P62805	OTTHUMG00000014417	ENST00000377364.3:c.137G>A	6.37:g.26027344C>T	ENSP00000366581:p.Arg46Gln		A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.R46Q	ENST00000377364.3	37	c.137	CCDS4572.1	6	.	.	.	.	.	.	.	.	.	.	c	22.1	4.241449	0.79912	.	.	ENSG00000124529	ENST00000377364	T	0.75367	-0.93	4.65	4.65	0.58169	.	0.000000	0.56097	U	0.000040	T	0.81721	0.4882	.	.	.	0.44117	D	0.996897	.	.	.	.	.	.	D	0.84239	0.0471	7	0.87932	D	0	.	17.4106	0.87484	0.0:1.0:0.0:0.0	.	.	.	.	Q	46	ENSP00000366581:R46Q	ENSP00000366581:R46Q	R	-	2	0	HIST1H4B	26135323	1.000000	0.71417	0.993000	0.49108	0.001000	0.01503	7.309000	0.78937	2.506000	0.84524	0.563000	0.77884	CGA	HIST1H4B	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	ENSG00000124529		0.572	HIST1H4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4B	HGNC	protein_coding	OTTHUMT00000040079.2	-	0.00	26	0	C	NM_003544		26027344	-1	tier1	-	no_errors	ENST00000377364	ensembl	human	known	74_37	missense	12.50	35	5	SNP	1.000	T
HMHA1	23526	genome.wustl.edu	37	19	1083036	1083036	+	Silent	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:1083036G>T	ENST00000313093.2	+	20	2946	c.2715G>T	c.(2713-2715)tcG>tcT	p.S905S	HMHA1_ENST00000586866.1_Silent_p.S909S|HMHA1_ENST00000543365.1_Silent_p.S788S|HMHA1_ENST00000536472.1_Silent_p.S773S|HMHA1_ENST00000590214.1_Silent_p.S932S|HMHA1_ENST00000591169.1_3'UTR|HMHA1_ENST00000590577.1_Silent_p.S540S|HMHA1_ENST00000539243.2_Silent_p.S921S	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	905	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCGGGCCTCGCTGCAGTACC	0.741																																																	0													6.0	7.0	7.0					19																	1083036		2119	4158	6277	SO:0001819	synonymous_variant	0			D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.2715G>T	19.37:g.1083036G>T			B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_FCH_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.S905	ENST00000313093.2	37	c.2715	CCDS32863.1	19																																																																																			HMHA1	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000180448		0.741	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HMHA1	HGNC	protein_coding	OTTHUMT00000458026.1	-	0.00	19	0	G			1083036	+1	tier1	-	no_errors	ENST00000313093	ensembl	human	known	74_37	silent	27.27	8	3	SNP	0.945	T
HNRNPL	3191	genome.wustl.edu	37	19	39327400	39327400	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:39327400G>T	ENST00000221419.5	-	13	2098	c.1732C>A	c.(1732-1734)Ctg>Atg	p.L578M	AC104534.3_ENST00000594769.1_Intron|HNRNPL_ENST00000600873.1_Missense_Mutation_p.L445M	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	578	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			CACAACTTCAGAGTGTAAGGG	0.493																																																	0													203.0	181.0	188.0					19																	39327400		2203	4300	6503	SO:0001583	missense	0			X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.1732C>A	19.37:g.39327400G>T	ENSP00000221419:p.Leu578Met		A6ND69|A6NIT8|Q9H3P3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.L578M	ENST00000221419.5	37	c.1732	CCDS33015.1	19	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187947	0.78789	.	.	ENSG00000104824	ENST00000221419;ENST00000388749;ENST00000388750	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.74253	0.3692	L	0.46741	1.465	0.80722	D	1	D	0.64830	0.994	D	0.70935	0.971	T	0.71623	-0.4537	9	0.45353	T	0.12	.	18.6545	0.91445	0.0:0.0:1.0:0.0	.	578	P14866	HNRPL_HUMAN	M	578;445;445	.	ENSP00000221419:L578M	L	-	1	2	HNRNPL	44019240	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.404000	0.79996	2.941000	0.99782	0.655000	0.94253	CTG	HNRNPL	-	tigrfam_HnRNP-L_PTB	ENSG00000104824		0.493	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPL	HGNC	protein_coding	OTTHUMT00000462670.1	-	0.00	51	0	G			39327400	-1	tier1	-	no_errors	ENST00000221419	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
HOMER1	9456	genome.wustl.edu	37	5	78746879	78746879	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:78746879C>G	ENST00000334082.6	-	3	1670	c.228G>C	c.(226-228)caG>caC	p.Q76H	HOMER1_ENST00000508576.1_Missense_Mutation_p.Q76H|HOMER1_ENST00000282260.6_Missense_Mutation_p.Q76H|HOMER1_ENST00000535690.1_Intron	NM_004272.3	NP_004263.1	Q86YM7	HOME1_HUMAN	homer homolog 1 (Drosophila)	76	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				behavioral response to cocaine (GO:0048148)|chemical homeostasis within a tissue (GO:0048875)|circadian rhythm (GO:0007623)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of signal transduction (GO:0009967)|protein localization to synapse (GO:0035418)|regulation of calcium ion import (GO:0090279)|regulation of cation channel activity (GO:2001257)|regulation of store-operated calcium entry (GO:2001256)|response to calcium ion (GO:0051592)|response to nicotine (GO:0035094)|skeletal muscle contraction (GO:0003009)|skeletal muscle fiber development (GO:0048741)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell junction (GO:0030054)|costamere (GO:0043034)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|signaling adaptor activity (GO:0035591)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|skin(1)	14		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)		TATCAGCCCACTGGCCAAACT	0.368																																																	0													111.0	105.0	107.0					5																	78746879		1829	4088	5917	SO:0001583	missense	0			BC015502	CCDS43335.1, CCDS64188.1, CCDS64189.1	5q14.2	2008-02-05			ENSG00000152413	ENSG00000152413			17512	protein-coding gene	gene with protein product		604798				9808459, 9808458	Standard	NM_004272		Approved	Ves-1, SYN47, HOMER-1B	uc003kfy.4	Q86YM7	OTTHUMG00000134278	ENST00000334082.6:c.228G>C	5.37:g.78746879C>G	ENSP00000334382:p.Gln76His		B2R688|O96003|Q86YM5	Missense_Mutation	SNP	pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	p.Q76H	ENST00000334082.6	37	c.228	CCDS43335.1	5	.	.	.	.	.	.	.	.	.	.	C	15.58	2.876817	0.51801	.	.	ENSG00000152413	ENST00000334082;ENST00000508576;ENST00000282260	D;D;D	0.98987	-5.3;-5.3;-5.3	5.78	-0.332	0.12675	EVH1 (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.99269	0.9745	M	0.92412	3.305	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.994;0.998;0.996	D	0.99889	1.1131	10	0.87932	D	0	-5.3302	11.7066	0.51601	0.0:0.5785:0.0:0.4215	.	76;76;76	Q86YM7-2;Q86YM7-3;Q86YM7	.;.;HOME1_HUMAN	H	76	ENSP00000334382:Q76H;ENSP00000426651:Q76H;ENSP00000282260:Q76H	ENSP00000282260:Q76H	Q	-	3	2	HOMER1	78782635	1.000000	0.71417	0.987000	0.45799	0.990000	0.78478	1.306000	0.33505	-0.287000	0.09064	-0.302000	0.09304	CAG	HOMER1	-	pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	ENSG00000152413		0.368	HOMER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOMER1	HGNC	protein_coding	OTTHUMT00000258856.1	-	0.00	71	0	C	NM_004272		78746879	-1	tier1	-	no_errors	ENST00000334082	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	G
HOOK3	84376	genome.wustl.edu	37	8	42828536	42828536	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:42828536A>T	ENST00000307602.4	+	12	1427	c.1227A>T	c.(1225-1227)gaA>gaT	p.E409D		NM_032410.3	NP_115786.1	Q86VS8	HOOK3_HUMAN	hook microtubule-tethering protein 3	409					cytoplasmic microtubule organization (GO:0031122)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|Golgi localization (GO:0051645)|interkinetic nuclear migration (GO:0022027)|lysosome organization (GO:0007040)|microtubule anchoring at centrosome (GO:0034454)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|protein localization to centrosome (GO:0071539)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|FHF complex (GO:0070695)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|pericentriolar material (GO:0000242)	identical protein binding (GO:0042802)|microtubule binding (GO:0008017)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	31	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			TTCAAAAAGAAAAGGACGTGA	0.308			T	RET	papillary thyroid																																			Dom	yes		8	8p11.21	84376	hook homolog 3		E	0													52.0	56.0	54.0					8																	42828536		2202	4296	6498	SO:0001583	missense	0			AK090540	CCDS6139.1	8p11.21	2013-08-21	2013-08-21		ENSG00000168172	ENSG00000168172			23576	protein-coding gene	gene with protein product		607825	"""hook homolog 3 (Drosophila)"""			9927460	Standard	NM_032410		Approved	HK3	uc003xpr.3	Q86VS8	OTTHUMG00000165278	ENST00000307602.4:c.1227A>T	8.37:g.42828536A>T	ENSP00000305699:p.Glu409Asp		D3DSY8|Q8NBH0|Q9BY13	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_t-SNARE	p.E409D	ENST00000307602.4	37	c.1227	CCDS6139.1	8	.	.	.	.	.	.	.	.	.	.	A	17.76	3.469918	0.63625	.	.	ENSG00000168172	ENST00000307602	T	0.24151	1.87	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.32436	0.0829	L	0.57536	1.79	0.54753	D	0.999987	B	0.22683	0.073	B	0.31686	0.134	T	0.07868	-1.0750	10	0.51188	T	0.08	-23.3786	16.0334	0.80603	1.0:0.0:0.0:0.0	.	409	Q86VS8	HOOK3_HUMAN	D	409	ENSP00000305699:E409D	ENSP00000305699:E409D	E	+	3	2	HOOK3	42947693	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.634000	0.61325	2.243000	0.73865	0.533000	0.62120	GAA	HOOK3	-	pfam_Hook-related_fam	ENSG00000168172		0.308	HOOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK3	HGNC	protein_coding	OTTHUMT00000383172.2	-	0.00	40	0	A	NM_032410		42828536	+1	tier1	-	no_errors	ENST00000307602	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
HOXA4	3201	genome.wustl.edu	37	7	27169012	27169012	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:27169012G>T	ENST00000360046.5	-	2	860	c.795C>A	c.(793-795)aaC>aaA	p.N265K	HOXA-AS2_ENST00000521159.1_RNA|HOXA3_ENST00000317201.2_5'Flank|HOXA-AS3_ENST00000518848.1_RNA|HOXA4_ENST00000428284.2_Missense_Mutation_p.N265K|HOXA-AS2_ENST00000517550.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA3_ENST00000521401.1_Intron|HOXA-AS2_ENST00000521687.1_RNA	NM_002141.4	NP_002132.3	Q00056	HXA4_HUMAN	homeobox A4	265					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)	12						TCATCCTCCGGTTCTGAAACC	0.572																																																	0													232.0	193.0	207.0					7																	27169012		2203	4300	6503	SO:0001583	missense	0				CCDS5405.1	7p15.2	2011-06-20	2005-12-22		ENSG00000197576	ENSG00000197576		"""Homeoboxes / ANTP class : HOXL subclass"""	5105	protein-coding gene	gene with protein product		142953	"""homeo box A4"""	HOX1D, HOX1		1973146, 1358459	Standard	NM_002141		Approved		uc003sym.4	Q00056	OTTHUMG00000023213	ENST00000360046.5:c.795C>A	7.37:g.27169012G>T	ENSP00000353151:p.Asn265Lys		A4D180|O43366	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa,prints_Homeobox_antennapedia	p.N265K	ENST00000360046.5	37	c.795	CCDS5405.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.8|20.8	4.044266|4.044266	0.75732|0.75732	.|.	.|.	ENSG00000197576|ENSG00000197576	ENST00000360046;ENST00000428284|ENST00000511914	D;D|.	0.99382|.	-5.8;-5.8|.	5.29|5.29	4.38|4.38	0.52667|0.52667	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);|.	0.000000|.	0.45126|.	D|.	0.000400|.	D|D	0.87067|0.87067	0.6085|0.6085	H|H	0.97158|0.97158	3.95|3.95	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	D|D	0.90500|0.90500	0.4473|0.4473	10|5	0.87932|.	D|.	0|.	.|.	13.0058|13.0058	0.58703|0.58703	0.0813:0.0:0.9187:0.0|0.0813:0.0:0.9187:0.0	.|.	265|.	Q00056|.	HXA4_HUMAN|.	K|T	265|85	ENSP00000353151:N265K;ENSP00000408845:N265K|.	ENSP00000353151:N265K|.	N|P	-|-	3|1	2|0	HOXA4|HOXA4	27135537|27135537	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.621000|6.621000	0.74228|0.74228	1.179000|1.179000	0.42884|0.42884	0.555000|0.555000	0.69702|0.69702	AAC|CCG	HOXA4	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	ENSG00000197576		0.572	HOXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA4	HGNC	protein_coding	OTTHUMT00000059534.4	-	0.00	63	0	G			27169012	-1	tier1	-	no_errors	ENST00000360046	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
HOXB7	3217	genome.wustl.edu	37	17	46685137	46685137	+	3'UTR	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:46685137G>A	ENST00000239165.7	-	0	819				HOXB6_ENST00000225648.3_5'Flank|HOXB-AS3_ENST00000466037.2_RNA|HOXB6_ENST00000484302.2_5'Flank|HOXB-AS3_ENST00000487849.3_RNA|HOXB7_ENST00000567101.2_5'UTR|HOXB-AS3_ENST00000491264.1_RNA|HOXB-AS3_ENST00000467155.2_RNA|HOXB-AS3_ENST00000494420.1_RNA|HOXB3_ENST00000552000.2_5'Flank	NM_004502.3	NP_004493.3	P09629	HXB7_HUMAN	homeobox B7						anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|multicellular organismal development (GO:0007275)|myeloid cell differentiation (GO:0030099)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	8						TCCTGATTCAGTTCCCAGAGC	0.398																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS11532.1	17q21.32	2013-05-22	2005-12-22					"""Homeoboxes / ANTP class : HOXL subclass"""	5118	protein-coding gene	gene with protein product		142962	"""homeo box B7"""	HOX2, HOX2C		1973146, 1358459	Standard	NM_004502		Approved		uc002inv.3	P09629	OTTHUMG00000170231	ENST00000239165.7:c.*67C>T	17.37:g.46685137G>A			A8K3N8|Q15957|Q53FN3|Q96BQ6	RNA	SNP	-	NULL	ENST00000239165.7	37	NULL	CCDS11532.1	17																																																																																			HOXB7	-	-	ENSG00000260027		0.398	HOXB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB7	HGNC	protein_coding	OTTHUMT00000358097.3	-	0.00	26	0	G			46685137	-1	tier1	-	no_errors	ENST00000567101	ensembl	human	known	74_37	rna	15.38	21	4	SNP	0.001	A
HR	55806	genome.wustl.edu	37	8	21983168	21983168	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:21983168C>T	ENST00000381418.4	-	4	2963	c.1483G>A	c.(1483-1485)Gct>Act	p.A495T	HR_ENST00000312841.8_Missense_Mutation_p.A495T	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	495					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		TGGCATTGAGCCAGTTTTGCA	0.617																																																	0													64.0	55.0	58.0					8																	21983168		2203	4300	6503	SO:0001583	missense	0			AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.1483G>A	8.37:g.21983168C>T	ENSP00000370826:p.Ala495Thr		Q6GS30|Q96H33|Q9NPE1	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.A495T	ENST00000381418.4	37	c.1483	CCDS6022.1	8	.	.	.	.	.	.	.	.	.	.	C	4.421	0.077893	0.08485	.	.	ENSG00000168453	ENST00000381418;ENST00000312841	T;T	0.71103	-0.54;-0.53	5.3	-10.6	0.00265	.	1.020170	0.07810	N	0.958046	T	0.32315	0.0825	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.29058	-1.0024	10	0.02654	T	1	1.1328	2.0275	0.03522	0.1658:0.1171:0.252:0.4651	.	495;495	O43593-2;O43593	.;HAIR_HUMAN	T	495	ENSP00000370826:A495T;ENSP00000326765:A495T	ENSP00000326765:A495T	A	-	1	0	HR	22039113	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	-2.284000	0.01154	-2.080000	0.00870	0.491000	0.48974	GCT	HR	-	NULL	ENSG00000168453		0.617	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HR	HGNC	protein_coding	OTTHUMT00000214213.1	-	0.00	38	0	C			21983168	-1	tier1	-	no_errors	ENST00000381418	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.000	T
HRH2	3274	genome.wustl.edu	37	5	175110525	175110525	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:175110525C>T	ENST00000231683.2	+	1	2062	c.289C>T	c.(289-291)Ctg>Ttg	p.L97L	HRH2_ENST00000377291.2_Silent_p.L97L	NM_022304.2	NP_071640.1	P25021	HRH2_HUMAN	histamine receptor H2	97					digestive tract development (GO:0048565)|epithelial cell morphogenesis (GO:0003382)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|gastrin-induced gastric acid secretion (GO:0001698)|gland development (GO:0048732)|histamine-induced gastric acid secretion (GO:0001697)|immune response (GO:0006955)|memory (GO:0007613)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(10)|ovary(1)	22	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Amitriptyline(DB00321)|Asenapine(DB06216)|Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Methantheline(DB00940)|Nizatidine(DB00585)|Olanzapine(DB00334)|Ranitidine(DB00863)|Roxatidine acetate(DB08806)|Tolazoline(DB00797)	CTACACCAGCCTGGATGTGAT	0.567																																																	0													113.0	92.0	100.0					5																	175110525		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4395.1, CCDS47344.1	5q35	2012-08-08			ENSG00000113749	ENSG00000113749		"""GPCR / Class A : Histamine receptors"""	5183	protein-coding gene	gene with protein product		142703				1714721	Standard	NM_022304		Approved		uc003mdc.4	P25021	OTTHUMG00000130660	ENST00000231683.2:c.289C>T	5.37:g.175110525C>T			B5BUP7|Q14464|Q7Z5R9	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Histamine_H2_rcpt,prints_GPCR_Rhodpsn,prints_5HT6_rcpt	p.L97	ENST00000231683.2	37	c.289	CCDS4395.1	5																																																																																			HRH2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000113749		0.567	HRH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HRH2	HGNC	protein_coding	OTTHUMT00000253151.1	-	0.00	23	0	C			175110525	+1	tier1	-	no_errors	ENST00000377291	ensembl	human	known	74_37	silent	25.00	15	5	SNP	1.000	T
HRNR	388697	genome.wustl.edu	37	1	152192299	152192299	+	Silent	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:152192299A>T	ENST00000368801.2	-	3	1881	c.1806T>A	c.(1804-1806)tcT>tcA	p.S602S	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	602					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACCCGAGCTAGATCCGTGTT	0.562																																																	0													262.0	231.0	241.0					1																	152192299		2203	4299	6502	SO:0001819	synonymous_variant	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.1806T>A	1.37:g.152192299A>T			Q5DT20|Q5U1F4	Silent	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.S602	ENST00000368801.2	37	c.1806	CCDS30859.1	1																																																																																			HRNR	-	NULL	ENSG00000197915		0.562	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	-	0.00	92	0	A	XM_373868		152192299	-1	tier1	-	no_errors	ENST00000368801	ensembl	human	known	74_37	silent	34.96	79	43	SNP	0.003	T
HSD17B13	345275	genome.wustl.edu	37	4	88235037	88235037	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:88235037G>C	ENST00000328546.4	-	5	697	c.633C>G	c.(631-633)atC>atG	p.I211M	HSD17B13_ENST00000302219.6_Missense_Mutation_p.I175M	NM_178135.3	NP_835236.2	Q7Z5P4	DHB13_HUMAN	hydroxysteroid (17-beta) dehydrogenase 13	211						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|urinary_tract(1)	8		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.000308)		ATGAGGTTTTGATACCAGTTT	0.413																																																	0													114.0	110.0	111.0					4																	88235037		2203	4300	6503	SO:0001583	missense	0				CCDS3618.1, CCDS47097.1	4q22.1	2011-09-20			ENSG00000170509	ENSG00000170509	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	18685	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 16C, member 3"""	612127				19027726	Standard	NM_178135		Approved	SCDR9, SDR16C3	uc003hqo.2	Q7Z5P4	OTTHUMG00000130602	ENST00000328546.4:c.633C>G	4.37:g.88235037G>C	ENSP00000333300:p.Ile211Met		A8K9R9|Q2M1L5|Q86W22|Q86W23	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.I211M	ENST00000328546.4	37	c.633	CCDS3618.1	4	.	.	.	.	.	.	.	.	.	.	G	16.86	3.240626	0.58995	.	.	ENSG00000170509	ENST00000302219;ENST00000328546	D;D	0.92446	-3.04;-3.04	5.55	4.71	0.59529	NAD(P)-binding domain (1);	0.097576	0.42548	D	0.000693	D	0.95768	0.8623	M	0.86573	2.825	0.42739	D	0.99373	P;P	0.48911	0.917;0.865	D;P	0.65443	0.935;0.863	D	0.95865	0.8886	10	0.87932	D	0	.	9.9914	0.41874	0.0733:0.0:0.7887:0.1379	.	175;211	Q7Z5P4-2;Q7Z5P4	.;DHB13_HUMAN	M	175;211	ENSP00000305438:I175M;ENSP00000333300:I211M	ENSP00000305438:I175M	I	-	3	3	HSD17B13	88454061	1.000000	0.71417	0.987000	0.45799	0.843000	0.47879	2.009000	0.40903	1.334000	0.45468	0.655000	0.94253	ATC	HSD17B13	-	prints_Glc/ribitol_DH	ENSG00000170509		0.413	HSD17B13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B13	HGNC	protein_coding	OTTHUMT00000253052.1	-	0.00	33	0	G	NM_178135		88235037	-1	tier1	-	no_errors	ENST00000328546	ensembl	human	known	74_37	missense	22.50	31	9	SNP	1.000	C
HSPG2	3339	genome.wustl.edu	37	1	22188551	22188551	+	Missense_Mutation	SNP	C	C	T	rs201665758		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:22188551C>T	ENST00000374695.3	-	38	4877	c.4798G>A	c.(4798-4800)Gga>Aga	p.G1600R		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1600	Laminin EGF-like 10. {ECO:0000255|PROSITE-ProRule:PRU00460}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GTGGCATCTCCGTAGTAGCCA	0.622																																																	0													75.0	74.0	75.0					1																	22188551		2203	4300	6503	SO:0001583	missense	0			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.4798G>A	1.37:g.22188551C>T	ENSP00000363827:p.Gly1600Arg		Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Laminin_G,pfam_Laminin_B_type_IV,pfam_EGF_laminin,pfam_LDrepeatLR_classA_rpt,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_SEA_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Laminin_B_subgr,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_LDrepeatLR_classA_rpt,pfscan_SEA_dom,pfscan_Ig-like_dom,prints_LDrepeatLR_classA_rpt	p.G1600R	ENST00000374695.3	37	c.4798	CCDS30625.1	1	.	.	.	.	.	.	.	.	.	.	C	31	5.070506	0.93950	.	.	ENSG00000142798	ENST00000374695	T	0.66460	-0.21	5.48	5.48	0.80851	EGF-like, laminin (4);	0.000000	0.39083	N	0.001479	T	0.79621	0.4477	L	0.60904	1.88	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80241	-0.1464	10	0.72032	D	0.01	.	16.8781	0.86057	0.0:1.0:0.0:0.0	.	1600	P98160	PGBM_HUMAN	R	1600	ENSP00000363827:G1600R	ENSP00000363827:G1600R	G	-	1	0	HSPG2	22061138	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	7.166000	0.77553	2.848000	0.98002	0.655000	0.94253	GGA	HSPG2	-	pfam_EGF_laminin,smart_EGF_laminin,smart_EG-like_dom,pfscan_EGF_laminin	ENSG00000142798		0.622	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	HGNC	protein_coding	OTTHUMT00000007598.1	-	0.00	47	0	C	NM_005529		22188551	-1	tier1	rs201665758	no_errors	ENST00000374695	ensembl	human	known	74_37	missense	25.00	36	12	SNP	1.000	T
HTR1E	3354	genome.wustl.edu	37	6	87726028	87726028	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:87726028G>A	ENST00000305344.5	+	2	1679	c.976G>A	c.(976-978)Gcc>Acc	p.A326T		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	326					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	CTCGGAAGTGGCCGACTTTCT	0.453																																																	0													152.0	159.0	157.0					6																	87726028		2203	4300	6503	SO:0001583	missense	0				CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.976G>A	6.37:g.87726028G>A	ENSP00000307766:p.Ala326Thr		E1P503|Q9P1Y1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_5HT_rcpt	p.A326T	ENST00000305344.5	37	c.976	CCDS5006.1	6	.	.	.	.	.	.	.	.	.	.	G	11.23	1.577015	0.28092	.	.	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.71698	-0.59;-0.59	4.61	4.61	0.57282	GPCR, rhodopsin-like superfamily (1);	0.100891	0.41500	U	0.000879	T	0.39860	0.1094	N	0.16166	0.38	0.35658	D	0.812326	B	0.11235	0.004	B	0.22386	0.039	T	0.26052	-1.0114	10	0.19590	T	0.45	.	17.4189	0.87508	0.0:0.0:1.0:0.0	.	326	P28566	5HT1E_HUMAN	T	326	ENSP00000307766:A326T;ENSP00000358597:A326T	ENSP00000307766:A326T	A	+	1	0	HTR1E	87782747	1.000000	0.71417	0.998000	0.56505	0.928000	0.56348	4.381000	0.59587	2.119000	0.64992	0.407000	0.27541	GCC	HTR1E	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000168830		0.453	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1E	HGNC	protein_coding	OTTHUMT00000472488.2	-	0.00	39	0	G	NM_000865		87726028	+1	tier1	-	no_errors	ENST00000305344	ensembl	human	known	74_37	missense	7.04	66	5	SNP	1.000	A
HUWE1	10075	genome.wustl.edu	37	X	53565335	53565335	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:53565335C>T	ENST00000342160.3	-	76	12416	c.11959G>A	c.(11959-11961)Gac>Aac	p.D3987N	HUWE1_ENST00000262854.6_Missense_Mutation_p.D3987N			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3987					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CGAATGTAGTCTACCAGGACA	0.537																																																	0													177.0	108.0	131.0					X																	53565335		2203	4300	6503	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.11959G>A	X.37:g.53565335C>T	ENSP00000340648:p.Asp3987Asn		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/Ts_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.D3987N	ENST00000342160.3	37	c.11959	CCDS35301.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.30|18.30	3.594280|3.594280	0.66219|0.66219	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000342160;ENST00000262854|ENST00000427052;ENST00000426907	T;T|.	0.37411|.	1.2;1.2|.	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	0.055992|.	0.64402|.	D|.	0.000002|.	T|T	0.53433|0.53433	0.1796|0.1796	N|N	0.21373|0.21373	0.66|0.66	0.80722|0.80722	D|D	1|1	P;D;D|.	0.67145|.	0.539;0.993;0.996|.	B;D;D|.	0.77557|.	0.085;0.956;0.99|.	T|T	0.50092|0.50092	-0.8868|-0.8868	10|5	0.13853|.	T|.	0.58|.	.|.	16.7622|16.7622	0.85515|0.85515	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	809;3987;3971|.	Q5H935;Q7Z6Z7;Q7Z6Z7-2|.	.;HUWE1_HUMAN;.|.	N|K	3987|3020;809	ENSP00000340648:D3987N;ENSP00000262854:D3987N|.	ENSP00000262854:D3987N|.	D|R	-|-	1|2	0|0	HUWE1|HUWE1	53582060|53582060	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.013000|7.013000	0.76373|0.76373	2.218000|2.218000	0.71995|0.71995	0.529000|0.529000	0.55759|0.55759	GAC|AGA	HUWE1	-	NULL	ENSG00000086758		0.537	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	-	0.00	27	0	C	XM_497119		53565335	-1	tier1	-	no_errors	ENST00000262854	ensembl	human	known	74_37	missense	12.20	36	5	SNP	1.000	T
IDH3A	3419	genome.wustl.edu	37	15	78458517	78458517	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr15:78458517C>T	ENST00000299518.2	+	10	973	c.890C>T	c.(889-891)gCa>gTa	p.A297V	IDH3A_ENST00000561366.1_Nonsense_Mutation_p.Q31*|IDH3A_ENST00000558554.1_Missense_Mutation_p.A262V|IDH3A_ENST00000441490.2_Missense_Mutation_p.A188V|IDH3A_ENST00000559205.1_Missense_Mutation_p.A18V|IDH3A_ENST00000558535.1_3'UTR	NM_005530.2	NP_005521.1	P50213	IDH3A_HUMAN	isocitrate dehydrogenase 3 (NAD+) alpha	297					carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	12						CCAGACATTGCAGGCAAGGAC	0.532																																																	0													155.0	135.0	141.0					15																	78458517		2196	4293	6489	SO:0001583	missense	0				CCDS10297.1	15q25.1-q25.2	2008-07-18			ENSG00000166411	ENSG00000166411	1.1.1.41		5384	protein-coding gene	gene with protein product	"""H-IDH alpha"", ""isocitric dehydrogenase"", ""isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial"", ""NAD+-specific ICDH"", ""NAD(H)-specific isocitrate dehydrogenase alpha subunit"", ""isocitrate dehydrogenase (NAD+) alpha chain"""	601149				8833160	Standard	NM_005530		Approved		uc002bdd.3	P50213	OTTHUMG00000143732	ENST00000299518.2:c.890C>T	15.37:g.78458517C>T	ENSP00000299518:p.Ala297Val		D3DW83|Q9H3X0	Nonsense_Mutation	SNP	pfam_IsoPropMal-DH-like_dom	p.Q31*	ENST00000299518.2	37	c.91	CCDS10297.1	15	.	.	.	.	.	.	.	.	.	.	C	19.37	3.813682	0.70912	.	.	ENSG00000166411	ENST00000299518;ENST00000441490	T;T	0.74737	-0.87;-0.87	5.7	4.78	0.61160	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.86797	0.6019	M	0.84433	2.695	0.80722	D	1	D;D;D	0.89917	1.0;0.975;0.975	D;P;P	0.97110	1.0;0.469;0.712	D	0.88367	0.2992	10	0.72032	D	0.01	-19.5155	14.2079	0.65746	0.0:0.9271:0.0:0.0729	.	262;247;297	B4DSY4;B4DJB4;P50213	.;.;IDH3A_HUMAN	V	297;188	ENSP00000299518:A297V;ENSP00000387506:A188V	ENSP00000299518:A297V	A	+	2	0	IDH3A	76245572	1.000000	0.71417	0.170000	0.22879	0.696000	0.40369	6.011000	0.70760	2.681000	0.91329	0.655000	0.94253	GCA	IDH3A	-	NULL	ENSG00000166411		0.532	IDH3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDH3A	HGNC	protein_coding	OTTHUMT00000289799.4	-	0.00	42	0	C	NM_005530		78458517	+1	tier1	-	no_errors	ENST00000561366	ensembl	human	putative	74_37	nonsense	6.35	59	4	SNP	0.998	T
IFI30	10437	genome.wustl.edu	37	19	18284687	18284689	+	In_Frame_Del	DEL	GCT	GCT	-	rs373433112		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	GCT	GCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:18284687_18284689delGCT	ENST00000407280.3	+	1	211_213	c.36_38delGCT	c.(34-39)ccgctg>ccg	p.L17del	PIK3R2_ENST00000593731.1_3'UTR	NM_006332.3	NP_006323.2	P13284	GILT_HUMAN	interferon, gamma-inducible protein 30	17					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of fibroblast proliferation (GO:0048147)|protein stabilization (GO:0050821)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	oxidoreductase activity, acting on a sulfur group of donors (GO:0016667)			endometrium(1)|kidney(2)|large_intestine(1)|stomach(1)	5						tcctgccaccgctgctgctgctg	0.621																																																	0																																										SO:0001651	inframe_deletion	0			J03909	CCDS46015.1	19p13.1	2008-07-16				ENSG00000216490			5398	protein-coding gene	gene with protein product	"""gamma-interferon-inducible lysosomal thiol reductase"", ""interferon gamma-inducible protein 30 preproprotein"""	604664				3136170, 10639150	Standard	NM_006332		Approved	IFI-30, GILT, IP30, MGC32056	uc002nic.1	P13284		ENST00000407280.3:c.36_38delGCT	19.37:g.18284696_18284698delGCT	ENSP00000384886:p.Leu17del		Q76MF9|Q8NEI4|Q8WU77|Q9UL08	In_Frame_Del	DEL	pfam_Interferon-induced_GILT	p.L16in_frame_del	ENST00000407280.3	37	c.36_38	CCDS46015.1	19																																																																																			IFI30	-	NULL	ENSG00000216490		0.621	IFI30-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IFI30	HGNC	protein_coding	OTTHUMT00000466396.3		0.00	56	0	GCT	NM_006332		18284689	+1			no_errors	ENST00000407280	ensembl	human	known	74_37	in_frame_del	9.23	59	6	DEL	0.167:0.723:0.800	0
IL11RA	3590	genome.wustl.edu	37	9	34657096	34657096	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:34657096G>A	ENST00000555003.1	+	5	1752	c.396G>A	c.(394-396)tgG>tgA	p.W132*	IL11RA_ENST00000602473.1_Nonsense_Mutation_p.W132*|IL11RA_ENST00000378817.4_Nonsense_Mutation_p.W132*|IL11RA_ENST00000441545.2_Nonsense_Mutation_p.W132*|GALT_ENST00000556278.1_Nonsense_Mutation_p.W276*|IL11RA_ENST00000478802.2_3'UTR|IL11RA_ENST00000318041.9_Nonsense_Mutation_p.W132*			Q14626	I11RA_HUMAN	interleukin 11 receptor, alpha	132	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				developmental process (GO:0032502)|embryo implantation (GO:0007566)|head development (GO:0060322)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|large_intestine(1)|ovary(1)|skin(1)	4	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.174)	Oprelvekin(DB00038)	CTTGCACTTGGAGTCCCAGCC	0.572																																																	0													119.0	105.0	109.0					9																	34657096		2203	4300	6503	SO:0001587	stop_gained	0			Z38102	CCDS6567.1	9p13	2014-05-22			ENSG00000137070	ENSG00000137070		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5967	protein-coding gene	gene with protein product		600939				7670098	Standard	NM_001142784		Approved		uc011loq.3	Q14626	OTTHUMG00000019837	ENST00000555003.1:c.396G>A	9.37:g.34657096G>A	ENSP00000450565:p.Trp132*		Q16542|Q5VZ80|Q7KYJ7	Nonsense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Ig_sub,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.W132*	ENST00000555003.1	37	c.396	CCDS6567.1	9	.	.	.	.	.	.	.	.	.	.	G	20.5	4.007456	0.75046	.	.	ENSG00000258728;ENSG00000137070;ENSG00000137070;ENSG00000137070;ENSG00000137070;ENSG00000137070;ENSG00000137070;ENSG00000137070;ENSG00000137070	ENST00000556278;ENST00000555003;ENST00000441545;ENST00000553620;ENST00000556792;ENST00000378817;ENST00000318041;ENST00000556531;ENST00000555981	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.9798	14.2807	0.66211	0.0:0.0:1.0:0.0	.	.	.	.	X	276;132;132;55;132;132;132;132;132	.	ENSP00000326500:W132X	W	+	3	0	RP11-195F19.29;IL11RA	34647096	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.331000	0.65905	2.425000	0.82216	0.655000	0.94253	TGG	IL11RA	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000137070		0.572	IL11RA-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IL11RA	HGNC	protein_coding	OTTHUMT00000410625.1	-	0.00	58	0	G	NM_001142784		34657096	+1	tier1	-	no_errors	ENST00000318041	ensembl	human	known	74_37	nonsense	10.77	57	7	SNP	1.000	A
IL21	59067	genome.wustl.edu	37	4	123542066	123542066	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:123542066C>T	ENST00000264497.3	-	1	158	c.101G>A	c.(100-102)cGc>cAc	p.R34H	IL21-AS1_ENST00000417927.1_RNA	NM_001207006.2|NM_021803.3	NP_001193935.1|NP_068575.1	Q9HBE4	IL21_HUMAN	interleukin 21	27					cell maturation (GO:0048469)|immune response (GO:0006955)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of natural killer cell cytokine production (GO:0002729)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	cytokine receptor binding (GO:0005126)|interleukin-2 receptor binding (GO:0005134)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(3)	8						AATCATGTGGCGATCTTGACC	0.398																																																	0													139.0	133.0	135.0					4																	123542066		2203	4300	6503	SO:0001583	missense	0			AF254069	CCDS3727.1, CCDS75189.1	4q26-q27	2011-07-15			ENSG00000138684	ENSG00000138684		"""Interleukins and interleukin receptors"""	6005	protein-coding gene	gene with protein product		605384				11081504, 17947662	Standard	NM_001207006		Approved	Za11, IL-21	uc003ies.3	Q9HBE4	OTTHUMG00000133073	ENST00000264497.3:c.101G>A	4.37:g.123542066C>T	ENSP00000264497:p.Arg34His		A5J0L4	Missense_Mutation	SNP	pfam_IL-15/IL-21_fam	p.R34H	ENST00000264497.3	37	c.101	CCDS3727.1	4	.	.	.	.	.	.	.	.	.	.	C	12.73	2.025754	0.35701	.	.	ENSG00000138684	ENST00000264497	.	.	.	5.1	3.33	0.38152	.	0.278577	0.26092	N	0.026394	T	0.42988	0.1227	L	0.47716	1.5	0.32156	N	0.583601	B;B	0.14438	0.008;0.01	B;B	0.16289	0.009;0.015	T	0.48854	-0.8998	9	0.51188	T	0.08	-2.2109	8.1174	0.30950	0.1657:0.7506:0.0:0.0838	.	27;27	Q9HBE4-2;Q9HBE4	.;IL21_HUMAN	H	34	.	ENSP00000264497:R34H	R	-	2	0	IL21	123761516	0.000000	0.05858	0.925000	0.36789	0.899000	0.52679	0.295000	0.19065	0.683000	0.31428	0.655000	0.94253	CGC	IL21	-	pfam_IL-15/IL-21_fam	ENSG00000138684		0.398	IL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL21	HGNC	protein_coding	OTTHUMT00000256713.1	-	0.00	20	0	C	NM_021803		123542066	-1	tier1	-	no_errors	ENST00000264497	ensembl	human	known	74_37	missense	20.00	20	5	SNP	0.946	T
ILKAP	80895	genome.wustl.edu	37	2	239098577	239098577	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:239098577G>T	ENST00000254654.3	-	4	390	c.215C>A	c.(214-216)aCt>aAt	p.T72N		NM_030768.2	NP_110395.1	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated serine/threonine phosphatase	72					protein dephosphorylation (GO:0006470)|regulation of nuclear cell cycle DNA replication (GO:0033262)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		TTTCCCTTCAGTCTTTACCAT	0.403																																																	0													109.0	106.0	107.0					2																	239098577		2203	4300	6503	SO:0001583	missense	0			AY024365	CCDS2526.1	2q37.3	2012-04-17	2010-10-25		ENSG00000132323	ENSG00000132323	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	15566	protein-coding gene	gene with protein product			"""integrin-linked kinase-associated serine/threonine phosphatase 2C"""				Standard	NM_030768		Approved	DKFZP434J2031, FLJ10181	uc002vxv.3	Q9H0C8	OTTHUMG00000133334	ENST00000254654.3:c.215C>A	2.37:g.239098577G>T	ENSP00000254654:p.Thr72Asn		B3KM39	Missense_Mutation	SNP	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.T72N	ENST00000254654.3	37	c.215	CCDS2526.1	2	.	.	.	.	.	.	.	.	.	.	G	11.41	1.630455	0.28978	.	.	ENSG00000132323	ENST00000254654;ENST00000457149	T;T	0.40756	2.0;1.02	5.85	-5.03	0.02973	.	0.914435	0.09640	N	0.775124	T	0.15998	0.0385	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34477	-0.9827	10	0.09338	T	0.73	2.9353	7.0941	0.25299	0.0:0.3651:0.3426:0.2924	.	72	Q9H0C8	ILKAP_HUMAN	N	72	ENSP00000254654:T72N;ENSP00000395301:T72N	ENSP00000254654:T72N	T	-	2	0	ILKAP	238763316	0.000000	0.05858	0.078000	0.20375	0.961000	0.63080	-0.110000	0.10824	-0.756000	0.04703	-0.357000	0.07601	ACT	ILKAP	-	NULL	ENSG00000132323		0.403	ILKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILKAP	HGNC	protein_coding	OTTHUMT00000257163.2	-	0.00	39	0	G	NM_030768		239098577	-1	tier1	-	no_errors	ENST00000254654	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.042	T
INSR	3643	genome.wustl.edu	37	19	7184523	7184523	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:7184523G>T	ENST00000302850.5	-	3	920	c.778C>A	c.(778-780)Ctg>Atg	p.L260M	INSR_ENST00000341500.5_Missense_Mutation_p.L260M	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	260	Cys-rich.		L -> P (in LEPRCH; Geldeimalsen). {ECO:0000269|PubMed:2479553}.		activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CTGCCGTCCAGGTAGAAGTTG	0.637																																																	0													42.0	37.0	38.0					19																	7184523		2203	4300	6503	SO:0001583	missense	0			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.778C>A	19.37:g.7184523G>T	ENSP00000303830:p.Leu260Met		Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom	p.L260M	ENST00000302850.5	37	c.778	CCDS12176.1	19	.	.	.	.	.	.	.	.	.	.	G	14.72	2.620541	0.46736	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	D;D	0.97575	-4.44;-4.44	5.01	5.01	0.66863	Growth factor, receptor (1);Furin-like cysteine-rich domain (1);	0.000000	0.36167	N	0.002741	D	0.96534	0.8869	L	0.46947	1.48	0.36864	D	0.888551	B;P;B	0.46706	0.045;0.883;0.215	B;P;B	0.57468	0.36;0.821;0.36	D	0.96264	0.9193	10	0.34782	T	0.22	.	9.4508	0.38725	0.0962:0.0:0.9038:0.0	.	251;260;260	Q86WY9;P06213-2;P06213	.;.;INSR_HUMAN	M	260	ENSP00000303830:L260M;ENSP00000342838:L260M	ENSP00000303830:L260M	L	-	1	2	INSR	7135523	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.305000	0.65750	2.319000	0.78375	0.655000	0.94253	CTG	INSR	-	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Furin-like_Cys-rich_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat	ENSG00000171105		0.637	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSR	HGNC	protein_coding	OTTHUMT00000458544.1		0.00	54	0	G			7184523	-1			no_errors	ENST00000302850	ensembl	human	known	74_37	missense	6.82	41	3	SNP	1.000	T
INTS2	57508	genome.wustl.edu	37	17	59974886	59974886	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:59974886G>A	ENST00000444766.3	-	11	1537	c.1462C>T	c.(1462-1464)Cac>Tac	p.H488Y	INTS2_ENST00000251334.6_Missense_Mutation_p.H480Y	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	488					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						TGGTTGCTGTGAAAGTACATA	0.358																																																	0													53.0	48.0	49.0					17																	59974886		1864	4101	5965	SO:0001583	missense	0			AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.1462C>T	17.37:g.59974886G>A	ENSP00000414237:p.His488Tyr		Q9ULD3	Missense_Mutation	SNP	NULL	p.H488Y	ENST00000444766.3	37	c.1462	CCDS45750.1	17	.	.	.	.	.	.	.	.	.	.	G	23.6	4.441427	0.83993	.	.	ENSG00000108506	ENST00000444766;ENST00000251334	T	0.55760	0.5	5.78	4.81	0.61882	.	0.091256	0.85682	D	0.000000	T	0.62804	0.2458	M	0.76170	2.325	0.80722	D	1	D	0.56968	0.978	P	0.50659	0.647	T	0.66771	-0.5839	9	.	.	.	-14.2714	15.029	0.71691	0.0684:0.0:0.9316:0.0	.	488	Q9H0H0	INT2_HUMAN	Y	488;487	ENSP00000414237:H488Y	.	H	-	1	0	INTS2	57329668	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.226000	0.95229	1.575000	0.49775	0.591000	0.81541	CAC	INTS2	-	NULL	ENSG00000108506		0.358	INTS2-001	KNOWN	basic|CCDS	protein_coding	INTS2	HGNC	protein_coding	OTTHUMT00000445368.1	-	0.00	42	0	G	NM_020748		59974886	-1	tier1	-	no_errors	ENST00000444766	ensembl	human	known	74_37	missense	21.43	33	9	SNP	1.000	A
SLC27A3	11000	genome.wustl.edu	37	1	153746484	153746484	+	5'Flank	SNP	G	G	T	rs199663864		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:153746484G>T	ENST00000368661.3	+	0	0				INTS3_ENST00000318967.2_3'UTR|INTS3_ENST00000456435.1_3'UTR|SLC27A3_ENST00000271857.2_5'Flank|INTS3_ENST00000476843.1_3'UTR	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3						fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gtttttttttgtttttttttt	0.368																																																	0																																										SO:0001631	upstream_gene_variant	0			BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155		1.37:g.153746484G>T	Exception_encountered		Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	RNA	SNP	-	NULL	ENST00000368661.3	37	NULL	CCDS1053.1	1																																																																																			INTS3	-	-	ENSG00000143624		0.368	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS3	HGNC	protein_coding		-	0.00	24	0	G	NM_024330		153746484	+1	tier1	rs199663864	no_errors	ENST00000476843	ensembl	human	known	74_37	rna	13.33	39	6	SNP	0.000	T
INVS	27130	genome.wustl.edu	37	9	102866832	102866832	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:102866832C>T	ENST00000262457.2	+	2	214	c.29C>T	c.(28-30)gCt>gTt	p.A10V	INVS_ENST00000541287.1_5'UTR|INVS_ENST00000262456.2_Missense_Mutation_p.A10V|INVS_ENST00000374921.3_Missense_Mutation_p.A10V|INVS_ENST00000460636.2_3'UTR|RN7SL75P_ENST00000461926.2_RNA	NM_014425.3	NP_055240.2	Q9Y283	INVS_HUMAN	inversin	10					embryonic heart tube left/right pattern formation (GO:0060971)|kidney development (GO:0001822)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|pancreas development (GO:0031016)|post-embryonic development (GO:0009791)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Acute lymphoblastic leukemia(62;0.056)				CTGCTGTTTGCTGGTTCATCA	0.458																																																	0													122.0	101.0	108.0					9																	102866832		2203	4300	6503	SO:0001583	missense	0			AF039217	CCDS6746.1, CCDS6747.1	9q31	2013-01-10	2003-08-11		ENSG00000119509	ENSG00000119509		"""Ankyrin repeat domain containing"""	17870	protein-coding gene	gene with protein product	"""nephrocystin 2"""	243305	"""nephronophthisis 2 (infantile)"""	NPHP2		12872123	Standard	NM_014425		Approved		uc004bap.2	Q9Y283	OTTHUMG00000020364	ENST00000262457.2:c.29C>T	9.37:g.102866832C>T	ENSP00000262457:p.Ala10Val		A2A2Y2|Q2NKL0|Q5W0T6|Q8IVX8|Q9BRB9|Q9Y488|Q9Y498	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_IQ_motif_EF-hand-BS,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,smart_IQ_motif_EF-hand-BS,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Ankyrin_rpt	p.A10V	ENST00000262457.2	37	c.29	CCDS6746.1	9	.	.	.	.	.	.	.	.	.	.	C	12.40	1.926030	0.34002	.	.	ENSG00000119509	ENST00000262457;ENST00000262456;ENST00000374921	T;T;T	0.52754	1.06;1.07;0.65	5.49	4.58	0.56647	.	0.696787	0.14485	N	0.316733	T	0.28699	0.0711	N	0.08118	0	0.80722	D	1	B;B	0.23249	0.012;0.082	B;B	0.21917	0.01;0.037	T	0.10222	-1.0639	10	0.42905	T	0.14	.	11.3287	0.49463	0.0:0.7106:0.2894:0.0	.	10;10	Q9Y283;Q9Y283-2	INVS_HUMAN;.	V	10	ENSP00000262457:A10V;ENSP00000262456:A10V;ENSP00000364056:A10V	ENSP00000262456:A10V	A	+	2	0	INVS	101906653	0.835000	0.29415	0.430000	0.26722	0.129000	0.20672	1.231000	0.32624	2.579000	0.87056	0.563000	0.77884	GCT	INVS	-	NULL	ENSG00000119509		0.458	INVS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	INVS	HGNC	protein_coding	OTTHUMT00000053407.1		0.00	34	0	C	NM_014425		102866832	+1			no_errors	ENST00000262457	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.916	T
IRX4	50805	genome.wustl.edu	37	5	1880924	1880924	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:1880924A>C	ENST00000505790.1	-	4	778	c.322T>G	c.(322-324)Tcg>Gcg	p.S108A	IRX4_ENST00000513692.1_Missense_Mutation_p.S108A|IRX4_ENST00000231357.2_Missense_Mutation_p.S108A|IRX4_ENST00000505938.1_5'UTR	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	108					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		GCAGATCCCGAACCATCCTTG	0.637																																																	0													70.0	77.0	75.0					5																	1880924		2203	4300	6503	SO:0001583	missense	0			AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.322T>G	5.37:g.1880924A>C	ENSP00000423161:p.Ser108Ala		B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,smart_Iroquois_homeo,pfscan_Homeobox_dom	p.S108A	ENST00000505790.1	37	c.322	CCDS3867.1	5	.	.	.	.	.	.	.	.	.	.	A	0.208	-1.039352	0.02013	.	.	ENSG00000113430	ENST00000231357;ENST00000505790;ENST00000513692;ENST00000511126	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.02	4.03	-8.07	0.01098	.	0.428141	0.20794	U	0.085571	T	0.22859	0.0552	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.40664	-0.9551	10	0.09590	T	0.72	-0.9	0.3503	0.00348	0.3284:0.1435:0.2617:0.2664	.	108	P78413	IRX4_HUMAN	A	108	ENSP00000231357:S108A;ENSP00000423161:S108A;ENSP00000424235:S108A;ENSP00000421772:S108A	ENSP00000231357:S108A	S	-	1	0	IRX4	1933924	0.000000	0.05858	0.001000	0.08648	0.164000	0.22412	-0.495000	0.06443	-1.605000	0.01593	-2.030000	0.00424	TCG	IRX4	-	NULL	ENSG00000113430		0.637	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	IRX4	HGNC	protein_coding	OTTHUMT00000365500.1	-	0.00	91	0	A	NM_016358		1880924	-1	tier1	-	no_errors	ENST00000231357	ensembl	human	known	74_37	missense	25.20	92	31	SNP	0.001	C
ITPR2	3709	genome.wustl.edu	37	12	26808727	26808727	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:26808727T>A	ENST00000381340.3	-	20	2919	c.2503A>T	c.(2503-2505)Atg>Ttg	p.M835L		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	835					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	ACAAATTCCATTGTCAGGGCA	0.343																																																	0													108.0	107.0	107.0					12																	26808727		1799	4066	5865	SO:0001583	missense	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.2503A>T	12.37:g.26808727T>A	ENSP00000370744:p.Met835Leu		O94773	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.M835L	ENST00000381340.3	37	c.2503	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	T	15.66	2.898522	0.52227	.	.	ENSG00000123104	ENST00000381340	D	0.91124	-2.79	5.48	5.48	0.80851	.	0.036852	0.85682	N	0.000000	D	0.90191	0.6934	L	0.49350	1.555	0.80722	D	1	P	0.42456	0.78	P	0.48552	0.581	D	0.87649	0.2527	10	0.15952	T	0.53	.	15.5707	0.76333	0.0:0.0:0.0:1.0	.	835	Q14571	ITPR2_HUMAN	L	835	ENSP00000370744:M835L	ENSP00000370744:M835L	M	-	1	0	ITPR2	26699994	1.000000	0.71417	0.970000	0.41538	0.998000	0.95712	7.664000	0.83830	2.074000	0.62210	0.533000	0.62120	ATG	ITPR2	-	superfamily_ARM-type_fold	ENSG00000123104		0.343	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1		0.00	53	0	T	NM_002223		26808727	-1			no_errors	ENST00000381340	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.998	A
KBTBD6	89890	genome.wustl.edu	37	13	41706585	41706585	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr13:41706585C>T	ENST00000379485.1	-	1	297	c.63G>A	c.(61-63)cgG>cgA	p.R21R	KBTBD6_ENST00000499385.2_Silent_p.R21R	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	21										NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		TCTTCTTGGGCCGCTTCCCAC	0.617																																																	0													98.0	107.0	104.0					13																	41706585		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.63G>A	13.37:g.41706585C>T			Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Silent	SNP	pfam_BTB_POZ,pfam_BACK,pfam_Kelch_1,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.R21	ENST00000379485.1	37	c.63	CCDS9376.1	13																																																																																			KBTBD6	-	NULL	ENSG00000165572		0.617	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD6	HGNC	protein_coding	OTTHUMT00000044657.1		0.00	67	0	C	NM_152903		41706585	-1			no_errors	ENST00000379485	ensembl	human	known	74_37	silent	7.14	52	4	SNP	0.764	T
KCNAB1	7881	genome.wustl.edu	37	3	156254468	156254468	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:156254468C>T	ENST00000490337.1	+	14	1256	c.1192C>T	c.(1192-1194)Cat>Tat	p.H398Y	KCNAB1_ENST00000471742.1_Missense_Mutation_p.H387Y|KCNAB1_ENST00000497291.1_3'UTR|KCNAB1_ENST00000389634.5_Missense_Mutation_p.H351Y|KCNAB1_ENST00000302490.8_Missense_Mutation_p.H380Y|KCNAB1_ENST00000389636.5_Missense_Mutation_p.H369Y	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	398					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GATGACATCACATGTGGTAAA	0.408																																																	0													174.0	154.0	161.0					3																	156254468		2203	4300	6503	SO:0001583	missense	0			U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.1192C>T	3.37:g.156254468C>T	ENSP00000419952:p.His398Tyr		A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_K_chnl_volt-dep_bsu_KCNAB-rel,prints_K_chnl_volt-dep_bsu_KCNAB1,prints_K_chnl_volt-dep_bsu_KCNAB3,tigrfam_K_chnl_volt-dep_bsu_KCNAB	p.H398Y	ENST00000490337.1	37	c.1192	CCDS3174.1	3	.	.	.	.	.	.	.	.	.	.	C	16.98	3.271261	0.59649	.	.	ENSG00000169282	ENST00000490337;ENST00000389636;ENST00000471742;ENST00000302490;ENST00000389634	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	5.8	5.8	0.92144	NADP-dependent oxidoreductase domain (3);	0.146599	0.64402	D	0.000009	T	0.45994	0.1370	N	0.20986	0.625	0.80722	D	1	P;B;B;B;P	0.35192	0.489;0.155;0.187;0.433;0.489	P;B;B;B;P	0.46629	0.522;0.306;0.433;0.388;0.522	T	0.47086	-0.9144	10	0.87932	D	0	-4.3289	20.063	0.97692	0.0:1.0:0.0:0.0	.	369;351;380;387;398	B7Z8E5;F8W6W4;B3KPZ4;Q14722-3;Q14722	.;.;.;.;KCAB1_HUMAN	Y	398;369;387;380;351	ENSP00000419952:H398Y;ENSP00000374287:H369Y;ENSP00000418956:H387Y;ENSP00000305858:H380Y;ENSP00000374285:H351Y	ENSP00000305858:H380Y	H	+	1	0	KCNAB1	157737162	0.604000	0.26932	0.954000	0.39281	0.596000	0.36781	2.370000	0.44240	2.741000	0.93983	0.650000	0.86243	CAT	KCNAB1	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_K_chnl_volt-dep_bsu_KCNAB1,prints_K_chnl_volt-dep_bsu_KCNAB3,tigrfam_K_chnl_volt-dep_bsu_KCNAB	ENSG00000169282		0.408	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	KCNAB1	HGNC	protein_coding	OTTHUMT00000351411.1	-	0.00	34	0	C	NM_003471		156254468	+1	tier1	-	no_errors	ENST00000490337	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.989	T
KCNH3	23416	genome.wustl.edu	37	12	49950970	49950970	+	Silent	SNP	C	C	T	rs377373409		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:49950970C>T	ENST00000257981.6	+	14	2840	c.2580C>T	c.(2578-2580)agC>agT	p.S860S	MCRS1_ENST00000547182.1_5'Flank	NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	860					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						CCACAGAGAGCGGCCTGCTCA	0.597																																																	0								C		0,4406		0,0,2203	57.0	54.0	55.0		2580	-9.4	0.2	12		55	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KCNH3	NM_012284.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		860/1084	49950970	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.2580C>T	12.37:g.49950970C>T			Q9UQ06	Silent	SNP	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_cNMP-bd_dom,pfam_PAS_4,pfam_PAS_fold,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.S860	ENST00000257981.6	37	c.2580	CCDS8786.1	12																																																																																			KCNH3	-	NULL	ENSG00000135519		0.597	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH3	HGNC	protein_coding	OTTHUMT00000404571.2	-	0.00	29	0	C	NM_012284		49950970	+1	tier1	-	no_errors	ENST00000257981	ensembl	human	known	74_37	silent	8.89	41	4	SNP	0.298	T
KCNIP4	80333	genome.wustl.edu	37	4	20985516	20985516	+	Intron	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:20985516C>T	ENST00000382152.2	-	2	229				KCNIP4_ENST00000382148.3_Intron|KCNIP4_ENST00000382149.4_5'UTR|KCNIP4_ENST00000447367.2_Intron|KCNIP4_ENST00000382150.4_Intron|KCNIP4_ENST00000509207.1_Intron|KCNIP4_ENST00000359001.5_5'UTR	NM_025221.5	NP_079497.2	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4							dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13		Breast(46;0.134)				CCACTGTTTGCAGTCCTTCGG	0.488																																																	0																																										SO:0001627	intron_variant	0			AF453244	CCDS3428.1, CCDS43215.1, CCDS43216.1, CCDS43217.1, CCDS47035.1	4p15.32	2013-01-10			ENSG00000185774	ENSG00000185774		"""EF-hand domain containing"""	30083	protein-coding gene	gene with protein product		608182				11805342, 11847232	Standard	XM_005248190		Approved	CALP, KCHIP4, MGC44947	uc003gqh.1	Q6PIL6	OTTHUMG00000128557	ENST00000382152.2:c.62-101184G>A	4.37:g.20985516C>T			Q3YAB8|Q3YAB9|Q3YAC0|Q3YAC1|Q3YAC2|Q4W5G8|Q8NEU0|Q9BWT2|Q9H294|Q9H2A4	RNA	SNP	-	NULL	ENST00000382152.2	37	NULL	CCDS43216.1	4																																																																																			KCNIP4	-	-	ENSG00000185774		0.488	KCNIP4-004	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	KCNIP4	HGNC	protein_coding	OTTHUMT00000360407.3	-	0.00	23	0	C	NM_025221		20985516	-1	tier1	-	no_errors	ENST00000382149	ensembl	human	known	74_37	rna	16.00	21	4	SNP	1.000	T
KIAA1407	57577	genome.wustl.edu	37	3	113697767	113697767	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:113697767C>T	ENST00000295878.3	-	15	2544	c.2398G>A	c.(2398-2400)Gcc>Acc	p.A800T	KIAA1407_ENST00000545063.1_3'UTR	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	800								p.A800T(1)		endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						TCAGCCTGGGCCATCTTTCTA	0.448																																																	1	Substitution - Missense(1)	endometrium(1)											161.0	158.0	159.0					3																	113697767		2203	4300	6503	SO:0001583	missense	0			AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.2398G>A	3.37:g.113697767C>T	ENSP00000295878:p.Ala800Thr		B4DYL1|Q9P2E0	Missense_Mutation	SNP	NULL	p.A800T	ENST00000295878.3	37	c.2398	CCDS2977.1	3	.	.	.	.	.	.	.	.	.	.	C	11.80	1.746383	0.30955	.	.	ENSG00000163617	ENST00000295878	T	0.34472	1.36	5.62	3.83	0.44106	.	0.054610	0.64402	D	0.000001	T	0.31857	0.0810	M	0.69823	2.125	0.18873	N	0.999989	P	0.40211	0.707	B	0.33254	0.16	T	0.28038	-1.0056	10	0.46703	T	0.11	.	8.0109	0.30353	0.0:0.7503:0.0:0.2497	.	800	Q8NCU4	K1407_HUMAN	T	800	ENSP00000295878:A800T	ENSP00000295878:A800T	A	-	1	0	KIAA1407	115180457	0.711000	0.27906	0.007000	0.13788	0.003000	0.03518	1.387000	0.34430	0.848000	0.35191	-0.145000	0.13849	GCC	KIAA1407	-	NULL	ENSG00000163617		0.448	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1407	HGNC	protein_coding	OTTHUMT00000354724.2	-	0.00	57	0	C	NM_020817		113697767	-1	tier1	-	no_errors	ENST00000295878	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.008	T
KIAA1551	55196	genome.wustl.edu	37	12	32135930	32135930	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:32135930A>G	ENST00000312561.4	+	4	2455	c.2041A>G	c.(2041-2043)Aaa>Gaa	p.K681E	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	681																	TTCCCTGTGGAAAAAGCAACC	0.423																																																	0													63.0	59.0	60.0					12																	32135930		2203	4299	6502	SO:0001583	missense	0			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.2041A>G	12.37:g.32135930A>G	ENSP00000310338:p.Lys681Glu		B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	NULL	p.K681E	ENST00000312561.4	37	c.2041	CCDS8725.2	12	.	.	.	.	.	.	.	.	.	.	A	15.51	2.853822	0.51270	.	.	ENSG00000174718	ENST00000312561	T	0.21191	2.02	5.68	4.55	0.56014	.	0.000000	0.64402	D	0.000009	T	0.26991	0.0661	M	0.66939	2.045	0.35501	D	0.79977	D	0.55605	0.972	P	0.47075	0.536	T	0.37430	-0.9706	9	.	.	.	.	8.3429	0.32254	0.8429:0.0:0.1571:0.0	.	681	Q9HCM1	CL035_HUMAN	E	681	ENSP00000310338:K681E	.	K	+	1	0	C12orf35	32027197	1.000000	0.71417	0.995000	0.50966	0.279000	0.26890	3.770000	0.55310	0.986000	0.38683	-0.379000	0.06801	AAA	KIAA1551	-	NULL	ENSG00000174718		0.423	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1551	HGNC	protein_coding	OTTHUMT00000250307.2	-	0.00	21	0	A	NM_018169		32135930	+1	tier1	-	no_errors	ENST00000312561	ensembl	human	known	74_37	missense	25.64	29	10	SNP	1.000	G
KIF13B	23303	genome.wustl.edu	37	8	29023209	29023209	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:29023209C>T	ENST00000524189.1	-	12	1277	c.1239G>A	c.(1237-1239)gaG>gaA	p.E413E	KIF13B_ENST00000521515.1_Silent_p.E413E	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	413					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		TCCTTAATTTCTCCTCCCAGG	0.453																																																	0													157.0	150.0	152.0					8																	29023209		1892	4114	6006	SO:0001819	synonymous_variant	0			AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.1239G>A	8.37:g.29023209C>T			B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Silent	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_CAP-Gly_domain,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_CAP-Gly_domain,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_CAP-Gly_domain,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E413	ENST00000524189.1	37	c.1239	CCDS55217.1	8																																																																																			KIF13B	-	NULL	ENSG00000197892		0.453	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF13B	HGNC	protein_coding	OTTHUMT00000376878.1	-	0.00	29	0	C			29023209	-1	tier1	-	no_errors	ENST00000524189	ensembl	human	known	74_37	silent	14.52	53	9	SNP	1.000	T
KLHL23	151230	genome.wustl.edu	37	2	170592266	170592266	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:170592266A>T	ENST00000392647.2	+	2	986	c.742A>T	c.(742-744)Acc>Tcc	p.T248S	KLHL23_ENST00000272797.4_Missense_Mutation_p.T248S|KLHL23_ENST00000602521.1_Intron	NM_144711.5	NP_653312.2	Q8NBE8	KLH23_HUMAN	kelch-like family member 23	248										breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(4)|skin(1)|urinary_tract(1)	16						CTGCCTGCTCACCGAAAATAA	0.403																																																	0													68.0	71.0	70.0					2																	170592266		2203	4300	6503	SO:0001583	missense	0			BC010437	CCDS2236.1	2q31.1	2013-01-30	2013-01-30		ENSG00000213160	ENSG00000213160		"""Kelch-like"", ""BTB/POZ domain containing"""	27506	protein-coding gene	gene with protein product			"""kelch-like 23 (Drosophila)"""				Standard	NM_144711		Approved	MGC2610, FLJ37812, MGC22679	uc002ufi.2	Q8NBE8	OTTHUMG00000132213	ENST00000392647.2:c.742A>T	2.37:g.170592266A>T	ENSP00000376419:p.Thr248Ser		Q8N9B9|Q96FT8	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.T248S	ENST00000392647.2	37	c.742	CCDS2236.1	2	.	.	.	.	.	.	.	.	.	.	A	7.764	0.706004	0.15172	.	.	ENSG00000213160	ENST00000272797;ENST00000392647;ENST00000437875	T;T;T	0.69306	-0.39;-0.39;-0.37	5.81	5.81	0.92471	.	0.227973	0.44285	D	0.000463	T	0.44095	0.1277	N	0.08118	0	0.28168	N	0.928709	B	0.06786	0.001	B	0.09377	0.004	T	0.48234	-0.9053	9	0.05436	T	0.98	.	16.167	0.81768	1.0:0.0:0.0:0.0	.	248	Q8NBE8	KLH23_HUMAN	S	248;248;69	ENSP00000272797:T248S;ENSP00000376419:T248S;ENSP00000394732:T69S	ENSP00000272797:T248S	T	+	1	0	KLHL23	170300512	0.827000	0.29292	0.256000	0.24389	0.624000	0.37722	4.430000	0.59907	2.210000	0.71456	0.533000	0.62120	ACC	KLHL23	-	pirsf_Kelch-like_gigaxonin	ENSG00000213160		0.403	KLHL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL23	HGNC	protein_coding	OTTHUMT00000255271.2		0.00	24	0	A	NM_144711		170592266	+1			no_errors	ENST00000272797	ensembl	human	known	74_37	missense	9.09	20	2	SNP	0.595	T
KLHL28	54813	genome.wustl.edu	37	14	45415050	45415050	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr14:45415050G>A	ENST00000396128.4	-	2	201	c.82C>T	c.(82-84)Ctt>Ttt	p.L28F	KLHL28_ENST00000355081.2_Missense_Mutation_p.L42F	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	28								p.L28V(1)		breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						TGTTGGCGAAGAAGATTCAAG	0.433																																																	1	Substitution - Missense(1)	lung(1)											97.0	88.0	91.0					14																	45415050		2203	4300	6503	SO:0001583	missense	0			AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.82C>T	14.37:g.45415050G>A	ENSP00000379434:p.Leu28Phe		Q0VAL5	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.L28F	ENST00000396128.4	37	c.82	CCDS9680.1	14	.	.	.	.	.	.	.	.	.	.	G	17.42	3.384411	0.61845	.	.	ENSG00000179454	ENST00000396128;ENST00000355081;ENST00000556500;ENST00000556239;ENST00000557468	T;T;T;T;T	0.74209	-0.82;-0.82;-0.82;-0.82;1.69	5.5	5.5	0.81552	BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.81250	0.4783	L	0.56199	1.76	0.50171	D	0.999856	P;B	0.48230	0.907;0.01	P;B	0.54270	0.747;0.013	T	0.82049	-0.0650	10	0.66056	D	0.02	.	19.362	0.94445	0.0:0.0:1.0:0.0	.	28;28	Q9NXS3-2;Q9NXS3	.;KLH28_HUMAN	F	28;42;28;28;28	ENSP00000379434:L28F;ENSP00000347193:L42F;ENSP00000452061:L28F;ENSP00000452591:L28F;ENSP00000450788:L28F	ENSP00000347193:L42F	L	-	1	0	KLHL28	44484800	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.332000	0.59279	2.751000	0.94390	0.650000	0.86243	CTT	KLHL28	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,pirsf_Kelch-like_gigaxonin	ENSG00000179454		0.433	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL28	HGNC	protein_coding	OTTHUMT00000276790.3		0.00	17	0	G			45415050	-1			no_errors	ENST00000396128	ensembl	human	known	74_37	missense	9.09	20	2	SNP	1.000	A
KMT2A	4297	genome.wustl.edu	37	11	118376220	118376220	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:118376220A>G	ENST00000389506.5	+	27	9604	c.9604A>G	c.(9604-9606)Agc>Ggc	p.S3202G	KMT2A_ENST00000534358.1_Missense_Mutation_p.S3205G|KMT2A_ENST00000354520.4_Missense_Mutation_p.S3164G			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	3202					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										TTCAGAATCCAGCCAGAGGAC	0.483																																																	0													77.0	82.0	80.0					11																	118376220		2200	4295	6495	SO:0001583	missense	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.9604A>G	11.37:g.118376220A>G	ENSP00000374157:p.Ser3202Gly		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.S3202G	ENST00000389506.5	37	c.9604	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	A	6.312	0.425741	0.11987	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	T;T;T	0.79653	-1.29;-1.29;-1.27	5.55	4.43	0.53597	.	0.199212	0.53938	D	0.000043	T	0.52533	0.1740	N	0.01874	-0.695	0.23537	N	0.99747	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39603	-0.9606	10	0.15952	T	0.53	.	7.8093	0.29221	0.7807:0.0:0.2193:0.0	.	3205;3202	E9PQG7;Q03164	.;MLL1_HUMAN	G	3205;3202;3164;2112	ENSP00000436786:S3205G;ENSP00000374157:S3202G;ENSP00000346516:S3164G	ENSP00000346516:S3164G	S	+	1	0	MLL	117881430	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.976000	0.63785	1.127000	0.42034	0.482000	0.46254	AGC	KMT2A	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.483	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	HGNC	protein_coding	OTTHUMT00000399085.2	-	0.00	30	0	A	NM_005933		118376220	+1	tier1	-	no_errors	ENST00000389506	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	G
KMT2D	8085	genome.wustl.edu	37	12	49443863	49443863	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:49443863G>T	ENST00000301067.7	-	11	3507	c.3508C>A	c.(3508-3510)Ccc>Acc	p.P1170T		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1170	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TTGCATTCGGGGTAGACCTCC	0.612																																																	0													63.0	69.0	67.0					12																	49443863		1984	4152	6136	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.3508C>A	12.37:g.49443863G>T	ENSP00000301067:p.Pro1170Thr		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.P1170T	ENST00000301067.7	37	c.3508	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	G	7.076	0.569264	0.13560	.	.	ENSG00000167548	ENST00000301067	T	0.80304	-1.36	4.88	1.8	0.24995	.	0.222313	0.23219	N	0.050584	T	0.56499	0.1989	N	0.08118	0	0.26605	N	0.97295	B	0.13594	0.008	B	0.14578	0.011	T	0.50021	-0.8876	10	0.87932	D	0	.	1.5958	0.02663	0.1852:0.3037:0.3544:0.1567	.	1170	O14686	MLL2_HUMAN	T	1170	ENSP00000301067:P1170T	ENSP00000301067:P1170T	P	-	1	0	MLL2	47730130	0.695000	0.27747	1.000000	0.80357	0.899000	0.52679	0.579000	0.23788	0.635000	0.30488	-0.244000	0.11960	CCC	KMT2D	-	NULL	ENSG00000167548		0.612	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	-	0.00	66	0	G			49443863	-1	tier1	-	no_errors	ENST00000301067	ensembl	human	known	74_37	missense	6.67	70	5	SNP	0.940	T
