#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA10	10349	genome.wustl.edu	37	17	67178855	67178855	+	Silent	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr17:67178855G>T	ENST00000269081.4	-	22	3501	c.2592C>A	c.(2590-2592)ccC>ccA	p.P864P	ABCA10_ENST00000416101.2_3'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	864					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					CATTGTAGGAGGGATCATCTG	0.378																																																	0													153.0	157.0	155.0					17																	67178855		2203	4300	6503	SO:0001819	synonymous_variant	0			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.2592C>A	17.37:g.67178855G>T			C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.P864	ENST00000269081.4	37	c.2592	CCDS11684.1	17																																																																																			ABCA10	-	NULL	ENSG00000154263		0.378	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA10	HGNC	protein_coding	OTTHUMT00000379881.4	-	0.00	44	0	G	NM_080282		67178855	-1	tier1	-	no_errors	ENST00000269081	ensembl	human	known	74_37	silent	8.00	46	4	SNP	0.000	T
ABCC8	6833	genome.wustl.edu	37	11	17449846	17449846	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:17449846C>T	ENST00000389817.3	-	14	2098	c.2030G>A	c.(2029-2031)tGc>tAc	p.C677Y	ABCC8_ENST00000302539.4_Missense_Mutation_p.C677Y|ABCC8_ENST00000528202.1_5'Flank			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	677					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	CTGGACACAGCAGTTGTCAGC	0.632																																																	0													84.0	93.0	90.0					11																	17449846		2200	4293	6493	SO:0001583	missense	0			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.2030G>A	11.37:g.17449846C>T	ENSP00000374467:p.Cys677Tyr		A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Surea_rcpt-1,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.C677Y	ENST00000389817.3	37	c.2030	CCDS31437.1	11	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.921376	0.00498	.	.	ENSG00000006071	ENST00000389817;ENST00000302539;ENST00000379493	D;D	0.91295	-2.81;-2.82	5.08	0.894	0.19242	.	0.518447	0.21577	N	0.072311	T	0.72269	0.3439	N	0.11131	0.1	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.58792	-0.7574	10	0.02654	T	1	.	2.9507	0.05861	0.3389:0.4126:0.1075:0.141	.	677	Q09428	ABCC8_HUMAN	Y	677;677;681	ENSP00000374467:C677Y;ENSP00000303960:C677Y	ENSP00000303960:C677Y	C	-	2	0	ABCC8	17406422	0.960000	0.32886	0.954000	0.39281	0.701000	0.40568	0.036000	0.13819	-0.364000	0.08088	-2.056000	0.00403	TGC	ABCC8	-	NULL	ENSG00000006071		0.632	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	HGNC	protein_coding	OTTHUMT00000389093.1	-	0.00	35	0	C	NM_000352		17449846	-1	tier1	-	no_errors	ENST00000302539	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.490	T
ABHD17A	81926	genome.wustl.edu	37	19	1880936	1880936	+	Intron	SNP	T	T	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:1880936T>C	ENST00000292577.7	-	2	766				ABHD17A_ENST00000250974.9_Silent_p.T148T|ABHD17A_ENST00000590661.1_Intron	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A							extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										GGGCAGCCCCTGTGCCCCAGC	0.662																																																	0													32.0	38.0	36.0					19																	1880936		2201	4299	6500	SO:0001627	intron_variant	0			BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.332+297A>G	19.37:g.1880936T>C			A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Silent	SNP	pfam_Dienelactn_hydro	p.T148	ENST00000292577.7	37	c.444	CCDS45902.1	19																																																																																			ABHD17A	-	NULL	ENSG00000129968		0.662	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD17A	HGNC	protein_coding	OTTHUMT00000415556.2		0.00	115	0	T	NM_031213		1880936	-1			no_errors	ENST00000250974	ensembl	human	known	74_37	silent	6.15	61	4	SNP	0.000	C
ACADL	33	genome.wustl.edu	37	2	211085455	211085455	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:211085455C>T	ENST00000233710.3	-	2	376	c.149G>A	c.(148-150)cGa>cAa	p.R50Q	AC006994.2_ENST00000412065.1_RNA	NM_001608.3	NP_001599.1	P28330	ACADL_HUMAN	acyl-CoA dehydrogenase, long chain	50					carnitine catabolic process (GO:0042413)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid catabolic process (GO:0044242)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|long-chain fatty acid catabolic process (GO:0042758)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|oxidation-reduction process (GO:0055114)|protein homotetramerization (GO:0051289)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|palmitoyl-CoA oxidase activity (GO:0016401)	p.R50Q(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14		Renal(323;0.202)		Epithelial(149;0.00631)|Lung(261;0.0438)|LUSC - Lung squamous cell carcinoma(261;0.0466)|all cancers(144;0.0621)		AAAGATTCTTCGAATTCCTAT	0.353																																																	1	Substitution - Missense(1)	large_intestine(1)											82.0	85.0	84.0					2																	211085455		2203	4300	6503	SO:0001583	missense	0			M74096	CCDS2389.1	2q34	2012-07-13	2010-04-30		ENSG00000115361	ENSG00000115361	1.3.99.13		88	protein-coding gene	gene with protein product		609576	"""acyl-Coenzyme A dehydrogenase, long chain"""			1774065	Standard	NM_001608		Approved	LCAD, ACAD4	uc002vdz.4	P28330	OTTHUMG00000132989	ENST00000233710.3:c.149G>A	2.37:g.211085455C>T	ENSP00000233710:p.Arg50Gln		B2R8T3|Q8IUN8	Missense_Mutation	SNP	pfam_AcylCo_DH/oxidase_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_AcylCo_DH/oxidase_C	p.R50Q	ENST00000233710.3	37	c.149	CCDS2389.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.547013	0.96488	.	.	ENSG00000115361	ENST00000233710	D	0.98889	-5.21	5.69	5.69	0.88448	Acyl-CoA dehydrogenase/oxidase (1);	0.000000	0.85682	D	0.000000	D	0.97854	0.9295	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.99937	1.1373	10	0.87932	D	0	.	19.821	0.96592	0.0:1.0:0.0:0.0	.	50	P28330	ACADL_HUMAN	Q	50	ENSP00000233710:R50Q	ENSP00000233710:R50Q	R	-	2	0	ACADL	210793700	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.761000	0.74945	2.683000	0.91414	0.655000	0.94253	CGA	ACADL	-	superfamily_AcylCoA_DH/oxidase_NM_dom	ENSG00000115361		0.353	ACADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACADL	HGNC	protein_coding	OTTHUMT00000256561.2	-	0.00	48	0	C	NM_001608		211085455	-1	tier1	-	no_errors	ENST00000233710	ensembl	human	known	74_37	missense	82.61	8	38	SNP	1.000	T
ADAMTS13	11093	genome.wustl.edu	37	9	136290691	136290691	+	Missense_Mutation	SNP	C	C	T	rs587701622		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr9:136290691C>T	ENST00000371929.3	+	4	817	c.373C>T	c.(373-375)Cgg>Tgg	p.R125W	ADAMTS13_ENST00000371916.1_Missense_Mutation_p.R125W|ADAMTS13_ENST00000356589.2_Missense_Mutation_p.R125W|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.R125W|ADAMTS13_ENST00000485925.1_3'UTR|ADAMTS13_ENST00000371911.3_Missense_Mutation_p.R125W	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	125	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R125W(1)		central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GGCTCAGTTTCGGGTGCACCT	0.607																																																	1	Substitution - Missense(1)	endometrium(1)											60.0	49.0	53.0					9																	136290691		2203	4300	6503	SO:0001583	missense	0			AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.373C>T	9.37:g.136290691C>T	ENSP00000360997:p.Arg125Trp		Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,superfamily_CUB_dom,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R125W	ENST00000371929.3	37	c.373	CCDS6970.1	9	.	.	.	.	.	.	.	.	.	.	C	11.80	1.746304	0.30955	.	.	ENSG00000160323	ENST00000371929;ENST00000371916;ENST00000355699;ENST00000356589;ENST00000371911	D;D;D;D;D	0.87729	-2.29;-2.29;-2.29;-2.29;-2.29	4.57	3.67	0.42095	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	D	0.84995	0.5596	M	0.81341	2.54	0.80722	D	1	P;B;B;P	0.45011	0.799;0.35;0.202;0.848	B;B;B;B	0.38880	0.284;0.094;0.057;0.222	D	0.83753	0.0210	9	0.62326	D	0.03	.	7.3467	0.26668	0.167:0.7411:0.0:0.0919	.	125;125;125;125	Q76LX8;Q76LX8-3;Q76LX8-2;E7EV88	ATS13_HUMAN;.;.;.	W	125	ENSP00000360997:R125W;ENSP00000360984:R125W;ENSP00000347927:R125W;ENSP00000348997:R125W;ENSP00000360979:R125W	ENSP00000347927:R125W	R	+	1	2	ADAMTS13	135280512	0.999000	0.42202	0.919000	0.36401	0.395000	0.30598	2.766000	0.47629	0.915000	0.36847	0.460000	0.39030	CGG	ADAMTS13	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000160323		0.607	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAMTS13	HGNC	protein_coding	OTTHUMT00000054920.1	-	0.00	43	0	C	NM_139025		136290691	+1	tier1	-	no_errors	ENST00000371929	ensembl	human	known	74_37	missense	53.45	27	31	SNP	1.000	T
ADAMTS2	9509	genome.wustl.edu	37	5	178579173	178579173	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr5:178579173delG	ENST00000251582.7	-	10	1700	c.1599delC	c.(1597-1599)cccfs	p.P533fs	ADAMTS2_ENST00000274609.5_Frame_Shift_Del_p.P533fs	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	533	Disintegrin.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TCCCGTCCAAGGGGGGCCCCT	0.597																																																	0													64.0	60.0	61.0					5																	178579173		2203	4300	6503	SO:0001589	frameshift_variant	0			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.1599delC	5.37:g.178579173delG	ENSP00000251582:p.Pro533fs			Frame_Shift_Del	DEL	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS2,prints_Peptidase_M12B_ADAM-TS	p.L534fs	ENST00000251582.7	37	c.1599	CCDS4444.1	5																																																																																			ADAMTS2	-	NULL	ENSG00000087116		0.597	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS2	HGNC	protein_coding	OTTHUMT00000253507.1		0.00	64	0	G	NM_014244		178579173	-1	tier1		no_errors	ENST00000251582	ensembl	human	known	74_37	frame_shift_del	5.13	37	2	DEL	0.009	-
AHNAK2	113146	genome.wustl.edu	37	14	105409712	105409712	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr14:105409712C>G	ENST00000333244.5	-	7	12195	c.12076G>C	c.(12076-12078)Gag>Cag	p.E4026Q	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4026						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.E4026*(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCCTGGACCTCCAGGTCAGCG	0.657																																																	1	Substitution - Nonsense(1)	lung(1)											104.0	109.0	108.0					14																	105409712		1939	4127	6066	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.12076G>C	14.37:g.105409712C>G	ENSP00000353114:p.Glu4026Gln		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E4026Q	ENST00000333244.5	37	c.12076	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	-	10.65	1.408844	0.25378	.	.	ENSG00000185567	ENST00000333244	T	0.00711	5.8	3.57	1.62	0.23740	.	.	.	.	.	T	0.03390	0.0098	M	0.85041	2.73	0.09310	N	1	D	0.58970	0.984	P	0.58454	0.839	T	0.27502	-1.0072	9	0.31617	T	0.26	.	12.1718	0.54163	0.0:0.4964:0.5036:0.0	.	4026	Q8IVF2	AHNK2_HUMAN	Q	4026	ENSP00000353114:E4026Q	ENSP00000353114:E4026Q	E	-	1	0	AHNAK2	104480757	0.000000	0.05858	0.001000	0.08648	0.143000	0.21401	-2.156000	0.01283	0.185000	0.20105	0.306000	0.20318	GAG	AHNAK2	-	NULL	ENSG00000185567		0.657	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	-	0.00	149	0	C	NM_138420		105409712	-1	tier1	-	no_errors	ENST00000333244	ensembl	human	known	74_37	missense	42.57	58	43	SNP	0.000	G
AKNA	80709	genome.wustl.edu	37	9	117129824	117129824	+	Splice_Site	SNP	T	T	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr9:117129824T>A	ENST00000307564.4	-	6	1888	c.1727A>T	c.(1726-1728)aAg>aTg	p.K576M	AKNA_ENST00000312033.3_Splice_Site_p.K576M|AKNA_ENST00000223791.3_Splice_Site_p.K36M|AKNA_ENST00000374088.3_Splice_Site_p.K576M|AKNA_ENST00000374075.5_Splice_Site_p.K495M	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	576					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						TCCACTCACCTTGGCCAGGAA	0.602																																																	0													33.0	33.0	33.0					9																	117129824		2203	4300	6503	SO:0001630	splice_region_variant	0			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.1728+1A>T	9.37:g.117129824T>A			Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	pfam_TF_AT-hook	p.K576M	ENST00000307564.4	37	c.1727	CCDS6805.1	9	.	.	.	.	.	.	.	.	.	.	T	21.2	4.110624	0.77210	.	.	ENSG00000106948	ENST00000307564;ENST00000394582;ENST00000374088;ENST00000223791;ENST00000374075;ENST00000312033	T;T;T;T;T	0.43294	2.2;2.2;2.05;2.2;0.95	5.05	5.05	0.67936	.	0.245479	0.29239	N	0.012735	T	0.54046	0.1834	L	0.51422	1.61	0.80722	D	1	D;D	0.76494	0.998;0.999	P;D	0.63192	0.819;0.912	T	0.56792	-0.7920	10	0.87932	D	0	-27.7219	11.3592	0.49633	0.0:0.0:0.0:1.0	.	576;495	Q7Z591;Q7Z591-2	AKNA_HUMAN;.	M	576;417;576;36;495;576	ENSP00000303769:K576M;ENSP00000363201:K576M;ENSP00000223791:K36M;ENSP00000363188:K495M;ENSP00000309222:K576M	ENSP00000223791:K36M	K	-	2	0	AKNA	116169645	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.261000	0.43276	2.244000	0.73946	0.533000	0.62120	AAG	AKNA	-	NULL	ENSG00000106948		0.602	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNA	HGNC	protein_coding	OTTHUMT00000053767.2	-	0.00	44	0	T	NM_030767	Missense_Mutation	117129824	-1	tier1	-	no_errors	ENST00000307564	ensembl	human	known	74_37	missense	11.54	23	3	SNP	1.000	A