KRTAP26-1	388818	genome.wustl.edu	37	21	31691923	31691923	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr21:31691923C>T	ENST00000360542.3	-	1	684	c.431G>A	c.(430-432)cGc>cAc	p.R144H		NM_203405.1	NP_981950.1	Q6PEX3	KR261_HUMAN	keratin associated protein 26-1	144						intermediate filament (GO:0005882)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16						GAATTGGGGGCGATAGGCATT	0.552																																																	0													184.0	183.0	183.0					21																	31691923		2203	4300	6503	SO:0001583	missense	0			AB096936	CCDS13588.1	21q22.11	2007-11-23			ENSG00000197683	ENSG00000197683		"""Keratin associated proteins"""	33760	protein-coding gene	gene with protein product							Standard	NM_203405		Approved		uc002ynw.3	Q6PEX3	OTTHUMG00000057766	ENST00000360542.3:c.431G>A	21.37:g.31691923C>T	ENSP00000353742:p.Arg144His		B0RZD3	Missense_Mutation	SNP	pfam_KRTAP_PMG	p.R144H	ENST00000360542.3	37	c.431	CCDS13588.1	21	.	.	.	.	.	.	.	.	.	.	C	12.27	1.888985	0.33348	.	.	ENSG00000197683	ENST00000360542	T	0.03745	3.82	3.77	2.88	0.33553	.	0.604741	0.14748	U	0.300785	T	0.03178	0.0093	L	0.43923	1.385	0.09310	N	1	P	0.42908	0.793	B	0.30716	0.119	T	0.43196	-0.9406	10	0.66056	D	0.02	-7.3395	7.6388	0.28282	0.0:0.874:0.0:0.126	.	144	Q6PEX3	KR261_HUMAN	H	144	ENSP00000353742:R144H	ENSP00000353742:R144H	R	-	2	0	KRTAP26-1	30613794	0.000000	0.05858	0.012000	0.15200	0.002000	0.02628	0.242000	0.18087	0.851000	0.35264	0.655000	0.94253	CGC	KRTAP26-1	-	pfam_KRTAP_PMG	ENSG00000197683		0.552	KRTAP26-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP26-1	HGNC	protein_coding	OTTHUMT00000128218.1		0.00	43	0	C	NM_203405		31691923	-1			no_errors	ENST00000360542	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.037	T
L3HYPDH	112849	genome.wustl.edu	37	14	59946071	59946072	+	Splice_Site	INS	-	-	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr14:59946071_59946072insA	ENST00000247194.4	-	2	622		c.e2-2		RP11-701B16.2_ENST00000554253.1_RNA|L3HYPDH_ENST00000487285.1_Splice_Site	NM_144581.1	NP_653182.1	Q96EM0	T3HPD_HUMAN	L-3-hydroxyproline dehydratase (trans-)						metabolic process (GO:0008152)		hydro-lyase activity (GO:0016836)|trans-L-3-hydroxyproline dehydratase activity (GO:0050346)									L-Proline(DB00172)	CCATGAGATCTAAAAAAAAGAT	0.332																																																	0																																										SO:0001630	splice_region_variant	0			AI762327	CCDS9739.1	14q23.1	2012-08-15	2012-08-15	2012-08-15	ENSG00000126790	ENSG00000126790	4.2.1.77		20488	protein-coding gene	gene with protein product	"""trans-L-3-hydroxyproline dehydratase"""	614811	"""chromosome 14 open reading frame 149"""	C14orf149		22528483	Standard	NM_144581		Approved	FLJ25436	uc001xee.1	Q96EM0	OTTHUMG00000028941	ENST00000247194.4:c.509-2->T	14.37:g.59946079_59946079dupA			Q96LJ5	Splice_Site	INS	-	e2-2	ENST00000247194.4	37	c.509-3_509-2	CCDS9739.1	14																																																																																			L3HYPDH	-	-	ENSG00000126790		0.332	L3HYPDH-003	KNOWN	basic|appris_principal|CCDS	protein_coding	L3HYPDH	HGNC	protein_coding	OTTHUMT00000072254.5		0.00	35	0	-	NM_144581	Intron	59946072	-1	tier1		no_errors	ENST00000247194	ensembl	human	known	74_37	splice_site_ins	8.11	34	3	INS	1.000:0.844	A
LEO1	123169	genome.wustl.edu	37	15	52258480	52258480	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr15:52258480A>G	ENST00000299601.5	-	2	340	c.280T>C	c.(280-282)Tct>Cct	p.S94P	LEO1_ENST00000315141.5_Missense_Mutation_p.S94P	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	94	Asp-rich.				endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		TCATGGTCAGAACGCTCAGAA	0.468																																					Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)												0													187.0	170.0	176.0					15																	52258480		2195	4293	6488	SO:0001583	missense	0			AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.280T>C	15.37:g.52258480A>G	ENSP00000299601:p.Ser94Pro		Q96N99	Missense_Mutation	SNP	pfam_Leo1	p.S94P	ENST00000299601.5	37	c.280	CCDS10146.1	15	.	.	.	.	.	.	.	.	.	.	A	18.61	3.661957	0.67700	.	.	ENSG00000166477	ENST00000299601;ENST00000538386;ENST00000315141	.	.	.	5.59	5.59	0.84812	.	0.116385	0.64402	D	0.000011	T	0.67306	0.2879	L	0.34521	1.04	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.83275	0.996;0.986	T	0.69636	-0.5092	9	0.56958	D	0.05	.	15.771	0.78167	1.0:0.0:0.0:0.0	.	94;94	Q8WVC0-2;Q8WVC0	.;LEO1_HUMAN	P	94	.	ENSP00000299601:S94P	S	-	1	0	LEO1	50045772	1.000000	0.71417	0.754000	0.31244	0.331000	0.28603	9.025000	0.93694	2.123000	0.65237	0.533000	0.62120	TCT	LEO1	-	NULL	ENSG00000166477		0.468	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEO1	HGNC	protein_coding	OTTHUMT00000254791.2	-	0.00	44	0	A	NM_138792		52258480	-1	tier1	-	no_errors	ENST00000299601	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	G
LLGL2	3993	genome.wustl.edu	37	17	73566270	73566270	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:73566270T>C	ENST00000392550.3	+	15	1925	c.1808T>C	c.(1807-1809)gTg>gCg	p.V603A	LLGL2_ENST00000167462.5_Missense_Mutation_p.V603A|LLGL2_ENST00000577200.1_Missense_Mutation_p.V603A	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	603					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			TGGCGGCTCGTGGCCTTCGGC	0.662																																																	0													21.0	18.0	19.0					17																	73566270		2180	4265	6445	SO:0001583	missense	0			X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.1808T>C	17.37:g.73566270T>C	ENSP00000376333:p.Val603Ala		Q14521|Q9BR62	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,prints_Lethal2_giant	p.V603A	ENST00000392550.3	37	c.1808	CCDS32733.1	17	.	.	.	.	.	.	.	.	.	.	T	16.33	3.094224	0.56075	.	.	ENSG00000073350	ENST00000167462;ENST00000392550;ENST00000545227	T;T	0.13657	2.57;2.57	5.19	5.19	0.71726	WD40/YVTN repeat-like-containing domain (1);	0.116139	0.64402	D	0.000019	T	0.41119	0.1145	M	0.87900	2.915	0.52099	D	0.999942	P;D;D;D;P	0.58268	0.917;0.963;0.978;0.982;0.919	P;B;P;D;P	0.63113	0.69;0.389;0.594;0.911;0.593	T	0.49184	-0.8966	10	0.87932	D	0	-3.771	15.0926	0.72207	0.0:0.0:0.0:1.0	.	230;592;592;603;603	B4DVR9;B3KX47;G3V1I9;Q6P1M3-2;Q6P1M3	.;.;.;.;L2GL2_HUMAN	A	603;603;592	ENSP00000167462:V603A;ENSP00000376333:V603A	ENSP00000167462:V603A	V	+	2	0	LLGL2	71077865	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.913000	0.87471	1.969000	0.57287	0.449000	0.29647	GTG	LLGL2	-	superfamily_WD40_repeat_dom,prints_Lethal2_giant	ENSG00000073350		0.662	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LLGL2	HGNC	protein_coding	OTTHUMT00000447633.1		0.00	55	0	T	NM_004524		73566270	+1			no_errors	ENST00000392550	ensembl	human	known	74_37	missense	5.00	75	4	SNP	1.000	C
LNPEP	4012	genome.wustl.edu	37	5	96315637	96315637	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:96315637A>T	ENST00000231368.5	+	2	1507	c.815A>T	c.(814-816)tAt>tTt	p.Y272F	LNPEP_ENST00000395770.3_Missense_Mutation_p.Y258F	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	272					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		AGTTCTTATTATGGGTTTTAT	0.398																																																	0													55.0	53.0	54.0					5																	96315637		2203	4300	6503	SO:0001583	missense	0			D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.815A>T	5.37:g.96315637A>T	ENSP00000231368:p.Tyr272Phe		O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.Y272F	ENST00000231368.5	37	c.815	CCDS4087.1	5	.	.	.	.	.	.	.	.	.	.	A	8.210	0.800110	0.16397	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	T;T	0.02525	4.26;4.26	5.83	3.32	0.38043	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.237373	0.43579	D	0.000551	T	0.02012	0.0063	N	0.17594	0.5	0.37658	D	0.922652	B	0.06786	0.001	B	0.15052	0.012	T	0.47289	-0.9129	10	0.10902	T	0.67	.	10.759	0.46253	0.7469:0.0:0.0:0.2531	.	272	Q9UIQ6	LCAP_HUMAN	F	272;258	ENSP00000231368:Y272F;ENSP00000379117:Y258F	ENSP00000231368:Y272F	Y	+	2	0	LNPEP	96341393	1.000000	0.71417	1.000000	0.80357	0.568000	0.35870	4.070000	0.57548	1.032000	0.39892	-0.266000	0.10368	TAT	LNPEP	-	pfam_Peptidase_M1_N	ENSG00000113441		0.398	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNPEP	HGNC	protein_coding	OTTHUMT00000250624.1	-	0.00	36	0	A	NM_005575		96315637	+1	tier1	-	no_errors	ENST00000231368	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	T
MSC	9242	genome.wustl.edu	37	8	72755778	72755778	+	Intron	SNP	C	C	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:72755778C>G	ENST00000325509.4	-	1	824				RP11-383H13.1_ENST00000524152.1_5'Flank|RP11-383H13.1_ENST00000521467.1_Intron|RP11-383H13.1_ENST00000537896.1_Missense_Mutation_p.P48A|MSC_ENST00000518440.1_5'Flank	NM_005098.3	NP_005089.2	O60682	MUSC_HUMAN	musculin						branchiomeric skeletal muscle development (GO:0014707)|diaphragm development (GO:0060539)|palate development (GO:0060021)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(4)|skin(2)	26	Breast(64;0.176)		Epithelial(68;0.137)|BRCA - Breast invasive adenocarcinoma(89;0.203)			GAACCTCCACCCCTTTCGAAT	0.607											OREG0018826	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0				CCDS43746.1	8q13.3	2013-06-07	2010-04-28		ENSG00000178860	ENSG00000178860		"""Basic helix-loop-helix proteins"""	7321	protein-coding gene	gene with protein product	"""activated B-cell factor-1"""	603628	"""musculin (activated B-cell factor-1)"""			9584154, 10198176	Standard	NM_005098		Approved	ABF-1, bHLHa22	uc003xyx.1	O60682	OTTHUMG00000164489	ENST00000325509.4:c.534+101G>C	8.37:g.72755778C>G		1140	O75946|Q53XZ2|Q9BRE7	Missense_Mutation	SNP	NULL	p.P48A	ENST00000325509.4	37	c.142	CCDS43746.1	8	.	.	.	.	.	.	.	.	.	.	C	11.16	1.555736	0.27827	.	.	ENSG00000235531	ENST00000537896	.	.	.	3.56	-4.82	0.03171	.	.	.	.	.	T	0.35740	0.0942	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.46803	-0.9165	5	0.87932	D	0	.	5.4586	0.16604	0.126:0.6093:0.1263:0.1383	.	.	.	.	A	48	.	ENSP00000440866:P48A	P	+	1	0	RP11-383H13.1	72918332	0.000000	0.05858	0.000000	0.03702	0.558000	0.35554	-0.292000	0.08332	-1.137000	0.02888	0.555000	0.69702	CCC	RP11-383H13.1	-	NULL	ENSG00000235531		0.607	MSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100132891	Clone_based_vega_gene	protein_coding	OTTHUMT00000378974.1	-	0.00	43	0	C	NM_005098		72755778	+1	tier1	-	no_errors	ENST00000537896	ensembl	human	known	74_37	missense	15.15	28	5	SNP	0.000	G
LINC01125	728537	genome.wustl.edu	37	2	98319210	98319210	+	RNA	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:98319210T>A	ENST00000451384.2	+	0	1047				AC017099.3_ENST00000601580.1_RNA|AC017099.3_ENST00000595492.1_RNA|AC017099.3_ENST00000595588.1_RNA|AC017099.3_ENST00000596740.1_RNA|AC017099.3_ENST00000599435.1_RNA|AC017099.3_ENST00000445382.2_RNA|AC017099.3_ENST00000458149.3_RNA|AC017099.3_ENST00000599501.1_RNA|AC017099.3_ENST00000600331.1_RNA|AC017099.3_ENST00000600606.1_RNA|AC017099.3_ENST00000599666.1_RNA|AC017099.3_ENST00000598824.1_RNA|AC017099.3_ENST00000605331.1_RNA|AC017099.3_ENST00000603835.1_RNA|AC017099.3_ENST00000597654.1_RNA|AC017099.3_ENST00000596069.1_RNA|AC017099.3_ENST00000601499.1_RNA|AC017099.3_ENST00000598737.1_RNA|AC017099.3_ENST00000601509.1_RNA	NR_038386.1																						AAGAAAAAAATTTCACAAAAC	0.388																																																	0																																												0																															2.37:g.98319210T>A				RNA	SNP	-	NULL	ENST00000451384.2	37	NULL		2																																																																																			AC017099.3	-	-	ENSG00000228486		0.388	AC017099.3-001	KNOWN	basic|exp_conf	antisense	LOC728537	Clone_based_vega_gene	antisense	OTTHUMT00000329293.2	-	0.00	37	0	T			98319210	+1	tier1	-	no_errors	ENST00000445382	ensembl	human	known	74_37	rna	66.67	10	20	SNP	0.000	A
LPHN2	23266	genome.wustl.edu	37	1	82456713	82456713	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:82456713T>C	ENST00000370728.1	+	25	4909	c.4264T>C	c.(4264-4266)Tgc>Cgc	p.C1422R	LPHN2_ENST00000370725.1_Missense_Mutation_p.C1437R|LPHN2_ENST00000469377.2_3'UTR|LPHN2_ENST00000370723.1_Missense_Mutation_p.C1424R|LPHN2_ENST00000370717.2_Missense_Mutation_p.C1437R|LPHN2_ENST00000319517.6_Missense_Mutation_p.C1366R|LPHN2_ENST00000370730.1_Missense_Mutation_p.C1379R|LPHN2_ENST00000359929.3_Missense_Mutation_p.C1366R|LPHN2_ENST00000335786.5_Missense_Mutation_p.C1379R|LPHN2_ENST00000271029.4_Missense_Mutation_p.C1394R|LPHN2_ENST00000370713.1_3'UTR|LPHN2_ENST00000370727.1_Missense_Mutation_p.C1394R|LPHN2_ENST00000394879.1_Missense_Mutation_p.C1424R|LPHN2_ENST00000370715.1_3'UTR|LPHN2_ENST00000370721.1_Missense_Mutation_p.C1347R			O95490	LPHN2_HUMAN	latrophilin 2	1422					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		gcttcagatgtgctaccagat	0.448																																																	0													41.0	40.0	40.0					1																	82456713		2203	4300	6503	SO:0001583	missense	0			AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.4264T>C	1.37:g.82456713T>C	ENSP00000359763:p.Cys1422Arg		A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.C1437R	ENST00000370728.1	37	c.4309		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.71|10.71	1.426721|1.426721	0.25726|0.25726	.|.	.|.	ENSG00000117114|ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786|ENST00000402328	T;T;T;T;T;T;T;T;T;T;T;T|.	0.68624|.	-0.32;-0.34;-0.34;-0.28;-0.28;-0.23;-0.3;-0.3;-0.28;-0.23;-0.28;-0.34|.	5.67|5.67	4.51|4.51	0.55191|0.55191	.|.	0.188117|.	0.47852|.	D|.	0.000205|.	T|T	0.33411|0.33411	0.0862|0.0862	N|N	0.22421|0.22421	0.69|0.69	0.58432|0.58432	D|D	0.999994|0.999994	B;B|.	0.22746|.	0.02;0.074|.	B;B|.	0.29663|.	0.038;0.105|.	T|T	0.17930|0.17930	-1.0353|-1.0353	10|5	0.87932|.	D|.	0|.	.|.	12.6783|12.6783	0.56908|0.56908	0.0:0.0:0.138:0.862|0.0:0.0:0.138:0.862	.|.	1366;346|.	O95490-2;B3KVU1|.	.;.|.	R|A	1347;1422;1379;1394;1437;1424;1366;1366;1437;1424;1394;1379|433	ENSP00000359756:C1347R;ENSP00000359763:C1422R;ENSP00000359765:C1379R;ENSP00000359762:C1394R;ENSP00000359760:C1437R;ENSP00000359758:C1424R;ENSP00000353006:C1366R;ENSP00000322270:C1366R;ENSP00000359752:C1437R;ENSP00000378344:C1424R;ENSP00000271029:C1394R;ENSP00000337306:C1379R|.	ENSP00000271029:C1394R|.	C|V	+|+	1|2	0|0	LPHN2|LPHN2	82229301|82229301	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	7.499000|7.499000	0.81566|0.81566	0.934000|0.934000	0.37316|0.37316	0.459000|0.459000	0.35465|0.35465	TGC|GTG	LPHN2	-	pfam_GPCR_2_latrophilin_rcpt_C	ENSG00000117114		0.448	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	LPHN2	HGNC	protein_coding	OTTHUMT00000027188.1		0.00	30	0	T	NM_012302		82456713	+1			no_errors	ENST00000370717	ensembl	human	known	74_37	missense	13.64	19	3	SNP	1.000	C
LPGAT1	9926	genome.wustl.edu	37	1	211952282	211952282	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:211952282T>A	ENST00000366997.4	-	6	1058	c.832A>T	c.(832-834)Aca>Tca	p.T278S	LPGAT1_ENST00000366996.1_Missense_Mutation_p.T278S	NM_014873.2	NP_055688.1	Q92604	LGAT1_HUMAN	lysophosphatidylglycerol acyltransferase 1	278					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring acyl groups (GO:0016746)			breast(1)|endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)		TGTGTGACTGTTGGTTTCCTG	0.343																																																	0													172.0	174.0	173.0					1																	211952282		2203	4300	6503	SO:0001583	missense	0			D86960	CCDS31018.1	1q32.3	2008-05-14	2004-11-25	2004-11-26	ENSG00000123684	ENSG00000123684			28985	protein-coding gene	gene with protein product		610473	"""family with sequence similarity 34, member A"""	FAM34A		9039502, 15485873	Standard	NM_014873		Approved	KIAA0205, FAM34A1, NET8	uc001hiv.3	Q92604	OTTHUMG00000037120	ENST00000366997.4:c.832A>T	1.37:g.211952282T>A	ENSP00000355964:p.Thr278Ser		Q53YL2	Missense_Mutation	SNP	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.T278S	ENST00000366997.4	37	c.832	CCDS31018.1	1	.	.	.	.	.	.	.	.	.	.	T	11.45	1.643122	0.29246	.	.	ENSG00000123684	ENST00000366997;ENST00000366996	T;T	0.28895	1.59;1.59	5.89	4.77	0.60923	.	0.041576	0.85682	D	0.000000	T	0.19446	0.0467	L	0.32530	0.975	0.58432	D	0.999998	B	0.27853	0.191	B	0.20577	0.03	T	0.03524	-1.1028	10	0.08179	T	0.78	-10.5817	10.9218	0.47169	0.0:0.0748:0.0:0.9252	.	278	Q92604	LGAT1_HUMAN	S	278	ENSP00000355964:T278S;ENSP00000355963:T278S	ENSP00000355963:T278S	T	-	1	0	LPGAT1	210018905	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	2.924000	0.48876	1.085000	0.41206	0.449000	0.29647	ACA	LPGAT1	-	NULL	ENSG00000123684		0.343	LPGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPGAT1	HGNC	protein_coding	OTTHUMT00000090150.1		0.00	49	0	T	NM_014873		211952282	-1			no_errors	ENST00000366997	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	A
LPIN3	64900	genome.wustl.edu	37	20	39976277	39976277	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr20:39976277A>G	ENST00000373257.3	+	3	369	c.278A>G	c.(277-279)gAg>gGg	p.E93G		NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	93	N-LIP.				fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				CAGGAGCTGGAGAGCGATGAT	0.577																																																	0													125.0	119.0	121.0					20																	39976277		2203	4300	6503	SO:0001583	missense	0			AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.278A>G	20.37:g.39976277A>G	ENSP00000362354:p.Glu93Gly		B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Missense_Mutation	SNP	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,smart_LNS2	p.E93G	ENST00000373257.3	37	c.278	CCDS33469.1	20	.	.	.	.	.	.	.	.	.	.	A	12.42	1.933716	0.34096	.	.	ENSG00000132793	ENST00000373257	T	0.79749	-1.3	5.56	3.33	0.38152	Lipin, N-terminal (1);	0.482191	0.22328	N	0.061519	T	0.76730	0.4028	L	0.56769	1.78	0.31374	N	0.679834	B;B	0.23650	0.089;0.008	B;B	0.33339	0.162;0.015	T	0.72653	-0.4228	9	.	.	.	-7.0655	9.1904	0.37195	0.8514:0.0:0.1486:0.0	.	93;93	Q9BQK8-2;Q9BQK8	.;LPIN3_HUMAN	G	93	ENSP00000362354:E93G	.	E	+	2	0	LPIN3	39409691	1.000000	0.71417	0.795000	0.32087	0.255000	0.26057	7.082000	0.76851	0.936000	0.37367	0.533000	0.62120	GAG	LPIN3	-	pfam_Lipin_N	ENSG00000132793		0.577	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LPIN3	HGNC	protein_coding	OTTHUMT00000080393.1	-	0.00	43	0	A	NM_022896		39976277	+1	tier1	-	no_errors	ENST00000373257	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.974	G
PLPPR4	9890	genome.wustl.edu	37	1	99772254	99772254	+	Silent	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:99772254T>G	ENST00000370185.3	+	7	2477	c.1980T>G	c.(1978-1980)acT>acG	p.T660T	LPPR4_ENST00000370184.1_Silent_p.T502T|LPPR4_ENST00000457765.1_Silent_p.T602T	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		660					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		TTCGCCAAACTTACGAGCTCA	0.507																																																	0													71.0	69.0	70.0					1																	99772254		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000370185.3:c.1980T>G	1.37:g.99772254T>G			E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Silent	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.T660	ENST00000370185.3	37	c.1980	CCDS757.1	1																																																																																			LPPR4	-	NULL	ENSG00000117600		0.507	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR4	Uniprot_gn	protein_coding	OTTHUMT00000029670.2	-	0.00	21	0	T			99772254	+1	tier1	-	no_errors	ENST00000370185	ensembl	human	known	74_37	silent	28.57	20	8	SNP	0.057	G
LRBA	987	genome.wustl.edu	37	4	151682972	151682972	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:151682972C>A	ENST00000357115.3	-	35	5851	c.5608G>T	c.(5608-5610)Gca>Tca	p.A1870S	LRBA_ENST00000510413.1_Missense_Mutation_p.A1870S|LRBA_ENST00000507224.1_Missense_Mutation_p.A1870S|LRBA_ENST00000535741.1_Missense_Mutation_p.A1870S	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	1870						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					GCAAGGCCTGCATTCTTCTGA	0.279																																																	0													50.0	59.0	56.0					4																	151682972		2203	4283	6486	SO:0001583	missense	0			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.5608G>T	4.37:g.151682972C>A	ENSP00000349629:p.Ala1870Ser		Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom	p.A1870S	ENST00000357115.3	37	c.5608	CCDS3773.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.5|27.5	4.839700|4.839700	0.91117|0.91117	.|.	.|.	ENSG00000198589|ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224|ENST00000509835	T;T;T;T|.	0.65178|.	0.29;0.43;0.3;-0.14|.	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	0.063550|.	0.64402|.	D|.	0.000006|.	T|T	0.82056|0.82056	0.4954|0.4954	M|M	0.83953|0.83953	2.67|2.67	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.999;0.999|.	D;D|.	0.78314|.	0.991;0.988|.	D|D	0.83753|0.83753	0.0210|0.0210	10|5	0.66056|.	D|.	0.02|.	.|.	18.5067|18.5067	0.90900|0.90900	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1870;1870|.	P50851;P50851-2|.	LRBA_HUMAN;.|.	S|I	1870|522	ENSP00000446299:A1870S;ENSP00000421552:A1870S;ENSP00000349629:A1870S;ENSP00000422180:A1870S|.	ENSP00000349629:A1870S|.	A|M	-|-	1|3	0|0	LRBA|LRBA	151902422|151902422	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.799000|0.799000	0.45148|0.45148	7.128000|7.128000	0.77217|0.77217	2.352000|2.352000	0.79861|0.79861	0.655000|0.655000	0.94253|0.94253	GCA|ATG	LRBA	-	NULL	ENSG00000198589		0.279	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	HGNC	protein_coding	OTTHUMT00000364939.1		0.00	56	0	C			151682972	-1			no_errors	ENST00000357115	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	A
LRPPRC	10128	genome.wustl.edu	37	2	44126659	44126659	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:44126659C>T	ENST00000260665.7	-	33	3712	c.3655G>A	c.(3655-3657)Gca>Aca	p.A1219T		NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	1219	RNA-binding.				mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				AATAAGTATGCCAAGCCGAAG	0.348																																																	0													99.0	91.0	94.0					2																	44126659		2203	4300	6503	SO:0001583	missense	0			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.3655G>A	2.37:g.44126659C>T	ENSP00000260665:p.Ala1219Thr		A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	pfam_Pentatricopeptide_repeat,tigrfam_Pentatricopeptide_repeat	p.A1219T	ENST00000260665.7	37	c.3655	CCDS33189.1	2	.	.	.	.	.	.	.	.	.	.	C	12.51	1.959385	0.34565	.	.	ENSG00000138095	ENST00000260665	T	0.57273	0.41	5.75	-3.9	0.04181	.	0.658374	0.15489	N	0.259657	T	0.36054	0.0953	L	0.48642	1.525	0.80722	D	1	B	0.12630	0.006	B	0.10450	0.005	T	0.24154	-1.0168	10	0.12103	T	0.63	-7.5245	8.8212	0.35027	0.6512:0.1566:0.0:0.1922	.	1219	P42704	LPPRC_HUMAN	T	1219	ENSP00000260665:A1219T	ENSP00000260665:A1219T	A	-	1	0	LRPPRC	43980163	0.002000	0.14202	0.573000	0.28510	0.819000	0.46315	-0.713000	0.05007	-1.308000	0.02318	0.563000	0.77884	GCA	LRPPRC	-	NULL	ENSG00000138095		0.348	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRPPRC	HGNC	protein_coding	OTTHUMT00000327823.1	-	0.00	51	0	C	NM_133259		44126659	-1	tier1	-	no_errors	ENST00000260665	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.409	T
LRP1B	53353	genome.wustl.edu	37	2	141214096	141214096	+	Silent	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:141214096A>G	ENST00000389484.3	-	62	10862	c.9891T>C	c.(9889-9891)acT>acC	p.T3297T		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3297	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GACATGCACAAGTGTGGGTTT	0.428										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													117.0	109.0	112.0					2																	141214096		2203	4300	6503	SO:0001819	synonymous_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.9891T>C	2.37:g.141214096A>G			Q8WY29|Q8WY30|Q8WY31	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.T3297	ENST00000389484.3	37	c.9891	CCDS2182.1	2																																																																																			LRP1B	-	superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom	ENSG00000168702		0.428	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	69	0	A	NM_018557		141214096	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	silent	43.24	42	32	SNP	0.997	G
LRRC7	57554	genome.wustl.edu	37	1	70488956	70488956	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:70488956G>A	ENST00000035383.5	+	15	1609	c.1579G>A	c.(1579-1581)Gca>Aca	p.A527T	LRRC7_ENST00000310961.5_Missense_Mutation_p.A532T|RP11-181B18.1_ENST00000425754.1_RNA|RP11-181B18.1_ENST00000414132.1_RNA|LRRC7_ENST00000415775.2_Intron	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	527						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						CCCACAGCTGGCATGGGGTTG	0.552																																																	0													98.0	92.0	94.0					1																	70488956		2203	4300	6503	SO:0001583	missense	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.1579G>A	1.37:g.70488956G>A	ENSP00000035383:p.Ala527Thr		Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.A527T	ENST00000035383.5	37	c.1579	CCDS645.1	1	.	.	.	.	.	.	.	.	.	.	G	15.64	2.893320	0.52121	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.37235	1.21;1.28	5.86	5.86	0.93980	.	0.294922	0.33753	N	0.004588	T	0.10508	0.0257	N	0.08118	0	0.80722	D	1	B	0.29432	0.244	B	0.26864	0.074	T	0.11203	-1.0597	10	0.25106	T	0.35	.	15.6849	0.77402	0.0:0.0:1.0:0.0	.	527	Q96NW7	LRRC7_HUMAN	T	532;527;350	ENSP00000309245:A532T;ENSP00000035383:A527T	ENSP00000035383:A527T	A	+	1	0	LRRC7	70261544	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.453000	0.60061	2.775000	0.95449	0.585000	0.79938	GCA	LRRC7	-	NULL	ENSG00000033122		0.552	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC7	HGNC	protein_coding	OTTHUMT00000131261.1	-	0.00	47	0	G	NM_020794		70488956	+1	tier1	-	no_errors	ENST00000035383	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	A
LRRC9	341883	genome.wustl.edu	37	14	60405167	60405167	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr14:60405167A>T	ENST00000445360.1	+	7	807	c.603A>T	c.(601-603)caA>caT	p.Q201H	LRRC9_ENST00000454474.2_3'UTR			Q6ZRR7	LRRC9_HUMAN	leucine rich repeat containing 9	201																	ATGACCCTCAATATACAACCA	0.373																																																	0																																										SO:0001583	missense	0			AK128037		14q23.1	2013-01-29	2003-11-19		ENSG00000131951	ENSG00000131951			19848	other	unknown			"""leucine-rich repeat-containing 9"""				Standard	NR_075071		Approved	FLJ46156	uc001xep.1	Q6ZRR7	OTTHUMG00000028948	ENST00000445360.1:c.603A>T	14.37:g.60405167A>T	ENSP00000454748:p.Gln201His			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.Q201H	ENST00000445360.1	37	c.603		14																																																																																			LRRC9	-	NULL	ENSG00000131951		0.373	LRRC9-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	LRRC9	HGNC	protein_coding	OTTHUMT00000072281.3	-	0.00	29	0	A			60405167	+1	tier1	-	no_errors	ENST00000254271	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
LRRIQ1	84125	genome.wustl.edu	37	12	85517861	85517861	+	Silent	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:85517861T>C	ENST00000393217.2	+	17	3632	c.3571T>C	c.(3571-3573)Ttg>Ctg	p.L1191L		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1191										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TGTATTTACCTTGGATACTGC	0.318																																																	0													43.0	46.0	45.0					12																	85517861		2203	4300	6503	SO:0001819	synonymous_variant	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.3571T>C	12.37:g.85517861T>C			Q567P4|Q9BS17|Q9HA36	Silent	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.L1191	ENST00000393217.2	37	c.3571	CCDS41816.1	12																																																																																			LRRIQ1	-	NULL	ENSG00000133640		0.318	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	-	0.00	28	0	T	NM_032165		85517861	+1	tier1	-	no_errors	ENST00000393217	ensembl	human	known	74_37	silent	25.81	22	8	SNP	0.006	C
MACROD2	140733	genome.wustl.edu	37	20	15843407	15843407	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr20:15843407C>T	ENST00000310348.4	+	9	663	c.663C>T	c.(661-663)ttC>ttT	p.F221F	MACROD2_ENST00000378058.3_5'Flank|MACROD2_ENST00000402914.1_5'UTR|MACROD2_ENST00000217246.4_Silent_p.F221F			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	221	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				GGATCATTTTCTGTGTCTTCT	0.348																																																	0													104.0	105.0	104.0					20																	15843407		2203	4299	6502	SO:0001819	synonymous_variant	0			BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.663C>T	20.37:g.15843407C>T			A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Silent	SNP	pfam_Macro_dom,smart_Macro_dom,pfscan_Macro_dom	p.F221	ENST00000310348.4	37	c.663	CCDS13120.2	20																																																																																			MACROD2	-	pfscan_Macro_dom	ENSG00000172264		0.348	MACROD2-201	KNOWN	basic|CCDS	protein_coding	MACROD2	HGNC	protein_coding		-	0.00	41	0	C	NM_080676		15843407	+1	tier1	-	no_errors	ENST00000310348	ensembl	human	known	74_37	silent	6.06	62	4	SNP	1.000	T
MAGEE2	139599	genome.wustl.edu	37	X	75004857	75004857	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:75004857G>C	ENST00000373359.2	-	1	222	c.30C>G	c.(28-30)caC>caG	p.H10Q		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	10										autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CTGCGCTACAGTGGCGTGCAT	0.577																																																	0													42.0	31.0	35.0					X																	75004857		2202	4293	6495	SO:0001583	missense	0			AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.30C>G	X.37:g.75004857G>C	ENSP00000362457:p.His10Gln		Q5JSI5	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.H10Q	ENST00000373359.2	37	c.30	CCDS14431.1	X	.	.	.	.	.	.	.	.	.	.	G	2.514	-0.312264	0.05422	.	.	ENSG00000186675	ENST00000373359	T	0.03330	3.97	2.86	-1.53	0.08611	.	.	.	.	.	T	0.01695	0.0054	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47598	-0.9105	9	0.24483	T	0.36	.	2.8142	0.05451	0.4676:0.0:0.3113:0.2211	.	10	Q8TD90	MAGE2_HUMAN	Q	10	ENSP00000362457:H10Q	ENSP00000362457:H10Q	H	-	3	2	MAGEE2	74921582	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.015000	0.13355	-0.534000	0.06315	-0.332000	0.08345	CAC	MAGEE2	-	NULL	ENSG00000186675		0.577	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE2	HGNC	protein_coding	OTTHUMT00000057288.1	-	0.00	16	0	G	NM_138703		75004857	-1	tier1	-	no_errors	ENST00000373359	ensembl	human	known	74_37	missense	50.00	11	11	SNP	0.000	C
MAGEA10	4109	genome.wustl.edu	37	X	151303610	151303610	+	Silent	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:151303610C>A	ENST00000370323.4	-	4	799	c.483G>T	c.(481-483)ctG>ctT	p.L161L	MAGEA10_ENST00000244096.3_Silent_p.L161L|RP11-1007I13.4_ENST00000509345.2_RNA	NM_001251828.1|NM_021048.4	NP_001238757.1|NP_066386	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	161	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					TGACACTCTCCAGTATTTCTG	0.428																																																	0													100.0	96.0	97.0					X																	151303610		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS14705.1	Xq28	2009-03-13			ENSG00000124260	ENSG00000124260			6797	protein-coding gene	gene with protein product	"""MAGE-10 antigen"", ""melanoma-associated antigen 10"", ""cancer/testis antigen family 1, member 10"""	300343		MAGE10		8575766	Standard	NM_001011543		Approved	MGC10599, CT1.10	uc004ffl.3	P43363	OTTHUMG00000024180	ENST00000370323.4:c.483G>T	X.37:g.151303610C>A				Silent	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.L161	ENST00000370323.4	37	c.483	CCDS14705.1	X																																																																																			MAGEA10	-	pfam_MAGE,pfscan_MAGE	ENSG00000124260		0.428	MAGEA10-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGEA10	HGNC	protein_coding	OTTHUMT00000060916.3	-	0.00	30	0	C	NM_021048		151303610	-1	tier1	-	no_errors	ENST00000244096	ensembl	human	known	74_37	silent	18.18	18	4	SNP	0.010	A
MAN1C1	57134	genome.wustl.edu	37	1	26085250	26085250	+	Intron	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:26085250C>T	ENST00000374332.4	+	6	1377				MAN1C1_ENST00000374329.1_Intron|MAN1C1_ENST00000473891.1_3'UTR|MAN1C1_ENST00000263979.3_Intron	NM_020379.2	NP_065112.1	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1						cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(7)|pancreas(1)|prostate(1)|skin(2)	25		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)		GATGAGCGTGCGGCTGCCACA	0.587																																																	0													46.0	43.0	44.0					1																	26085250		2203	4300	6503	SO:0001627	intron_variant	0			AF261655	CCDS265.1	1p35	2008-02-05			ENSG00000117643	ENSG00000117643			19080	protein-coding gene	gene with protein product						10915796	Standard	XM_005245945		Approved	HMIC	uc001bkm.2	Q9NR34	OTTHUMG00000004417	ENST00000374332.4:c.1047+50C>T	1.37:g.26085250C>T			A6NNE2|B2RNP2|Q9Y545	RNA	SNP	-	NULL	ENST00000374332.4	37	NULL	CCDS265.1	1																																																																																			MAN1C1	-	-	ENSG00000117643		0.587	MAN1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1C1	HGNC	protein_coding	OTTHUMT00000012828.3	-	0.00	41	0	C	NM_020379		26085250	+1	tier1	-	no_errors	ENST00000473891	ensembl	human	known	74_37	rna	11.11	32	4	SNP	0.000	T
MAOA	4128	genome.wustl.edu	37	X	43571184	43571184	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:43571184C>T	ENST00000338702.3	+	4	495	c.372C>T	c.(370-372)taC>taT	p.Y124Y	MAOA_ENST00000542639.1_5'UTR|MAOA_ENST00000497485.1_3'UTR	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A	124					cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	ATTTGGATTACAATAATCTGT	0.383																																																	0													143.0	132.0	136.0					X																	43571184		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.372C>T	X.37:g.43571184C>T			B4DF46|Q16426	Silent	SNP	pfam_Amino_oxidase,pfam_FAD-dep_OxRdtase,pfam_mOase_FAD-bd,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_FAD_bind_dom,prints_Flavin_amine_oxidase	p.Y124	ENST00000338702.3	37	c.372	CCDS14260.1	X																																																																																			MAOA	-	pfam_Amino_oxidase	ENSG00000189221		0.383	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAOA	HGNC	protein_coding	OTTHUMT00000056300.1	-	0.00	19	0	C	NM_000240		43571184	+1	tier1	-	no_errors	ENST00000338702	ensembl	human	known	74_37	silent	46.88	17	15	SNP	1.000	T
MAP2K2	5605	genome.wustl.edu	37	19	4099205	4099205	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:4099205C>T	ENST00000262948.5	-	7	1166	c.913G>A	c.(913-915)Gtc>Atc	p.V305I	MAP2K2_ENST00000394867.4_Missense_Mutation_p.V208I|MAP2K2_ENST00000599345.1_5'Flank	NM_030662.3	NP_109587.1	P36507	MP2K2_HUMAN	mitogen-activated protein kinase kinase 2	305	Pro-rich.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of cell motility (GO:2000147)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|scaffold protein binding (GO:0097110)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)	Bosutinib(DB06616)|Trametinib(DB08911)	GTACCGCTGACGGGGCGCCCG	0.706																																																	0													9.0	10.0	10.0					19																	4099205		2167	4244	6411	SO:0001583	missense	0			L11285	CCDS12120.1	19p13.3	2014-09-17			ENSG00000126934	ENSG00000126934	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6842	protein-coding gene	gene with protein product		601263		PRKMK2		8388392	Standard	NM_030662		Approved	MEK2	uc002lzk.3	P36507	OTTHUMG00000134286	ENST00000262948.5:c.913G>A	19.37:g.4099205C>T	ENSP00000262948:p.Val305Ile			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V305I	ENST00000262948.5	37	c.913	CCDS12120.1	19	.	.	.	.	.	.	.	.	.	.	c	4.290	0.052980	0.08291	.	.	ENSG00000126934	ENST00000262948;ENST00000394867	D;D	0.92348	-3.02;-3.02	4.44	1.18	0.20946	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.402492	0.27554	N	0.018845	D	0.83945	0.5364	L	0.31294	0.92	0.23886	N	0.996564	B	0.02656	0.0	B	0.04013	0.001	T	0.70070	-0.4973	10	0.33940	T	0.23	-6.5506	7.4778	0.27387	0.0:0.2766:0.0:0.7234	.	305	P36507	MP2K2_HUMAN	I	305;208	ENSP00000262948:V305I;ENSP00000378336:V208I	ENSP00000262948:V305I	V	-	1	0	MAP2K2	4050205	0.749000	0.28305	0.998000	0.56505	0.232000	0.25224	0.125000	0.15749	-0.053000	0.13289	-0.609000	0.04063	GTC	MAP2K2	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000126934		0.706	MAP2K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K2	HGNC	protein_coding	OTTHUMT00000258957.2		0.00	19	0	C			4099205	-1			no_errors	ENST00000262948	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.998	T
MAST2	23139	genome.wustl.edu	37	1	46494458	46494458	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:46494458T>G	ENST00000361297.2	+	18	2354	c.2071T>G	c.(2071-2073)Tac>Gac	p.Y691D	MAST2_ENST00000372009.2_Missense_Mutation_p.Y621D	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					GACCCCAGAATACATTGCGCC	0.617																																																	0													109.0	110.0	110.0					1																	46494458		2021	4191	6212	SO:0001583	missense	0			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.2071T>G	1.37:g.46494458T>G	ENSP00000354671:p.Tyr691Asp			Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_dom	p.Y691D	ENST00000361297.2	37	c.2071	CCDS41326.1	1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.932538	0.73442	.	.	ENSG00000086015	ENST00000361297;ENST00000372009;ENST00000432341;ENST00000372008	T;T;T	0.59638	0.25;0.25;0.25	4.83	3.68	0.42216	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.206192	0.43110	D	0.000620	D	0.83454	0.5258	H	0.98594	4.275	0.80722	D	1	D;D;D;D	0.89917	0.982;1.0;0.998;0.999	P;D;D;D	0.85130	0.764;0.997;0.977;0.988	D	0.88069	0.2799	10	0.87932	D	0	-12.8343	10.9853	0.47518	0.0:0.0779:0.0:0.9221	.	621;365;621;691	Q6P0Q8-2;E7EWL1;E7ERL6;Q6P0Q8	.;.;.;MAST2_HUMAN	D	691;621;365;576	ENSP00000354671:Y691D;ENSP00000361079:Y621D;ENSP00000361078:Y576D	ENSP00000354671:Y691D	Y	+	1	0	MAST2	46267045	1.000000	0.71417	0.996000	0.52242	0.918000	0.54935	6.212000	0.72188	1.920000	0.55613	0.459000	0.35465	TAC	MAST2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000086015		0.617	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST2	HGNC	protein_coding	OTTHUMT00000021977.1	-	0.00	51	0	T	NM_015112		46494458	+1	tier1	-	no_errors	ENST00000361297	ensembl	human	known	74_37	missense	13.64	38	6	SNP	1.000	G
MBIP	51562	genome.wustl.edu	37	14	36770037	36770037	+	Intron	DEL	A	A	-	rs79987603		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr14:36770037delA	ENST00000416007.4	-	8	976				MBIP_ENST00000318473.7_Intron|MBIP_ENST00000359527.7_Intron	NM_001144891.1|NM_016586.2	NP_001138363.1|NP_057670.2	Q9NS73	MBIP1_HUMAN	MAP3K12 binding inhibitory protein 1						chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|inactivation of MAPK activity involved in osmosensory signaling pathway (GO:0000173)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|protein kinase inhibitor activity (GO:0004860)			breast(2)|large_intestine(1)|lung(5)	8	all_cancers(3;1.55e-52)|all_epithelial(1;2.69e-62)|Breast(36;0.0505)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.28e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.0303)|all cancers(34;0.0781)	GBM - Glioblastoma multiforme(112;0.0191)		GCTCTAGATTAAAAAAAAAAA	0.279																																																	0									,	80,359,3749		2,0,76,2,355,1659	22.0	24.0	23.0		,	-4.8	0.0	14	dbSNP_131	25	127,760,7263		1,4,121,6,744,3199	no	intron,intron	MBIP	NM_016586.2,NM_001144891.1	,	3,4,197,8,1099,4858	A1A1,A1A2,A1R,A2A2,A2R,RR		10.8834,10.4823,10.7473	,	,	36770037	207,1119,11012	2175	4261	6436	SO:0001627	intron_variant	0			BC016821	CCDS9658.1, CCDS45096.1	14q13.2	2005-01-10			ENSG00000151332	ENSG00000151332			20427	protein-coding gene	gene with protein product		609431				10801814	Standard	NM_016586		Approved		uc001wtm.2	Q9NS73	OTTHUMG00000140222	ENST00000416007.4:c.889-8T>-	14.37:g.36770037delA			Q86TZ2|Q96AS5|Q9BS93|Q9NZE1	RNA	DEL	-	NULL	ENST00000416007.4	37	NULL	CCDS9658.1	14																																																																																			MBIP	-	-	ENSG00000151332		0.279	MBIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MBIP	HGNC	protein_coding	OTTHUMT00000276685.2		0.00	49	0	A	NM_016586		36770037	-1	tier1		no_errors	ENST00000604154	ensembl	human	putative	74_37	rna	16.18	57	11	DEL	0.241	-
MBIP	51562	genome.wustl.edu	37	14	36777397	36777397	+	Splice_Site	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr14:36777397T>A	ENST00000416007.4	-	7	878		c.e7-2		MBIP_ENST00000318473.7_Splice_Site|MBIP_ENST00000359527.7_Intron	NM_001144891.1|NM_016586.2	NP_001138363.1|NP_057670.2	Q9NS73	MBIP1_HUMAN	MAP3K12 binding inhibitory protein 1						chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|inactivation of MAPK activity involved in osmosensory signaling pathway (GO:0000173)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|protein kinase inhibitor activity (GO:0004860)			breast(2)|large_intestine(1)|lung(5)	8	all_cancers(3;1.55e-52)|all_epithelial(1;2.69e-62)|Breast(36;0.0505)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.28e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.0303)|all cancers(34;0.0781)	GBM - Glioblastoma multiforme(112;0.0191)		CTGGACCACCTAAATACATTA	0.303																																																	0													51.0	55.0	54.0					14																	36777397		2199	4291	6490	SO:0001630	splice_region_variant	0			BC016821	CCDS9658.1, CCDS45096.1	14q13.2	2005-01-10			ENSG00000151332	ENSG00000151332			20427	protein-coding gene	gene with protein product		609431				10801814	Standard	NM_016586		Approved		uc001wtm.2	Q9NS73	OTTHUMG00000140222	ENST00000416007.4:c.791-2A>T	14.37:g.36777397T>A			Q86TZ2|Q96AS5|Q9BS93|Q9NZE1	Splice_Site	SNP	-	e7-2	ENST00000416007.4	37	c.791-2	CCDS9658.1	14	.	.	.	.	.	.	.	.	.	.	T	19.40	3.820550	0.71028	.	.	ENSG00000151332	ENST00000416007;ENST00000318473;ENST00000553977;ENST00000396329	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3299	0.74200	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MBIP	35847148	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.014000	0.76380	2.076000	0.62316	0.254000	0.18369	.	MBIP	-	-	ENSG00000151332		0.303	MBIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MBIP	HGNC	protein_coding	OTTHUMT00000276685.2	-	0.00	41	0	T	NM_016586	Intron	36777397	-1	tier1	-	no_errors	ENST00000416007	ensembl	human	known	74_37	splice_site	28.57	20	8	SNP	1.000	A
MC4R	4160	genome.wustl.edu	37	18	58038875	58038875	+	Silent	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr18:58038875G>T	ENST00000299766.3	-	1	1126	c.708C>A	c.(706-708)cgC>cgA	p.R236R		NM_005912.2	NP_005903.2	P32245	MC4R_HUMAN	melanocortin 4 receptor	236					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|diet induced thermogenesis (GO:0002024)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|insulin secretion (GO:0030073)|negative regulation of feeding behavior (GO:2000252)|positive regulation of bone resorption (GO:0045780)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of grooming behavior (GO:2000821)|response to insulin (GO:0032868)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)|ubiquitin protein ligase binding (GO:0031625)	p.R236R(1)		endometrium(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(73;0.0946)				TGGCACCTTGGCGGATGGCAC	0.517																																																	1	Substitution - coding silent(1)	large_intestine(1)											71.0	66.0	68.0					18																	58038875		2203	4300	6503	SO:0001819	synonymous_variant	0			AY236539	CCDS11976.1	18q22	2012-08-10			ENSG00000166603	ENSG00000166603		"""GPCR / Class A : Melanocortin receptors"""	6932	protein-coding gene	gene with protein product		155541				7949735, 9763669	Standard	NM_005912		Approved		uc002lie.1	P32245	OTTHUMG00000132766	ENST00000299766.3:c.708C>A	18.37:g.58038875G>T			B2RAC3|Q16317|Q3MIJ6	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Melcrt_ACTH_rcpt,prints_Mcort_rcpt_4,prints_GPCR_Rhodpsn,prints_Melancort_rcpt,prints_Cnbnoid_rcpt	p.R236	ENST00000299766.3	37	c.708	CCDS11976.1	18																																																																																			MC4R	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Mcort_rcpt_4	ENSG00000166603		0.517	MC4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC4R	HGNC	protein_coding	OTTHUMT00000256139.1		0.00	22	0	G	NM_005912		58038875	-1			no_errors	ENST00000299766	ensembl	human	known	74_37	silent	7.14	26	2	SNP	0.998	T
MDGA1	266727	genome.wustl.edu	37	6	37613816	37613816	+	Intron	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:37613816G>T	ENST00000434837.3	-	12	3403				MDGA1_ENST00000297153.7_Missense_Mutation_p.T750N|MDGA1_ENST00000510077.1_5'Flank|MDGA1_ENST00000505425.1_Intron	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1						brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						AGAGGACAGGGTCCTCAGAGC	0.582																																																	0													37.0	41.0	40.0					6																	37613816		692	1591	2283	SO:0001627	intron_variant	0			AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.2225-84C>A	6.37:g.37613816G>T			A6NHG0|Q8NBE3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Ig-like_dom	p.T750N	ENST00000434837.3	37	c.2249	CCDS47417.1	6	.	.	.	.	.	.	.	.	.	.	G	8.396	0.840737	0.16891	.	.	ENSG00000112139	ENST00000297153	T	0.52057	0.68	5.7	-4.16	0.03869	.	.	.	.	.	T	0.06416	0.0165	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28038	-1.0056	6	0.13108	T	0.6	.	2.8607	0.05586	0.4914:0.1184:0.2695:0.1207	.	.	.	.	N	750	ENSP00000297153:T750N	ENSP00000297153:T750N	T	-	2	0	MDGA1	37721794	0.001000	0.12720	0.002000	0.10522	0.922000	0.55478	0.159000	0.16442	-0.510000	0.06523	-0.136000	0.14681	ACC	MDGA1	-	NULL	ENSG00000112139		0.582	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDGA1	HGNC	protein_coding	OTTHUMT00000040419.3	-	0.00	37	0	G			37613816	-1	tier1	-	no_errors	ENST00000297153	ensembl	human	known	74_37	missense	14.43	82	14	SNP	0.000	T
MDH1B	130752	genome.wustl.edu	37	2	207619816	207619816	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:207619816G>T	ENST00000374412.3	-	5	1102	c.827C>A	c.(826-828)gCa>gAa	p.A276E	MDH1B_ENST00000392214.2_Intron|MDH1B_ENST00000449792.1_Missense_Mutation_p.A178E|MDH1B_ENST00000454776.2_Missense_Mutation_p.A276E	NM_001039845.1|NM_001282940.1	NP_001034934.1|NP_001269869.1	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	276					carbohydrate metabolic process (GO:0005975)|malate metabolic process (GO:0006108)|tricarboxylic acid cycle (GO:0006099)		malate dehydrogenase activity (GO:0016615)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(14)|ovary(4)|stomach(1)	34				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)		AATGTTGTGTGCAATGCGTGG	0.468																																					Pancreas(76;29 1355 28675 37177 51207)												0													116.0	103.0	107.0					2																	207619816		2203	4300	6503	SO:0001583	missense	0				CCDS33365.1, CCDS63102.1	2q33.3	2008-05-27			ENSG00000138400	ENSG00000138400			17836	protein-coding gene	gene with protein product							Standard	NM_001039845		Approved	FLJ25341, RP11-95H11	uc002vbs.3	Q5I0G3	OTTHUMG00000132918	ENST00000374412.3:c.827C>A	2.37:g.207619816G>T	ENSP00000363533:p.Ala276Glu		A8K8M1|Q53TK9|Q8IV51	Missense_Mutation	SNP	pfam_Lactate/malate_DH_C,superfamily_Lactate_DH/Glyco_Ohase_4_C	p.A276E	ENST00000374412.3	37	c.827	CCDS33365.1	2	.	.	.	.	.	.	.	.	.	.	G	11.76	1.734926	0.30774	.	.	ENSG00000138400	ENST00000374412;ENST00000449792;ENST00000454776	T;T;T	0.09163	3.01;3.01;3.01	5.49	2.54	0.30619	NAD(P)-binding domain (1);	0.696038	0.15179	N	0.276219	T	0.14356	0.0347	M	0.63428	1.95	0.21256	N	0.999747	B;B	0.30851	0.297;0.197	B;B	0.36186	0.219;0.109	T	0.15350	-1.0440	10	0.72032	D	0.01	-3.7898	8.4576	0.32908	0.1402:0.1277:0.7322:0.0	.	276;276	Q5I0G3-2;Q5I0G3	.;MDH1B_HUMAN	E	276;178;276	ENSP00000363533:A276E;ENSP00000416577:A178E;ENSP00000389916:A276E	ENSP00000363533:A276E	A	-	2	0	MDH1B	207328061	0.993000	0.37304	0.002000	0.10522	0.002000	0.02628	3.169000	0.50809	0.800000	0.34041	-0.136000	0.14681	GCA	MDH1B	-	NULL	ENSG00000138400		0.468	MDH1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDH1B	HGNC	protein_coding	OTTHUMT00000256429.2		0.00	31	0	G	NM_001039845		207619816	-1			no_errors	ENST00000374412	ensembl	human	known	74_37	missense	6.38	44	3	SNP	0.060	T
MEX3B	84206	genome.wustl.edu	37	15	82335721	82335721	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr15:82335721G>C	ENST00000329713.4	-	2	1925	c.1490C>G	c.(1489-1491)tCc>tGc	p.S497C	MEX3B_ENST00000558133.1_3'UTR|AC026956.1_ENST00000410589.1_RNA	NM_032246.4	NP_115622.2	Q6ZN04	MEX3B_HUMAN	mex-3 RNA binding family member B	497					protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)	19						ggaggagctggacgaagagga	0.667																																																	0													46.0	43.0	44.0					15																	82335721		2203	4300	6503	SO:0001583	missense	0			AK131424	CCDS10319.1	15q25.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000183496	ENSG00000183496		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	25297	protein-coding gene	gene with protein product		611008	"""ring finger and KH domain containing 3"", ""mex-3 homolog B (C. elegans)"""	RKHD3		11230166, 17267406	Standard	NM_032246		Approved	DKFZp434J0617, RNF195	uc002bgq.2	Q6ZN04	OTTHUMG00000147356	ENST00000329713.4:c.1490C>G	15.37:g.82335721G>C	ENSP00000329918:p.Ser497Cys		Q4G0W1|Q8IVG2|Q9H0J0	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,smart_Znf_RING,pfscan_Znf_RING,pfscan_KH_dom_type_1	p.S497C	ENST00000329713.4	37	c.1490	CCDS10319.1	15	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208847	0.58343	.	.	ENSG00000183496	ENST00000329713	T	0.26373	1.74	4.5	4.5	0.54988	.	0.172537	0.38605	N	0.001635	T	0.40222	0.1108	L	0.40543	1.245	0.80722	D	1	D	0.76494	0.999	D	0.64042	0.921	T	0.23691	-1.0181	10	0.56958	D	0.05	-13.6184	16.1323	0.81449	0.0:0.0:1.0:0.0	.	497	Q6ZN04	MEX3B_HUMAN	C	497	ENSP00000329918:S497C	ENSP00000329918:S497C	S	-	2	0	MEX3B	80122776	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	3.266000	0.51569	2.333000	0.79357	0.561000	0.74099	TCC	MEX3B	-	NULL	ENSG00000183496		0.667	MEX3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEX3B	HGNC	protein_coding	OTTHUMT00000304000.1	-	0.00	37	0	G	XM_290645		82335721	-1	tier1	-	no_errors	ENST00000329713	ensembl	human	known	74_37	missense	26.32	28	10	SNP	1.000	C
MEX3D	399664	genome.wustl.edu	37	19	1556852	1556852	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:1556852C>T	ENST00000402693.4	-	2	665	c.666G>A	c.(664-666)ccG>ccA	p.P222P	MEX3D_ENST00000388824.6_Silent_p.P222P|AC027307.2_ENST00000581992.1_RNA|AC027307.1_ENST00000410788.1_RNA	NM_203304.3	NP_976049.3	Q86XN8	MEX3D_HUMAN	mex-3 RNA binding family member D	222	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				mRNA destabilization (GO:0061157)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|lung(3)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGATGAAGACCGGCTCCTCGC	0.642																																																	0													33.0	35.0	34.0					19																	1556852		2200	4286	6486	SO:0001819	synonymous_variant	0			AB107353	CCDS32865.2	19p13.3	2013-08-21	2013-08-21	2007-07-18	ENSG00000181588	ENSG00000181588		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	16734	protein-coding gene	gene with protein product	"""bcl-2 ARE RNA binding protein"""	611009	"""ring finger and KH domain containing 1"", ""mex-3 homolog D (C. elegans)"""	RKHD1		17267406	Standard	NM_203304		Approved	Tino, KIAA2031, OK/SW-cl.4, RNF193	uc010dsn.3	Q86XN8	OTTHUMG00000150369	ENST00000402693.4:c.666G>A	19.37:g.1556852C>T			A0PJL8|A1L023|E9PAL6|Q71M49	Silent	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_Znf_RING,pfscan_KH_dom_type_1	p.P222	ENST00000402693.4	37	c.666	CCDS32865.2	19																																																																																			MEX3D	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000181588		0.642	MEX3D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MEX3D	HGNC	protein_coding	OTTHUMT00000317870.2		0.00	51	0	C	NM_203304		1556852	-1			no_errors	ENST00000388824	ensembl	human	known	74_37	silent	6.67	28	2	SNP	0.008	T
DDR1	780	genome.wustl.edu	37	6	30858733	30858733	+	Intron	SNP	T	T	C	rs573611837|rs544509367	byFrequency	TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:30858733T>C	ENST00000324771.8	+	7	965				DDR1_ENST00000376569.3_Intron|DDR1_ENST00000513240.1_Intron|DDR1_ENST00000452441.1_Intron|MIR4640_ENST00000581824.1_RNA|DDR1_ENST00000454612.2_Intron|DDR1_ENST00000508472.1_Intron|DDR1_ENST00000361741.4_5'Flank|DDR1_ENST00000376575.3_Intron|DDR1_ENST00000418800.2_Intron|DDR1_ENST00000376568.3_Intron|DDR1_ENST00000376570.4_Intron|DDR1_ENST00000446312.1_Intron|DDR1_ENST00000508312.1_Intron|DDR1_ENST00000376567.2_Intron			Q08345	DDR1_HUMAN	discoidin domain receptor tyrosine kinase 1						branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|ear development (GO:0043583)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine autophosphorylation (GO:0038083)|protein autophosphorylation (GO:0046777)|regulation of cell growth (GO:0001558)|regulation of cell-matrix adhesion (GO:0001952)|regulation of extracellular matrix disassembly (GO:0010715)|smooth muscle cell migration (GO:0014909)|smooth muscle cell-matrix adhesion (GO:0061302)|wound healing, spreading of cells (GO:0044319)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(1)|prostate(1)|skin(1)	29					Imatinib(DB00619)	ACCCACCCCCTGTTTCCTGGC	0.622																																																	0													37.0	39.0	38.0					6																	30858733		1508	2708	4216	SO:0001627	intron_variant	0			X99031	CCDS4690.1, CCDS34385.1, CCDS47396.1, CCDS56411.1, CCDS75419.1	6p21.33	2010-02-17	2008-01-23		ENSG00000204580	ENSG00000204580	2.7.10.1	"""CD molecules"""	2730	protein-coding gene	gene with protein product		600408	"""discoidin domain receptor family, member 1"""	NTRK4, PTK3A, NEP, CAK, EDDR1		7789998	Standard	NM_001954		Approved	RTK6, CD167	uc003nrv.3	Q08345	OTTHUMG00000031236	ENST00000324771.8:c.418-17T>C	6.37:g.30858733T>C			B5A975|B5A976|B7Z2K0|Q14196|Q16562|Q2L6H3|Q4LE50|Q5ST11|Q5ST12|Q6NSK4|Q9UD35|Q9UD36|Q9UD37|Q9UD86|Q9UDL2	RNA	SNP	-	NULL	ENST00000324771.8	37	NULL	CCDS34385.1	6																																																																																			MIR4640	-	-	ENSG00000264594		0.622	DDR1-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	MIR4640	HGNC	protein_coding	OTTHUMT00000076494.3		0.00	20	0	T	NM_013994		30858733	+1			no_errors	ENST00000581824	ensembl	human	known	74_37	rna	36.84	12	7	SNP	0.000	C
MIR509-1	574514	genome.wustl.edu	37	X	146341198	146341198	+	RNA	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:146341198A>G	ENST00000385265.1	-	0	94				MIR509-3_ENST00000390725.1_RNA|MIR509-2_ENST00000390724.1_RNA	NR_030236.1|NR_030586.1				microRNA 509-1																		AGACGTACCAATCATTTTTAA	0.463																																																	0													244.0	196.0	210.0					X																	146341198		1568	3582	5150			0					Xq27.3	2011-09-12	2007-10-23	2008-12-18	ENSG00000208000	ENSG00000208000		"""ncRNAs / Micro RNAs"""	32146	non-coding RNA	RNA, micro		300875	"""microRNA 509"""	MIRN509, MIRN509-1			Standard	NR_030236		Approved	hsa-mir-509, hsa-mir-509-1	uc022cfy.1				X.37:g.146341198A>G				RNA	SNP	-	NULL	ENST00000385265.1	37	NULL		X																																																																																			MIR509-3	-	-	ENSG00000212014		0.463	MIR509-1-201	KNOWN	basic	miRNA	MIR509-3	HGNC	miRNA		-	0.00	30	0	A	NR_030236		146341198	-1	tier1	-	no_errors	ENST00000390725	ensembl	human	known	74_37	rna	18.92	30	7	SNP	0.012	G
PCDH15	65217	genome.wustl.edu	37	10	56367692	56367692	+	Intron	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:56367692T>A	ENST00000320301.6	-	2	486				PCDH15_ENST00000395446.1_Intron|MIR548F1_ENST00000408667.1_RNA|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395432.2_Intron|PCDH15_ENST00000395445.1_Intron|RP11-257I14.1_ENST00000422842.1_RNA|PCDH15_ENST00000395430.1_Intron|PCDH15_ENST00000361849.3_Intron|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000437009.1_Intron|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395433.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373955.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15						equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				tgtcaaaaactgtgattactt	0.383										HNSCC(58;0.16)																																							0													57.0	54.0	55.0					10																	56367692		1568	3582	5150	SO:0001627	intron_variant	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.91+56239A>T	10.37:g.56367692T>A			A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	RNA	SNP	-	NULL	ENST00000320301.6	37	NULL	CCDS7248.1	10																																																																																			MIR548F1	-	-	ENSG00000221594		0.383	PCDH15-001	KNOWN	basic|CCDS	protein_coding	MIR548F1	HGNC	protein_coding	OTTHUMT00000048121.2	-	0.00	40	0	T	NM_033056		56367692	-1	tier1	-	no_errors	ENST00000408667	ensembl	human	known	74_37	rna	25.58	32	11	SNP	0.018	A
MLLT4	4301	genome.wustl.edu	37	6	168227147	168227147	+	5'Flank	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:168227147A>G	ENST00000447894.2	+	0	0				MLLT4_ENST00000400822.3_5'Flank|MLLT4-AS1_ENST00000359760.5_RNA|MLLT4_ENST00000392112.1_5'Flank|MLLT4_ENST00000351017.4_5'Flank|MLLT4_ENST00000344191.4_5'Flank|MLLT4_ENST00000366806.2_5'Flank|MLLT4_ENST00000392108.3_5'Flank			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4						adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		TAGACCTAGCACCGCCCGTCC	0.677			T	MLL	AL																																			Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	0													68.0	86.0	80.0					6																	168227147		2064	4186	6250	SO:0001631	upstream_gene_variant	0			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031		6.37:g.168227147A>G	Exception_encountered		O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	RNA	SNP	-	NULL	ENST00000447894.2	37	NULL		6																																																																																			MLLT4-AS1	-	-	ENSG00000198221		0.677	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	MLLT4-AS1	HGNC	protein_coding	OTTHUMT00000372077.1	-	0.00	213	0	A	NM_005936		168227147	-1	tier1	-	no_errors	ENST00000359760	ensembl	human	known	74_37	rna	8.54	252	24	SNP	0.482	G
MMD	23531	genome.wustl.edu	37	17	53488754	53488754	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:53488754C>G	ENST00000262065.3	-	3	429	c.133G>C	c.(133-135)Ggc>Cgc	p.G45R		NM_012329.2	NP_036461.2	Q15546	PAQRB_HUMAN	monocyte to macrophage differentiation-associated	45					cytolysis (GO:0019835)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|large_intestine(1)|lung(4)|prostate(1)	7						AGGGCACTGCCCACGATGGCC	0.443																																																	0													69.0	63.0	65.0					17																	53488754		2203	4300	6503	SO:0001583	missense	0			X85750	CCDS11586.1	17q	2008-05-02				ENSG00000108960			7153	protein-coding gene	gene with protein product		604467				7503749, 16044242	Standard	NM_012329		Approved	MMA, PAQR11	uc002iui.3	Q15546		ENST00000262065.3:c.133G>C	17.37:g.53488754C>G	ENSP00000262065:p.Gly45Arg		B2R6X9|D3DTY6|Q8TAN7	Missense_Mutation	SNP	pfam_HlyIII-related,tigrfam_HylIII	p.G45R	ENST00000262065.3	37	c.133	CCDS11586.1	17	.	.	.	.	.	.	.	.	.	.	C	29.7	5.026233	0.93518	.	.	ENSG00000108960	ENST00000262065	T	0.31247	1.5	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.65460	0.2693	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72083	-0.4397	10	0.87932	D	0	-16.9843	18.8899	0.92395	0.0:1.0:0.0:0.0	.	45	Q15546	PAQRB_HUMAN	R	45	ENSP00000262065:G45R	ENSP00000262065:G45R	G	-	1	0	MMD	50843753	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.480000	0.81109	2.707000	0.92482	0.561000	0.74099	GGC	MMD	-	pfam_HlyIII-related,tigrfam_HylIII	ENSG00000108960		0.443	MMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMD	HGNC	protein_coding	OTTHUMT00000439214.1		0.00	36	0	C			53488754	-1			no_errors	ENST00000262065	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	G
MOV10	4343	genome.wustl.edu	37	1	113231692	113231692	+	Silent	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:113231692G>A	ENST00000413052.2	+	3	663	c.273G>A	c.(271-273)agG>agA	p.R91R	MOV10_ENST00000369644.1_Silent_p.R35R|MOV10_ENST00000468624.1_3'UTR|MOV10_ENST00000369645.1_Silent_p.R91R|MOV10_ENST00000357443.2_Silent_p.R91R	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	91					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		CAGAAAAGAGGAGAATGAAGC	0.502																																																	0													95.0	92.0	93.0					1																	113231692		2203	4300	6503	SO:0001819	synonymous_variant	0			AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.273G>A	1.37:g.113231692G>A			Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Silent	SNP	superfamily_P-loop_NTPase	p.R91	ENST00000413052.2	37	c.273	CCDS853.1	1																																																																																			MOV10	-	NULL	ENSG00000155363		0.502	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOV10	HGNC	protein_coding	OTTHUMT00000032906.1	-	0.00	61	0	G	NM_020963		113231692	+1	tier1	-	no_errors	ENST00000357443	ensembl	human	known	74_37	silent	17.50	33	7	SNP	0.991	A
MNDA	4332	genome.wustl.edu	37	1	158815416	158815416	+	Silent	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:158815416A>C	ENST00000368141.4	+	5	871	c.610A>C	c.(610-612)Aga>Cga	p.R204R		NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	204	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					GGATGCAAGAAGAAATGTTCC	0.488																																																	0													60.0	59.0	60.0					1																	158815416		2203	4300	6503	SO:0001819	synonymous_variant	0			BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.610A>C	1.37:g.158815416A>C				Silent	SNP	pfam_HIN200/IF120x,pfam_DAPIN,pfscan_DAPIN,pfscan_HIN200/IF120x	p.R204	ENST00000368141.4	37	c.610	CCDS1177.1	1																																																																																			MNDA	-	pfscan_HIN200/IF120x	ENSG00000163563		0.488	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MNDA	HGNC	protein_coding	OTTHUMT00000059069.1	-	0.00	40	0	A	NM_002432		158815416	+1	tier1	-	no_errors	ENST00000368141	ensembl	human	known	74_37	silent	36.54	33	19	SNP	0.000	C
MROH2B	133558	genome.wustl.edu	37	5	40999877	40999877	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:40999877T>G	ENST00000399564.4	-	40	4937	c.4487A>C	c.(4486-4488)aAg>aCg	p.K1496T	MROH2B_ENST00000506092.2_Missense_Mutation_p.K1051T	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1496																	CTGGTTTTTCTTGGCCTAGAA	0.473																																																	0													172.0	173.0	173.0					5																	40999877		1875	4112	5987	SO:0001583	missense	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.4487A>C	5.37:g.40999877T>G	ENSP00000382476:p.Lys1496Thr		Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.K1496T	ENST00000399564.4	37	c.4487	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	T	17.80	3.477794	0.63849	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.66099	-0.19;-0.19	4.95	2.54	0.30619	Armadillo-like helical (1);Armadillo-type fold (1);	0.120229	0.37715	N	0.001978	T	0.62282	0.2415	L	0.51422	1.61	0.34651	D	0.721696	D	0.60575	0.988	P	0.58721	0.844	T	0.64605	-0.6368	10	0.15499	T	0.54	.	6.5398	0.22375	0.0:0.1912:0.0:0.8088	.	1496	Q7Z745	HTRB2_HUMAN	T	1051;1201;1496	ENSP00000441504:K1051T;ENSP00000382476:K1496T	ENSP00000296803:K1201T	K	-	2	0	HEATR7B2	41035634	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	1.495000	0.35627	0.366000	0.24427	0.533000	0.62120	AAG	MROH2B	-	superfamily_ARM-type_fold	ENSG00000171495		0.473	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH2B	HGNC	protein_coding	OTTHUMT00000367558.2	-	0.00	47	0	T	NM_173489		40999877	-1	tier1	-	no_errors	ENST00000399564	ensembl	human	known	74_37	missense	19.30	46	11	SNP	1.000	G
MROH9	80133	genome.wustl.edu	37	1	170928680	170928680	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:170928680C>A	ENST00000367758.3	+	5	329	c.230C>A	c.(229-231)cCa>cAa	p.P77Q	MROH9_ENST00000367759.4_Missense_Mutation_p.P77Q	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	77																	GTTGTCATGCCAAGTCTTGAC	0.358																																																	0													121.0	114.0	116.0					1																	170928680		1851	4108	5959	SO:0001583	missense	0			AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.230C>A	1.37:g.170928680C>A	ENSP00000356732:p.Pro77Gln		A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.P77Q	ENST00000367758.3	37	c.230	CCDS41436.1	1	.	.	.	.	.	.	.	.	.	.	C	19.16	3.773358	0.69992	.	.	ENSG00000117501	ENST00000367759;ENST00000367758	T;T	0.70749	0.73;-0.51	5.61	5.61	0.85477	.	0.000000	0.56097	D	0.000024	T	0.77961	0.4209	M	0.67953	2.075	0.23751	N	0.996949	D;D	0.89917	1.0;1.0	D;D	0.75484	0.986;0.986	T	0.72527	-0.4266	10	0.87932	D	0	-11.3744	15.4923	0.75619	0.0:1.0:0.0:0.0	.	77;77	F5GWX6;Q5TGP6	.;CA129_HUMAN	Q	77	ENSP00000356733:P77Q;ENSP00000356732:P77Q	ENSP00000356732:P77Q	P	+	2	0	C1orf129	169195304	0.257000	0.24022	0.296000	0.24974	0.170000	0.22686	3.389000	0.52516	2.793000	0.96121	0.655000	0.94253	CCA	MROH9	-	NULL	ENSG00000117501		0.358	MROH9-001	KNOWN	basic|CCDS	protein_coding	MROH9	HGNC	protein_coding	OTTHUMT00000099327.1	-	0.00	32	0	C	NM_025063		170928680	+1	tier1	-	no_errors	ENST00000367759	ensembl	human	known	74_37	missense	17.46	52	11	SNP	0.378	A
MS4A14	84689	genome.wustl.edu	37	11	60170472	60170472	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:60170472G>C	ENST00000300187.6	+	4	683	c.406G>C	c.(406-408)Gac>Cac	p.D136H	MS4A14_ENST00000395005.2_Missense_Mutation_p.D119H|MS4A14_ENST00000531783.1_Missense_Mutation_p.D136H|MS4A14_ENST00000531787.1_Missense_Mutation_p.D24H|MS4A14_ENST00000395001.1_Missense_Mutation_p.D24H	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	136						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						CAGACATCAAGACAAGTACTG	0.398																																																	0													261.0	233.0	243.0					11																	60170472		2203	4300	6503	SO:0001583	missense	0			AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.406G>C	11.37:g.60170472G>C	ENSP00000300187:p.Asp136His		E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	pfam_CD20-like	p.D136H	ENST00000300187.6	37	c.406	CCDS31569.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.017|0.017	-1.496511|-1.496511	0.01001|0.01001	.|.	.|.	ENSG00000166928|ENSG00000166928	ENST00000531787;ENST00000300187;ENST00000395005;ENST00000526375;ENST00000531783;ENST00000395001|ENST00000534688	T;T;T;T;T;T|.	0.29142|.	4.37;4.37;4.37;1.58;4.37;4.37|.	4.77|4.77	-1.8|-1.8	0.07907|0.07907	.|.	.|.	.|.	.|.	.|.	T|T	0.09158|0.09158	0.0226|0.0226	N|N	0.02315|0.02315	-0.6|-0.6	0.09310|0.09310	N|N	1|1	B;B|.	0.09022|.	0.002;0.002|.	B;B|.	0.06405|.	0.001;0.002|.	T|T	0.33548|0.33548	-0.9864|-0.9864	9|5	0.02654|.	T|.	1|.	-4.7941|-4.7941	5.2324|5.2324	0.15430|0.15430	0.0:0.3334:0.1641:0.5025|0.0:0.3334:0.1641:0.5025	.|.	119;136|.	Q96JA4-2;Q96JA4|.	.;M4A14_HUMAN|.	H|N	24;136;119;119;136;24|94	ENSP00000437222:D24H;ENSP00000300187:D136H;ENSP00000378453:D119H;ENSP00000435764:D119H;ENSP00000433761:D136H;ENSP00000378449:D24H|.	ENSP00000300187:D136H|.	D|K	+|+	1|3	0|2	MS4A14|MS4A14	59927048|59927048	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.005000|0.005000	0.04900|0.04900	-0.285000|-0.285000	0.08410|0.08410	-0.203000|-0.203000	0.10251|0.10251	-0.995000|-0.995000	0.02519|0.02519	GAC|AAG	MS4A14	-	pfam_CD20-like	ENSG00000166928		0.398	MS4A14-002	KNOWN	basic|CCDS	protein_coding	MS4A14	HGNC	protein_coding	OTTHUMT00000395383.2	-	0.00	55	0	G			60170472	+1	tier1	-	no_errors	ENST00000300187	ensembl	human	known	74_37	missense	15.73	75	14	SNP	0.000	C
MSC	9242	genome.wustl.edu	37	8	72754825	72754825	+	3'UTR	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:72754825C>T	ENST00000325509.4	-	0	981				RP11-383H13.1_ENST00000524152.1_5'Flank|RP11-383H13.1_ENST00000521467.1_Intron|RP11-383H13.1_ENST00000537896.1_5'Flank|MSC_ENST00000518440.1_5'UTR	NM_005098.3	NP_005089.2	O60682	MUSC_HUMAN	musculin						branchiomeric skeletal muscle development (GO:0014707)|diaphragm development (GO:0060539)|palate development (GO:0060021)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(4)|skin(2)	26	Breast(64;0.176)		Epithelial(68;0.137)|BRCA - Breast invasive adenocarcinoma(89;0.203)			CTCACGAGCTCTCCCTTCTCT	0.537																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS43746.1	8q13.3	2013-06-07	2010-04-28		ENSG00000178860	ENSG00000178860		"""Basic helix-loop-helix proteins"""	7321	protein-coding gene	gene with protein product	"""activated B-cell factor-1"""	603628	"""musculin (activated B-cell factor-1)"""			9584154, 10198176	Standard	NM_005098		Approved	ABF-1, bHLHa22	uc003xyx.1	O60682	OTTHUMG00000164489	ENST00000325509.4:c.*71G>A	8.37:g.72754825C>T			O75946|Q53XZ2|Q9BRE7	RNA	SNP	-	NULL	ENST00000325509.4	37	NULL	CCDS43746.1	8																																																																																			MSC	-	-	ENSG00000178860		0.537	MSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSC	HGNC	protein_coding	OTTHUMT00000378974.1	-	0.00	34	0	C	NM_005098		72754825	-1	tier1	-	no_errors	ENST00000518440	ensembl	human	putative	74_37	rna	26.47	25	9	SNP	0.582	T
APEH	327	genome.wustl.edu	37	3	49721800	49721800	+	IGR	SNP	G	G	A	rs201444451		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:49721800G>A	ENST00000296456.5	+	0	3220				MST1_ENST00000494828.2_5'Flank|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000449682.2_Missense_Mutation_p.R655W	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TCACTCTCCCGCACACGTCCT	0.597																																																	0													56.0	59.0	58.0					3																	49721800		2203	4300	6503	SO:0001628	intergenic_variant	0			D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49721800G>A			Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	pfam_Kringle,pfam_Peptidase_S1,pfam_PAN-1_domain,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R655W	ENST00000296456.5	37	c.1963	CCDS2801.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.77|16.77	3.214937|3.214937	0.58452|0.58452	.|.	.|.	ENSG00000173531|ENSG00000173531	ENST00000448220|ENST00000449682	.|D	.|0.89050	.|-2.46	5.59|5.59	2.28|2.28	0.28536|0.28536	.|.	.|1.156200	.|0.06730	.|N	.|0.776513	D|D	0.89128|0.89128	0.6627|0.6627	L|L	0.55990|0.55990	1.75|1.75	0.09310|0.09310	N|N	0.999996|0.999996	.|D	.|0.67145	.|0.996	.|P	.|0.49361	.|0.608	T|T	0.77213|0.77213	-0.2670|-0.2670	5|10	.|0.66056	.|D	.|0.02	.|.	9.1102|9.1102	0.36723|0.36723	0.077:0.0:0.4359:0.4871|0.077:0.0:0.4359:0.4871	.|.	.|655	.|G3XAK1	.|.	V|W	124|655	.|ENSP00000414287:R655W	.|ENSP00000414287:R655W	A|R	-|-	2|1	0|2	MST1|MST1	49696804|49696804	0.001000|0.001000	0.12720|0.12720	0.001000|0.001000	0.08648|0.08648	0.944000|0.944000	0.59088|0.59088	0.994000|0.994000	0.29693|0.29693	0.620000|0.620000	0.30215|0.30215	0.655000|0.655000	0.94253|0.94253	GCG|CGG	MST1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000173531		0.597	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MST1	HGNC	protein_coding	OTTHUMT00000346415.2		0.00	43	0	G			49721800	-1			no_errors	ENST00000449682	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.000	A
MT-ND5	4540	genome.wustl.edu	37	M	12488	12488	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrM:12488C>T	ENST00000361567.2	+	1	152	c.152C>T	c.(151-153)aCa>aTa	p.T51I	MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	51					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TCTCTTCCCCACAACAATATT	0.428																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.152C>T	M.37:g.12488C>T	ENSP00000354813:p.Thr51Ile		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.T51M	ENST00000361567.2	37	c.152		MT																																																																																			MT-ND5	-	tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.428	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	34	0	C	YP_003024036		12488	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	50.00	3	3	SNP	NULL	T
MX2	4600	genome.wustl.edu	37	21	42748941	42748941	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr21:42748941C>T	ENST00000330714.3	+	2	292	c.108C>T	c.(106-108)ttC>ttT	p.F36F	MX2_ENST00000543692.1_Silent_p.F36F	NM_002463.1	NP_002454.1	P20592	MX2_HUMAN	MX dynamin-like GTPase 2	36					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|GTP catabolic process (GO:0006184)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of nucleocytoplasmic transport (GO:0046822)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.F36F(1)		breast(2)|endometrium(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	34		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				CACCGCCATTCGGCACAGTGC	0.498																																																	1	Substitution - coding silent(1)	large_intestine(1)											79.0	84.0	82.0					21																	42748941		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13672.1	21q22.3	2014-07-15	2014-07-15		ENSG00000183486	ENSG00000183486			7533	protein-coding gene	gene with protein product	"""interferon-regulated resistance GTP-binding protein MXB"", ""second interferon-induced protein p78"""	147890	"""myxovirus (influenza) resistance 2, homolog of murine"", ""myxovirus (influenza virus) resistance 2 (mouse)"""			2481229, 8798556	Standard	NM_002463		Approved	MXB	uc002yzf.1	P20592	OTTHUMG00000086753	ENST00000330714.3:c.108C>T	21.37:g.42748941C>T			B7Z5D3|D3DSI7	Silent	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,superfamily_P-loop_NTPase,superfamily_CH-domain,smart_Dynamin_GTPase,smart_GED,prints_Dynamin_SF	p.F36	ENST00000330714.3	37	c.108	CCDS13672.1	21																																																																																			MX2	-	NULL	ENSG00000183486		0.498	MX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MX2	HGNC	protein_coding	OTTHUMT00000195147.1	-	0.00	31	0	C	NM_002463		42748941	+1	tier1	-	no_errors	ENST00000330714	ensembl	human	known	74_37	silent	42.42	19	14	SNP	0.000	T
MZF1	7593	genome.wustl.edu	37	19	59081731	59081731	+	Nonsense_Mutation	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:59081731G>C	ENST00000215057.2	-	3	1120	c.560C>G	c.(559-561)tCa>tGa	p.S187*	MZF1_ENST00000594234.1_Nonsense_Mutation_p.S187*|MZF1_ENST00000599369.1_Nonsense_Mutation_p.S187*|MZF1_ENST00000594108.1_Nonsense_Mutation_p.S187*|AC016629.8_ENST00000593642.1_RNA|AC016629.8_ENST00000600726.1_RNA|AC016629.8_ENST00000600534.1_RNA	NM_001267033.1|NM_198055.1	NP_001253962.1|NP_932172.1	P28698	MZF1_HUMAN	myeloid zinc finger 1	187					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)		TGTAACCTCTGACTCCTCTTT	0.602																																																	0													145.0	137.0	139.0					19																	59081731		2203	4300	6503	SO:0001587	stop_gained	0			M58297	CCDS12988.1, CCDS59427.1	19q13.43	2014-08-22	2006-06-15	2006-06-15	ENSG00000099326	ENSG00000099326		"""-"", ""Zinc fingers, C2H2-type"""	13108	protein-coding gene	gene with protein product		194550	"""zinc finger protein 42 (myeloid-specific retinoic acid-responsive)"""	ZNF42		1860835	Standard	NM_198055		Approved	ZSCAN6, MZF1B, MZF-1, Zfp98	uc002qtn.3	P28698	OTTHUMG00000183550	ENST00000215057.2:c.560C>G	19.37:g.59081731G>C	ENSP00000215057:p.Ser187*		M0QXU0|Q7Z729|Q96I71|Q9NRY0|Q9UBW2	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.S187*	ENST00000215057.2	37	c.560	CCDS12988.1	19	.	.	.	.	.	.	.	.	.	.	.	39	7.818760	0.98507	.	.	ENSG00000099326	ENST00000215057	.	.	.	4.78	3.7	0.42460	.	0.408897	0.18101	N	0.151686	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-2.4814	10.2359	0.43284	0.0:0.0:0.8022:0.1978	.	.	.	.	X	187	.	.	S	-	2	0	MZF1	63773543	0.000000	0.05858	0.132000	0.22025	0.590000	0.36582	-0.268000	0.08607	1.302000	0.44855	0.655000	0.94253	TCA	MZF1	-	NULL	ENSG00000099326		0.602	MZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MZF1	HGNC	protein_coding	OTTHUMT00000467112.1	-	0.00	37	0	G	NM_198055		59081731	-1	tier1	-	no_errors	ENST00000215057	ensembl	human	known	74_37	nonsense	8.20	55	5	SNP	0.285	C
NALCN	259232	genome.wustl.edu	37	13	101762982	101762982	+	Silent	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr13:101762982A>C	ENST00000251127.6	-	20	2433	c.2352T>G	c.(2350-2352)acT>acG	p.T784T		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	784					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CTTGAGTCAAAGTTTCAAGAG	0.373																																																	0													166.0	152.0	157.0					13																	101762982		2203	4300	6503	SO:0001819	synonymous_variant	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.2352T>G	13.37:g.101762982A>C			Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Silent	SNP	pfam_Ion_trans_dom	p.T784	ENST00000251127.6	37	c.2352	CCDS9498.1	13																																																																																			NALCN	-	NULL	ENSG00000102452		0.373	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	-	0.00	39	0	A	NM_052867		101762982	-1	tier1	-	no_errors	ENST00000251127	ensembl	human	known	74_37	silent	15.79	32	6	SNP	0.795	C
NAV3	89795	genome.wustl.edu	37	12	78392127	78392127	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:78392127C>A	ENST00000397909.2	+	7	924	c.751C>A	c.(751-753)Ccc>Acc	p.P251T	NAV3_ENST00000228327.6_Missense_Mutation_p.P251T|NAV3_ENST00000266692.7_Missense_Mutation_p.P251T|NAV3_ENST00000536525.2_Missense_Mutation_p.P251T			Q8IVL0	NAV3_HUMAN	neuron navigator 3	251						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GCTTCCAGGGCCCTCTAGGGT	0.413										HNSCC(70;0.22)																																							0													39.0	36.0	37.0					12																	78392127		1816	4078	5894	SO:0001583	missense	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.751C>A	12.37:g.78392127C>A	ENSP00000381007:p.Pro251Thr		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.P251T	ENST00000397909.2	37	c.751		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.74|17.74	3.463539|3.463539	0.63513|0.63513	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000550503|ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	.|T;T;T;T;T	.|0.41065	.|1.01;1.01;1.01;1.01;1.01	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	.|0.000000	.|0.40064	.|U	.|0.001195	T|T	0.62974|0.62974	0.2472|0.2472	L|L	0.55213|0.55213	1.73|1.73	0.80722|0.80722	D|D	1|1	.|B;D	.|0.89917	.|0.1;1.0	.|B;D	.|0.87578	.|0.033;0.998	T|T	0.64158|0.64158	-0.6473|-0.6473	5|10	.|0.87932	.|D	.|0	-10.6037|-10.6037	19.5543|19.5543	0.95335|0.95335	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|251;251	.|Q8IVL0;Q8IVL0-2	.|NAV3_HUMAN;.	D|T	74|251	.|ENSP00000446628:P251T;ENSP00000446132:P251T;ENSP00000381007:P251T;ENSP00000228327:P251T;ENSP00000266692:P251T	.|ENSP00000228327:P251T	A|P	+|+	2|1	0|0	NAV3|NAV3	76916258|76916258	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.293000|7.293000	0.78740|0.78740	2.617000|2.617000	0.88574|0.88574	0.655000|0.655000	0.94253|0.94253	GCC|CCC	NAV3	-	NULL	ENSG00000067798		0.413	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	-	0.00	27	0	C	NM_001024383		78392127	+1	tier1	-	no_errors	ENST00000397909	ensembl	human	known	74_37	missense	20.00	20	5	SNP	1.000	A
NBEA	26960	genome.wustl.edu	37	13	35756623	35756623	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr13:35756623G>T	ENST00000400445.3	+	29	5323	c.4789G>T	c.(4789-4791)Ggt>Tgt	p.G1597C	NBEA_ENST00000540320.1_Missense_Mutation_p.G1597C|NBEA_ENST00000379939.2_Missense_Mutation_p.G1594C|NBEA_ENST00000310336.4_Missense_Mutation_p.G1597C	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1597					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AAGCCAACCAGGTAGAAACAT	0.373																																																	0													121.0	112.0	115.0					13																	35756623		1838	4084	5922	SO:0001583	missense	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.4789G>T	13.37:g.35756623G>T	ENSP00000383295:p.Gly1597Cys		B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.G1597C	ENST00000400445.3	37	c.4789	CCDS45026.1	13	.	.	.	.	.	.	.	.	.	.	G	19.03	3.746913	0.69418	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.63	3.91	0.45181	.	0.444083	0.24659	N	0.036643	T	0.52581	0.1743	L	0.50333	1.59	0.80722	D	1	D;D	0.62365	0.983;0.991	P;P	0.52672	0.635;0.706	T	0.53746	-0.8395	10	0.66056	D	0.02	.	11.9629	0.53019	0.1399:0.0:0.8601:0.0	.	1597;1594	Q8NFP9;Q5T321	NBEA_HUMAN;.	C	1597;1597;1594;1597;256	ENSP00000440951:G1597C;ENSP00000383295:G1597C;ENSP00000369271:G1594C;ENSP00000308534:G1597C	ENSP00000308534:G1597C	G	+	1	0	NBEA	34654623	1.000000	0.71417	0.591000	0.28745	0.993000	0.82548	4.928000	0.63447	0.742000	0.32697	0.467000	0.42956	GGT	NBEA	-	NULL	ENSG00000172915		0.373	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		-	0.00	52	0	G	NM_015678		35756623	+1	tier1	-	no_errors	ENST00000310336	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.997	T
NCAPG2	54892	genome.wustl.edu	37	7	158485569	158485569	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:158485569T>C	ENST00000409423.1	-	5	519	c.347A>G	c.(346-348)tAc>tGc	p.Y116C	NCAPG2_ENST00000479022.1_5'Flank|NCAPG2_ENST00000275830.10_5'Flank|NCAPG2_ENST00000409339.3_Missense_Mutation_p.Y116C|NCAPG2_ENST00000356309.3_Missense_Mutation_p.Y116C|NCAPG2_ENST00000449727.2_Missense_Mutation_p.Y116C	NM_001281932.1	NP_001268861.1	Q86XI2	CNDG2_HUMAN	non-SMC condensin II complex, subunit G2	116					chromosome condensation (GO:0030261)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	39	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		TAGGGCTTCGTAGTTCTCACT	0.294																																																	0													138.0	136.0	137.0					7																	158485569		1812	4073	5885	SO:0001583	missense	0			BC043404	CCDS43686.1, CCDS64816.1	7q36.3	2006-09-04	2006-09-04	2006-09-04	ENSG00000146918	ENSG00000146918			21904	protein-coding gene	gene with protein product		608532	"""leucine zipper protein 5"""	LUZP5		14532007	Standard	NM_001281933		Approved	FLJ20311, MTB, CAP-G2, hCAP-G2	uc003wnv.1	Q86XI2	OTTHUMG00000151438	ENST00000409423.1:c.347A>G	7.37:g.158485569T>C	ENSP00000386569:p.Tyr116Cys		A4D228|Q7Z3J9|Q8WUG8|Q9BRX6|Q9H8S2|Q9H9K6	Missense_Mutation	SNP	pfam_Condensin2_G2,superfamily_ARM-type_fold	p.Y116C	ENST00000409423.1	37	c.347	CCDS43686.1	7	.	.	.	.	.	.	.	.	.	.	T	6.450	0.451201	0.12223	.	.	ENSG00000146918	ENST00000356309;ENST00000409423;ENST00000409339;ENST00000449727	T;T;T;T	0.33865	1.39;1.39;1.39;1.39	5.41	-0.182	0.13287	Armadillo-type fold (1);	0.058363	0.64402	D	0.000001	T	0.25232	0.0613	L	0.45137	1.4	0.39673	D	0.970788	B;B	0.27416	0.178;0.111	B;B	0.31547	0.132;0.062	T	0.04373	-1.0956	10	0.46703	T	0.11	-8.2418	3.7201	0.08453	0.3966:0.1472:0.0:0.4561	.	116;116	Q86XI2-2;Q86XI2	.;CNDG2_HUMAN	C	116	ENSP00000348657:Y116C;ENSP00000386569:Y116C;ENSP00000387007:Y116C;ENSP00000388326:Y116C	ENSP00000348657:Y116C	Y	-	2	0	NCAPG2	158178330	0.962000	0.33011	0.153000	0.22517	0.116000	0.19942	1.504000	0.35726	-0.182000	0.10602	0.397000	0.26171	TAC	NCAPG2	-	superfamily_ARM-type_fold	ENSG00000146918		0.294	NCAPG2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NCAPG2	HGNC	protein_coding	OTTHUMT00000327111.1	-	0.00	77	0	T	NM_017760		158485569	-1	tier1	-	no_errors	ENST00000409339	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.354	C
NCKAP1	10787	genome.wustl.edu	37	2	183806893	183806894	+	Splice_Site	INS	-	-	A	rs140820523	byFrequency	TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:183806893_183806894insA	ENST00000361354.4	-	24	2974		c.e24-2		NCKAP1_ENST00000478449.1_Splice_Site|NCKAP1_ENST00000360982.2_Splice_Site	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1						apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			CACAAGTTTCTAAAAAAAAAAG	0.391																																																	0																																										SO:0001630	splice_region_variant	0			AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.2602-2->T	2.37:g.183806903_183806903dupA			O60329|Q53QN5|Q53S94|Q53Y35	Splice_Site	INS	-	e25-2	ENST00000361354.4	37	c.2620-3_2620-2	CCDS2287.1	2																																																																																			NCKAP1	-	-	ENSG00000061676		0.391	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1	HGNC	protein_coding	OTTHUMT00000255867.2		0.00	27	0	-	NM_205842	Intron	183806894	-1	tier1		no_errors	ENST00000360982	ensembl	human	known	74_37	splice_site_ins	16.13	26	5	INS	0.999:0.019	A
NCKAP5	344148	genome.wustl.edu	37	2	133751795	133751795	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:133751795C>T	ENST00000409261.1	-	7	732	c.359G>A	c.(358-360)cGa>cAa	p.R120Q	NCKAP5_ENST00000405974.3_Missense_Mutation_p.R120Q|NCKAP5_ENST00000409213.1_Missense_Mutation_p.R120Q|NCKAP5_ENST00000317721.6_Missense_Mutation_p.R120Q	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	120										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CAATAGATTTCGTACTGTTTC	0.348																																																	0													100.0	92.0	94.0					2																	133751795		1808	4083	5891	SO:0001583	missense	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.359G>A	2.37:g.133751795C>T	ENSP00000387128:p.Arg120Gln		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	NULL	p.R120Q	ENST00000409261.1	37	c.359	CCDS46418.1	2	.	.	.	.	.	.	.	.	.	.	C	21.7	4.180643	0.78677	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661;ENST00000542834	T;T;T;T	0.57107	2.38;0.42;2.38;0.42	5.65	5.65	0.86999	.	.	.	.	.	T	0.57140	0.2033	N	0.12182	0.205	0.27841	N	0.941093	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.83275	0.986;0.996;0.991	T	0.56511	-0.7967	9	0.72032	D	0.01	.	15.093	0.72211	0.0:1.0:0.0:0.0	.	95;120;120	O14513-3;O14513-2;O14513	.;.;NCKP5_HUMAN	Q	120;120;120;120;120;95	ENSP00000387128:R120Q;ENSP00000386952:R120Q;ENSP00000380603:R120Q;ENSP00000385692:R120Q	ENSP00000380603:R120Q	R	-	2	0	NCKAP5	133468265	0.967000	0.33354	1.000000	0.80357	0.991000	0.79684	1.733000	0.38156	2.941000	0.99782	0.655000	0.94253	CGA	NCKAP5	-	NULL	ENSG00000176771		0.348	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1		0.00	23	0	C	NM_207481		133751795	-1			no_errors	ENST00000317721	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	T
NECAB1	64168	genome.wustl.edu	37	8	91893332	91893332	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:91893332C>T	ENST00000417640.2	+	5	668	c.331C>T	c.(331-333)Ctg>Ttg	p.L111L	NECAB1_ENST00000521954.1_3'UTR	NM_022351.4	NP_071746.1	Q8N987	NECA1_HUMAN	N-terminal EF-hand calcium binding protein 1	111						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)	12			BRCA - Breast invasive adenocarcinoma(11;0.0499)			TCTTTCCATCCTGAAGGCAAT	0.299																																																	0													40.0	36.0	37.0					8																	91893332		1812	4070	5882	SO:0001819	synonymous_variant	0			AF414126	CCDS47889.1	8q21.3	2013-01-10	2007-12-06	2007-12-06	ENSG00000123119	ENSG00000123119		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	20983	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 1"""	EFCBP1			Standard	NM_022351		Approved		uc011lgg.2	Q8N987	OTTHUMG00000164009	ENST00000417640.2:c.331C>T	8.37:g.91893332C>T			Q6NUS7|Q96AZ7|Q9HBW8	Silent	SNP	pfam_Antibiotic_mOase,superfamily_Dimeric_a/b-barrel,smart_EF_hand_dom,pfscan_EF_hand_dom	p.L111	ENST00000417640.2	37	c.331	CCDS47889.1	8																																																																																			NECAB1	-	NULL	ENSG00000123119		0.299	NECAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NECAB1	HGNC	protein_coding	OTTHUMT00000376728.1	-	0.00	27	0	C	NM_022351		91893332	+1	tier1	-	no_errors	ENST00000417640	ensembl	human	known	74_37	silent	11.54	46	6	SNP	1.000	T
NEK10	152110	genome.wustl.edu	37	3	27337137	27337137	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:27337137C>T	ENST00000429845.2	-	16	1637	c.1275G>A	c.(1273-1275)aaG>aaA	p.K425K	NEK10_ENST00000341435.5_Silent_p.K425K			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	425					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						CATTCTTTTGCTTATTTGGTA	0.313																																																	0													171.0	143.0	152.0					3																	27337137		1564	3574	5138	SO:0001819	synonymous_variant	0			AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.1275G>A	3.37:g.27337137C>T			A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Aminoglycoside_PTrfase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K425	ENST00000429845.2	37	c.1275		3																																																																																			NEK10	-	superfamily_ARM-type_fold	ENSG00000163491		0.313	NEK10-016	NOVEL	basic|appris_principal	protein_coding	NEK10	HGNC	protein_coding	OTTHUMT00000438156.1	-	0.00	56	0	C	NM_152534		27337137	-1	tier1	-	no_errors	ENST00000341435	ensembl	human	known	74_37	silent	7.55	49	4	SNP	1.000	T
NELL2	4753	genome.wustl.edu	37	12	45171055	45171055	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:45171055A>C	ENST00000429094.2	-	6	1153	c.649T>G	c.(649-651)Ttt>Gtt	p.F217V	NELL2_ENST00000452445.2_Missense_Mutation_p.F217V|NELL2_ENST00000549027.1_Missense_Mutation_p.F216V|NELL2_ENST00000395487.2_Missense_Mutation_p.F216V|NELL2_ENST00000551601.1_Missense_Mutation_p.F216V|NELL2_ENST00000547172.1_5'Flank|NELL2_ENST00000437801.2_Missense_Mutation_p.F267V|NELL2_ENST00000333837.4_Missense_Mutation_p.F240V	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	217	Laminin G-like.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		TGAGCAATAAATCCCTGGGGC	0.368																																																	0													139.0	130.0	133.0					12																	45171055		2203	4300	6503	SO:0001583	missense	0			D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.649T>G	12.37:g.45171055A>C	ENSP00000390680:p.Phe217Val		B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_VWF_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_VWC_out,smart_VWF_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_VWF_C	p.F267V	ENST00000429094.2	37	c.799	CCDS8746.1	12	.	.	.	.	.	.	.	.	.	.	A	19.27	3.795312	0.70452	.	.	ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000551601;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801;ENST00000543684;ENST00000552993	T;T;T;T;T;T;T;T	0.81330	-1.43;-1.4;-1.11;-1.4;-1.43;-1.36;-1.48;2.78	5.62	5.62	0.85841	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.053081	0.85682	D	0.000000	T	0.80773	0.4687	M	0.62723	1.935	0.53688	D	0.999974	B;B;P;B;B;B	0.36789	0.181;0.446;0.57;0.319;0.376;0.311	B;B;B;B;B;B	0.39217	0.036;0.211;0.294;0.051;0.115;0.211	T	0.82655	-0.0350	10	0.72032	D	0.01	-19.6245	15.8389	0.78824	1.0:0.0:0.0:0.0	.	240;267;216;217;217;216	B7Z2U7;B7Z9U3;F8VVB6;B3KTI3;Q99435;Q96JS2	.;.;.;.;NELL2_HUMAN;.	V	216;217;216;217;216;240;267;216;217	ENSP00000378866:F216V;ENSP00000390680:F217V;ENSP00000449332:F216V;ENSP00000394612:F217V;ENSP00000447927:F216V;ENSP00000327988:F240V;ENSP00000416341:F267V;ENSP00000447085:F217V	ENSP00000327988:F240V	F	-	1	0	NELL2	43457322	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.172000	0.94808	2.150000	0.67090	0.533000	0.62120	TTT	NELL2	-	superfamily_ConA-like_lec_gl_sf	ENSG00000184613		0.368	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL2	HGNC	protein_coding	OTTHUMT00000404180.1	-	0.00	34	0	A	NM_006159		45171055	-1	tier1	-	no_errors	ENST00000437801	ensembl	human	known	74_37	missense	15.09	45	8	SNP	1.000	C
NEU4	129807	genome.wustl.edu	37	2	242755705	242755705	+	Silent	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:242755705A>G	ENST00000391969.2	+	3	735	c.24A>G	c.(22-24)tcA>tcG	p.S8S	NEU4_ENST00000325935.6_Silent_p.S21S|NEU4_ENST00000404257.1_Silent_p.S20S|NEU4_ENST00000405370.1_Silent_p.S8S|NEU4_ENST00000407683.1_Silent_p.S8S|AC114730.3_ENST00000420272.2_RNA	NM_001167602.1	NP_001161074.1	Q8WWR8	NEUR4_HUMAN	sialidase 4	8					ganglioside catabolic process (GO:0006689)|glycoprotein catabolic process (GO:0006516)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|organelle inner membrane (GO:0019866)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			breast(1)|lung(10)|prostate(2)|skin(2)	15		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		GTACCCCTTCACGGACAGTGC	0.692																																																	0													36.0	37.0	37.0					2																	242755705		2203	4300	6503	SO:0001819	synonymous_variant	0			BC012899	CCDS2553.1, CCDS54441.1, CCDS54442.1	2q37.3	2008-02-05			ENSG00000204099	ENSG00000204099			21328	protein-coding gene	gene with protein product		608527					Standard	NM_001167600		Approved		uc010fzr.3	Q8WWR8	OTTHUMG00000133412	ENST00000391969.2:c.24A>G	2.37:g.242755705A>G			A8K056|J3KNJ5|Q96D64	Silent	SNP	superfamily_Sialidases	p.S21	ENST00000391969.2	37	c.63	CCDS54442.1	2	.	.	.	.	.	.	.	.	.	.	A	6.541	0.468024	0.12461	.	.	ENSG00000204099	ENST00000472793	.	.	.	3.12	-5.62	0.02481	.	.	.	.	.	T	0.23249	0.0562	.	.	.	0.22354	N	0.99918	.	.	.	.	.	.	T	0.36792	-0.9733	5	0.45353	T	0.12	-1.1445	2.6898	0.05117	0.51:0.197:0.1861:0.107	.	.	.	.	A	32	.	ENSP00000441629:T32A	T	+	1	0	NEU4	242404378	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.374000	0.02566	-0.616000	0.05671	-0.656000	0.03901	ACG	NEU4	-	superfamily_Sialidases	ENSG00000204099		0.692	NEU4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NEU4	HGNC	protein_coding	OTTHUMT00000257270.2	-	0.00	35	0	A	NM_080741		242755705	+1	tier1	-	no_errors	ENST00000325935	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.111	G
NGRN	51335	genome.wustl.edu	37	15	90814633	90814633	+	Silent	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr15:90814633C>A	ENST00000379095.3	+	3	497	c.489C>A	c.(487-489)ctC>ctA	p.L163L	RP11-697E2.6_ENST00000561573.1_3'UTR|NGRN_ENST00000331497.3_3'UTR	NM_001033088.1	NP_001028260.2	Q9NPE2	NGRN_HUMAN	neugrin, neurite outgrowth associated	163					neuron differentiation (GO:0030182)	extracellular region (GO:0005576)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			CAAAGCTGCTCCCTGCAGGCC	0.517																																																	0													42.0	46.0	45.0					15																	90814633		2199	4298	6497	SO:0001819	synonymous_variant	0			AB029315	CCDS32329.1	15q26.1	2008-02-05			ENSG00000182768	ENSG00000182768			18077	protein-coding gene	gene with protein product						11118320	Standard	NR_028052		Approved	DSC92	uc002bpf.1	Q9NPE2	OTTHUMG00000149807	ENST00000379095.3:c.489C>A	15.37:g.90814633C>A			B2R6M8|Q4V9L7|Q9HBL4	Silent	SNP	pfam_Neugrin-related	p.L163	ENST00000379095.3	37	c.489	CCDS32329.1	15																																																																																			NGRN	-	pfam_Neugrin-related	ENSG00000182768		0.517	NGRN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NGRN	HGNC	protein_coding	OTTHUMT00000313418.1		0.00	32	0	C			90814633	+1			no_errors	ENST00000379095	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.000	A
NOB1	28987	genome.wustl.edu	37	16	69782978	69782980	+	In_Frame_Del	DEL	TCC	TCC	-	rs528891272	byFrequency	TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr16:69782978_69782980delTCC	ENST00000268802.5	-	6	596_598	c.567_569delGGA	c.(565-570)gaggaa>gaa	p.189_190EE>E		NM_014062.1	NP_054781.1	Q9ULX3	NOB1_HUMAN	NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)	189	Poly-Glu.				visual perception (GO:0007601)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CCCGTTTTCTTCCTCCTCCTCCT	0.522																																																	0																																										SO:0001651	inframe_deletion	0			AB026125	CCDS10884.1	16q22.1	2008-02-05	2006-04-20	2006-04-20	ENSG00000141101	ENSG00000141101			29540	protein-coding gene	gene with protein product	"""nin one binding protein"""	613586	"""PSMD8 binding protein 1"""	PSMD8BP1		16172919	Standard	NM_014062		Approved	NOB1P, ART-4, MST158	uc002exs.4	Q9ULX3	OTTHUMG00000137576	ENST00000268802.5:c.567_569delGGA	16.37:g.69782987_69782989delTCC	ENSP00000268802:p.Glu191del		Q7L6B7|Q7M4M4|Q7Z4B5|Q9NWB0	In_Frame_Del	DEL	pfam_NOB1_Zn-bd,smart_PIN_dom,pirsf_D-site_20S_pre-rRNA_nuclease	p.E191in_frame_del	ENST00000268802.5	37	c.569_567	CCDS10884.1	16																																																																																			NOB1	-	pirsf_D-site_20S_pre-rRNA_nuclease	ENSG00000141101		0.522	NOB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOB1	HGNC	protein_coding	OTTHUMT00000268958.2		0.00	21	0	TCC	NM_014062		69782980	-1	tier1		no_errors	ENST00000268802	ensembl	human	known	74_37	in_frame_del	15.38	22	4	DEL	0.032:0.038:0.042	-
NOMO3	408050	genome.wustl.edu	37	16	16339001	16339001	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr16:16339001T>A	ENST00000399336.4	+	5	651	c.479T>A	c.(478-480)aTc>aAc	p.I160N	NOMO3_ENST00000538468.1_Intron|NOMO3_ENST00000263012.6_Missense_Mutation_p.I160N	NM_001004067.3	NP_001004067.1	P69849	NOMO3_HUMAN	NODAL modulator 3	160						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	8				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)		GAAGCAAAGATCCAGTCCACA	0.567																																																	0													2.0	3.0	3.0					16																	16339001		1604	3765	5369	SO:0001583	missense	0			AK125530	CCDS42123.1	16p13	2004-11-24				ENSG00000103226			25242	protein-coding gene	gene with protein product		609159				15257293	Standard	NM_001004067		Approved		uc002deq.3	P69849	OTTHUMG00000170525	ENST00000399336.4:c.479T>A	16.37:g.16339001T>A	ENSP00000382274:p.Ile160Asn			Missense_Mutation	SNP	pfam_DUF2012,superfamily_CarboxyPept-like_regulatory,superfamily_Carb-bd-like_fold,superfamily_Collagen-bd_Cna_B-typ_dom	p.I160N	ENST00000399336.4	37	c.479	CCDS42123.1	16	.	.	.	.	.	.	.	.	.	.	.	13.76	2.333367	0.41297	.	.	ENSG00000103226	ENST00000263012;ENST00000399336	T;T	0.41065	1.01;1.01	3.33	3.33	0.38152	Carboxypeptidase-like, regulatory domain (1);Immunoglobulin-like fold (1);	0.161832	0.39834	N	0.001258	T	0.34600	0.0903	L	0.52126	1.63	0.80722	D	1	B;P	0.36315	0.051;0.547	B;B	0.34301	0.048;0.179	T	0.13388	-1.0511	10	0.28530	T	0.3	-23.9278	12.0605	0.53561	0.0:0.0:0.0:1.0	.	160;160	P69849;Q5JPE7-2	NOMO3_HUMAN;.	N	160	ENSP00000263012:I160N;ENSP00000382274:I160N	ENSP00000263012:I160N	I	+	2	0	NOMO3	16246502	1.000000	0.71417	0.999000	0.59377	0.666000	0.39218	7.393000	0.79851	1.308000	0.44962	0.156000	0.16432	ATC	NOMO3	-	superfamily_CarboxyPept-like_regulatory	ENSG00000103226		0.567	NOMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOMO3	HGNC	protein_coding	OTTHUMT00000409528.13	-	0.00	21	0	T	NM_001004067		16339001	+1	tier1	-	no_errors	ENST00000399336	ensembl	human	known	74_37	missense	25.00	6	2	SNP	0.976	A
NOX4	50507	genome.wustl.edu	37	11	89133398	89133398	+	Silent	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:89133398T>C	ENST00000263317.4	-	10	1234	c.996A>G	c.(994-996)aaA>aaG	p.K332K	NOX4_ENST00000375979.3_Intron|NOX4_ENST00000424319.1_Silent_p.K308K|NOX4_ENST00000525196.1_Intron|NOX4_ENST00000542487.1_Silent_p.K308K|NOX4_ENST00000527956.1_Silent_p.K308K|NOX4_ENST00000343727.5_Silent_p.K308K|NOX4_ENST00000535633.1_Silent_p.K308K|NOX4_ENST00000528341.1_Silent_p.K307K|NOX4_ENST00000531342.1_Intron|NOX4_ENST00000534731.1_Silent_p.K332K|NOX4_ENST00000532825.1_Silent_p.K308K|NOX4_ENST00000413594.2_Silent_p.K353K|NOX4_ENST00000527626.1_Silent_p.K166K			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	332	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.|Mediates interaction with TLR4.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				CAGGTCTTGCTTTAAAATTTT	0.378																																																	0													96.0	94.0	94.0					11																	89133398		2201	4299	6500	SO:0001819	synonymous_variant	0			AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.996A>G	11.37:g.89133398T>C			A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Silent	SNP	pfam_Fe_red_NAD-bd_6,pfam_Fe3_Rdtase_TM_dom,pfam_FAD-bd_8,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.K353	ENST00000263317.4	37	c.1059	CCDS8285.1	11																																																																																			NOX4	-	pfam_FAD-bd_8,superfamily_Riboflavin_synthase-like_b-brl	ENSG00000086991		0.378	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX4	HGNC	protein_coding	OTTHUMT00000394054.1	-	0.00	83	0	T	NM_016931		89133398	-1	tier1	-	no_errors	ENST00000413594	ensembl	human	known	74_37	silent	17.28	66	14	SNP	1.000	C
NPHS1	4868	genome.wustl.edu	37	19	36322231	36322231	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:36322231C>G	ENST00000378910.5	-	26	3353	c.3354G>C	c.(3352-3354)caG>caC	p.Q1118H	NPHS1_ENST00000353632.6_Missense_Mutation_p.Q1078H	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	1118					cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTCCTGTCCACTGGCTCTCCT	0.632																																																	0													95.0	88.0	91.0					19																	36322231		2203	4300	6503	SO:0001583	missense	0				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.3354G>C	19.37:g.36322231C>G	ENSP00000368190:p.Gln1118His		A6NDH2|C3RX61	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.Q1118H	ENST00000378910.5	37	c.3354	CCDS32996.1	19	.	.	.	.	.	.	.	.	.	.	C	8.802	0.933146	0.18131	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	T;T	0.74526	-0.82;-0.85	5.07	4.01	0.46588	.	0.229124	0.40064	N	0.001184	T	0.62648	0.2445	N	0.24115	0.695	0.28798	N	0.89892	B	0.33379	0.41	B	0.38712	0.28	T	0.63332	-0.6661	10	0.72032	D	0.01	-12.9898	9.6054	0.39630	0.0:0.903:0.0:0.097	.	1118	O60500	NPHN_HUMAN	H	1118;1078	ENSP00000368190:Q1118H;ENSP00000343634:Q1078H	ENSP00000343634:Q1078H	Q	-	3	2	NPHS1	41014071	0.980000	0.34600	0.998000	0.56505	0.091000	0.18340	0.190000	0.17057	2.651000	0.90000	0.442000	0.29010	CAG	NPHS1	-	NULL	ENSG00000161270		0.632	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS1	HGNC	protein_coding	OTTHUMT00000452553.1	-	0.00	52	0	C			36322231	-1	tier1	-	no_errors	ENST00000378910	ensembl	human	known	74_37	missense	20.78	61	16	SNP	0.993	G
NRG1	3084	genome.wustl.edu	37	8	32463089	32463089	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:32463089A>C	ENST00000405005.3	+	3	288	c.288A>C	c.(286-288)gaA>gaC	p.E96D	NRG1_ENST00000356819.4_Missense_Mutation_p.E96D|NRG1_ENST00000520407.1_Missense_Mutation_p.E311D|NRG1_ENST00000523079.1_Missense_Mutation_p.E96D|NRG1_ENST00000519301.1_Missense_Mutation_p.E75D|NRG1_ENST00000341377.5_Missense_Mutation_p.E96D|NRG1_ENST00000521670.1_Missense_Mutation_p.E96D|NRG1_ENST00000287842.3_Missense_Mutation_p.E96D|NRG1_ENST00000287845.5_Missense_Mutation_p.E96D|NRG1_ENST00000338921.4_Missense_Mutation_p.E96D			Q02297	NRG1_HUMAN	neuregulin 1	96	Ig-like C2-type.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GGAAGTCAGAACTTCGCATTA	0.378																																																	0													168.0	154.0	159.0					8																	32463089		2203	4300	6503	SO:0001583	missense	0			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.288A>C	8.37:g.32463089A>C	ENSP00000384620:p.Glu96Asp		A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Ig-like_dom,prints_Neuregulin	p.E96D	ENST00000405005.3	37	c.288	CCDS6085.1	8	.	.	.	.	.	.	.	.	.	.	A	13.12	2.142366	0.37825	.	.	ENSG00000157168	ENST00000518104;ENST00000519301;ENST00000520407;ENST00000523534;ENST00000523079;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000341377;ENST00000287842;ENST00000405005;ENST00000521670	T;T;T;T;T;T;T;T;T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29;-0.29;-0.29;-0.29;-0.29;-0.29;-0.29;-0.29;-0.29	5.5	0.444	0.16592	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.708602	0.14031	N	0.346133	T	0.76263	0.3963	L	0.58669	1.825	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;0.999;0.997;0.998;0.999;0.999;0.998;0.998;0.998;0.997	D;D;D;D;D;D;D;D;D;D;D;D	0.87578	0.996;0.995;0.998;0.997;0.992;0.996;0.994;0.997;0.995;0.997;0.994;0.983	T	0.72717	-0.4209	10	0.72032	D	0.01	-9.0803	11.022	0.47724	0.6253:0.0:0.3747:0.0	.	96;96;96;95;95;96;96;96;96;96;96;311	E9PHH4;F8W9E3;Q7RTW4;B0FYA9;B0FWZ3;B7Z4Z3;Q02297-7;Q02297;Q02297-6;Q02297-3;Q02297-8;Q02297-9	.;.;.;.;.;.;.;NRG1_HUMAN;.;.;.;.	D	75;75;311;164;96;96;96;96;96;96;96;96;96	ENSP00000430053:E75D;ENSP00000429582:E75D;ENSP00000434640:E311D;ENSP00000429067:E164D;ENSP00000430120:E96D;ENSP00000343395:E96D;ENSP00000349275:E96D;ENSP00000287840:E96D;ENSP00000287845:E96D;ENSP00000340497:E96D;ENSP00000287842:E96D;ENSP00000384620:E96D;ENSP00000428828:E96D	ENSP00000287840:E96D	E	+	3	2	NRG1	32582631	1.000000	0.71417	0.991000	0.47740	0.121000	0.20230	1.101000	0.31037	-0.339000	0.08401	-1.162000	0.01777	GAA	NRG1	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000157168		0.378	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	HGNC	protein_coding	OTTHUMT00000472504.1	-	0.00	45	0	A			32463089	+1	tier1	-	no_errors	ENST00000338921	ensembl	human	known	74_37	missense	25.00	27	9	SNP	0.993	C
NTM	50863	genome.wustl.edu	37	11	132206471	132206471	+	3'UTR	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:132206471T>A	ENST00000374786.1	+	0	2945				NTM_ENST00000474900.1_3'UTR|NTM_ENST00000374791.3_3'UTR	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin						cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						GATGCCTTTGTGACCACTGGA	0.413																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.*1431T>A	11.37:g.132206471T>A			A0MTT2|Q6UXJ3|Q86VJ9	RNA	SNP	-	NULL	ENST00000374786.1	37	NULL	CCDS8491.1	11																																																																																			NTM	-	-	ENSG00000182667		0.413	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTM	HGNC	protein_coding	OTTHUMT00000141937.1	-	0.00	25	0	T	NM_016522		132206471	+1	tier1	-	no_errors	ENST00000474900	ensembl	human	known	74_37	rna	29.09	39	16	SNP	0.998	A
NUP205	23165	genome.wustl.edu	37	7	135300665	135300665	+	Splice_Site	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:135300665A>T	ENST00000285968.6	+	24	3338	c.3312A>T	c.(3310-3312)gaA>gaT	p.E1104D		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1104					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						AAATTCTAGAATATGAAATAT	0.353																																																	0													60.0	60.0	60.0					7																	135300665		2203	4299	6502	SO:0001630	splice_region_variant	0			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.3311-1A>T	7.37:g.135300665A>T			A6H8X3|Q86YC1	Missense_Mutation	SNP	pfam_Nup186/Nup192/Nup205	p.E1104D	ENST00000285968.6	37	c.3312	CCDS34759.1	7	.	.	.	.	.	.	.	.	.	.	A	13.50	2.256461	0.39896	.	.	ENSG00000155561	ENST00000285968	T	0.29397	1.57	6.16	-0.433	0.12287	.	0.219434	0.49916	N	0.000126	T	0.16938	0.0407	L	0.31664	0.95	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.08086	-1.0739	10	0.24483	T	0.36	.	6.1825	0.20480	0.4325:0.2383:0.3292:0.0	.	1104	Q92621	NU205_HUMAN	D	1104	ENSP00000285968:E1104D	ENSP00000285968:E1104D	E	+	3	2	NUP205	134951205	0.072000	0.21174	0.997000	0.53966	0.991000	0.79684	-0.564000	0.05936	-0.037000	0.13646	0.528000	0.53228	GAA	NUP205	-	pfam_Nup186/Nup192/Nup205	ENSG00000155561		0.353	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP205	HGNC	protein_coding	OTTHUMT00000340358.1		0.00	39	0	A		Missense_Mutation	135300665	+1			no_errors	ENST00000285968	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.950	T
OAF	220323	genome.wustl.edu	37	11	120099634	120099634	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:120099634C>T	ENST00000328965.4	+	4	1118	c.605C>T	c.(604-606)cCt>cTt	p.P202L	OAF_ENST00000531220.1_Missense_Mutation_p.P86L	NM_178507.2	NP_848602.1	Q86UD1	OAF_HUMAN	OAF homolog (Drosophila)	202						extracellular vesicular exosome (GO:0070062)				kidney(1)|lung(5)	6		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)		GCGGAGCTGCCTCGCTGCAGG	0.667																																																	0													34.0	32.0	32.0					11																	120099634		2202	4295	6497	SO:0001583	missense	0			BC047726	CCDS8430.1	11q23.3	2010-11-23			ENSG00000184232	ENSG00000184232			28752	protein-coding gene	gene with protein product						12477932	Standard	NM_178507		Approved	MGC52117	uc001pxb.3	Q86UD1	OTTHUMG00000166139	ENST00000328965.4:c.605C>T	11.37:g.120099634C>T	ENSP00000332613:p.Pro202Leu			Missense_Mutation	SNP	NULL	p.P202L	ENST00000328965.4	37	c.605	CCDS8430.1	11	.	.	.	.	.	.	.	.	.	.	C	11.16	1.557852	0.27827	.	.	ENSG00000184232	ENST00000328965;ENST00000531220	T;T	0.28666	1.6;1.6	4.73	2.61	0.31194	.	0.278439	0.36519	N	0.002555	T	0.21267	0.0512	L	0.36672	1.1	0.40882	D	0.984004	B	0.32467	0.372	B	0.30316	0.114	T	0.11131	-1.0600	10	0.49607	T	0.09	-6.2189	9.0922	0.36619	0.2437:0.5782:0.178:0.0	.	202	Q86UD1	OAF_HUMAN	L	202;86	ENSP00000332613:P202L;ENSP00000431865:P86L	ENSP00000332613:P202L	P	+	2	0	OAF	119604844	0.234000	0.23783	0.591000	0.28745	0.557000	0.35523	1.745000	0.38278	2.167000	0.68274	0.655000	0.94253	CCT	OAF	-	NULL	ENSG00000184232		0.667	OAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OAF	HGNC	protein_coding	OTTHUMT00000388036.2		0.00	53	0	C	NM_178507		120099634	+1			no_errors	ENST00000328965	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.969	T
OBSCN	84033	genome.wustl.edu	37	1	228505712	228505712	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:228505712C>A	ENST00000422127.1	+	53	14013	c.13969C>A	c.(13969-13971)Cac>Aac	p.H4657N	OBSCN_ENST00000366709.4_Missense_Mutation_p.H1776N|OBSCN_ENST00000570156.2_Missense_Mutation_p.H5614N|OBSCN_ENST00000366707.4_Missense_Mutation_p.H2291N|OBSCN_ENST00000284548.11_Missense_Mutation_p.H4657N	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4657	Ig-like 47.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGTCATCTGGCACAAGGGAAT	0.637																																																	0													79.0	89.0	85.0					1																	228505712		2138	4241	6379	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13969C>A	1.37:g.228505712C>A	ENSP00000409493:p.His4657Asn		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.H4657N	ENST00000422127.1	37	c.13969	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	c	11.39	1.624574	0.28889	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0	4.51	2.37	0.29283	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.009960	0.07956	N	0.981725	T	0.61640	0.2363	L	0.43152	1.355	0.27549	N	0.950545	B;B	0.34161	0.29;0.439	B;B	0.30316	0.079;0.114	T	0.52335	-0.8589	10	0.28530	T	0.3	.	4.6415	0.12550	0.536:0.3312:0.0:0.1328	.	4657;4657	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	N	4657;4657;2291;1776	ENSP00000284548:H4657N;ENSP00000409493:H4657N;ENSP00000355668:H2291N;ENSP00000355670:H1776N	ENSP00000284548:H4657N	H	+	1	0	OBSCN	226572335	0.137000	0.22531	1.000000	0.80357	0.075000	0.17131	-0.504000	0.06375	1.076000	0.40961	0.479000	0.44913	CAC	OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000154358		0.637	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	77	0	C	NM_052843		228505712	+1	tier1	-	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	43.48	38	30	SNP	0.996	A
OMG	4974	genome.wustl.edu	37	17	29622574	29622574	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:29622574G>T	ENST00000247271.4	-	2	1037	c.776C>A	c.(775-777)tCa>tAa	p.S259*	NF1_ENST00000358273.4_Intron|NF1_ENST00000356175.3_Intron	NM_002544.4	NP_002535.3	P23515	OMGP_HUMAN	oligodendrocyte myelin glycoprotein	259					cell adhesion (GO:0007155)|negative regulation of axonogenesis (GO:0050771)|neuron projection regeneration (GO:0031102)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|regulation of collateral sprouting of intact axon in response to injury (GO:0048683)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.0?(8)|p.?(3)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)|stomach(1)	13		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;1.81e-13)|Epithelial(4;4.04e-12)|OV - Ovarian serous cystadenocarcinoma(4;9.49e-12)|GBM - Glioblastoma multiforme(4;0.121)		CTTTAAAGATGATATTTGGGT	0.408																																																	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)											163.0	139.0	147.0					17																	29622574		2203	4300	6503	SO:0001587	stop_gained	0				CCDS11265.1	17q11-q12	2008-07-18			ENSG00000126861	ENSG00000126861			8135	protein-coding gene	gene with protein product		164345				1899288, 2277079	Standard	NM_002544		Approved	OMGP	uc002hgj.3	P23515	OTTHUMG00000132870	ENST00000247271.4:c.776C>A	17.37:g.29622574G>T	ENSP00000247271:p.Ser259*		E1P659	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.S259*	ENST00000247271.4	37	c.776	CCDS11265.1	17	.	.	.	.	.	.	.	.	.	.	G	28.2	4.902755	0.92035	.	.	ENSG00000126861	ENST00000247271	.	.	.	5.54	5.54	0.83059	.	0.160293	0.29638	N	0.011585	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	-6.8468	15.358	0.74443	0.0:0.0:1.0:0.0	.	.	.	.	X	259	.	ENSP00000247271:S259X	S	-	2	0	OMG	26646700	0.938000	0.31826	1.000000	0.80357	0.997000	0.91878	-0.238000	0.08977	2.776000	0.95493	0.650000	0.86243	TCA	OMG	-	NULL	ENSG00000126861		0.408	OMG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OMG	HGNC	protein_coding	OTTHUMT00000256350.2	-	0.00	57	0	G	NM_002544		29622574	-1	tier1	-	no_errors	ENST00000247271	ensembl	human	known	74_37	nonsense	5.80	65	4	SNP	1.000	T
OPRK1	4986	genome.wustl.edu	37	8	54141976	54141976	+	Missense_Mutation	SNP	G	G	A	rs200955469		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:54141976G>A	ENST00000265572.3	-	4	1321	c.1024C>T	c.(1024-1026)Cgg>Tgg	p.R342W	RP11-162D9.3_ENST00000524425.1_RNA|OPRK1_ENST00000524278.1_Missense_Mutation_p.R253W|OPRK1_ENST00000520287.1_Missense_Mutation_p.R342W	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	342					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CAGAAGTCCCGGAAACACCGC	0.493																																																	0													80.0	75.0	77.0					8																	54141976		2203	4300	6503	SO:0001583	missense	0				CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.1024C>T	8.37:g.54141976G>A	ENSP00000265572:p.Arg342Trp		E5RHC9|Q499G4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_Kappa_opi_rcpt,prints_GPCR_Rhodpsn,prints_Opioid_rcpt,prints_Neuropept_B/W_rcpt,prints_Somatstn_rcpt,prints_NPY_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.R342W	ENST00000265572.3	37	c.1024	CCDS6152.1	8	.	.	.	.	.	.	.	.	.	.	G	19.30	3.801618	0.70682	.	.	ENSG00000082556	ENST00000265572;ENST00000524278;ENST00000520287;ENST00000396798	T;T;T	0.40225	1.04;1.04;1.04	5.8	-3.02	0.05446	.	0.126264	0.64402	D	0.000001	T	0.63070	0.2480	M	0.78049	2.395	0.42720	D	0.99367	D	0.76494	0.999	D	0.76071	0.987	T	0.69503	-0.5128	10	0.87932	D	0	.	19.1693	0.93570	0.0:0.0:0.6867:0.3133	.	342	P41145	OPRK_HUMAN	W	342;253;342;328	ENSP00000265572:R342W;ENSP00000430923:R253W;ENSP00000429706:R342W	ENSP00000265572:R342W	R	-	1	2	OPRK1	54304529	1.000000	0.71417	0.902000	0.35471	0.975000	0.68041	2.214000	0.42853	-0.763000	0.04658	-0.271000	0.10264	CGG	OPRK1	-	pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_Somatstn_rcpt	ENSG00000082556		0.493	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPRK1	HGNC	protein_coding	OTTHUMT00000378048.1		0.00	20	0	G			54141976	-1			no_errors	ENST00000265572	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.997	A
OR10H2	26538	genome.wustl.edu	37	19	15838920	15838920	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:15838920C>G	ENST00000305899.3	+	1	87	c.67C>G	c.(67-69)Ctc>Gtc	p.L23V		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	23						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					CTTCCCCCACCTCCAACTGAT	0.582																																																	0													277.0	239.0	252.0					19																	15838920		2203	4300	6503	SO:0001583	missense	0			AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.67C>G	19.37:g.15838920C>G	ENSP00000306095:p.Leu23Val		Q6IFQ1|Q96R58	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L23V	ENST00000305899.3	37	c.67	CCDS12333.1	19	.	.	.	.	.	.	.	.	.	.	.	2.890	-0.229771	0.06022	.	.	ENSG00000171942	ENST00000305899	T	0.04970	3.52	2.15	1.06	0.20224	.	0.000000	0.43416	D	0.000562	T	0.09423	0.0232	L	0.46885	1.475	0.09310	N	1	P	0.50943	0.94	P	0.52267	0.694	T	0.12578	-1.0542	10	0.48119	T	0.1	.	6.3528	0.21385	0.0:0.8302:0.0:0.1698	.	23	O60403	O10H2_HUMAN	V	23	ENSP00000306095:L23V	ENSP00000306095:L23V	L	+	1	0	OR10H2	15699920	0.000000	0.05858	0.002000	0.10522	0.084000	0.17831	0.283000	0.18846	0.119000	0.18210	0.194000	0.17425	CTC	OR10H2	-	NULL	ENSG00000171942		0.582	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H2	HGNC	protein_coding	OTTHUMT00000460917.1	-	0.00	98	0	C			15838920	+1	tier1	-	no_errors	ENST00000305899	ensembl	human	known	74_37	missense	31.25	77	35	SNP	0.001	G
OR10X1	128367	genome.wustl.edu	37	1	158549657	158549657	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:158549657T>G	ENST00000368150.1	-	1	32	c.33A>C	c.(31-33)caA>caC	p.Q11H		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	11						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					TGTCTGAAATTTGAAAGAAAC	0.323																																																	0													95.0	95.0	95.0					1																	158549657		2203	4300	6503	SO:0001583	missense	0			BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.33A>C	1.37:g.158549657T>G	ENSP00000357132:p.Gln11His		Q6IFR8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q11H	ENST00000368150.1	37	c.33	CCDS30900.1	1	.	.	.	.	.	.	.	.	.	.	T	3.627	-0.076358	0.07184	.	.	ENSG00000186400	ENST00000368150	T	0.00004	9.81	3.98	-5.83	0.02325	.	3.942700	0.01037	N	0.004250	T	0.00012	0.0000	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.01853	-1.1260	10	0.15066	T	0.55	.	2.631	0.04945	0.1172:0.3127:0.3651:0.205	.	11	Q8NGY0	O10X1_HUMAN	H	11	ENSP00000357132:Q11H	ENSP00000357132:Q11H	Q	-	3	2	OR10X1	156816281	0.000000	0.05858	0.001000	0.08648	0.080000	0.17528	-1.214000	0.02988	-1.391000	0.02085	-1.166000	0.01754	CAA	OR10X1	-	NULL	ENSG00000186400		0.323	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10X1	HGNC	protein_coding	OTTHUMT00000051850.2	-	0.00	21	0	T	NM_001004477		158549657	-1	tier1	-	no_errors	ENST00000368150	ensembl	human	known	74_37	missense	22.73	17	5	SNP	0.000	G
OR10Z1	128368	genome.wustl.edu	37	1	158576679	158576679	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:158576679A>T	ENST00000361284.1	+	1	451	c.451A>T	c.(451-453)Act>Tct	p.T151S		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					TTCCTTCCTGACTGGATACCT	0.493																																																	0													100.0	97.0	98.0					1																	158576679		2203	4300	6503	SO:0001583	missense	0			AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.451A>T	1.37:g.158576679A>T	ENSP00000354707:p.Thr151Ser		Q5VYL0|Q6IFR7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T151S	ENST00000361284.1	37	c.451	CCDS30901.1	1	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.790001	0.00623	.	.	ENSG00000198967	ENST00000361284	T	0.37058	1.22	5.36	1.48	0.22813	GPCR, rhodopsin-like superfamily (1);	1.226290	0.05846	N	0.620267	T	0.03520	0.0101	N	0.01529	-0.815	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33599	-0.9862	10	0.18710	T	0.47	.	4.0578	0.09824	0.4444:0.0:0.388:0.1676	.	151	Q8NGY1	O10Z1_HUMAN	S	151	ENSP00000354707:T151S	ENSP00000354707:T151S	T	+	1	0	OR10Z1	156843303	0.000000	0.05858	0.095000	0.20976	0.059000	0.15707	0.039000	0.13884	0.071000	0.16664	0.533000	0.62120	ACT	OR10Z1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000198967		0.493	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Z1	HGNC	protein_coding	OTTHUMT00000051853.1		0.00	30	0	A	NM_001004478		158576679	+1			no_errors	ENST00000361284	ensembl	human	known	74_37	missense	7.32	38	3	SNP	0.002	T
OR2J1	442185	genome.wustl.edu	37	6	29068816	29068816	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:29068816T>A	ENST00000377171.3	+	1	431	c.97T>A	c.(97-99)Ttg>Atg	p.L33M				Q9GZK6	OR2J1_HUMAN	olfactory receptor, family 2, subfamily J, member 1 (gene/pseudogene)	33						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|lung(6)	7						TGTGGTTATCTTGATCTTCTA	0.378																																																	0																																										SO:0001583	missense	0					6p22.2-p21.31	2012-08-09	2011-08-30	2004-05-28	ENSG00000204702	ENSG00000204702		"""GPCR / Class A : Olfactory receptors"""	8259	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily J, member 1 pseudogene"", ""olfactory receptor, family 2, subfamily J, member 1"""	OR2J1P			Standard	NG_004683		Approved	OR6-5, hs6M1-4, dJ80I19.2		Q9GZK6	OTTHUMG00000031280	ENST00000377171.3:c.97T>A	6.37:g.29068816T>A	ENSP00000366376:p.Leu33Met		A2AAS1|B0V1T2|Q9GZK1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.L33M	ENST00000377171.3	37	c.97		6	.	.	.	.	.	.	.	.	.	.	T	12.26	1.885607	0.33255	.	.	ENSG00000204702	ENST00000377171	T	0.01902	4.57	2.21	1.05	0.20165	.	.	.	.	.	T	0.01287	0.0042	.	.	.	0.28792	N	0.899283	.	.	.	.	.	.	T	0.49103	-0.8974	6	0.66056	D	0.02	.	6.1166	0.20130	0.0:0.2393:0.0:0.7607	.	.	.	.	M	33	ENSP00000366376:L33M	ENSP00000366376:L33M	L	+	1	2	OR2J1	29176795	0.001000	0.12720	0.904000	0.35570	0.582000	0.36321	-0.524000	0.06222	1.002000	0.39104	0.383000	0.25322	TTG	OR2J1	-	prints_GPCR_Rhodpsn	ENSG00000204702		0.378	OR2J1-001	KNOWN	basic|appris_principal	protein_coding	OR2J1	HGNC	protein_coding	OTTHUMT00000076612.2	-	0.00	64	0	T	NG_004683		29068816	+1	tier1	-	no_errors	ENST00000377171	ensembl	human	known	74_37	missense	48.72	40	38	SNP	0.986	A
OR2H1	26716	genome.wustl.edu	37	6	29430376	29430376	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:29430376C>T	ENST00000377136.1	+	4	1295	c.830C>T	c.(829-831)gCa>gTa	p.A277V	OR2H1_ENST00000442615.1_Missense_Mutation_p.A277V|OR2H1_ENST00000473369.1_3'UTR|OR2H1_ENST00000396792.2_Missense_Mutation_p.A277V|OR2H1_ENST00000377132.1_Missense_Mutation_p.A277V|OR2H1_ENST00000377133.1_Missense_Mutation_p.A277V			Q9GZK4	OR2H1_HUMAN	olfactory receptor, family 2, subfamily H, member 1	277						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(5)|lung(12)	17						CTCTTCTATGCAGTGGGCACT	0.512																																																	0													100.0	103.0	102.0					6																	29430376		1511	2709	4220	SO:0001583	missense	0			AF044491	CCDS4660.1	6p22.1	2014-02-19	2002-02-28		ENSG00000204688	ENSG00000204688		"""GPCR / Class A : Olfactory receptors"""	8252	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily H, member 8"""	OR2H6, OR2H8			Standard	NM_030883		Approved	OR6-2	uc003nmi.3	Q9GZK4	OTTHUMG00000031050	ENST00000377136.1:c.830C>T	6.37:g.29430376C>T	ENSP00000366340:p.Ala277Val		B0S7T4|O43629|O43661|O43662|Q5SUN6|Q9GZK9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A277V	ENST00000377136.1	37	c.830	CCDS4660.1	6	.	.	.	.	.	.	.	.	.	.	C	15.22	2.767845	0.49680	.	.	ENSG00000204688	ENST00000377136;ENST00000377133;ENST00000442615;ENST00000377132;ENST00000396792	T;T;T;T;T	0.00063	8.78;8.78;8.78;8.78;8.78	2.91	2.91	0.33838	GPCR, rhodopsin-like superfamily (1);	0.380726	0.19284	N	0.118077	T	0.00109	0.0003	L	0.28694	0.88	0.09310	N	1	D	0.63046	0.992	P	0.58721	0.844	T	0.53599	-0.8416	10	0.66056	D	0.02	.	14.6783	0.68998	0.0:1.0:0.0:0.0	.	277	Q9GZK4	OR2H1_HUMAN	V	277	ENSP00000366340:A277V;ENSP00000366337:A277V;ENSP00000393254:A277V;ENSP00000366336:A277V;ENSP00000380010:A277V	ENSP00000366336:A277V	A	+	2	0	OR2H1	29538355	0.002000	0.14202	0.888000	0.34837	0.374000	0.29953	1.743000	0.38258	1.933000	0.56026	0.603000	0.83216	GCA	OR2H1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000204688		0.512	OR2H1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2H1	HGNC	protein_coding	OTTHUMT00000194014.3	-	0.00	29	0	C			29430376	+1	tier1	-	no_errors	ENST00000377132	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.293	T
OR2L2	26246	genome.wustl.edu	37	1	248201876	248201876	+	Missense_Mutation	SNP	T	T	C	rs151223470		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:248201876T>C	ENST00000366479.2	+	1	403	c.307T>C	c.(307-309)Ttc>Ctc	p.F103L	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			GAGTTTCTTCTTCTTGACTTT	0.423																																																	0													132.0	126.0	128.0					1																	248201876		2203	4300	6503	SO:0001583	missense	0			X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.307T>C	1.37:g.248201876T>C	ENSP00000355435:p.Phe103Leu		Q2M3T5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F103L	ENST00000366479.2	37	c.307	CCDS31103.1	1	.	.	.	.	.	.	.	.	.	.	.	16.79	3.219883	0.58560	.	.	ENSG00000203663	ENST00000366479	T	0.02258	4.37	1.9	1.9	0.25705	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33144	U	0.005239	T	0.06280	0.0162	M	0.66297	2.02	0.09310	N	0.999999	D	0.55172	0.97	P	0.55161	0.77	T	0.10823	-1.0613	10	0.49607	T	0.09	.	9.0367	0.36291	0.0:0.0:0.0:1.0	.	103	Q8NH16	OR2L2_HUMAN	L	103	ENSP00000355435:F103L	ENSP00000355435:F103L	F	+	1	0	OR2L2	246268499	0.005000	0.15991	0.986000	0.45419	0.382000	0.30200	0.114000	0.15520	0.746000	0.32786	0.163000	0.16589	TTC	OR2L2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000203663		0.423	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L2	HGNC	protein_coding	OTTHUMT00000096871.1	-	0.00	102	0	T	NM_001004686		248201876	+1	tier1	-	no_errors	ENST00000366479	ensembl	human	known	74_37	missense	39.78	56	37	SNP	0.258	C
OR51F2	119694	genome.wustl.edu	37	11	4842644	4842644	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:4842644G>C	ENST00000322110.5	+	1	94	c.29G>C	c.(28-30)tGc>tCc	p.C10S	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004753.1	NP_001004753.1	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F, member 2	10						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCTTCTCAGTGCTTCCCTATG	0.433																																																	0													265.0	250.0	255.0					11																	4842644		2201	4298	6499	SO:0001583	missense	0			BK004281	CCDS31361.1	11p15.4	2012-08-09			ENSG00000176925	ENSG00000176925		"""GPCR / Class A : Olfactory receptors"""	15197	protein-coding gene	gene with protein product							Standard	NM_001004753		Approved		uc010qyn.2	Q8NH61	OTTHUMG00000066508	ENST00000322110.5:c.29G>C	11.37:g.4842644G>C	ENSP00000323952:p.Cys10Ser		Q6IFI1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C10S	ENST00000322110.5	37	c.29	CCDS31361.1	11	.	.	.	.	.	.	.	.	.	.	C	0.001	-2.942215	0.00052	.	.	ENSG00000176925	ENST00000322110	T	0.00642	6.02	4.69	1.63	0.23807	.	.	.	.	.	T	0.00356	0.0011	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42548	-0.9445	9	0.07030	T	0.85	.	2.9716	0.05925	0.2999:0.3404:0.2753:0.0844	.	10	Q8NH61	O51F2_HUMAN	S	10	ENSP00000323952:C10S	ENSP00000323952:C10S	C	+	2	0	OR51F2	4799220	0.000000	0.05858	0.011000	0.14972	0.054000	0.15201	-0.349000	0.07731	0.006000	0.14734	-0.998000	0.02512	TGC	OR51F2	-	NULL	ENSG00000176925		0.433	OR51F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51F2	HGNC	protein_coding	OTTHUMT00000142181.1	-	0.00	38	0	G	NM_001004753		4842644	+1	tier1	-	no_errors	ENST00000322110	ensembl	human	known	74_37	missense	21.31	48	13	SNP	0.019	C
OR52H1	390067	genome.wustl.edu	37	11	5566396	5566396	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:5566396A>G	ENST00000322653.4	-	1	383	c.358T>C	c.(358-360)Tca>Cca	p.S120P	HBG2_ENST00000380259.2_Intron	NM_001005289.1	NP_001005289.1	Q8NGJ2	O52H1_HUMAN	olfactory receptor, family 52, subfamily H, member 1	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;5.33e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGAATGGCTGAATCCAGGACA	0.453																																																	0													118.0	107.0	111.0					11																	5566396		2201	4297	6498	SO:0001583	missense	0			AB065802	CCDS31386.1	11p15.4	2012-08-09			ENSG00000181616	ENSG00000181616		"""GPCR / Class A : Olfactory receptors"""	15218	protein-coding gene	gene with protein product							Standard	NM_001005289		Approved		uc010qzh.2	Q8NGJ2	OTTHUMG00000066909	ENST00000322653.4:c.358T>C	11.37:g.5566396A>G	ENSP00000326259:p.Ser120Pro		B9EH26|Q6IF79	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S120P	ENST00000322653.4	37	c.358	CCDS31386.1	11	.	.	.	.	.	.	.	.	.	.	A	14.94	2.684643	0.47991	.	.	ENSG00000181616	ENST00000322653	T	0.00384	7.6	5.55	5.55	0.83447	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000067	T	0.01029	0.0034	H	0.98951	4.38	0.37991	D	0.933918	B	0.27679	0.185	B	0.32342	0.144	T	0.02450	-1.1157	10	0.87932	D	0	.	14.5207	0.67849	1.0:0.0:0.0:0.0	.	120	Q8NGJ2	O52H1_HUMAN	P	120	ENSP00000326259:S120P	ENSP00000326259:S120P	S	-	1	0	OR52H1	5522972	0.041000	0.20044	1.000000	0.80357	0.955000	0.61496	0.533000	0.23082	2.112000	0.64535	0.528000	0.53228	TCA	OR52H1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181616		0.453	OR52H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52H1	HGNC	protein_coding	OTTHUMT00000143400.1	-	0.00	23	0	A	NM_001005289		5566396	-1	tier1	-	no_errors	ENST00000322653	ensembl	human	known	74_37	missense	23.08	20	6	SNP	0.997	G