ANAPC2	29882	genome.wustl.edu	37	9	140074823	140074823	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr9:140074823G>A	ENST00000323927.2	-	10	1704	c.1700C>T	c.(1699-1701)tCc>tTc	p.S567F		NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	567					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		GATGCGGCGGGAGTCCGCCAT	0.667																																																	0													34.0	36.0	36.0					9																	140074823		2203	4299	6502	SO:0001583	missense	0			AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.1700C>T	9.37:g.140074823G>A	ENSP00000314004:p.Ser567Phe		Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Missense_Mutation	SNP	pfam_Cullin_N,pfam_APC_su2_C,superfamily_Cullin_homology,smart_Cullin_homology,pfscan_Cullin_homology	p.S567F	ENST00000323927.2	37	c.1700	CCDS7033.1	9	.	.	.	.	.	.	.	.	.	.	G	19.44	3.828624	0.71258	.	.	ENSG00000176248	ENST00000323927	D	0.87334	-2.24	4.27	4.27	0.50696	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	D	0.93848	0.8032	M	0.88842	2.985	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.73708	0.981;0.968	D	0.94915	0.8068	10	0.87932	D	0	-23.5812	14.1985	0.65686	0.0:0.0:1.0:0.0	.	567;564	Q9UJX6;Q9UJX6-2	ANC2_HUMAN;.	F	567	ENSP00000314004:S567F	ENSP00000314004:S567F	S	-	2	0	ANAPC2	139194644	1.000000	0.71417	0.756000	0.31282	0.558000	0.35554	6.765000	0.74965	2.202000	0.70862	0.462000	0.41574	TCC	ANAPC2	-	pfam_Cullin_N,superfamily_Cullin_homology,smart_Cullin_homology,pfscan_Cullin_homology	ENSG00000176248		0.667	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC2	HGNC	protein_coding	OTTHUMT00000055315.1	-	0.00	69	0	G	NM_013366		140074823	-1	tier1	-	no_errors	ENST00000323927	ensembl	human	known	74_37	missense	15.07	62	11	SNP	0.998	A
ANK3	288	genome.wustl.edu	37	10	61835810	61835810	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr10:61835810G>T	ENST00000280772.2	-	37	5020	c.4829C>A	c.(4828-4830)cCc>cAc	p.P1610H	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron|ANK3_ENST00000355288.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1610	Ser-rich.				axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						CCCTTTTAAGGGCGTAGCTTC	0.483																																																	0													105.0	104.0	104.0					10																	61835810		2203	4300	6503	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.4829C>A	10.37:g.61835810G>T	ENSP00000280772:p.Pro1610His		B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.P1610H	ENST00000280772.2	37	c.4829	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	G	16.11	3.029941	0.54790	.	.	ENSG00000151150	ENST00000280772	T	0.64438	-0.1	5.79	5.79	0.91817	.	0.172360	0.27896	N	0.017416	T	0.57184	0.2036	L	0.36672	1.1	0.80722	D	1	P	0.52842	0.956	B	0.43916	0.436	T	0.62167	-0.6911	10	0.66056	D	0.02	.	15.7864	0.78306	0.0:0.1738:0.8261:0.0	.	1610	Q12955	ANK3_HUMAN	H	1610	ENSP00000280772:P1610H	ENSP00000280772:P1610H	P	-	2	0	ANK3	61505816	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	5.123000	0.64703	2.739000	0.93911	0.591000	0.81541	CCC	ANK3	-	NULL	ENSG00000151150		0.483	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	-	0.00	55	0	G	NM_020987		61835810	-1	tier1	-	no_errors	ENST00000280772	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.997	T
ANKRD6	22881	genome.wustl.edu	37	6	90334314	90334314	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr6:90334314G>T	ENST00000522441.1	+	13	1916	c.1275G>T	c.(1273-1275)ttG>ttT	p.L425F	LYRM2_ENST00000520441.1_Intron|ANKRD6_ENST00000520793.1_Missense_Mutation_p.L366F|ANKRD6_ENST00000447838.2_Missense_Mutation_p.L425F|ANKRD6_ENST00000339746.4_Missense_Mutation_p.L425F|ANKRD6_ENST00000369408.5_Missense_Mutation_p.L390F	NM_001242811.1	NP_001229740.1	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	425					negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of JNK cascade (GO:0046330)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(3)|large_intestine(7)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|stomach(2)	21		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		AGAATCAGTTGGAGGCTACTG	0.433																																																	0													64.0	61.0	62.0					6																	90334314		1903	4115	6018	SO:0001583	missense	0			AB023174	CCDS47460.1, CCDS56441.1, CCDS56442.1, CCDS56443.1	6q14.2-q16.1	2013-03-20			ENSG00000135299	ENSG00000135299		"""Ankyrin repeat domain containing"""	17280	protein-coding gene	gene with protein product		610583					Standard	NM_001242809		Approved	KIAA0957	uc003pni.4	Q9Y2G4	OTTHUMG00000015202	ENST00000522441.1:c.1275G>T	6.37:g.90334314G>T	ENSP00000430985:p.Leu425Phe		B3KUC3|Q5JUJ4|Q5JUJ5|Q8IUQ8|Q9NU24|Q9UFQ9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L425F	ENST00000522441.1	37	c.1275	CCDS56441.1	6	.	.	.	.	.	.	.	.	.	.	G	21.7	4.185887	0.78789	.	.	ENSG00000135299	ENST00000369408;ENST00000339746;ENST00000447838;ENST00000522441;ENST00000518150;ENST00000520793	T;T;T;T;T	0.76060	0.52;0.52;0.51;0.52;-0.99	5.99	5.12	0.69794	.	0.000000	0.44097	D	0.000481	T	0.81437	0.4822	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	D;D;D;D	0.91635	0.986;0.999;0.999;0.991	D	0.84674	0.0713	10	0.87932	D	0	-8.4015	15.2166	0.73270	0.067:0.0:0.933:0.0	.	366;425;390;425	B3KUC3;Q9Y2G4;Q9Y2G4-1;C9JJE8	.;ANKR6_HUMAN;.;.	F	390;425;425;425;166;366	ENSP00000358416:L390F;ENSP00000345767:L425F;ENSP00000396771:L425F;ENSP00000430985:L425F;ENSP00000429782:L366F	ENSP00000345767:L425F	L	+	3	2	ANKRD6	90391035	1.000000	0.71417	0.996000	0.52242	0.676000	0.39594	6.095000	0.71439	1.545000	0.49373	0.655000	0.94253	TTG	ANKRD6	-	NULL	ENSG00000135299		0.433	ANKRD6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ANKRD6	HGNC	protein_coding	OTTHUMT00000376594.1		0.00	87	0	G			90334314	+1			no_errors	ENST00000339746	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
AP5Z1	9907	genome.wustl.edu	37	7	4824612	4824612	+	Silent	SNP	G	G	A	rs372643577	byFrequency	TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr7:4824612G>A	ENST00000348624.4	+	7	958	c.864G>A	c.(862-864)ccG>ccA	p.P288P	AP5Z1_ENST00000401897.1_Silent_p.P288P	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	288					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											GCCTGCTGCCGCCCCGGGAGC	0.672													G|||	2	0.000399361	0.0	0.0	5008	,	,		14509	0.0		0.0	False		,,,				2504	0.002																0								G		0,3836		0,0,1918	14.0	18.0	17.0		864	-1.6	0.3	7		17	1,8171		0,1,4085	no	coding-synonymous	KIAA0415	NM_014855.2		0,1,6003	AA,AG,GG		0.0122,0.0,0.0083		288/808	4824612	1,12007	1918	4086	6004	SO:0001819	synonymous_variant	0			AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.864G>A	7.37:g.4824612G>A			Q8N3X2|Q96H80	Silent	SNP	NULL	p.P288	ENST00000348624.4	37	c.864	CCDS47528.1	7																																																																																			AP5Z1	-	NULL	ENSG00000242802		0.672	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP5Z1	HGNC	protein_coding	OTTHUMT00000323771.1	-	0.00	67	0	G			4824612	+1	tier1	-	no_errors	ENST00000348624	ensembl	human	known	74_37	silent	32.18	57	28	SNP	0.997	A
APOC3	345	genome.wustl.edu	37	11	116703493	116703493	+	Missense_Mutation	SNP	G	G	A	rs149707394		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:116703493G>A	ENST00000227667.3	+	4	255	c.193G>A	c.(193-195)Gat>Aat	p.D65N	APOC3_ENST00000375345.1_Missense_Mutation_p.D83N	NM_000040.1	NP_000031.1	P02656	APOC3_HUMAN	apolipoprotein C-III	65					cellular response to glucose stimulus (GO:0071333)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle remodeling (GO:0034375)|inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of cholesterol import (GO:0060621)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of high-density lipoprotein particle clearance (GO:0010987)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of triglyceride catabolic process (GO:0010897)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|negative regulation of very-low-density lipoprotein particle remodeling (GO:0010903)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	cholesterol binding (GO:0015485)|enzyme regulator activity (GO:0030234)|high-density lipoprotein particle receptor binding (GO:0070653)|lipase inhibitor activity (GO:0055102)|phospholipid binding (GO:0005543)			endometrium(1)|lung(6)	7	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		CTGGGTGACCGATGGCTTCAG	0.557																																					GBM(81;259 1650 7161 35190)												0			GRCh37	CM942307	APOC3	M	rs149707394	G	ASN/ASP	0,4402		0,0,2201	150.0	136.0	141.0		193	-0.0	0.0	11	dbSNP_134	141	2,8590	2.2+/-6.3	0,2,4294	no	missense	APOC3	NM_000040.1	23	0,2,6495	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	65/100	116703493	2,12992	2201	4296	6497	SO:0001583	missense	0			X01388	CCDS8377.1	11q23.3	2013-01-24			ENSG00000110245	ENSG00000110245		"""Apolipoproteins"""	610	protein-coding gene	gene with protein product		107720					Standard	NM_000040		Approved		uc001ppt.1	P02656	OTTHUMG00000046115	ENST00000227667.3:c.193G>A	11.37:g.116703493G>A	ENSP00000227667:p.Asp65Asn		Q08E83|Q6Q786	Missense_Mutation	SNP	pfam_Apo-CIII	p.D65N	ENST00000227667.3	37	c.193	CCDS8377.1	11	.	.	.	.	.	.	.	.	.	.	G	17.42	3.384567	0.61845	0.0	2.33E-4	ENSG00000110245	ENST00000227667;ENST00000375345	D;D	0.87029	-2.2;-2.2	5.04	-0.00653	0.14013	.	1.097390	0.07192	N	0.855884	T	0.74839	0.3769	.	.	.	0.09310	N	1	B	0.15141	0.012	B	0.18561	0.022	T	0.56347	-0.7994	9	0.15066	T	0.55	-0.0993	7.4726	0.27357	0.4637:0.0:0.5363:0.0	.	65	P02656	APOC3_HUMAN	N	65;83	ENSP00000227667:D65N;ENSP00000364494:D83N	ENSP00000227667:D65N	D	+	1	0	APOC3	116208703	0.000000	0.05858	0.000000	0.03702	0.617000	0.37484	0.506000	0.22658	-0.152000	0.11156	0.555000	0.69702	GAT	APOC3	-	pfam_Apo-CIII	ENSG00000110245		0.557	APOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOC3	HGNC	protein_coding	OTTHUMT00000106284.2	-	0.00	97	0	G	NM_000040		116703493	+1	tier1	rs149707394	no_errors	ENST00000227667	ensembl	human	known	74_37	missense	26.37	67	24	SNP	0.000	A
AQP7	364	genome.wustl.edu	37	9	33386447	33386447	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr9:33386447G>T	ENST00000537089.1	-	4	403	c.85C>A	c.(85-87)Ctg>Atg	p.L29M	AQP7_ENST00000541274.1_Missense_Mutation_p.L29M|AQP7_ENST00000377425.4_Missense_Mutation_p.L64M|AQP7_ENST00000539936.1_Missense_Mutation_p.L121M			O14520	AQP7_HUMAN	aquaporin 7	121					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		AAGGAGCCCAGGAACTGCCCC	0.612																																																	0													24.0	25.0	24.0					9																	33386447		2203	4299	6502	SO:0001583	missense	0			AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.85C>A	9.37:g.33386447G>T	ENSP00000441619:p.Leu29Met		Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,prints_Aquaporin_3,tigrfam_MIP	p.L121M	ENST00000537089.1	37	c.361		9	.	.	.	.	.	.	.	.	.	.	-	16.94	3.260374	0.59431	.	.	ENSG00000165269	ENST00000537089;ENST00000379507;ENST00000297988;ENST00000377425;ENST00000439678;ENST00000379506;ENST00000539936;ENST00000541274;ENST00000379503	T;T;T;T;T;T;T;T;T	0.15603	2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41	4.42	1.5	0.22942	Aquaporin-like (2);	0.303270	0.31370	N	0.007766	T	0.28632	0.0709	M	0.83603	2.65	0.48341	D	0.999633	D;P;P;P;P	0.63046	0.992;0.871;0.767;0.871;0.949	P;P;P;P;P	0.51701	0.677;0.616;0.642;0.562;0.616	T	0.05550	-1.0878	10	0.59425	D	0.04	-9.6271	6.5516	0.22438	0.0903:0.0:0.5886:0.3211	.	29;120;121;64;121	B7Z7F6;Q5T5M0;B7Z4U2;Q6P5T0;O14520	.;.;.;.;AQP7_HUMAN	M	29;120;121;64;29;120;121;29;57	ENSP00000441619:L29M;ENSP00000368821:L120M;ENSP00000297988:L121M;ENSP00000396111:L64M;ENSP00000410138:L29M;ENSP00000368820:L120M;ENSP00000439534:L121M;ENSP00000438860:L29M;ENSP00000368817:L57M	ENSP00000297988:L121M	L	-	1	2	AQP7	33376447	0.991000	0.36638	1.000000	0.80357	0.802000	0.45316	0.784000	0.26816	0.591000	0.29711	-0.194000	0.12790	CTG	AQP7	-	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,tigrfam_MIP	ENSG00000165269		0.612	AQP7-202	KNOWN	basic	protein_coding	AQP7	HGNC	protein_coding		-	0.00	237	0	G	NM_001170		33386447	-1	tier1	-	no_errors	ENST00000297988	ensembl	human	known	74_37	missense	11.64	167	22	SNP	0.999	T
ARFGAP2	84364	genome.wustl.edu	37	11	47189519	47189519	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:47189519G>T	ENST00000524782.1	-	12	1374	c.1146C>A	c.(1144-1146)gaC>gaA	p.D382E	ARFGAP2_ENST00000395449.3_Intron|ARFGAP2_ENST00000419701.2_Missense_Mutation_p.D275E|ARFGAP2_ENST00000426335.2_Missense_Mutation_p.D246E|ARFGAP2_ENST00000319543.6_Missense_Mutation_p.D113E|RP11-390K5.6_ENST00000524412.1_RNA	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	382	Required for interaction with coatomer.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						CCTCTACCCTGTCCATACCCC	0.478																																																	0													75.0	68.0	70.0					11																	47189519		2201	4299	6500	SO:0001583	missense	0			AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.1146C>A	11.37:g.47189519G>T	ENSP00000434442:p.Asp382Glu		B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Missense_Mutation	SNP	pfam_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP	p.D382E	ENST00000524782.1	37	c.1146	CCDS7926.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.907|9.907	1.208592|1.208592	0.22205|0.22205	.|.	.|.	ENSG00000149182|ENSG00000149182	ENST00000426335;ENST00000524782;ENST00000319543;ENST00000419701;ENST00000526342;ENST00000527927|ENST00000527776	T;T;T;T;T;T|.	0.15017|.	3.57;3.67;3.31;3.42;2.46;2.9|.	6.02|6.02	4.15|4.15	0.48705|0.48705	.|.	0.084831|.	0.85682|.	D|.	0.000000|.	T|T	0.29524|0.29524	0.0736|0.0736	N|N	0.04636|0.04636	-0.2|-0.2	0.40890|0.40890	D|D	0.984065|0.984065	B;B;B|.	0.13145|.	0.007;0.004;0.002|.	B;B;B|.	0.17979|.	0.02;0.003;0.004|.	T|T	0.08722|0.08722	-1.0708|-1.0708	10|5	0.06365|.	T|.	0.9|.	-19.6883|-19.6883	8.2779|8.2779	0.31883|0.31883	0.1339:0.1293:0.7368:0.0|0.1339:0.1293:0.7368:0.0	.|.	275;246;382|.	B4DX29;G5E9L0;Q8N6H7|.	.;.;ARFG2_HUMAN|.	E|K	246;382;113;275;89;246|104	ENSP00000400226:D246E;ENSP00000434442:D382E;ENSP00000327309:D113E;ENSP00000389264:D275E;ENSP00000437305:D89E;ENSP00000434433:D246E|.	ENSP00000327309:D113E|.	D|Q	-|-	3|1	2|0	ARFGAP2|ARFGAP2	47146095|47146095	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	3.270000|3.270000	0.51600|0.51600	0.876000|0.876000	0.35872|0.35872	0.655000|0.655000	0.94253|0.94253	GAC|CAG	ARFGAP2	-	NULL	ENSG00000149182		0.478	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGAP2	HGNC	protein_coding	OTTHUMT00000391425.1	-	0.00	72	0	G	NM_032389		47189519	-1	tier1	-	no_errors	ENST00000524782	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
ARHGEF15	22899	genome.wustl.edu	37	17	8221919	8221919	+	Missense_Mutation	SNP	G	G	A	rs143720339		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr17:8221919G>A	ENST00000361926.3	+	11	1921	c.1811G>A	c.(1810-1812)cGc>cAc	p.R604H	AC135178.7_ENST00000458568.1_RNA|ARHGEF15_ENST00000421050.1_Missense_Mutation_p.R604H	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	604					negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						GAGGTGGGGCGCATGAAGCAG	0.612																																																	0								G	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	62.0	63.0	62.0		1811,1811	5.3	1.0	17	dbSNP_134	62	0,8600		0,0,4300	no	missense,missense	ARHGEF15	NM_025014.1,NM_173728.3	29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	604/842,604/842	8221919	1,13005	2203	4300	6503	SO:0001583	missense	0			AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.1811G>A	17.37:g.8221919G>A	ENSP00000355026:p.Arg604His		A8K6G1|Q8N449|Q9H8B4	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	p.R604H	ENST00000361926.3	37	c.1811	CCDS11139.1	17	.	.	.	.	.	.	.	.	.	.	g	23.0	4.358370	0.82243	2.27E-4	0.0	ENSG00000198844	ENST00000361926;ENST00000455564;ENST00000421050	T;T	0.32515	1.45;1.45	5.29	5.29	0.74685	Dbl homology (DH) domain (1);	0.059270	0.64402	D	0.000004	T	0.51160	0.1658	L	0.59436	1.845	0.46113	D	0.998873	D;D	0.89917	1.0;1.0	D;D	0.66979	0.948;0.948	T	0.49679	-0.8914	10	0.54805	T	0.06	-18.0429	16.4339	0.83864	0.0:0.0:1.0:0.0	.	604;604	D3DTR7;O94989	.;ARHGF_HUMAN	H	604;394;604	ENSP00000355026:R604H;ENSP00000412505:R604H	ENSP00000355026:R604H	R	+	2	0	ARHGEF15	8162644	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.368000	0.59505	2.470000	0.83445	0.555000	0.69702	CGC	ARHGEF15	-	superfamily_DH-domain	ENSG00000198844		0.612	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF15	HGNC	protein_coding	OTTHUMT00000226993.2		0.00	51	0	G	NM_173728		8221919	+1			no_errors	ENST00000361926	ensembl	human	known	74_37	missense	8.00	23	2	SNP	1.000	A
ARSI	340075	genome.wustl.edu	37	5	149676934	149676934	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr5:149676934delC	ENST00000328668.7	-	2	2132	c.1553delG	c.(1552-1554)ggtfs	p.G518fs		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	518					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCCCCAAGCACCCCCATTAAA	0.607																																																	0													78.0	93.0	88.0					5																	149676934		2203	4300	6503	SO:0001589	frameshift_variant	0			AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.1553delG	5.37:g.149676934delC	ENSP00000333395:p.Gly518fs		A1L3B0|B3KV22|B7XD03	Frame_Shift_Del	DEL	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.G518fs	ENST00000328668.7	37	c.1553	CCDS34275.1	5																																																																																			ARSI	-	superfamily_Alkaline_phosphatase_core	ENSG00000183876		0.607	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSI	HGNC	protein_coding	OTTHUMT00000373681.1		0.00	38	0	C	NM_001012301		149676934	-1			no_errors	ENST00000328668	ensembl	human	known	74_37	frame_shift_del	26.32	28	10	DEL	1.000	0
MRPS18B	28973	genome.wustl.edu	37	6	30594688	30594688	+	IGR	SNP	C	C	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr6:30594688C>A	ENST00000259873.4	+	0	1532				ATAT1_ENST00000319027.5_Missense_Mutation_p.A9E|ATAT1_ENST00000376485.4_Missense_Mutation_p.A9E|ATAT1_ENST00000376478.2_Missense_Mutation_p.A9E|ATAT1_ENST00000468713.1_3'UTR|ATAT1_ENST00000329992.8_Missense_Mutation_p.A9E|ATAT1_ENST00000330083.5_5'UTR|ATAT1_ENST00000376483.4_Missense_Mutation_p.A9E|ATAT1_ENST00000318999.7_Missense_Mutation_p.A9E	NM_014046.3	NP_054765.1	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B						translation (GO:0006412)	cell junction (GO:0030054)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(2)	13						GATGTGGACGCGCTGTTCCCG	0.701																																																	0													61.0	31.0	42.0					6																	30594688		1508	2708	4216	SO:0001628	intergenic_variant	0			AF100761	CCDS4682.1	6p21	2012-09-13			ENSG00000204568	ENSG00000204568		"""Mitochondrial ribosomal proteins / small subunits"""	14516	protein-coding gene	gene with protein product		611982				11279123	Standard	NM_014046		Approved	MRPS18-2, PTD017, C6orf14, HSPC183	uc003nqo.2	Q9Y676	OTTHUMG00000031268		6.37:g.30594688C>A			A6NDQ0|Q659G4|Q9BS27	Missense_Mutation	SNP	pfam_Alpha-TAT,superfamily_Acyl_CoA_acyltransferase	p.A9E	ENST00000259873.4	37	c.26	CCDS4682.1	6	.	.	.	.	.	.	.	.	.	.	C	14.21	2.466044	0.43839	.	.	ENSG00000137343	ENST00000318999;ENST00000376485;ENST00000376478;ENST00000319027;ENST00000376483;ENST00000329992	.	.	.	5.27	3.5	0.40072	.	0.554792	0.20111	N	0.099002	T	0.09862	0.0242	N	0.14661	0.345	0.31957	N	0.608931	P;D;B;P	0.60575	0.891;0.988;0.021;0.879	B;P;B;P	0.52267	0.272;0.694;0.038;0.58	T	0.02885	-1.1098	9	0.02654	T	1	-14.8273	7.3871	0.26888	0.0:0.739:0.0:0.261	.	9;9;9;9	Q5SQI0-3;Q5SQI0;Q5SQI0-6;Q5SQI0-4	.;ATAT_HUMAN;.;.	E	9	.	ENSP00000324222:A9E	A	+	2	0	ATAT1	30702667	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.011000	0.40922	0.796000	0.33947	0.563000	0.77884	GCG	ATAT1	-	NULL	ENSG00000137343		0.701	MRPS18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAT1	HGNC	protein_coding	OTTHUMT00000076584.2	-	0.00	123	0	C			30594688	+1	tier1	-	no_errors	ENST00000376485	ensembl	human	known	74_37	missense	23.08	79	24	SNP	0.998	A
ATM	472	genome.wustl.edu	37	11	108137916	108137916	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:108137916C>T	ENST00000452508.2	+	18	2674	c.2485C>T	c.(2485-2487)Cca>Tca	p.P829S	ATM_ENST00000278616.4_Missense_Mutation_p.P829S|AP001925.1_ENST00000596081.1_5'Flank			Q13315	ATM_HUMAN	ATM serine/threonine kinase	829					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CATCAAAAAGCCATTTGACCG	0.408			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													105.0	92.0	97.0					11																	108137916		2201	4298	6499	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.2485C>T	11.37:g.108137916C>T	ENSP00000388058:p.Pro829Ser		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.P829S	ENST00000452508.2	37	c.2485	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	C	10.74	1.434430	0.25813	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.01685	4.69;4.98;4.98	5.32	4.4	0.53042	Armadillo-type fold (1);	0.333863	0.34025	N	0.004321	T	0.02156	0.0067	M	0.67953	2.075	0.22693	N	0.998849	B	0.15719	0.014	B	0.12837	0.008	T	0.51301	-0.8723	10	0.05525	T	0.97	.	8.1037	0.30872	0.0:0.7532:0.1612:0.0856	.	829	Q13315	ATM_HUMAN	S	829	ENSP00000435747:P829S;ENSP00000278616:P829S;ENSP00000388058:P829S	ENSP00000278616:P829S	P	+	1	0	ATM	107643126	0.995000	0.38212	0.996000	0.52242	0.664000	0.39144	1.635000	0.37134	2.469000	0.83416	0.655000	0.94253	CCA	ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.408	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	-	0.00	50	0	C	NM_000051		108137916	+1	tier1	-	no_errors	ENST00000278616	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
ATN1	1822	genome.wustl.edu	37	12	7044758	7044758	+	Missense_Mutation	SNP	G	G	A	rs201715319		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr12:7044758G>A	ENST00000356654.4	+	5	565	c.328G>A	c.(328-330)Ggg>Agg	p.G110R	ATN1_ENST00000396684.2_Missense_Mutation_p.G110R	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	110		Cleavage.			cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						TAGCTTGGACGGGCGGAGCCT	0.537																																																	0													124.0	97.0	106.0					12																	7044758		2203	4300	6503	SO:0001583	missense	0			U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.328G>A	12.37:g.7044758G>A	ENSP00000349076:p.Gly110Arg		Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	pfam_Atrophin-like,prints_Atrophin-1	p.G110R	ENST00000356654.4	37	c.328	CCDS31734.1	12	.	.	.	.	.	.	.	.	.	.	G	18.63	3.665600	0.67700	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325	T;T;T	0.05081	3.5;3.5;3.5	3.95	3.95	0.45737	.	0.000000	0.32503	U	0.006009	T	0.14056	0.0340	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.98	T	0.13980	-1.0489	10	0.49607	T	0.09	.	16.5623	0.84569	0.0:0.0:1.0:0.0	.	110;110	Q86V38;P54259	.;ATN1_HUMAN	R	110	ENSP00000349076:G110R;ENSP00000379915:G110R;ENSP00000441744:G110R	ENSP00000349076:G110R	G	+	1	0	ATN1	6915019	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.221000	0.51215	2.199000	0.70637	0.460000	0.39030	GGG	ATN1	-	pfam_Atrophin-like	ENSG00000111676		0.537	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATN1	HGNC	protein_coding	OTTHUMT00000401948.2	-	0.00	82	0	G	NM_001940		7044758	+1	tier1	-	no_errors	ENST00000356654	ensembl	human	known	74_37	missense	20.29	55	14	SNP	1.000	A