OR4C3	256144	genome.wustl.edu	37	11	48346896	48346896	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:48346896T>G	ENST00000319856.4	+	1	425	c.404T>G	c.(403-405)gTt>gGt	p.V135G		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						TTGGGAGGTGTTGAGATCATT	0.483																																																	0													259.0	243.0	249.0					11																	48346896		2201	4298	6499	SO:0001583	missense	0			AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.404T>G	11.37:g.48346896T>G	ENSP00000321419:p.Val135Gly		B2RNF2|Q6IFB3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V135G	ENST00000319856.4	37	c.404	CCDS31489.1	11	.	.	.	.	.	.	.	.	.	.	T	12.51	1.959648	0.34565	.	.	ENSG00000176547	ENST00000319856	T	0.01185	5.21	5.78	-5.09	0.02920	GPCR, rhodopsin-like superfamily (1);	1.881030	0.02539	N	0.094430	T	0.01353	0.0044	L	0.31578	0.945	0.09310	N	1	B	0.19706	0.038	B	0.23150	0.044	T	0.48115	-0.9063	10	0.87932	D	0	.	9.7621	0.40539	0.0:0.264:0.0992:0.6368	.	108	Q8NH37	OR4C3_HUMAN	G	135	ENSP00000321419:V135G	ENSP00000321419:V135G	V	+	2	0	OR4C3	48303472	0.000000	0.05858	0.000000	0.03702	0.900000	0.52787	-0.977000	0.03782	-0.914000	0.03827	0.391000	0.25812	GTT	OR4C3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000176547		0.483	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C3	HGNC	protein_coding	OTTHUMT00000390557.1	-	0.00	80	0	T	NM_001004702		48346896	+1	tier1	-	no_errors	ENST00000319856	ensembl	human	known	74_37	missense	8.00	69	6	SNP	0.000	G
OR4A16	81327	genome.wustl.edu	37	11	55110764	55110764	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:55110764T>G	ENST00000314721.2	+	1	138	c.88T>G	c.(88-90)Tta>Gta	p.L30V		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	30						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						TGTCATGTTTTTACTCATATA	0.423																																																	0													99.0	92.0	94.0					11																	55110764		2201	4296	6497	SO:0001583	missense	0			AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.88T>G	11.37:g.55110764T>G	ENSP00000325128:p.Leu30Val		Q6IFL3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L30V	ENST00000314721.2	37	c.88	CCDS31499.1	11	.	.	.	.	.	.	.	.	.	.	T	3.106	-0.183647	0.06340	.	.	ENSG00000181961	ENST00000314721	T	0.01902	4.57	2.41	0.0474	0.14280	.	.	.	.	.	T	0.11410	0.0278	M	0.92367	3.3	0.09310	N	1	D	0.57899	0.981	P	0.60949	0.881	T	0.05131	-1.0904	9	0.66056	D	0.02	.	5.4636	0.16630	0.0:0.3017:0.0:0.6982	.	30	Q8NH70	O4A16_HUMAN	V	30	ENSP00000325128:L30V	ENSP00000325128:L30V	L	+	1	2	OR4A16	54867340	0.000000	0.05858	0.371000	0.25978	0.016000	0.09150	0.170000	0.16663	0.183000	0.20059	0.155000	0.16302	TTA	OR4A16	-	prints_GPCR_Rhodpsn	ENSG00000181961		0.423	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A16	HGNC	protein_coding	OTTHUMT00000391160.1	-	0.00	38	0	T	NM_001005274		55110764	+1	tier1	-	no_errors	ENST00000314721	ensembl	human	known	74_37	missense	24.32	28	9	SNP	0.068	G
OR8I2	120586	genome.wustl.edu	37	11	55861094	55861094	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:55861094T>C	ENST00000302124.2	+	1	342	c.311T>C	c.(310-312)tTt>tCt	p.F104S		NM_001003750.1	NP_001003750.1	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I, member 2	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(24)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	53	Esophageal squamous(21;0.00693)					ATGTACTTTTTTGTTGGATTG	0.408																																																	0													138.0	128.0	132.0					11																	55861094		2201	4296	6497	SO:0001583	missense	0			AB065656	CCDS31517.1	11q11	2012-08-09			ENSG00000172154	ENSG00000172154		"""GPCR / Class A : Olfactory receptors"""	15310	protein-coding gene	gene with protein product							Standard	NM_001003750		Approved		uc010rix.2	Q8N0Y5	OTTHUMG00000166831	ENST00000302124.2:c.311T>C	11.37:g.55861094T>C	ENSP00000303864:p.Phe104Ser		B2RNN4|Q6IFC0|Q96RC5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F104S	ENST00000302124.2	37	c.311	CCDS31517.1	11	.	.	.	.	.	.	.	.	.	.	T	11.24	1.580333	0.28180	.	.	ENSG00000172154	ENST00000302124	T	0.00406	7.55	4.5	3.37	0.38596	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41605	U	0.000856	T	0.00328	0.0010	M	0.64080	1.96	0.19775	N	0.999954	B	0.29432	0.244	B	0.22386	0.039	T	0.48269	-0.9050	10	0.62326	D	0.03	-12.8537	4.026	0.09687	0.1538:0.1763:0.0:0.6699	.	104	Q8N0Y5	OR8I2_HUMAN	S	104	ENSP00000303864:F104S	ENSP00000303864:F104S	F	+	2	0	OR8I2	55617670	0.320000	0.24616	0.911000	0.35937	0.258000	0.26162	1.520000	0.35899	0.703000	0.31848	0.362000	0.22060	TTT	OR8I2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000172154		0.408	OR8I2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8I2	HGNC	protein_coding		-	0.00	27	0	T	NM_001003750		55861094	+1	tier1	-	no_errors	ENST00000302124	ensembl	human	known	74_37	missense	18.60	35	8	SNP	0.094	C
OR5M1	390168	genome.wustl.edu	37	11	56380609	56380609	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:56380609C>A	ENST00000526538.1	-	1	369	c.370G>T	c.(370-372)Gta>Tta	p.V124L		NM_001004740.1	NP_001004740.1	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M, member 1	124						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|upper_aerodigestive_tract(1)	12						CAAATGGCTACATAGCGATCC	0.468																																																	0													155.0	142.0	146.0					11																	56380609		1997	4179	6176	SO:0001583	missense	0			AB065742	CCDS53631.1	11q11	2012-08-09				ENSG00000255012		"""GPCR / Class A : Olfactory receptors"""	8352	protein-coding gene	gene with protein product							Standard	NM_001004740		Approved	OST050	uc001nja.1	Q8NGP8		ENST00000526538.1:c.370G>T	11.37:g.56380609C>A	ENSP00000435416:p.Val124Leu		Q6IF60|Q96RB6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V124L	ENST00000526538.1	37	c.370	CCDS53631.1	11	.	.	.	.	.	.	.	.	.	.	C	13.42	2.231391	0.39399	.	.	ENSG00000255012	ENST00000526538	T	0.01406	4.93	3.71	2.73	0.32206	GPCR, rhodopsin-like superfamily (1);	0.250769	0.21539	N	0.072934	T	0.01523	0.0049	L	0.37466	1.105	0.27950	N	0.937171	P	0.40066	0.701	B	0.38921	0.285	T	0.44697	-0.9311	10	0.66056	D	0.02	-35.2183	7.6997	0.28615	0.1818:0.6413:0.1769:0.0	.	124	Q8NGP8	OR5M1_HUMAN	L	124	ENSP00000435416:V124L	ENSP00000435416:V124L	V	-	1	0	OR5M1	56137185	0.000000	0.05858	0.994000	0.49952	0.904000	0.53231	-1.058000	0.03482	1.949000	0.56562	0.280000	0.19369	GTA	OR5M1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000255012		0.468	OR5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M1	HGNC	protein_coding	OTTHUMT00000391610.1		0.00	45	0	C	NM_001004740		56380609	-1			no_errors	ENST00000526538	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.795	A
CCND1	595	genome.wustl.edu	37	11	69472228	69472228	+	IGR	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:69472228G>A	ENST00000227507.2	+	0	4307				ORAOV1_ENST00000542515.1_5'UTR	NM_053056.2	NP_444284.1	P24385	CCND1_HUMAN	cyclin D1						canonical Wnt signaling pathway (GO:0060070)|cell division (GO:0051301)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|lactation (GO:0007595)|Leydig cell differentiation (GO:0033327)|liver development (GO:0001889)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ regeneration (GO:0031100)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|positive regulation of protein phosphorylation (GO:0001934)|re-entry into mitotic cell cycle (GO:0000320)|response to calcium ion (GO:0051592)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to organonitrogen compound (GO:0010243)|response to UV-A (GO:0070141)|response to vitamin E (GO:0033197)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)|transcriptional repressor complex (GO:0017053)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|proline-rich region binding (GO:0070064)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			NS(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|ovary(1)|urinary_tract(1)	23	all_cancers(3;2.01e-114)|all_epithelial(3;3.59e-122)|Breast(3;5.4e-34)|all_lung(4;1.99e-21)|Lung NSC(4;4.65e-21)|Hepatocellular(3;8.22e-16)|Melanoma(5;1.89e-05)|Ovarian(3;0.0348)		Epithelial(3;7.2e-57)|all cancers(3;7.75e-51)|BRCA - Breast invasive adenocarcinoma(2;4.9e-48)|Lung(3;1.13e-16)|LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)|LUAD - Lung adenocarcinoma(13;0.0537)		Arsenic trioxide(DB01169)	TCATGCCTGGGCACCTTCCTG	0.597			T	"""IGH@, FSTL3"""	"""CLL, B-ALL, breast"""					Multiple Myeloma(6;0.086)																											Pancreas(65;393 884 2788 21700 24360 27795 36895)			Dom	yes		11	11q13	595	cyclin D1		"""L, E"""	0																																										SO:0001628	intergenic_variant	0			Z23022	CCDS8191.1	11q13	2008-07-18	2005-09-12		ENSG00000110092	ENSG00000110092			1582	protein-coding gene	gene with protein product	"""parathyroid adenomatosis 1"", ""B-cell CLL/lymphoma 1"", ""G1/S-specific cyclin D1"""	168461	"""cyclin D1 (PRAD1: parathyroid adenomatosis 1)"""	BCL1, D11S287E, PRAD1		1826542, 1833066	Standard	XM_006718653		Approved	U21B31	uc001opa.3	P24385	OTTHUMG00000167877		11.37:g.69472228G>A			Q6LEF0	RNA	SNP	-	NULL	ENST00000227507.2	37	NULL	CCDS8191.1	11																																																																																			ORAOV1	-	-	ENSG00000149716		0.597	CCND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORAOV1	HGNC	protein_coding	OTTHUMT00000396775.2	-	0.00	40	0	G	NM_053056		69472228	-1	tier1	-	no_errors	ENST00000542515	ensembl	human	known	74_37	rna	6.78	55	4	SNP	0.000	A
OTOR	56914	genome.wustl.edu	37	20	16730646	16730646	+	Silent	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr20:16730646T>C	ENST00000246081.2	+	3	398	c.354T>C	c.(352-354)gtT>gtC	p.V118V	OTOR_ENST00000486129.1_3'UTR	NM_020157.2	NP_064542.1	Q9NRC9	OTOR_HUMAN	otoraplin	118					cartilage condensation (GO:0001502)|sensory perception of sound (GO:0007605)	extracellular region (GO:0005576)		p.V118V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|liver(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	10						CCAAGGAAGTTCCCACCACGG	0.483																																																	1	Substitution - coding silent(1)	central_nervous_system(1)											97.0	74.0	82.0					20																	16730646		2203	4300	6503	SO:0001819	synonymous_variant	0			AF233261	CCDS13124.1	20p12.1-p11.23	2005-11-14			ENSG00000125879	ENSG00000125879			8517	protein-coding gene	gene with protein product		606067				10873378	Standard	NM_020157		Approved	MIAL, MIAL1, FDP	uc002wpj.3	Q9NRC9	OTTHUMG00000031931	ENST00000246081.2:c.354T>C	20.37:g.16730646T>C			D3DW22|Q3MIU6	Silent	SNP	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain	p.V118	ENST00000246081.2	37	c.354	CCDS13124.1	20																																																																																			OTOR	-	superfamily_SH3_domain	ENSG00000125879		0.483	OTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOR	HGNC	protein_coding	OTTHUMT00000078108.2	-	0.00	43	0	T			16730646	+1	tier1	-	no_errors	ENST00000246081	ensembl	human	known	74_37	silent	31.58	39	18	SNP	0.856	C
PAH	5053	genome.wustl.edu	37	12	103237424	103237424	+	Splice_Site	SNP	C	C	G	rs199475603|rs199475658|rs199475590		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:103237424C>G	ENST00000553106.1	-	11	1671	c.1199G>C	c.(1198-1200)aGg>aCg	p.R400T	PAH_ENST00000307000.2_Splice_Site_p.R395T	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	400			Missing (in PKU; haplotype 7).		catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)			endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	ACCACCTCACCTTACTTTCTC	0.532																																																	0			GRCh37	CD962118|CM034748|CM056669	PAH	D|M							119.0	111.0	114.0					12																	103237424		2203	4300	6503	SO:0001630	splice_region_variant	0			U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.1199+1G>C	12.37:g.103237424C>G			Q16717|Q8TC14	Missense_Mutation	SNP	pfam_Aromatic-AA_hydroxylase_C,pfam_ACT_dom,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Phe-4-hydroxylase_tetra	p.R400T	ENST00000553106.1	37	c.1199	CCDS9092.1	12	.	.	.	.	.	.	.	.	.	.	C	20.9	4.072458	0.76415	.	.	ENSG00000171759	ENST00000553106;ENST00000307000	D;D	0.99660	-6.32;-6.32	5.34	4.44	0.53790	Aromatic amino acid hydroxylase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.98880	0.9621	M	0.71296	2.17	0.80722	D	1	B	0.23650	0.089	B	0.32149	0.141	D	0.99951	1.1548	9	.	.	.	-16.0503	14.3913	0.66981	0.0:0.9274:0.0:0.0726	rs62652668	400	P00439	PH4H_HUMAN	T	400;395	ENSP00000448059:R400T;ENSP00000303500:R395T	.	R	-	2	0	PAH	101761554	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	5.940000	0.70187	2.494000	0.84150	0.591000	0.81541	AGG	PAH	-	pfam_Aromatic-AA_hydroxylase_C,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,tigrfam_Phe-4-hydroxylase_tetra	ENSG00000171759		0.532	PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAH	HGNC	protein_coding	OTTHUMT00000406692.1	-	0.00	47	0	C		Missense_Mutation	103237424	-1	tier1	rs199475658	no_errors	ENST00000553106	ensembl	human	known	74_37	missense	17.07	68	14	SNP	1.000	G
PANK2	80025	genome.wustl.edu	37	20	3899433	3899433	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr20:3899433C>T	ENST00000316562.4	+	6	1658	c.1652C>T	c.(1651-1653)tCg>tTg	p.S551L	MIR103A2_ENST00000362154.1_RNA|PANK2_ENST00000497424.1_Missense_Mutation_p.S260L|PANK2_ENST00000610179.1_Missense_Mutation_p.S428L	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	551					aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GCACTTTTTTCGGAACACGAG	0.443																																																	0													234.0	230.0	231.0					20																	3899433		2203	4300	6503	SO:0001583	missense	0			AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.1652C>T	20.37:g.3899433C>T	ENSP00000313377:p.Ser551Leu		B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	pfam_Type_II_PanK,tigrfam_Type_II_PanK	p.S551L	ENST00000316562.4	37	c.1652	CCDS13071.2	20	.	.	.	.	.	.	.	.	.	.	C	6.976	0.550151	0.13374	.	.	ENSG00000125779	ENST00000497424;ENST00000316562;ENST00000399552	D;D	0.98747	-5.11;-5.11	5.12	3.16	0.36331	.	0.084010	0.49916	D	0.000133	T	0.79730	0.4496	N	0.00002	-3.635	0.31464	N	0.669179	B	0.12630	0.006	B	0.04013	0.001	T	0.82244	-0.0553	10	0.02654	T	1	.	5.2144	0.15334	0.0:0.6513:0.1704:0.1783	.	551	Q9BZ23	PANK2_HUMAN	L	260;551;367	ENSP00000417609:S260L;ENSP00000313377:S551L	ENSP00000313377:S551L	S	+	2	0	PANK2	3847433	1.000000	0.71417	0.989000	0.46669	0.998000	0.95712	5.966000	0.70395	0.719000	0.32188	0.655000	0.94253	TCG	PANK2	-	pfam_Type_II_PanK,tigrfam_Type_II_PanK	ENSG00000125779		0.443	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PANK2	HGNC	protein_coding	OTTHUMT00000077793.2		0.00	56	0	C	NM_024960		3899433	+1			no_errors	ENST00000316562	ensembl	human	known	74_37	missense	8.20	56	5	SNP	0.978	T
PARS2	25973	genome.wustl.edu	37	1	55224664	55224664	+	Silent	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:55224664G>T	ENST00000371279.3	-	2	253	c.171C>A	c.(169-171)ctC>ctA	p.L57L		NM_152268.3	NP_689481.2	Q7L3T8	SYPM_HUMAN	prolyl-tRNA synthetase 2, mitochondrial (putative)	57					gene expression (GO:0010467)|prolyl-tRNA aminoacylation (GO:0006433)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|proline-tRNA ligase activity (GO:0004827)			breast(1)|endometrium(3)|kidney(2)|lung(4)|ovary(2)|prostate(2)|skin(1)	15					L-Proline(DB00172)	CCTGCAGGGAGAGCACCCGGT	0.602																																																	0													41.0	41.0	41.0					1																	55224664		2203	4300	6503	SO:0001819	synonymous_variant	0			AK025585	CCDS597.1	1p32.2	2011-07-01	2007-02-23		ENSG00000162396	ENSG00000162396	6.1.1.15	"""Aminoacyl tRNA synthetases / Class II"""	30563	protein-coding gene	gene with protein product	"""proline tRNA ligase 2, mitochondrial (putative)"""	612036				15779907	Standard	NM_152268		Approved	DKFZp727A071	uc001cxy.3	Q7L3T8	OTTHUMG00000009915	ENST00000371279.3:c.171C>A	1.37:g.55224664G>T			A8K0W4|Q9H6S5|Q9UFT1	Silent	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,superfamily_Anticodon-bd,pfscan_aa-tRNA-synth_II,prints_Pro-tRNA-ligase_IIa	p.L57	ENST00000371279.3	37	c.171	CCDS597.1	1																																																																																			PARS2	-	pfscan_aa-tRNA-synth_II	ENSG00000162396		0.602	PARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARS2	HGNC	protein_coding	OTTHUMT00000027436.1	-	0.00	35	0	G	NM_152268		55224664	-1	tier1	-	no_errors	ENST00000371279	ensembl	human	known	74_37	silent	7.55	49	4	SNP	0.000	T
PASD1	139135	genome.wustl.edu	37	X	150791459	150791459	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:150791459T>G	ENST00000370357.4	+	7	714	c.469T>G	c.(469-471)Ttt>Gtt	p.F157V		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	157						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					CTGTGCTGACTTTGCTGCATG	0.463																																																	0													265.0	209.0	228.0					X																	150791459		2203	4300	6503	SO:0001583	missense	0			AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.469T>G	X.37:g.150791459T>G	ENSP00000359382:p.Phe157Val		Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	superfamily_PAS,smart_PAS,pfscan_PAS	p.F157V	ENST00000370357.4	37	c.469	CCDS35431.1	X	.	.	.	.	.	.	.	.	.	.	t	7.150	0.583580	0.13749	.	.	ENSG00000166049	ENST00000370357	T	0.69040	-0.37	3.32	-6.64	0.01801	.	.	.	.	.	T	0.40932	0.1137	N	0.24115	0.695	0.09310	N	1	B	0.26258	0.145	B	0.21151	0.033	T	0.19516	-1.0303	9	0.51188	T	0.08	.	1.181	0.01845	0.3965:0.2975:0.1329:0.1731	.	157	Q8IV76	PASD1_HUMAN	V	157	ENSP00000359382:F157V	ENSP00000359382:F157V	F	+	1	0	PASD1	150542115	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.531000	0.00943	-2.276000	0.00678	-1.804000	0.00617	TTT	PASD1	-	NULL	ENSG00000166049		0.463	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PASD1	HGNC	protein_coding	OTTHUMT00000060879.2	-	0.00	27	0	T	NM_173493		150791459	+1	tier1	-	no_errors	ENST00000370357	ensembl	human	known	74_37	missense	35.90	25	14	SNP	0.000	G
PCDH17	27253	genome.wustl.edu	37	13	58299065	58299065	+	Silent	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr13:58299065A>G	ENST00000377918.3	+	4	3143	c.3117A>G	c.(3115-3117)ccA>ccG	p.P1039P		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	1039					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CAAGCAGCCCAACCAAGGCGT	0.532																																					Melanoma(72;952 1291 1619 12849 33676)												0													86.0	86.0	86.0					13																	58299065		2203	4300	6503	SO:0001819	synonymous_variant	0			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.3117A>G	13.37:g.58299065A>G			A8K1R5|Q5VVW9|Q5VVX0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P1039	ENST00000377918.3	37	c.3117	CCDS31986.1	13																																																																																			PCDH17	-	NULL	ENSG00000118946		0.532	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH17	HGNC	protein_coding	OTTHUMT00000045139.1	-	0.00	24	0	A	NM_001040429		58299065	+1	tier1	-	no_errors	ENST00000377918	ensembl	human	known	74_37	silent	33.33	16	8	SNP	0.580	G
PCDHA11	56138	genome.wustl.edu	37	5	140250534	140250534	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:140250534G>A	ENST00000398640.2	+	1	1846	c.1846G>A	c.(1846-1848)Ggc>Agc	p.G616S	PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	616	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCGGCGGGCGGCTCGCGCAT	0.667																																																	0													42.0	51.0	48.0					5																	140250534		2202	4299	6501	SO:0001583	missense	0			AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1846G>A	5.37:g.140250534G>A	ENSP00000381636:p.Gly616Ser		B2RN58|O75279	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G616S	ENST00000398640.2	37	c.1846	CCDS47284.1	5	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.517379	0.00975	.	.	ENSG00000249158	ENST00000398640	T	0.52057	0.68	4.78	1.88	0.25563	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.23054	0.0557	N	0.11255	0.115	0.09310	N	1	B;B	0.26258	0.145;0.046	B;B	0.20767	0.031;0.025	T	0.23655	-1.0182	9	0.12430	T	0.62	.	7.11	0.25384	0.3967:0.0:0.6033:0.0	.	616;616	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	S	616	ENSP00000381636:G616S	ENSP00000381636:G616S	G	+	1	0	PCDHA11	140230718	0.047000	0.20315	0.000000	0.03702	0.001000	0.01503	1.160000	0.31761	0.073000	0.16731	-1.189000	0.01698	GGC	PCDHA11	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000249158		0.667	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA11	HGNC	protein_coding	OTTHUMT00000372885.2	-	0.00	119	0	G	NM_018902		140250534	+1	tier1	-	no_errors	ENST00000398640	ensembl	human	known	74_37	missense	15.82	133	25	SNP	0.000	A
PCDHB7	56129	genome.wustl.edu	37	5	140553230	140553230	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:140553230G>A	ENST00000231137.3	+	1	988	c.814G>A	c.(814-816)Gga>Aga	p.G272R		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	272	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTTAGATACCGGAAGTAATGG	0.468																																																	0													74.0	78.0	77.0					5																	140553230		2203	4300	6503	SO:0001583	missense	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.814G>A	5.37:g.140553230G>A	ENSP00000231137:p.Gly272Arg		A1L3Y8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G272R	ENST00000231137.3	37	c.814	CCDS4249.1	5	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959618	0.74016	.	.	ENSG00000113212	ENST00000231137;ENST00000543636	T	0.03468	3.92	4.61	3.72	0.42706	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.23492	0.0568	M	0.92923	3.36	0.49687	D	0.999815	D	0.89917	1.0	D	0.97110	1.0	T	0.10268	-1.0637	9	0.87932	D	0	.	13.2502	0.60048	0.0838:0.0:0.9162:0.0	.	272	Q9Y5E2	PCDB7_HUMAN	R	272;55	ENSP00000231137:G272R	ENSP00000231137:G272R	G	+	1	0	PCDHB7	140533414	1.000000	0.71417	0.684000	0.30055	0.995000	0.86356	6.677000	0.74503	2.248000	0.74166	0.655000	0.94253	GGA	PCDHB7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113212		0.468	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2		0.00	36	0	G	NM_018940		140553230	+1			no_errors	ENST00000231137	ensembl	human	known	74_37	missense	15.56	38	7	SNP	0.997	A
PCID2	55795	genome.wustl.edu	37	13	113839842	113839842	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr13:113839842C>T	ENST00000337344.4	-	8	576	c.500G>A	c.(499-501)gGc>gAc	p.G167D	PCID2_ENST00000375477.1_Missense_Mutation_p.G167D|PCID2_ENST00000246505.5_Missense_Mutation_p.G221D|PCID2_ENST00000375479.2_Missense_Mutation_p.G167D|PCID2_ENST00000375457.2_Missense_Mutation_p.G165D|PCID2_ENST00000493650.1_5'UTR|PCID2_ENST00000375459.1_Missense_Mutation_p.G165D	NM_001127202.2	NP_001120674.1	Q5JVF3	PCID2_HUMAN	PCI domain containing 2	167					negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mRNA stability (GO:0043488)|spleen development (GO:0048536)					breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)	20	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			AAACAGCATGCCCCACTTCTT	0.348																																																	0													128.0	124.0	125.0					13																	113839842		2203	4300	6503	SO:0001583	missense	0			AK002167	CCDS9532.2, CCDS58301.1, CCDS58302.1	13q34	2006-03-31			ENSG00000126226	ENSG00000126226			25653	protein-coding gene	gene with protein product		613713				12477932	Standard	NM_001127203		Approved	FLJ11305	uc031qnm.1	Q5JVF3	OTTHUMG00000017385	ENST00000337344.4:c.500G>A	13.37:g.113839842C>T	ENSP00000337405:p.Gly167Asp		A6NK09|Q3ZCX1|Q5TC57|Q5TC58|Q9H7K1|Q9HBZ7|Q9NUK6|Q9NVY1|Q9NW44|Q9NWH3	Missense_Mutation	SNP	pfam_PCI_dom,smart_PAM	p.G221D	ENST00000337344.4	37	c.662	CCDS9532.2	13	.	.	.	.	.	.	.	.	.	.	C	21.9	4.220155	0.79464	.	.	ENSG00000126226	ENST00000337344;ENST00000375479;ENST00000375477;ENST00000246505;ENST00000375459;ENST00000375457;ENST00000375462;ENST00000246506;ENST00000351317	.	.	.	5.21	4.37	0.52481	PCI/PINT associated module (1);	0.000000	0.85682	D	0.000000	D	0.83949	0.5365	M	0.90759	3.145	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.86313	0.1687	9	0.52906	T	0.07	-20.2664	13.7278	0.62769	0.0:0.926:0.0:0.074	.	221;167	Q5JVF3-4;Q5JVF3	.;PCID2_HUMAN	D	167;167;167;221;165;165;144;167;144	.	ENSP00000246505:G221D	G	-	2	0	PCID2	112887843	1.000000	0.71417	0.940000	0.37924	0.910000	0.53928	7.407000	0.80029	1.197000	0.43143	-0.251000	0.11542	GGC	PCID2	-	smart_PAM	ENSG00000126226		0.348	PCID2-002	KNOWN	alternative_3_UTR|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	PCID2	HGNC	protein_coding	OTTHUMT00000045897.1	-	0.00	63	0	C	NM_018386		113839842	-1	tier1	-	no_errors	ENST00000246505	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.999	T
PCNT	5116	genome.wustl.edu	37	21	47819540	47819540	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr21:47819540G>A	ENST00000359568.5	+	25	4728	c.4621G>A	c.(4621-4623)Gat>Aat	p.D1541N	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1541					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					AGAAAAGTTGGATGAATTTAA	0.328																																																	0													82.0	91.0	88.0					21																	47819540		2203	4300	6503	SO:0001583	missense	0			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.4621G>A	21.37:g.47819540G>A	ENSP00000352572:p.Asp1541Asn		O43152|Q7Z7C9	Missense_Mutation	SNP	pfam_PACT_domain	p.D1541N	ENST00000359568.5	37	c.4621	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	G	27.9	4.868745	0.91587	.	.	ENSG00000160299	ENST00000359568	T	0.65549	-0.16	5.74	5.74	0.90152	.	0.000000	0.34959	N	0.003554	T	0.80391	0.4614	M	0.81341	2.54	0.33913	D	0.639978	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.984	D	0.85287	0.1065	10	0.49607	T	0.09	.	17.4165	0.87502	0.0:0.0:1.0:0.0	.	1423;1541	O95613-2;O95613	.;PCNT_HUMAN	N	1541	ENSP00000352572:D1541N	ENSP00000352572:D1541N	D	+	1	0	PCNT	46643968	1.000000	0.71417	0.987000	0.45799	0.880000	0.50808	4.858000	0.62947	2.707000	0.92482	0.651000	0.88453	GAT	PCNT	-	NULL	ENSG00000160299		0.328	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1	-	0.00	54	0	G	NM_006031		47819540	+1	tier1	-	no_errors	ENST00000359568	ensembl	human	known	74_37	missense	40.74	32	22	SNP	0.995	A
PDE4B	5142	genome.wustl.edu	37	1	66384385	66384385	+	Silent	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:66384385T>C	ENST00000329654.4	+	3	335	c.148T>C	c.(148-150)Tta>Cta	p.L50L	PDE4B_ENST00000371049.3_Silent_p.L50L	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	50					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	CTCAGGAAACTTACAGTTACC	0.468																																																	0													99.0	94.0	96.0					1																	66384385		2203	4300	6503	SO:0001819	synonymous_variant	0			L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.148T>C	1.37:g.66384385T>C			A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Silent	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.L50	ENST00000329654.4	37	c.148	CCDS632.1	1																																																																																			PDE4B	-	NULL	ENSG00000184588		0.468	PDE4B-001	KNOWN	basic|CCDS	protein_coding	PDE4B	HGNC	protein_coding	OTTHUMT00000025188.3	-	0.00	36	0	T	NM_002600		66384385	+1	tier1	-	no_errors	ENST00000329654	ensembl	human	known	74_37	silent	10.53	34	4	SNP	0.997	C
PDE4B	5142	genome.wustl.edu	37	1	66798111	66798111	+	Intron	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:66798111C>T	ENST00000329654.4	+	8	821				PDE4B_ENST00000423207.2_Intron|PDE4B_ENST00000371049.3_Intron|PDE4B_ENST00000371045.5_Silent_p.I13I	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific						cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	GCACCGGAATCAGCGGTGGTA	0.522																																																	0													86.0	86.0	86.0					1																	66798111		2203	4300	6503	SO:0001627	intron_variant	0			L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.635-80C>T	1.37:g.66798111C>T			A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Silent	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.I13	ENST00000329654.4	37	c.39	CCDS632.1	1																																																																																			PDE4B	-	NULL	ENSG00000184588		0.522	PDE4B-001	KNOWN	basic|CCDS	protein_coding	PDE4B	HGNC	protein_coding	OTTHUMT00000025188.3	-	0.00	26	0	C	NM_002600		66798111	+1	tier1	-	no_errors	ENST00000371045	ensembl	human	known	74_37	silent	30.00	14	6	SNP	0.426	T
PDIA6	10130	genome.wustl.edu	37	2	10942647	10942647	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:10942647G>T	ENST00000272227.3	-	2	286	c.139C>A	c.(139-141)Ctt>Att	p.L47I	PDIA6_ENST00000404824.2_Missense_Mutation_p.L95I|PDIA6_ENST00000489662.1_5'UTR|PDIA6_ENST00000540494.1_Missense_Mutation_p.L44I|PDIA6_ENST00000381611.4_Missense_Mutation_p.L52I|PDIA6_ENST00000404371.2_Missense_Mutation_p.L99I	NM_001282707.1|NM_005742.2	NP_001269636.1|NP_005733.1	Q15084	PDIA6_HUMAN	protein disulfide isomerase family A, member 6	47	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein disulfide isomerase activity (GO:0003756)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)	18	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)		AATTCTACAAGCCACAAACTA	0.333																																					GBM(73;509 1219 34219 41343 41551)												0													72.0	71.0	71.0					2																	10942647		2203	4300	6503	SO:0001583	missense	0			BC001312	CCDS1675.1, CCDS62852.1, CCDS62853.1, CCDS62854.1, CCDS62855.1	2p25.1	2009-11-20	2005-06-29	2005-03-03	ENSG00000143870	ENSG00000143870	5.3.4.1	"""Protein disulfide isomerases"""	30168	protein-coding gene	gene with protein product	"""protein disulfide isomerase-related protein"""	611099	"""thioredoxin domain containing 7 (protein disulfide isomerase)"", ""protein disulfide isomerase-associated 6"""	TXNDC7		7590364, 12204115	Standard	XM_005246145		Approved	P5, ERp5	uc002rau.3	Q15084	OTTHUMG00000090479	ENST00000272227.3:c.139C>A	2.37:g.10942647G>T	ENSP00000272227:p.Leu47Ile		B3KY95|B5MCQ5|B7Z254|B7Z4M8|F8WA83|Q53RC7|Q6ZSH5|Q99778	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold,prints_Thioredoxin,tigrfam_Disulphide_isomerase	p.L52I	ENST00000272227.3	37	c.154	CCDS1675.1	2	.	.	.	.	.	.	.	.	.	.	G	16.54	3.151049	0.57151	.	.	ENSG00000143870	ENST00000272227;ENST00000404371;ENST00000404824;ENST00000540494;ENST00000381611	T;T;T;T;T	0.52983	0.64;0.64;0.64;0.64;0.64	6.03	6.03	0.97812	Thioredoxin domain (1);Thioredoxin, conserved site (1);Thioredoxin-like fold (3);Disulphide isomerase (1);	0.000000	0.85682	D	0.000000	T	0.53722	0.1814	L	0.47716	1.5	0.80722	D	1	B;B;B;B	0.19817	0.0;0.002;0.001;0.039	B;B;B;B	0.40782	0.028;0.096;0.096;0.34	T	0.43861	-0.9365	10	0.12430	T	0.62	.	20.5666	0.99351	0.0:0.0:1.0:0.0	.	44;95;99;47	B7Z254;B5MCQ5;Q15084-2;Q15084	.;.;.;PDIA6_HUMAN	I	47;99;95;44;52	ENSP00000272227:L47I;ENSP00000385385:L99I;ENSP00000384459:L95I;ENSP00000438778:L44I;ENSP00000371024:L52I	ENSP00000272227:L47I	L	-	1	0	PDIA6	10860098	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.111000	0.77077	2.854000	0.98071	0.655000	0.94253	CTT	PDIA6	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold,prints_Thioredoxin,tigrfam_Disulphide_isomerase	ENSG00000143870		0.333	PDIA6-001	KNOWN	basic|CCDS	protein_coding	PDIA6	HGNC	protein_coding	OTTHUMT00000206933.1	-	0.00	67	0	G	NM_005742		10942647	-1	tier1	-	no_errors	ENST00000381611	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
PDZD4	57595	genome.wustl.edu	37	X	153073805	153073805	+	Intron	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:153073805G>T	ENST00000164640.4	-	2	488				PDZD4_ENST00000544474.1_Intron|PDZD4_ENST00000393758.2_Silent_p.L21L|PDZD4_ENST00000475140.1_Intron	NM_032512.2	NP_115901.2	Q76G19	PDZD4_HUMAN	PDZ domain containing 4							cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(5)|lung(13)|skin(1)	23	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACAGCTCAGAGAGGACGTACG	0.672																																																	0													32.0	26.0	28.0					X																	153073805		2199	4295	6494	SO:0001627	intron_variant	0			AK091444	CCDS14732.1	Xq28	2008-02-05		2006-01-24	ENSG00000067840	ENSG00000067840			21167	protein-coding gene	gene with protein product		300634		PDZK4		10819331, 15077175	Standard	NM_032512		Approved	KIAA1444, LU1, FLJ34125, PDZRN4L	uc004fiz.1	Q76G19	OTTHUMG00000024209	ENST00000164640.4:c.296+9C>A	X.37:g.153073805G>T			B3KXB1|B7ZKY3|Q8NB75|Q9BUH9|Q9P284	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L21	ENST00000164640.4	37	c.63	CCDS14732.1	X																																																																																			PDZD4	-	NULL	ENSG00000067840		0.672	PDZD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD4	HGNC	protein_coding	OTTHUMT00000061013.3	-	0.00	29	0	G	NM_032512		153073805	-1	tier1	-	no_errors	ENST00000393758	ensembl	human	known	74_37	silent	56.41	17	22	SNP	0.471	T
PDZD7	79955	genome.wustl.edu	37	10	102778884	102778884	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:102778884C>T	ENST00000370215.3	-	8	1244	c.1019G>A	c.(1018-1020)gGc>gAc	p.G340D		NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	340	Ser-rich.					cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		CGGCAGGGAGCCCGAGCTGTA	0.721											OREG0020453	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													4.0	5.0	5.0					10																	102778884		2059	4140	6199	SO:0001583	missense	0			AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.1019G>A	10.37:g.102778884C>T	ENSP00000359234:p.Gly340Asp	1369	D5FJ77|Q8N321	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.G340D	ENST00000370215.3	37	c.1019	CCDS31269.1	10	.	.	.	.	.	.	.	.	.	.	C	5.972	0.363243	0.11296	.	.	ENSG00000186862	ENST00000393462;ENST00000370215	T	0.11495	2.77	5.21	4.32	0.51571	.	1.153170	0.06133	N	0.670954	T	0.07954	0.0199	N	0.19112	0.55	0.35462	D	0.796587	P;B	0.38922	0.651;0.006	B;B	0.36030	0.216;0.013	T	0.21759	-1.0236	10	0.11485	T	0.65	.	10.1507	0.42791	0.0:0.7453:0.1751:0.0795	.	340;340	Q9H5P4;Q9H5P4-2	PDZD7_HUMAN;.	D	340	ENSP00000359234:G340D	ENSP00000359234:G340D	G	-	2	0	PDZD7	102768874	0.875000	0.30112	0.958000	0.39756	0.034000	0.12701	1.711000	0.37930	1.207000	0.43291	-0.224000	0.12420	GGC	PDZD7	-	NULL	ENSG00000186862		0.721	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD7	HGNC	protein_coding	OTTHUMT00000049883.1		0.00	18	0	C	NM_024895		102778884	-1			no_errors	ENST00000370215	ensembl	human	known	74_37	missense	17.39	19	4	SNP	0.978	T
PELI2	57161	genome.wustl.edu	37	14	56763841	56763841	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr14:56763841A>G	ENST00000267460.4	+	6	1506	c.1220A>G	c.(1219-1221)gAg>gGg	p.E407G		NM_021255.2	NP_067078.1	Q9HAT8	PELI2_HUMAN	pellino E3 ubiquitin protein ligase family member 2	407					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein phosphorylation (GO:0001934)|protein ubiquitination (GO:0016567)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)	ligase activity (GO:0016874)			kidney(6)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	22						CTGGTTGGGGAGCAAAACTGC	0.458																																																	0													78.0	73.0	74.0					14																	56763841		2203	4300	6503	SO:0001583	missense	0			AF302502	CCDS9726.1	14q21	2012-02-23	2012-02-23		ENSG00000139946	ENSG00000139946		"""Pellino homologs"""	8828	protein-coding gene	gene with protein product		614798	"""pellino (Drosophila) homolog 2"", ""pellino homolog 2 (Drosophila)"""			11306823, 12860405	Standard	XM_006720211		Approved		uc001xch.3	Q9HAT8	OTTHUMG00000152336	ENST00000267460.4:c.1220A>G	14.37:g.56763841A>G	ENSP00000267460:p.Glu407Gly		B2RDY5	Missense_Mutation	SNP	pfam_Pellino_fam	p.E407G	ENST00000267460.4	37	c.1220	CCDS9726.1	14	.	.	.	.	.	.	.	.	.	.	A	20.9	4.062454	0.76187	.	.	ENSG00000139946	ENST00000267460	T	0.48201	0.82	5.83	5.83	0.93111	.	0.193295	0.53938	D	0.000042	T	0.54775	0.1879	M	0.72894	2.215	0.51767	D	0.999936	B	0.31705	0.336	B	0.37833	0.259	T	0.57723	-0.7762	10	0.62326	D	0.03	-35.1406	16.1936	0.82006	1.0:0.0:0.0:0.0	.	407	Q9HAT8	PELI2_HUMAN	G	407	ENSP00000267460:E407G	ENSP00000267460:E407G	E	+	2	0	PELI2	55833594	0.974000	0.33945	0.997000	0.53966	0.976000	0.68499	3.176000	0.50863	2.229000	0.72834	0.454000	0.30748	GAG	PELI2	-	pfam_Pellino_fam	ENSG00000139946		0.458	PELI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PELI2	HGNC	protein_coding	OTTHUMT00000276925.1	-	0.00	39	0	A			56763841	+1	tier1	-	no_errors	ENST00000267460	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.995	G
PELI3	246330	genome.wustl.edu	37	11	66241227	66241227	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:66241227G>A	ENST00000320740.7	+	7	831	c.671G>A	c.(670-672)cGg>cAg	p.R224Q	CTD-3074O7.5_ENST00000533502.1_RNA|PELI3_ENST00000531856.1_Intron|PELI3_ENST00000524466.1_Missense_Mutation_p.R224Q|CTD-3074O7.5_ENST00000602951.1_RNA|PELI3_ENST00000349459.6_Missense_Mutation_p.R200Q|CTD-3074O7.5_ENST00000527092.1_RNA	NM_001243136.1|NM_145065.2	NP_001230065.1|NP_659502.2	Q8N2H9	PELI3_HUMAN	pellino E3 ubiquitin protein ligase family member 3	224					defense response to Gram-negative bacterium (GO:0050829)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of Toll signaling pathway (GO:0045751)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon production (GO:0032480)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|protein K63-linked ubiquitination (GO:0070534)|regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070428)|Toll signaling pathway (GO:0008063)	cytosol (GO:0005829)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	15						GCCAAATGGCGGACCCCAGAT	0.672																																																	0													54.0	55.0	55.0					11																	66241227		2200	4295	6495	SO:0001583	missense	0			AL834395	CCDS31615.1, CCDS41675.1, CCDS73328.1	11q13.2	2012-02-23	2012-02-23		ENSG00000174516	ENSG00000174516		"""Pellino homologs"""	30010	protein-coding gene	gene with protein product		609827	"""pellino homolog 3 (Drosophila)"""			12874243, 15917247	Standard	NM_145065		Approved	MGC35521	uc001oic.4	Q8N2H9	OTTHUMG00000167109	ENST00000320740.7:c.671G>A	11.37:g.66241227G>A	ENSP00000322532:p.Arg224Gln		Q8N3E1|Q8N9Q6|Q8TAW7|Q8TED5	Missense_Mutation	SNP	pfam_Pellino_fam	p.R224Q	ENST00000320740.7	37	c.671	CCDS31615.1	11	.	.	.	.	.	.	.	.	.	.	G	14.78	2.637977	0.47153	.	.	ENSG00000174516	ENST00000349459;ENST00000320740;ENST00000524466;ENST00000526296;ENST00000528752	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.22126	0.0533	N	0.10782	0.045	0.51012	D	0.999904	B;B;P	0.36378	0.174;0.43;0.55	B;B;B	0.37422	0.038;0.107;0.249	T	0.06643	-1.0815	10	0.13853	T	0.58	-28.6583	9.4995	0.39008	0.0938:0.0:0.9062:0.0	.	200;224;224	Q8N2H9-2;Q8N2H9;Q8N2H9-4	.;PELI3_HUMAN;.	Q	200;224;224;117;11	ENSP00000309848:R200Q;ENSP00000322532:R224Q;ENSP00000434677:R224Q;ENSP00000436722:R117Q;ENSP00000436161:R11Q	ENSP00000322532:R224Q	R	+	2	0	PELI3	65997803	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.693000	0.54735	2.746000	0.94184	0.655000	0.94253	CGG	PELI3	-	pfam_Pellino_fam	ENSG00000174516		0.672	PELI3-001	KNOWN	basic|CCDS	protein_coding	PELI3	HGNC	protein_coding	OTTHUMT00000393226.1	-	0.00	75	0	G	NM_145065		66241227	+1	tier1	-	no_errors	ENST00000320740	ensembl	human	known	74_37	missense	15.31	82	15	SNP	1.000	A
PFKP	5214	genome.wustl.edu	37	10	3154472	3154472	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:3154472G>A	ENST00000381125.4	+	11	1224	c.1148G>A	c.(1147-1149)cGa>cAa	p.R383Q	PFKP_ENST00000381075.2_Missense_Mutation_p.R375Q	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet	383	N-terminal catalytic PFK domain 1.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)			breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		GTTCGACTCCGAGGGAGGTGA	0.502																																																	0													140.0	137.0	138.0					10																	3154472		2203	4300	6503	SO:0001583	missense	0			AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.1148G>A	10.37:g.3154472G>A	ENSP00000370517:p.Arg383Gln		B3KS15|Q5VSR7|Q5VSR8	Missense_Mutation	SNP	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,prints_Phosphofructokinase,tigrfam_6-phosphofructokinase_euk	p.R383Q	ENST00000381125.4	37	c.1148	CCDS7059.1	10	.	.	.	.	.	.	.	.	.	.	G	22.9	4.346772	0.82022	.	.	ENSG00000067057	ENST00000381125;ENST00000397834;ENST00000381075;ENST00000415005	T;T;T	0.81078	-1.45;-1.45;-1.45	5.39	5.39	0.77823	Phosphofructokinase domain (1);	0.000000	0.85682	D	0.000000	D	0.92928	0.7750	H	0.95816	3.725	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.74348	0.983;0.983;0.974	D	0.94629	0.7820	10	0.87932	D	0	.	18.5094	0.90910	0.0:0.0:1.0:0.0	.	375;375;383	B3KS15;Q5VSR7;Q01813	.;.;K6PP_HUMAN	Q	383;372;375;167	ENSP00000370517:R383Q;ENSP00000370465:R375Q;ENSP00000408858:R167Q	ENSP00000370465:R375Q	R	+	2	0	PFKP	3144472	1.000000	0.71417	0.986000	0.45419	0.026000	0.11368	9.603000	0.98315	2.700000	0.92200	0.561000	0.74099	CGA	PFKP	-	superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,tigrfam_6-phosphofructokinase_euk	ENSG00000067057		0.502	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKP	HGNC	protein_coding	OTTHUMT00000046454.1		0.00	51	0	G	NM_002627		3154472	+1			no_errors	ENST00000381125	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	A
PIH1D1	55011	genome.wustl.edu	37	19	49952776	49952776	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:49952776C>T	ENST00000262265.5	-	3	528	c.293G>A	c.(292-294)cGc>cAc	p.R98H	PIH1D1_ENST00000602226.1_5'Flank|PIH1D1_ENST00000596049.1_Missense_Mutation_p.R98H	NM_017916.2	NP_060386.1	Q9NWS0	PIHD1_HUMAN	PIH1 domain containing 1	98					box C/D snoRNP assembly (GO:0000492)|epithelial cell differentiation (GO:0030855)	pre-snoRNP complex (GO:0070761)				NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|urinary_tract(1)	11		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)		CATGGGGATGCGAAACCCAGC	0.592																																																	0													120.0	106.0	111.0					19																	49952776		2203	4300	6503	SO:0001583	missense	0			AK000650	CCDS12765.1	19q13.33	2012-07-18	2007-01-31	2007-01-31	ENSG00000104872	ENSG00000104872			26075	protein-coding gene	gene with protein product		611480		NOP17		12477932	Standard	NM_017916		Approved	FLJ20643	uc002pns.2	Q9NWS0		ENST00000262265.5:c.293G>A	19.37:g.49952776C>T	ENSP00000262265:p.Arg98His		B4DGN7|B4E2X7|Q9BVL0	Missense_Mutation	SNP	pfam_PIH	p.R98H	ENST00000262265.5	37	c.293	CCDS12765.1	19	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046206	0.75846	.	.	ENSG00000104872	ENST00000262265	T	0.22134	1.97	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.44787	0.1310	M	0.74389	2.26	0.53688	D	0.999971	P;D	0.76494	0.789;0.999	B;D	0.64687	0.186;0.928	T	0.44128	-0.9348	10	0.87932	D	0	-13.0615	14.3008	0.66352	0.0:1.0:0.0:0.0	.	98;98	B4DGN7;Q9NWS0	.;PIHD1_HUMAN	H	98	ENSP00000262265:R98H	ENSP00000262265:R98H	R	-	2	0	PIH1D1	54644588	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	3.453000	0.52978	2.437000	0.82529	0.655000	0.94253	CGC	PIH1D1	-	pfam_PIH	ENSG00000104872		0.592	PIH1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIH1D1	HGNC	protein_coding	OTTHUMT00000465389.2	-	0.00	44	0	C	NM_017916		49952776	-1	tier1	-	no_errors	ENST00000262265	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
PIK3C2B	5287	genome.wustl.edu	37	1	204426964	204426964	+	Silent	SNP	G	G	T	rs533281881		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:204426964G>T	ENST00000367187.3	-	10	2161	c.1605C>A	c.(1603-1605)tcC>tcA	p.S535S	PIK3C2B_ENST00000424712.2_Silent_p.S535S|PIK3C2B_ENST00000496872.1_5'Flank	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	535					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			TGGCCTTGACGGACTGGACCA	0.632																																																	0													54.0	50.0	51.0					1																	204426964		2203	4300	6503	SO:0001819	synonymous_variant	0			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.1605C>A	1.37:g.204426964G>T			O95666|Q5SW99	Silent	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_dom,pfscan_C2_dom,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.S535	ENST00000367187.3	37	c.1605	CCDS1446.1	1																																																																																			PIK3C2B	-	NULL	ENSG00000133056		0.632	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2B	HGNC	protein_coding	OTTHUMT00000087965.1	-	0.00	39	0	G	NM_002646		204426964	-1	tier1	-	no_errors	ENST00000367187	ensembl	human	known	74_37	silent	38.10	26	16	SNP	0.056	T
PLCXD1	55344	genome.wustl.edu	37	X	205431	205431	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:205431C>T	ENST00000381657.2	+	3	673	c.159C>T	c.(157-159)aaC>aaT	p.N53N	PLCXD1_ENST00000381663.3_Silent_p.N53N|PLCXD1_ENST00000484611.2_3'UTR|PLCXD1_ENST00000399012.1_Silent_p.N53N	NM_018390.3	NP_060860.1	Q9NUJ7	PLCX1_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 1	53	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				lipid metabolic process (GO:0006629)		phosphoric diester hydrolase activity (GO:0008081)			endometrium(3)|large_intestine(1)|lung(7)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ACTGCCTGAACAAGAAGTCCC	0.617																																																	0													346.0	271.0	296.0					X																	205431		2203	4296	6499	SO:0001819	synonymous_variant	0			AK002185	CCDS14103.1	Xp22.33 and Yp11.32	2010-07-28			ENSG00000182378	ENSG00000182378		"""Pseudoautosomal regions / PAR1"""	23148	protein-coding gene	gene with protein product							Standard	NM_018390		Approved	FLJ11323	uc004cpc.3	Q9NUJ7	OTTHUMG00000022693	ENST00000381657.2:c.159C>T	X.37:g.205431C>T			A2BH51|A2BH52	Silent	SNP	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom	p.N53	ENST00000381657.2	37	c.159	CCDS14103.1	X																																																																																			PLCXD1	-	superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom	ENSG00000182378		0.617	PLCXD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLCXD1	HGNC	protein_coding	OTTHUMT00000058879.2	-	0.00	53	0	C	NM_018390		205431	+1	tier1	-	no_errors	ENST00000381657	ensembl	human	known	74_37	silent	35.62	47	26	SNP	0.998	T
PLXNA4	91584	genome.wustl.edu	37	7	131853090	131853090	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:131853090T>C	ENST00000359827.3	-	22	5221	c.4259A>G	c.(4258-4260)aAg>aGg	p.K1420R	PLXNA4_ENST00000321063.4_Missense_Mutation_p.K1420R			Q9HCM2	PLXA4_HUMAN	plexin A4	1420					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						AGGGTGGTTCTTGCTCTCCAG	0.602																																																	0													63.0	66.0	65.0					7																	131853090		2203	4300	6503	SO:0001583	missense	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4259A>G	7.37:g.131853090T>C	ENSP00000352882:p.Lys1420Arg		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.K1420R	ENST00000359827.3	37	c.4259	CCDS43646.1	7	.	.	.	.	.	.	.	.	.	.	T	19.80	3.893887	0.72639	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.16457	2.34;2.34	5.49	5.49	0.81192	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.28067	0.0692	L	0.48877	1.53	0.80722	D	1	P	0.41848	0.763	P	0.51016	0.656	T	0.00817	-1.1554	10	0.39692	T	0.17	.	15.5722	0.76349	0.0:0.0:0.0:1.0	.	1420	Q9HCM2	PLXA4_HUMAN	R	1420	ENSP00000323194:K1420R;ENSP00000352882:K1420R	ENSP00000323194:K1420R	K	-	2	0	PLXNA4	131503630	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.295000	0.72744	2.087000	0.62958	0.379000	0.24179	AAG	PLXNA4	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000221866		0.602	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	-	0.00	27	0	T	NM_181775		131853090	-1	tier1	-	no_errors	ENST00000321063	ensembl	human	known	74_37	missense	40.00	15	10	SNP	1.000	C
PMM1	5372	genome.wustl.edu	37	22	41973338	41973338	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr22:41973338G>T	ENST00000216259.7	-	8	857	c.773C>A	c.(772-774)aCa>aAa	p.T258K		NM_002676.2	NP_002667.2	Q92871	PMM1_HUMAN	phosphomannomutase 1	258					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|mannose biosynthetic process (GO:0019307)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	metal ion binding (GO:0046872)|phosphomannomutase activity (GO:0004615)			NS(1)|large_intestine(4)|lung(3)|ovary(1)|urinary_tract(2)	11						CTCATGAGCTGTCTCTGGGAA	0.572											OREG0026591	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													74.0	78.0	77.0					22																	41973338		2203	4300	6503	SO:0001583	missense	0				CCDS14020.1	22q13	2008-12-01			ENSG00000100417	ENSG00000100417	5.4.2.8		9114	protein-coding gene	gene with protein product	"""brain glucose-1,6-bisphosphatase"""	601786				9070917, 9271215	Standard	NM_002676		Approved	Sec53	uc003bal.2	Q92871	OTTHUMG00000150972	ENST00000216259.7:c.773C>A	22.37:g.41973338G>T	ENSP00000216259:p.Thr258Lys	905	A8K003|Q92586	Missense_Mutation	SNP	pfam_PMM,pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIB	p.T258K	ENST00000216259.7	37	c.773	CCDS14020.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.98|15.98	2.991653|2.991653	0.54041|0.54041	.|.	.|.	ENSG00000172346|ENSG00000100417	ENST00000460790|ENST00000216259	.|D	.|0.98437	.|-4.93	5.52|5.52	4.48|4.48	0.54585|0.54585	.|.	.|0.261902	.|0.41605	.|D	.|0.000854	D|D	0.92961|0.92961	0.7760|0.7760	N|N	0.08118|0.08118	0|0	0.26509|0.26509	N|N	0.974635|0.974635	.|B	.|0.11235	.|0.004	.|B	.|0.04013	.|0.001	T|T	0.79697|0.79697	-0.1695|-0.1695	6|10	0.87932|0.08599	D|T	0|0.76	-19.6971|-19.6971	14.6915|14.6915	0.69091|0.69091	0.0:0.2736:0.7264:0.0|0.0:0.2736:0.7264:0.0	.|.	.|258	.|Q92871	.|PMM1_HUMAN	F|K	105|258	.|ENSP00000216259:T258K	ENSP00000417127:C105F|ENSP00000216259:T258K	C|T	+|-	2|2	0|0	CSDC2|PMM1	40303284|40303284	0.994000|0.994000	0.37717|0.37717	1.000000|1.000000	0.80357|0.80357	0.960000|0.960000	0.62799|0.62799	2.552000|2.552000	0.45828|0.45828	2.592000|2.592000	0.87571|0.87571	0.557000|0.557000	0.71058|0.71058	TGT|ACA	PMM1	-	NULL	ENSG00000100417		0.572	PMM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMM1	HGNC	protein_coding	OTTHUMT00000320711.3	-	0.00	46	0	G	NM_002676		41973338	-1	tier1	-	no_errors	ENST00000216259	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.998	T
PNLIPRP3	119548	genome.wustl.edu	37	10	118236283	118236283	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:118236283A>C	ENST00000369230.3	+	11	1438	c.1292A>C	c.(1291-1293)aAg>aCg	p.K431T		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	431	PLAT.				lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		TCTCAGAATAAGTTGGGAGCA	0.303																																																	0													95.0	99.0	97.0					10																	118236283		2203	4300	6503	SO:0001583	missense	0			BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.1292A>C	10.37:g.118236283A>C	ENSP00000358232:p.Lys431Thr			Missense_Mutation	SNP	pfam_Lipase_N,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase,prints_Lipase_panc	p.K431T	ENST00000369230.3	37	c.1292	CCDS31292.1	10	.	.	.	.	.	.	.	.	.	.	A	10.46	1.356734	0.24598	.	.	ENSG00000203837	ENST00000369230	T	0.65549	-0.16	4.13	1.42	0.22433	Lipoxygenase, LH2 (2);Lipase/lipooxygenase, PLAT/LH2 (1);	0.581864	0.14711	N	0.302929	T	0.47192	0.1432	L	0.33137	0.985	0.21064	N	0.999796	P	0.37370	0.592	B	0.37091	0.241	T	0.28267	-1.0049	10	0.33141	T	0.24	.	8.7727	0.34742	0.6344:0.3656:0.0:0.0	.	431	Q17RR3	LIPR3_HUMAN	T	431	ENSP00000358232:K431T	ENSP00000358232:K431T	K	+	2	0	PNLIPRP3	118226273	0.572000	0.26668	0.480000	0.27341	0.476000	0.33039	0.250000	0.18235	0.670000	0.31165	0.533000	0.62120	AAG	PNLIPRP3	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH	ENSG00000203837		0.303	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNLIPRP3	HGNC	protein_coding	OTTHUMT00000050520.1	-	0.00	68	0	A	XM_058404		118236283	+1	tier1	-	no_errors	ENST00000369230	ensembl	human	known	74_37	missense	30.43	48	21	SNP	0.620	C
POTED	317754	genome.wustl.edu	37	21	14982728	14982728	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr21:14982728A>C	ENST00000299443.5	+	1	231	c.179A>C	c.(178-180)aAg>aCg	p.K60T		NM_174981.3|NM_207355.2	NP_778146.2|NP_997238.2	Q86YR6	POTED_HUMAN	POTE ankyrin domain family, member D	60						plasma membrane (GO:0005886)				central_nervous_system(1)|large_intestine(10)|liver(2)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	33						CTCAGGAGCAAGATGGGCAAG	0.587																																																	0													1.0	2.0	2.0					21																	14982728		177	1131	1308	SO:0001583	missense	0			AY172978	CCDS13562.1	21q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000166351	ENSG00000166351		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	23822	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 1"""	607549	"""ankyrin repeat domain 21"", ""ANKRD26-like family B, member 3"""	ANKRD21, A26B3		12475935, 15276201, 16364570	Standard	NM_174981		Approved	POTE, POTE-21, POTE21, CT104.1	uc002yjb.1	Q86YR6	OTTHUMG00000074197	ENST00000299443.5:c.179A>C	21.37:g.14982728A>C	ENSP00000299443:p.Lys60Thr		C9JCF7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.K60T	ENST00000299443.5	37	c.179	CCDS13562.1	21	.	.	.	.	.	.	.	.	.	.	A	7.088	0.571638	0.13623	.	.	ENSG00000166351	ENST00000299443	T	0.38722	1.12	.	.	.	.	.	.	.	.	T	0.40448	0.1117	L	0.61218	1.895	0.09310	N	1	P	0.39094	0.659	B	0.42959	0.403	T	0.27673	-1.0067	7	0.40728	T	0.16	.	.	.	.	.	60	Q86YR6	POTED_HUMAN	T	60	ENSP00000299443:K60T	ENSP00000299443:K60T	K	+	2	0	POTED	13904599	0.116000	0.22171	0.034000	0.17996	0.035000	0.12851	-0.053000	0.11846	0.103000	0.17682	0.102000	0.15555	AAG	POTED	-	NULL	ENSG00000166351		0.587	POTED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTED	HGNC	protein_coding	OTTHUMT00000157660.1	-	0.00	43	0	A	NM_174981		14982728	+1	tier1	-	no_errors	ENST00000299443	ensembl	human	known	74_37	missense	46.88	17	15	SNP	0.036	C
PP2D1	151649	genome.wustl.edu	37	3	20043253	20043253	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:20043253G>A	ENST00000389050.4	-	2	616	c.359C>T	c.(358-360)tCt>tTt	p.S120F		NM_001252657.1	NP_001239586.1	A8MPX8	PP2D1_HUMAN	protein phosphatase 2C-like domain containing 1	120							catalytic activity (GO:0003824)										GAACATAAAAGATGACAATAG	0.378																																																	0																																										SO:0001583	missense	0			AK058178	CCDS58817.1	3p24.3	2011-06-24	2011-06-24	2011-06-24	ENSG00000183977	ENSG00000183977			28406	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 48"""	C3orf48		12477932	Standard	NR_027694		Approved	FLJ25449	uc021wtw.1	A8MPX8	OTTHUMG00000155393	ENST00000389050.4:c.359C>T	3.37:g.20043253G>A	ENSP00000373702:p.Ser120Phe		Q96LI7	Missense_Mutation	SNP	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.S120F	ENST00000389050.4	37	c.359	CCDS58817.1	3	.	.	.	.	.	.	.	.	.	.	G	7.872	0.728319	0.15507	.	.	ENSG00000183977	ENST00000389050	T	0.19806	2.12	5.6	2.78	0.32641	.	0.841724	0.10576	N	0.658573	T	0.09113	0.0225	.	.	.	0.09310	N	1	B	0.17038	0.02	B	0.19391	0.025	T	0.42699	-0.9436	9	0.09084	T	0.74	-7.179	3.8141	0.08808	0.3552:0.0:0.4849:0.1599	.	120	A8MPX8-2	.	F	120	ENSP00000373702:S120F	ENSP00000331295:S120F	S	-	2	0	PP2D1	20018257	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.065000	0.14466	0.299000	0.22661	0.585000	0.79938	TCT	PP2D1	-	NULL	ENSG00000183977		0.378	PP2D1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PP2D1	HGNC	protein_coding	OTTHUMT00000339833.1	-	0.00	39	0	G	NM_144714		20043253	-1	tier1	-	no_errors	ENST00000389050	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.000	A
PPHLN1	51535	genome.wustl.edu	37	12	42729775	42729775	+	Splice_Site	DEL	G	G	-	rs548195005		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:42729775delG	ENST00000395568.2	+	2	155	c.71delG	c.(70-72)agt>at	p.S24fs	PPHLN1_ENST00000549190.1_Splice_Site_p.S42fs|PPHLN1_ENST00000358314.7_Splice_Site_p.S24fs|PPHLN1_ENST00000317560.9_Splice_Site_p.S31fs|PPHLN1_ENST00000395580.3_Splice_Site_p.S31fs|PPHLN1_ENST00000550535.1_3'UTR|PPHLN1_ENST00000337898.6_Splice_Site_p.S24fs|PPHLN1_ENST00000432191.2_Splice_Site_p.S24fs|PPHLN1_ENST00000449194.2_Splice_Site_p.S24fs|PPHLN1_ENST00000256678.8_Intron|PPHLN1_ENST00000552761.1_Splice_Site_p.S31fs	NM_016488.6	NP_057572.5	Q8NEY8	PPHLN_HUMAN	periphilin 1	24					keratinization (GO:0031424)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	16	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		AGTCATCCCAGTGTAAGTTAC	0.388																																																	0													108.0	111.0	110.0					12																	42729775		2203	4300	6503	SO:0001630	splice_region_variant	0			AY157850	CCDS8741.1, CCDS31777.1, CCDS41773.1, CCDS44860.1, CCDS44861.1, CCDS55817.1	12q12	2006-10-24				ENSG00000134283			19369	protein-coding gene	gene with protein product		608150					Standard	NM_016488		Approved		uc001rng.1	Q8NEY8		ENST00000395568.2:c.72+1G>-	12.37:g.42729775delG			E9PAX8|Q86YT2|Q8IXN3|Q8TB09|Q96NB9|Q9NXL4|Q9P0P6|Q9P0R9	Frame_Shift_Del	DEL	NULL	p.S24fs	ENST00000395568.2	37	c.71	CCDS31777.1	12																																																																																			PPHLN1	-	NULL	ENSG00000134283		0.388	PPHLN1-010	KNOWN	basic|CCDS	protein_coding	PPHLN1	HGNC	protein_coding	OTTHUMT00000404047.1		0.00	42	0	G	NM_201515	Frame_Shift_Del	42729775	+1	tier1		no_errors	ENST00000395568	ensembl	human	known	74_37	frame_shift_del	23.26	33	10	DEL	0.947	-
PPIE	10450	genome.wustl.edu	37	1	40214724	40214724	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:40214724G>T	ENST00000324379.5	+	8	677	c.658G>T	c.(658-660)Gat>Tat	p.D220Y	PPIE_ENST00000372830.1_Missense_Mutation_p.D220Y|PPIE_ENST00000470213.1_Silent_p.S178S|PPIE_ENST00000356511.2_Missense_Mutation_p.D220Y	NM_006112.3	NP_006103.1	Q9UNP9	PPIE_HUMAN	peptidylprolyl isomerase E (cyclophilin E)	220	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of viral genome replication (GO:0045070)|protein folding (GO:0006457)|regulation of transcription, DNA-templated (GO:0006355)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|nucleotide binding (GO:0000166)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(3)|large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	9	all_cancers(7;1.63e-13)|all_lung(5;2.27e-16)|all_epithelial(6;1.35e-15)|Lung NSC(20;1.49e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;2.7e-17)|all cancers(16;5.5e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GAAGAAGTTCGATGATGAAAA	0.552																																																	0													88.0	84.0	85.0					1																	40214724		2203	4300	6503	SO:0001583	missense	0			AF042385	CCDS442.1, CCDS443.1, CCDS53299.1	1p32	2013-02-12			ENSG00000084072	ENSG00000084072		"""RNA binding motif (RRM) containing"""	9258	protein-coding gene	gene with protein product	"""peptidyl-prolyl cis-trans isomerase E"", ""cyclophilin 33"", ""cyclophilin E"", ""PPIase E"", ""rotamase E"", ""peptidylprolyl isomerase E, isoform 1"""	602435				9747881	Standard	NM_203456		Approved	CyP-33, MGC3736, MGC111222	uc001cdw.3	Q9UNP9	OTTHUMG00000009248	ENST00000324379.5:c.658G>T	1.37:g.40214724G>T	ENSP00000312769:p.Asp220Tyr		B2R971|O43634|O43635|Q32Q72|Q3S611|Q5TGA0|Q5TGA2|Q5TGA3|Q9UIZ5	Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,pfam_RRM_dom,superfamily_Cyclophilin-like_PPIase_dom,smart_RRM_dom,pirsf_Cyclophilin-type_PPIase_E,pfscan_RRM_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.D220Y	ENST00000324379.5	37	c.658	CCDS443.1	1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.227856	0.79576	.	.	ENSG00000084072	ENST00000324379;ENST00000356511;ENST00000497370;ENST00000372835;ENST00000372830	T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92	4.87	4.87	0.63330	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (3);Cyclophilin-like (1);	0.052701	0.85682	D	0.000000	T	0.62588	0.2440	H	0.94964	3.605	0.80722	D	1	D;D;D;D	0.76494	0.993;0.999;0.998;0.997	P;D;P;D	0.69307	0.897;0.963;0.879;0.915	T	0.74343	-0.3696	10	0.62326	D	0.03	-30.9549	17.7843	0.88533	0.0:0.0:1.0:0.0	.	141;220;220;220	B4E3F2;Q5TGA3;Q9UNP9-2;Q9UNP9	.;.;.;PPIE_HUMAN	Y	220;220;154;169;220	ENSP00000312769:D220Y;ENSP00000348904:D220Y;ENSP00000433475:D154Y;ENSP00000361925:D169Y;ENSP00000361918:D220Y	ENSP00000312769:D220Y	D	+	1	0	PPIE	39987311	1.000000	0.71417	0.997000	0.53966	0.815000	0.46073	9.233000	0.95337	2.550000	0.86006	0.462000	0.41574	GAT	PPIE	-	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pirsf_Cyclophilin-type_PPIase_E,pfscan_Cyclophilin-like_PPIase_dom	ENSG00000084072		0.552	PPIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIE	HGNC	protein_coding	OTTHUMT00000025642.2		0.00	50	0	G	NM_006112		40214724	+1			no_errors	ENST00000324379	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
PREX2	80243	genome.wustl.edu	37	8	69104018	69104018	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:69104018G>T	ENST00000288368.4	+	36	4685	c.4408G>T	c.(4408-4410)Gat>Tat	p.D1470Y		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1470					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TGCCTATGTAGATAAGGTAAA	0.308																																																	0													92.0	92.0	92.0					8																	69104018		2203	4300	6503	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.4408G>T	8.37:g.69104018G>T	ENSP00000288368:p.Asp1470Tyr		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.D1470Y	ENST00000288368.4	37	c.4408	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	G	24.6	4.551545	0.86127	.	.	ENSG00000046889	ENST00000288368	T	0.61627	0.09	5.48	5.48	0.80851	.	0.056518	0.64402	D	0.000002	T	0.73674	0.3617	M	0.67397	2.05	0.80722	D	1	D	0.58268	0.982	P	0.61874	0.895	T	0.75722	-0.3218	10	0.87932	D	0	.	18.7115	0.91658	0.0:0.0:1.0:0.0	.	1470	Q70Z35	PREX2_HUMAN	Y	1470	ENSP00000288368:D1470Y	ENSP00000288368:D1470Y	D	+	1	0	PREX2	69266572	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.234000	0.95347	2.729000	0.93468	0.650000	0.86243	GAT	PREX2	-	NULL	ENSG00000046889		0.308	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	-	0.00	53	0	G	NM_025170		69104018	+1	tier1	-	no_errors	ENST00000288368	ensembl	human	known	74_37	missense	8.89	40	4	SNP	1.000	T
PRIM2	5558	genome.wustl.edu	37	6	57467108	57467108	+	3'UTR	SNP	G	G	A	rs201913517	byFrequency	TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:57467108G>A	ENST00000389488.2	+	0	1136				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TAGAACATCCGTCACAGCTTT	0.413													G|||	7	0.00139776	0.0053	0.0	5008	,	,		37281	0.0		0.0	False		,,,				2504	0.0																0								G	HIS/ARG	14,3938		0,14,1962	113.0	104.0	107.0		1049	4.0	0.9	6		107	1,8345		0,1,4172	yes	missense	PRIM2	XM_003403439.1	29	0,15,6134	AA,AG,GG		0.012,0.3543,0.122	probably-damaging	350/510	57467108	15,12283	1976	4173	6149	SO:0001624	3_prime_UTR_variant	0				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1133G>A	6.37:g.57467108G>A			Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	SNP	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			PRIM2	-	-	ENSG00000146143		0.413	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	HGNC	protein_coding	OTTHUMT00000043468.3	-	0.00	116	0	G	NM_000947		57467108	+1	tier1	rs201913517	no_errors	ENST00000389488	ensembl	human	known	74_37	rna	14.60	117	20	SNP	0.999	A
PRIM2	5558	genome.wustl.edu	37	6	57512519	57512519	+	3'UTR	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:57512519T>C	ENST00000389488.2	+	0	1434				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ATTTCTTTTGTGAGAGCCAAC	0.363																																																	0													259.0	224.0	235.0					6																	57512519		1935	4158	6093	SO:0001624	3_prime_UTR_variant	0				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1431T>C	6.37:g.57512519T>C			Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	SNP	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			PRIM2	-	-	ENSG00000146143		0.363	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	HGNC	protein_coding	OTTHUMT00000043468.3	-	0.00	82	0	T	NM_000947		57512519	+1	tier1	-	no_errors	ENST00000389488	ensembl	human	known	74_37	rna	8.33	88	8	SNP	0.086	C