BDH2	56898	genome.wustl.edu	37	4	104000908	104000908	+	Missense_Mutation	SNP	G	G	A	rs56124221		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr4:104000908G>A	ENST00000296424.4	-	10	809	c.689C>T	c.(688-690)gCt>gTt	p.A230V	SLC9B2_ENST00000339611.4_5'Flank|SLC9B2_ENST00000394785.3_5'Flank|SLC9B2_ENST00000503230.1_5'Flank	NM_020139.3	NP_064524.3	Q9BUT1	BDH2_HUMAN	3-hydroxybutyrate dehydrogenase, type 2	230				A -> T (in Ref. 6; AAH95414). {ECO:0000305}.	epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|heme metabolic process (GO:0042168)|iron ion homeostasis (GO:0055072)|siderophore biosynthetic process (GO:0019290)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	3-hydroxybutyrate dehydrogenase activity (GO:0003858)|NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|urinary_tract(1)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.02e-08)		AGTTACATAAGCAGACTGCAG	0.423																																																	0													131.0	114.0	120.0					4																	104000908		2203	4300	6503	SO:0001583	missense	0			AF164790	CCDS3663.1	4q24	2011-09-14			ENSG00000164039	ENSG00000164039	1.1.1.30	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	32389	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 15C, member 1"""		"""dehydrogenase/reductase (SDR family) member 6"""	DHRS6		16380372, 19027726	Standard	XM_005263140		Approved	UCPA-OR, FLJ13261, UNQ6308, PRO20933, SDR15C1	uc003hwz.3	Q9BUT1	OTTHUMG00000074039	ENST00000296424.4:c.689C>T	4.37:g.104000908G>A	ENSP00000296424:p.Ala230Val		A8K295|B4DUF6|Q503A0|Q6IA46|Q6UWD3|Q9H8S8|Q9NRX8	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DHB_DH,prints_DH_sc/Rdtase_SDR,prints_ADH_insect	p.A230V	ENST00000296424.4	37	c.689	CCDS3663.1	4	.	.	.	.	.	.	.	.	.	.	G	18.00	3.525815	0.64860	.	.	ENSG00000164039	ENST00000296424	T	0.23950	1.88	5.31	4.47	0.54385	NAD(P)-binding domain (1);	0.218408	0.48286	D	0.000189	T	0.23451	0.0567	M	0.65320	2	0.46678	D	0.999153	P	0.38455	0.632	B	0.32624	0.149	T	0.05649	-1.0872	10	0.66056	D	0.02	.	8.5084	0.33201	0.177:0.0:0.823:0.0	rs56124221	230	Q9BUT1	BDH2_HUMAN	V	230	ENSP00000296424:A230V	ENSP00000296424:A230V	A	-	2	0	BDH2	104220357	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.298000	0.89944	1.371000	0.46172	0.585000	0.79938	GCT	BDH2	-	prints_DHB_DH	ENSG00000164039		0.423	BDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BDH2	HGNC	protein_coding	OTTHUMT00000157159.2		0.00	65	0	G	NM_020139		104000908	-1			no_errors	ENST00000296424	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	A
BPIFA1	51297	genome.wustl.edu	37	20	31825905	31825905	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr20:31825905G>C	ENST00000354297.4	+	3	276	c.205G>C	c.(205-207)Gaa>Caa	p.E69Q	BPIFA1_ENST00000375413.4_Missense_Mutation_p.E69Q|BPIFA1_ENST00000375422.2_Missense_Mutation_p.E69Q	NM_130852.2	NP_570913.1	Q9NP55	BPIA1_HUMAN	BPI fold containing family A, member 1	69					antibacterial humoral response (GO:0019731)|innate immune response (GO:0045087)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|regulation of liquid surface tension (GO:0050828)|regulation of sodium ion transmembrane transport (GO:1902305)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)										GGGCATTCTGGAAAACCTTCC	0.567																																																	0													61.0	60.0	61.0					20																	31825905		2203	4300	6503	SO:0001583	missense	0			AB024937	CCDS13217.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000198183	ENSG00000198183		"""BPI fold containing"""	15749	protein-coding gene	gene with protein product		607412	"""palate, lung and nasal epithelium carcinoma associated"", ""palate, lung and nasal epithelium associated"""	PLUNC		11018263, 11251963, 21787333	Standard	NM_130852		Approved	LUNX, bA49G10.5, SPLUNC1	uc002wyv.3	Q9NP55	OTTHUMG00000032243	ENST00000354297.4:c.205G>C	20.37:g.31825905G>C	ENSP00000346251:p.Glu69Gln		A8K9R3|E1P5M9|Q9NZT0	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom	p.E69Q	ENST00000354297.4	37	c.205	CCDS13217.1	20	.	.	.	.	.	.	.	.	.	.	G	10.48	1.362556	0.24684	.	.	ENSG00000198183	ENST00000375422;ENST00000354297;ENST00000375413;ENST00000544328	T;T;T	0.05382	3.45;3.45;3.45	5.43	-2.71	0.05986	.	0.580480	0.17514	N	0.171481	T	0.04227	0.0117	L	0.33753	1.03	0.09310	N	1	B	0.23937	0.094	B	0.25614	0.062	T	0.42137	-0.9469	10	0.23302	T	0.38	-0.079	7.3723	0.26808	0.1933:0.4806:0.326:0.0	.	69	Q9NP55	BPIA1_HUMAN	Q	69;69;69;55	ENSP00000364571:E69Q;ENSP00000346251:E69Q;ENSP00000364562:E69Q	ENSP00000346251:E69Q	E	+	1	0	BPIFA1	31289566	0.001000	0.12720	0.001000	0.08648	0.030000	0.12068	-0.472000	0.06623	-0.151000	0.11176	0.655000	0.94253	GAA	BPIFA1	-	pfam_Lipid-bd_serum_glycop_N	ENSG00000198183		0.567	BPIFA1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	BPIFA1	HGNC	protein_coding	OTTHUMT00000078667.2	-	0.00	57	0	G	NM_130852		31825905	+1	tier1	-	no_errors	ENST00000354297	ensembl	human	known	74_37	missense	32.56	58	28	SNP	0.001	C
BRD4	23476	genome.wustl.edu	37	19	15375435	15375435	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:15375435G>T	ENST00000263377.2	-	6	1213	c.992C>A	c.(991-993)cCa>cAa	p.P331Q	BRD4_ENST00000371835.4_Missense_Mutation_p.P331Q|BRD4_ENST00000602230.1_5'Flank|BRD4_ENST00000360016.5_Missense_Mutation_p.P331Q	NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	331					cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			GTCCTTCTTTGGAGGTTTCAC	0.637			T	C15orf55	lethal midline carcinoma of young people						OREG0025319	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																												Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	0													65.0	55.0	59.0					19																	15375435		2203	4300	6503	SO:0001583	missense	0			Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.992C>A	19.37:g.15375435G>T	ENSP00000263377:p.Pro331Gln	702	O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.P331Q	ENST00000263377.2	37	c.992	CCDS12328.1	19	.	.	.	.	.	.	.	.	.	.	G	24.0	4.480291	0.84747	.	.	ENSG00000141867	ENST00000263377;ENST00000371835;ENST00000360016	T;T;T	0.20069	2.1;2.1;2.1	5.45	5.45	0.79879	Bromodomain (1);	0.000000	0.64402	D	0.000008	T	0.51924	0.1703	M	0.84846	2.72	0.44643	D	0.997628	D;D;P	0.71674	0.974;0.998;0.937	P;D;B	0.69307	0.497;0.963;0.4	T	0.58312	-0.7658	10	0.72032	D	0.01	-10.3449	18.0458	0.89331	0.0:0.0:1.0:0.0	.	331;331;331	Q4G0X8;O60885-2;O60885	.;.;BRD4_HUMAN	Q	331	ENSP00000263377:P331Q;ENSP00000360901:P331Q;ENSP00000353112:P331Q	ENSP00000263377:P331Q	P	-	2	0	BRD4	15236435	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.383000	0.66219	2.556000	0.86216	0.563000	0.77884	CCA	BRD4	-	superfamily_Bromodomain	ENSG00000141867		0.637	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	BRD4	HGNC	protein_coding	OTTHUMT00000465800.3		0.00	80	0	G	NM_058243		15375435	-1			no_errors	ENST00000263377	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
C16orf89	146556	genome.wustl.edu	37	16	5105319	5105319	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr16:5105319A>C	ENST00000315997.5	-	6	997	c.796T>G	c.(796-798)Ttc>Gtc	p.F266V	C16orf89_ENST00000474471.3_Missense_Mutation_p.F298V|C16orf89_ENST00000422873.1_Missense_Mutation_p.F304V|C16orf89_ENST00000350219.4_Missense_Mutation_p.F304V|ALG1_ENST00000588623.1_Intron|C16orf89_ENST00000472572.3_Missense_Mutation_p.F266V	NM_152459.4	NP_689672.4	Q6UX73	CP089_HUMAN	chromosome 16 open reading frame 89	266						cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	12						AGCTTGTAGAAGTCGGAGAAG	0.637																																																	0													24.0	26.0	26.0					16																	5105319		1929	4143	6072	SO:0001583	missense	0				CCDS42116.1, CCDS45404.1, CCDS42116.2, CCDS45404.2	16p13.3	2011-12-12			ENSG00000153446	ENSG00000153446			28687	protein-coding gene	gene with protein product						12975309, 20578903	Standard	NM_001098514		Approved	MGC45438	uc010bud.3	Q6UX73	OTTHUMG00000159314	ENST00000315997.5:c.796T>G	16.37:g.5105319A>C	ENSP00000324672:p.Phe266Val		B4DUM5|Q8N2I3|Q8N4T1	Missense_Mutation	SNP	NULL	p.F304V	ENST00000315997.5	37	c.910	CCDS42116.2	16	.	.	.	.	.	.	.	.	.	.	A	21.9	4.220557	0.79464	.	.	ENSG00000153446	ENST00000474471;ENST00000472572;ENST00000477550;ENST00000422873;ENST00000350219;ENST00000315997	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.49	5.49	0.81192	.	0.129809	0.52532	D	0.000065	T	0.65186	0.2667	M	0.81341	2.54	0.42331	D	0.992292	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.70659	-0.4811	10	0.87932	D	0	-16.5523	11.9807	0.53119	1.0:0.0:0.0:0.0	.	266;304	Q6UX73;G3V0F0	CP089_HUMAN;.	V	298;266;266;304;304;298	ENSP00000417158:F298V;ENSP00000420566:F266V;ENSP00000390402:F304V;ENSP00000283478:F304V	ENSP00000324672:F298V	F	-	1	0	C16orf89	5045320	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.452000	0.66638	2.071000	0.62044	0.455000	0.32223	TTC	C16orf89	-	NULL	ENSG00000153446		0.637	C16orf89-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	C16orf89	HGNC	protein_coding	OTTHUMT00000354524.1	-	0.00	63	0	A	NM_152459		5105319	-1	tier1	-	no_errors	ENST00000350219	ensembl	human	known	74_37	missense	27.59	42	16	SNP	1.000	C
C16orf78	123970	genome.wustl.edu	37	16	49407973	49407973	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr16:49407973G>T	ENST00000299191.3	+	1	240	c.123G>T	c.(121-123)agG>agT	p.R41S		NM_144602.2	NP_653203.1	Q8WTQ4	CP078_HUMAN	chromosome 16 open reading frame 78	41						nucleus (GO:0005634)		p.R41S(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(1)	22						TGGAGCGGAGGCAGGGGAAGA	0.502																																																	1	Substitution - Missense(1)	lung(1)											83.0	79.0	80.0					16																	49407973		2199	4300	6499	SO:0001583	missense	0			BC021181	CCDS10738.1	16q12.1	2008-02-05			ENSG00000166152	ENSG00000166152			28479	protein-coding gene	gene with protein product						12477932	Standard	NM_144602		Approved	MGC33367	uc002efr.3	Q8WTQ4	OTTHUMG00000133149	ENST00000299191.3:c.123G>T	16.37:g.49407973G>T	ENSP00000299191:p.Arg41Ser			Missense_Mutation	SNP	NULL	p.R41S	ENST00000299191.3	37	c.123	CCDS10738.1	16	.	.	.	.	.	.	.	.	.	.	G	15.99	2.996165	0.54147	.	.	ENSG00000166152	ENST00000299191	T	0.60299	0.2	3.66	0.551	0.17225	.	0.120943	0.37906	N	0.001890	T	0.43122	0.1233	L	0.34521	1.04	0.30611	N	0.759529	D	0.54964	0.969	P	0.47134	0.539	T	0.44877	-0.9299	9	.	.	.	-69.353	4.0124	0.09629	0.2245:0.1964:0.5791:0.0	.	41	Q8WTQ4	CP078_HUMAN	S	41	ENSP00000299191:R41S	.	R	+	3	2	C16orf78	47965474	0.998000	0.40836	0.984000	0.44739	0.781000	0.44180	1.062000	0.30555	0.161000	0.19458	0.561000	0.74099	AGG	C16orf78	-	NULL	ENSG00000166152		0.502	C16orf78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf78	HGNC	protein_coding	OTTHUMT00000256846.1		0.00	63	0	G	NM_144602		49407973	+1			no_errors	ENST00000299191	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.985	T
C21orf58	54058	genome.wustl.edu	37	21	47721986	47721988	+	In_Frame_Del	DEL	TGG	TGG	-	rs144178764		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	TGG	TGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr21:47721986_47721988delTGG	ENST00000291691.7	-	8	2030_2032	c.894_896delCCA	c.(892-897)caccat>cat	p.298_299HH>H	C21orf58_ENST00000397682.3_In_Frame_Del_p.192_193HH>H|C21orf58_ENST00000397680.1_In_Frame_Del_p.192_193HH>H|C21orf58_ENST00000397683.1_In_Frame_Del_p.192_193HH>H|C21orf58_ENST00000472607.1_5'UTR|C21orf58_ENST00000397679.1_In_Frame_Del_p.192_193HH>H	NM_058180.3	NP_478060.2	P58505	CU058_HUMAN	chromosome 21 open reading frame 58	298	Poly-His.							p.H299_A300insH(3)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(1)|pancreas(1)	9	Breast(49;0.112)			Colorectal(79;0.239)		CCACACAGCAtggtggtggtggt	0.704																																																	3	Insertion - In frame(3)	breast(2)|central_nervous_system(1)								573,1,211,2791		116,0,12,329,0,0,1,27,145,1158						-4.4	0.0		dbSNP_130	7	1951,10,230,4919		506,0,22,917,3,0,4,18,172,1913	no	codingComplex	C21orf58	NM_058180.3		622,0,34,1246,3,0,5,45,317,3071	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		30.8158,21.9519,27.8495				2524,11,441,7710				SO:0001651	inframe_deletion	0				CCDS13735.1, CCDS68229.1	21q22.3	2008-07-07			ENSG00000160298	ENSG00000160298			1300	protein-coding gene	gene with protein product							Standard	XM_005261149		Approved		uc002zjf.3	P58505	OTTHUMG00000090634	ENST00000291691.7:c.894_896delCCA	21.37:g.47721995_47721997delTGG	ENSP00000291691:p.His299del		B3KPI1	In_Frame_Del	DEL	NULL	p.H299in_frame_del	ENST00000291691.7	37	c.896_894	CCDS13735.1	21																																																																																			C21orf58	-	NULL	ENSG00000160298		0.704	C21orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf58	HGNC	protein_coding	OTTHUMT00000207283.1		0.00	36	0	TGG	NM_058180		47721988	-1	tier1		no_errors	ENST00000291691	ensembl	human	known	74_37	in_frame_del	5.71	33	2	DEL	0.001:0.001:0.001	-
C2orf68	388969	genome.wustl.edu	37	2	85838932	85838932	+	Intron	SNP	C	C	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:85838932C>A	ENST00000306336.5	-	2	152				USP39_ENST00000459775.1_Intron|USP39_ENST00000450066.2_5'Flank|C2orf68_ENST00000478626.1_5'Flank|C2orf68_ENST00000409734.3_Intron	NM_001013649.3	NP_001013671.2	Q2NKX9	CB068_HUMAN	chromosome 2 open reading frame 68											breast(1)|central_nervous_system(1)|endometrium(1)	3						GAGCGGGAGTCAGGGACTGTC	0.721																																																	0													15.0	22.0	20.0					2																	85838932		1944	4099	6043	SO:0001627	intron_variant	0				CCDS42704.1	2p11.2	2008-07-18			ENSG00000168887	ENSG00000168887			34353	protein-coding gene	gene with protein product							Standard	NM_001013649		Approved		uc002sqc.2	Q2NKX9	OTTHUMG00000153088	ENST00000306336.5:c.108-23G>T	2.37:g.85838932C>A			B4DT10|Q4G0J7|Q6ZVA6	Nonstop_Mutation	SNP	pfam_UPF0561	p.*59L	ENST00000306336.5	37	c.176	CCDS42704.1	2																																																																																			C2orf68	-	NULL	ENSG00000168887		0.721	C2orf68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf68	HGNC	protein_coding	OTTHUMT00000329451.1	-	0.00	39	0	C	NM_001013649		85838932	-1	tier1	-	no_errors	ENST00000423181	ensembl	human	known	74_37	nonstop	30.51	41	18	SNP	1.000	A
C6orf211	79624	genome.wustl.edu	37	6	151773812	151773812	+	Intron	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr6:151773812G>A	ENST00000367294.3	+	1	300				C6orf211_ENST00000545879.1_Intron|RMND1_ENST00000367303.4_5'Flank|C6orf211_ENST00000483931.1_3'UTR	NM_024573.1	NP_078849.1	Q9H993	CF211_HUMAN	chromosome 6 open reading frame 211											breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(7)	15			BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)		CCGCTCCCCGGTGGGCTGCGT	0.721																																																	0																																										SO:0001627	intron_variant	0			AJ420548	CCDS5233.1, CCDS69224.1	6q25.1	2013-01-07			ENSG00000146476	ENSG00000146476			17872	protein-coding gene	gene with protein product							Standard	NM_001286562		Approved	FLJ12910	uc003qok.1	Q9H993	OTTHUMG00000015838	ENST00000367294.3:c.41+91G>A	6.37:g.151773812G>A			Q96FC6|Q9UFY5	RNA	SNP	-	NULL	ENST00000367294.3	37	NULL	CCDS5233.1	6																																																																																			C6orf211	-	-	ENSG00000146476		0.721	C6orf211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf211	HGNC	protein_coding	OTTHUMT00000042724.1	-	0.00	87	0	G	NM_024573		151773812	+1	tier1	-	no_errors	ENST00000483931	ensembl	human	known	74_37	rna	5.56	68	4	SNP	0.000	A
CAB39	51719	genome.wustl.edu	37	2	231657972	231657972	+	Silent	SNP	A	A	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:231657972A>G	ENST00000258418.5	+	4	753	c.324A>G	c.(322-324)agA>agG	p.R108R	CAB39_ENST00000410084.3_Silent_p.R108R|CAB39_ENST00000409788.3_Silent_p.R108R	NM_016289.3	NP_057373.1	Q9Y376	CAB39_HUMAN	calcium binding protein 39	108					activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|cellular hypotonic response (GO:0071476)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of rubidium ion transmembrane transporter activity (GO:2000687)|negative regulation of rubidium ion transport (GO:2000681)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein heterooligomerization (GO:0051291)|signal transduction by phosphorylation (GO:0023014)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activator activity (GO:0043539)			central_nervous_system(1)|large_intestine(1)|skin(1)	3		all_lung(227;4.63e-07)|all_hematologic(139;1.83e-06)|Lung NSC(271;2.11e-05)|Acute lymphoblastic leukemia(138;5.51e-05)|Hepatocellular(293;0.0207)|Lung SC(224;0.187)		all cancers(144;1.64e-12)|Epithelial(121;5.29e-11)|LUSC - Lung squamous cell carcinoma(224;0.0154)|Lung(119;0.0177)|COAD - Colon adenocarcinoma(134;0.226)		TTCTCAGAAGACAAATTGGTA	0.323																																																	0													124.0	122.0	123.0					2																	231657972		2203	4300	6503	SO:0001819	synonymous_variant	0			AF113536	CCDS2478.1	2q37.1	2008-02-05			ENSG00000135932	ENSG00000135932			20292	protein-coding gene	gene with protein product		612174					Standard	NM_016289		Approved	CGI-66, MO25	uc002vqx.3	Q9Y376	OTTHUMG00000133220	ENST00000258418.5:c.324A>G	2.37:g.231657972A>G			A8K8L7	Silent	SNP	pfam_Mo25,superfamily_ARM-type_fold	p.R108	ENST00000258418.5	37	c.324	CCDS2478.1	2																																																																																			CAB39	-	pfam_Mo25,superfamily_ARM-type_fold	ENSG00000135932		0.323	CAB39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAB39	HGNC	protein_coding	OTTHUMT00000256955.2	-	0.00	57	0	A	NM_016289		231657972	+1	tier1	-	no_errors	ENST00000258418	ensembl	human	known	74_37	silent	22.39	52	15	SNP	1.000	G
CACNA1A	773	genome.wustl.edu	37	19	13616887	13616887	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:13616887G>T	ENST00000360228.5	-	1	151	c.152C>A	c.(151-153)tCa>tAa	p.S51*	CACNA1A_ENST00000573710.2_Nonsense_Mutation_p.S51*	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	51					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.S51*(3)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CTGCGCCATTGACTGCTTGTA	0.687																																																	3	Substitution - Nonsense(3)	lung(3)											85.0	90.0	88.0					19																	13616887		2077	4212	6289	SO:0001587	stop_gained	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.152C>A	19.37:g.13616887G>T	ENSP00000353362:p.Ser51*		J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.S51*	ENST00000360228.5	37	c.152	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	G	40	8.442518	0.98813	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	.	.	.	3.04	1.98	0.26296	.	0.000000	0.49916	U	0.000124	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.1312	0.36846	0.1155:0.0:0.8845:0.0	.	.	.	.	X	51	.	ENSP00000317661:S51X	S	-	2	0	CACNA1A	13477887	1.000000	0.71417	0.976000	0.42696	0.948000	0.59901	9.247000	0.95444	0.478000	0.27488	0.508000	0.49915	TCA	CACNA1A	-	NULL	ENSG00000141837		0.687	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2		0.00	44	0	G	NM_000068		13616887	-1			no_errors	ENST00000360228	ensembl	human	known	74_37	nonsense	6.06	31	2	SNP	0.996	T
CAMK1D	57118	genome.wustl.edu	37	10	12391792	12391792	+	5'UTR	SNP	G	G	A	rs374252424	byFrequency	TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr10:12391792G>A	ENST00000378847.3	+	0	312				CAMK1D_ENST00000378845.1_5'UTR|CAMK1D_ENST00000487696.1_3'UTR	NM_153498.2	NP_705718.1	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID						inflammatory response (GO:0006954)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis (GO:0050766)|positive regulation of respiratory burst (GO:0060267)|regulation of dendrite development (GO:0050773)|regulation of granulocyte chemotaxis (GO:0071622)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)	16				GBM - Glioblastoma multiforme(1;3.16e-05)		gcccccggccgctcctccgcg	0.736																																																	0													9.0	10.0	10.0					10																	12391792		2161	4247	6408	SO:0001623	5_prime_UTR_variant	0			AF286366	CCDS7091.1, CCDS7092.1	10p13	2003-11-05			ENSG00000183049	ENSG00000183049			19341	protein-coding gene	gene with protein product		607957				11050006	Standard	XM_006717481		Approved	CKLiK	uc001ilo.3	Q8IU85	OTTHUMG00000017683	ENST00000378847.3:c.-26G>A	10.37:g.12391792G>A			B0YIY0|Q9HD31	RNA	SNP	-	NULL	ENST00000378847.3	37	NULL	CCDS7091.1	10																																																																																			CAMK1D	-	-	ENSG00000183049		0.736	CAMK1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK1D	HGNC	protein_coding	OTTHUMT00000046820.1	-	0.00	61	0	G	NM_020397		12391792	+1	tier1	-	no_errors	ENST00000487696	ensembl	human	known	74_37	rna	59.62	21	31	SNP	0.001	A
CCDC115	84317	genome.wustl.edu	37	2	131097207	131097207	+	Intron	SNP	C	C	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:131097207C>G	ENST00000259229.2	-	5	654				IMP4_ENST00000259239.3_5'Flank|CCDC115_ENST00000437688.2_Missense_Mutation_p.E182Q|CCDC115_ENST00000409127.1_Intron	NM_032357.2	NP_115733.2	Q96NT0	CC115_HUMAN	coiled-coil domain containing 115							endosome (GO:0005768)|lysosome (GO:0005764)|membrane (GO:0016020)				central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)	7	Colorectal(110;0.1)					gctgatgtctctgctggaaca	0.547																																																	0																																										SO:0001627	intron_variant	0			AK054693	CCDS2159.1	2q21.1	2010-12-24			ENSG00000136710	ENSG00000136710			28178	protein-coding gene	gene with protein product		613734				21118521	Standard	XM_005263825		Approved	MGC12981, FLJ30131, ccp1	uc002tqy.1	Q96NT0	OTTHUMG00000131631	ENST00000259229.2:c.431-402G>C	2.37:g.131097207C>G			B4DJ47|Q9BR88	Missense_Mutation	SNP	NULL	p.E187Q	ENST00000259229.2	37	c.559	CCDS2159.1	2	.	.	.	.	.	.	.	.	.	.	C	10.05	1.243813	0.22796	.	.	ENSG00000136710	ENST00000437688	.	.	.	1.83	-0.0561	0.13806	.	.	.	.	.	T	0.26955	0.0660	.	.	.	0.09310	N	1	B;B	0.26775	0.159;0.159	B;B	0.19391	0.025;0.018	T	0.23404	-1.0189	7	0.87932	D	0	.	4.1615	0.10285	0.0:0.6094:0.0:0.3906	.	182;187	B4DJ47;F8WCZ3	.;.	Q	182	.	ENSP00000399756:E182Q	E	-	1	0	CCDC115	130813677	0.001000	0.12720	0.001000	0.08648	0.170000	0.22686	0.019000	0.13444	-0.021000	0.14009	0.407000	0.27541	GAG	CCDC115	-	NULL	ENSG00000136710		0.547	CCDC115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC115	HGNC	protein_coding	OTTHUMT00000254524.2	-	0.00	31	0	C	NM_032357		131097207	-1	tier1	-	no_errors	ENST00000442217	ensembl	human	known	74_37	missense	58.97	16	23	SNP	0.001	G
CCDC132	55610	genome.wustl.edu	37	7	92970741	92970741	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr7:92970741A>C	ENST00000305866.5	+	23	2189	c.2061A>C	c.(2059-2061)gaA>gaC	p.E687D	CCDC132_ENST00000535481.1_Missense_Mutation_p.E407D|CCDC132_ENST00000544910.1_Missense_Mutation_p.E657D|CCDC132_ENST00000474412.1_3'UTR|CCDC132_ENST00000541136.1_Missense_Mutation_p.E498D	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	687						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			ATTTTCAGGAAGTTTCAGCTG	0.383																																																	0													87.0	88.0	87.0					7																	92970741		1933	4136	6069	SO:0001583	missense	0			AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.2061A>C	7.37:g.92970741A>C	ENSP00000307666:p.Glu687Asp		B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	pfam_Vacuolar_sorting-assoc_54,pfam_DUF2451_C	p.E687D	ENST00000305866.5	37	c.2061	CCDS43617.1	7	.	.	.	.	.	.	.	.	.	.	A	11.05	1.523536	0.27299	.	.	ENSG00000004766	ENST00000305866;ENST00000544910;ENST00000541136;ENST00000535481	.	.	.	5.55	-3.14	0.05250	.	0.172037	0.52532	D	0.000063	T	0.44265	0.1285	L	0.55481	1.735	0.80722	D	1	B;B;B	0.29590	0.162;0.25;0.162	B;B;B	0.30572	0.055;0.117;0.055	T	0.10847	-1.0612	9	0.39692	T	0.17	-19.0119	7.1677	0.25700	0.3537:0.0:0.5147:0.1316	.	407;657;687	B4DS55;F5H5U7;Q96JG6	.;.;CC132_HUMAN	D	687;657;498;407	.	ENSP00000307666:E687D	E	+	3	2	CCDC132	92808677	1.000000	0.71417	0.989000	0.46669	0.005000	0.04900	1.480000	0.35464	-0.351000	0.08249	-1.140000	0.01884	GAA	CCDC132	-	NULL	ENSG00000004766		0.383	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC132	HGNC	protein_coding	OTTHUMT00000341687.1	-	0.00	68	0	A	NM_017667		92970741	+1	tier1	-	no_errors	ENST00000305866	ensembl	human	known	74_37	missense	17.33	62	13	SNP	1.000	C
CFAP58	159686	genome.wustl.edu	37	10	106139896	106139896	+	Missense_Mutation	SNP	C	C	T	rs34038957		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr10:106139896C>T	ENST00000369704.3	+	9	1417	c.1283C>T	c.(1282-1284)gCt>gTt	p.A428V	CCDC147_ENST00000369703.1_Missense_Mutation_p.A50V|CCDC147_ENST00000312902.5_Missense_Mutation_p.A50V	NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		428						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		AAGGATGAGGCTCAGAAGCAG	0.493																																																	0													131.0	122.0	125.0					10																	106139896		2203	4300	6503	SO:0001583	missense	0																														ENST00000369704.3:c.1283C>T	10.37:g.106139896C>T	ENSP00000358718:p.Ala428Val		D3DRA6|Q8NA27	Missense_Mutation	SNP	superfamily_Homeodomain-like	p.A428V	ENST00000369704.3	37	c.1283	CCDS31282.1	10	.	.	.	.	.	.	.	.	.	.	C	28.3	4.908623	0.92107	.	.	ENSG00000120051	ENST00000369704;ENST00000312902;ENST00000369703	T	0.33438	1.41	5.31	5.31	0.75309	.	0.048061	0.85682	D	0.000000	T	0.30947	0.0781	L	0.49455	1.56	0.80722	D	1	P	0.40794	0.729	B	0.36922	0.236	T	0.09164	-1.0687	10	0.48119	T	0.1	-8.2454	17.1399	0.86750	0.0:1.0:0.0:0.0	.	428	Q5T655	CC147_HUMAN	V	428;50;50	ENSP00000358718:A428V	ENSP00000323620:A50V	A	+	2	0	CCDC147	106129886	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	7.703000	0.84585	2.485000	0.83878	0.557000	0.71058	GCT	CCDC147	-	NULL	ENSG00000120051		0.493	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC147	HGNC	protein_coding	OTTHUMT00000050216.1		0.00	57	0	C			106139896	+1			no_errors	ENST00000369704	ensembl	human	known	74_37	missense	5.13	73	4	SNP	1.000	T