PRKCQ	5588	genome.wustl.edu	37	10	6557012	6557012	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:6557012C>T	ENST00000263125.5	-	2	185	c.86G>A	c.(85-87)tGt>tAt	p.C29Y	PRKCQ_ENST00000397176.2_Missense_Mutation_p.C29Y|PRKCQ_ENST00000539722.1_De_novo_Start_OutOfFrame	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	29	C2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	GAGCACAGCACAGTAAGGGTT	0.522																																					Ovarian(50;572 1126 10530 25349 30594)												0													98.0	95.0	96.0					10																	6557012		2203	4300	6503	SO:0001583	missense	0			L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.86G>A	10.37:g.6557012C>T	ENSP00000263125:p.Cys29Tyr		B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd,prints_Ser-Thr/Tyr_kinase_cat_dom	p.C29Y	ENST00000263125.5	37	c.86	CCDS7079.1	10	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455379	0.84209	.	.	ENSG00000065675	ENST00000263125;ENST00000397176	T;T	0.68765	-0.35;-0.31	5.2	5.2	0.72013	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.83413	0.5249	M	0.81497	2.545	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.996	D	0.85583	0.1241	10	0.87932	D	0	.	19.1283	0.93394	0.0:1.0:0.0:0.0	.	29;29	Q04759-2;Q04759	.;KPCT_HUMAN	Y	29	ENSP00000263125:C29Y;ENSP00000380361:C29Y	ENSP00000263125:C29Y	C	-	2	0	PRKCQ	6597018	1.000000	0.71417	0.988000	0.46212	0.833000	0.47200	6.906000	0.75719	2.584000	0.87258	0.563000	0.77884	TGT	PRKCQ	-	superfamily_C2_dom,pirsf_Prot_kin_PKC_delta	ENSG00000065675		0.522	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCQ	HGNC	protein_coding	OTTHUMT00000046665.1	-	0.00	51	0	C	NM_006257		6557012	-1	tier1	-	no_errors	ENST00000263125	ensembl	human	known	74_37	missense	18.03	50	11	SNP	1.000	T
PRMT9	90826	genome.wustl.edu	37	4	148594174	148594174	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:148594174C>T	ENST00000322396.6	-	4	921	c.679G>A	c.(679-681)Gca>Aca	p.A227T	PRMT10_ENST00000541232.1_Missense_Mutation_p.A114T	NM_138364.2	NP_612373.2	Q6P2P2	ANM9_HUMAN		227	SAM-dependent MTase PRMT-type 1. {ECO:0000255|PROSITE-ProRule:PRU01015}.					cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28						TTGATCCCTGCTTCCATCTTG	0.388																																																	0													161.0	151.0	154.0					4																	148594174		2203	4300	6503	SO:0001583	missense	0																														ENST00000322396.6:c.679G>A	4.37:g.148594174C>T	ENSP00000314396:p.Ala227Thr		A8KA39|B3KU92|Q6ZR58|Q8N383|Q9BT55|Q9NT98	Missense_Mutation	SNP	pfam_Ribosomal-L11_MeTrfase_PrmA,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A227T	ENST00000322396.6	37	c.679	CCDS3771.1	4	.	.	.	.	.	.	.	.	.	.	C	10.36	1.329425	0.24167	.	.	ENSG00000164169	ENST00000322396;ENST00000541232	T;T	0.21932	1.98;1.98	5.44	2.28	0.28536	.	0.857067	0.10707	N	0.643371	T	0.11665	0.0284	N	0.12527	0.23	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.25779	-1.0122	10	0.52906	T	0.07	-6.1689	6.9053	0.24305	0.0:0.5714:0.0:0.4286	.	227	Q6P2P2	ANM10_HUMAN	T	227;114	ENSP00000314396:A227T;ENSP00000439508:A114T	ENSP00000314396:A227T	A	-	1	0	PRMT10	148813624	0.160000	0.22878	0.759000	0.31340	0.955000	0.61496	0.897000	0.28390	0.633000	0.30452	0.655000	0.94253	GCA	PRMT10	-	pfam_Ribosomal-L11_MeTrfase_PrmA	ENSG00000164169		0.388	PRMT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT10	HGNC	protein_coding	OTTHUMT00000364650.1		0.00	67	0	C			148594174	-1			no_errors	ENST00000322396	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.089	T
PSMB3	5691	genome.wustl.edu	37	17	36916828	36916828	+	Silent	SNP	C	C	T	rs572205029		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:36916828C>T	ENST00000225426.4	+	4	532	c.441C>T	c.(439-441)taC>taT	p.Y147Y		NM_002795.2	NP_002786.2	P49720	PSB3_HUMAN	proteasome (prosome, macropain) subunit, beta type, 3	147					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)	p.Y147Y(1)		endometrium(2)|large_intestine(1)|lung(1)	4						AACAAATGTACGGAATGTGTG	0.537													c|||	1	0.000199681	0.0	0.0	5008	,	,		20145	0.001		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	endometrium(1)											81.0	67.0	72.0					17																	36916828		2203	4300	6503	SO:0001819	synonymous_variant	0			BC013008	CCDS11328.1	17q12	2014-05-06			ENSG00000108294	ENSG00000277791		"""Proteasome (prosome, macropain) subunits"""	9540	protein-coding gene	gene with protein product		602176				7918633	Standard	NM_002795		Approved	HC10-II, MGC4147	uc002hqr.3	P49720	OTTHUMG00000188503	ENST00000225426.4:c.441C>T	17.37:g.36916828C>T			P31147|Q0P6J7|Q96E27	Silent	SNP	pfam_Proteasome_sua/b	p.Y147	ENST00000225426.4	37	c.441	CCDS11328.1	17																																																																																			PSMB3	-	pfam_Proteasome_sua/b	ENSG00000108294		0.537	PSMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMB3	HGNC	protein_coding	OTTHUMT00000256810.2		0.00	30	0	C	NM_002795		36916828	+1			no_errors	ENST00000225426	ensembl	human	known	74_37	silent	5.88	32	2	SNP	0.996	T
PSMC5	5705	genome.wustl.edu	37	17	61905527	61905527	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:61905527C>T	ENST00000310144.6	+	2	362	c.54C>T	c.(52-54)agC>agT	p.S18S	PSMC5_ENST00000581882.1_Silent_p.S10S|PSMC5_ENST00000375812.4_Silent_p.S10S|FTSJ3_ENST00000580295.1_Intron|FTSJ3_ENST00000427159.2_5'Flank|PSMC5_ENST00000580864.1_Silent_p.S10S	NM_002805.5	NP_002796.4	P62195	PRS8_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 5	18					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of inclusion body assembly (GO:0090261)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|nuclear proteasome complex (GO:0031595)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|thyrotropin-releasing hormone receptor binding (GO:0031531)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(2)|large_intestine(8)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	20						AGGCAGGCAGCGGACTCCGCC	0.537																																																	0													65.0	65.0	65.0					17																	61905527		2203	4300	6503	SO:0001819	synonymous_variant	0			L38810	CCDS11645.1, CCDS56043.1	17q23.3	2010-04-21			ENSG00000087191	ENSG00000087191		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9552	protein-coding gene	gene with protein product		601681				9473509, 9048938	Standard	NM_002805		Approved	SUG1, p45/SUG, TBP10, p45, S8, TRIP1, SUG-1	uc002jcb.3	P62195		ENST00000310144.6:c.54C>T	17.37:g.61905527C>T			A8K3Z3|A8K763|O35051|O43208|P47210|P52915|P52916	Silent	SNP	pfam_ATPase_AAA_core,pfam_ATPase_AAA-2,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.S18	ENST00000310144.6	37	c.54	CCDS11645.1	17																																																																																			PSMC5	-	NULL	ENSG00000087191		0.537	PSMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMC5	HGNC	protein_coding	OTTHUMT00000444404.1	-	0.00	36	0	C	NM_002805		61905527	+1	tier1	-	no_errors	ENST00000310144	ensembl	human	known	74_37	silent	9.43	48	5	SNP	0.998	T
PTBP2	58155	genome.wustl.edu	37	1	97270350	97270350	+	Intron	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:97270350T>C	ENST00000426398.2	+	9	947				PTBP2_ENST00000541987.1_Intron|PTBP2_ENST00000370197.1_Missense_Mutation_p.V305A|PTBP2_ENST00000609116.1_Intron|PTBP2_ENST00000482253.1_Intron|PTBP2_ENST00000370198.1_Missense_Mutation_p.V305A|PTBP2_ENST00000394184.3_Missense_Mutation_p.V316A	NM_021190.2	NP_067013.1	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2						mRNA splice site selection (GO:0006376)|negative regulation of RNA splicing (GO:0033119)|regulation of neural precursor cell proliferation (GO:2000177)	spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|skin(1)	26		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		GGGCTTCCTGTTGCAGCTGTT	0.483																																																	0													63.0	68.0	66.0					1																	97270350		2203	4300	6503	SO:0001627	intron_variant	0			AB051232	CCDS754.1, CCDS72828.1, CCDS72829.1, CCDS72830.1	1p21.3	2013-07-16			ENSG00000117569	ENSG00000117569		"""RNA binding motif (RRM) containing"""	17662	protein-coding gene	gene with protein product		608449				11003644	Standard	XM_005271084		Approved	brPTB, nPTB, PTB, PTBLP	uc001drq.3	Q9UKA9	OTTHUMG00000010685	ENST00000426398.2:c.905-6T>C	1.37:g.97270350T>C			Q8N0Z1|Q8N160|Q8NFB0|Q8NFB1|Q969N9|Q96Q76	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.V316A	ENST00000426398.2	37	c.947	CCDS754.1	1	.	.	.	.	.	.	.	.	.	.	T	7.253	0.603670	0.14002	.	.	ENSG00000117569	ENST00000370198;ENST00000370197;ENST00000394184;ENST00000394176	T;T;T	0.42131	0.99;0.98;0.99	5.24	5.24	0.73138	.	1.148940	0.06340	N	0.707863	T	0.17238	0.0414	.	.	.	0.80722	D	1	B;B;B	0.14805	0.0;0.001;0.011	B;B;B	0.06405	0.001;0.002;0.002	T	0.03060	-1.1077	9	0.16896	T	0.51	.	15.1307	0.72520	0.0:0.0:0.0:1.0	.	316;305;305	B4DSS8;Q9UKA9-4;Q9UKA9-3	.;.;.	A	305;305;316;295	ENSP00000359217:V305A;ENSP00000359216:V305A;ENSP00000377738:V316A	ENSP00000359216:V305A	V	+	2	0	PTBP2	97042938	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.635000	0.74295	1.981000	0.57761	0.482000	0.46254	GTT	PTBP2	-	tigrfam_HnRNP-L_PTB	ENSG00000117569		0.483	PTBP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTBP2	HGNC	protein_coding	OTTHUMT00000029453.1	-	0.00	58	0	T			97270350	+1	tier1	-	no_errors	ENST00000394184	ensembl	human	known	74_37	missense	11.11	48	6	SNP	1.000	C
PTBP3	9991	genome.wustl.edu	37	9	114986446	114986446	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:114986446G>A	ENST00000374255.2	-	14	1640	c.1493C>T	c.(1492-1494)gCt>gTt	p.A498V	PTBP3_ENST00000343327.2_Missense_Mutation_p.A403V|PTBP3_ENST00000374257.1_Missense_Mutation_p.A470V|PTBP3_ENST00000458258.1_Missense_Mutation_p.A504V|PTBP3_ENST00000334318.6_Missense_Mutation_p.A501V			O95758	PTBP3_HUMAN	polypyrimidine tract binding protein 3	498	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anatomical structure morphogenesis (GO:0009653)|erythrocyte maturation (GO:0043249)|mRNA processing (GO:0006397)|negative regulation of RNA splicing (GO:0033119)|regulation of cell differentiation (GO:0045595)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										TGAACATCCAGCTTCTATGAA	0.363																																																	0													79.0	83.0	82.0					9																	114986446		2203	4300	6503	SO:0001583	missense	0			AB023967	CCDS6784.1, CCDS55332.1, CCDS55333.1, CCDS59140.1, CCDS59141.1	9q32	2013-07-16	2011-11-16	2011-11-16	ENSG00000119314	ENSG00000119314		"""RNA binding motif (RRM) containing"""	10253	protein-coding gene	gene with protein product		607527	"""regulator of differentiation (in S. pombe) 1"", ""ROD1 regulator of differentiation 1 (S. pombe)"""	ROD1		10207106	Standard	NM_005156		Approved	DKFZp781I1117	uc004bfx.3	O95758	OTTHUMG00000020503	ENST00000374255.2:c.1493C>T	9.37:g.114986446G>A	ENSP00000363373:p.Ala498Val		B1ALY2|B1ALY3|B1ALY5|B1ALY6|B3KME7|Q68DB9|Q86YB3|Q86YH9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.A504V	ENST00000374255.2	37	c.1511	CCDS6784.1	9	.	.	.	.	.	.	.	.	.	.	G	10.64	1.405722	0.25378	.	.	ENSG00000119314	ENST00000374257;ENST00000334318;ENST00000458258;ENST00000374255;ENST00000343327	T;T;T;T;T	0.08370	3.1;3.1;3.1;3.1;3.1	5.8	5.8	0.92144	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.276251	0.37304	N	0.002143	T	0.09555	0.0235	L	0.37850	1.14	0.37024	D	0.89637	B;B;B;B;B;B	0.23249	0.019;0.01;0.001;0.082;0.019;0.016	B;B;B;B;B;B	0.29440	0.102;0.022;0.027;0.023;0.016;0.009	T	0.29058	-1.0024	10	0.20046	T	0.44	-6.2382	16.3184	0.82936	0.0:0.0:0.8673:0.1327	.	470;470;403;501;498;504	B1ALY5;O95758-2;B1ALY6;O95758-5;O95758;O95758-4	.;.;.;.;ROD1_HUMAN;.	V	470;501;504;498;403	ENSP00000363375:A470V;ENSP00000334499:A501V;ENSP00000414921:A504V;ENSP00000363373:A498V;ENSP00000340705:A403V	ENSP00000334499:A501V	A	-	2	0	ROD1	114026267	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.315000	0.51951	2.737000	0.93849	0.563000	0.77884	GCT	PTBP3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	ENSG00000119314		0.363	PTBP3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTBP3	HGNC	protein_coding	OTTHUMT00000053679.1		0.00	62	0	G			114986446	-1			no_errors	ENST00000458258	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.997	A
PTCHD2	57540	genome.wustl.edu	37	1	11585247	11585247	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:11585247G>A	ENST00000294484.6	+	12	2629	c.2491G>A	c.(2491-2493)Gtg>Atg	p.V831M	PTCHD2_ENST00000389575.3_Missense_Mutation_p.V831M	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	831					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CCCAGGCACCGTGTACATCTC	0.582																																																	0													173.0	178.0	177.0					1																	11585247		2047	4168	6215	SO:0001583	missense	0			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.2491G>A	1.37:g.11585247G>A	ENSP00000294484:p.Val831Met		Q5VTU9|Q9UJD6	Missense_Mutation	SNP	pfam_Patched,pfam_MMPL_dom,pfscan_SSD	p.V831M	ENST00000294484.6	37	c.2491	CCDS41247.1	1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.460909	0.43736	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.91740	-2.9;-2.9	5.73	4.8	0.61643	.	0.116340	0.56097	D	0.000022	D	0.93475	0.7918	L	0.32530	0.975	0.45930	D	0.99876	D	0.89917	1.0	D	0.81914	0.995	D	0.94363	0.7589	10	0.87932	D	0	-26.3281	15.6386	0.76977	0.0:0.1377:0.8623:0.0	.	831	Q9P2K9	PTHD2_HUMAN	M	831	ENSP00000294484:V831M;ENSP00000374226:V831M	ENSP00000294484:V831M	V	+	1	0	PTCHD2	11507834	1.000000	0.71417	0.972000	0.41901	0.048000	0.14542	6.975000	0.76128	1.384000	0.46424	0.655000	0.94253	GTG	PTCHD2	-	NULL	ENSG00000204624		0.582	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	HGNC	protein_coding	OTTHUMT00000005770.2		0.00	39	0	G	XM_052561		11585247	+1			no_errors	ENST00000294484	ensembl	human	known	74_37	missense	7.14	39	3	SNP	0.994	A
PTPRD	5789	genome.wustl.edu	37	9	8528579	8528579	+	Intron	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:8528579A>C	ENST00000381196.4	-	12	1085				PTPRD_ENST00000358503.5_Intron|PTPRD_ENST00000486161.1_Intron|PTPRD_ENST00000356435.5_Intron|PTPRD_ENST00000397606.3_Intron|PTPRD_ENST00000397617.3_Intron|PTPRD_ENST00000463477.1_Intron|PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000540109.1_Intron|PTPRD_ENST00000397611.3_Intron|PTPRD_ENST00000537002.1_Splice_Site|PTPRD_ENST00000360074.4_Intron	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		AGAAACAGTAACAAGACCCTA	0.303										TSP Lung(15;0.13)																																							0													113.0	103.0	107.0					9																	8528579		2203	4300	6503	SO:0001627	intron_variant	0			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.541+11T>G	9.37:g.8528579A>C			B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Splice_Site	SNP	-	e4+2	ENST00000381196.4	37	c.551+2	CCDS43786.1	9	.	.	.	.	.	.	.	.	.	.	A	16.41	3.115911	0.56505	.	.	ENSG00000153707	ENST00000537002	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0511	0.47889	0.9315:0.0:0.0685:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PTPRD	8518579	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.662000	0.61525	2.371000	0.80710	0.533000	0.62120	.	PTPRD	-	-	ENSG00000153707		0.303	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3	-	0.00	62	0	A			8528579	-1	tier1	-	no_errors	ENST00000537002	ensembl	human	known	74_37	splice_site	22.58	48	14	SNP	1.000	C
PTPRD	5789	genome.wustl.edu	37	9	8528696	8528696	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:8528696G>A	ENST00000381196.4	-	12	979	c.436C>T	c.(436-438)Ctt>Ttt	p.L146F	PTPRD_ENST00000358503.5_Missense_Mutation_p.L146F|PTPRD_ENST00000486161.1_Missense_Mutation_p.L146F|PTPRD_ENST00000356435.5_Missense_Mutation_p.L146F|PTPRD_ENST00000397606.3_Missense_Mutation_p.L146F|PTPRD_ENST00000397617.3_Missense_Mutation_p.L146F|PTPRD_ENST00000463477.1_Missense_Mutation_p.L146F|PTPRD_ENST00000355233.5_Missense_Mutation_p.L146F|PTPRD_ENST00000540109.1_Missense_Mutation_p.L146F|PTPRD_ENST00000397611.3_Missense_Mutation_p.L146F|PTPRD_ENST00000537002.1_Missense_Mutation_p.L146F|PTPRD_ENST00000360074.4_Missense_Mutation_p.L146F	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	146	Ig-like C2-type 2.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GCTGCACAAAGCATGGTGGCC	0.483										TSP Lung(15;0.13)																																							0													122.0	111.0	115.0					9																	8528696		2203	4300	6503	SO:0001583	missense	0			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.436C>T	9.37:g.8528696G>A	ENSP00000370593:p.Leu146Phe		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt	p.L146F	ENST00000381196.4	37	c.436	CCDS43786.1	9	.	.	.	.	.	.	.	.	.	.	G	15.72	2.915840	0.52546	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606;ENST00000463477	T;T;T;T;T;T;T;T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;2.7	6.17	6.17	0.99709	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.063256	0.64402	D	0.000012	T	0.68760	0.3036	N	0.21373	0.66	0.80722	D	1	P;D;D;D;D;D;D;D;D;D	0.89917	0.937;1.0;0.999;1.0;1.0;0.996;1.0;0.998;1.0;0.998	P;D;D;D;D;P;D;D;D;D	0.91635	0.809;0.993;0.993;0.993;0.999;0.854;0.988;0.964;0.979;0.965	T	0.65969	-0.6039	9	.	.	.	.	10.7375	0.46133	0.1433:0.0:0.8567:0.0	.	146;146;146;146;146;146;146;146;146;146	C9J8S8;Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;.;PTPRD_HUMAN	F	146	ENSP00000370593:L146F;ENSP00000348812:L146F;ENSP00000353187:L146F;ENSP00000351293:L146F;ENSP00000347373:L146F;ENSP00000380741:L146F;ENSP00000380735:L146F;ENSP00000440515:L146F;ENSP00000438164:L146F;ENSP00000417093:L146F;ENSP00000380731:L146F;ENSP00000417661:L146F	.	L	-	1	0	PTPRD	8518696	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	3.835000	0.55805	2.941000	0.99782	0.655000	0.94253	CTT	PTPRD	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000153707		0.483	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3	-	0.00	56	0	G			8528696	-1	tier1	-	no_errors	ENST00000356435	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	A
PTPN3	5774	genome.wustl.edu	37	9	112182864	112182864	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:112182864G>A	ENST00000374541.2	-	14	1257	c.1153C>T	c.(1153-1155)Cgg>Tgg	p.R385W	PTPN3_ENST00000446349.1_Missense_Mutation_p.R209W|PTPN3_ENST00000394827.3_5'Flank|PTPN3_ENST00000412145.1_Missense_Mutation_p.R254W|PTPN3_ENST00000262539.3_Missense_Mutation_p.R231W	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	385					negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)	p.R385W(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						ATTTCGTGCCGGAGCCGAGGA	0.458																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											110.0	95.0	100.0					9																	112182864		2203	4300	6503	SO:0001583	missense	0				CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.1153C>T	9.37:g.112182864G>A	ENSP00000363667:p.Arg385Trp		A0AUW9|E7EN99|E9PGU7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_PDZ,pfam_Dual-sp_phosphatase_cat-dom,superfamily_FERM_central,superfamily_PDZ,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-3/4,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,prints_Ez/rad/moesin_like,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.R385W	ENST00000374541.2	37	c.1153	CCDS6776.1	9	.	.	.	.	.	.	.	.	.	.	G	25.9	4.684590	0.88639	.	.	ENSG00000070159	ENST00000394831;ENST00000412145;ENST00000446349;ENST00000374541;ENST00000262539	T;T;T;T	0.71222	0.97;-0.55;0.97;-0.49	5.85	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.79482	0.4453	L	0.47716	1.5	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.994;0.982	T	0.81404	-0.0948	10	0.87932	D	0	.	13.8707	0.63617	0.0:0.0:0.7225:0.2774	.	231;340;385	B7Z3H5;B7Z9V1;P26045	.;.;PTN3_HUMAN	W	385;254;209;385;231	ENSP00000416654:R254W;ENSP00000395384:R209W;ENSP00000363667:R385W;ENSP00000262539:R231W	ENSP00000262539:R231W	R	-	1	2	PTPN3	111222685	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.599000	0.61076	1.431000	0.47355	0.655000	0.94253	CGG	PTPN3	-	pirsf_Tyr_Pase_non-rcpt_typ-3/4	ENSG00000070159		0.458	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN3	HGNC	protein_coding	OTTHUMT00000053598.4		0.00	22	0	G			112182864	-1			no_errors	ENST00000374541	ensembl	human	known	74_37	missense	5.41	34	2	SNP	1.000	A
PWP1	11137	genome.wustl.edu	37	12	108096757	108096757	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:108096757G>C	ENST00000412830.3	+	9	1020	c.852G>C	c.(850-852)tgG>tgC	p.W284C	PWP1_ENST00000541166.1_Missense_Mutation_p.W222C	NM_007062.1	NP_008993.1	Q13610	PWP1_HUMAN	PWP1 homolog (S. cerevisiae)	284					transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|endometrium(4)|kidney(1)|large_intestine(8)|lung(6)|urinary_tract(1)	23						TAATTCTGTGGGATATGTCCT	0.403																																																	0													125.0	115.0	118.0					12																	108096757		2203	4300	6503	SO:0001583	missense	0			BC000067	CCDS9114.1	12q23.3	2013-06-10				ENSG00000136045		"""WD repeat domain containing"""	17015	protein-coding gene	gene with protein product	"""endonuclein"""					7828893, 11850830	Standard	NM_007062		Approved	IEF-SSP-9502	uc001tmo.1	Q13610	OTTHUMG00000169913	ENST00000412830.3:c.852G>C	12.37:g.108096757G>C	ENSP00000387365:p.Trp284Cys		A8K3R6|Q7Z3X9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.W284C	ENST00000412830.3	37	c.852	CCDS9114.1	12	.	.	.	.	.	.	.	.	.	.	G	23.3	4.396082	0.83011	.	.	ENSG00000136045	ENST00000412830;ENST00000258531;ENST00000541166	D;D	0.83506	-1.73;-1.73	5.71	5.71	0.89125	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.94460	0.8217	H	0.96048	3.76	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95653	0.8708	10	0.87932	D	0	.	19.4527	0.94873	0.0:0.0:1.0:0.0	.	284	Q13610	PWP1_HUMAN	C	284;284;222	ENSP00000387365:W284C;ENSP00000445249:W222C	ENSP00000258531:W284C	W	+	3	0	PWP1	106620887	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.831000	0.92068	2.696000	0.92011	0.655000	0.94253	TGG	PWP1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	ENSG00000136045		0.403	PWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PWP1	HGNC	protein_coding	OTTHUMT00000406539.1	-	0.00	23	0	G	NM_007062		108096757	+1	tier1	-	no_errors	ENST00000412830	ensembl	human	known	74_37	missense	21.05	30	8	SNP	1.000	C
RAB13	5872	genome.wustl.edu	37	1	153955601	153955602	+	Intron	INS	-	-	A	rs375247680|rs370008084		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:153955601_153955602insA	ENST00000368575.3	-	4	440				RAB13_ENST00000462680.1_5'UTR	NM_002870.2	NP_002861.1	P51153	RAB13_HUMAN	RAB13, member RAS oncogene family						cellular response to insulin stimulus (GO:0032869)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endosomal transport (GO:0016197)|endothelial cell chemotaxis (GO:0035767)|establishment of protein localization to plasma membrane (GO:0090002)|establishment of Sertoli cell barrier (GO:0097368)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|protein kinase A signaling (GO:0010737)|protein localization to cell leading edge (GO:1902463)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)|trans-Golgi network to recycling endosome transport (GO:0044795)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(3)|kidney(1)|lung(5)|urinary_tract(1)	11	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			aacttcatctcaaaaaaaaaaa	0.495																																					Ovarian(138;395 2427 24306 43415)												0																																										SO:0001627	intron_variant	0			X75593	CCDS1058.1, CCDS72921.1	1q21.2	2008-02-05			ENSG00000143545	ENSG00000143545		"""RAB, member RAS oncogene"""	9762	protein-coding gene	gene with protein product		602672				8294494	Standard	NM_002870		Approved		uc001fdt.2	P51153	OTTHUMG00000036589	ENST00000368575.3:c.324+92->T	1.37:g.153955612_153955612dupA			A8K6B5|D3DV67|Q5U0A6|Q6GPG6|Q96GU4	RNA	INS	-	NULL	ENST00000368575.3	37	NULL	CCDS1058.1	1																																																																																			RAB13	-	-	ENSG00000143545		0.495	RAB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB13	HGNC	protein_coding	OTTHUMT00000088992.1		0.00	16	0	-	NM_002870		153955602	-1	tier1		no_errors	ENST00000462680	ensembl	human	known	74_37	rna	15.38	22	4	INS	0.027:0.029	A
RAB3GAP1	22930	genome.wustl.edu	37	2	135920378	135920378	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:135920378G>T	ENST00000264158.8	+	21	2490	c.2447G>T	c.(2446-2448)aGt>aTt	p.S816I	RAB3GAP1_ENST00000442034.1_Missense_Mutation_p.S816I|RAB3GAP1_ENST00000539493.1_Missense_Mutation_p.S772I|RAB3GAP1_ENST00000487003.1_3'UTR|ZRANB3_ENST00000412849.1_Intron	NM_012233.2	NP_036365.1	Q15042	RB3GP_HUMAN	RAB3 GTPase activating protein subunit 1 (catalytic)	816					brain development (GO:0007420)|camera-type eye development (GO:0043010)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|face morphogenesis (GO:0060325)|hypothalamus development (GO:0021854)|lipid particle organization (GO:0034389)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of calcium ion-dependent exocytosis of neurotransmitter (GO:1903233)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of GTPase activity (GO:0043087)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cytoplasm (GO:0005737)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32				BRCA - Breast invasive adenocarcinoma(221;0.117)		TCCCATTCCAGTAAAGTTTTG	0.333																																																	0													91.0	102.0	98.0					2																	135920378		2202	4300	6502	SO:0001583	missense	0			D31886	CCDS33294.1, CCDS54402.1	2q21.3	2013-07-09			ENSG00000115839	ENSG00000115839			17063	protein-coding gene	gene with protein product		602536				9030515, 15696165	Standard	NM_012233		Approved	RAB3GAP, KIAA0066, RAB3GAP130, WARBM1	uc010fnf.3	Q15042	OTTHUMG00000154889	ENST00000264158.8:c.2447G>T	2.37:g.135920378G>T	ENSP00000264158:p.Ser816Ile		A6H8Z3|C9J837|Q659F5|Q8TBB4	Missense_Mutation	SNP	NULL	p.S816I	ENST00000264158.8	37	c.2447	CCDS33294.1	2	.	.	.	.	.	.	.	.	.	.	G	24.8	4.572469	0.86542	.	.	ENSG00000115839	ENST00000264158;ENST00000539493;ENST00000442034	T;T;T	0.46451	0.88;0.87;0.88	6.06	6.06	0.98353	.	0.038079	0.85682	D	0.000000	T	0.52289	0.1725	L	0.48362	1.52	0.80722	D	1	D;D	0.54964	0.969;0.961	P;P	0.52856	0.711;0.64	T	0.32188	-0.9916	10	0.35671	T	0.21	-19.2039	20.6208	0.99490	0.0:0.0:1.0:0.0	.	816;816	C9J837;Q15042	.;RB3GP_HUMAN	I	816;772;816	ENSP00000264158:S816I;ENSP00000444306:S772I;ENSP00000411418:S816I	ENSP00000264158:S816I	S	+	2	0	RAB3GAP1	135636848	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.731000	0.68554	2.882000	0.98803	0.655000	0.94253	AGT	RAB3GAP1	-	NULL	ENSG00000115839		0.333	RAB3GAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3GAP1	HGNC	protein_coding	OTTHUMT00000337514.2		0.00	41	0	G	NM_012233		135920378	+1			no_errors	ENST00000264158	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
RABEPK	10244	genome.wustl.edu	37	9	127982852	127982852	+	Silent	SNP	C	C	T	rs546948946	byFrequency	TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:127982852C>T	ENST00000373538.3	+	5	709	c.399C>T	c.(397-399)agC>agT	p.S133S	RABEPK_ENST00000373544.1_3'UTR|RABEPK_ENST00000394124.4_3'UTR|RABEPK_ENST00000259460.8_Silent_p.S82S|RABEPK_ENST00000394125.4_Silent_p.S133S	NM_005833.3	NP_005824.2	Q7Z6M1	RABEK_HUMAN	Rab9 effector protein with kelch motifs	133					receptor-mediated endocytosis (GO:0006898)|vesicle docking involved in exocytosis (GO:0006904)	endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15						AAGTGACCAGCCCCCCACCAT	0.572																																																	0													118.0	106.0	110.0					9																	127982852		2203	4300	6503	SO:0001819	synonymous_variant	0			BC000503	CCDS6862.1, CCDS55341.1	9q33.1-q33.3	2010-04-19			ENSG00000136933	ENSG00000136933			16896	protein-coding gene	gene with protein product		605962				9230071	Standard	NM_005833		Approved	RAB9P40, bA65N13.1	uc004bpi.3	Q7Z6M1	OTTHUMG00000020674	ENST00000373538.3:c.399C>T	9.37:g.127982852C>T			A8K403|O00568|Q69YR2|Q6FHA4|Q6IBG7|Q6P092|Q86Y76|Q9BWB1	Silent	SNP	pfam_Kelch_2,pfam_Kelch_1	p.S133	ENST00000373538.3	37	c.399	CCDS6862.1	9																																																																																			RABEPK	-	NULL	ENSG00000136933		0.572	RABEPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABEPK	HGNC	protein_coding	OTTHUMT00000054064.1	-	0.00	54	0	C	NM_005833		127982852	+1	tier1	-	no_errors	ENST00000373538	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.005	T
RAD51	5888	genome.wustl.edu	37	15	41023356	41023356	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr15:41023356G>T	ENST00000267868.3	+	10	1268	c.1000G>T	c.(1000-1002)Gtg>Ttg	p.V334L	RAD51_ENST00000557850.1_Missense_Mutation_p.V237L|RAD51_ENST00000530766.1_3'UTR|RAD51_ENST00000532743.1_Missense_Mutation_p.V335L|RAD51_ENST00000423169.2_3'UTR|RAD51_ENST00000382643.3_Missense_Mutation_p.V335L	NM_002875.4	NP_002866.2	Q06609	RAD51_HUMAN	RAD51 recombinase	334					ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA unwinding involved in DNA replication (GO:0006268)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|mitotic recombination (GO:0006312)|positive regulation of DNA ligation (GO:0051106)|protein homooligomerization (GO:0051260)|reciprocal meiotic recombination (GO:0007131)|regulation of double-strand break repair via homologous recombination (GO:0010569)	condensed chromosome (GO:0000793)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|lateral element (GO:0000800)|mitochondrion (GO:0005739)|nuclear chromosome (GO:0000228)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|PML body (GO:0016605)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA polymerase binding (GO:0070182)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|single-stranded DNA binding (GO:0003697)|single-stranded DNA-dependent ATPase activity (GO:0043142)			breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	9		all_cancers(109;1.19e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.45e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000421)|COAD - Colon adenocarcinoma(120;0.163)		TGCAGATGGAGTGGGAGATGC	0.468								Homologous recombination																																									0													136.0	125.0	128.0					15																	41023356		2203	4300	6503	SO:0001583	missense	0			D13804	CCDS10062.1, CCDS53931.1, CCDS53932.1	15q15.1	2014-06-12	2013-07-02		ENSG00000051180	ENSG00000051180			9817	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 5"""	179617	"""RAD51 (S. cerevisiae) homolog (E coli RecA homolog)"", ""RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)"", ""RAD51 homolog (S. cerevisiae)"""	RAD51A, RECA		8358431, 8479919	Standard	NM_002875		Approved	HsRad51, HsT16930, BRCC5	uc010bbx.3	Q06609	OTTHUMG00000130067	ENST00000267868.3:c.1000G>T	15.37:g.41023356G>T	ENSP00000267868:p.Val334Leu		B0FXP0|B2R8T6|Q6FHX9|Q6ZNA8|Q9BV60	Missense_Mutation	SNP	pfam_DNA_recomb/repair_Rad51_C,pfam_DNA_recomb/repair_RecA,superfamily_P-loop_NTPase,superfamily_DNA_repair_Rad51/TF_NusA_a-hlx,smart_AAA+_ATPase,pirsf_DNA_recomb/repair_RecA-like,pfscan_DNA_recomb_RecA/RadB_ATP-bd,pfscan_RecA_monomer-monomer_interface,tigrfam_DNA_recomb/repair_Rad51	p.V335L	ENST00000267868.3	37	c.1003	CCDS10062.1	15	.	.	.	.	.	.	.	.	.	.	G	20.7	4.036189	0.75617	.	.	ENSG00000051180	ENST00000382642;ENST00000267868;ENST00000532743;ENST00000382643	T;T;T	0.45668	0.89;0.89;0.89	5.5	5.5	0.81552	DNA recombination and repair protein Rad51, C-terminal (1);DNA recombination/repair protein RecA, monomer-monomer interface (1);	0.000000	0.85682	D	0.000000	T	0.43478	0.1249	L	0.42744	1.35	0.80722	D	1	B;B	0.22541	0.071;0.002	B;B	0.29267	0.1;0.07	T	0.34378	-0.9831	10	0.72032	D	0.01	-15.472	19.5818	0.95469	0.0:0.0:1.0:0.0	.	335;334	Q6ZNA8;Q06609	.;RAD51_HUMAN	L	237;334;335;335	ENSP00000267868:V334L;ENSP00000433924:V335L;ENSP00000372088:V335L	ENSP00000267868:V334L	V	+	1	0	RAD51	38810648	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.695000	0.84257	2.850000	0.98022	0.650000	0.86243	GTG	RAD51	-	pfam_DNA_recomb/repair_Rad51_C,superfamily_P-loop_NTPase,pirsf_DNA_recomb/repair_RecA-like,pfscan_RecA_monomer-monomer_interface,tigrfam_DNA_recomb/repair_Rad51	ENSG00000051180		0.468	RAD51-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RAD51	HGNC	protein_coding	OTTHUMT00000252358.1		0.00	59	0	G	NM_002875, NM_133487		41023356	+1			no_errors	ENST00000382643	ensembl	human	known	74_37	missense	5.41	69	4	SNP	1.000	T
RAPGEF5	9771	genome.wustl.edu	37	7	22194211	22194211	+	Missense_Mutation	SNP	C	C	T	rs201437488		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:22194211C>T	ENST00000401957.2	-	7	986	c.739G>A	c.(739-741)Gtg>Atg	p.V247M	RAPGEF5_ENST00000344041.6_Missense_Mutation_p.V397M			Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5	247					nervous system development (GO:0007399)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)	GTP-dependent protein binding (GO:0030742)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|ovary(1)	6						GTTATATACACGTGGCAGAAA	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		19995	0.0		0.0	False		,,,				2504	0.001																0								C	MET/VAL	3,3725		0,3,1861	91.0	86.0	87.0		1189	5.7	1.0	7		87	0,8220		0,0,4110	yes	missense	RAPGEF5	NM_012294.3	21	0,3,5971	TT,TC,CC		0.0,0.0805,0.0251	probably-damaging	397/731	22194211	3,11945	1864	4110	5974	SO:0001583	missense	0			D87467	CCDS55093.1	7p15.3	2004-03-01			ENSG00000136237	ENSG00000136237			16862	protein-coding gene	gene with protein product	"""M-Ras-regulated GEF"""	609527				9039502, 10486569	Standard	NM_012294		Approved	KIAA0277, GFR, MR-GEF	uc003svg.3	Q92565	OTTHUMG00000152525	ENST00000401957.2:c.739G>A	7.37:g.22194211C>T	ENSP00000384044:p.Val247Met		A4D140|Q8IXU5	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.V397M	ENST00000401957.2	37	c.1189		7	.	.	.	.	.	.	.	.	.	.	C	24.9	4.580297	0.86645	8.05E-4	0.0	ENSG00000136237	ENST00000344041;ENST00000425852;ENST00000258735;ENST00000401957;ENST00000458533	T;T	0.63417	0.45;-0.04	5.69	5.69	0.88448	Ras guanine nucleotide exchange factor, domain (1);	0.111433	0.64402	D	0.000011	T	0.78984	0.4370	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.73708	0.89;0.981	T	0.78489	-0.2184	10	0.59425	D	0.04	.	20.205	0.98274	0.0:1.0:0.0:0.0	.	247;397	Q92565;A8MQ07	RPGF5_HUMAN;.	M	397;247;247;247;135	ENSP00000343656:V397M;ENSP00000384044:V247M	ENSP00000258735:V247M	V	-	1	0	RAPGEF5	22160736	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.696000	0.68287	2.857000	0.98124	0.650000	0.86243	GTG	RAPGEF5	-	superfamily_Ras_GEF_dom	ENSG00000136237		0.413	RAPGEF5-001	KNOWN	basic	protein_coding	RAPGEF5	HGNC	protein_coding	OTTHUMT00000326590.2	-	0.00	36	0	C	NM_012294		22194211	-1	tier1	rs201437488	no_errors	ENST00000344041	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
RASL12	51285	genome.wustl.edu	37	15	65347312	65347312	+	Silent	SNP	G	G	A	rs143172698		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr15:65347312G>A	ENST00000220062.4	-	5	1002	c.726C>T	c.(724-726)acC>acT	p.T242T	RASL12_ENST00000434605.2_Silent_p.T231T|RASL12_ENST00000421977.3_Silent_p.T223T	NM_016563.2	NP_057647.1	Q9NYN1	RASLC_HUMAN	RAS-like, family 12	242					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			lung(1)|ovary(1)|skin(1)|urinary_tract(1)	4						ATGACTTCACGGTGACCAGCT	0.642											OREG0023189	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	g|||	1	0.000199681	0.0008	0.0	5008	,	,		18730	0.0		0.0	False		,,,				2504	0.0																0								A		13,4391	21.2+/-45.6	0,13,2189	45.0	43.0	43.0		726	-10.5	0.2	15	dbSNP_134	43	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	RASL12	NM_016563.2		0,14,6487	AA,AG,GG		0.0116,0.2952,0.1077		242/267	65347312	14,12988	2202	4299	6501	SO:0001819	synonymous_variant	0			AF233588	CCDS10200.1	15q11.2-q22.33	2014-05-09			ENSG00000103710	ENSG00000103710			30289	protein-coding gene	gene with protein product	"""Ras family member Ris"""					12107412	Standard	NM_016563		Approved	RIS	uc002aoi.1	Q9NYN1	OTTHUMG00000133115	ENST00000220062.4:c.726C>T	15.37:g.65347312G>A		1083	B2RC29|B4DJW2|B4DU82	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.T242	ENST00000220062.4	37	c.726	CCDS10200.1	15																																																																																			RASL12	-	NULL	ENSG00000103710		0.642	RASL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASL12	HGNC	protein_coding	OTTHUMT00000256782.2	-	0.00	35	0	G	NM_016563		65347312	-1	tier1	rs143172698	no_errors	ENST00000220062	ensembl	human	known	74_37	silent	42.86	36	27	SNP	0.011	A
RASSF9	9182	genome.wustl.edu	37	12	86199481	86199481	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:86199481A>T	ENST00000361228.3	-	2	675	c.307T>A	c.(307-309)Tgg>Agg	p.W103R		NM_005447.3	NP_005438.2	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 9	103	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				endosomal transport (GO:0016197)|protein targeting (GO:0006605)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|trans-Golgi network transport vesicle membrane (GO:0012510)	transporter activity (GO:0005215)			endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCATCTCCCCACGCTTTCCAA	0.463																																																	0													113.0	113.0	113.0					12																	86199481		1904	4126	6030	SO:0001583	missense	0				CCDS44950.1	12q21.31	2008-02-22	2008-02-22	2008-02-22		ENSG00000198774			15739	protein-coding gene	gene with protein product		610383	"""peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor"""	PAMCI		9837933, 18272789	Standard	NM_005447		Approved	P-CIP1	uc001taf.1	O75901	OTTHUMG00000169831	ENST00000361228.3:c.307T>A	12.37:g.86199481A>T	ENSP00000354884:p.Trp103Arg		B3KMQ4|Q8N5U8	Missense_Mutation	SNP	smart_Ras-assoc,pfscan_Ras-assoc	p.W103R	ENST00000361228.3	37	c.307	CCDS44950.1	12	.	.	.	.	.	.	.	.	.	.	A	19.25	3.791035	0.70452	.	.	ENSG00000198774	ENST00000361228	T	0.49139	0.79	4.96	4.96	0.65561	Ras-association (2);	0.000000	0.85682	D	0.000000	T	0.74688	0.3749	M	0.91717	3.235	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81491	-0.0909	10	0.72032	D	0.01	-10.8558	14.9265	0.70881	1.0:0.0:0.0:0.0	.	103	O75901	RASF9_HUMAN	R	103	ENSP00000354884:W103R	ENSP00000354884:W103R	W	-	1	0	RASSF9	84723612	1.000000	0.71417	0.982000	0.44146	0.907000	0.53573	9.213000	0.95133	1.999000	0.58509	0.496000	0.49642	TGG	RASSF9	-	smart_Ras-assoc,pfscan_Ras-assoc	ENSG00000198774		0.463	RASSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF9	HGNC	protein_coding	OTTHUMT00000406109.1		0.00	24	0	A			86199481	-1			no_errors	ENST00000361228	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.999	T
RBM12B	389677	genome.wustl.edu	37	8	94746364	94746364	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:94746364G>A	ENST00000399300.2	-	3	2488	c.2275C>T	c.(2275-2277)Ccc>Tcc	p.P759S	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000520961.1_Intron|RBM12B_ENST00000517700.1_Missense_Mutation_p.P639S	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	759							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TGCTCTGGGGGTGGCCGCCGG	0.682																																																	0													31.0	37.0	35.0					8																	94746364		1796	4041	5837	SO:0001583	missense	0				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.2275C>T	8.37:g.94746364G>A	ENSP00000382239:p.Pro759Ser		A8MYB5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P759S	ENST00000399300.2	37	c.2275	CCDS43755.1	8	.	.	.	.	.	.	.	.	.	.	G	11.09	1.536278	0.27475	.	.	ENSG00000183808	ENST00000399300;ENST00000517700	T;T	0.07908	3.15;3.19	4.66	-0.876	0.10624	.	.	.	.	.	T	0.04543	0.0124	N	0.19112	0.55	0.09310	N	1	B	0.18461	0.028	B	0.12156	0.007	T	0.40701	-0.9549	9	0.51188	T	0.08	-3.4385	2.0554	0.03580	0.2624:0.1314:0.4716:0.1346	.	759	Q8IXT5	RB12B_HUMAN	S	759;639	ENSP00000382239:P759S;ENSP00000427729:P639S	ENSP00000382239:P759S	P	-	1	0	RBM12B	94815540	0.140000	0.22579	0.003000	0.11579	0.219000	0.24729	0.576000	0.23744	-0.150000	0.11195	0.563000	0.77884	CCC	RBM12B	-	NULL	ENSG00000183808		0.682	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM12B	HGNC	protein_coding	OTTHUMT00000383603.1	-	0.00	21	0	G	NM_203390		94746364	-1	tier1	-	no_errors	ENST00000399300	ensembl	human	known	74_37	missense	19.23	21	5	SNP	0.007	A
RBM19	9904	genome.wustl.edu	37	12	114296648	114296648	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:114296648C>T	ENST00000545145.2	-	22	2690	c.2612G>A	c.(2611-2613)gGc>gAc	p.G871D	RBM19_ENST00000261741.5_Missense_Mutation_p.G871D|RBM19_ENST00000392561.3_Missense_Mutation_p.G871D	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	871	RRM 6. {ECO:0000255|PROSITE- ProRule:PRU00176}.				multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					TCTGTGTGTGCCTGTCCCAGT	0.552																																																	0													142.0	131.0	135.0					12																	114296648		2203	4300	6503	SO:0001583	missense	0			AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.2612G>A	12.37:g.114296648C>T	ENSP00000442053:p.Gly871Asp		A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom	p.G871D	ENST00000545145.2	37	c.2612	CCDS9172.1	12	.	.	.	.	.	.	.	.	.	.	C	19.97	3.925965	0.73327	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.20738	2.05;2.05;2.05	5.2	5.2	0.72013	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.185124	0.45867	D	0.000333	T	0.50051	0.1593	M	0.83852	2.665	0.80722	D	1	D	0.67145	0.996	D	0.68765	0.96	T	0.50162	-0.8860	10	0.35671	T	0.21	-25.8407	18.7652	0.91869	0.0:1.0:0.0:0.0	.	871	Q9Y4C8	RBM19_HUMAN	D	871	ENSP00000442053:G871D;ENSP00000376344:G871D;ENSP00000261741:G871D	ENSP00000261741:G871D	G	-	2	0	RBM19	112781031	1.000000	0.71417	0.542000	0.28115	0.985000	0.73830	6.819000	0.75262	2.412000	0.81896	0.655000	0.94253	GGC	RBM19	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000122965		0.552	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	RBM19	HGNC	protein_coding	OTTHUMT00000405251.1	-	0.00	64	0	C	NM_016196		114296648	-1	tier1	-	no_errors	ENST00000261741	ensembl	human	known	74_37	missense	5.56	67	4	SNP	0.999	T
RBM27	54439	genome.wustl.edu	37	5	145613276	145613276	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:145613276C>T	ENST00000265271.5	+	7	1280	c.1114C>T	c.(1114-1116)Cct>Tct	p.P372S	RBM27_ENST00000506502.1_Missense_Mutation_p.P372S	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	372	Pro-rich.				mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACATGGTCAGCCTCCACCATC	0.532																																																	0													45.0	45.0	45.0					5																	145613276		1568	3582	5150	SO:0001583	missense	0			AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.1114C>T	5.37:g.145613276C>T	ENSP00000265271:p.Pro372Ser		Q8IYW9	Missense_Mutation	SNP	pfam_PWI_dom,pfam_Znf_CCCH,smart_RRM_dom,pfscan_RRM_dom	p.P372S	ENST00000265271.5	37	c.1114	CCDS43378.1	5	.	.	.	.	.	.	.	.	.	.	C	16.59	3.164589	0.57476	.	.	ENSG00000091009	ENST00000265271	T	0.64085	-0.08	5.52	5.52	0.82312	.	0.144280	0.48767	D	0.000168	T	0.51975	0.1706	L	0.38175	1.15	0.58432	D	0.999992	P;B	0.37061	0.58;0.437	B;B	0.32090	0.14;0.098	T	0.53865	-0.8378	10	0.41790	T	0.15	-12.9411	16.8041	0.85621	0.0:0.8716:0.1284:0.0	.	372;372	Q9P2N5;B3KY61	RBM27_HUMAN;.	S	372	ENSP00000265271:P372S	ENSP00000265271:P372S	P	+	1	0	RBM27	145593469	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	3.357000	0.52277	2.748000	0.94277	0.655000	0.94253	CCT	RBM27	-	NULL	ENSG00000091009		0.532	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM27	HGNC	protein_coding	OTTHUMT00000373420.1	-	0.00	51	0	C	XM_291128		145613276	+1	tier1	-	no_errors	ENST00000265271	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
RBM3	5935	genome.wustl.edu	37	X	48433709	48433709	+	Intron	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:48433709G>C	ENST00000376759.3	+	2	166				AC115618.1_ENST00000376775.2_5'Flank|RBM3_ENST00000466764.1_Intron|RBM3_ENST00000376755.1_Intron|RBM3_ENST00000354480.2_5'Flank|RBM3_ENST00000430348.2_Intron	NM_006743.4	NP_006734.1	P98179	RBM3_HUMAN	RNA binding motif (RNP1, RRM) protein 3						positive regulation of translation (GO:0045727)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of translation (GO:0006417)|response to cold (GO:0009409)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						GTTGGTGAGAGAAAGTCTGGG	0.478											OREG0019765	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													41.0	32.0	35.0					X																	48433709		2201	4300	6501	SO:0001627	intron_variant	0			BC006825	CCDS14301.1	Xp11.2	2014-05-19	2004-04-23		ENSG00000102317	ENSG00000102317		"""RNA binding motif (RRM) containing"""	9900	protein-coding gene	gene with protein product		300027	"""RNA binding motif protein 3"""			8634703	Standard	NM_006743		Approved	IS1-RNPL	uc004dkf.2	P98179	OTTHUMG00000024121	ENST00000376759.3:c.103+38G>C	X.37:g.48433709G>C		954		RNA	SNP	-	NULL	ENST00000376759.3	37	NULL	CCDS14301.1	X																																																																																			RBM3	-	-	ENSG00000102317		0.478	RBM3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM3	HGNC	protein_coding	OTTHUMT00000060755.1	-	0.00	22	0	G	NM_006743		48433709	+1	tier1	-	no_errors	ENST00000491240	ensembl	human	known	74_37	rna	44.00	14	11	SNP	0.000	C
RBPMS2	348093	genome.wustl.edu	37	15	65040632	65040632	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr15:65040632C>T	ENST00000300069.4	-	6	820	c.553G>A	c.(553-555)Gcc>Acc	p.A185T	RBPMS2_ENST00000560606.1_Missense_Mutation_p.A74T	NM_194272.1	NP_919248.1	Q6ZRY4	RBPS2_HUMAN	RNA binding protein with multiple splicing 2	185							nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)			breast(1)|large_intestine(3)|lung(3)|prostate(1)	8						GCGTGGAGGGCGGCGGCAGCG	0.632																																																	0																																										SO:0001583	missense	0			AY369207	CCDS32271.1	15q22.31	2014-05-15			ENSG00000166831	ENSG00000166831		"""RNA binding motif (RRM) containing"""	19098	protein-coding gene	gene with protein product							Standard	NM_194272		Approved		uc002anq.3	Q6ZRY4	OTTHUMG00000172423	ENST00000300069.4:c.553G>A	15.37:g.65040632C>T	ENSP00000300069:p.Ala185Thr		A2RRG0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A185T	ENST00000300069.4	37	c.553	CCDS32271.1	15	.	.	.	.	.	.	.	.	.	.	C	6.510	0.462296	0.12342	.	.	ENSG00000166831	ENST00000300069	T	0.35421	1.31	4.53	-1.65	0.08291	.	0.432896	0.25520	N	0.030108	T	0.23410	0.0566	L	0.43923	1.385	0.45066	D	0.998089	B	0.19935	0.04	B	0.10450	0.005	T	0.02646	-1.1129	10	0.44086	T	0.13	4.0796	5.3387	0.15971	0.1303:0.5409:0.0:0.3288	.	185	Q6ZRY4	RBPS2_HUMAN	T	185	ENSP00000300069:A185T	ENSP00000300069:A185T	A	-	1	0	RBPMS2	62827685	0.500000	0.26091	0.057000	0.19452	0.065000	0.16274	1.157000	0.31724	-0.379000	0.07906	0.563000	0.77884	GCC	RBPMS2	-	NULL	ENSG00000166831		0.632	RBPMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBPMS2	HGNC	protein_coding	OTTHUMT00000418466.1		0.00	52	0	C			65040632	-1			no_errors	ENST00000300069	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.661	T
REL	5966	genome.wustl.edu	37	2	61144029	61144029	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:61144029A>G	ENST00000295025.8	+	5	732	c.412A>G	c.(412-414)Aat>Gat	p.N138D	REL_ENST00000394479.3_Missense_Mutation_p.N138D	NM_002908.2	NP_002899.1	Q04864	REL_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog	138	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				cytokine production (GO:0001816)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of neuron death (GO:1901215)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(5)|lung(3)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	16	all_hematologic(2;0.0797)	Ovarian(717;0.0728)	LUSC - Lung squamous cell carcinoma(5;6.2e-08)|Lung(5;1.65e-06)|Epithelial(17;0.064)|all cancers(80;0.221)			AAAACAGCTGAATGATATTGA	0.378			A		Hodgkin Lymphoma																																			Dom	yes		2	2p13-p12	5966	v-rel reticuloendotheliosis viral oncogene homolog (avian)		L	0													151.0	140.0	144.0					2																	61144029		2203	4300	6503	SO:0001583	missense	0			M11595	CCDS1864.1, CCDS74515.1	2p13-p12	2013-07-09	2013-07-09		ENSG00000162924	ENSG00000162924			9954	protein-coding gene	gene with protein product		164910				1577270	Standard	XM_005264470		Approved	I-Rel, c-Rel	uc002sam.1	Q04864	OTTHUMG00000129418	ENST00000295025.8:c.412A>G	2.37:g.61144029A>G	ENSP00000295025:p.Asn138Asp		Q17RU2|Q2PNZ7|Q6LDY0	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NF_Rel_Dor	p.N138D	ENST00000295025.8	37	c.412	CCDS1864.1	2	.	.	.	.	.	.	.	.	.	.	A	14.46	2.543223	0.45280	.	.	ENSG00000162924	ENST00000295025;ENST00000394479	T;T	0.41065	1.01;1.01	5.82	4.93	0.64822	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.213212	0.40640	N	0.001041	T	0.26521	0.0648	N	0.11560	0.145	0.25785	N	0.984689	B;B	0.25169	0.027;0.119	B;B	0.30855	0.004;0.121	T	0.14090	-1.0485	10	0.12430	T	0.62	-2.4128	15.5398	0.76035	0.1538:0.8462:0.0:0.0	.	138;138	Q17RU2;Q04864	.;REL_HUMAN	D	138	ENSP00000295025:N138D;ENSP00000377989:N138D	ENSP00000295025:N138D	N	+	1	0	REL	60997533	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.022000	0.30052	1.395000	0.46643	0.482000	0.46254	AAT	REL	-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD	ENSG00000162924		0.378	REL-001	KNOWN	basic|CCDS	protein_coding	REL	HGNC	protein_coding	OTTHUMT00000251576.3		0.00	45	0	A	NM_002908		61144029	+1			no_errors	ENST00000295025	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	G
RHOA	387	genome.wustl.edu	37	3	49405962	49405962	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:49405962T>C	ENST00000418115.1	-	3	560	c.176A>G	c.(175-177)gAc>gGc	p.D59G	RHOA_ENST00000454011.2_Intron|RHOA-IT1_ENST00000428083.1_RNA|RHOA_ENST00000422781.1_Missense_Mutation_p.D59G	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A	59					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)	p.D59G(1)		cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CCCAGCTGTGTCCCACAAAGC	0.463																																																	1	Substitution - Missense(1)	prostate(1)											105.0	101.0	103.0					3																	49405962		2203	4300	6503	SO:0001583	missense	0			BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838	ENST00000418115.1:c.176A>G	3.37:g.49405962T>C	ENSP00000400175:p.Asp59Gly		P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.D59G	ENST00000418115.1	37	c.176	CCDS2795.1	3	.	.	.	.	.	.	.	.	.	.	T	26.8	4.772178	0.90108	.	.	ENSG00000067560	ENST00000418115;ENST00000422781;ENST00000445425	D;D;D	0.86297	-2.1;-2.1;-2.1	5.78	5.78	0.91487	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.96632	0.8901	H	0.99545	4.62	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.98321	1.0528	10	0.87932	D	0	.	14.9619	0.71164	0.0:0.0:0.0:1.0	.	59	P61586	RHOA_HUMAN	G	59	ENSP00000400175:D59G;ENSP00000413587:D59G;ENSP00000408402:D59G	ENSP00000400175:D59G	D	-	2	0	RHOA	49380966	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.893000	0.87330	2.219000	0.72066	0.450000	0.29827	GAC	RHOA	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000067560		0.463	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOA	HGNC	protein_coding	OTTHUMT00000346157.3	-	0.00	39	0	T	NM_001664		49405962	-1	tier1	-	no_errors	ENST00000418115	ensembl	human	known	74_37	missense	12.20	36	5	SNP	1.000	C
RIMS2	9699	genome.wustl.edu	37	8	104898169	104898169	+	Silent	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:104898169T>C	ENST00000436393.2	+	2	917	c.676T>C	c.(676-678)Ttg>Ctg	p.L226L	RIMS2_ENST00000262231.10_Silent_p.L256L|RIMS2_ENST00000406091.3_Silent_p.L448L|RIMS2_ENST00000507740.1_Silent_p.L256L			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	479					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.L256L(1)|p.L226L(1)|p.L484L(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TAGACCAGACTTGAGGCGTAC	0.463										HNSCC(12;0.0054)																																							3	Substitution - coding silent(3)	large_intestine(3)											102.0	94.0	97.0					8																	104898169		1929	4148	6077	SO:0001819	synonymous_variant	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.676T>C	8.37:g.104898169T>C			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.L448	ENST00000436393.2	37	c.1342		8																																																																																			RIMS2	-	NULL	ENSG00000176406		0.463	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	-	0.00	30	0	T	NM_001100117		104898169	+1	tier1	-	no_errors	ENST00000406091	ensembl	human	known	74_37	silent	25.81	23	8	SNP	0.117	C
RLF	6018	genome.wustl.edu	37	1	40704105	40704105	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:40704105G>T	ENST00000372771.4	+	8	3758	c.3731G>T	c.(3730-3732)tGt>tTt	p.C1244F		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	1244					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			AAACCACACTGTCATCCTAAA	0.398																																																	0													67.0	65.0	66.0					1																	40704105		2203	4300	6503	SO:0001583	missense	0				CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.3731G>T	1.37:g.40704105G>T	ENSP00000361857:p.Cys1244Phe		Q14CQ1|Q9NU60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C1244F	ENST00000372771.4	37	c.3731	CCDS448.1	1	.	.	.	.	.	.	.	.	.	.	G	5.569	0.289825	0.10567	.	.	ENSG00000117000	ENST00000372771;ENST00000535839	T	0.13657	2.57	5.91	4.94	0.65067	.	0.322422	0.37669	N	0.001996	T	0.08935	0.0221	N	0.19112	0.55	0.09310	N	1	B;B	0.10296	0.003;0.002	B;B	0.08055	0.003;0.001	T	0.21690	-1.0238	10	0.27082	T	0.32	-10.3681	11.0516	0.47894	0.0:0.2413:0.6292:0.1295	.	937;1244	F5H2M5;Q13129	.;RLF_HUMAN	F	1244;937	ENSP00000361857:C1244F	ENSP00000361857:C1244F	C	+	2	0	RLF	40476692	0.534000	0.26362	1.000000	0.80357	0.600000	0.36913	2.040000	0.41203	2.793000	0.96121	0.655000	0.94253	TGT	RLF	-	NULL	ENSG00000117000		0.398	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLF	HGNC	protein_coding	OTTHUMT00000015767.1		0.00	20	0	G	NM_012421		40704105	+1			no_errors	ENST00000372771	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.018	T
RPTOR	57521	genome.wustl.edu	37	17	78865547	78865547	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:78865547G>T	ENST00000306801.3	+	18	2373	c.2011G>T	c.(2011-2013)Gtg>Ttg	p.V671L	RPTOR_ENST00000575542.1_3'UTR|RPTOR_ENST00000544334.2_Missense_Mutation_p.V513L	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	671					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						GAGTCATCTTGTGGTTCAGTA	0.517																																																	0													182.0	157.0	166.0					17																	78865547		2203	4300	6503	SO:0001583	missense	0				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.2011G>T	17.37:g.78865547G>T	ENSP00000307272:p.Val671Leu		B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	pfam_HEAT,pfam_WD40_repeat,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Raptor	p.V671L	ENST00000306801.3	37	c.2011	CCDS11773.1	17	.	.	.	.	.	.	.	.	.	.	G	18.06	3.539444	0.65085	.	.	ENSG00000141564	ENST00000306801;ENST00000544334	T;T	0.34275	1.38;1.37	4.69	4.69	0.59074	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.55417	0.1919	L	0.56769	1.78	0.80722	D	1	P;B	0.47910	0.902;0.179	D;B	0.64595	0.927;0.057	T	0.49153	-0.8969	10	0.31617	T	0.26	.	17.8192	0.88645	0.0:0.0:1.0:0.0	.	513;671	F5H7J5;Q8N122	.;RPTOR_HUMAN	L	671;513	ENSP00000307272:V671L;ENSP00000442479:V513L	ENSP00000307272:V671L	V	+	1	0	RPTOR	76480142	1.000000	0.71417	0.045000	0.18777	0.155000	0.21991	9.112000	0.94314	2.434000	0.82447	0.591000	0.81541	GTG	RPTOR	-	superfamily_ARM-type_fold	ENSG00000141564		0.517	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTOR	HGNC	protein_coding	OTTHUMT00000438125.1	-	0.00	22	0	G	NM_020761		78865547	+1	tier1	-	no_errors	ENST00000306801	ensembl	human	known	74_37	missense	20.00	60	15	SNP	0.994	T
RRN3P2	653390	genome.wustl.edu	37	16	29124405	29124405	+	RNA	SNP	C	C	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr16:29124405C>G	ENST00000564580.1	+	0	1483							A6NIE6	RN3P2_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 2																		CAGATGAAGACGAACCTGCTT	0.358																																																	0																																												0					16p11.2	2011-12-02			ENSG00000103472	ENSG00000103472			37619	pseudogene	pseudogene							Standard	NR_003369		Approved		uc002dsf.4	A6NIE6			16.37:g.29124405C>G				RNA	SNP	-	NULL	ENST00000564580.1	37	NULL		16																																																																																			RRN3P2	-	-	ENSG00000103472		0.358	RRN3P2-001	KNOWN	basic	processed_transcript	RRN3P2	HGNC	pseudogene	OTTHUMT00000433243.1	-	0.00	75	0	C	NR_003369		29124405	+1	tier1	-	no_errors	ENST00000427965	ensembl	human	known	74_37	rna	15.79	80	15	SNP	0.977	G
RYR2	6262	genome.wustl.edu	37	1	237777544	237777544	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:237777544C>T	ENST00000366574.2	+	37	5433	c.5116C>T	c.(5116-5118)Ctg>Ttg	p.L1706L	RYR2_ENST00000360064.6_Silent_p.L1704L|RYR2_ENST00000542537.1_Silent_p.L1690L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1706	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTATGACCTGCTGATTGACAT	0.537																																																	0													62.0	63.0	63.0					1																	237777544		2168	4272	6440	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5116C>T	1.37:g.237777544C>T			Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.L1704	ENST00000366574.2	37	c.5110	CCDS55691.1	1																																																																																			RYR2	-	NULL	ENSG00000198626		0.537	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	53	0	C	NM_001035		237777544	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	silent	6.35	59	4	SNP	1.000	T
SDK1	221935	genome.wustl.edu	37	7	3681696	3681696	+	Silent	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:3681696T>G	ENST00000404826.2	+	4	811	c.672T>G	c.(670-672)acT>acG	p.T224T	SDK1_ENST00000389531.3_Silent_p.T224T|AC011284.3_ENST00000427920.1_RNA	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	224	Ig-like C2-type 2.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CTCAAGTGACTTGGTTTAGAG	0.448																																																	0													104.0	93.0	97.0					7																	3681696		2203	4300	6503	SO:0001819	synonymous_variant	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.672T>G	7.37:g.3681696T>G			Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T224	ENST00000404826.2	37	c.672	CCDS34590.1	7																																																																																			SDK1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2	ENSG00000146555		0.448	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	-	0.00	30	0	T	NM_152744		3681696	+1	tier1	-	no_errors	ENST00000404826	ensembl	human	known	74_37	silent	17.07	34	7	SNP	0.324	G
SELP	6403	genome.wustl.edu	37	1	169588459	169588459	+	Splice_Site	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:169588459T>C	ENST00000263686.6	-	2	41		c.e2-2		SELP_ENST00000367792.2_Splice_Site|SELP_ENST00000367788.2_Splice_Site|SELP_ENST00000367794.2_Splice_Site|SELP_ENST00000367791.2_Splice_Site|SELP_ENST00000367793.2_Splice_Site|SELP_ENST00000367786.2_Splice_Site|SELP_ENST00000458599.2_Splice_Site	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)						blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	GCAGTTGGCCTGAAACAAGAA	0.388																																																	0													82.0	82.0	82.0					1																	169588459		2203	4300	6503	SO:0001630	splice_region_variant	0			BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.4-2A>G	1.37:g.169588459T>C			Q5R344|Q8IVD1	Splice_Site	SNP	-	e2-2	ENST00000263686.6	37	c.4-2	CCDS1282.1	1	.	.	.	.	.	.	.	.	.	.	T	8.216	0.801478	0.16397	.	.	ENSG00000174175	ENST00000367795;ENST00000367790;ENST00000367789;ENST00000263686;ENST00000544572;ENST00000367793;ENST00000367794;ENST00000367792;ENST00000367791;ENST00000367788;ENST00000367786	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0378	0.47811	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SELP	167855083	1.000000	0.71417	1.000000	0.80357	0.235000	0.25334	3.669000	0.54561	2.162000	0.67917	0.533000	0.62120	.	SELP	-	-	ENSG00000174175		0.388	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SELP	HGNC	protein_coding	OTTHUMT00000083916.4		0.00	38	0	T	NM_003005	Intron	169588459	-1			no_errors	ENST00000263686	ensembl	human	known	74_37	splice_site	11.11	32	4	SNP	1.000	C
SIDT1	54847	genome.wustl.edu	37	3	113303617	113303617	+	Splice_Site	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:113303617G>T	ENST00000264852.4	+	8	1633		c.e8+1		SIDT1_ENST00000393830.3_Splice_Site	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1						dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)			breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						TCCATTAAAGGTCAGTGTTGG	0.358																																																	0													95.0	94.0	94.0					3																	113303617		2203	4300	6503	SO:0001630	splice_region_variant	0			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.907+1G>T	3.37:g.113303617G>T			Q17RR4	Splice_Site	SNP	-	e8+1	ENST00000264852.4	37	c.907+1	CCDS2974.1	3	.	.	.	.	.	.	.	.	.	.	G	15.30	2.793616	0.50102	.	.	ENSG00000072858	ENST00000264852;ENST00000393830	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.177	0.98182	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SIDT1	114786307	1.000000	0.71417	1.000000	0.80357	0.526000	0.34562	6.368000	0.73104	2.854000	0.98071	0.655000	0.94253	.	SIDT1	-	-	ENSG00000072858		0.358	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT1	HGNC	protein_coding	OTTHUMT00000317564.1	-	0.00	32	0	G	NM_017699	Intron	113303617	+1	tier1	-	no_errors	ENST00000393830	ensembl	human	known	74_37	splice_site	7.14	52	4	SNP	1.000	T
SIN3B	23309	genome.wustl.edu	37	19	16982133	16982133	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:16982133C>G	ENST00000248054.5	+	14	2537	c.2516C>G	c.(2515-2517)aCc>aGc	p.T839S	SIN3B_ENST00000595541.1_Missense_Mutation_p.T429S|SIN3B_ENST00000379803.1_Missense_Mutation_p.T871S					SIN3 transcription regulator family member B											endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						TACGAGGACACCCTACGCGAG	0.647																																																	0													112.0	94.0	100.0					19																	16982133		2203	4300	6503	SO:0001583	missense	0			AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.2516C>G	19.37:g.16982133C>G	ENSP00000248054:p.Thr839Ser			Missense_Mutation	SNP	pfam_PAH,pfam_HDAC_interact,superfamily_PAH,smart_HDAC_interact	p.T871S	ENST00000248054.5	37	c.2612		19	.	.	.	.	.	.	.	.	.	.	C	16.26	3.072440	0.55646	.	.	ENSG00000127511	ENST00000379803;ENST00000248054	T;T	0.41400	1.01;1.0	5.05	5.05	0.67936	.	0.051029	0.85682	D	0.000000	T	0.44435	0.1293	N	0.16201	0.385	0.58432	D	0.999996	D;P;B	0.71674	0.998;0.815;0.22	D;B;B	0.77004	0.989;0.421;0.074	T	0.20538	-1.0272	10	0.06236	T	0.91	-23.5198	18.3659	0.90390	0.0:1.0:0.0:0.0	.	429;839;871	B7Z392;O75182-2;O75182	.;.;SIN3B_HUMAN	S	871;839	ENSP00000369131:T871S;ENSP00000248054:T839S	ENSP00000248054:T839S	T	+	2	0	SIN3B	16843133	1.000000	0.71417	0.743000	0.31040	0.835000	0.47333	7.510000	0.81708	2.347000	0.79759	0.491000	0.48974	ACC	SIN3B	-	NULL	ENSG00000127511		0.647	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	SIN3B	HGNC	protein_coding	OTTHUMT00000462846.1	-	0.00	23	0	C	NM_015260		16982133	+1	tier1	-	no_errors	ENST00000379803	ensembl	human	known	74_37	missense	26.32	28	10	SNP	1.000	G