CCDC74A	90557	genome.wustl.edu	37	2	132290352	132290352	+	Missense_Mutation	SNP	G	G	C	rs376130814		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:132290352G>C	ENST00000295171.6	+	5	1012	c.874G>C	c.(874-876)Gag>Cag	p.E292Q	CCDC74A_ENST00000467992.2_3'UTR|CCDC74A_ENST00000409856.3_Missense_Mutation_p.E226Q	NM_001258304.1|NM_001258305.1|NM_138770.2	NP_001245233.1|NP_001245234.1|NP_620125.1	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A	292										endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						GCAGACCCAAGAGGTGAGGCC	0.652																																																	0								G	GLN/GLU	0,4404		0,0,2202	32.0	35.0	34.0		874	2.7	1.0	2		34	2,8588		0,2,4293	no	missense	CCDC74A	NM_138770.1	29	0,2,6495	CC,CG,GG		0.0233,0.0,0.0154	probably-damaging	292/379	132290352	2,12992	2202	4295	6497	SO:0001583	missense	0				CCDS2167.1, CCDS58732.1, CCDS74578.1	2q21.1	2008-02-05		2006-02-16	ENSG00000163040	ENSG00000163040			25197	protein-coding gene	gene with protein product						12477932	Standard	NM_138770		Approved	FLJ40345	uc002ttb.4	Q96AQ1	OTTHUMG00000131667	ENST00000295171.6:c.874G>C	2.37:g.132290352G>C	ENSP00000295171:p.Glu292Gln		Q6P4I5	Missense_Mutation	SNP	NULL	p.E292Q	ENST00000295171.6	37	c.874	CCDS2167.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	14.21|14.21	2.466460|2.466460	0.43839|0.43839	0.0|0.0	2.33E-4|2.33E-4	ENSG00000163040|ENSG00000163040	ENST00000295171;ENST00000409856|ENST00000434330	T;T|T	0.53206|0.55930	0.63;0.63|0.49	2.66|2.66	2.66|2.66	0.31614|0.31614	.|.	0.000000|.	0.36854|.	U|.	0.002376|.	T|T	0.60818|0.60818	0.2298|0.2298	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.999;0.968|.	D;D|.	0.80764|.	0.994;0.969|.	T|T	0.61710|0.61710	-0.7007|-0.7007	10|7	0.87932|0.51188	D|T	0|0.08	.|.	9.0698|9.0698	0.36486|0.36486	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	226;292|.	Q96AQ1-2;Q96AQ1|.	.;CC74A_HUMAN|.	Q|N	292;226|180	ENSP00000295171:E292Q;ENSP00000387009:E226Q|ENSP00000406839:K180N	ENSP00000295171:E292Q|ENSP00000406839:K180N	E|K	+|+	1|3	0|2	CCDC74A|CCDC74A	132006822|132006822	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.289000|0.289000	0.27227|0.27227	4.189000|4.189000	0.58358|0.58358	1.192000|1.192000	0.43071|0.43071	0.194000|0.194000	0.17425|0.17425	GAG|AAG	CCDC74A	-	NULL	ENSG00000163040		0.652	CCDC74A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC74A	HGNC	protein_coding	OTTHUMT00000254570.2	-	0.00	125	0	G	NM_138770		132290352	+1	tier1	-	no_errors	ENST00000295171	ensembl	human	known	74_37	missense	37.86	87	53	SNP	1.000	C
CD96	10225	genome.wustl.edu	37	3	111298030	111298031	+	Frame_Shift_Del	DEL	AG	AG	-	rs375233278		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr3:111298030_111298031delAG	ENST00000283285.5	+	5	879_880	c.748_749delAG	c.(748-750)agafs	p.R250fs	CD96_ENST00000438817.2_Frame_Shift_Del_p.R234fs|CD96_ENST00000352690.4_Frame_Shift_Del_p.R234fs	NM_198196.2	NP_937839.1	P40200	TACT_HUMAN	CD96 molecule	250					cell adhesion (GO:0007155)|immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(4)|liver(2)|lung(14)|skin(5)	35						TTGCCACATTAGAGTCGGTCCT	0.475									Opitz Trigonocephaly syndrome																																								0																																										SO:0001589	frameshift_variant	0	Familial Cancer Database	C syndrome, Trigonocephaly syndrome	M88282	CCDS2958.1, CCDS2959.1	3p13-q13.2	2013-01-11	2006-03-28		ENSG00000153283	ENSG00000153283		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16892	protein-coding gene	gene with protein product		606037	"""CD96 antigen"""			1313846	Standard	XR_241462		Approved	TACTILE	uc003dxx.3	P40200	OTTHUMG00000159275	ENST00000283285.5:c.748_749delAG	3.37:g.111298032_111298033delAG	ENSP00000283285:p.Arg250fs		Q5JPB3	Frame_Shift_Del	DEL	smart_Ig_sub,pfscan_Ig-like_dom	p.R250fs	ENST00000283285.5	37	c.748_749	CCDS2959.1	3																																																																																			CD96	-	smart_Ig_sub	ENSG00000153283		0.475	CD96-001	KNOWN	basic|CCDS	protein_coding	CD96	HGNC	protein_coding	OTTHUMT00000354312.2		0.00	89	0	AG			111298031	+1	tier1		no_errors	ENST00000283285	ensembl	human	known	74_37	frame_shift_del	31.86	77	36	DEL	0.000:0.000	-
CDK11B	984	genome.wustl.edu	37	1	1581180	1581180	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:1581180G>C	ENST00000407249.3	-	4	343	c.344C>G	c.(343-345)aCa>aGa	p.T115R	CDK11B_ENST00000341832.6_Missense_Mutation_p.T70R|CDK11B_ENST00000340677.5_Missense_Mutation_p.T104R|CDK11B_ENST00000317673.7_Missense_Mutation_p.H120Q			P21127	CD11B_HUMAN	cyclin-dependent kinase 11B	104					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(3)|lung(4)|skin(1)|stomach(2)	12						gtttctggctgtgaagtcctt	0.478																																																	0																																										SO:0001583	missense	0			AK000081	CCDS72682.1, CCDS72683.1, CCDS72684.1	1p36.33	2013-09-24	2009-12-16	2009-12-16	ENSG00000248333	ENSG00000248333		"""Cyclin-dependent kinases"""	1729	protein-coding gene	gene with protein product		176873	"""cell division cycle 2-like 1 (PITSLRE proteins)"""	CDC2L1		1774066, 14511641, 19884882	Standard	XM_006711061		Approved	CDK11-p110, CDK11-p58, CDK11-p46	uc001agv.1	P21127	OTTHUMG00000078638	ENST00000407249.3:c.344C>G	1.37:g.1581180G>C	ENSP00000464036:p.Thr115Arg		O95265|Q12817|Q12818|Q12819|Q12820|Q12822|Q8N530|Q9NZS5|Q9UBJ0|Q9UBQ1|Q9UBR0|Q9UNY2|Q9UP57|Q9UP58|Q9UP59	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.T115R	ENST00000407249.3	37	c.344		1																																																																																			CDK11B	-	NULL	ENSG00000248333		0.478	CDK11B-204	KNOWN	basic|appris_candidate_longest	protein_coding	CDK11B	HGNC	protein_coding		-	0.00	364	0	G	NM_001787		1581180	-1	tier1	-	no_errors	ENST00000407249	ensembl	human	known	74_37	missense	13.15	284	43	SNP	0.028	C
CDK13	8621	genome.wustl.edu	37	7	40027419	40027419	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr7:40027419A>C	ENST00000181839.4	+	2	2038	c.1433A>C	c.(1432-1434)aAg>aCg	p.K478T	CDK13_ENST00000340829.5_Missense_Mutation_p.K478T	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	478					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						gaagcaacTAAGGCTGCTGAG	0.502																																																	0													40.0	40.0	40.0					7																	40027419		2203	4300	6503	SO:0001583	missense	0			M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.1433A>C	7.37:g.40027419A>C	ENSP00000181839:p.Lys478Thr		Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K478T	ENST00000181839.4	37	c.1433	CCDS5461.1	7	.	.	.	.	.	.	.	.	.	.	A	13.60	2.284791	0.40394	.	.	ENSG00000065883	ENST00000181839;ENST00000340829	T;T	0.71103	-0.52;-0.54	4.56	4.56	0.56223	.	.	.	.	.	T	0.71702	0.3371	N	0.22421	0.69	0.40848	D	0.983721	D;D	0.61080	0.989;0.981	D;D	0.70487	0.969;0.932	T	0.70528	-0.4847	8	.	.	.	-11.8986	12.2684	0.54691	1.0:0.0:0.0:0.0	.	478;478	Q14004-2;Q14004	.;CDK13_HUMAN	T	478	ENSP00000181839:K478T;ENSP00000340557:K478T	.	K	+	2	0	CDK13	39993944	1.000000	0.71417	0.975000	0.42487	0.905000	0.53344	4.440000	0.59975	2.280000	0.76307	0.460000	0.39030	AAG	CDK13	-	NULL	ENSG00000065883		0.502	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK13	HGNC	protein_coding	OTTHUMT00000250726.2	-	0.00	27	0	A	NM_003718		40027419	+1	tier1	-	no_errors	ENST00000181839	ensembl	human	known	74_37	missense	37.50	20	12	SNP	0.989	C
CDKN2A	1029	genome.wustl.edu	37	9	21974766	21974766	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr9:21974766C>T	ENST00000304494.5	-	1	331	c.61G>A	c.(61-63)Gcc>Acc	p.A21T	CDKN2A_ENST00000361570.3_Intron|CDKN2A_ENST00000530628.2_Intron|CDKN2A_ENST00000498124.1_Missense_Mutation_p.A21T|CDKN2A_ENST00000494262.1_Intron|CDKN2A_ENST00000498628.2_Intron|CDKN2A_ENST00000446177.1_Missense_Mutation_p.A21T|CDKN2A_ENST00000579122.1_Missense_Mutation_p.A21T|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000579755.1_Intron	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	21					cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(23)|p.0(1)|p.S12fs*20(1)|p.A17fs*5(1)|p.R22fs*14(1)|p.A20_A21del(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CGACCCCGGGCCGCGGCCGTG	0.741		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																																							1343	Whole gene deletion(1316)|Unknown(23)|Deletion - Frameshift(3)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(279)|skin(168)|central_nervous_system(163)|lung(146)|urinary_tract(90)|bone(73)|soft_tissue(57)|pleura(52)|oesophagus(51)|upper_aerodigestive_tract(47)|ovary(34)|kidney(31)|breast(30)|pancreas(29)|thyroid(14)|biliary_tract(13)|NS(12)|stomach(12)|autonomic_ganglia(7)|liver(7)|meninges(7)|large_intestine(6)|salivary_gland(5)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)											13.0	17.0	16.0					9																	21974766		1850	3817	5667	SO:0001583	missense	0			L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.61G>A	9.37:g.21974766C>T	ENSP00000307101:p.Ala21Thr		A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.A21T	ENST00000304494.5	37	c.61	CCDS6510.1	9	.	.	.	.	.	.	.	.	.	.	C	28.7	4.941382	0.92526	.	.	ENSG00000147889	ENST00000304494;ENST00000446177	D;D	0.91843	-2.92;-2.92	4.89	3.98	0.46160	Ankyrin repeat-containing domain (3);	.	.	.	.	D	0.95137	0.8424	M	0.82923	2.615	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.68621	0.83;0.959	D	0.93883	0.7173	9	0.15066	T	0.55	.	13.9251	0.63958	0.1536:0.8464:0.0:0.0	.	21;21	P42771;G3XAG3	CD2A1_HUMAN;.	T	21	ENSP00000307101:A21T;ENSP00000394932:A21T	ENSP00000307101:A21T	A	-	1	0	CDKN2A	21964766	0.994000	0.37717	0.044000	0.18714	0.119000	0.20118	3.954000	0.56708	1.392000	0.46585	-0.169000	0.13324	GCC	CDKN2A	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000147889		0.741	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDKN2A	HGNC	protein_coding	OTTHUMT00000051915.1		0.00	45	0	C	NM_000077		21974766	-1			no_errors	ENST00000446177	ensembl	human	known	74_37	missense	10.53	17	2	SNP	0.925	T
CHRM1	1128	genome.wustl.edu	37	11	62677888	62677888	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:62677888C>T	ENST00000306960.3	-	2	1226	c.685G>A	c.(685-687)Gag>Aag	p.E229K	AP000438.2_ENST00000543624.1_RNA	NM_000738.2	NP_000729.2	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	229					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cognition (GO:0050890)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of ion transport (GO:0043270)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of locomotion (GO:0040012)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			large_intestine(5)|lung(3)|stomach(1)	9					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Benzatropine(DB00245)|Biperiden(DB00810)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbachol(DB00411)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clidinium(DB00771)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Doxylamine(DB00366)|Escitalopram(DB01175)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Flupentixol(DB00875)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Trospium(DB00209)|Ziprasidone(DB00246)	CCTGGCGTCTCGGAGCCCTGA	0.647																																																	0													28.0	30.0	29.0					11																	62677888		2201	4298	6499	SO:0001583	missense	0			Y00508	CCDS8040.1	11q12-q13	2012-08-08				ENSG00000168539		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1950	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 1"""	118510					Standard	NM_000738		Approved		uc001nwi.3	P11229		ENST00000306960.3:c.685G>A	11.37:g.62677888C>T	ENSP00000306490:p.Glu229Lys		Q96RH1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M1_rcpt,prints_Musac_Ach_rcpt,prints_GPCR_Rhodpsn	p.E229K	ENST00000306960.3	37	c.685	CCDS8040.1	11	.	.	.	.	.	.	.	.	.	.	C	2.306	-0.359128	0.05138	.	.	ENSG00000168539	ENST00000306960;ENST00000543973	T;T	0.59502	0.29;0.26	4.48	4.48	0.54585	GPCR, rhodopsin-like superfamily (1);	0.304612	0.24375	N	0.039063	T	0.31670	0.0804	N	0.04805	-0.155	0.35318	D	0.784503	P	0.40032	0.699	B	0.33568	0.166	T	0.42327	-0.9458	10	0.14252	T	0.57	-19.4515	14.6856	0.69047	0.0:1.0:0.0:0.0	.	229	P11229	ACM1_HUMAN	K	229	ENSP00000306490:E229K;ENSP00000441188:E229K	ENSP00000306490:E229K	E	-	1	0	CHRM1	62434464	0.237000	0.23815	0.964000	0.40570	0.378000	0.30076	1.587000	0.36622	2.329000	0.79093	0.563000	0.77884	GAG	CHRM1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000168539		0.647	CHRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM1	HGNC	protein_coding	OTTHUMT00000396178.1	-	0.00	36	0	C	NM_000738		62677888	-1	tier1	-	no_errors	ENST00000306960	ensembl	human	known	74_37	missense	52.94	16	18	SNP	0.966	T
CLMN	79789	genome.wustl.edu	37	14	95669921	95669921	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr14:95669921T>C	ENST00000298912.4	-	9	1878	c.1765A>G	c.(1765-1767)Aca>Gca	p.T589A		NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	589					negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		TCAGGTTTTGTCTCATGAGGT	0.408																																																	0													84.0	83.0	83.0					14																	95669921		2203	4300	6503	SO:0001583	missense	0			AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.1765A>G	14.37:g.95669921T>C	ENSP00000298912:p.Thr589Ala		B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.T589A	ENST00000298912.4	37	c.1765	CCDS9933.1	14	.	.	.	.	.	.	.	.	.	.	T	10.42	1.344318	0.24339	.	.	ENSG00000165959	ENST00000298912	D	0.91996	-2.95	5.48	-6.38	0.01957	.	2.340400	0.01745	N	0.029588	D	0.83718	0.5315	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.71137	-0.4680	10	0.66056	D	0.02	.	4.3649	0.11220	0.1163:0.4448:0.1197:0.3192	.	589	Q96JQ2	CLMN_HUMAN	A	589	ENSP00000298912:T589A	ENSP00000298912:T589A	T	-	1	0	CLMN	94739674	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.587000	0.05780	-1.308000	0.02318	-2.190000	0.00312	ACA	CLMN	-	NULL	ENSG00000165959		0.408	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLMN	HGNC	protein_coding	OTTHUMT00000414518.2		0.00	97	0	T			95669921	-1			no_errors	ENST00000298912	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.000	C
CLYBL	171425	genome.wustl.edu	37	13	100511232	100511232	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr13:100511232C>G	ENST00000376360.1	+	3	394	c.367C>G	c.(367-369)Ctt>Gtt	p.L123V	CLYBL_ENST00000376354.1_Missense_Mutation_p.L123V|CLYBL_ENST00000339105.4_Missense_Mutation_p.L123V|CLYBL_ENST00000444838.2_Missense_Mutation_p.L123V|CLYBL_ENST00000376355.3_Missense_Mutation_p.L123V			Q8N0X4	CLYBL_HUMAN	citrate lyase beta like	123						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|metal ion binding (GO:0046872)			NS(1)|kidney(6)|large_intestine(6)|lung(10)|skin(2)	25	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CCTAGAGACCCTTTTGCAATC	0.463																																																	0													81.0	76.0	78.0					13																	100511232		2203	4300	6503	SO:0001583	missense	0			AF428253	CCDS32002.1	13q32.3	2011-04-08			ENSG00000125246	ENSG00000125246			18355	protein-coding gene	gene with protein product		609686					Standard	XM_005254030		Approved	CLB	uc001vok.3	Q8N0X4	OTTHUMG00000017278	ENST00000376360.1:c.367C>G	13.37:g.100511232C>G	ENSP00000365538:p.Leu123Val		Q5W0F7|Q8TDH8	Missense_Mutation	SNP	pfam_Aldehyde-lyase_domain,superfamily_Pyrv/PenolPyrv_Kinase-like_dom,pirsf_Citrate_lyase_beta	p.L123V	ENST00000376360.1	37	c.367	CCDS32002.1	13	.	.	.	.	.	.	.	.	.	.	C	7.573	0.667135	0.14710	.	.	ENSG00000125246	ENST00000376355;ENST00000376360;ENST00000444838;ENST00000376354;ENST00000339105;ENST00000416504;ENST00000443887	T;T;T;T;T;T;T	0.35236	1.32;1.32;1.32;1.32;1.32;1.32;1.32	5.91	3.15	0.36227	Aldehyde-lyase domain (1);Pyruvate/Phosphoenolpyruvate kinase (2);	0.215069	0.47455	D	0.000240	T	0.15305	0.0369	N	0.04820	-0.15	0.35552	D	0.803986	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.17098	0.017;0.004;0.014	T	0.18745	-1.0327	10	0.08837	T	0.75	-14.2139	8.6868	0.34243	0.511:0.4199:0.0:0.0691	.	123;123;123	B4DU60;Q8N0X4-2;Q8N0X4	.;.;CLYBL_HUMAN	V	123;123;123;123;123;40;40	ENSP00000365533:L123V;ENSP00000365538:L123V;ENSP00000404768:L123V;ENSP00000365532:L123V;ENSP00000342991:L123V;ENSP00000403408:L40V;ENSP00000401586:L40V	ENSP00000342991:L123V	L	+	1	0	CLYBL	99309233	0.066000	0.20996	0.006000	0.13384	0.937000	0.57800	0.359000	0.20233	0.351000	0.24027	0.655000	0.94253	CTT	CLYBL	-	pfam_Aldehyde-lyase_domain,superfamily_Pyrv/PenolPyrv_Kinase-like_dom,pirsf_Citrate_lyase_beta	ENSG00000125246		0.463	CLYBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLYBL	HGNC	protein_coding	OTTHUMT00000045611.1	-	0.00	95	0	C			100511232	+1	tier1	-	no_errors	ENST00000339105	ensembl	human	known	74_37	missense	70.69	17	41	SNP	0.964	G
CNKSR2	22866	genome.wustl.edu	37	X	21534649	21534649	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chrX:21534649C>G	ENST00000379510.3	+	9	893	c.857C>G	c.(856-858)cCg>cGg	p.P286R	CNKSR2_ENST00000279451.4_Missense_Mutation_p.P286R|CNKSR2_ENST00000543067.1_Intron|CNKSR2_ENST00000425654.2_Missense_Mutation_p.P286R	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	286	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						CGAGAGGACCCGAGTGGTGTT	0.423																																																	0													123.0	111.0	115.0					X																	21534649		2203	4300	6503	SO:0001583	missense	0			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.857C>G	X.37:g.21534649C>G	ENSP00000368824:p.Pro286Arg		B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	pfam_CNKSR2,pfam_CRIC_domain_Chordata,pfam_SAM_type1,pfam_Pleckstrin_homology,pfam_SAM_2,pfam_PDZ,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.P286R	ENST00000379510.3	37	c.857	CCDS14198.1	X	.	.	.	.	.	.	.	.	.	.	C	18.23	3.577919	0.65878	.	.	ENSG00000149970	ENST00000425654;ENST00000279451;ENST00000379510	T;T;T	0.39056	1.1;1.1;1.1	5.25	5.25	0.73442	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.68357	0.2992	M	0.82823	2.61	0.80722	D	1	D;D	0.76494	0.999;0.975	D;D	0.74348	0.983;0.947	T	0.74287	-0.3714	10	0.72032	D	0.01	-1.7959	17.8997	0.88900	0.0:1.0:0.0:0.0	.	286;286	B7ZLJ1;Q8WXI2	.;CNKR2_HUMAN	R	286	ENSP00000397906:P286R;ENSP00000279451:P286R;ENSP00000368824:P286R	ENSP00000279451:P286R	P	+	2	0	CNKSR2	21444570	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.691000	0.68249	2.160000	0.67779	0.594000	0.82650	CCG	CNKSR2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000149970		0.423	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNKSR2	HGNC	protein_coding	OTTHUMT00000056019.1	-	0.00	75	0	C	NM_014927		21534649	+1	tier1	-	no_errors	ENST00000379510	ensembl	human	known	74_37	missense	79.17	15	57	SNP	1.000	G
COL9A1	1297	genome.wustl.edu	37	6	70970365	70970365	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr6:70970365C>T	ENST00000357250.6	-	20	1602	c.1444G>A	c.(1444-1446)Gaa>Aaa	p.E482K	COL9A1_ENST00000320755.7_Missense_Mutation_p.E239K|COL9A1_ENST00000489611.1_5'UTR|COL9A1_ENST00000370499.4_Missense_Mutation_p.E239K	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	482	Collagen-like 5.|Triple-helical region (COL2).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						CTTACTTTTTCCCCTTTGTCC	0.333																																																	0													61.0	61.0	61.0					6																	70970365		2203	4300	6503	SO:0001583	missense	0				CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.1444G>A	6.37:g.70970365C>T	ENSP00000349790:p.Glu482Lys		Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.E482K	ENST00000357250.6	37	c.1444	CCDS4971.1	6	.	.	.	.	.	.	.	.	.	.	C	15.28	2.787801	0.49997	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	D;D;D	0.93133	-3.17;-3.17;-3.17	5.86	5.86	0.93980	.	0.217591	0.56097	D	0.000032	D	0.87454	0.6181	N	0.21142	0.635	0.43364	D	0.995443	P;P;B	0.42010	0.768;0.622;0.222	P;B;B	0.47015	0.534;0.295;0.119	D	0.86170	0.1599	10	0.19590	T	0.45	.	17.1033	0.86655	0.0:1.0:0.0:0.0	.	482;239;55	P20849;P20849-2;B3KWS8	CO9A1_HUMAN;.;.	K	482;239;239	ENSP00000349790:E482K;ENSP00000315252:E239K;ENSP00000359530:E239K	ENSP00000315252:E239K	E	-	1	0	COL9A1	71027086	0.994000	0.37717	0.956000	0.39512	0.932000	0.56968	3.459000	0.53021	2.775000	0.95449	0.655000	0.94253	GAA	COL9A1	-	pfam_Collagen	ENSG00000112280		0.333	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A1	HGNC	protein_coding	OTTHUMT00000041131.2	-	0.00	86	0	C			70970365	-1	tier1	-	no_errors	ENST00000357250	ensembl	human	known	74_37	missense	34.21	49	26	SNP	0.981	T
COQ10B	80219	genome.wustl.edu	37	2	198318574	198318574	+	Intron	SNP	C	C	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:198318574C>G	ENST00000263960.2	+	1	242				COQ10B_ENST00000409398.1_Intron|COQ10B_ENST00000488445.1_3'UTR|COQ10B_ENST00000545340.1_5'UTR|COQ10B_ENST00000409010.1_5'UTR	NM_025147.3	NP_079423.1	Q9H8M1	CQ10B_HUMAN	coenzyme Q10 homolog B (S. cerevisiae)							mitochondrial inner membrane (GO:0005743)				endometrium(1)|large_intestine(2)|lung(3)	6			Epithelial(96;0.231)|OV - Ovarian serous cystadenocarcinoma(117;0.246)			ACCTTGGGCCCAAGGCTGTGT	0.562																																																	0																																										SO:0001627	intron_variant	0			AK023510	CCDS2319.1	2q33.1	2008-02-05	2006-04-04		ENSG00000115520	ENSG00000115520			25819	protein-coding gene	gene with protein product			"""coenzyme Q10 homolog B (yeast)"""				Standard	NM_025147		Approved	FLJ13448	uc002uuh.1	Q9H8M1	OTTHUMG00000132745	ENST00000263960.2:c.104+186C>G	2.37:g.198318574C>G			B7Z1Y4	RNA	SNP	-	NULL	ENST00000263960.2	37	NULL	CCDS2319.1	2																																																																																			COQ10B	-	-	ENSG00000115520		0.562	COQ10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COQ10B	HGNC	protein_coding	OTTHUMT00000256105.2	-	0.00	68	0	C	NM_025147		198318574	+1	tier1	-	no_errors	ENST00000488445	ensembl	human	known	74_37	rna	25.93	40	14	SNP	0.000	G
CPNE4	131034	genome.wustl.edu	37	3	131253640	131253640	+	3'UTR	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr3:131253640G>T	ENST00000512055.1	-	0	4199				CPNE4_ENST00000503204.1_5'UTR|CPNE4_ENST00000429747.1_3'UTR			Q96A23	CPNE4_HUMAN	copine IV							extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						TCATCCTATAGCAGATAAAAC	0.294																																																	0																																										SO:0001624	3_prime_UTR_variant	0			H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.*399C>A	3.37:g.131253640G>T			D3DNC5|Q8TEX1	RNA	SNP	-	NULL	ENST00000512055.1	37	NULL	CCDS3072.1	3																																																																																			CPNE4	-	-	ENSG00000196353		0.294	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE4	HGNC	protein_coding	OTTHUMT00000356583.4	-	0.00	73	0	G	NM_130808		131253640	-1	tier1	-	no_errors	ENST00000503204	ensembl	human	known	74_37	rna	6.45	58	4	SNP	1.000	T
CSF2RA	1438	genome.wustl.edu	37	X	1407924	1407924	+	Intron	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chrX:1407924G>A	ENST00000381524.3	+	6	659				CSF2RA_ENST00000355805.2_Intron|CSF2RA_ENST00000501036.2_Intron|CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000381529.3_Intron|CSF2RA_ENST00000417535.2_Intron|CSF2RA_ENST00000355432.3_Intron|BX649553.3_ENST00000581137.1_RNA|CSF2RA_ENST00000361536.3_Intron|CSF2RA_ENST00000432318.2_Intron|CSF2RA_ENST00000381509.3_Intron|CSF2RA_ENST00000381500.1_Intron			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)						response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	gtgccacctcggctcactgca	0.507																																					Esophageal Squamous(131;723 1707 25334 40494 41806)												0																																										SO:0001627	intron_variant	0			M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.473+143G>A	X.37:g.1407924G>A			A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	RNA	SNP	-	NULL	ENST00000381524.3	37	NULL	CCDS35191.1	X																																																																																			CSF2RA	-	-	ENSG00000198223		0.507	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CSF2RA	HGNC	protein_coding	OTTHUMT00000035013.2	-	0.00	8	0	G			1407924	+1	tier1	-	no_errors	ENST00000478256	ensembl	human	putative	74_37	rna	38.46	8	5	SNP	0.005	A