SIRPG	55423	genome.wustl.edu	37	20	1629814	1629814	+	Missense_Mutation	SNP	C	C	T	rs200001337		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr20:1629814C>T	ENST00000303415.3	-	2	378	c.314G>A	c.(313-315)cGc>cAc	p.R105H	SIRPG_ENST00000381583.2_Missense_Mutation_p.R105H|SIRPG_ENST00000216927.4_Missense_Mutation_p.R105H|RP11-77C3.3_ENST00000456177.1_RNA|SIRPG_ENST00000381580.1_Missense_Mutation_p.R72H|SIRPG_ENST00000344103.4_Missense_Mutation_p.R105H	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	105	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						GCTACTGATGCGGATGGAAAA	0.483																																																	0													310.0	255.0	274.0					20																	1629814		2203	4300	6503	SO:0001583	missense	0			AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.314G>A	20.37:g.1629814C>T	ENSP00000305529:p.Arg105His		B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_C1-set,pfscan_Ig-like_dom	p.R105H	ENST00000303415.3	37	c.314	CCDS13020.2	20	.	.	.	.	.	.	.	.	.	.	.	5.089	0.202128	0.09652	.	.	ENSG00000089012	ENST00000381580;ENST00000344103;ENST00000303415;ENST00000381583;ENST00000216927	T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21	1.93	0.97	0.19692	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.198861	0.36167	N	0.002741	T	0.45276	0.1334	N	0.26130	0.795	0.39890	D	0.973759	B;B;B	0.23854	0.092;0.091;0.063	B;B;B	0.20384	0.01;0.01;0.029	T	0.19451	-1.0305	10	0.35671	T	0.21	.	4.4718	0.11715	0.0:0.7972:0.0:0.2028	.	105;105;105	Q9P1W8-3;Q9P1W8-4;Q9P1W8	.;.;SIRPG_HUMAN	H	72;105;105;105;105	ENSP00000370992:R72H;ENSP00000342759:R105H;ENSP00000305529:R105H;ENSP00000370995:R105H;ENSP00000216927:R105H	ENSP00000216927:R105H	R	-	2	0	SIRPG	1577814	0.435000	0.25577	0.963000	0.40424	0.349000	0.29174	-1.065000	0.03458	0.378000	0.24764	0.195000	0.17529	CGC	SIRPG	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000089012		0.483	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRPG	HGNC	protein_coding	OTTHUMT00000077566.2	-	0.00	144	0	C	NM_018556		1629814	-1	tier1	rs200001337	no_errors	ENST00000303415	ensembl	human	known	74_37	missense	23.29	112	34	SNP	0.969	T
SLAMF9	89886	genome.wustl.edu	37	1	159922241	159922241	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:159922241C>A	ENST00000368093.3	-	3	591	c.475G>T	c.(475-477)Gag>Tag	p.E159*	SLAMF9_ENST00000368092.3_Intron|SLAMF9_ENST00000466773.1_5'UTR	NM_033438.3	NP_254273.2	Q96A28	SLAF9_HUMAN	SLAM family member 9	159	Ig-like C2-type.					integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CCTGCCTTCTCCACAGAGCAC	0.567																																																	0													147.0	140.0	142.0					1																	159922241		2203	4300	6503	SO:0001587	stop_gained	0			AY034613	CCDS1191.1, CCDS53392.1	1q23.1	2013-01-11			ENSG00000162723	ENSG00000162723		"""Immunoglobulin superfamily / V-set domain containing"""	18430	protein-coding gene	gene with protein product		608589				11685473	Standard	NM_033438		Approved	CD2F-10, CD84-H1, SF2001	uc001fus.3	Q96A28	OTTHUMG00000024074	ENST00000368093.3:c.475G>T	1.37:g.159922241C>A	ENSP00000357072:p.Glu159*		Q5JRQ9|Q5JRR0|Q6UWG1	Nonsense_Mutation	SNP	pfam_Ig_V-set,pfscan_Ig-like_dom	p.E159*	ENST00000368093.3	37	c.475	CCDS1191.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.356798	0.97502	.	.	ENSG00000162723	ENST00000368093	.	.	.	4.89	3.96	0.45880	.	0.583578	0.17793	N	0.161824	.	.	.	.	.	.	0.21579	N	0.999636	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.5764	9.458	0.38767	0.0:0.8992:0.0:0.1008	.	.	.	.	X	159	.	.	E	-	1	0	SLAMF9	158188865	0.016000	0.18221	0.159000	0.22649	0.907000	0.53573	1.489000	0.35562	1.027000	0.39758	0.650000	0.86243	GAG	SLAMF9	-	pfscan_Ig-like_dom	ENSG00000162723		0.567	SLAMF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAMF9	HGNC	protein_coding	OTTHUMT00000060630.1		0.00	16	0	C	NM_033438		159922241	-1			no_errors	ENST00000368093	ensembl	human	known	74_37	nonsense	13.33	26	4	SNP	0.017	A
SLC10A6	345274	genome.wustl.edu	37	4	87754468	87754468	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:87754468G>T	ENST00000273905.6	-	2	634	c.487C>A	c.(487-489)Cag>Aag	p.Q163K	SLC10A6_ENST00000505535.1_5'UTR	NM_197965.2	NP_932069.1	Q3KNW5	SOAT_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 6	163					sodium-dependent organic anion transport (GO:0043251)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)|sodium-dependent organic anion transmembrane transporter activity (GO:0043250)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	9		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.00099)		CCTATGTTCTGATAAGGAATG	0.448																																																	0													108.0	104.0	105.0					4																	87754468		2203	4300	6503	SO:0001583	missense	0			AJ583502	CCDS3614.1	4q22.1	2013-07-18	2013-07-18		ENSG00000145283	ENSG00000145283		"""Solute carriers"""	30603	protein-coding gene	gene with protein product		613366				15020217, 17491011	Standard	NM_197965		Approved	SOAT	uc003hqd.2	Q3KNW5	OTTHUMG00000130596	ENST00000273905.6:c.487C>A	4.37:g.87754468G>T	ENSP00000273905:p.Gln163Lys		Q70EX7	Missense_Mutation	SNP	pfam_BilAc/Na_symport,tigrfam_Bil_ac_transpt	p.Q163K	ENST00000273905.6	37	c.487	CCDS3614.1	4	.	.	.	.	.	.	.	.	.	.	G	2.097	-0.407096	0.04832	.	.	ENSG00000145283	ENST00000273905	T	0.10382	2.88	5.12	4.25	0.50352	.	0.334641	0.25172	N	0.032598	T	0.04363	0.0120	N	0.10809	0.05	0.27655	N	0.947278	B	0.17038	0.02	B	0.16722	0.016	T	0.42327	-0.9458	10	0.05959	T	0.93	-2.9615	6.6012	0.22701	0.0911:0.0:0.7298:0.1791	.	163	Q3KNW5	SOAT_HUMAN	K	163	ENSP00000273905:Q163K	ENSP00000273905:Q163K	Q	-	1	0	SLC10A6	87973492	1.000000	0.71417	0.983000	0.44433	0.522000	0.34438	1.233000	0.32648	2.406000	0.81754	0.655000	0.94253	CAG	SLC10A6	-	pfam_BilAc/Na_symport,tigrfam_Bil_ac_transpt	ENSG00000145283		0.448	SLC10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A6	HGNC	protein_coding	OTTHUMT00000253043.2	-	0.00	39	0	G	NM_197965		87754468	-1	tier1	-	no_errors	ENST00000273905	ensembl	human	known	74_37	missense	8.89	40	4	SNP	0.957	T
SLC22A6	9356	genome.wustl.edu	37	11	62752130	62752130	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:62752130C>T	ENST00000377871.3	-	1	299	c.33G>A	c.(31-33)ggG>ggA	p.G11G	SLC22A6_ENST00000360421.4_Silent_p.G11G|SLC22A6_ENST00000537349.1_5'Flank|SLC22A6_ENST00000421062.2_Silent_p.G11G|SLC22A6_ENST00000458333.2_Silent_p.G11G	NM_004790.4|NM_153278.2	NP_004781.2|NP_695010.1	Q4U2R8	S22A6_HUMAN	solute carrier family 22 (organic anion transporter), member 6	11					alpha-ketoglutarate transport (GO:0015742)|organic anion transport (GO:0015711)|protein homooligomerization (GO:0051260)|renal tubular secretion (GO:0097254)|response to methotrexate (GO:0031427)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride ion binding (GO:0031404)|inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(18)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36					Acetaminophen(DB00316)|Acetazolamide(DB00819)|Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Aminohippurate(DB00345)|Aminophenazone(DB01424)|Amoxicillin(DB01060)|Antipyrine(DB01435)|Aspartame(DB00168)|Benzylpenicillin(DB01053)|Bromodiphenhydramine(DB01237)|Bumetanide(DB00887)|Captopril(DB01197)|Carbenicillin(DB00578)|Carprofen(DB00821)|Caspofungin(DB00520)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cefotiam(DB00229)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Chloramphenicol(DB00446)|Chlorothiazide(DB00880)|Chlorpropamide(DB00672)|Cidofovir(DB00369)|Cilastatin(DB01597)|Cimetidine(DB00501)|Cinoxacin(DB00827)|Cloxacillin(DB01147)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Cyclothiazide(DB00606)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Didanosine(DB00900)|Diflunisal(DB00861)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Fluorescein(DB00693)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Foscarnet(DB00529)|Furosemide(DB00695)|Ganciclovir(DB01004)|Gentamicin(DB00798)|Glyburide(DB01016)|Hydrochlorothiazide(DB00999)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Levofloxacin(DB01137)|Losartan(DB00678)|Meclofenamic acid(DB00939)|Methazolamide(DB00703)|Methotrexate(DB00563)|Minocycline(DB01017)|Nafcillin(DB00607)|Nalidixic Acid(DB00779)|Naproxen(DB00788)|Nateglinide(DB00731)|Norfloxacin(DB01059)|Novobiocin(DB01051)|Ofloxacin(DB01165)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piperacillin(DB00319)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Riboflavin(DB00140)|Salicylic acid(DB00936)|Stavudine(DB00649)|Streptomycin(DB01082)|Sulindac(DB00605)|Tenofovir(DB00300)|Tetracycline(DB00759)|Tolbutamide(DB01124)|Tolmetin(DB00500)|Trifluridine(DB00432)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Vancomycin(DB00512)|Zalcitabine(DB00943)|Zidovudine(DB00495)	GGCCGACACCCCCCACCTGCT	0.637																																																	0													27.0	31.0	29.0					11																	62752130		2201	4297	6498	SO:0001819	synonymous_variant	0			AF057039	CCDS8041.1, CCDS31591.1, CCDS44631.1, CCDS44632.1	11q12.3	2013-07-15			ENSG00000197901	ENSG00000197901		"""Solute carriers"""	10970	protein-coding gene	gene with protein product		607582				9762842, 9950961	Standard	NM_004790		Approved	ROAT1, PAHT, OAT1	uc001nwk.3	Q4U2R8	OTTHUMG00000167767	ENST00000377871.3:c.33G>A	11.37:g.62752130C>T			A8MY93|B2D0R6|O95187|O95742|Q7LDA0|Q8N192|Q9NQA6|Q9NQC2|Q9UBG6|Q9UEQ8	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.G11	ENST00000377871.3	37	c.33	CCDS31591.1	11																																																																																			SLC22A6	-	NULL	ENSG00000197901		0.637	SLC22A6-002	KNOWN	basic|CCDS	protein_coding	SLC22A6	HGNC	protein_coding	OTTHUMT00000396186.1	-	0.00	85	0	C	NM_004790		62752130	-1	tier1	-	no_errors	ENST00000377871	ensembl	human	known	74_37	silent	23.29	56	17	SNP	1.000	T
SLC25A3P1	163742	genome.wustl.edu	37	1	53905547	53905547	+	RNA	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:53905547A>G	ENST00000566100.1	-	0	0									solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 pseudogene 1																		CAACATGTACAAACACGAGTA	0.542																																																	0																																												0					1p32.3	2013-05-22	2012-03-29		ENSG00000236253	ENSG00000236253		"""Solute carriers"""	26869	pseudogene	pseudogene			"""solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 pseudogene 1"""				Standard	NR_002314		Approved	FLJ40434	uc009vzj.3		OTTHUMG00000008078		1.37:g.53905547A>G				RNA	SNP	-	NULL	ENST00000566100.1	37	NULL		1																																																																																			SLC25A3P1	-	-	ENSG00000236253		0.542	SLC25A3P1-002	KNOWN	basic	processed_transcript	SLC25A3P1	HGNC	pseudogene	OTTHUMT00000422839.1	-	0.00	26	0	A	NM_178501		53905547	-1	tier1	-	no_errors	ENST00000563752	ensembl	human	known	74_37	rna	18.18	27	6	SNP	0.993	G
SLC37A2	219855	genome.wustl.edu	37	11	124954182	124954182	+	Silent	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:124954182T>A	ENST00000403796.2	+	12	1393	c.1092T>A	c.(1090-1092)acT>acA	p.T364T	SLC37A2_ENST00000525837.1_Intron|SLC37A2_ENST00000298280.5_Intron|SLC37A2_ENST00000407458.1_Silent_p.T364T|SLC37A2_ENST00000308074.4_Silent_p.T364T	NM_001145290.1	NP_001138762.1	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 2	364					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	27	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		GGGCCACCACTTGCTGTGTCA	0.612																																					Melanoma(11;373 620 21213 26083 47768)												0													163.0	115.0	131.0					11																	124954182		2201	4299	6500	SO:0001819	synonymous_variant	0			AK074100	CCDS31714.1, CCDS44757.1	11q24.2	2013-07-17	2013-07-17		ENSG00000134955	ENSG00000134955		"""Solute carriers"""	20644	protein-coding gene	gene with protein product			"""solute carrier family 37 (glycerol-3-phosphate transporter), member 2"""				Standard	NM_198277		Approved	FLJ00171	uc010sau.2	Q8TED4	OTTHUMG00000165879	ENST00000403796.2:c.1092T>A	11.37:g.124954182T>A			A8K2P9|Q6P599|Q7Z7P8|Q8TEM2	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.T364	ENST00000403796.2	37	c.1092	CCDS44757.1	11																																																																																			SLC37A2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000134955		0.612	SLC37A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC37A2	HGNC	protein_coding	OTTHUMT00000386837.1	-	0.00	36	0	T	XM_166184		124954182	+1	tier1	-	no_errors	ENST00000308074	ensembl	human	known	74_37	silent	18.75	39	9	SNP	0.897	A
SLC5A5	6528	genome.wustl.edu	37	19	17985311	17985311	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:17985311C>T	ENST00000222248.3	+	3	779	c.432C>T	c.(430-432)taC>taT	p.Y144Y		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	144					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						AGATGCTGTACACCGGCATCG	0.592																																					Melanoma(65;1008 1708 7910 46650)												0													114.0	114.0	114.0					19																	17985311		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.432C>T	19.37:g.17985311C>T			O43702|Q2M335|Q9NYB6	Silent	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.Y144	ENST00000222248.3	37	c.432	CCDS12368.1	19																																																																																			SLC5A5	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000105641		0.592	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A5	HGNC	protein_coding	OTTHUMT00000466690.1		0.00	46	0	C			17985311	+1			no_errors	ENST00000222248	ensembl	human	known	74_37	silent	7.27	51	4	SNP	1.000	T
SLC5A8	160728	genome.wustl.edu	37	12	101560435	101560435	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:101560435A>G	ENST00000536262.2	-	12	1921	c.1363T>C	c.(1363-1365)Tgg>Cgg	p.W455R		NM_145913.3	NP_666018.3			solute carrier family 5 (sodium/monocarboxylate cotransporter), member 8											breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(29)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						ATTCCAACCCATAGAGAAATG	0.388																																					GBM(60;420 1056 13605 22380 47675)												0													86.0	77.0	80.0					12																	101560435		2203	4300	6503	SO:0001583	missense	0			AY081220	CCDS9080.1	12q23.1	2013-07-19	2013-07-19		ENSG00000256870	ENSG00000256870		"""Solute carriers"""	19119	protein-coding gene	gene with protein product		608044	"""solute carrier family 5 (iodide transporter), member 8"""			12107270, 12829793	Standard	NM_145913		Approved	AIT	uc001thz.4	Q8N695	OTTHUMG00000170499	ENST00000536262.2:c.1363T>C	12.37:g.101560435A>G	ENSP00000445340:p.Trp455Arg			Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.W455R	ENST00000536262.2	37	c.1363	CCDS9080.1	12	.	.	.	.	.	.	.	.	.	.	A	15.47	2.843983	0.51164	.	.	ENSG00000256870	ENST00000536262	D	0.89270	-2.49	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.95030	0.8391	M	0.88906	2.99	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.95818	0.8847	10	0.87932	D	0	.	14.393	0.66991	1.0:0.0:0.0:0.0	.	455	Q8N695	SC5A8_HUMAN	R	455	ENSP00000445340:W455R	ENSP00000445340:W455R	W	-	1	0	SLC5A8	100084566	1.000000	0.71417	0.968000	0.41197	0.223000	0.24884	7.560000	0.82277	2.047000	0.60756	0.533000	0.62120	TGG	SLC5A8	-	pfscan_Na/solute_symporter	ENSG00000256870		0.388	SLC5A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A8	HGNC	protein_coding	OTTHUMT00000409401.1	-	0.00	43	0	A	NM_145913		101560435	-1	tier1	-	no_errors	ENST00000536262	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	G
SLC6A3	6531	genome.wustl.edu	37	5	1432626	1432626	+	Silent	SNP	C	C	T	rs376554288		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:1432626C>T	ENST00000270349.9	-	4	733	c.606G>A	c.(604-606)tcG>tcA	p.S202S	SLC6A3_ENST00000453492.2_Silent_p.S202S	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	202					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	CGTTGAGGCCCGAGCTGTCTC	0.617																																																	0								C		1,4405	2.1+/-5.4	0,1,2202	103.0	91.0	95.0		606	-7.9	0.0	5		95	0,8600		0,0,4300	no	coding-synonymous	SLC6A3	NM_001044.4		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		202/621	1432626	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.606G>A	5.37:g.1432626C>T			A2RUN4|Q14996	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_dopamine	p.S202	ENST00000270349.9	37	c.606	CCDS3863.1	5																																																																																			SLC6A3	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000142319		0.617	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A3	HGNC	protein_coding	OTTHUMT00000253650.3	-	0.00	49	0	C	NM_001044		1432626	-1	tier1	-	no_errors	ENST00000270349	ensembl	human	known	74_37	silent	26.83	30	11	SNP	0.000	T
SLIT2	9353	genome.wustl.edu	37	4	20618698	20618698	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:20618698A>G	ENST00000504154.1	+	35	4265	c.4013A>G	c.(4012-4014)aAg>aGg	p.K1338R	SLIT2_ENST00000503837.1_Missense_Mutation_p.K1334R|SLIT2_ENST00000273739.5_Missense_Mutation_p.K1351R|SLIT2_ENST00000503823.1_Missense_Mutation_p.K1330R	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1338	EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						CCATGCCACAAGAAGGTGTGT	0.597																																																	0													60.0	58.0	59.0					4																	20618698		2203	4300	6503	SO:0001583	missense	0			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.4013A>G	4.37:g.20618698A>G	ENSP00000422591:p.Lys1338Arg		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.K1338R	ENST00000504154.1	37	c.4013	CCDS3426.1	4	.	.	.	.	.	.	.	.	.	.	A	15.20	2.763463	0.49574	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	T;T;T;T	0.80480	-1.37;-1.38;-1.3;-1.35	5.96	2.24	0.28232	Concanavalin A-like lectin/glucanase, subgroup (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.177965	0.64402	N	0.000011	T	0.61248	0.2332	N	0.11341	0.13	0.42374	D	0.992464	B;B	0.16603	0.018;0.003	B;B	0.19148	0.024;0.008	T	0.47355	-0.9124	10	0.30078	T	0.28	.	9.5197	0.39126	0.8017:0.0:0.1983:0.0	.	1330;1338	O94813-3;O94813	.;SLIT2_HUMAN	R	1330;1338;1351;1334;1334	ENSP00000427548:K1330R;ENSP00000422591:K1338R;ENSP00000273739:K1351R;ENSP00000422261:K1334R	ENSP00000273739:K1351R	K	+	2	0	SLIT2	20227796	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.124000	0.42006	0.171000	0.19730	0.528000	0.53228	AAG	SLIT2	-	smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	ENSG00000145147		0.597	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	HGNC	protein_coding	OTTHUMT00000250396.2	-	0.00	32	0	A			20618698	+1	tier1	-	no_errors	ENST00000504154	ensembl	human	known	74_37	missense	13.51	32	5	SNP	1.000	G
SMARCC1	6599	genome.wustl.edu	37	3	47747971	47747971	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:47747971C>T	ENST00000254480.5	-	10	1087	c.968G>A	c.(967-969)cGa>cAa	p.R323Q	SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	323					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		TTTCCTCTTTCGAGCATTAGC	0.438																																																	0													245.0	206.0	219.0					3																	47747971		2203	4300	6503	SO:0001583	missense	0			U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.968G>A	3.37:g.47747971C>T	ENSP00000254480:p.Arg323Gln		Q17RS0|Q6P172|Q8IWH2	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.R323Q	ENST00000254480.5	37	c.968	CCDS2758.1	3	.	.	.	.	.	.	.	.	.	.	C	15.45	2.836785	0.50951	.	.	ENSG00000173473	ENST00000254480	T	0.42513	0.97	5.62	4.73	0.59995	.	0.105878	0.64402	D	0.000007	T	0.19805	0.0476	N	0.11064	0.09	0.09310	N	1	P	0.46656	0.882	B	0.35607	0.206	T	0.07635	-1.0762	10	0.41790	T	0.15	-2.4415	8.5599	0.33505	0.1541:0.7692:0.0:0.0767	.	323	Q92922	SMRC1_HUMAN	Q	323	ENSP00000254480:R323Q	ENSP00000254480:R323Q	R	-	2	0	SMARCC1	47722975	0.455000	0.25736	0.807000	0.32361	0.909000	0.53808	3.147000	0.50639	1.494000	0.48533	0.644000	0.83932	CGA	SMARCC1	-	NULL	ENSG00000173473		0.438	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCC1	HGNC	protein_coding	OTTHUMT00000257491.1	-	0.00	70	0	C			47747971	-1	tier1	-	no_errors	ENST00000254480	ensembl	human	known	74_37	missense	10.29	61	7	SNP	0.144	T
SMARCC2	6601	genome.wustl.edu	37	12	56558198	56558198	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:56558198T>C	ENST00000267064.4	-	27	3543	c.3457A>G	c.(3457-3459)Atg>Gtg	p.M1153V	SMARCC2_ENST00000347471.4_Intron|SMARCC2_ENST00000550164.1_Missense_Mutation_p.M1184V|RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000394023.3_Intron	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	1153	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			GAAGATGGCATGGTGGTGGTC	0.657																																																	0													69.0	67.0	67.0					12																	56558198		2203	4299	6502	SO:0001583	missense	0			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.3457A>G	12.37:g.56558198T>C	ENSP00000267064:p.Met1153Val		F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.M1153V	ENST00000267064.4	37	c.3457	CCDS8907.1	12	.	.	.	.	.	.	.	.	.	.	T	12.13	1.846872	0.32606	.	.	ENSG00000139613	ENST00000550164;ENST00000267064	T;T	0.41400	1.0;1.01	4.75	4.75	0.60458	.	0.000000	0.56097	D	0.000021	T	0.25494	0.0620	N	0.03608	-0.345	0.28283	N	0.923901	B	0.26041	0.14	B	0.38194	0.267	T	0.29181	-1.0020	9	.	.	.	-12.1139	12.5367	0.56145	0.0:0.0:0.0:1.0	.	1153	Q8TAQ2	SMRC2_HUMAN	V	1184;1153	ENSP00000449396:M1184V;ENSP00000267064:M1153V	.	M	-	1	0	SMARCC2	54844465	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.396000	0.44468	2.132000	0.65825	0.460000	0.39030	ATG	SMARCC2	-	NULL	ENSG00000139613		0.657	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCC2	HGNC	protein_coding	OTTHUMT00000408370.1	-	0.00	62	0	T			56558198	-1	tier1	-	no_errors	ENST00000267064	ensembl	human	known	74_37	missense	27.59	63	24	SNP	1.000	C
SNX9	51429	genome.wustl.edu	37	6	158348167	158348167	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:158348167G>T	ENST00000392185.3	+	11	1276	c.1105G>T	c.(1105-1107)Gcc>Tcc	p.A369S		NM_016224.3	NP_057308.1	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	369					cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|lipid tube assembly (GO:0060988)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein oligomerization (GO:0032461)|receptor-mediated endocytosis (GO:0006898)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	1-phosphatidylinositol binding (GO:0005545)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		AAAGAGGAAGGCCGAGAGAGA	0.468																																																	0													106.0	111.0	110.0					6																	158348167		2203	4300	6503	SO:0001583	missense	0			AF121859	CCDS5253.1	6q25.1-q26	2008-05-22			ENSG00000130340	ENSG00000130340		"""Sorting nexins"""	14973	protein-coding gene	gene with protein product		605952				10531379, 17609109	Standard	NM_016224		Approved	SH3PX1, SDP1, SH3PXD3A	uc003qqv.1	Q9Y5X1	OTTHUMG00000015903	ENST00000392185.3:c.1105G>T	6.37:g.158348167G>T	ENSP00000376024:p.Ala369Ser		Q9BSI7|Q9BVM1|Q9UJH6|Q9UP20	Missense_Mutation	SNP	pfam_Sorting_nexin_WASP-bd-dom,pfam_Phox,pfam_SH3_domain,pfam_SH3_2,superfamily_Phox,superfamily_SH3_domain,smart_SH3_domain,smart_Phox,pirsf_Snx9,pfscan_Phox,pfscan_SH3_domain	p.A369S	ENST00000392185.3	37	c.1105	CCDS5253.1	6	.	.	.	.	.	.	.	.	.	.	G	21.4	4.137567	0.77775	.	.	ENSG00000130340	ENST00000539592;ENST00000392185;ENST00000252631	T	0.54866	0.55	5.46	5.46	0.80206	Sorting nexin protein, WASP-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.55673	0.1935	M	0.84219	2.685	0.80722	D	1	B	0.18013	0.025	B	0.33750	0.169	T	0.60409	-0.7269	10	0.87932	D	0	-27.1435	19.2861	0.94072	0.0:0.0:1.0:0.0	.	369	Q9Y5X1	SNX9_HUMAN	S	369;369;169	ENSP00000376024:A369S	ENSP00000252631:A169S	A	+	1	0	SNX9	158268155	1.000000	0.71417	0.970000	0.41538	0.879000	0.50718	8.859000	0.92264	2.542000	0.85734	0.650000	0.86243	GCC	SNX9	-	pfam_Sorting_nexin_WASP-bd-dom,pirsf_Snx9	ENSG00000130340		0.468	SNX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX9	HGNC	protein_coding	OTTHUMT00000042856.1		0.00	39	0	G			158348167	+1			no_errors	ENST00000392185	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
SP110	3431	genome.wustl.edu	37	2	231048323	231048323	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:231048323G>T	ENST00000358662.4	-	12	1391	c.1313C>A	c.(1312-1314)tCa>tAa	p.S438*	SP110_ENST00000258382.5_Nonsense_Mutation_p.S438*|SP110_ENST00000540870.1_Nonsense_Mutation_p.S444*|SP110_ENST00000392048.3_Nonsense_Mutation_p.S436*|SP110_ENST00000258381.6_Nonsense_Mutation_p.S438*|SP110_ENST00000338556.3_Nonsense_Mutation_p.S140*	NM_004509.3	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein	438					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(4)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		TCTCCTTTTTGAGCTTGAACA	0.413																																																	0													212.0	213.0	212.0					2																	231048323		2203	4300	6503	SO:0001587	stop_gained	0			L22343	CCDS2474.1, CCDS2475.1, CCDS2476.1, CCDS54435.1	2q37.1	2014-09-17	2001-12-19	2001-12-20	ENSG00000135899	ENSG00000135899			5401	protein-coding gene	gene with protein product		604457	"""interferon-induced protein 41, 30kD"""	IFI41, IFI75		7693701, 10388521	Standard	NM_080424		Approved		uc002vqg.3	Q9HB58	OTTHUMG00000133204	ENST00000358662.4:c.1313C>A	2.37:g.231048323G>T	ENSP00000351488:p.Ser438*		B4DVI4|F5H1M1|Q14976|Q14977|Q53TG2|Q8WUZ6|Q9HCT8	Nonsense_Mutation	SNP	pfam_Sp100,pfam_SAND_dom,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom	p.S438*	ENST00000358662.4	37	c.1313	CCDS2474.1	2	.	.	.	.	.	.	.	.	.	.	G	40	8.420894	0.98803	.	.	ENSG00000135899	ENST00000258381;ENST00000358662;ENST00000392048;ENST00000258382;ENST00000540870;ENST00000338556	.	.	.	2.56	0.62	0.17637	.	8.131980	0.00649	N	0.000557	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	3.0032	0.06020	0.1554:0.0:0.5782:0.2664	.	.	.	.	X	438;438;436;438;444;140	.	ENSP00000258381:S438X	S	-	2	0	SP110	230756567	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.032000	0.12266	0.147000	0.19030	-0.262000	0.10625	TCA	SP110	-	NULL	ENSG00000135899		0.413	SP110-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SP110	HGNC	protein_coding	OTTHUMT00000332414.1		0.00	58	0	G	NM_080424		231048323	-1			no_errors	ENST00000258381	ensembl	human	known	74_37	nonsense	6.67	56	4	SNP	0.000	T
SPATA7	55812	genome.wustl.edu	37	14	88892755	88892755	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr14:88892755T>A	ENST00000393545.4	+	6	841	c.552T>A	c.(550-552)gaT>gaA	p.D184E	SPATA7_ENST00000045347.7_Missense_Mutation_p.D184E|SPATA7_ENST00000356583.5_Missense_Mutation_p.D152E|SPATA7_ENST00000556553.1_Missense_Mutation_p.D152E	NM_018418.4	NP_060888.2	Q9P0W8	SPAT7_HUMAN	spermatogenesis associated 7	184					response to stimulus (GO:0050896)|visual perception (GO:0007601)					cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	18						CCAGTGTGGATTATGCAGCCT	0.502																																																	0													71.0	66.0	68.0					14																	88892755		2203	4300	6503	SO:0001583	missense	0			AF144487	CCDS9883.1, CCDS32132.1	14q31.3	2011-02-17				ENSG00000042317			20423	protein-coding gene	gene with protein product		609868	"""Leber congenital amaurosis 3"""	LCA3		9799089, 19268277	Standard	NM_018418		Approved	HSD3	uc001xwq.3	Q9P0W8		ENST00000393545.4:c.552T>A	14.37:g.88892755T>A	ENSP00000377176:p.Asp184Glu		Q5BKY5|Q8WX30|Q96HF3|Q9H0X0|Q9P0W7	Missense_Mutation	SNP	NULL	p.D184E	ENST00000393545.4	37	c.552	CCDS9883.1	14	.	.	.	.	.	.	.	.	.	.	T	17.04	3.287357	0.59976	.	.	ENSG00000042317	ENST00000556553;ENST00000393545;ENST00000356583;ENST00000555401;ENST00000553885;ENST00000045347	T;T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26;2.26	5.11	-9.79	0.00494	.	0.792514	0.11441	N	0.563770	T	0.11196	0.0273	L	0.46157	1.445	0.09310	N	1	B;B;B	0.16802	0.019;0.019;0.019	B;B;B	0.19391	0.025;0.015;0.015	T	0.13764	-1.0497	10	0.25751	T	0.34	-4.6888	10.0472	0.42195	0.1959:0.5421:0.0:0.262	.	152;152;184	A8K3L6;Q9P0W8-2;Q9P0W8	.;.;SPAT7_HUMAN	E	152;184;152;127;170;184	ENSP00000451128:D152E;ENSP00000377176:D184E;ENSP00000348991:D152E;ENSP00000452435:D127E;ENSP00000450606:D170E;ENSP00000045347:D184E	ENSP00000045347:D184E	D	+	3	2	SPATA7	87962508	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.735000	0.04888	-2.354000	0.00614	-1.201000	0.01664	GAT	SPATA7	-	NULL	ENSG00000042317		0.502	SPATA7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATA7	HGNC	protein_coding	OTTHUMT00000410172.1		0.00	33	0	T			88892755	+1			no_errors	ENST00000393545	ensembl	human	known	74_37	missense	10.34	26	3	SNP	0.000	A
SSX2IP	117178	genome.wustl.edu	37	1	85136350	85136350	+	Missense_Mutation	SNP	C	C	G	rs376196736		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:85136350C>G	ENST00000342203.3	-	3	455	c.192G>C	c.(190-192)caG>caC	p.Q64H	SSX2IP_ENST00000437941.2_Missense_Mutation_p.Q37H|SSX2IP_ENST00000605755.1_Missense_Mutation_p.Q37H|SSX2IP_ENST00000603677.1_Intron|SSX2IP_ENST00000370612.4_Missense_Mutation_p.Q64H	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting protein	64					cell adhesion (GO:0007155)|centrosome organization (GO:0051297)|regulation of cell motility (GO:2000145)|regulation of Rac protein signal transduction (GO:0035020)	cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|centriolar satellite (GO:0034451)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|urinary_tract(1)	19				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		ATGAGATACTCTGTTCAATAT	0.299																																																	0													70.0	78.0	75.0					1																	85136350		2203	4296	6499	SO:0001583	missense	0				CCDS699.1, CCDS53337.1	1p22.3	2008-02-05			ENSG00000117155	ENSG00000117155			16509	protein-coding gene	gene with protein product		608690					Standard	NM_014021		Approved		uc001dkj.3	Q9Y2D8	OTTHUMG00000009926	ENST00000342203.3:c.192G>C	1.37:g.85136350C>G	ENSP00000340279:p.Gln64His		A8K8W0|B4DFE3|D3DT13|J3KR02|Q6P2P8|Q6ULS1|Q7L168|Q9UIX0	Missense_Mutation	SNP	pfam_Afadin/alpha-actinin-bd	p.Q64H	ENST00000342203.3	37	c.192	CCDS699.1	1	.	.	.	.	.	.	.	.	.	.	C	17.52	3.411321	0.62399	.	.	ENSG00000117155	ENST00000342203;ENST00000437941;ENST00000544699;ENST00000370612;ENST00000422026	T;T	0.49432	0.78;0.78	5.18	-1.95	0.07548	.	0.054407	0.85682	D	0.000000	T	0.33294	0.0858	L	0.28608	0.87	0.41329	D	0.987222	D;D;D	0.61697	0.99;0.986;0.986	P;P;P	0.56343	0.693;0.796;0.796	T	0.33266	-0.9875	10	0.87932	D	0	0.0745	13.3925	0.60832	0.0:0.8557:0.0:0.1443	.	60;64;37	F5H549;Q9Y2D8;B4DFE3	.;ADIP_HUMAN;.	H	64;37;60;64;64	ENSP00000340279:Q64H;ENSP00000412781:Q37H	ENSP00000340279:Q64H	Q	-	3	2	SSX2IP	84908938	0.994000	0.37717	0.982000	0.44146	0.987000	0.75469	0.321000	0.19558	-0.700000	0.05070	-0.218000	0.12543	CAG	SSX2IP	-	pfam_Afadin/alpha-actinin-bd	ENSG00000117155		0.299	SSX2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSX2IP	HGNC	protein_coding	OTTHUMT00000027469.1		0.00	20	0	C	NM_014021		85136350	-1			no_errors	ENST00000342203	ensembl	human	known	74_37	missense	9.52	19	2	SNP	0.994	G
SSR2	6746	genome.wustl.edu	37	1	155979398	155979398	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:155979398C>T	ENST00000295702.4	-	6	556	c.485G>A	c.(484-486)gGc>gAc	p.G162D	SSR2_ENST00000496742.1_3'UTR|SSR2_ENST00000480567.1_Missense_Mutation_p.G162D|SSR2_ENST00000529008.1_3'UTR	NM_003145.3	NP_003136.1	P43308	SSRB_HUMAN	signal sequence receptor, beta (translocon-associated protein beta)	162					cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.G162D(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|stomach(1)	10	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					CAGGGGGATGCCGATGGAGGG	0.517																																																	1	Substitution - Missense(1)	lung(1)											123.0	112.0	116.0					1																	155979398		2203	4300	6503	SO:0001583	missense	0			BC000341	CCDS1126.1	1q21-q23	2008-02-05			ENSG00000163479	ENSG00000163479			11324	protein-coding gene	gene with protein product		600867				7789174	Standard	NM_003145		Approved	TLAP, TRAPB	uc001fmx.3	P43308	OTTHUMG00000017456	ENST00000295702.4:c.485G>A	1.37:g.155979398C>T	ENSP00000295702:p.Gly162Asp		B2R9K9|D3DVA7|Q53HI0|Q5VY95|Q5VY96|Q6IB31|Q9BWE4	Missense_Mutation	SNP	pfam_TRAP_beta,pirsf_TRAP_beta	p.G162D	ENST00000295702.4	37	c.485	CCDS1126.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.250791	0.95305	.	.	ENSG00000163479	ENST00000295702;ENST00000480567	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.65688	0.2715	L	0.59436	1.845	0.80722	D	1	D	0.57257	0.979	P	0.58780	0.845	T	0.63251	-0.6679	9	0.38643	T	0.18	-15.6569	15.6578	0.77155	0.0:1.0:0.0:0.0	.	162	P43308	SSRB_HUMAN	D	162	.	ENSP00000295702:G162D	G	-	2	0	SSR2	154246022	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.548000	0.73896	2.767000	0.95098	0.655000	0.94253	GGC	SSR2	-	pfam_TRAP_beta,pirsf_TRAP_beta	ENSG00000163479		0.517	SSR2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SSR2	HGNC	protein_coding	OTTHUMT00000046172.2		0.00	39	0	C	NM_003145		155979398	-1			no_errors	ENST00000295702	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	T
SPTA1	6708	genome.wustl.edu	37	1	158584081	158584081	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:158584081C>T	ENST00000368147.4	-	49	6984	c.6804G>A	c.(6802-6804)gtG>gtA	p.V2268V	SPTA1_ENST00000485680.1_5'Flank	NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2268					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCTCTTCACTCACACCTTTGA	0.338																																																	0													74.0	72.0	73.0					1																	158584081		1807	4064	5871	SO:0001819	synonymous_variant	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6804G>A	1.37:g.158584081C>T			Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.V2268	ENST00000368147.4	37	c.6804	CCDS41423.1	1																																																																																			SPTA1	-	NULL	ENSG00000163554		0.338	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	-	0.00	50	0	C	NM_003126		158584081	-1	tier1	-	no_errors	ENST00000368147	ensembl	human	known	74_37	silent	18.18	71	16	SNP	1.000	T
STAMBPL1	57559	genome.wustl.edu	37	10	90682145	90682146	+	Frame_Shift_Ins	INS	-	-	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:90682145_90682146insA	ENST00000371926.3	+	10	2164_2165	c.1206_1207insA	c.(1207-1209)aaafs	p.K403fs	STAMBPL1_ENST00000371927.3_Frame_Shift_Ins_p.K403fs|STAMBPL1_ENST00000371924.1_Frame_Shift_Ins_p.K403fs|STAMBPL1_ENST00000371922.1_Frame_Shift_Ins_p.K237fs	NM_020799.3	NP_065850.1	Q96FJ0	STALP_HUMAN	STAM binding protein-like 1	403						membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(2)|endometrium(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(1)	11		Colorectal(252;0.0381)		Colorectal(12;6.38e-05)|COAD - Colon adenocarcinoma(12;7.75e-05)		TTTCTGCTTGTAAAAAAAAGGG	0.426																																																	0																																										SO:0001589	frameshift_variant	0			AB037794	CCDS7391.1	10q23.32	2006-11-08			ENSG00000138134	ENSG00000138134			24105	protein-coding gene	gene with protein product	"""associated molecule with the SH3 domain of STAM (AMSH) like protein"", ""associated molecule with the SH3 domain of STAM (AMSH) - Family Protein"""	612352				12810066, 12943674	Standard	NM_020799		Approved	AMSH-LP, KIAA1373, AMSH-FP, FLJ31524, ALMalpha, bA399O19.2	uc001kfk.4	Q96FJ0	OTTHUMG00000018702	ENST00000371926.3:c.1214dupA	10.37:g.90682153_90682153dupA	ENSP00000360994:p.Lys403fs		B3KPA7|Q5T9N4|Q5T9N9|Q7Z420|Q9P2H4	Frame_Shift_Ins	INS	pfam_JAB_MPN_dom,smart_JAB_MPN_dom	p.G406fs	ENST00000371926.3	37	c.1206_1207	CCDS7391.1	10																																																																																			STAMBPL1	-	NULL	ENSG00000138134		0.426	STAMBPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAMBPL1	HGNC	protein_coding	OTTHUMT00000049283.1		0.00	47	0	-	NM_020799		90682146	+1	tier1		no_errors	ENST00000371927	ensembl	human	known	74_37	frame_shift_ins	16.98	44	9	INS	1.000:1.000	A
STARD8	9754	genome.wustl.edu	37	X	67937516	67937516	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:67937516G>T	ENST00000252336.6	+	5	892	c.520G>T	c.(520-522)Gct>Tct	p.A174S	STARD8_ENST00000374599.3_Missense_Mutation_p.A254S|STARD8_ENST00000374597.3_Missense_Mutation_p.A174S	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	174					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						CTTCCTCTCAGCTGGATTTTA	0.602																																																	0													51.0	45.0	47.0					X																	67937516		2202	4299	6501	SO:0001583	missense	0			D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.520G>T	X.37:g.67937516G>T	ENSP00000252336:p.Ala174Ser		A8K6T2|D3DVT9|Q5JST0|Q68DG7	Missense_Mutation	SNP	pfam_START_lipid-bd_dom,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom,pfscan_RhoGAP_dom	p.A254S	ENST00000252336.6	37	c.760	CCDS14390.1	X	.	.	.	.	.	.	.	.	.	.	g	4.285	0.052166	0.08291	.	.	ENSG00000130052	ENST00000252336;ENST00000374599;ENST00000374597	T;T;T	0.09073	3.02;3.03;3.02	3.93	3.06	0.35304	.	0.890661	0.09683	N	0.769441	T	0.05090	0.0136	N	0.16602	0.42	0.09310	N	1	B;B	0.15473	0.013;0.008	B;B	0.21917	0.037;0.016	T	0.42799	-0.9430	10	0.05833	T	0.94	.	8.5811	0.33630	0.1183:0.0:0.8816:0.0	.	254;174	Q92502-2;Q92502	.;STAR8_HUMAN	S	174;254;174	ENSP00000252336:A174S;ENSP00000363727:A254S;ENSP00000363725:A174S	ENSP00000252336:A174S	A	+	1	0	STARD8	67854241	0.003000	0.15002	0.488000	0.27440	0.212000	0.24457	1.157000	0.31724	0.698000	0.31739	0.597000	0.82753	GCT	STARD8	-	NULL	ENSG00000130052		0.602	STARD8-201	KNOWN	basic|CCDS	protein_coding	STARD8	HGNC	protein_coding	OTTHUMT00000057026.2	-	0.00	22	0	G	NM_014725		67937516	+1	tier1	-	no_errors	ENST00000374599	ensembl	human	known	74_37	missense	21.05	15	4	SNP	0.016	T
SULT1C2	6819	genome.wustl.edu	37	2	108921051	108921051	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:108921051G>T	ENST00000437390.2	+	5	616	c.439G>T	c.(439-441)Gcc>Tcc	p.A147S	SULT1C2_ENST00000326853.5_Missense_Mutation_p.A144S|SULT1C2_ENST00000251481.6_Missense_Mutation_p.A133S|SULT1C2_ENST00000409880.1_Missense_Mutation_p.A96S			O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 2	139					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)	p.A144S(1)		NS(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						AGCTCGAAATGCCAAAGACTG	0.433																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											189.0	179.0	182.0					2																	108921051		2203	4300	6503	SO:0001583	missense	0			U66036, AF186255	CCDS2075.1, CCDS2076.1	2q12.3	2010-09-30	2007-03-16	2007-03-16	ENSG00000198203	ENSG00000198203		"""Sulfotransferases, cytosolic"""	11456	protein-coding gene	gene with protein product		602385	"""sulfotransferase family, cytosolic, 1C, member 1"""	SULT1C1		9169148, 10783263	Standard	NM_001056		Approved	ST1C1	uc002tdx.3	O00338	OTTHUMG00000153215	ENST00000437390.2:c.439G>T	2.37:g.108921051G>T	ENSP00000399651:p.Ala147Ser		Q069I8|Q08AS5|Q53S63	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.A144S	ENST00000437390.2	37	c.430		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.467|9.467	1.094516|1.094516	0.20471|0.20471	.|.	.|.	ENSG00000198203|ENSG00000198203	ENST00000251481;ENST00000326853;ENST00000409880;ENST00000437390|ENST00000438339;ENST00000409067	T;T;T;T|T	0.01787|0.12879	4.64;4.64;4.64;4.64|2.64	4.52|4.52	3.64|3.64	0.41730|0.41730	Sulfotransferase domain (1);|.	0.182081|.	0.36778|.	N|.	0.002411|.	T|T	0.38692|0.38692	0.1050|0.1050	M|M	0.90483|0.90483	3.12|3.12	0.46011|0.46011	D|D	0.998814|0.998814	D;D;D;D|.	0.69078|.	0.967;0.997;0.967;0.987|.	D;D;D;D|.	0.72338|.	0.976;0.977;0.967;0.972|.	T|T	0.45396|0.45396	-0.9264|-0.9264	10|6	0.51188|.	T|.	0.08|.	.|.	11.9253|11.9253	0.52817|0.52817	0.0854:0.0:0.9146:0.0|0.0854:0.0:0.9146:0.0	.|.	147;48;133;144|.	B4DLP0;B4DPE8;O00338;O00338-2|.	.;.;ST1C2_HUMAN;.|.	S|F	133;144;96;147|112;129	ENSP00000251481:A133S;ENSP00000319622:A144S;ENSP00000387054:A96S;ENSP00000399651:A147S|ENSP00000401996:C112F	ENSP00000251481:A133S|.	A|C	+|+	1|2	0|0	SULT1C2|SULT1C2	108287483|108287483	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	3.346000|3.346000	0.52190|0.52190	1.244000|1.244000	0.43870|0.43870	0.655000|0.655000	0.94253|0.94253	GCC|TGC	SULT1C2	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	ENSG00000198203		0.433	SULT1C2-007	NOVEL	basic|exp_conf	protein_coding	SULT1C2	HGNC	protein_coding	OTTHUMT00000329969.2		0.00	37	0	G	NM_176825		108921051	+1			no_errors	ENST00000326853	ensembl	human	known	74_37	missense	5.45	52	3	SNP	1.000	T
STK25	10494	genome.wustl.edu	37	2	242437665	242437665	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:242437665C>T	ENST00000316586.4	-	9	1366	c.1017G>A	c.(1015-1017)ctG>ctA	p.L339L	STK25_ENST00000478403.1_5'UTR|STK25_ENST00000401869.1_Silent_p.L339L|STK25_ENST00000405585.1_Silent_p.L262L|STK25_ENST00000535007.1_Silent_p.L245L|STK25_ENST00000405883.3_Silent_p.L262L|STK25_ENST00000403346.3_Silent_p.L339L|STK25_ENST00000543554.1_Silent_p.L245L	NM_001271977.1|NM_001271978.1|NM_001282308.1	NP_001258906.1|NP_001258907.1|NP_001269237.1	O00506	STK25_HUMAN	serine/threonine kinase 25	339					establishment or maintenance of cell polarity (GO:0007163)|Golgi localization (GO:0051645)|positive regulation of axonogenesis (GO:0050772)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;8.24e-34)|all cancers(36;3.46e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.1e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		GTGAACTGTGCAGGGCCGTCC	0.662																																					NSCLC(99;1100 1566 7679 28647 48345)												0													150.0	130.0	137.0					2																	242437665		2203	4300	6503	SO:0001819	synonymous_variant	0			D63780	CCDS2549.1, CCDS63199.1, CCDS63200.1	2q37.3	2010-06-25	2010-06-25		ENSG00000115694	ENSG00000115694			11404	protein-coding gene	gene with protein product		602255	"""serine/threonine kinase 25 (Ste20, yeast homolog)"""			8887545, 9160885, 15037601	Standard	NM_001271977		Approved	SOK1, YSK1	uc002wbp.4	O00506	OTTHUMG00000133408	ENST00000316586.4:c.1017G>A	2.37:g.242437665C>T			A8K6Z3|A8K7D2|B7Z9K1|Q15522|Q5BJF1	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L339	ENST00000316586.4	37	c.1017	CCDS2549.1	2																																																																																			STK25	-	NULL	ENSG00000115694		0.662	STK25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK25	HGNC	protein_coding	OTTHUMT00000257265.4		0.00	63	0	C	NM_006374		242437665	-1			no_errors	ENST00000316586	ensembl	human	known	74_37	silent	5.00	76	4	SNP	0.993	T
TAF1L	138474	genome.wustl.edu	37	9	32635065	32635065	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:32635065T>G	ENST00000242310.4	-	1	602	c.513A>C	c.(511-513)caA>caC	p.Q171H	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	171			Q -> E (in dbSNP:rs56352331). {ECO:0000269|PubMed:17344846}.		DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TAATAGCATCTTGGTCCTTAT	0.458																																																	0													194.0	154.0	168.0					9																	32635065		2203	4300	6503	SO:0001583	missense	0			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.513A>C	9.37:g.32635065T>G	ENSP00000418379:p.Gln171His		Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.Q171H	ENST00000242310.4	37	c.513	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	T	13.46	2.242735	0.39598	.	.	ENSG00000122728	ENST00000242310	T	0.08546	3.08	1.04	-1.27	0.09347	.	0.454846	0.24294	N	0.039797	T	0.04998	0.0134	N	0.22421	0.69	0.20563	N	0.999883	P	0.37997	0.614	B	0.39738	0.308	T	0.30650	-0.9971	10	0.45353	T	0.12	.	3.9729	0.09462	0.0:0.4896:0.0:0.5104	.	171	Q8IZX4	TAF1L_HUMAN	H	171	ENSP00000418379:Q171H	ENSP00000418379:Q171H	Q	-	3	2	TAF1L	32625065	0.732000	0.28121	0.953000	0.39169	0.226000	0.24999	-0.139000	0.10358	-0.399000	0.07668	-1.073000	0.02249	CAA	TAF1L	-	pirsf_TAF1_animal	ENSG00000122728		0.458	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	-	0.00	95	0	T			32635065	-1	tier1	-	no_errors	ENST00000242310	ensembl	human	known	74_37	missense	20.45	105	27	SNP	0.684	G
TAS1R3	83756	genome.wustl.edu	37	1	1268413	1268413	+	Missense_Mutation	SNP	G	G	A	rs370861077		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:1268413G>A	ENST00000339381.5	+	4	1420	c.1388G>A	c.(1387-1389)gGc>gAc	p.G463D		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	463					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		GTGTGGCAGGGCTCAGTGCCC	0.627																																																	0								G	ASP/GLY	1,4399		0,1,2199	56.0	53.0	54.0		1388	-1.8	0.0	1		54	0,8592		0,0,4296	no	missense	TAS1R3	NM_152228.1	94	0,1,6495	AA,AG,GG		0.0,0.0227,0.0077	benign	463/853	1268413	1,12991	2200	4296	6496	SO:0001583	missense	0			AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.1388G>A	1.37:g.1268413G>A	ENSP00000344411:p.Gly463Asp		Q5TA49|Q8NGW9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3	p.G463D	ENST00000339381.5	37	c.1388	CCDS30556.1	1	.	.	.	.	.	.	.	.	.	.	G	3.252	-0.153140	0.06585	2.27E-4	0.0	ENSG00000169962	ENST00000339381	D	0.87029	-2.2	4.86	-1.77	0.07982	.	5.998850	0.00447	N	0.000090	T	0.73369	0.3578	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.65919	-0.6051	10	0.02654	T	1	.	12.7158	0.57113	0.192:0.0:0.808:0.0	.	463	Q7RTX0	TS1R3_HUMAN	D	463	ENSP00000344411:G463D	ENSP00000344411:G463D	G	+	2	0	TAS1R3	1258276	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.070000	0.03440	-0.187000	0.10516	-0.390000	0.06520	GGC	TAS1R3	-	superfamily_Peripla_BP_I	ENSG00000169962		0.627	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS1R3	HGNC	protein_coding	OTTHUMT00000008493.1		0.00	24	0	G			1268413	+1			no_errors	ENST00000339381	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.000	A
TBC1D17	79735	genome.wustl.edu	37	19	50385558	50385558	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:50385558C>G	ENST00000221543.5	+	7	998	c.699C>G	c.(697-699)ttC>ttG	p.F233L	TBC1D17_ENST00000535102.2_Missense_Mutation_p.F200L	NM_024682.2	NP_078958	Q9HA65	TBC17_HUMAN	TBC1 domain family, member 17	233	Required for interaction with OPTN.				autophagy (GO:0006914)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	Rab GTPase activator activity (GO:0005097)			NS(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15		all_lung(116;0.000338)|Lung NSC(112;0.000446)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.017)		TGACCAACTTCTTCCGGGGTG	0.657																																																	0													78.0	80.0	79.0					19																	50385558		2203	4300	6503	SO:0001583	missense	0			AK090606	CCDS12785.1, CCDS54294.1	19q13.33	2013-07-09				ENSG00000104946			25699	protein-coding gene	gene with protein product						22854040	Standard	NM_024682		Approved	FLJ12168	uc002pqo.3	Q9HA65		ENST00000221543.5:c.699C>G	19.37:g.50385558C>G	ENSP00000221543:p.Phe233Leu		B4DT12|B9A6L8|F5H1W7	Missense_Mutation	SNP	pfam_DUF3548,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.F233L	ENST00000221543.5	37	c.699	CCDS12785.1	19	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490665	0.64074	.	.	ENSG00000104946	ENST00000221543;ENST00000535102	T;T	0.10763	2.87;2.84	4.9	2.68	0.31781	.	0.000000	0.85682	D	0.000000	T	0.15739	0.0379	L	0.55743	1.74	0.44579	D	0.997545	P;P	0.49862	0.929;0.609	P;B	0.53549	0.729;0.119	T	0.02047	-1.1223	10	0.38643	T	0.18	-37.2761	5.38	0.16186	0.0:0.6804:0.0:0.3196	.	200;233	F5H1W7;Q9HA65	.;TBC17_HUMAN	L	233;200	ENSP00000221543:F233L;ENSP00000446323:F200L	ENSP00000221543:F233L	F	+	3	2	TBC1D17	55077370	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.064000	0.30579	1.311000	0.45024	0.563000	0.77884	TTC	TBC1D17	-	NULL	ENSG00000104946		0.657	TBC1D17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D17	HGNC	protein_coding	OTTHUMT00000466404.1	-	0.00	50	0	C	NM_024682		50385558	+1	tier1	-	no_errors	ENST00000221543	ensembl	human	known	74_37	missense	8.93	102	10	SNP	1.000	G
TBC1D26	353149	genome.wustl.edu	37	17	15644474	15644474	+	Silent	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:15644474C>A	ENST00000437605.2	+	10	835	c.585C>A	c.(583-585)gcC>gcA	p.A195A	AC005324.6_ENST00000433873.1_RNA|AC005324.6_ENST00000580194.1_RNA|ZNF286A_ENST00000413242.2_3'UTR|AC005324.6_ENST00000434017.1_RNA	NM_178571.4	NP_848666	Q86UD7	TBC26_HUMAN	TBC1 domain family, member 26	195	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.078)		GCATCACTGCCATCCTCCTCC	0.617																																																	0													83.0	90.0	88.0					17																	15644474		2199	4299	6498	SO:0001819	synonymous_variant	0				CCDS42265.1	17p11.2	2008-11-04			ENSG00000214946	ENSG00000214946			28745	protein-coding gene	gene with protein product						11347906	Standard	NM_178571		Approved	MGC51025	uc010cov.3	Q86UD7	OTTHUMG00000059071	ENST00000437605.2:c.585C>A	17.37:g.15644474C>A			A8K929|Q4G172	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.A195	ENST00000437605.2	37	c.585	CCDS42265.1	17																																																																																			TBC1D26	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000214946		0.617	TBC1D26-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D26	HGNC	protein_coding		-	0.00	55	0	C	NM_178571		15644474	+1	tier1	-	no_errors	ENST00000437605	ensembl	human	known	74_37	silent	16.67	40	8	SNP	0.049	A
TBC1D9	23158	genome.wustl.edu	37	4	141560556	141560556	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:141560556C>G	ENST00000442267.2	-	14	2438	c.2364G>C	c.(2362-2364)ttG>ttC	p.L788F		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	788							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				TCTGTTCAATCAAATCTGCCC	0.438																																																	0													73.0	71.0	72.0					4																	141560556		1916	4114	6030	SO:0001583	missense	0			AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.2364G>C	4.37:g.141560556C>G	ENSP00000411197:p.Leu788Phe		A6H8U8|D3DNZ1|O94958	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_hand_dom,pfscan_Rab-GTPase-TBC_dom	p.L788F	ENST00000442267.2	37	c.2364	CCDS47136.1	4	.	.	.	.	.	.	.	.	.	.	C	15.06	2.720902	0.48728	.	.	ENSG00000109436	ENST00000442267	T	0.08458	3.09	5.42	1.73	0.24493	.	0.148834	0.46145	D	0.000314	T	0.07324	0.0185	L	0.38175	1.15	0.49798	D	0.999826	B	0.26845	0.161	B	0.30943	0.122	T	0.25710	-1.0124	10	0.54805	T	0.06	-6.3228	7.3882	0.26895	0.0:0.6375:0.1102:0.2523	.	788	Q6ZT07	TBCD9_HUMAN	F	788	ENSP00000411197:L788F	ENSP00000411197:L788F	L	-	3	2	TBC1D9	141780006	0.999000	0.42202	0.957000	0.39632	0.995000	0.86356	0.716000	0.25836	0.269000	0.21961	0.655000	0.94253	TTG	TBC1D9	-	NULL	ENSG00000109436		0.438	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D9	HGNC	protein_coding	OTTHUMT00000364806.1	-	0.00	48	0	C	NM_015130		141560556	-1	tier1	-	no_errors	ENST00000442267	ensembl	human	known	74_37	missense	37.25	32	19	SNP	1.000	G
TBX3	6926	genome.wustl.edu	37	12	115118902	115118902	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:115118902C>T	ENST00000257566.3	-	2	828	c.439G>A	c.(439-441)Gcc>Acc	p.A147T	TBX3_ENST00000349155.2_Missense_Mutation_p.A147T	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	147					anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		ATGTATTTGGCTTTTTTATCC	0.383																																																	0													131.0	139.0	136.0					12																	115118902		2203	4300	6503	SO:0001583	missense	0			BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.439G>A	12.37:g.115118902C>T	ENSP00000257566:p.Ala147Thr		Q8TB20|Q9UKF8	Missense_Mutation	SNP	pfam_TF_T-box,pfam_TBX,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.A147T	ENST00000257566.3	37	c.439	CCDS9176.1	12	.	.	.	.	.	.	.	.	.	.	C	36	5.749346	0.96882	.	.	ENSG00000135111	ENST00000349155;ENST00000257566;ENST00000361100	D;D	0.88586	-2.4;-2.4	5.75	5.75	0.90469	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.94660	0.8278	M	0.80422	2.495	0.80722	D	1	D;D;D	0.89917	0.996;1.0;0.998	D;D;D	0.80764	0.982;0.99;0.994	D	0.93811	0.7110	10	0.44086	T	0.13	.	18.9263	0.92546	0.0:1.0:0.0:0.0	.	147;147;147	B4E3A6;O15119-2;O15119	.;.;TBX3_HUMAN	T	147	ENSP00000257567:A147T;ENSP00000257566:A147T	ENSP00000257566:A147T	A	-	1	0	TBX3	113603285	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.485000	0.81204	2.721000	0.93114	0.655000	0.94253	GCC	TBX3	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box	ENSG00000135111		0.383	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBX3	HGNC	protein_coding	OTTHUMT00000404947.2		0.00	34	0	C	NM_016569, NM_005996		115118902	-1			no_errors	ENST00000257566	ensembl	human	known	74_37	missense	9.38	29	3	SNP	1.000	T
TBX6	6911	genome.wustl.edu	37	16	30100109	30100109	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr16:30100109C>T	ENST00000395224.2	-	5	732	c.673G>A	c.(673-675)Gca>Aca	p.A225T	TBX6_ENST00000553607.1_Missense_Mutation_p.A225T|TBX6_ENST00000279386.2_Missense_Mutation_p.A225T	NM_004608.3	NP_004599.2	O95947	TBX6_HUMAN	T-box 6	225					anatomical structure morphogenesis (GO:0009653)|cell fate specification (GO:0001708)|mesoderm development (GO:0007498)|mesoderm formation (GO:0001707)|negative regulation of neuron maturation (GO:0014043)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)	9						AGCTGGGCTGCCCGAACTAGG	0.617																																																	0													99.0	106.0	104.0					16																	30100109		2197	4300	6497	SO:0001583	missense	0			AJ007989	CCDS10670.1	16p11.2	2008-02-05			ENSG00000149922	ENSG00000149922		"""T-boxes"""	11605	protein-coding gene	gene with protein product		602427				9888994, 9933572	Standard	NM_004608		Approved		uc010veh.2	O95947	OTTHUMG00000132115	ENST00000395224.2:c.673G>A	16.37:g.30100109C>T	ENSP00000378650:p.Ala225Thr		Q8TAS4|Q9HA44	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box,prints_TF_Brachyury	p.A225T	ENST00000395224.2	37	c.673	CCDS10670.1	16	.	.	.	.	.	.	.	.	.	.	C	29.9	5.041909	0.93685	.	.	ENSG00000149922	ENST00000395224;ENST00000279386;ENST00000553607	D;D;D	0.89552	-2.53;-2.53;-2.53	6.04	6.04	0.98038	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.87176	0.6112	N	0.16166	0.38	0.80722	D	1	D;D	0.63046	0.992;0.977	P;P	0.53760	0.734;0.651	D	0.87152	0.2209	10	0.40728	T	0.16	.	19.3663	0.94464	0.0:1.0:0.0:0.0	.	225;225	O95947;Q9HA44	TBX6_HUMAN;.	T	225	ENSP00000378650:A225T;ENSP00000279386:A225T;ENSP00000461223:A225T	ENSP00000279386:A225T	A	-	1	0	TBX6	30007610	1.000000	0.71417	0.994000	0.49952	0.883000	0.51084	4.937000	0.63513	2.873000	0.98535	0.563000	0.77884	GCA	TBX6	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_Brachyury	ENSG00000149922		0.617	TBX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX6	HGNC	protein_coding	OTTHUMT00000255157.2		0.00	43	0	C	NM_004608, NM_080758		30100109	-1			no_errors	ENST00000279386	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	T
TEKT3	64518	genome.wustl.edu	37	17	15222427	15222427	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:15222427T>A	ENST00000395930.1	-	5	887	c.701A>T	c.(700-702)aAg>aTg	p.K234M	TEKT3_ENST00000338696.2_Missense_Mutation_p.K234M	NM_031898.2	NP_114104.1	Q9BXF9	TEKT3_HUMAN	tektin 3	234					cilium morphogenesis (GO:0060271)|regulation of fertilization (GO:0080154)|sperm motility (GO:0030317)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.K234R(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	23				UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)		CAAATGTAGCTTCATTCTTTC	0.308																																																	1	Substitution - Missense(1)	kidney(1)											127.0	125.0	126.0					17																	15222427		2203	4298	6501	SO:0001583	missense	0			AF334676	CCDS11169.1	17p12	2011-05-23			ENSG00000125409	ENSG00000125409			14293	protein-coding gene	gene with protein product		612683				11381029, 14735490	Standard	NM_031898		Approved	FLJ32828	uc002gon.3	Q9BXF9	OTTHUMG00000058965	ENST00000395930.1:c.701A>T	17.37:g.15222427T>A	ENSP00000379263:p.Lys234Met		B2RAS7|D3DTT0|Q8N5R5|Q96M48	Missense_Mutation	SNP	pfam_Tektin,prints_Tektin	p.K234M	ENST00000395930.1	37	c.701	CCDS11169.1	17	.	.	.	.	.	.	.	.	.	.	t	15.10	2.733249	0.48939	.	.	ENSG00000125409	ENST00000395930;ENST00000338696;ENST00000539245	T;T;T	0.02916	4.11;4.11;4.11	5.58	2.03	0.26663	.	0.224771	0.51477	D	0.000084	T	0.06142	0.0159	L	0.52573	1.65	0.30026	N	0.813896	B	0.26120	0.142	B	0.43990	0.438	T	0.07028	-1.0794	10	0.52906	T	0.07	-1.9112	7.6523	0.28354	0.0:0.4788:0.0:0.5212	.	234	Q9BXF9	TEKT3_HUMAN	M	234;234;68	ENSP00000379263:K234M;ENSP00000343995:K234M;ENSP00000443280:K68M	ENSP00000343995:K234M	K	-	2	0	TEKT3	15163152	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.059000	0.41384	0.423000	0.26033	-0.263000	0.10527	AAG	TEKT3	-	pfam_Tektin	ENSG00000125409		0.308	TEKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT3	HGNC	protein_coding	OTTHUMT00000130385.2		0.00	39	0	T	NM_031898		15222427	-1			no_errors	ENST00000338696	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	A
TELO2	9894	genome.wustl.edu	37	16	1550701	1550701	+	Splice_Site	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr16:1550701G>T	ENST00000262319.6	+	9	1560		c.e9+1			NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2						regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				GAAATTCCAGGTGAGCGGGCC	0.716																																																	0													30.0	36.0	34.0					16																	1550701		2199	4298	6497	SO:0001630	splice_region_variant	0			AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.1281+1G>T	16.37:g.1550701G>T			D3DU73|O75168|Q7LDV4|Q9BR21	Splice_Site	SNP	-	e8+1	ENST00000262319.6	37	c.1281+1	CCDS32363.1	16	.	.	.	.	.	.	.	.	.	.	g	13.34	2.207307	0.39003	.	.	ENSG00000100726	ENST00000437914;ENST00000262319	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9556	0.86258	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TELO2	1490702	1.000000	0.71417	0.998000	0.56505	0.299000	0.27559	8.129000	0.89597	2.299000	0.77371	0.651000	0.88453	.	TELO2	-	-	ENSG00000100726		0.716	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TELO2	HGNC	protein_coding	OTTHUMT00000103602.2	-	0.00	13	0	G	NM_016111	Intron	1550701	+1	tier1	-	no_errors	ENST00000262319	ensembl	human	known	74_37	splice_site	23.53	13	4	SNP	1.000	T
TENM3	55714	genome.wustl.edu	37	4	183267985	183267985	+	Silent	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:183267985G>T	ENST00000511685.1	+	3	537	c.414G>T	c.(412-414)ggG>ggT	p.G138G	TENM3_ENST00000406950.2_Silent_p.G138G			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	138	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GGGGCAGGGGGGTCAAATCAG	0.537																																																	0													53.0	59.0	57.0					4																	183267985		2021	4186	6207	SO:0001819	synonymous_variant	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.414G>T	4.37:g.183267985G>T			Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c-like_dom,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.G138	ENST00000511685.1	37	c.414	CCDS47165.1	4																																																																																			TENM3	-	pfam_Ten_N	ENSG00000218336		0.537	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM3	HGNC	protein_coding	OTTHUMT00000361734.1	-	0.00	43	0	G			183267985	+1	tier1	-	no_errors	ENST00000406950	ensembl	human	known	74_37	silent	17.02	38	8	SNP	1.000	T
TENM3	55714	genome.wustl.edu	37	4	183594180	183594180	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:183594180A>C	ENST00000511685.1	+	7	1257	c.1134A>C	c.(1132-1134)caA>caC	p.Q378H	TENM3_ENST00000406950.2_Missense_Mutation_p.Q378H			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	378					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GATTTACGCAAGAAAATAACA	0.348																																																	0													28.0	26.0	27.0					4																	183594180		1803	4082	5885	SO:0001583	missense	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.1134A>C	4.37:g.183594180A>C	ENSP00000424226:p.Gln378His		Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c-like_dom,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.Q378H	ENST00000511685.1	37	c.1134	CCDS47165.1	4	.	.	.	.	.	.	.	.	.	.	A	11.63	1.695329	0.30052	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	T;T	0.27557	1.66;1.66	5.57	-1.03	0.10102	.	.	.	.	.	T	0.23492	0.0568	L	0.53249	1.67	0.33876	D	0.635553	P	0.50943	0.94	P	0.44860	0.462	T	0.41734	-0.9492	9	0.23891	T	0.37	.	2.1316	0.03751	0.5059:0.1198:0.2587:0.1156	.	378	Q9P273	TEN3_HUMAN	H	378	ENSP00000424226:Q378H;ENSP00000385276:Q378H	ENSP00000385276:Q378H	Q	+	3	2	ODZ3	183831174	0.065000	0.20965	0.998000	0.56505	0.995000	0.86356	0.614000	0.24314	-0.077000	0.12752	0.529000	0.55759	CAA	TENM3	-	NULL	ENSG00000218336		0.348	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM3	HGNC	protein_coding	OTTHUMT00000361734.1	-	0.00	39	0	A			183594180	+1	tier1	-	no_errors	ENST00000406950	ensembl	human	known	74_37	missense	41.38	34	24	SNP	0.997	C
TET3	200424	genome.wustl.edu	37	2	74274419	74274419	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:74274419C>T	ENST00000409262.3	+	1	970	c.970C>T	c.(970-972)Ccc>Tcc	p.P324S		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	324					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AAGCCCCGATCCCATGGCTGA	0.612																																																	0													44.0	48.0	47.0					2																	74274419		2053	4190	6243	SO:0001583	missense	0				CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.970C>T	2.37:g.74274419C>T	ENSP00000386869:p.Pro324Ser		A6NEI3|Q86Z24|Q8TBM9	Missense_Mutation	SNP	NULL	p.P324S	ENST00000409262.3	37	c.970	CCDS46339.1	2	.	.	.	.	.	.	.	.	.	.	C	17.05	3.290307	0.59976	.	.	ENSG00000187605	ENST00000305799;ENST00000409262;ENST00000233310	T;T	0.58940	0.3;1.55	5.7	5.7	0.88788	.	.	.	.	.	T	0.39572	0.1083	N	0.19112	0.55	0.45899	D	0.998745	P	0.38597	0.639	B	0.30943	0.122	T	0.45469	-0.9259	9	0.72032	D	0.01	.	12.0166	0.53317	0.0:0.9201:0.0:0.0799	.	324	O43151	TET3_HUMAN	S	366;324;324	ENSP00000307803:P366S;ENSP00000386869:P324S	ENSP00000233310:P324S	P	+	1	0	TET3	74127927	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	6.351000	0.73022	2.688000	0.91661	0.655000	0.94253	CCC	TET3	-	NULL	ENSG00000187605		0.612	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TET3	HGNC	protein_coding	OTTHUMT00000328141.4	-	0.00	49	0	C			74274419	+1	tier1	-	no_errors	ENST00000409262	ensembl	human	known	74_37	missense	56.67	26	34	SNP	1.000	T
TEX13A	56157	genome.wustl.edu	37	X	104464871	104464871	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:104464871T>C	ENST00000413579.1	-	2	322	c.211A>G	c.(211-213)Agc>Ggc	p.S71G	TEX13A_ENST00000372575.1_Missense_Mutation_p.S71G|IL1RAPL2_ENST00000372582.1_Intron|IL1RAPL2_ENST00000344799.4_Intron|TEX13A_ENST00000372578.3_Missense_Mutation_p.S71G			Q9BXU3	TX13A_HUMAN	testis expressed 13A	71							zinc ion binding (GO:0008270)			large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8						AAGGCCAGGCTGCCCCAGGTG	0.602																																																	0													42.0	41.0	41.0					X																	104464871		2203	4300	6503	SO:0001583	missense	0			AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629			11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""			11279525	Standard	NM_031274		Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000413579.1:c.211A>G	X.37:g.104464871T>C	ENSP00000399753:p.Ser71Gly		B1B1G8|Q32NB6	Missense_Mutation	SNP	pfam_Znf_RanBP2,pfscan_Znf_RanBP2	p.S71G	ENST00000413579.1	37	c.211		X	.	.	.	.	.	.	.	.	.	.	T	1.865	-0.461780	0.04508	.	.	ENSG00000133149	ENST00000372578;ENST00000372575;ENST00000413579	.	.	.	3.11	-4.38	0.03622	.	1.167150	0.06543	N	0.743565	T	0.26846	0.0657	.	.	.	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.10450	0.005;0.004	T	0.26608	-1.0098	8	0.51188	T	0.08	.	4.9382	0.13952	0.1852:0.509:0.0:0.3058	.	71;71	C9JWK0;Q9BXU3	.;TX13A_HUMAN	G	71	.	ENSP00000361656:S71G	S	-	1	0	TEX13A	104351527	0.836000	0.29430	0.207000	0.23584	0.145000	0.21501	-0.318000	0.08050	-1.193000	0.02688	-0.448000	0.05591	AGC	TEX13A	-	NULL	ENSG00000133149		0.602	TEX13A-201	KNOWN	basic|appris_principal	protein_coding	TEX13A	HGNC	protein_coding		-	0.00	17	0	T	NM_031274		104464871	-1	tier1	-	no_errors	ENST00000413579	ensembl	human	known	74_37	missense	52.94	8	9	SNP	0.147	C
TFR2	7036	genome.wustl.edu	37	7	100224466	100224466	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:100224466C>T	ENST00000462107.1	-	18	2343	c.2056G>A	c.(2056-2058)Gaa>Aaa	p.E686K	TFR2_ENST00000223051.3_Missense_Mutation_p.E686K|TFR2_ENST00000544242.1_Missense_Mutation_p.E227K|TFR2_ENST00000431692.1_3'UTR			Q9UP52	TFR2_HUMAN	transferrin receptor 2	686					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	CGCAGCTTTTCCGCCGCCCGG	0.706																																																	0													33.0	24.0	27.0					7																	100224466		2015	3938	5953	SO:0001583	missense	0			AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.2056G>A	7.37:g.100224466C>T	ENSP00000420525:p.Glu686Lys		A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.E686K	ENST00000462107.1	37	c.2056	CCDS34707.1	7	.	.	.	.	.	.	.	.	.	.	c	12.03	1.814329	0.32053	.	.	ENSG00000106327	ENST00000223051;ENST00000462107;ENST00000544242	T;T;T	0.56776	0.44;0.44;0.44	5.35	5.35	0.76521	Transferrin receptor-like, dimerisation domain (3);	0.252772	0.38959	N	0.001519	T	0.33323	0.0859	N	0.14661	0.345	0.80722	D	1	P	0.39094	0.659	B	0.34873	0.191	T	0.18808	-1.0325	10	0.34782	T	0.22	-25.9806	12.3206	0.54983	0.0:0.8296:0.1704:0.0	.	686	Q9UP52	TFR2_HUMAN	K	686;686;227	ENSP00000223051:E686K;ENSP00000420525:E686K;ENSP00000443656:E227K	ENSP00000223051:E686K	E	-	1	0	TFR2	100062402	0.978000	0.34361	0.690000	0.30148	0.085000	0.17905	1.738000	0.38207	2.522000	0.85027	0.558000	0.71614	GAA	TFR2	-	pfam_TFR-like_dimer_dom,superfamily_TFR-like_dimer_dom	ENSG00000106327		0.706	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFR2	HGNC	protein_coding	OTTHUMT00000356392.3	-	0.00	54	0	C	NM_003227		100224466	-1	tier1	-	no_errors	ENST00000223051	ensembl	human	known	74_37	missense	51.81	40	43	SNP	0.716	T
TG	7038	genome.wustl.edu	37	8	134042123	134042123	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:134042123delG	ENST00000220616.4	+	41	7134	c.7094delG	c.(7093-7095)tggfs	p.W2365fs	TG_ENST00000542445.1_Frame_Shift_Del_p.W735fs|TG_ENST00000377869.1_Frame_Shift_Del_p.W2308fs|TG_ENST00000519543.1_Frame_Shift_Del_p.W498fs	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	2365					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GCTCTGACCTGGGTGCAGACC	0.612																																																	0													45.0	47.0	47.0					8																	134042123		2203	4300	6503	SO:0001589	frameshift_variant	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.7094delG	8.37:g.134042123delG	ENSP00000220616:p.Trp2365fs		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Frame_Shift_Del	DEL	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.V2366fs	ENST00000220616.4	37	c.7094	CCDS34944.1	8																																																																																			TG	-	pfam_CarbesteraseB,pirsf_Thyroglobulin	ENSG00000042832		0.612	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1		0.00	57	0	G	NM_003235		134042123	+1			no_errors	ENST00000220616	ensembl	human	known	74_37	frame_shift_del	7.41	100	8	DEL	1.000	0
TIAM1	7074	genome.wustl.edu	37	21	32585673	32585673	+	Intron	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr21:32585673T>C	ENST00000286827.3	-	11	2689				TIAM1_ENST00000469412.1_5'UTR|TIAM1_ENST00000541036.1_Intron	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1						apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						GTTGATGCACTTGTGGTACTT	0.303																																																	0													69.0	66.0	67.0					21																	32585673		2202	4300	6502	SO:0001627	intron_variant	0				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.2217+40A>G	21.37:g.32585673T>C			B7ZLR6|F5GZ53|Q17RT7	RNA	SNP	-	NULL	ENST00000286827.3	37	NULL	CCDS13609.1	21																																																																																			TIAM1	-	-	ENSG00000156299		0.303	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	HGNC	protein_coding	OTTHUMT00000192552.1	-	0.00	23	0	T	NM_003253		32585673	-1	tier1	-	no_errors	ENST00000469412	ensembl	human	known	74_37	rna	33.33	22	11	SNP	0.000	C
TLE1	7088	genome.wustl.edu	37	9	84230981	84230981	+	Silent	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:84230981C>A	ENST00000376499.3	-	11	1898	c.834G>T	c.(832-834)ctG>ctT	p.L278L	TLE1_ENST00000376472.1_5'UTR|TLE1_ENST00000464999.1_5'UTR|TLE1_ENST00000376484.1_5'Flank	NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	278	Pro/Ser-rich.				multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						CCTTCTTTAGCAGGCGATTTT	0.478																																					NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)												0													121.0	119.0	120.0					9																	84230981		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.834G>T	9.37:g.84230981C>A			A8K495|Q5T3G4|Q969V9	Silent	SNP	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.L278	ENST00000376499.3	37	c.834	CCDS6661.1	9																																																																																			TLE1	-	NULL	ENSG00000196781		0.478	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLE1	HGNC	protein_coding	OTTHUMT00000055407.1		0.00	40	0	C	NM_005077		84230981	-1			no_errors	ENST00000376499	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.935	A
TLN2	83660	genome.wustl.edu	37	15	63004277	63004277	+	Splice_Site	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr15:63004277G>C	ENST00000561311.1	+	21	2864		c.e21+1		TLN2_ENST00000306829.6_Splice_Site			Q9Y4G6	TLN2_HUMAN	talin 2						cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						AGCTGCAAAGGTATTCTACTG	0.443																																																	0													41.0	42.0	41.0					15																	63004277		2203	4300	6503	SO:0001630	splice_region_variant	0			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.2634+1G>C	15.37:g.63004277G>C			A6NLB8	Splice_Site	SNP	-	e19+1	ENST00000561311.1	37	c.2634+1	CCDS32261.1	15	.	.	.	.	.	.	.	.	.	.	G	23.3	4.394514	0.83011	.	.	ENSG00000171914	ENST00000306829	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2602	0.98440	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TLN2	60791569	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	9.699000	0.98703	2.861000	0.98227	0.655000	0.94253	.	TLN2	-	-	ENSG00000171914		0.443	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	HGNC	protein_coding	OTTHUMT00000257878.2	-	0.00	31	0	G		Intron	63004277	+1	tier1	-	no_errors	ENST00000306829	ensembl	human	known	74_37	splice_site	30.00	35	15	SNP	1.000	C
TMC7	79905	genome.wustl.edu	37	16	19041668	19041668	+	Silent	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr16:19041668G>T	ENST00000304381.5	+	6	964	c.834G>T	c.(832-834)ctG>ctT	p.L278L	TMC7_ENST00000421369.3_Silent_p.L168L|TMC7_ENST00000569532.1_Silent_p.L278L	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	278					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						CCCTGGCCCTGAGCCTTCTTT	0.473																																																	0													92.0	82.0	85.0					16																	19041668		2197	4300	6497	SO:0001819	synonymous_variant	0			AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.834G>T	16.37:g.19041668G>T			E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Silent	SNP	pfam_TMC	p.L278	ENST00000304381.5	37	c.834	CCDS10573.1	16																																																																																			TMC7	-	NULL	ENSG00000170537		0.473	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC7	HGNC	protein_coding	OTTHUMT00000254276.3		0.00	26	0	G	NM_024847		19041668	+1			no_errors	ENST00000304381	ensembl	human	known	74_37	silent	5.26	36	2	SNP	1.000	T
TMCO4	255104	genome.wustl.edu	37	1	20021004	20021004	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:20021004C>T	ENST00000294543.6	-	15	1664	c.1423G>A	c.(1423-1425)Gtg>Atg	p.V475M	TMCO4_ENST00000375127.1_Missense_Mutation_p.V475M|TMCO4_ENST00000489814.1_5'UTR|TMCO4_ENST00000375122.2_Missense_Mutation_p.V435M	NM_181719.4	NP_859070.3	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4	475						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		CGGAGCTGCACCGAGGATGTG	0.617																																																	0													126.0	106.0	113.0					1																	20021004		2203	4300	6503	SO:0001583	missense	0				CCDS198.1	1p36.13	2008-02-05			ENSG00000162542	ENSG00000162542			27393	protein-coding gene	gene with protein product							Standard	NM_181719		Approved	DKFZp686C23231	uc001bcn.3	Q5TGY1	OTTHUMG00000002697	ENST00000294543.6:c.1423G>A	1.37:g.20021004C>T	ENSP00000294543:p.Val475Met		Q5TGY2|Q6MZN5|Q7Z6K6|Q9UQP4|Q9Y3K1	Missense_Mutation	SNP	pfam_DUF726,pfam_DUF900_hydrolase	p.V475M	ENST00000294543.6	37	c.1423	CCDS198.1	1	.	.	.	.	.	.	.	.	.	.	C	8.102	0.776878	0.16120	.	.	ENSG00000162542	ENST00000294543;ENST00000375127;ENST00000375122	T;T;T	0.45668	0.89;0.89;0.89	4.68	3.76	0.43208	.	1.128570	0.06832	N	0.794126	T	0.33990	0.0882	L	0.28556	0.865	0.32045	N	0.597653	B;B;P	0.36144	0.195;0.011;0.539	B;B;B	0.35073	0.111;0.033;0.195	T	0.31024	-0.9958	10	0.32370	T	0.25	-15.4086	11.0463	0.47861	0.0:0.9069:0.0:0.0931	.	59;475;435	Q6ZSC6;Q5TGY1;Q5TGY1-2	.;TMCO4_HUMAN;.	M	475;475;435	ENSP00000294543:V475M;ENSP00000364269:V475M;ENSP00000364264:V435M	ENSP00000294543:V475M	V	-	1	0	TMCO4	19893591	0.741000	0.28217	0.120000	0.21714	0.036000	0.12997	4.757000	0.62213	1.102000	0.41551	0.561000	0.74099	GTG	TMCO4	-	pfam_DUF726,pfam_DUF900_hydrolase	ENSG00000162542		0.617	TMCO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO4	HGNC	protein_coding	OTTHUMT00000007658.1		0.00	41	0	C	NM_181719		20021004	-1			no_errors	ENST00000294543	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.685	T
TMCO4	255104	genome.wustl.edu	37	1	20067393	20067393	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:20067393C>A	ENST00000294543.6	-	11	1160	c.919G>T	c.(919-921)Gag>Tag	p.E307*	TMCO4_ENST00000375122.2_Nonsense_Mutation_p.E267*|TMCO4_ENST00000489814.1_5'Flank|TMCO4_ENST00000375127.1_Nonsense_Mutation_p.E307*	NM_181719.4	NP_859070.3	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4	307						integral component of membrane (GO:0016021)		p.E307*(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		CAGTACTGCTCACGGCTGTGG	0.632																																																	1	Substitution - Nonsense(1)	lung(1)											54.0	47.0	50.0					1																	20067393		2203	4300	6503	SO:0001587	stop_gained	0				CCDS198.1	1p36.13	2008-02-05			ENSG00000162542	ENSG00000162542			27393	protein-coding gene	gene with protein product							Standard	NM_181719		Approved	DKFZp686C23231	uc001bcn.3	Q5TGY1	OTTHUMG00000002697	ENST00000294543.6:c.919G>T	1.37:g.20067393C>A	ENSP00000294543:p.Glu307*		Q5TGY2|Q6MZN5|Q7Z6K6|Q9UQP4|Q9Y3K1	Nonsense_Mutation	SNP	pfam_DUF726,pfam_DUF900_hydrolase	p.E307*	ENST00000294543.6	37	c.919	CCDS198.1	1	.	.	.	.	.	.	.	.	.	.	C	39	7.767262	0.98477	.	.	ENSG00000162542	ENST00000294543;ENST00000375127;ENST00000375122	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-8.6427	16.5542	0.84481	0.0:1.0:0.0:0.0	.	.	.	.	X	307;307;267	.	ENSP00000294543:E307X	E	-	1	0	TMCO4	19939980	1.000000	0.71417	0.952000	0.39060	0.847000	0.48162	7.204000	0.77872	2.506000	0.84524	0.655000	0.94253	GAG	TMCO4	-	pfam_DUF726	ENSG00000162542		0.632	TMCO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO4	HGNC	protein_coding	OTTHUMT00000007658.1		0.00	35	0	C	NM_181719		20067393	-1			no_errors	ENST00000294543	ensembl	human	known	74_37	nonsense	6.25	30	2	SNP	0.999	A
TMEM132C	92293	genome.wustl.edu	37	12	129190790	129190790	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr12:129190790G>A	ENST00000435159.2	+	9	3277	c.3277G>A	c.(3277-3279)Gcc>Acc	p.A1093T	TMEM132C_ENST00000537538.1_Missense_Mutation_p.A478T|TMEM132C_ENST00000315208.8_Missense_Mutation_p.A709T	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	1093						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						GGCTGTGGGTGCCCCCAAGGA	0.547																																																	0													37.0	39.0	38.0					12																	129190790		692	1591	2283	SO:0001583	missense	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.3277G>A	12.37:g.129190790G>A	ENSP00000410852:p.Ala1093Thr		Q69YX8	Missense_Mutation	SNP	NULL	p.A1093T	ENST00000435159.2	37	c.3277		12	.	.	.	.	.	.	.	.	.	.	G	10.89	1.477510	0.26511	.	.	ENSG00000181234	ENST00000435159;ENST00000315208;ENST00000537538	T;T;T	0.09630	3.76;3.42;2.96	4.19	2.8	0.32819	.	0.575559	0.15592	N	0.254332	T	0.12944	0.0314	L	0.46157	1.445	0.28017	N	0.934688	P	0.35033	0.481	B	0.38500	0.275	T	0.08046	-1.0741	10	0.62326	D	0.03	.	11.3655	0.49668	0.1092:0.0:0.8908:0.0	.	1093	Q8N3T6	T132C_HUMAN	T	1093;709;478	ENSP00000410852:A1093T;ENSP00000324458:A709T;ENSP00000438477:A478T	ENSP00000324458:A709T	A	+	1	0	TMEM132C	127756743	0.342000	0.24809	0.023000	0.16930	0.006000	0.05464	2.264000	0.43302	0.904000	0.36572	0.561000	0.74099	GCC	TMEM132C	-	NULL	ENSG00000181234		0.547	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		-	0.00	45	0	G	XM_044062		129190790	+1	tier1	-	no_errors	ENST00000435159	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	A
TMEM196	256130	genome.wustl.edu	37	7	19763924	19763924	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:19763924delG	ENST00000405844.1	-	4	1207	c.512delC	c.(511-513)ccgfs	p.P171fs	TMEM196_ENST00000422233.1_Frame_Shift_Del_p.P103fs|TMEM196_ENST00000493519.1_Intron|TMEM196_ENST00000405764.3_Intron|TMEM196_ENST00000433641.1_3'UTR			Q5HYL7	TM196_HUMAN	transmembrane protein 196	0						integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(4)	6						CTCTGGTGTCGGGGGCACCAC	0.433																																																	0																																										SO:0001589	frameshift_variant	0				CCDS34607.2	7p15.3	2007-11-21			ENSG00000173452	ENSG00000173452			22431	protein-coding gene	gene with protein product							Standard	NM_152774		Approved	MGC42090	uc011jyg.2	Q5HYL7	OTTHUMG00000152504	ENST00000405844.1:c.512delC	7.37:g.19763924delG	ENSP00000385087:p.Pro171fs		Q8N6I6	Frame_Shift_Del	DEL	NULL	p.P103fs	ENST00000405844.1	37	c.308		7																																																																																			TMEM196	-	NULL	ENSG00000173452		0.433	TMEM196-003	NOVEL	not_organism_supported|basic	protein_coding	TMEM196	HGNC	protein_coding	OTTHUMT00000326539.1		0.00	42	0	G	NM_152774		19763924	-1	tier1		no_errors	ENST00000422233	ensembl	human	putative	74_37	frame_shift_del	5.00	38	2	DEL	1.000	-
TMSB15A	11013	genome.wustl.edu	37	X	101770005	101770005	+	Silent	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:101770005A>C	ENST00000289373.4	-	2	222	c.87T>G	c.(85-87)ctT>ctG	p.L29L		NM_021992.2	NP_068832.1	P0CG34	TB15A_HUMAN	thymosin beta 15a	29					actin cytoskeleton organization (GO:0030036)|sequestering of actin monomers (GO:0042989)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				large_intestine(1)|lung(1)	2						CCTTTGAGGGAAGAGTATTTT	0.363																																																	0													140.0	134.0	136.0					X																	101770005		2203	4300	6503	SO:0001819	synonymous_variant	0			D82345	CCDS14498.1	Xq21.33-q22.3	2009-01-12	2009-01-12	2009-01-12	ENSG00000158164	ENSG00000158164			30744	protein-coding gene	gene with protein product		601587	"""thymosin-like 8"""	TMSL8		9039501, 17567946	Standard	NM_021992		Approved	TMSNB	uc004eje.3	P0CG34	OTTHUMG00000022054	ENST00000289373.4:c.87T>G	X.37:g.101770005A>C			A8K614|Q99406	Silent	SNP	pfam_Thymosin_b4,smart_Thymosin_b4,pirsf_Thymosin_b4_metazoa	p.L29	ENST00000289373.4	37	c.87	CCDS14498.1	X																																																																																			TMSB15A	-	pfam_Thymosin_b4,smart_Thymosin_b4,pirsf_Thymosin_b4_metazoa	ENSG00000158164		0.363	TMSB15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMSB15A	HGNC	protein_coding	OTTHUMT00000057621.1	-	0.00	24	0	A	NM_021992		101770005	-1	tier1	-	no_errors	ENST00000289373	ensembl	human	known	74_37	silent	35.14	24	13	SNP	0.041	C
TNIP3	79931	genome.wustl.edu	37	4	122068273	122068273	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:122068273A>T	ENST00000509841.1	-	10	975	c.897T>A	c.(895-897)aaT>aaA	p.N299K	TNIP3_ENST00000057513.3_Missense_Mutation_p.N222K|TNIP3_ENST00000511909.1_5'UTR|TNIP3_ENST00000507879.1_Missense_Mutation_p.N292K|TNIP3_ENST00000454328.1_Missense_Mutation_p.N222K	NM_001244764.1	NP_001231693.1			TNFAIP3 interacting protein 3											NS(1)|endometrium(4)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(2)	24						CTTTCTCTTGATTAAGTCTCT	0.383																																																	0													224.0	216.0	219.0					4																	122068273		2203	4300	6503	SO:0001583	missense	0			AJ320534	CCDS3718.1, CCDS58925.1, CCDS58926.1	4q27	2008-02-05			ENSG00000050730	ENSG00000050730			19315	protein-coding gene	gene with protein product		608019				11345586	Standard	NM_024873		Approved	LIND, FLJ21162, ABIN-3	uc021xrj.1	Q96KP6	OTTHUMG00000132969	ENST00000509841.1:c.897T>A	4.37:g.122068273A>T	ENSP00000426613:p.Asn299Lys			Missense_Mutation	SNP	NULL	p.N222K	ENST00000509841.1	37	c.666	CCDS58926.1	4	.	.	.	.	.	.	.	.	.	.	A	13.39	2.223551	0.39300	.	.	ENSG00000050730	ENST00000057513;ENST00000454328;ENST00000507879;ENST00000509841	D;D;D;D	0.97279	-4.32;-4.32;-4.32;-4.32	5.4	1.52	0.23074	.	0.231041	0.37012	N	0.002300	D	0.94205	0.8140	M	0.62723	1.935	0.25676	N	0.98584	B;B	0.24426	0.103;0.029	B;B	0.22880	0.042;0.015	D	0.88151	0.2851	10	0.59425	D	0.04	-7.818	5.677	0.17753	0.6551:0.1326:0.2123:0.0	.	292;222	B4DVF5;Q96KP6	.;TNIP3_HUMAN	K	222;222;292;299	ENSP00000057513:N222K;ENSP00000411817:N222K;ENSP00000427106:N292K;ENSP00000426613:N299K	ENSP00000057513:N222K	N	-	3	2	TNIP3	122287723	1.000000	0.71417	0.965000	0.40720	0.991000	0.79684	1.231000	0.32624	0.042000	0.15717	0.460000	0.39030	AAT	TNIP3	-	NULL	ENSG00000050730		0.383	TNIP3-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	TNIP3	HGNC	protein_coding	OTTHUMT00000364000.4	-	0.00	52	0	A	NM_024873		122068273	-1	tier1	-	no_errors	ENST00000057513	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.998	T
TNN	63923	genome.wustl.edu	37	1	175092723	175092723	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:175092723C>T	ENST00000239462.4	+	12	2951	c.2838C>T	c.(2836-2838)ggC>ggT	p.G946G		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	946	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		TGAGACCAGGCATGGAGTACA	0.627																																																	0													90.0	75.0	80.0					1																	175092723		2203	4300	6503	SO:0001819	synonymous_variant	0			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2838C>T	1.37:g.175092723C>T			B9EGP3|Q5R360	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.G946	ENST00000239462.4	37	c.2838	CCDS30943.1	1																																																																																			TNN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000120332		0.627	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNN	HGNC	protein_coding	OTTHUMT00000084422.1	-	0.00	60	0	C	XM_040527		175092723	+1	tier1	-	no_errors	ENST00000239462	ensembl	human	known	74_37	silent	40.00	45	30	SNP	0.727	T
TP53	7157	genome.wustl.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	GRCh37	CM941329	TP53	M							102.0	91.0	94.0					17																	7578263		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	17.37:g.7578263G>A	ENSP00000269305:p.Arg196*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R196*	ENST00000269305.4	37	c.586	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	TP53	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	38	0	G	NM_000546		7578263	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	27.08	33	13	SNP	1.000	A
TOP2A	7153	genome.wustl.edu	37	17	38567944	38567944	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:38567944T>C	ENST00000423485.1	-	8	1074	c.916A>G	c.(916-918)Aaa>Gaa	p.K306E		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	306					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	TGAAAGCCTTTTTCACTCATA	0.323																																																	0													118.0	110.0	113.0					17																	38567944		1848	4088	5936	SO:0001583	missense	0				CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.916A>G	17.37:g.38567944T>C	ENSP00000411532:p.Lys306Glu		B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Missense_Mutation	SNP	pfam_Topo_IIA_A/C,pfam_Topo_IIA_bsu_dom2,pfam_DTHCT,pfam_HATPase_ATP-bd,superfamily_Topo_IIA_like_dom,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,smart_Topo_IIA_A/C,prints_TopoII_euk,prints_Topo_IIA,prints_Transcrpt_fac_NFYB/HAP3	p.K306E	ENST00000423485.1	37	c.916	CCDS45672.1	17	.	.	.	.	.	.	.	.	.	.	T	17.50	3.404274	0.62288	.	.	ENSG00000131747	ENST00000423485;ENST00000269577;ENST00000348049;ENST00000357601	T	0.22945	1.93	5.59	5.59	0.84812	Ribosomal protein S5 domain 2-type fold (1);DNA topoisomerase, type IIA, subunit B, domain 2 (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);DNA topoisomerase, type IIA, subunit B/N-terminal (1);	0.048068	0.85682	D	0.000000	T	0.20941	0.0504	L	0.37507	1.11	0.58432	D	0.999997	B	0.06786	0.001	B	0.09377	0.004	T	0.06588	-1.0818	10	0.11794	T	0.64	.	15.7667	0.78131	0.0:0.0:0.0:1.0	.	306	P11388	TOP2A_HUMAN	E	306;305;305;308	ENSP00000411532:K306E	ENSP00000269577:K305E	K	-	1	0	TOP2A	35821470	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.963000	0.87922	2.138000	0.66242	0.528000	0.53228	AAA	TOP2A	-	pfam_Topo_IIA_bsu_dom2,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,prints_Transcrpt_fac_NFYB/HAP3	ENSG00000131747		0.323	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP2A	HGNC	protein_coding	OTTHUMT00000338035.1		0.00	38	0	T			38567944	-1			no_errors	ENST00000423485	ensembl	human	known	74_37	missense	5.26	54	3	SNP	1.000	C
TPTE2P1	646405	genome.wustl.edu	37	13	25525623	25525623	+	RNA	SNP	A	A	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr13:25525623A>T	ENST00000429698.1	-	0	285							Q5T6R2	TPT2L_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 pseudogene 1																		TTGGTAGATAAAGCCTAAGAA	0.348																																																	0																																												0					13q12.12-q12.13	2012-10-03			ENSG00000253771	ENSG00000253771			35196	pseudogene	pseudogene							Standard	NR_026730		Approved		uc010tdh.2	Q5T6R2	OTTHUMG00000016596		13.37:g.25525623A>T			B3KST4|B4DMH9	RNA	SNP	-	NULL	ENST00000429698.1	37	NULL		13																																																																																			TPTE2P1	-	-	ENSG00000253771		0.348	TPTE2P1-003	KNOWN	basic	processed_transcript	TPTE2P1	HGNC	pseudogene	OTTHUMT00000044206.1		0.00	80	0	A			25525623	-1			no_errors	ENST00000429698	ensembl	human	known	74_37	rna	5.80	65	4	SNP	1.000	T
TRIM26	7726	genome.wustl.edu	37	6	30157254	30157254	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:30157254delT	ENST00000454678.2	-	8	1281	c.845delA	c.(844-846)aagfs	p.K282fs	TRIM26_ENST00000437089.1_Frame_Shift_Del_p.K282fs|TRIM26_ENST00000453195.1_Frame_Shift_Del_p.K282fs	NM_003449.4	NP_003440.1	Q12899	TRI26_HUMAN	tripartite motif containing 26	282					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)	p.K282fs*16(1)		lung(1)|ovary(2)	3						TTCTCCGGTCTTTTTTTTAAC	0.483																																																	1	Deletion - Frameshift(1)	ovary(1)											93.0	106.0	101.0					6																	30157254		1510	2709	4219	SO:0001589	frameshift_variant	0			AB088090	CCDS4678.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000234127	ENSG00000234127		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12962	protein-coding gene	gene with protein product		600830	"""tripartite motif-containing 26"""	ZNF173		8530076	Standard	NM_003449		Approved	RNF95	uc003npt.3	Q12899	OTTHUMG00000031041	ENST00000454678.2:c.845delA	6.37:g.30157254delT	ENSP00000410446:p.Lys282fs		A6NG96|Q5SRL2	Frame_Shift_Del	DEL	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.K282fs	ENST00000454678.2	37	c.845	CCDS4678.1	6																																																																																			TRIM26	-	NULL	ENSG00000234127		0.483	TRIM26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM26	HGNC	protein_coding	OTTHUMT00000253442.1		0.00	35	0	T	NM_003449		30157254	-1	tier1		no_errors	ENST00000437089	ensembl	human	known	74_37	frame_shift_del	9.09	20	2	DEL	0.012	-
TRIM3	10612	genome.wustl.edu	37	11	6478090	6478090	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:6478090C>T	ENST00000525074.1	-	6	1260	c.866G>A	c.(865-867)cGg>cAg	p.R289Q	TRIM3_ENST00000536344.1_Missense_Mutation_p.R170Q|TRIM3_ENST00000359518.3_Missense_Mutation_p.R289Q|TRIM3_ENST00000345851.3_Missense_Mutation_p.R289Q|TRIM3_ENST00000529058.1_5'UTR|TRIM3_ENST00000537602.1_Intron	NM_001248006.1	NP_001234935.1	O75382	TRIM3_HUMAN	tripartite motif containing 3	289					nervous system development (GO:0007399)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)	protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(3)	27		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTCATGTGGCCGCTCCGGGAA	0.667																																					Melanoma(6;5 510 1540 25169 29084)												0													58.0	53.0	55.0					11																	6478090		2196	4282	6478	SO:0001583	missense	0			AF045239	CCDS7764.1, CCDS58115.1	11p15.5	2013-01-09	2011-01-25	2001-11-23	ENSG00000110171	ENSG00000110171		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10064	protein-coding gene	gene with protein product	"""ring finger protein 22"", ""brain expressed ring finger"", ""tripartite motif protein TRIM3"""	605493	"""tripartite motif-containing 3"""	RNF22		10391919	Standard	NM_006458		Approved	HAC1, BERP, RNF97	uc009yfd.3	O75382	OTTHUMG00000133405	ENST00000525074.1:c.866G>A	11.37:g.6478090C>T	ENSP00000433102:p.Arg289Gln		B7Z5E6|F5H2Q8|Q4V9L4|Q9C038|Q9C039	Missense_Mutation	SNP	pfam_NHL_repeat,pfam_Filamin/ABP280_repeat-like,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_Ig_E-set,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Filamin,pfscan_Filamin/ABP280_repeat-like,pfscan_NHL_repeat_subgr,pfscan_Znf_B-box,pfscan_Znf_RING	p.R289Q	ENST00000525074.1	37	c.866	CCDS7764.1	11	.	.	.	.	.	.	.	.	.	.	C	6.646	0.487775	0.12641	.	.	ENSG00000110171	ENST00000530899;ENST00000525074;ENST00000545029;ENST00000345851;ENST00000336043;ENST00000359518;ENST00000536344	T;T;T;D	0.82803	-0.53;-0.53;-0.53;-1.65	5.27	5.27	0.74061	.	0.306232	0.37219	N	0.002182	T	0.64461	0.2600	N	0.14661	0.345	0.29552	N	0.851297	B;B;B	0.13594	0.004;0.008;0.004	B;B;B	0.08055	0.002;0.003;0.002	T	0.53063	-0.8491	10	0.07813	T	0.8	-13.0167	8.2335	0.31612	0.0:0.8301:0.0:0.1699	.	170;170;289	F5H2Q8;D3DQT4;O75382	.;.;TRIM3_HUMAN	Q	289;289;289;289;278;289;170	ENSP00000433102:R289Q;ENSP00000340797:R289Q;ENSP00000352508:R289Q;ENSP00000445460:R170Q	ENSP00000337094:R278Q	R	-	2	0	TRIM3	6434666	0.990000	0.36364	0.955000	0.39395	0.972000	0.66771	1.925000	0.40074	2.472000	0.83506	0.563000	0.77884	CGG	TRIM3	-	NULL	ENSG00000110171		0.667	TRIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRIM3	HGNC	protein_coding	OTTHUMT00000384224.2	-	0.00	69	0	C	NM_006458		6478090	-1	tier1	-	no_errors	ENST00000345851	ensembl	human	known	74_37	missense	19.23	63	15	SNP	0.998	T
TRIM32	22954	genome.wustl.edu	37	9	119460513	119460513	+	Silent	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:119460513G>A	ENST00000450136.1	+	2	653	c.492G>A	c.(490-492)caG>caA	p.Q164Q	ASTN2_ENST00000361209.2_Intron|TRIM32_ENST00000373983.2_Silent_p.Q164Q|ASTN2_ENST00000373996.3_Intron|ASTN2_ENST00000313400.4_Intron|ASTN2_ENST00000361477.3_Intron	NM_001099679.1|NM_012210.3	NP_001093149.1|NP_036342.2	Q13049	TRI32_HUMAN	tripartite motif containing 32	164					fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of proteolysis (GO:0045862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of type I interferon production (GO:0032479)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|striated muscle myosin thick filament (GO:0005863)	ligase activity (GO:0016874)|myosin binding (GO:0017022)|protein self-association (GO:0043621)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|translation initiation factor binding (GO:0031369)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	26						GGGAGCTGCAGCGGCGGAAGG	0.577																																					Esophageal Squamous(92;212 1916 19711 26951)												0													47.0	54.0	51.0					9																	119460513		2203	4300	6503	SO:0001819	synonymous_variant	0			U18543	CCDS6817.1	9q33.1	2014-09-17	2011-01-25		ENSG00000119401	ENSG00000119401		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16380	protein-coding gene	gene with protein product		602290	"""limb girdle muscular dystrophy 2H (autosomal recessive)"", ""tripartite motif-containing 32"""	LGMD2H		11331580, 7778269, 16606853	Standard	NM_001099679		Approved	HT2A, TATIP, BBS11	uc004bjx.2	Q13049	OTTHUMG00000021026	ENST00000450136.1:c.492G>A	9.37:g.119460513G>A			Q9NQP8	Silent	SNP	pfam_NHL_repeat,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_NHL_repeat_subgr,pfscan_Znf_B-box,pfscan_Znf_RING	p.Q164	ENST00000450136.1	37	c.492	CCDS6817.1	9																																																																																			TRIM32	-	NULL	ENSG00000119401		0.577	TRIM32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM32	HGNC	protein_coding	OTTHUMT00000055466.2	-	0.00	20	0	G	NM_012210		119460513	+1	tier1	-	no_errors	ENST00000373983	ensembl	human	known	74_37	silent	17.86	23	5	SNP	1.000	A
TRIM49C	642612	genome.wustl.edu	37	11	89774338	89774338	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:89774338A>C	ENST00000448984.1	+	8	1308	c.979A>C	c.(979-981)Agt>Cgt	p.S327R	TRIM49C_ENST00000432771.1_Intron	NM_001195234.1	NP_001182163.1	P0CI26	TR49C_HUMAN	tripartite motif containing 49C	327	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|lung(4)	8						AACACCTAGAAGTTTTCTTGC	0.423																																																	0																																										SO:0001583	missense	0			BC126470	CCDS53694.1	11q14.3	2014-02-17	2012-05-18	2012-05-18	ENSG00000204449	ENSG00000204449		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	38877	protein-coding gene	gene with protein product			"""tripartite motif containing 49-like 2"""	TRIM49L2			Standard	NM_001195234		Approved		uc010rua.2	P0CI26		ENST00000448984.1:c.979A>C	11.37:g.89774338A>C	ENSP00000388299:p.Ser327Arg		A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.S327R	ENST00000448984.1	37	c.979	CCDS53694.1	11	.	.	.	.	.	.	.	.	.	.	A	5.198	0.221998	0.09863	.	.	ENSG00000204449	ENST00000448984	T	0.08546	3.08	0.823	-0.7	0.11273	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.05593	0.0147	L	0.36672	1.1	0.09310	N	1	B	0.22211	0.066	B	0.20184	0.028	T	0.43163	-0.9408	8	.	.	.	.	2.82	0.05468	0.4537:0.0:0.0:0.5463	.	327	P0CI26	T49L2_HUMAN	R	327	ENSP00000388299:S327R	.	S	+	1	0	TRIM49L2	89413986	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	0.039000	0.13884	-0.248000	0.09583	0.254000	0.18369	AGT	TRIM49C	-	superfamily_ConA-like_lec_gl_sf,prints_Butyrophylin,pfscan_B30.2/SPRY	ENSG00000204449		0.423	TRIM49C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM49C	HGNC	protein_coding	OTTHUMT00000395455.1	-	0.00	121	0	A	NM_001195234		89774338	+1	tier1	-	no_errors	ENST00000448984	ensembl	human	known	74_37	missense	14.41	95	16	SNP	0.001	C
TRIM52	84851	genome.wustl.edu	37	5	180687428	180687428	+	Silent	SNP	C	C	T	rs200454506|rs3073543|rs33972170	byFrequency	TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:180687428C>T	ENST00000327767.4	-	1	691	c.387G>A	c.(385-387)gaG>gaA	p.E129E	CTC-338M12.4_ENST00000505151.1_RNA|CTC-338M12.4_ENST00000511331.1_RNA|TRIM52-AS1_ENST00000507434.1_RNA|CTC-338M12.4_ENST00000417281.2_RNA|TRIM52-AS1_ENST00000509252.1_RNA|TRIM52-AS1_ENST00000514146.1_RNA|TRIM52_ENST00000514805.1_5'UTR	NM_032765.2	NP_116154.1	Q96A61	TRI52_HUMAN	tripartite motif containing 52	129	Glu-rich.				positive regulation of NF-kappaB transcription factor activity (GO:0051092)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	8	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.0106)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0588)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.232)		CCTGATCTTCCTCTTCTTCTT	0.458																																																	0													187.0	165.0	173.0					5																	180687428		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4467.1	5q35.3	2013-01-09	2011-01-25		ENSG00000183718	ENSG00000183718		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19024	protein-coding gene	gene with protein product			"""tripartite motif-containing 52"""				Standard	NM_032765		Approved	RNF102	uc003mnp.3	Q96A61	OTTHUMG00000130964	ENST00000327767.4:c.387G>A	5.37:g.180687428C>T				Silent	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.E129	ENST00000327767.4	37	c.387	CCDS4467.1	5																																																																																			TRIM52	-	smart_Znf_RING	ENSG00000183718		0.458	TRIM52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM52	HGNC	protein_coding	OTTHUMT00000253572.3		0.00	38	0	C	NM_032765		180687428	-1			no_errors	ENST00000327767	ensembl	human	known	74_37	silent	6.76	69	5	SNP	0.097	T
TRIM58	25893	genome.wustl.edu	37	1	248039702	248039702	+	Silent	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:248039702T>C	ENST00000366481.3	+	6	1420	c.1372T>C	c.(1372-1374)Ttg>Ctg	p.L458L	OR2W3_ENST00000537741.1_Intron	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	458	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TCCTCTTATCTTGCCACCCAC	0.418																																																	0													123.0	117.0	119.0					1																	248039702		2203	4300	6503	SO:0001819	synonymous_variant	0			AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.1372T>C	1.37:g.248039702T>C			Q6B0H9	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.L458	ENST00000366481.3	37	c.1372	CCDS1636.1	1																																																																																			TRIM58	-	superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000162722		0.418	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM58	HGNC	protein_coding	OTTHUMT00000096860.1	-	0.00	45	0	T	NM_015431		248039702	+1	tier1	-	no_errors	ENST00000366481	ensembl	human	known	74_37	silent	45.00	33	27	SNP	0.000	C
TRIML2	205860	genome.wustl.edu	37	4	189018310	189018310	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr4:189018310T>G	ENST00000512729.1	-	6	874	c.500A>C	c.(499-501)aAg>aCg	p.K167T	TRIML2_ENST00000326754.3_Missense_Mutation_p.K192T	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	167					protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)			central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		CAGCAGTGACTTGCTCCTGAA	0.498																																																	0													119.0	115.0	117.0					4																	189018310		2203	4300	6503	SO:0001583	missense	0			AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.500A>C	4.37:g.189018310T>G	ENSP00000422581:p.Lys167Thr		B7Z6J6	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	p.K167T	ENST00000512729.1	37	c.500	CCDS3850.1	4	.	.	.	.	.	.	.	.	.	.	T	6.155	0.396834	0.11638	.	.	ENSG00000179046	ENST00000512729;ENST00000326754	T;T	0.59638	3.56;0.25	4.51	3.28	0.37604	.	0.532223	0.16040	N	0.232475	T	0.34629	0.0904	N	0.14661	0.345	0.26805	N	0.969112	B;B	0.29716	0.255;0.039	B;B	0.23852	0.049;0.034	T	0.17349	-1.0372	10	0.44086	T	0.13	.	6.1431	0.20271	0.0:0.1269:0.0:0.8731	.	192;167	B7ZLC3;Q8N7C3	.;TRIMM_HUMAN	T	167;192	ENSP00000422581:K167T;ENSP00000317498:K192T	ENSP00000317498:K192T	K	-	2	0	TRIML2	189255304	0.022000	0.18835	0.326000	0.25389	0.004000	0.04260	1.626000	0.37039	0.998000	0.38996	0.519000	0.50382	AAG	TRIML2	-	NULL	ENSG00000179046		0.498	TRIML2-001	KNOWN	basic|CCDS	protein_coding	TRIML2	HGNC	protein_coding	OTTHUMT00000359733.1	-	0.00	30	0	T	NM_173553		189018310	-1	tier1	-	no_errors	ENST00000512729	ensembl	human	known	74_37	missense	43.18	25	19	SNP	0.425	G
TRMT6	51605	genome.wustl.edu	37	20	5922605	5922605	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr20:5922605G>T	ENST00000203001.2	-	8	1234	c.1104C>A	c.(1102-1104)aaC>aaA	p.N368K	TRMT6_ENST00000473131.1_5'UTR|TRMT6_ENST00000453074.2_Missense_Mutation_p.N198K	NM_015939.3	NP_057023.2	Q9UJA5	TRM6_HUMAN	tRNA methyltransferase 6 homolog (S. cerevisiae)	368					regulation of translational initiation (GO:0006446)|tRNA processing (GO:0008033)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.N368N(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)	15						ACCCATCTGCGTTTCTTTCAC	0.453																																																	1	Substitution - coding silent(1)	large_intestine(1)											235.0	226.0	229.0					20																	5922605		2203	4300	6503	SO:0001583	missense	0			AK000613	CCDS13093.1, CCDS63225.1	20p12.3	2009-01-12			ENSG00000089195	ENSG00000089195			20900	protein-coding gene	gene with protein product						16043508	Standard	NM_001281467		Approved	GCD10, MGC5029, Gcd10p, CGI-09	uc002wmh.1	Q9UJA5	OTTHUMG00000031816	ENST00000203001.2:c.1104C>A	20.37:g.5922605G>T	ENSP00000203001:p.Asn368Lys		B4DUV6|Q76P92|Q9BQV5|Q9ULR7|Q9Y2Z8	Missense_Mutation	SNP	pfam_EIF3_gamma,pirsf_tRNA_m1A_mtfrase	p.N368K	ENST00000203001.2	37	c.1104	CCDS13093.1	20	.	.	.	.	.	.	.	.	.	.	G	17.14	3.312671	0.60414	.	.	ENSG00000089195	ENST00000203001;ENST00000453074	T;T	0.21932	2.0;1.98	6.17	-10.3	0.00346	.	0.000000	0.85682	D	0.000000	T	0.23611	0.0571	L	0.28649	0.875	0.51012	D	0.999902	D	0.89917	1.0	D	0.77557	0.99	T	0.71909	-0.4450	10	0.07813	T	0.8	-26.5267	20.2849	0.98532	0.825:0.0:0.175:0.0	.	368	Q9UJA5	TRM6_HUMAN	K	368;198	ENSP00000203001:N368K;ENSP00000392070:N198K	ENSP00000203001:N368K	N	-	3	2	TRMT6	5870605	0.595000	0.26857	0.533000	0.28001	0.606000	0.37113	-0.090000	0.11163	-1.836000	0.01190	-1.623000	0.00790	AAC	TRMT6	-	pirsf_tRNA_m1A_mtfrase	ENSG00000089195		0.453	TRMT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT6	HGNC	protein_coding	OTTHUMT00000077889.2		0.00	29	0	G			5922605	-1			no_errors	ENST00000203001	ensembl	human	known	74_37	missense	6.25	45	3	SNP	0.417	T
TROVE2	6738	genome.wustl.edu	37	1	193053775	193053775	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:193053775C>A	ENST00000367446.3	+	9	1741	c.1531C>A	c.(1531-1533)Cca>Aca	p.P511T	TROVE2_ENST00000460715.2_3'UTR|TROVE2_ENST00000400968.2_Missense_Mutation_p.P511T|TROVE2_ENST00000367444.3_Missense_Mutation_p.P511T|TROVE2_ENST00000432079.1_Missense_Mutation_p.P236T|TROVE2_ENST00000367443.1_Missense_Mutation_p.P511T|TROVE2_ENST00000416058.2_Missense_Mutation_p.P236T|TROVE2_ENST00000367441.1_Missense_Mutation_p.P511T|TROVE2_ENST00000367445.3_Missense_Mutation_p.P511T	NM_004600.5	NP_004591.2	P10155	RO60_HUMAN	TROVE domain family, member 2	511	VWFA-like domain. {ECO:0000250}.				cilium morphogenesis (GO:0060271)|immune system development (GO:0002520)|response to UV (GO:0009411)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|RNA binding (GO:0003723)|U2 snRNA binding (GO:0030620)			biliary_tract(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|urinary_tract(1)	21						CATTGCAGACCCAGATGATAG	0.358																																																	0													170.0	157.0	161.0					1																	193053775		1894	4117	6011	SO:0001583	missense	0			BC036658	CCDS41449.1, CCDS1379.1, CCDS41450.1, CCDS41450.2, CCDS53451.1	1q31	2014-08-06	2005-06-14	2005-06-14	ENSG00000116747	ENSG00000116747			11313	protein-coding gene	gene with protein product		600063	"""Sjogren syndrome antigen A2 (60kDa, ribonucleoprotein autoantigen SS-A/Ro)"""	SSA2		8188321	Standard	NM_001042369		Approved	Ro60	uc001gss.3	P10155	OTTHUMG00000035675	ENST00000367446.3:c.1531C>A	1.37:g.193053775C>A	ENSP00000356416:p.Pro511Thr		B2RBB9|Q5LJ98|Q5LJ99|Q5LJA0|Q86WL3|Q86WL4|Q92787|Q9H1W6	Missense_Mutation	SNP	pfam_TROVE,pfscan_TROVE	p.P511T	ENST00000367446.3	37	c.1531	CCDS1379.1	1	.	.	.	.	.	.	.	.	.	.	C	15.25	2.778403	0.49786	.	.	ENSG00000116747	ENST00000400968;ENST00000416058;ENST00000367446;ENST00000367443;ENST00000367445;ENST00000367444;ENST00000367441	.	.	.	5.22	5.22	0.72569	.	0.051722	0.85682	D	0.000000	T	0.59473	0.2196	L	0.54323	1.7	0.58432	D	0.999992	P;P;D;P	0.55385	0.537;0.851;0.971;0.745	B;P;P;B	0.46975	0.313;0.533;0.476;0.357	T	0.56529	-0.7964	9	0.21540	T	0.41	-20.1881	18.7832	0.91942	0.0:1.0:0.0:0.0	.	511;511;511;511	Q5LJ99;Q5LJ98;Q5LJA0;P10155	.;.;.;RO60_HUMAN	T	511;236;511;511;511;511;511	.	ENSP00000356411:P511T	P	+	1	0	TROVE2	191320398	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.408000	0.59761	2.407000	0.81776	0.460000	0.39030	CCA	TROVE2	-	NULL	ENSG00000116747		0.358	TROVE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TROVE2	HGNC	protein_coding	OTTHUMT00000086688.1	-	0.00	46	0	C	NM_004600		193053775	+1	tier1	-	no_errors	ENST00000367441	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	A
TRPM3	80036	genome.wustl.edu	37	9	73376527	73376527	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:73376527T>C	ENST00000377111.2	-	8	1505	c.1262A>G	c.(1261-1263)aAg>aGg	p.K421R	TRPM3_ENST00000377105.1_Missense_Mutation_p.K268R|TRPM3_ENST00000358082.3_Missense_Mutation_p.K293R|TRPM3_ENST00000377106.1_Missense_Mutation_p.K293R|TRPM3_ENST00000357533.2_Missense_Mutation_p.K423R|TRPM3_ENST00000396285.1_Missense_Mutation_p.K268R|TRPM3_ENST00000377110.3_Missense_Mutation_p.K421R|TRPM3_ENST00000408909.2_Missense_Mutation_p.K268R|TRPM3_ENST00000360823.2_Missense_Mutation_p.K293R|TRPM3_ENST00000377101.1_Missense_Mutation_p.K268R|TRPM3_ENST00000396292.4_Missense_Mutation_p.K293R|TRPM3_ENST00000423814.3_Missense_Mutation_p.K448R|TRPM3_ENST00000396280.5_Missense_Mutation_p.K268R	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	446					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						CAATTCCTTCTTCTTCATGCA	0.433																																																	0													123.0	106.0	112.0					9																	73376527		2203	4300	6503	SO:0001583	missense	0			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.1262A>G	9.37:g.73376527T>C	ENSP00000366315:p.Lys421Arg		A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.K448R	ENST00000377111.2	37	c.1343		9	.	.	.	.	.	.	.	.	.	.	T	15.56	2.868561	0.51588	.	.	ENSG00000083067	ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814;ENST00000377101	T;T;T;T;T;T;T;T;T;T;T;T	0.55588	1.54;1.74;0.51;0.51;1.74;1.74;1.74;1.74;0.51;0.51;0.55;1.54	6.17	6.17	0.99709	.	0.049170	0.85682	D	0.000000	T	0.56062	0.1960	N	0.17082	0.46	0.49130	D	0.999758	B;B;B;B;D;B;B;D;B;B	0.67145	0.212;0.003;0.004;0.009;0.996;0.048;0.004;0.996;0.028;0.006	B;B;B;B;D;B;B;D;B;B	0.76071	0.04;0.02;0.01;0.013;0.987;0.028;0.003;0.987;0.079;0.017	T	0.51764	-0.8664	10	0.13470	T	0.59	-30.221	16.8222	0.85835	0.0:0.0:0.0:1.0	.	446;268;421;421;421;423;293;268;421;268	Q9HCF6;Q504Y1;Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	TRPM3_HUMAN;.;.;.;.;.;.;.;.;.	R	421;421;293;293;268;423;268;268;293;293;448;268	ENSP00000366315:K421R;ENSP00000366314:K421R;ENSP00000366310:K293R;ENSP00000354066:K293R;ENSP00000366309:K268R;ENSP00000350140:K423R;ENSP00000386127:K268R;ENSP00000379581:K268R;ENSP00000379587:K293R;ENSP00000350791:K293R;ENSP00000389542:K448R;ENSP00000366305:K268R	ENSP00000350140:K423R	K	-	2	0	TRPM3	72566347	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.698000	0.84413	2.371000	0.80710	0.533000	0.62120	AAG	TRPM3	-	NULL	ENSG00000083067		0.433	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	TRPM3	HGNC	protein_coding	OTTHUMT00000214157.5	-	0.00	40	0	T	NM_206945		73376527	-1	tier1	-	no_errors	ENST00000423814	ensembl	human	known	74_37	missense	38.30	28	18	SNP	1.000	C
TRRAP	8295	genome.wustl.edu	37	7	98591352	98591352	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:98591352C>T	ENST00000359863.4	+	65	10206	c.9997C>T	c.(9997-9999)Cat>Tat	p.H3333Y	TRRAP_ENST00000446306.3_Missense_Mutation_p.H3322Y|TRRAP_ENST00000355540.3_Missense_Mutation_p.H3304Y	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3333					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			AGAAAATTGGCATGAAGAGGT	0.522																																																	0													202.0	179.0	187.0					7																	98591352		2203	4300	6503	SO:0001583	missense	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.9997C>T	7.37:g.98591352C>T	ENSP00000352925:p.His3333Tyr		A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.H3333Y	ENST00000359863.4	37	c.9997	CCDS59066.1	7	.	.	.	.	.	.	.	.	.	.	C	9.774	1.173420	0.21704	.	.	ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306	T;T	0.02737	4.19;4.18	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.01124	0.0037	N	0.00399	-1.545	0.80722	D	1	B;B;B	0.16802	0.019;0.003;0.007	B;B;B	0.15870	0.014;0.002;0.004	T	0.51545	-0.8692	10	0.02654	T	1	.	19.5819	0.95471	0.0:1.0:0.0:0.0	.	3304;3061;3333	Q9Y4A5-2;Q59FH1;Q9Y4A5	.;.;TRRAP_HUMAN	Y	3333;3304;3321	ENSP00000352925:H3333Y;ENSP00000347733:H3304Y	ENSP00000347733:H3304Y	H	+	1	0	TRRAP	98429288	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.736000	0.84948	2.693000	0.91896	0.655000	0.94253	CAT	TRRAP	-	NULL	ENSG00000196367		0.522	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1		0.00	37	0	C	NM_003496		98591352	+1			no_errors	ENST00000359863	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
TTYH2	94015	genome.wustl.edu	37	17	72218722	72218722	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:72218722C>T	ENST00000269346.4	+	2	302	c.228C>T	c.(226-228)gaC>gaT	p.D76D	TTYH2_ENST00000529107.1_Silent_p.D55D	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	76						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						GCCGGCGGGACGATGCGGTGC	0.657																																																	0													94.0	76.0	82.0					17																	72218722		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.228C>T	17.37:g.72218722C>T			B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Silent	SNP	pfam_Tweety	p.D76	ENST00000269346.4	37	c.228	CCDS32717.1	17																																																																																			TTYH2	-	pfam_Tweety	ENSG00000141540		0.657	TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TTYH2	HGNC	protein_coding	OTTHUMT00000387459.1		0.00	35	0	C			72218722	+1			no_errors	ENST00000269346	ensembl	human	known	74_37	silent	5.48	69	4	SNP	0.000	T
TWIST1	7291	genome.wustl.edu	37	7	19156473	19156473	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:19156473A>C	ENST00000242261.5	-	1	822	c.472T>G	c.(472-474)Ttc>Gtc	p.F158V	AC003986.6_ENST00000419944.1_RNA	NM_000474.3	NP_000465.1	Q15672	TWST1_HUMAN	twist family bHLH transcription factor 1	158	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				aortic valve morphogenesis (GO:0003180)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cell proliferation involved in heart valve development (GO:2000793)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cranial suture morphogenesis (GO:0060363)|embryonic camera-type eye formation (GO:0060900)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cushion morphogenesis (GO:0003203)|eyelid development in camera-type eye (GO:0061029)|in utero embryonic development (GO:0001701)|mitral valve morphogenesis (GO:0003183)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone phosphorylation (GO:0033128)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of oxidative phosphorylation uncoupler activity (GO:2000276)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|outer ear morphogenesis (GO:0042473)|palate development (GO:0060021)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell motility (GO:2000147)|positive regulation of endocardial cushion to mesenchymal transition involved in heart valve formation (GO:2000802)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of bone mineralization (GO:0030500)|rhythmic process (GO:0048511)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription factor binding (GO:0008134)			lung(2)|upper_aerodigestive_tract(1)	3						TGGTAGAGGAAGTCGATGTAC	0.617																																																	0			GRCh37	CM013612	TWIST1	M							114.0	92.0	99.0					7																	19156473		2203	4300	6503	SO:0001583	missense	0			U80998	CCDS5367.1	7p21	2014-02-07	2013-10-17	2003-03-28	ENSG00000122691	ENSG00000122691		"""Basic helix-loop-helix proteins"""	12428	protein-coding gene	gene with protein product	"""Saethre-Chotzen syndrome"""	601622	"""blepharophimosis, epicanthus inversus and ptosis 3"", ""acrocephalosyndactyly 3"", ""twist homolog 1 (Drosophila)"", ""twist basic helix-loop-helix transcription factor 1"", ""craniosynostosis"""	ACS3, BPES3, TWIST, CRS		8995765, 11474656, 17343269	Standard	XR_428085		Approved	SCS, H-twist, BPES2, bHLHa38, CRS1	uc003sum.3	Q15672	OTTHUMG00000090821	ENST00000242261.5:c.472T>G	7.37:g.19156473A>C	ENSP00000242261:p.Phe158Val		A4D128|Q92487|Q99804	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.F158V	ENST00000242261.5	37	c.472	CCDS5367.1	7	.	.	.	.	.	.	.	.	.	.	a	18.23	3.577736	0.65878	.	.	ENSG00000122691	ENST00000242261	D	0.97888	-4.59	4.77	3.59	0.41128	Helix-loop-helix DNA-binding (5);	0.000000	0.50627	D	0.000105	D	0.98058	0.9360	M	0.65677	2.01	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97625	1.0138	10	0.62326	D	0.03	-10.7718	10.3203	0.43762	0.852:0.0:0.0:0.148	.	158	Q15672	TWST1_HUMAN	V	158	ENSP00000242261:F158V	ENSP00000242261:F158V	F	-	1	0	TWIST1	19122998	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.180000	0.94867	0.641000	0.30601	0.374000	0.22700	TTC	TWIST1	-	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	ENSG00000122691		0.617	TWIST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TWIST1	HGNC	protein_coding	OTTHUMT00000207625.1	-	0.00	40	0	A	NM_000474		19156473	-1	tier1	-	no_errors	ENST00000242261	ensembl	human	known	74_37	missense	15.91	37	7	SNP	1.000	C
UBR4	23352	genome.wustl.edu	37	1	19528214	19528214	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr1:19528214A>G	ENST00000375254.3	-	2	299	c.272T>C	c.(271-273)cTc>cCc	p.L91P	UBR4_ENST00000375226.2_Missense_Mutation_p.L91P|UBR4_ENST00000375267.2_Missense_Mutation_p.L91P|UBR4_ENST00000375217.2_Missense_Mutation_p.L91P	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	91					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		ATACTTACTGAGACTGCAAAC	0.408																																																	0													162.0	140.0	148.0					1																	19528214		2203	4300	6503	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.272T>C	1.37:g.19528214A>G	ENSP00000364403:p.Leu91Pro		A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.L91P	ENST00000375254.3	37	c.272	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	A	13.52	2.260368	0.39995	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.23147	1.93;1.93;1.92;1.92	5.65	4.5	0.54988	.	0.142941	0.50627	D	0.000104	T	0.12475	0.0303	N	0.08118	0	0.80722	D	1	B	0.22604	0.072	B	0.19666	0.026	T	0.08493	-1.0719	10	0.42905	T	0.14	.	7.3472	0.26670	0.7062:0.1501:0.0:0.1436	.	91	Q5T4S7	UBR4_HUMAN	P	91	ENSP00000364403:L91P;ENSP00000364416:L91P;ENSP00000364365:L91P;ENSP00000364374:L91P	ENSP00000364365:L91P	L	-	2	0	UBR4	19400801	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.575000	0.67430	1.042000	0.40150	0.533000	0.62120	CTC	UBR4	-	NULL	ENSG00000127481		0.408	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	-	0.00	30	0	A	NM_020765		19528214	-1	tier1	-	no_errors	ENST00000375267	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	G
UBXN4	23190	genome.wustl.edu	37	2	136519420	136519420	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:136519420C>T	ENST00000272638.9	+	6	852	c.541C>T	c.(541-543)Cag>Tag	p.Q181*	UBXN4_ENST00000490163.1_Intron	NM_014607.3	NP_055422.1	Q92575	UBXN4_HUMAN	UBX domain protein 4	181					response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	24						CACTTCCTCTCAGGAGCCTAG	0.368																																																	0													58.0	61.0	60.0					2																	136519420		1847	4085	5932	SO:0001587	stop_gained	0			D87684	CCDS42761.1	2q21.3-q22.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000144224	ENSG00000144224		"""UBX domain containing"""	14860	protein-coding gene	gene with protein product	"""erasin"""	611216	"""UBX domain-containing 2"", ""UBX domain containing 2"""	UBXDC1, UBXD2		16968747	Standard	NM_014607		Approved	KIAA0242	uc002tur.3	Q92575	OTTHUMG00000153577	ENST00000272638.9:c.541C>T	2.37:g.136519420C>T	ENSP00000272638:p.Gln181*		A8K9W4|Q4ZG56|Q8IYM5	Nonsense_Mutation	SNP	pfam_UBX,superfamily_Thioredoxin-like_fold,smart_UBX,pfscan_UBX	p.Q181*	ENST00000272638.9	37	c.541	CCDS42761.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.707827	0.96821	.	.	ENSG00000144224	ENST00000272638;ENST00000430594	.	.	.	5.02	5.02	0.67125	.	0.619068	0.16876	N	0.195939	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	.	14.2258	0.65858	0.0:1.0:0.0:0.0	.	.	.	.	X	181;163	.	ENSP00000272638:Q181X	Q	+	1	0	UBXN4	136235890	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.895000	0.56258	2.485000	0.83878	0.655000	0.94253	CAG	UBXN4	-	NULL	ENSG00000144224		0.368	UBXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN4	HGNC	protein_coding	OTTHUMT00000331696.1	-	0.00	51	0	C	NM_014607		136519420	+1	tier1	-	no_errors	ENST00000272638	ensembl	human	known	74_37	nonsense	6.49	72	5	SNP	1.000	T
UGT3A2	167127	genome.wustl.edu	37	5	36038104	36038104	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr5:36038104G>T	ENST00000282507.3	-	6	1191	c.1090C>A	c.(1090-1092)Cgt>Agt	p.R364S	UGT3A2_ENST00000504954.1_5'Flank|UGT3A2_ENST00000545528.1_Missense_Mutation_p.R62S|UGT3A2_ENST00000513300.1_Missense_Mutation_p.R330S	NM_174914.3	NP_777574.2	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	364					cellular response to genistein (GO:0071412)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	43	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACAAACAGACGGATGCTTGGG	0.498																																																	0													63.0	66.0	65.0					5																	36038104		2203	4300	6503	SO:0001583	missense	0				CCDS3914.1, CCDS54842.1	5p13.2	2014-05-20			ENSG00000168671	ENSG00000168671		"""UDP glucuronosyltransferases"""	27266	protein-coding gene	gene with protein product						12975309	Standard	NM_174914		Approved		uc003jjz.2	Q3SY77	OTTHUMG00000131108	ENST00000282507.3:c.1090C>A	5.37:g.36038104G>T	ENSP00000282507:p.Arg364Ser		B4DUQ7|E9PFK7|Q6UXC4|Q8NBP2	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.R364S	ENST00000282507.3	37	c.1090	CCDS3914.1	5	.	.	.	.	.	.	.	.	.	.	G	9.918	1.211456	0.22289	.	.	ENSG00000168671	ENST00000282507;ENST00000513300;ENST00000545528	T;T;T	0.61510	0.1;0.1;3.3	3.32	1.49	0.22878	.	0.088372	0.42682	U	0.000677	T	0.74951	0.3784	M	0.92507	3.315	0.09310	N	1	D;D	0.61080	0.989;0.988	P;P	0.62014	0.897;0.831	T	0.65717	-0.6100	10	0.72032	D	0.01	.	7.7016	0.28625	0.0989:0.1667:0.7345:0.0	.	330;364	E9PFK7;Q3SY77	.;UD3A2_HUMAN	S	364;330;62	ENSP00000282507:R364S;ENSP00000427404:R330S;ENSP00000445367:R62S	ENSP00000282507:R364S	R	-	1	0	UGT3A2	36073861	0.000000	0.05858	0.053000	0.19242	0.122000	0.20287	0.264000	0.18497	0.399000	0.25367	-0.251000	0.11542	CGT	UGT3A2	-	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	ENSG00000168671		0.498	UGT3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT3A2	HGNC	protein_coding	OTTHUMT00000253771.2	-	0.00	33	0	G	NM_174914		36038104	-1	tier1	-	no_errors	ENST00000282507	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.005	T
UNC50	25972	genome.wustl.edu	37	2	99226273	99226273	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:99226273G>C	ENST00000357765.2	+	2	203	c.51G>C	c.(49-51)ttG>ttC	p.L17F	COA5_ENST00000409997.1_5'Flank|COA5_ENST00000328709.3_5'Flank|UNC50_ENST00000409975.1_Missense_Mutation_p.L34F|UNC50_ENST00000409347.1_Missense_Mutation_p.L34F|COA5_ENST00000483527.1_5'Flank	NM_014044.5	NP_054763.2	Q53HI1	UNC50_HUMAN	unc-50 homolog (C. elegans)	17					cell surface receptor signaling pathway (GO:0007166)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)	RNA binding (GO:0003723)			breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(1)	10						ACGGAGTCTTGAATTCCAGGG	0.443																																																	0													196.0	200.0	199.0					2																	99226273		2203	4300	6503	SO:0001583	missense	0				CCDS2035.1	2q12.2	2008-02-05			ENSG00000115446	ENSG00000115446			16046	protein-coding gene	gene with protein product						10980252	Standard	NM_014044		Approved	URP, UNCL, GMH1	uc002szc.4	Q53HI1	OTTHUMG00000130562	ENST00000357765.2:c.51G>C	2.37:g.99226273G>C	ENSP00000350409:p.Leu17Phe		D3DVH4|Q53S98|Q53TD6|Q5U5U2|Q6X7B9|Q9UQF4|Q9Y4S6	Missense_Mutation	SNP	pfam_UNC-50	p.L34F	ENST00000357765.2	37	c.102	CCDS2035.1	2	.	.	.	.	.	.	.	.	.	.	G	9.977	1.227178	0.22542	.	.	ENSG00000115446	ENST00000357765;ENST00000409975;ENST00000409347	.	.	.	5.36	1.3	0.21679	.	0.070023	0.56097	D	0.000030	T	0.33265	0.0857	L	0.59436	1.845	0.32430	N	0.548222	B	0.26744	0.158	B	0.17098	0.017	T	0.29518	-1.0009	9	0.12430	T	0.62	-3.8065	5.1335	0.14922	0.3207:0.2374:0.442:0.0	.	17	Q53HI1	UNC50_HUMAN	F	17;34;34	.	ENSP00000350409:L17F	L	+	3	2	UNC50	98592705	0.999000	0.42202	0.086000	0.20670	0.337000	0.28794	0.691000	0.25467	0.243000	0.21327	-0.216000	0.12614	TTG	UNC50	-	NULL	ENSG00000115446		0.443	UNC50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC50	HGNC	protein_coding	OTTHUMT00000252987.1	-	0.00	35	0	G	NM_014044		99226273	+1	tier1	-	no_errors	ENST00000409347	ensembl	human	known	74_37	missense	19.61	41	10	SNP	0.401	C
UNC5D	137970	genome.wustl.edu	37	8	35608143	35608143	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:35608143T>A	ENST00000404895.2	+	13	2307	c.1979T>A	c.(1978-1980)cTt>cAt	p.L660H	UNC5D_ENST00000449677.1_Missense_Mutation_p.L236H|UNC5D_ENST00000420357.1_Missense_Mutation_p.L593H|UNC5D_ENST00000287272.2_Missense_Mutation_p.L591H|UNC5D_ENST00000416672.1_Missense_Mutation_p.L665H|UNC5D_ENST00000453357.2_Missense_Mutation_p.L655H	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	660					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TGTTACTGCCTTTTGGACCCC	0.468																																																	0													242.0	202.0	216.0					8																	35608143		2203	4300	6503	SO:0001583	missense	0			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.1979T>A	8.37:g.35608143T>A	ENSP00000385143:p.Leu660His		Q8WYP7	Missense_Mutation	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death_domain,pfam_Immunoglobulin,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.L660H	ENST00000404895.2	37	c.1979	CCDS6093.2	8	.	.	.	.	.	.	.	.	.	.	T	25.0	4.596042	0.86953	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	T;T;T;T;T;T	0.56103	0.52;0.96;0.95;0.52;0.48;2.42	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.67268	0.2875	L	0.46157	1.445	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	T	0.67711	-0.5600	10	0.52906	T	0.07	-16.0861	16.3317	0.83023	0.0:0.0:0.0:1.0	.	236;655;660	E9PDS8;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	H	660;593;591;665;655;236	ENSP00000385143:L660H;ENSP00000392739:L593H;ENSP00000287272:L591H;ENSP00000412652:L665H;ENSP00000394303:L655H;ENSP00000397211:L236H	ENSP00000287272:L591H	L	+	2	0	UNC5D	35727685	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	7.698000	0.84413	2.264000	0.75181	0.533000	0.62120	CTT	UNC5D	-	NULL	ENSG00000156687		0.468	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2	-	0.00	79	0	T			35608143	+1	tier1	-	no_errors	ENST00000404895	ensembl	human	known	74_37	missense	11.36	78	10	SNP	0.999	A
URGCP	55665	genome.wustl.edu	37	7	43917890	43917890	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:43917890C>T	ENST00000453200.1	-	6	1665	c.1172G>A	c.(1171-1173)cGt>cAt	p.R391H	URGCP_ENST00000223341.7_Missense_Mutation_p.R348H|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000402306.3_Missense_Mutation_p.R382H|URGCP_ENST00000447717.3_Missense_Mutation_p.R348H|URGCP_ENST00000336086.6_Missense_Mutation_p.R348H|URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Missense_Mutation_p.R348H			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	391					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GCGCTTCCCACGGTAGGGACT	0.418																																																	0													128.0	123.0	124.0					7																	43917890		1962	4152	6114	SO:0001583	missense	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.1172G>A	7.37:g.43917890C>T	ENSP00000396918:p.Arg391His		E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	superfamily_P-loop_NTPase,prints_GTP_binding_domain	p.R391H	ENST00000453200.1	37	c.1172	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	C	17.11	3.306438	0.60305	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.10192	2.91;2.91;2.9;2.91;2.9;2.91	5.48	5.48	0.80851	.	0.395644	0.27306	N	0.019975	T	0.26085	0.0636	L	0.57536	1.79	0.32449	N	0.545616	D;D	0.71674	0.998;0.998	P;P	0.58873	0.847;0.847	T	0.06716	-1.0811	10	0.42905	T	0.14	-19.9148	16.8266	0.85933	0.0:1.0:0.0:0.0	.	382;391	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	H	348;348;382;348;391;348	ENSP00000223341:R348H;ENSP00000336872:R348H;ENSP00000384955:R382H;ENSP00000392136:R348H;ENSP00000396918:R391H;ENSP00000402803:R348H	ENSP00000223341:R348H	R	-	2	0	URGCP	43884415	0.206000	0.23470	0.992000	0.48379	0.983000	0.72400	0.818000	0.27295	2.571000	0.86741	0.591000	0.81541	CGT	URGCP	-	NULL	ENSG00000106608		0.418	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1		0.00	37	0	C	NM_001077664		43917890	-1			no_errors	ENST00000453200	ensembl	human	known	74_37	missense	8.20	55	5	SNP	0.969	T
USP20	10868	genome.wustl.edu	37	9	132632775	132632775	+	Missense_Mutation	SNP	G	G	T	rs370182930		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:132632775G>T	ENST00000315480.4	+	15	1767	c.1609G>T	c.(1609-1611)Gtc>Ttc	p.V537F	USP20_ENST00000372429.3_Missense_Mutation_p.V537F|USP20_ENST00000358355.1_Missense_Mutation_p.V537F			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	537	USP.				endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				GGGGCCTGTCGTCACCCTGGA	0.607																																																	0													103.0	105.0	104.0					9																	132632775		2000	4168	6168	SO:0001583	missense	0			AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.1609G>T	9.37:g.132632775G>T	ENSP00000313811:p.Val537Phe		Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Pept_C19_DUSP,pfam_Znf_UBP,smart_Znf_UBP,smart_Pept_C19_DUSP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.V537F	ENST00000315480.4	37	c.1609	CCDS43892.1	9	.	.	.	.	.	.	.	.	.	.	G	20.2	3.945307	0.73672	.	.	ENSG00000136878	ENST00000372429;ENST00000315480;ENST00000358355	T;T;T	0.03212	4.01;4.01;4.01	5.36	3.54	0.40534	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.112207	0.64402	D	0.000010	T	0.10465	0.0256	M	0.70903	2.155	0.80722	D	1	P	0.43788	0.817	P	0.52267	0.694	T	0.00701	-1.1603	10	0.87932	D	0	.	8.8847	0.35396	0.2285:0.0:0.7715:0.0	.	537	Q9Y2K6	UBP20_HUMAN	F	537	ENSP00000361506:V537F;ENSP00000313811:V537F;ENSP00000351122:V537F	ENSP00000313811:V537F	V	+	1	0	USP20	131672596	1.000000	0.71417	0.830000	0.32933	0.940000	0.58332	5.455000	0.66658	0.755000	0.32990	-0.137000	0.14449	GTC	USP20	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000136878		0.607	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	USP20	HGNC	protein_coding	OTTHUMT00000054604.2	-	0.00	59	0	G			132632775	+1	tier1	-	no_errors	ENST00000315480	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.998	T
USP36	57602	genome.wustl.edu	37	17	76810529	76810529	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr17:76810529T>C	ENST00000542802.3	-	11	1572	c.1129A>G	c.(1129-1131)Agc>Ggc	p.S377G	USP36_ENST00000588467.1_5'UTR|USP36_ENST00000449938.2_Missense_Mutation_p.S77G|USP36_ENST00000312010.6_Missense_Mutation_p.S377G			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	377	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			GCATGGCAGCTGTAGCCCGAG	0.527																																																	0													92.0	68.0	76.0					17																	76810529		2203	4300	6503	SO:0001583	missense	0			AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.1129A>G	17.37:g.76810529T>C	ENSP00000441214:p.Ser377Gly		Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.S377G	ENST00000542802.3	37	c.1129	CCDS32755.1	17	.	.	.	.	.	.	.	.	.	.	T	23.4	4.411169	0.83340	.	.	ENSG00000055483	ENST00000312010;ENST00000449938;ENST00000542802;ENST00000432878	T;T;T	0.06687	3.27;3.27;3.27	5.16	5.16	0.70880	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.077885	0.85682	D	0.000000	T	0.24509	0.0594	L	0.53561	1.675	0.58432	D	0.999996	D;D	0.76494	0.999;0.999	D;D	0.76071	0.987;0.978	T	0.00565	-1.1668	10	0.87932	D	0	-32.9359	14.672	0.68951	0.0:0.0:0.0:1.0	.	377;377	Q9P275;Q9P275-2	UBP36_HUMAN;.	G	377;77;377;377	ENSP00000310590:S377G;ENSP00000401119:S77G;ENSP00000441214:S377G	ENSP00000310590:S377G	S	-	1	0	USP36	74322124	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.123000	0.57917	1.936000	0.56123	0.533000	0.62120	AGC	USP36	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000055483		0.527	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	USP36	HGNC	protein_coding	OTTHUMT00000437472.3		0.00	25	0	T	NM_025090		76810529	-1			no_errors	ENST00000312010	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	C
VCPIP1	80124	genome.wustl.edu	37	8	67576954	67576954	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:67576954G>T	ENST00000310421.4	-	1	2498	c.2240C>A	c.(2239-2241)tCt>tAt	p.S747Y	C8orf44_ENST00000521889.1_5'Flank|C8orf44_ENST00000519561.1_5'Flank|C8orf44-SGK3_ENST00000519289.1_5'Flank	NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	747					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			GGTACTGGGAGAAACAGTCCT	0.443																																					NSCLC(179;265 2915 6144 43644)												0													191.0	186.0	188.0					8																	67576954		2203	4300	6503	SO:0001583	missense	0			AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.2240C>A	8.37:g.67576954G>T	ENSP00000309031:p.Ser747Tyr		Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.S747Y	ENST00000310421.4	37	c.2240	CCDS6192.1	8	.	.	.	.	.	.	.	.	.	.	G	19.38	3.817443	0.70912	.	.	ENSG00000175073	ENST00000310421	T	0.36699	1.24	5.67	5.67	0.87782	.	0.170611	0.53938	D	0.000051	T	0.48132	0.1483	L	0.44542	1.39	0.58432	D	0.999999	D	0.61080	0.989	P	0.53912	0.737	T	0.46133	-0.9213	10	0.87932	D	0	-12.1122	19.7688	0.96353	0.0:0.0:1.0:0.0	.	747	Q96JH7	VCIP1_HUMAN	Y	747	ENSP00000309031:S747Y	ENSP00000309031:S747Y	S	-	2	0	VCPIP1	67739508	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.135000	0.77276	2.648000	0.89879	0.655000	0.94253	TCT	VCPIP1	-	NULL	ENSG00000175073		0.443	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCPIP1	HGNC	protein_coding	OTTHUMT00000379227.1	-	0.00	34	0	G			67576954	-1	tier1	-	no_errors	ENST00000310421	ensembl	human	known	74_37	missense	31.58	13	6	SNP	1.000	T
VIPAS39	63894	genome.wustl.edu	37	14	77908903	77908903	+	Splice_Site	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr14:77908903C>T	ENST00000553888.1	-	10	1244	c.734G>A	c.(733-735)aGg>aAg	p.R245K	VIPAS39_ENST00000556412.1_Splice_Site_p.R271K|VIPAS39_ENST00000327028.4_Splice_Site_p.R232K|VIPAS39_ENST00000557658.1_Splice_Site_p.R245K|VIPAS39_ENST00000448935.2_Splice_Site_p.R196K|VIPAS39_ENST00000343765.2_Splice_Site_p.R245K	NM_001193314.1|NM_001193317.1|NM_022067.3	NP_001180243.1|NP_001180246.1|NP_071350.2	Q9H9C1	SPE39_HUMAN	VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog	245					cell differentiation (GO:0030154)|endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|late endosome (GO:0005770)|recycling endosome (GO:0055037)											CAGTTCTTACCTGAAGAGGTC	0.433																																																	0													157.0	159.0	159.0					14																	77908903		2203	4300	6503	SO:0001630	splice_region_variant	0			AK022925	CCDS9862.1, CCDS53905.1	14q24.3-q31	2013-08-14	2012-07-24	2012-07-24	ENSG00000151445	ENSG00000151445			20347	protein-coding gene	gene with protein product	"""VPS33B interacting protein, apical-basolateral polarity regulator"""	613401	"""chromosome 14 open reading frame 133"""	C14orf133		20190753, 19109425, 22753090, 23002115, 23918659	Standard	NM_022067		Approved	VIPAR, VPS16B, SPE-39, SPE39, hSPE-39	uc001xtu.2	Q9H9C1		ENST00000553888.1:c.734+1G>A	14.37:g.77908903C>T			B4DPI6|O95434|Q9H7E1|Q9H9I9	Missense_Mutation	SNP	pfam_Golgin_subfamily_A_member_5	p.R245K	ENST00000553888.1	37	c.734	CCDS9862.1	14	.	.	.	.	.	.	.	.	.	.	C	10.32	1.316877	0.23908	.	.	ENSG00000151445	ENST00000343765;ENST00000553888;ENST00000327028;ENST00000557658;ENST00000448935;ENST00000556412	T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77	4.7	4.7	0.59300	.	0.091283	0.85682	D	0.000000	T	0.33381	0.0861	N	0.19112	0.55	0.51233	D	0.999913	B;B	0.26809	0.023;0.16	B;B	0.23150	0.018;0.044	T	0.10428	-1.0630	9	.	.	.	-16.2442	17.2495	0.87038	0.0:1.0:0.0:0.0	.	196;245	B4DPI6;Q9H9C1	.;VIPAR_HUMAN	K	245;245;232;245;196;271	ENSP00000339122:R245K;ENSP00000452181:R245K;ENSP00000313098:R232K;ENSP00000452191:R245K;ENSP00000404815:R196K;ENSP00000451857:R271K	.	R	-	2	0	VIPAR	76978656	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	3.277000	0.51654	2.146000	0.66826	0.655000	0.94253	AGG	VIPAS39	-	pfam_Golgin_subfamily_A_member_5	ENSG00000151445		0.433	VIPAS39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIPAS39	HGNC	protein_coding	OTTHUMT00000414008.1	-	0.00	36	0	C	NM_022067	Missense_Mutation	77908903	-1	tier1	-	no_errors	ENST00000343765	ensembl	human	known	74_37	missense	34.29	23	12	SNP	1.000	T
VSIG10L	147645	genome.wustl.edu	37	19	51837087	51837087	+	Silent	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:51837087G>C	ENST00000335624.4	-	9	2531	c.2532C>G	c.(2530-2532)ctC>ctG	p.L844L		NM_001163922.1	NP_001157394.1	Q86VR7	VS10L_HUMAN	V-set and immunoglobulin domain containing 10 like	844						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)	4						GAGGGACTTTGAGGTCCAGAG	0.527																																																	0													47.0	48.0	47.0					19																	51837087		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS54300.1	19q13.41	2013-01-11				ENSG00000186806		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27111	protein-coding gene	gene with protein product						12477932	Standard	NM_001163922		Approved		uc002pwf.3	Q86VR7		ENST00000335624.4:c.2532C>G	19.37:g.51837087G>C				Silent	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L844	ENST00000335624.4	37	c.2532	CCDS54300.1	19																																																																																			VSIG10L	-	NULL	ENSG00000186806		0.527	VSIG10L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VSIG10L	HGNC	protein_coding	OTTHUMT00000464535.1	-	0.00	31	0	G	NM_001163922		51837087	-1	tier1	-	no_errors	ENST00000335624	ensembl	human	novel	74_37	silent	32.76	38	19	SNP	0.050	C
VSTM2A	222008	genome.wustl.edu	37	7	54617710	54617710	+	Missense_Mutation	SNP	G	G	A	rs548506452		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:54617710G>A	ENST00000407838.3	+	4	887	c.481G>A	c.(481-483)Gaa>Aaa	p.E161K	VSTM2A_ENST00000404951.1_Missense_Mutation_p.E161K|VSTM2A_ENST00000302287.3_Missense_Mutation_p.E161K|VSTM2A_ENST00000402026.2_Missense_Mutation_p.E160K|VSTM2A_ENST00000498834.1_3'UTR|VSTM2A_ENST00000402613.3_Missense_Mutation_p.E161K	NM_182546.2	NP_872352.2	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2A	161						extracellular region (GO:0005576)		p.E160K(1)		endometrium(1)|large_intestine(2)|lung(12)|prostate(1)	16			STAD - Stomach adenocarcinoma(5;0.0525)			GCAGGCCTTCGAAGCCTCGCC	0.592													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16996	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	ovary(1)											62.0	56.0	58.0					7																	54617710		2203	4299	6502	SO:0001583	missense	0			BC028404	CCDS5512.2, CCDS75604.1	7p11.2	2013-01-11	2007-08-10	2007-08-10	ENSG00000170419	ENSG00000170419		"""Immunoglobulin superfamily / V-set domain containing"""	28499	protein-coding gene	gene with protein product			"""V-set and transmembrane domain containing 2"""	VSTM2		12477932	Standard	XM_006715663		Approved	MGC33530	uc010kzf.3	Q8TAG5	OTTHUMG00000129271	ENST00000407838.3:c.481G>A	7.37:g.54617710G>A	ENSP00000384967:p.Glu161Lys		A4D2E9|B5MC94	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.E160K	ENST00000407838.3	37	c.478	CCDS5512.2	7	.	.	.	.	.	.	.	.	.	.	G	17.94	3.511284	0.64522	.	.	ENSG00000170419	ENST00000302287;ENST00000407838;ENST00000404951;ENST00000402026;ENST00000402613	T;T;T;T;T	0.54071	0.61;0.62;0.6;0.61;0.59	5.06	5.06	0.68205	.	0.049488	0.85682	D	0.000000	T	0.66268	0.2772	L	0.46157	1.445	0.36811	D	0.885866	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.986;0.994;0.981	T	0.70905	-0.4745	10	0.49607	T	0.09	-28.802	16.2779	0.82654	0.0:0.0:1.0:0.0	.	161;161;161	Q8TAG5;Q8TAG5-2;B5MCX6	VTM2A_HUMAN;.;.	K	161;161;161;160;161	ENSP00000303108:E161K;ENSP00000384967:E161K;ENSP00000384701:E161K;ENSP00000385933:E160K;ENSP00000384103:E161K	ENSP00000303108:E161K	E	+	1	0	VSTM2A	54585204	1.000000	0.71417	0.995000	0.50966	0.768000	0.43524	6.097000	0.71452	2.501000	0.84356	0.655000	0.94253	GAA	VSTM2A	-	NULL	ENSG00000170419		0.592	VSTM2A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VSTM2A	HGNC	protein_coding	OTTHUMT00000318694.1		0.00	47	0	G	NM_182546		54617710	+1			no_errors	ENST00000402026	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	A
VWCE	220001	genome.wustl.edu	37	11	61048557	61048557	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:61048557A>G	ENST00000335613.5	-	8	1324	c.938T>C	c.(937-939)gTc>gCc	p.V313A		NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	313						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						GGTGGTCCTGACTCCGGCTGG	0.682																																																	0													30.0	34.0	33.0					11																	61048557		2202	4298	6500	SO:0001583	missense	0			AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.938T>C	11.37:g.61048557A>G	ENSP00000334186:p.Val313Ala		A5PKV0|Q7Z7L6|Q86WK8	Missense_Mutation	SNP	pfam_VWF_C,pfam_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_VWF_C,smart_VWC_out,pfscan_EG-like_dom,pfscan_VWF_C	p.V313A	ENST00000335613.5	37	c.938	CCDS8002.1	11	.	.	.	.	.	.	.	.	.	.	A	11.66	1.703499	0.30232	.	.	ENSG00000167992	ENST00000335613	T	0.68765	-0.35	5.51	-0.597	0.11653	.	0.949995	0.08722	N	0.903391	T	0.51584	0.1683	L	0.43923	1.385	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.32025	-0.9922	10	0.20046	T	0.44	.	5.2032	0.15277	0.4497:0.1751:0.3753:0.0	.	313	Q96DN2	VWCE_HUMAN	A	313	ENSP00000334186:V313A	ENSP00000334186:V313A	V	-	2	0	VWCE	60805133	0.000000	0.05858	0.006000	0.13384	0.699000	0.40488	-0.019000	0.12546	0.086000	0.17137	0.459000	0.35465	GTC	VWCE	-	NULL	ENSG00000167992		0.682	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWCE	HGNC	protein_coding	OTTHUMT00000398811.1	-	0.00	67	0	A	NM_152718		61048557	-1	tier1	-	no_errors	ENST00000335613	ensembl	human	known	74_37	missense	23.75	61	19	SNP	0.000	G
VWDE	221806	genome.wustl.edu	37	7	12401077	12401077	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:12401077A>C	ENST00000275358.3	-	14	3157	c.2969T>G	c.(2968-2970)gTt>gGt	p.V990G		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	990						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						CTGACAATCAACAGCTCTGCT	0.418																																																	0													74.0	65.0	68.0					7																	12401077		692	1591	2283	SO:0001583	missense	0				CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.2969T>G	7.37:g.12401077A>C	ENSP00000275358:p.Val990Gly		B7ZM77|Q96SQ3	Missense_Mutation	SNP	pfam_VWF_type-D,superfamily_Cadherin-like,smart_VWF_type-D,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.V990G	ENST00000275358.3	37	c.2969	CCDS47544.1	7	.	.	.	.	.	.	.	.	.	.	A	14.31	2.496412	0.44352	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	D	0.87491	-2.26	3.95	3.95	0.45737	.	0.477603	0.20187	N	0.097390	D	0.89643	0.6774	M	0.72894	2.215	0.48571	D	0.999676	D	0.54047	0.964	P	0.52267	0.694	D	0.90525	0.4491	10	0.62326	D	0.03	.	13.2972	0.60305	1.0:0.0:0.0:0.0	.	990	Q8N2E2	VWDE_HUMAN	G	990;444	ENSP00000275358:V990G	ENSP00000275358:V990G	V	-	2	0	VWDE	12367602	0.367000	0.25023	0.992000	0.48379	0.196000	0.23810	5.335000	0.65929	1.784000	0.52394	0.533000	0.62120	GTT	VWDE	-	NULL	ENSG00000146530		0.418	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VWDE	HGNC	protein_coding	OTTHUMT00000325870.3	-	0.00	33	0	A	XM_371878		12401077	-1	tier1	-	no_errors	ENST00000452576	ensembl	human	known	74_37	missense	10.87	41	5	SNP	0.998	C
WDFY4	57705	genome.wustl.edu	37	10	49929343	49929343	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:49929343G>T	ENST00000325239.5	+	3	414	c.387G>T	c.(385-387)tgG>tgT	p.W129C	WDFY4_ENST00000413659.2_Missense_Mutation_p.W129C|WDFY4_ENST00000360890.2_Missense_Mutation_p.W129C	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	129						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						TGCTGTGGTGGAAGGGGGACG	0.582																																																	0													182.0	176.0	178.0					10																	49929343		692	1591	2283	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.387G>T	10.37:g.49929343G>T	ENSP00000320563:p.Trp129Cys		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W129C	ENST00000325239.5	37	c.387	CCDS44385.1	10	.	.	.	.	.	.	.	.	.	.	G	11.00	1.511498	0.27036	.	.	ENSG00000128815	ENST00000360890;ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659	T;T;T	0.55588	0.95;0.51;1.53	5.61	4.7	0.59300	.	.	.	.	.	T	0.66733	0.2819	M	0.67953	2.075	0.47037	D	0.999291	D;D	0.76494	0.998;0.999	P;P	0.61722	0.818;0.893	T	0.69525	-0.5122	9	0.56958	D	0.05	.	13.3469	0.60578	0.0:0.0:0.8422:0.1578	.	129;129	Q6ZS81;Q6ZS81-2	WDFY4_HUMAN;.	C	129;138;129;129;129	ENSP00000354141:W129C;ENSP00000320563:W129C;ENSP00000403789:W129C	ENSP00000320563:W129C	W	+	3	0	WDFY4	49599349	1.000000	0.71417	0.711000	0.30485	0.012000	0.07955	2.580000	0.46068	1.355000	0.45865	-0.182000	0.12963	TGG	WDFY4	-	NULL	ENSG00000128815		0.582	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding			0.00	41	0	G	XM_033379		49929343	+1			no_errors	ENST00000325239	ensembl	human	known	74_37	missense	5.45	52	3	SNP	0.976	T
WDFY4	57705	genome.wustl.edu	37	10	50025447	50025447	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr10:50025447C>T	ENST00000325239.5	+	31	5525	c.5498C>T	c.(5497-5499)gCc>gTc	p.A1833V	WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1833						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CCCCTGGGAGCCCAAAAGGTA	0.617																																																	0													24.0	30.0	28.0					10																	50025447		692	1591	2283	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.5498C>T	10.37:g.50025447C>T	ENSP00000320563:p.Ala1833Val		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A1833V	ENST00000325239.5	37	c.5498	CCDS44385.1	10	.	.	.	.	.	.	.	.	.	.	C	0.007	-2.012760	0.00422	.	.	ENSG00000128815	ENST00000426033;ENST00000325239	T	0.55588	0.51	5.24	-0.863	0.10669	.	0.981883	0.08311	N	0.965312	T	0.27134	0.0665	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.19910	-1.0291	9	.	.	.	.	6.2391	0.20780	0.0:0.4958:0.2509:0.2533	.	361;1833	F2Z372;Q6ZS81	.;WDFY4_HUMAN	V	1833	ENSP00000320563:A1833V	.	A	+	2	0	WDFY4	49695453	0.000000	0.05858	0.001000	0.08648	0.084000	0.17831	0.258000	0.18387	-0.047000	0.13423	-0.885000	0.02943	GCC	WDFY4	-	NULL	ENSG00000128815		0.617	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		-	0.00	51	0	C	XM_033379		50025447	+1	tier1	-	no_errors	ENST00000325239	ensembl	human	known	74_37	missense	8.33	66	6	SNP	0.000	T
WDR33	55339	genome.wustl.edu	37	2	128477673	128477673	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr2:128477673C>T	ENST00000322313.4	-	16	2084	c.1926G>A	c.(1924-1926)ctG>ctA	p.L642L		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	642	Collagen-like.				mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		CTCCCTGATGCAGTGGAGGAC	0.637																																																	0													52.0	53.0	53.0					2																	128477673		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.1926G>A	2.37:g.128477673C>T			Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Silent	SNP	pfam_WD40_repeat,pfam_Collagen,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L642	ENST00000322313.4	37	c.1926	CCDS2150.1	2																																																																																			WDR33	-	NULL	ENSG00000136709		0.637	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR33	HGNC	protein_coding	OTTHUMT00000331141.2	-	0.00	42	0	C	NM_018383		128477673	-1	tier1	-	no_errors	ENST00000322313	ensembl	human	known	74_37	silent	8.00	46	4	SNP	1.000	T
WDR48	57599	genome.wustl.edu	37	3	39136632	39136632	+	3'UTR	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:39136632G>A	ENST00000302313.5	+	0	2460				WDR48_ENST00000396258.3_3'UTR|WDR48_ENST00000466405.1_3'UTR|WDR48_ENST00000544962.1_3'UTR	NM_020839.2	NP_065890.1	Q8TAF3	WDR48_HUMAN	WD repeat domain 48						double-strand break repair via homologous recombination (GO:0000724)|embryonic organ development (GO:0048568)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|positive regulation of epithelial cell proliferation (GO:0050679)|protein deubiquitination (GO:0016579)|regulation of protein monoubiquitination (GO:1902525)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CACACACTCTGTAGCTTTTCT	0.378																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF468833	CCDS33738.1	3p21.33	2014-06-16			ENSG00000114742	ENSG00000114742		"""WD repeat domain containing"""	30914	protein-coding gene	gene with protein product		612167				10819331, 12196293, 24482476	Standard	NM_020839		Approved	KIAA1449, P80, SPG60	uc003cit.3	Q8TAF3	OTTHUMG00000155972	ENST00000302313.5:c.*398G>A	3.37:g.39136632G>A			B4DM86|B4DQI2|B4DY84|Q63HJ2|Q658Y1|Q8N3Z1|Q9NSK8|Q9P279	RNA	SNP	-	NULL	ENST00000302313.5	37	NULL	CCDS33738.1	3																																																																																			WDR48	-	-	ENSG00000114742		0.378	WDR48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR48	HGNC	protein_coding	OTTHUMT00000342529.1	-	0.00	47	0	G	NM_020839		39136632	+1	tier1	-	no_errors	ENST00000466405	ensembl	human	known	74_37	rna	5.48	69	4	SNP	0.018	A
WDR5B	54554	genome.wustl.edu	37	3	122133874	122133874	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:122133874C>T	ENST00000330689.4	-	1	1008	c.502G>A	c.(502-504)Gac>Aac	p.D168N	RP11-299J3.8_ENST00000608465.1_RNA|RP11-299J3.8_ENST00000608346.1_RNA|RP11-299J3.8_ENST00000608015.1_RNA|RP11-299J3.8_ENST00000608756.1_RNA|RP11-299J3.8_ENST00000609469.1_RNA	NM_019069.3	NP_061942.2	Q86VZ2	WDR5B_HUMAN	WD repeat domain 5B	168										kidney(2)|large_intestine(4)|lung(2)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.0704)		GAAACTGGGTCAGAATGAGCA	0.438																																																	0													78.0	74.0	76.0					3																	122133874		2203	4300	6503	SO:0001583	missense	0			AK002149	CCDS3012.1	3q21.1	2013-01-09			ENSG00000196981	ENSG00000196981		"""WD repeat domain containing"""	17826	protein-coding gene	gene with protein product						10369878	Standard	NM_019069		Approved	FLJ11287	uc003efa.1	Q86VZ2	OTTHUMG00000159489	ENST00000330689.4:c.502G>A	3.37:g.122133874C>T	ENSP00000330381:p.Asp168Asn		B2RCM9|Q9NUL4	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.D168N	ENST00000330689.4	37	c.502	CCDS3012.1	3	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782778	0.90282	.	.	ENSG00000196981	ENST00000330689	T	0.41400	1.0	4.58	4.58	0.56647	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.043065	0.85682	D	0.000000	T	0.48714	0.1515	L	0.33189	0.99	0.80722	D	1	D	0.57571	0.98	P	0.59889	0.865	T	0.39941	-0.9589	10	0.39692	T	0.17	.	15.2729	0.73720	0.0:1.0:0.0:0.0	.	168	Q86VZ2	WDR5B_HUMAN	N	168	ENSP00000330381:D168N	ENSP00000330381:D168N	D	-	1	0	WDR5B	123616564	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	6.927000	0.75840	2.540000	0.85666	0.462000	0.41574	GAC	WDR5B	-	pfam_WD40_repeat,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000196981		0.438	WDR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR5B	HGNC	protein_coding	OTTHUMT00000355753.1	-	0.00	17	0	C	NM_019069		122133874	-1	tier1	-	no_errors	ENST00000330689	ensembl	human	known	74_37	missense	31.03	20	9	SNP	1.000	T
WFDC2	10406	genome.wustl.edu	37	20	44099056	44099056	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr20:44099056G>A	ENST00000372676.3	+	2	183	c.107G>A	c.(106-108)tGc>tAc	p.C36Y	WFDC2_ENST00000217425.5_Missense_Mutation_p.C36Y|AL031663.1_ENST00000599747.1_Intron|WFDC2_ENST00000339946.3_Intron	NM_006103.3	NP_006094.3	Q14508	WFDC2_HUMAN	WAP four-disulfide core domain 2	36	WAP 1. {ECO:0000255|PROSITE- ProRule:PRU00722}.				negative regulation of endopeptidase activity (GO:0010951)|proteolysis (GO:0006508)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase inhibitor activity (GO:0019828)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			lung(1)	1		Myeloproliferative disorder(115;0.0122)				ACTGGCGTGTGCCCCGAGCTC	0.677																																																	0													27.0	24.0	25.0					20																	44099056		2195	4295	6490	SO:0001583	missense	0			X63187	CCDS35501.1	20q13.12	2013-01-21			ENSG00000101443	ENSG00000101443		"""WAP four-disulfide core domain containing"""	15939	protein-coding gene	gene with protein product	"""epididymal protein 4"""					1686187, 10570965	Standard	NM_006103		Approved	HE4, WAP5, dJ461P17.6, EDDM4	uc002xoo.3	Q14508	OTTHUMG00000032594	ENST00000372676.3:c.107G>A	20.37:g.44099056G>A	ENSP00000361761:p.Cys36Tyr		A2A2A5|A2A2A6|A6PVD5|Q6IB27|Q8WXV9|Q8WXW0|Q8WXW1|Q8WXW2|Q96KJ1	Missense_Mutation	SNP	pfam_WAP-type_4-diS_core,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core,prints_WAP-type_4-diS_core	p.C36Y	ENST00000372676.3	37	c.107	CCDS35501.1	20	.	.	.	.	.	.	.	.	.	.	G	14.64	2.596052	0.46318	.	.	ENSG00000101443	ENST00000372676;ENST00000217425	D;D	0.99239	-5.61;-5.61	4.48	4.48	0.54585	Whey acidic protein, 4-disulphide core (5);4-disulphide core (1);	0.000000	0.64402	D	0.000005	D	0.99622	0.9862	H	0.98005	4.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97637	1.0146	10	0.87932	D	0	-26.1902	12.6543	0.56778	0.0:0.0:1.0:0.0	.	36	Q14508	WFDC2_HUMAN	Y	36	ENSP00000361761:C36Y;ENSP00000217425:C36Y	ENSP00000217425:C36Y	C	+	2	0	WFDC2	43532470	1.000000	0.71417	0.991000	0.47740	0.168000	0.22595	3.086000	0.50159	2.039000	0.60335	0.655000	0.94253	TGC	WFDC2	-	pfam_WAP-type_4-diS_core,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core,prints_WAP-type_4-diS_core	ENSG00000101443		0.677	WFDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WFDC2	HGNC	protein_coding	OTTHUMT00000079476.3		0.00	11	0	G			44099056	+1			no_errors	ENST00000372676	ensembl	human	known	74_37	missense	13.33	13	2	SNP	1.000	A
WNK2	65268	genome.wustl.edu	37	9	96051729	96051729	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr9:96051729G>A	ENST00000297954.4	+	20	4804	c.4804G>A	c.(4804-4806)Gtg>Atg	p.V1602M	WNK2_ENST00000349097.3_Missense_Mutation_p.V1214M|WNK2_ENST00000427277.2_Missense_Mutation_p.V1177M|WNK2_ENST00000395477.2_Missense_Mutation_p.V1565M|WNK2_ENST00000356055.3_5'UTR|WNK2_ENST00000395475.2_3'UTR	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	1602					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						CCAGGAGCACGTGCCCACCTC	0.667																																																	0													28.0	32.0	31.0					9																	96051729		2203	4300	6503	SO:0001583	missense	0			AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.4804G>A	9.37:g.96051729G>A	ENSP00000297954:p.Val1602Met		Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V1602M	ENST00000297954.4	37	c.4804		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.20|19.20	3.780753|3.780753	0.70222|0.70222	.|.	.|.	ENSG00000165238|ENSG00000165238	ENST00000411624|ENST00000297954;ENST00000395477;ENST00000349097;ENST00000427277	.|T;T;T;T	.|0.27890	.|1.64;1.64;1.64;1.64	5.21|5.21	4.28|4.28	0.50868|0.50868	.|.	.|0.378995	.|0.27402	.|N	.|0.019540	T|T	0.46814|0.46814	0.1412|0.1412	L|L	0.58101|0.58101	1.795|1.795	0.80722|0.80722	D|D	1|1	.|D;P;D;D;P	.|0.89917	.|0.971;0.938;0.987;1.0;0.937	.|P;B;P;D;B	.|0.80764	.|0.611;0.367;0.499;0.994;0.272	T|T	0.34054|0.34054	-0.9844|-0.9844	5|10	.|0.39692	.|T	.|0.17	.|.	8.6133|8.6133	0.33815|0.33815	0.1862:0.0:0.8138:0.0|0.1862:0.0:0.8138:0.0	.|.	.|1565;1560;1168;1565;1602	.|Q9Y3S1-2;A6PVR3;A6PVR4;F8W9F9;Q9Y3S1	.|.;.;.;.;WNK2_HUMAN	H|M	1168|1602;1565;1214;1177	.|ENSP00000297954:V1602M;ENSP00000378860:V1565M;ENSP00000297876:V1214M;ENSP00000411181:V1177M	.|ENSP00000297954:V1602M	R|V	+|+	2|1	0|0	WNK2|WNK2	95091550|95091550	0.977000|0.977000	0.34250|0.34250	0.921000|0.921000	0.36526|0.36526	0.969000|0.969000	0.65631|0.65631	1.858000|1.858000	0.39408|0.39408	1.125000|1.125000	0.41998|0.41998	0.561000|0.561000	0.74099|0.74099	CGT|GTG	WNK2	-	NULL	ENSG00000165238		0.667	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	WNK2	HGNC	protein_coding	OTTHUMT00000317359.1		0.00	22	0	G	NM_006648		96051729	+1			no_errors	ENST00000297954	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.980	A
WRN	7486	genome.wustl.edu	37	8	30999101	30999101	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr8:30999101C>T	ENST00000298139.5	+	25	3372	c.3123C>T	c.(3121-3123)tgC>tgT	p.C1041C		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	1041					aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)	p.C1041C(1)		central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		TGAAGATTTGCGCCCTTACGA	0.403			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)		yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	1	Substitution - coding silent(1)	endometrium(1)											103.0	101.0	102.0					8																	30999101		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.3123C>T	8.37:g.30999101C>T			A1KYY9	Silent	SNP	pfam_3'-5'_exonuclease_dom,pfam_Helicase_C,pfam_RQC_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_HRDC_dom,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_HRDC_dom,pfscan_HRDC_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.C1041	ENST00000298139.5	37	c.3123	CCDS6082.1	8																																																																																			WRN	-	pfam_RQC_domain,smart_RQC_domain	ENSG00000165392		0.403	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRN	HGNC	protein_coding	OTTHUMT00000376248.1	-	0.00	41	0	C			30999101	+1	tier1	-	no_errors	ENST00000298139	ensembl	human	known	74_37	silent	5.80	65	4	SNP	0.917	T
WWTR1	25937	genome.wustl.edu	37	3	149260124	149260124	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:149260124G>A	ENST00000465804.1	-	5	1025	c.769C>T	c.(769-771)Cag>Tag	p.Q257*	WWTR1_ENST00000360632.3_Nonsense_Mutation_p.Q257*|WWTR1_ENST00000467467.1_Nonsense_Mutation_p.Q257*	NM_001168278.1	NP_001161750.1	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1	257					cilium morphogenesis (GO:0060271)|gene expression (GO:0010467)|glomerulus development (GO:0032835)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast differentiation (GO:0001649)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of SMAD protein import into nucleus (GO:0060390)|regulation of transcription, DNA-templated (GO:0006355)|stem cell division (GO:0017145)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(5)|cervix(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	23			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			AGCCATACCTGCCTCATGAGC	0.537			T	CAMTA1	epitheliod hemangioendothelioma																																			Dom	yes		3	3q23-q24	607392	WW domain containing transcription regulator 1		M	0													115.0	99.0	104.0					3																	149260124		2203	4300	6503	SO:0001587	stop_gained	0			AK022036	CCDS3144.1	3q23-q24	2004-12-03			ENSG00000018408	ENSG00000018408			24042	protein-coding gene	gene with protein product		607392				11118213, 15096513	Standard	NM_015472		Approved	TAZ, DKFZp586I1419	uc021xfm.1	Q9GZV5	OTTHUMG00000159614	ENST00000465804.1:c.769C>T	3.37:g.149260124G>A	ENSP00000419465:p.Gln257*		D3DNH7|Q8N3P2|Q9Y3W6	Nonsense_Mutation	SNP	pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.Q257*	ENST00000465804.1	37	c.769	CCDS3144.1	3	.	.	.	.	.	.	.	.	.	.	G	40	8.177590	0.98691	.	.	ENSG00000018408	ENST00000465804;ENST00000360632;ENST00000467467;ENST00000472417	.	.	.	5.16	5.16	0.70880	.	0.123941	0.56097	D	0.000036	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-20.9579	18.8393	0.92176	0.0:0.0:1.0:0.0	.	.	.	.	X	257;257;257;115	.	ENSP00000353847:Q257X	Q	-	1	0	WWTR1	150742814	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.380000	0.79704	2.676000	0.91093	0.655000	0.94253	CAG	WWTR1	-	NULL	ENSG00000018408		0.537	WWTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWTR1	HGNC	protein_coding	OTTHUMT00000356498.1	-	0.00	44	0	G	NM_015472		149260124	-1	tier1	-	no_errors	ENST00000360632	ensembl	human	known	74_37	nonsense	8.33	44	4	SNP	1.000	A
ZDHHC14	79683	genome.wustl.edu	37	6	158014064	158014064	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr6:158014064A>G	ENST00000359775.5	+	3	1340	c.451A>G	c.(451-453)Aga>Gga	p.R151G	ZDHHC14_ENST00000341375.8_3'UTR|ZDHHC14_ENST00000414563.2_Missense_Mutation_p.R151G			Q8IZN3	ZDH14_HUMAN	zinc finger, DHHC-type containing 14	151					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	17		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)		CCCGCCTCCCAGAACCAAAGA	0.552																																																	0													91.0	89.0	90.0					6																	158014064		2203	4296	6499	SO:0001583	missense	0			AF542388	CCDS5252.1, CCDS47510.1	6q25.3	2008-05-02			ENSG00000175048	ENSG00000175048		"""Zinc fingers, DHHC-type"""	20341	protein-coding gene	gene with protein product							Standard	NM_024630		Approved	FLJ20984, NEW1CP	uc003qqt.3	Q8IZN3	OTTHUMG00000015896	ENST00000359775.5:c.451A>G	6.37:g.158014064A>G	ENSP00000352821:p.Arg151Gly		A6NDB7|Q5JS07|Q5JS08|Q6PHS4|Q8IZN2|Q9H7F1	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.R151G	ENST00000359775.5	37	c.451	CCDS5252.1	6	.	.	.	.	.	.	.	.	.	.	A	19.86	3.905221	0.72868	.	.	ENSG00000175048	ENST00000359775;ENST00000414563;ENST00000538483	T;T	0.27104	1.69;1.69	5.71	3.11	0.35812	.	0.000000	0.85682	D	0.000000	T	0.49881	0.1583	M	0.89534	3.04	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.86	D;D;P	0.87578	0.998;0.996;0.729	T	0.58691	-0.7592	10	0.87932	D	0	-12.6333	13.6188	0.62126	0.6432:0.3568:0.0:0.0	.	155;151;151	A4FVA9;Q8IZN3;Q8IZN3-2	.;ZDH14_HUMAN;.	G	151;151;155	ENSP00000352821:R151G;ENSP00000410713:R151G	ENSP00000352821:R151G	R	+	1	2	ZDHHC14	157934052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.240000	0.43088	2.687000	0.91594	0.655000	0.94253	AGA	ZDHHC14	-	NULL	ENSG00000175048		0.552	ZDHHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC14	HGNC	protein_coding	OTTHUMT00000042841.2		0.00	44	0	A	NM_153746		158014064	+1			no_errors	ENST00000359775	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	G
ZFP30	22835	genome.wustl.edu	37	19	38126131	38126131	+	Silent	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:38126131G>T	ENST00000351218.2	-	6	1868	c.1311C>A	c.(1309-1311)ccC>ccA	p.P437P	ZFP30_ENST00000514101.2_Silent_p.P437P|ZFP30_ENST00000392144.1_Silent_p.P437P|ZFP30_ENST00000589018.1_Intron	NM_014898.2	NP_055713.1	Q9Y2G7	ZFP30_HUMAN	ZFP30 zinc finger protein	437					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	21			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TACACTTAAAGGGTTTCTCAC	0.383																																																	0													68.0	64.0	65.0					19																	38126131		2203	4300	6503	SO:0001819	synonymous_variant	0			AB023178	CCDS33005.1	19q13.13	2013-01-08	2012-11-27		ENSG00000120784	ENSG00000120784		"""Zinc fingers, C2H2-type"", ""-"""	29555	protein-coding gene	gene with protein product			"""zinc finger protein 30 homolog (mouse)"""			10231032	Standard	NM_014898		Approved	ZNF745, KIAA0961	uc002ogx.1	Q9Y2G7	OTTHUMG00000048177	ENST00000351218.2:c.1311C>A	19.37:g.38126131G>T			Q58EY8	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P437	ENST00000351218.2	37	c.1311	CCDS33005.1	19																																																																																			ZFP30	-	pfscan_Znf_C2H2	ENSG00000120784		0.383	ZFP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP30	HGNC	protein_coding	OTTHUMT00000109601.2	-	0.00	37	0	G	NM_014898		38126131	-1	tier1	-	no_errors	ENST00000351218	ensembl	human	known	74_37	silent	11.11	40	5	SNP	0.995	T
ZIC1	7545	genome.wustl.edu	37	3	147128856	147128856	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:147128856A>C	ENST00000282928.4	+	1	1686	c.957A>C	c.(955-957)ttA>ttC	p.L319F		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	319					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						CCGAGAATTTAAAGATCCACA	0.572																																																	0													46.0	50.0	48.0					3																	147128856		2203	4300	6503	SO:0001583	missense	0			D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.957A>C	3.37:g.147128856A>C	ENSP00000282928:p.Leu319Phe		Q2M3N1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L319F	ENST00000282928.4	37	c.957	CCDS3136.1	3	.	.	.	.	.	.	.	.	.	.	A	16.32	3.090476	0.55968	.	.	ENSG00000152977	ENST00000282928	T	0.52057	0.68	3.89	1.08	0.20341	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000007	T	0.64483	0.2602	M	0.73753	2.245	0.58432	D	0.999997	D	0.89917	1.0	D	0.85130	0.997	T	0.67027	-0.5774	10	0.87932	D	0	.	11.2169	0.48831	0.3548:0.6452:0.0:0.0	.	319	Q15915	ZIC1_HUMAN	F	319	ENSP00000282928:L319F	ENSP00000282928:L319F	L	+	3	2	ZIC1	148611546	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.304000	0.33482	0.449000	0.26747	0.459000	0.35465	TTA	ZIC1	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000152977		0.572	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC1	HGNC	protein_coding	OTTHUMT00000355497.1	-	0.00	49	0	A	NM_003412		147128856	+1	tier1	-	no_errors	ENST00000282928	ensembl	human	known	74_37	missense	22.22	42	12	SNP	1.000	C
ZNF185	7739	genome.wustl.edu	37	X	152097180	152097180	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chrX:152097180G>T	ENST00000370268.4	+	12	926	c.889G>T	c.(889-891)Gtg>Ttg	p.V297L	ZNF185_ENST00000539731.1_Intron|ZNF185_ENST00000449285.2_Missense_Mutation_p.V298L|ZNF185_ENST00000535861.1_Missense_Mutation_p.V297L|ZNF185_ENST00000324823.6_Missense_Mutation_p.V133L|ZNF185_ENST00000370270.2_Missense_Mutation_p.V297L|ZNF185_ENST00000318529.8_Intron|ZNF185_ENST00000318504.7_Intron			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	297						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					ACTCCGCCTGGTGGCCCCAGA	0.612																																																	0													44.0	51.0	49.0					X																	152097180		1991	4150	6141	SO:0001583	missense	0			AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.889G>T	X.37:g.152097180G>T	ENSP00000359291:p.Val297Leu		A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	Missense_Mutation	SNP	smart_Znf_LIM,pfscan_Znf_LIM	p.V297L	ENST00000370268.4	37	c.889	CCDS48184.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.54|13.54	2.268170|2.268170	0.40095|0.40095	.|.	.|.	ENSG00000147394|ENSG00000147394	ENST00000447088|ENST00000535861;ENST00000449285;ENST00000535156;ENST00000324823;ENST00000433245;ENST00000370268;ENST00000370270	.|T;T;T	.|0.50813	.|0.73;0.75;0.75	3.2|3.2	1.32|1.32	0.21799|0.21799	.|.	.|1.068350	.|0.07389	.|N	.|0.888776	T|T	0.38532|0.38532	0.1044|0.1044	L|L	0.53249|0.53249	1.67|1.67	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.40211	.|0.484;0.707;0.484	.|B;B;B	.|0.37198	.|0.178;0.243;0.178	T|T	0.26258|0.26258	-1.0108|-1.0108	5|10	.|0.25751	.|T	.|0.34	-0.311|-0.311	4.7205|4.7205	0.12915|0.12915	0.3229:0.0:0.6771:0.0|0.3229:0.0:0.6771:0.0	.|.	.|298;297;297	.|O15231-3;F5GXF7;O15231	.|.;.;ZN185_HUMAN	V|L	114|297;298;132;133;163;297;128	.|ENSP00000440847:V297L;ENSP00000395228:V298L;ENSP00000359291:V297L	.|ENSP00000325307:V133L	G|V	+|+	2|1	0|0	ZNF185|ZNF185	151847836|151847836	0.994000|0.994000	0.37717|0.37717	0.993000|0.993000	0.49108|0.49108	0.968000|0.968000	0.65278|0.65278	0.555000|0.555000	0.23422|0.23422	0.207000|0.207000	0.20607|0.20607	0.600000|0.600000	0.82982|0.82982	GGT|GTG	ZNF185	-	NULL	ENSG00000147394		0.612	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF185	HGNC	protein_coding	OTTHUMT00000377480.1	-	0.00	53	0	G	NM_007150		152097180	+1	tier1	-	no_errors	ENST00000370270	ensembl	human	known	74_37	missense	49.38	41	40	SNP	0.987	T
ZNF208	7757	genome.wustl.edu	37	19	22155412	22155412	+	Silent	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:22155412T>C	ENST00000397126.4	-	4	2572	c.2424A>G	c.(2422-2424)gaA>gaG	p.E808E	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	808					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGCCACATTCTTCACATTTGT	0.378																																																	0													54.0	64.0	61.0					19																	22155412		2092	4242	6334	SO:0001819	synonymous_variant	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2424A>G	19.37:g.22155412T>C				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E808	ENST00000397126.4	37	c.2424	CCDS54240.1	19																																																																																			ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.378	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	-	0.00	64	0	T	NM_007153		22155412	-1	tier1	-	no_errors	ENST00000397126	ensembl	human	novel	74_37	silent	18.82	69	16	SNP	0.000	C
ZNF215	7762	genome.wustl.edu	37	11	6953817	6953817	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:6953817G>T	ENST00000278319.5	+	3	902	c.314G>T	c.(313-315)aGg>aTg	p.R105M	ZNF215_ENST00000529903.1_Missense_Mutation_p.R105M|ZNF215_ENST00000414517.2_Missense_Mutation_p.R105M|ZNF215_ENST00000527171.1_3'UTR	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	105	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		GAAGAAGTCAGGACTTGGGTG	0.398																																																	0													62.0	65.0	64.0					11																	6953817		2201	4296	6497	SO:0001583	missense	0			AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.314G>T	11.37:g.6953817G>T	ENSP00000278319:p.Arg105Met		Q96C84	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.R105M	ENST00000278319.5	37	c.314	CCDS7775.1	11	.	.	.	.	.	.	.	.	.	.	G	12.87	2.066158	0.36470	.	.	ENSG00000149054	ENST00000278319;ENST00000414517;ENST00000529903	T;T;T	0.05139	3.49;3.49;3.49	3.86	2.95	0.34219	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.44902	D	0.000408	T	0.20536	0.0494	M	0.79343	2.45	0.27049	N	0.963825	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.83275	0.986;0.996;0.992	T	0.01375	-1.1371	10	0.54805	T	0.06	-20.8351	7.3563	0.26721	0.1177:0.0:0.8823:0.0	.	105;105;105	B4DYW9;Q96C84;Q9UL58	.;.;ZN215_HUMAN	M	105	ENSP00000278319:R105M;ENSP00000393202:R105M;ENSP00000432306:R105M	ENSP00000278319:R105M	R	+	2	0	ZNF215	6910393	0.864000	0.29904	0.968000	0.41197	0.349000	0.29174	0.854000	0.27791	1.197000	0.43143	0.655000	0.94253	AGG	ZNF215	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000149054		0.398	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF215	HGNC	protein_coding	OTTHUMT00000384550.1		0.00	24	0	G			6953817	+1			no_errors	ENST00000278319	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.981	T
ZNF215	7762	genome.wustl.edu	37	11	6977060	6977060	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr11:6977060G>T	ENST00000278319.5	+	7	1440	c.852G>T	c.(850-852)ttG>ttT	p.L284F	ZNF215_ENST00000529903.1_Intron|ZNF215_ENST00000414517.2_Missense_Mutation_p.L284F|ZNF215_ENST00000527171.1_3'UTR	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	284					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		ACATAAATTTGCCACAAGAGG	0.368																																																	0													82.0	89.0	86.0					11																	6977060		2201	4294	6495	SO:0001583	missense	0			AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.852G>T	11.37:g.6977060G>T	ENSP00000278319:p.Leu284Phe		Q96C84	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.L284F	ENST00000278319.5	37	c.852	CCDS7775.1	11	.	.	.	.	.	.	.	.	.	.	G	15.66	2.900095	0.52227	.	.	ENSG00000149054	ENST00000278319;ENST00000414517	T;T	0.07444	3.19;3.19	4.09	2.2	0.27929	.	0.000000	0.36519	N	0.002550	T	0.09862	0.0242	N	0.14661	0.345	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	T	0.36432	-0.9748	10	0.40728	T	0.16	-9.4773	3.6332	0.08140	0.2118:0.0:0.5923:0.1958	.	284	Q9UL58	ZN215_HUMAN	F	284	ENSP00000278319:L284F;ENSP00000393202:L284F	ENSP00000278319:L284F	L	+	3	2	ZNF215	6933636	0.000000	0.05858	0.991000	0.47740	0.230000	0.25150	-0.867000	0.04241	0.491000	0.27793	0.655000	0.94253	TTG	ZNF215	-	NULL	ENSG00000149054		0.368	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF215	HGNC	protein_coding	OTTHUMT00000384550.1	-	0.00	44	0	G			6977060	+1	tier1	-	no_errors	ENST00000278319	ensembl	human	known	74_37	missense	18.18	45	10	SNP	0.983	T
ZNF257	113835	genome.wustl.edu	37	19	22271914	22271914	+	Silent	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:22271914T>G	ENST00000594947.1	+	4	1506	c.1362T>G	c.(1360-1362)acT>acG	p.T454T		NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	454					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				TAATTCATACTGGAGAGAAAC	0.388																																																	0													41.0	46.0	44.0					19																	22271914		2120	4251	6371	SO:0001819	synonymous_variant	0			AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.1362T>G	19.37:g.22271914T>G			B3KPS4|E9PG34|Q8NE34	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T454	ENST00000594947.1	37	c.1362	CCDS46030.1	19																																																																																			ZNF257	-	pfscan_Znf_C2H2	ENSG00000197134		0.388	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF257	HGNC	protein_coding	OTTHUMT00000464382.1	-	0.00	37	0	T			22271914	+1	tier1	-	no_errors	ENST00000594947	ensembl	human	known	74_37	silent	10.53	34	4	SNP	0.994	G
ZNF385D	79750	genome.wustl.edu	37	3	21466996	21466996	+	Silent	SNP	C	C	T	rs201622878		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr3:21466996C>T	ENST00000281523.2	-	6	1358	c.840G>A	c.(838-840)acG>acA	p.T280T		NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	280						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						GTTTAAGTTGCGTTTCCGAGT	0.413																																																	0													219.0	193.0	202.0					3																	21466996		2203	4300	6503	SO:0001819	synonymous_variant	0			BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.840G>A	3.37:g.21466996C>T				Silent	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.T280	ENST00000281523.2	37	c.840	CCDS2636.1	3																																																																																			ZNF385D	-	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	ENSG00000151789		0.413	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385D	HGNC	protein_coding	OTTHUMT00000252884.1	-	0.00	67	0	C	NM_024697		21466996	-1	tier1	rs201622878	no_errors	ENST00000281523	ensembl	human	known	74_37	silent	6.94	67	5	SNP	0.967	T
ZNF410	57862	genome.wustl.edu	37	14	74364860	74364860	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr14:74364860G>T	ENST00000555044.1	+	5	669	c.475G>T	c.(475-477)Gac>Tac	p.D159Y	ZNF410_ENST00000324593.6_Missense_Mutation_p.D159Y|ZNF410_ENST00000442160.3_Missense_Mutation_p.D176Y|ZNF410_ENST00000334521.4_Missense_Mutation_p.D106Y|ZNF410_ENST00000540593.1_Missense_Mutation_p.D86Y|ZNF410_ENST00000556797.1_Missense_Mutation_p.D106Y|RP5-1021I20.4_ENST00000556551.2_3'UTR|RP5-1021I20.5_ENST00000554009.1_RNA|ZNF410_ENST00000412490.3_3'UTR	NM_001242928.1|NM_021188.2	NP_001229857.1|NP_067011.1	Q86VK4	ZN410_HUMAN	zinc finger protein 410	159					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(234;0.00369)		TGAGAGCACAGACAGTAGCAT	0.488																																																	0													153.0	135.0	141.0					14																	74364860		2203	4300	6503	SO:0001583	missense	0			U90919	CCDS9821.1, CCDS55929.1, CCDS55930.1, CCDS55931.1	14q24.3	2013-01-08				ENSG00000119725		"""Zinc fingers, C2H2-type"""	20144	protein-coding gene	gene with protein product						12370286	Standard	NM_001242924		Approved	APA1, APA-1	uc010arz.2	Q86VK4		ENST00000555044.1:c.475G>T	14.37:g.74364860G>T	ENSP00000451763:p.Asp159Tyr		B4DDV5|B4DR78|O00153|Q9BQ19	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D159Y	ENST00000555044.1	37	c.475	CCDS9821.1	14	.	.	.	.	.	.	.	.	.	.	G	26.1	4.708086	0.89018	.	.	ENSG00000119725	ENST00000540593;ENST00000324593;ENST00000557363;ENST00000458102;ENST00000442160;ENST00000555044;ENST00000334521;ENST00000556797	T;T;T;T;T	0.11495	2.89;2.89;2.85;2.85;2.77	5.17	5.17	0.71159	.	0.000000	0.40818	N	0.001014	T	0.23766	0.0575	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.87578	0.998;0.997;0.997;0.993	T	0.01013	-1.1481	10	0.41790	T	0.15	.	18.8466	0.92209	0.0:0.0:1.0:0.0	.	86;176;159;159	B4DR78;B4DDV5;Q86VK4-3;Q86VK4	.;.;.;ZN410_HUMAN	Y	86;159;106;148;176;159;106;106	ENSP00000442228:D86Y;ENSP00000323293:D159Y;ENSP00000407130:D176Y;ENSP00000451763:D159Y;ENSP00000334170:D106Y	ENSP00000323293:D159Y	D	+	1	0	ZNF410	73434613	1.000000	0.71417	0.999000	0.59377	0.964000	0.63967	9.106000	0.94253	2.681000	0.91329	0.655000	0.94253	GAC	ZNF410	-	NULL	ENSG00000119725		0.488	ZNF410-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF410	HGNC	protein_coding	OTTHUMT00000412597.1		0.00	60	0	G	NM_021188		74364860	+1			no_errors	ENST00000555044	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
ZNF527	84503	genome.wustl.edu	37	19	37879856	37879856	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:37879856A>G	ENST00000436120.2	+	5	1012	c.905A>G	c.(904-906)tAt>tGt	p.Y302C	ZNF527_ENST00000587349.1_Intron	NM_032453.1	NP_115829.1	Q8NB42	ZN527_HUMAN	zinc finger protein 527	302					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y302>?(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	33			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAAAAACCATATGCATGCAAT	0.393																																																	1	Complex(1)	lung(1)											105.0	96.0	99.0					19																	37879856		2093	4241	6334	SO:0001583	missense	0			AB058732, AK091585	CCDS42559.1	19q13.1	2013-01-08			ENSG00000189164	ENSG00000189164		"""Zinc fingers, C2H2-type"", ""-"""	29385	protein-coding gene	gene with protein product						11347906	Standard	NM_032453		Approved	KIAA1829	uc010efk.1	Q8NB42	OTTHUMG00000048173	ENST00000436120.2:c.905A>G	19.37:g.37879856A>G	ENSP00000390179:p.Tyr302Cys		B4DVL5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y302C	ENST00000436120.2	37	c.905	CCDS42559.1	19	.	.	.	.	.	.	.	.	.	.	A	2.120	-0.401673	0.04865	.	.	ENSG00000189164	ENST00000356178;ENST00000317566;ENST00000436120	.	.	.	4.19	2.11	0.27256	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.557068	0.13635	N	0.373399	T	0.49983	0.1589	M	0.88704	2.975	0.09310	N	0.999999	B;B	0.17038	0.02;0.016	B;B	0.16722	0.016;0.009	T	0.53704	-0.8401	9	0.72032	D	0.01	.	3.9384	0.09316	0.6603:0.0:0.1838:0.1559	.	302;270	Q8NB42;Q8NB42-2	ZN527_HUMAN;.	C	302;270;250	.	ENSP00000325231:Y270C	Y	+	2	0	ZNF527	42571696	0.000000	0.05858	0.042000	0.18584	0.284000	0.27059	-0.422000	0.07043	0.193000	0.20303	-0.274000	0.10170	TAT	ZNF527	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000189164		0.393	ZNF527-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF527	HGNC	protein_coding	OTTHUMT00000458434.1		0.00	29	0	A	NM_032453		37879856	+1			no_errors	ENST00000436120	ensembl	human	known	74_37	missense	7.14	39	3	SNP	0.002	G
ZNF532	55205	genome.wustl.edu	37	18	56606792	56606792	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr18:56606792G>T	ENST00000336078.4	+	6	3420	c.2644G>T	c.(2644-2646)Gcc>Tcc	p.A882S	ZNF532_ENST00000591083.1_Missense_Mutation_p.A882S|ZNF532_ENST00000591230.1_Missense_Mutation_p.A882S|ZNF532_ENST00000589288.1_Missense_Mutation_p.A882S|ZNF532_ENST00000591808.1_Missense_Mutation_p.A882S	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	882					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						GTTTAAGTCTGCCCCAAGCAC	0.453																																																	0													140.0	118.0	125.0					18																	56606792		2203	4300	6503	SO:0001583	missense	0			AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.2644G>T	18.37:g.56606792G>T	ENSP00000338217:p.Ala882Ser		Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A882S	ENST00000336078.4	37	c.2644	CCDS11969.1	18	.	.	.	.	.	.	.	.	.	.	g	34	5.342849	0.95783	.	.	ENSG00000074657	ENST00000336078	T	0.27104	1.69	5.43	5.43	0.79202	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.051440	0.85682	D	0.000000	T	0.33030	0.0849	N	0.11106	0.095	0.58432	D	0.999999	D	0.76494	0.999	D	0.80764	0.994	T	0.26916	-1.0089	10	0.29301	T	0.29	-24.544	18.8737	0.92327	0.0:0.0:1.0:0.0	.	882	Q9HCE3	ZN532_HUMAN	S	882	ENSP00000338217:A882S	ENSP00000338217:A882S	A	+	1	0	ZNF532	54757772	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.601000	0.74136	2.579000	0.87056	0.645000	0.84053	GCC	ZNF532	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000074657		0.453	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF532	HGNC	protein_coding	OTTHUMT00000256130.1	-	0.00	42	0	G	NM_018181		56606792	+1	tier1	-	no_errors	ENST00000336078	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
ZNF585A	199704	genome.wustl.edu	37	19	37643365	37643365	+	Nonsense_Mutation	SNP	G	G	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:37643365G>C	ENST00000356958.4	-	5	1694	c.1436C>G	c.(1435-1437)tCa>tGa	p.S479*	ZNF585A_ENST00000392157.2_Nonsense_Mutation_p.S424*|ZNF585A_ENST00000355533.2_Intron|ZNF585A_ENST00000588723.1_Intron|ZNF585A_ENST00000292841.5_Nonsense_Mutation_p.S424*			Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	479					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|central_nervous_system(1)|endometrium(2)|large_intestine(17)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AATGAGATTTGACCGGTTGGT	0.403																																																	0													102.0	100.0	101.0					19																	37643365		2203	4300	6503	SO:0001587	stop_gained	0			AK074345	CCDS12499.1, CCDS74353.1	19q13.13	2013-01-08				ENSG00000196967		"""Zinc fingers, C2H2-type"", ""-"""	26305	protein-coding gene	gene with protein product						12477932	Standard	NM_199126		Approved	FLJ23765	uc002ofn.1	Q6P3V2		ENST00000356958.4:c.1436C>G	19.37:g.37643365G>C	ENSP00000349440:p.Ser479*		Q8TE95|Q96MV3	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S479*	ENST00000356958.4	37	c.1436		19	.	.	.	.	.	.	.	.	.	.	G	22.4	4.284764	0.80803	.	.	ENSG00000196967	ENST00000356958;ENST00000292841;ENST00000392157	.	.	.	2.72	1.51	0.23008	.	0.000000	0.30979	N	0.008483	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	8.3997	0.32579	0.0:0.0:0.7676:0.2324	.	.	.	.	X	479;424;424	.	ENSP00000292841:S424X	S	-	2	0	ZNF585A	42335205	0.000000	0.05858	0.277000	0.24703	0.111000	0.19643	0.223000	0.17719	1.517000	0.48917	0.561000	0.74099	TCA	ZNF585A	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196967		0.403	ZNF585A-001	KNOWN	basic|appris_principal	protein_coding	ZNF585A	HGNC	protein_coding	OTTHUMT00000457980.2	-	0.00	83	0	G	NM_152655		37643365	-1	tier1	-	no_errors	ENST00000356958	ensembl	human	known	74_37	nonsense	33.62	77	39	SNP	0.000	C
ZNF570	148268	genome.wustl.edu	37	19	37975773	37975773	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:37975773C>T	ENST00000330173.1	+	5	1778	c.1249C>T	c.(1249-1251)Cag>Tag	p.Q417*	ZNF570_ENST00000388801.3_Nonsense_Mutation_p.Q214*|ZNF570_ENST00000586475.1_Nonsense_Mutation_p.Q473*	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570	417					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTATAAGTGTCAGGAATGTAG	0.428																																																	0													94.0	96.0	95.0					19																	37975773		2203	4300	6503	SO:0001587	stop_gained	0			AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.1249C>T	19.37:g.37975773C>T	ENSP00000331540:p.Gln417*		A1L472|B4DMP1	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q417*	ENST00000330173.1	37	c.1249	CCDS12504.1	19	.	.	.	.	.	.	.	.	.	.	C	40	8.141913	0.98675	.	.	ENSG00000171827	ENST00000330173;ENST00000388801	.	.	.	4.11	1.69	0.24217	.	0.828074	0.10115	N	0.714143	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.9053	0.18998	0.3361:0.5674:0.0:0.0966	.	.	.	.	X	417;214	.	ENSP00000331540:Q417X	Q	+	1	0	ZNF570	42667613	0.000000	0.05858	1.000000	0.80357	0.961000	0.63080	-0.527000	0.06200	1.023000	0.39654	0.462000	0.41574	CAG	ZNF570	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171827		0.428	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF570	HGNC	protein_coding	OTTHUMT00000109600.1	-	0.00	42	0	C	NM_144694		37975773	+1	tier1	-	no_errors	ENST00000330173	ensembl	human	known	74_37	nonsense	11.29	55	7	SNP	0.094	T
ZNF610	162963	genome.wustl.edu	37	19	52869351	52869351	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:52869351C>T	ENST00000403906.3	+	6	1176	c.720C>T	c.(718-720)gtC>gtT	p.V240V	ZNF610_ENST00000321287.8_Silent_p.V240V|ZNF610_ENST00000327920.8_Silent_p.V240V|ZNF610_ENST00000601151.1_Silent_p.V197V	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	240					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		GTGGCAAGGTCTTCAGTCGCA	0.398																																																	0													68.0	67.0	68.0					19																	52869351		2203	4300	6503	SO:0001819	synonymous_variant	0			AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.720C>T	19.37:g.52869351C>T			A8K4C3|Q86YH8|Q8NDS9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V240	ENST00000403906.3	37	c.720	CCDS12851.1	19																																																																																			ZNF610	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167554		0.398	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF610	HGNC	protein_coding	OTTHUMT00000462880.1	-	0.00	56	0	C	NM_173530		52869351	+1	tier1	-	no_errors	ENST00000321287	ensembl	human	known	74_37	silent	6.25	60	4	SNP	0.019	T
ZNF677	342926	genome.wustl.edu	37	19	53741686	53741686	+	Missense_Mutation	SNP	T	T	G	rs201826579		TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:53741686T>G	ENST00000598513.1	-	5	444	c.294A>C	c.(292-294)gaA>gaC	p.E98D	ZNF677_ENST00000333952.4_Missense_Mutation_p.E98D|CTD-2245F17.6_ENST00000596041.1_RNA	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	98					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		TTTCCCAGACTTCCTTGAGGT	0.363																																																	0													95.0	90.0	92.0					19																	53741686		2203	4299	6502	SO:0001583	missense	0			BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.294A>C	19.37:g.53741686T>G	ENSP00000469391:p.Glu98Asp			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E98D	ENST00000598513.1	37	c.294	CCDS12861.1	19	.	.	.	.	.	.	.	.	.	.	T	8.698	0.909117	0.17833	.	.	ENSG00000197928	ENST00000416063;ENST00000333952	T	0.08984	3.03	2.29	-0.0502	0.13831	.	0.939528	0.08720	N	0.903575	T	0.04679	0.0127	N	0.24115	0.695	0.09310	N	1	B	0.14805	0.011	B	0.10450	0.005	T	0.46020	-0.9221	10	0.30078	T	0.28	.	0.2891	0.00256	0.2329:0.1446:0.2391:0.3834	.	98	Q86XU0	ZN677_HUMAN	D	98	ENSP00000334394:E98D	ENSP00000334394:E98D	E	-	3	2	ZNF677	58433498	0.000000	0.05858	0.015000	0.15790	0.076000	0.17211	-0.430000	0.06973	-0.087000	0.12528	-0.316000	0.08728	GAA	ZNF677	-	NULL	ENSG00000197928		0.363	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF677	HGNC	protein_coding	OTTHUMT00000464189.1	-	0.00	62	0	T	NM_182609		53741686	-1	tier1	-	no_errors	ENST00000333952	ensembl	human	known	74_37	missense	40.96	49	34	SNP	0.064	G
ZNF667	63934	genome.wustl.edu	37	19	56981367	56981367	+	Intron	SNP	T	T	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:56981367T>G	ENST00000504904.3	-	3	661				ZNF667_ENST00000589652.1_Intron|ZNF667_ENST00000342634.3_Missense_Mutation_p.K20Q|ZNF667_ENST00000591790.1_Intron|ZNF667_ENST00000292069.6_Intron			Q5HYK9	ZN667_HUMAN	zinc finger protein 667						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	38		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		TGAGCACATTTGCCTTCTGGC	0.502																																																	0													12.0	10.0	11.0					19																	56981367		875	1986	2861	SO:0001627	intron_variant	0				CCDS12944.1	19q13.43	2013-01-08				ENSG00000198046		"""Zinc fingers, C2H2-type"", ""-"""	28854	protein-coding gene	gene with protein product		611024					Standard	NM_022103		Approved	FLJ14011	uc002qnd.3	Q5HYK9		ENST00000504904.3:c.58+1700A>C	19.37:g.56981367T>G			B2RMS6|B9EK36|Q6B093|Q9H807	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K20Q	ENST00000504904.3	37	c.58	CCDS12944.1	19	.	.	.	.	.	.	.	.	.	.	T	8.019	0.759150	0.15846	.	.	ENSG00000198046	ENST00000342634	T	0.06294	3.32	0.788	0.788	0.18601	.	.	.	.	.	T	0.07593	0.0191	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.34850	-0.9812	6	0.87932	D	0	.	3.8441	0.08926	0.0:0.0:0.0:1.0	.	.	.	.	Q	20	ENSP00000344699:K20Q	ENSP00000344699:K20Q	K	-	1	0	ZNF667	61673179	0.012000	0.17670	0.002000	0.10522	0.006000	0.05464	-0.105000	0.10907	0.591000	0.29711	0.402000	0.26972	AAA	ZNF667	-	NULL	ENSG00000198046		0.502	ZNF667-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF667	HGNC	protein_coding	OTTHUMT00000458394.1	-	0.00	32	0	T	NM_022103		56981367	-1	tier1	-	no_errors	ENST00000342634	ensembl	human	known	74_37	missense	31.48	37	17	SNP	0.002	G
ZNF606	80095	genome.wustl.edu	37	19	58491553	58491553	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:58491553T>C	ENST00000341164.4	-	7	1115	c.495A>G	c.(493-495)atA>atG	p.I165M	ZNF606_ENST00000536132.1_Missense_Mutation_p.I75M	NM_025027.3	NP_079303.2	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	165					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		GATCATCCCATATATATCTTT	0.408																																																	0													127.0	117.0	120.0					19																	58491553		2203	4300	6503	SO:0001583	missense	0			AB058755	CCDS12968.1	19q13.43	2013-01-08			ENSG00000166704	ENSG00000166704		"""Zinc fingers, C2H2-type"", ""-"""	25879	protein-coding gene	gene with protein product		613905		ZNF328		11347906	Standard	XM_005259276		Approved	FLJ14260, KIAA1852	uc002qqw.3	Q8WXB4	OTTHUMG00000169804	ENST00000341164.4:c.495A>G	19.37:g.58491553T>C	ENSP00000343617:p.Ile165Met		A8KAN2|Q8NE04|Q96JH5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I165M	ENST00000341164.4	37	c.495	CCDS12968.1	19	.	.	.	.	.	.	.	.	.	.	T	6.658	0.489837	0.12702	.	.	ENSG00000166704	ENST00000341164;ENST00000536132;ENST00000551380	T;T;T	0.22336	1.96;3.1;1.96	4.76	2.6	0.31112	.	0.341582	0.21618	N	0.071685	T	0.10809	0.0264	N	0.22421	0.69	0.23271	N	0.998004	B	0.34015	0.435	B	0.27608	0.081	T	0.18967	-1.0320	10	0.48119	T	0.1	.	4.8516	0.13540	0.1651:0.0923:0.0:0.7426	.	165	Q8WXB4	ZN606_HUMAN	M	165;75;165	ENSP00000343617:I165M;ENSP00000445624:I75M;ENSP00000446972:I165M	ENSP00000343617:I165M	I	-	3	3	ZNF606	63183365	0.993000	0.37304	0.998000	0.56505	0.992000	0.81027	0.023000	0.13533	0.292000	0.22492	0.533000	0.62120	ATA	ZNF606	-	NULL	ENSG00000166704		0.408	ZNF606-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF606	HGNC	protein_coding	OTTHUMT00000405961.1	-	0.00	35	0	T	NM_025027		58491553	-1	tier1	-	no_errors	ENST00000341164	ensembl	human	known	74_37	missense	10.87	41	5	SNP	0.995	C
ZNF727	442319	genome.wustl.edu	37	7	63538205	63538205	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr7:63538205G>T	ENST00000550760.3	+	4	957	c.778G>T	c.(778-780)Gaa>Taa	p.E260*	RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727	260					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						CAAATGCGAAGAATGTCACAA	0.393																																																	0													60.0	64.0	63.0					7																	63538205		692	1591	2283	SO:0001587	stop_gained	0					7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536	ENST00000550760.3:c.778G>T	7.37:g.63538205G>T	ENSP00000447987:p.Glu260*			Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E260*	ENST00000550760.3	37	c.778	CCDS55113.1	7	.	.	.	.	.	.	.	.	.	.	G	18.71	3.683229	0.68157	.	.	ENSG00000257482	ENST00000550760	.	.	.	1.02	1.02	0.19986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.4265	0.27102	0.0:0.0:1.0:0.0	.	.	.	.	X	260	.	.	E	+	1	0	ZNF727	63175640	0.000000	0.05858	0.120000	0.21714	0.107000	0.19398	0.165000	0.16564	0.436000	0.26393	0.436000	0.28706	GAA	ZNF727	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000257482		0.393	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF727	HGNC	protein_coding		-	0.00	52	0	G	NM_001159522		63538205	+1	tier1	-	no_errors	ENST00000550760	ensembl	human	known	74_37	nonsense	34.78	30	16	SNP	0.801	T
ZNF730	100129543	genome.wustl.edu	37	19	23328686	23328686	+	Silent	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:23328686A>G	ENST00000597761.2	+	4	1039	c.840A>G	c.(838-840)ggA>ggG	p.G280G		NM_001277403.1	NP_001264332.1	Q6ZMV8	ZN730_HUMAN	zinc finger protein 730	280					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|pancreas(1)|stomach(2)|urinary_tract(1)	16						TTCATACTGGAGAGAAACCCT	0.343																																																	0																																										SO:0001819	synonymous_variant	0			AK131472	CCDS59371.1	19p12	2013-01-08			ENSG00000183850	ENSG00000183850		"""Zinc fingers, C2H2-type"", ""-"""	32470	protein-coding gene	gene with protein product							Standard	NM_001277403		Approved		uc031rkc.1	Q6ZMV8		ENST00000597761.2:c.840A>G	19.37:g.23328686A>G				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G280	ENST00000597761.2	37	c.840	CCDS59371.1	19																																																																																			ZNF730	-	pfscan_Znf_C2H2	ENSG00000183850		0.343	ZNF730-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF730	HGNC	protein_coding	OTTHUMT00000465737.2	-	0.00	44	0	A	XM_001719792		23328686	+1	tier1	-	no_errors	ENST00000597761	ensembl	human	known	74_37	silent	20.37	43	11	SNP	1.000	G
ZNF90	7643	genome.wustl.edu	37	19	20229823	20229823	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:20229823A>G	ENST00000418063.2	+	4	1572	c.1460A>G	c.(1459-1461)gAc>gGc	p.D487G	ZNF90_ENST00000474284.1_Intron	NM_007138.1	NP_009069.1	Q03938	ZNF90_HUMAN	zinc finger protein 90	487					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|lung(2)|ovary(1)|skin(1)	5						CAAGAATGTGACAAAGCCTTC	0.413																																																	0													94.0	87.0	89.0					19																	20229823		692	1591	2283	SO:0001583	missense	0			M61870	CCDS46028.1	19p12	2013-01-08	2006-02-01		ENSG00000213988	ENSG00000213988		"""Zinc fingers, C2H2-type"", ""-"""	13165	protein-coding gene	gene with protein product		603973	"""zinc finger protein 90 (HTF9)"""			8467795	Standard	NM_007138		Approved	HTF9	uc002nor.2	Q03938	OTTHUMG00000158057	ENST00000418063.2:c.1460A>G	19.37:g.20229823A>G	ENSP00000410466:p.Asp487Gly		B9EH87	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D487G	ENST00000418063.2	37	c.1460	CCDS46028.1	19	.	.	.	.	.	.	.	.	.	.	a	0.007	-2.016103	0.00418	.	.	ENSG00000213988	ENST00000418063	T	0.18174	2.23	1.12	-2.24	0.06909	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02304	0.0071	N	0.00080	-2.225	0.23050	N	0.998379	B	0.02656	0.0	B	0.01281	0.0	T	0.41088	-0.9528	8	.	.	.	.	4.2243	0.10574	0.5038:0.0:0.4962:0.0	.	487	Q03938	ZNF90_HUMAN	G	487	ENSP00000410466:D487G	.	D	+	2	0	ZNF90	20090823	0.964000	0.33143	0.008000	0.14137	0.008000	0.06430	1.256000	0.32921	-0.814000	0.04352	-0.804000	0.03201	GAC	ZNF90	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213988		0.413	ZNF90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF90	HGNC	protein_coding	OTTHUMT00000350101.1	-	0.00	51	0	A	NM_007138		20229823	+1	tier1	-	no_errors	ENST00000418063	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.999	G
ZNF781	163115	genome.wustl.edu	37	19	38160930	38160930	+	Silent	SNP	C	C	T			TCGA-2H-A9GK-01A-11D-A37C-09	TCGA-2H-A9GK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae7e4bef-a699-4444-849d-91415b60763f	4c66b924-401a-40bb-a134-07a35536cf3c	g.chr19:38160930C>T	ENST00000590008.1	-	5	972	c.120G>A	c.(118-120)aaG>aaA	p.K40K	ZNF781_ENST00000593040.1_5'Flank|ZFP30_ENST00000586732.1_Intron|ZNF781_ENST00000358582.4_Silent_p.K40K			Q8N8C0	ZN781_HUMAN	zinc finger protein 781	40					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24						TTCTAAAGGGCTTTCCACATA	0.378																																																	0													182.0	176.0	178.0					19																	38160930		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097019	CCDS12507.1	19q13.12	2013-01-08				ENSG00000196381		"""Zinc fingers, C2H2-type"""	26745	protein-coding gene	gene with protein product							Standard	NM_152605		Approved	FLJ37549	uc002ogy.2	Q8N8C0		ENST00000590008.1:c.120G>A	19.37:g.38160930C>T			Q2VPJ8	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K40	ENST00000590008.1	37	c.120	CCDS12507.1	19																																																																																			ZNF781	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196381		0.378	ZNF781-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF781	HGNC	protein_coding	OTTHUMT00000459495.2	-	0.00	53	0	C	NM_152605		38160930	-1	tier1	-	no_errors	ENST00000358582	ensembl	human	known	74_37	silent	12.20	72	10	SNP	0.429	T