CTDSPL2	51496	genome.wustl.edu	37	15	44751267	44751267	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr15:44751267C>T	ENST00000260327.4	+	2	618	c.55C>T	c.(55-57)Cgc>Tgc	p.R19C	CTDSPL2_ENST00000396780.1_Missense_Mutation_p.R19C|CTDSPL2_ENST00000558373.1_Missense_Mutation_p.R19C|CTDSPL2_ENST00000558966.1_Missense_Mutation_p.R19C	NM_016396.2	NP_057480.2	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2	19							phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	13		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		CCAAACACAACGCACTGCCAG	0.403																																																	0													89.0	90.0	90.0					15																	44751267		2198	4298	6496	SO:0001583	missense	0			AF161478	CCDS10110.1	15q15.3-q21.1	2010-06-21			ENSG00000137770	ENSG00000137770		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	26936	protein-coding gene	gene with protein product							Standard	NM_016396		Approved	HSPC129, FLJ10523	uc001ztr.3	Q05D32	OTTHUMG00000131159	ENST00000260327.4:c.55C>T	15.37:g.44751267C>T	ENSP00000260327:p.Arg19Cys		Q3ZTU1|Q6AI06|Q8IYI9|Q9NVT2|Q9NZX8|Q9P030	Missense_Mutation	SNP	pfam_NIF,superfamily_HAD-like_dom,smart_NIF,pfscan_NIF,tigrfam_Dullard_phosphatase	p.R19C	ENST00000260327.4	37	c.55	CCDS10110.1	15	.	.	.	.	.	.	.	.	.	.	C	15.90	2.970035	0.53614	.	.	ENSG00000137770	ENST00000260327;ENST00000396780	T;T	0.79940	-1.32;-1.32	5.28	5.28	0.74379	.	0.261763	0.45867	D	0.000324	T	0.72550	0.3474	N	0.24115	0.695	0.58432	D	0.999998	B;B	0.19073	0.022;0.033	B;B	0.10450	0.003;0.005	T	0.68454	-0.5404	10	0.56958	D	0.05	-0.1222	18.9057	0.92460	0.0:1.0:0.0:0.0	.	19;19	Q05D32-2;Q05D32	.;CTSL2_HUMAN	C	19	ENSP00000260327:R19C;ENSP00000380000:R19C	ENSP00000260327:R19C	R	+	1	0	CTDSPL2	42538559	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	5.697000	0.68295	2.464000	0.83262	0.650000	0.86243	CGC	CTDSPL2	-	NULL	ENSG00000137770		0.403	CTDSPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDSPL2	HGNC	protein_coding	OTTHUMT00000253851.1	-	0.00	60	0	C	NM_016396		44751267	+1	tier1	-	no_errors	ENST00000260327	ensembl	human	known	74_37	missense	18.75	65	15	SNP	1.000	T
CXCR2	3579	genome.wustl.edu	37	2	219000352	219000352	+	Silent	SNP	C	C	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:219000352C>A	ENST00000318507.2	+	3	1255	c.828C>A	c.(826-828)ctC>ctA	p.L276L		NM_001557.3	NP_001548.1	P25025	CXCR2_HUMAN	chemokine (C-X-C motif) receptor 2	276					cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(11)|skin(1)|stomach(1)	22						CAGACACCCTCATGAGGACCC	0.612																																																	0													85.0	83.0	84.0					2																	219000352		2203	4300	6503	SO:0001819	synonymous_variant	0			U11869	CCDS2408.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000180871	ENSG00000180871		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6027	protein-coding gene	gene with protein product		146928	"""interleukin 8 receptor, beta"""	IL8RB		1427896	Standard	NM_001557		Approved	CMKAR2, CD182	uc002vha.2	P25025	OTTHUMG00000133107	ENST00000318507.2:c.828C>A	2.37:g.219000352C>A			Q8IUZ1|Q9P2T6|Q9P2T7	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR_1/2,prints_GPCR_Rhodpsn,prints_Chemokine_CXCR2,prints_Chemokine_rcpt,prints_Chemokine_CXCR4	p.L276	ENST00000318507.2	37	c.828	CCDS2408.1	2																																																																																			CXCR2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR_1/2	ENSG00000180871		0.612	CXCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCR2	HGNC	protein_coding	OTTHUMT00000256772.2	-	0.00	32	0	C	NM_001557		219000352	+1	tier1	-	no_errors	ENST00000318507	ensembl	human	known	74_37	silent	15.07	62	11	SNP	0.994	A
DACT3	147906	genome.wustl.edu	37	19	47152183	47152183	+	Silent	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:47152183G>A	ENST00000391916.2	-	4	1519	c.1446C>T	c.(1444-1446)atC>atT	p.I482I	DACT3_ENST00000300875.4_Silent_p.I257I	NM_145056.2	NP_659493.2	Q96B18	DACT3_HUMAN	dishevelled-binding antagonist of beta-catenin 3	482	Arg-rich.				negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)	delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			lung(1)	1		Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000173)|all cancers(93;0.000464)|Epithelial(262;0.02)|GBM - Glioblastoma multiforme(486;0.0325)		CGGCAGCGTCGATCTCCGCAG	0.781																																																	0													1.0	1.0	1.0					19																	47152183		497	1221	1718	SO:0001819	synonymous_variant	0				CCDS12688.2, CCDS74402.1	19q13.32	2013-05-15	2013-05-15	2006-09-25	ENSG00000197380	ENSG00000197380			30745	protein-coding gene	gene with protein product		611112	"""arginine rich region 1"", ""dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis)"""	RRR1		16881060	Standard	NM_145056		Approved	MGC15476, DAPPER3	uc010ekq.3	Q96B18	OTTHUMG00000153070	ENST00000391916.2:c.1446C>T	19.37:g.47152183G>A				Silent	SNP	NULL	p.I482	ENST00000391916.2	37	c.1446	CCDS12688.2	19																																																																																			DACT3	-	NULL	ENSG00000197380		0.781	DACT3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	DACT3	HGNC	protein_coding	OTTHUMT00000334090.1	-	0.00	9	0	G	NM_145056		47152183	-1	tier1	-	no_errors	ENST00000391916	ensembl	human	known	74_37	silent	100.00	0	5	SNP	1.000	A
DMXL1	1657	genome.wustl.edu	37	5	118482976	118482976	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr5:118482976G>A	ENST00000311085.8	+	17	2802	c.2722G>A	c.(2722-2724)Gtt>Att	p.V908I	DMXL1_ENST00000539542.1_Missense_Mutation_p.V908I	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	908										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		ATCCGAAGCGGTTTGGCAGCC	0.378																																																	0													61.0	66.0	64.0					5																	118482976		2201	4300	6501	SO:0001583	missense	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.2722G>A	5.37:g.118482976G>A	ENSP00000309690:p.Val908Ile			Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V908I	ENST00000311085.8	37	c.2722	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	G	7.594	0.671433	0.14776	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.30981	1.51;1.51	5.73	3.82	0.43975	.	0.914403	0.09571	N	0.784123	T	0.16171	0.0389	N	0.04508	-0.205	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.16719	-1.0393	10	0.36615	T	0.2	-0.7593	10.3276	0.43803	0.0743:0.1359:0.7898:0.0	.	908;908	F5H269;Q9Y485	.;DMXL1_HUMAN	I	908	ENSP00000309690:V908I;ENSP00000439479:V908I	ENSP00000309690:V908I	V	+	1	0	DMXL1	118510875	0.027000	0.19231	0.995000	0.50966	0.034000	0.12701	0.591000	0.23969	1.387000	0.46486	0.591000	0.81541	GTT	DMXL1	-	superfamily_WD40_repeat_dom	ENSG00000172869		0.378	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	-	0.00	79	0	G	NM_005509		118482976	+1	tier1	-	no_errors	ENST00000539542	ensembl	human	known	74_37	missense	26.09	34	12	SNP	0.757	A
DNAH1	25981	genome.wustl.edu	37	3	52428676	52428676	+	Splice_Site	SNP	C	C	A	rs142905685		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr3:52428676C>A	ENST00000420323.2	+	67	11083	c.10822C>A	c.(10822-10824)Cgg>Agg	p.R3608R		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3673					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TGAGCCCCACCGGTTAGCTGG	0.582																																																	0													56.0	58.0	57.0					3																	52428676		1930	4123	6053	SO:0001630	splice_region_variant	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.10823+1C>A	3.37:g.52428676C>A			B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase	p.R3608	ENST00000420323.2	37	c.10822	CCDS46842.1	3																																																																																			DNAH1	-	pfam_Dynein_heavy_dom	ENSG00000114841		0.582	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1		0.00	62	0	C	NM_015512	Silent	52428676	+1			no_errors	ENST00000420323	ensembl	human	known	74_37	silent	5.56	34	2	SNP	1.000	A
DNAH2	146754	genome.wustl.edu	37	17	7643207	7643207	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr17:7643207G>T	ENST00000572933.1	+	9	2787	c.1327G>T	c.(1327-1329)Ggg>Tgg	p.G443W	DNAH2_ENST00000082259.3_Missense_Mutation_p.G525W|DNAH2_ENST00000570791.1_Missense_Mutation_p.G525W|DNAH2_ENST00000389173.2_Missense_Mutation_p.G443W			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	443	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				AGCCGTTCGCGGGGGTATCCT	0.537																																																	0													66.0	61.0	63.0					17																	7643207		2203	4300	6503	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.1327G>T	17.37:g.7643207G>T	ENSP00000458355:p.Gly443Trp		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.G443W	ENST00000572933.1	37	c.1327	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	G	6.454	0.451969	0.12283	.	.	ENSG00000183914	ENST00000360606;ENST00000389173;ENST00000082259	T;T	0.55234	0.53;0.53	4.85	4.85	0.62838	Dynein heavy chain, domain-1 (1);	0.283081	0.35495	N	0.003170	T	0.39384	0.1076	L	0.29908	0.895	0.23056	N	0.998362	B;B	0.29508	0.016;0.246	B;B	0.30251	0.055;0.113	T	0.29731	-1.0002	10	0.38643	T	0.18	.	10.4806	0.44691	0.0901:0.0:0.9099:0.0	.	443;525	Q9P225;Q9P225-3	DYH2_HUMAN;.	W	443;443;525	ENSP00000373825:G443W;ENSP00000082259:G525W	ENSP00000082259:G525W	G	+	1	0	DNAH2	7583932	1.000000	0.71417	0.948000	0.38648	0.258000	0.26162	3.646000	0.54396	2.520000	0.84964	0.650000	0.86243	GGG	DNAH2	-	pfam_Dynein_heavy_dom-1	ENSG00000183914		0.537	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1		0.00	42	0	G	NM_020877		7643207	+1			no_errors	ENST00000389173	ensembl	human	known	74_37	missense	8.82	30	3	SNP	0.823	T
DOK5	55816	genome.wustl.edu	37	20	53205284	53205284	+	Silent	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr20:53205284C>T	ENST00000262593.5	+	4	698	c.348C>T	c.(346-348)atC>atT	p.I116I	DOK5_ENST00000395939.1_Silent_p.I8I	NM_018431.3	NP_060901.2	Q9P104	DOK5_HUMAN	docking protein 5	116					MAPK cascade (GO:0000165)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)		receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|skin(1)	19			Colorectal(105;0.202)			GAACACGGATCAATGACATCA	0.458																																																	0													128.0	125.0	126.0					20																	53205284		2203	4300	6503	SO:0001819	synonymous_variant	0			AF132732	CCDS13446.1, CCDS13447.1	20q13.2	2013-01-10	2002-11-28	2002-11-29	ENSG00000101134	ENSG00000101134		"""Pleckstrin homology (PH) domain containing"""	16173	protein-coding gene	gene with protein product		608334	"""chromosome 20 open reading frame 180"""	C20orf180		11470823	Standard	XM_005260451		Approved	dJ805C22.1	uc002xwy.3	Q9P104	OTTHUMG00000032778	ENST00000262593.5:c.348C>T	20.37:g.53205284C>T			Q5T7Y0|Q5TE53|Q8TEW7|Q96H13|Q9BZ24|Q9NQF4|Q9Y411	Silent	SNP	pfam_Insln_rcpt_S1,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.I116	ENST00000262593.5	37	c.348	CCDS13446.1	20																																																																																			DOK5	-	NULL	ENSG00000101134		0.458	DOK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOK5	HGNC	protein_coding	OTTHUMT00000079777.2	-	0.00	77	0	C			53205284	+1	tier1	-	no_errors	ENST00000262593	ensembl	human	known	74_37	silent	46.24	50	43	SNP	1.000	T
DST	667	genome.wustl.edu	37	6	56374518	56374518	+	Silent	SNP	A	A	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr6:56374518A>G	ENST00000361203.3	-	69	17981	c.17974T>C	c.(17974-17976)Ttg>Ctg	p.L5992L	DST_ENST00000446842.2_Silent_p.L5777L|DST_ENST00000370788.2_Silent_p.L3906L|DST_ENST00000421834.2_Silent_p.L4015L|DST_ENST00000370754.5_Silent_p.L6281L|DST_ENST00000340834.4_5'UTR|DST_ENST00000244364.6_Silent_p.L3689L|DST_ENST00000370769.4_Silent_p.L6103L|DST_ENST00000312431.6_3'UTR			Q03001	DYST_HUMAN	dystonin	5993					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GTTTCATACAACGGCTGTAGC	0.428																																																	0													120.0	110.0	113.0					6																	56374518		1874	4115	5989	SO:0001819	synonymous_variant	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.17974T>C	6.37:g.56374518A>G			B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.L6281	ENST00000361203.3	37	c.18841		6																																																																																			DST	-	superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000151914		0.428	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	58	0	A	NM_001723		56374518	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	silent	29.09	39	16	SNP	0.050	G
EFNA2	1943	genome.wustl.edu	37	19	1295853	1295853	+	Silent	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:1295853C>T	ENST00000215368.2	+	2	465	c.450C>T	c.(448-450)taC>taT	p.Y150Y	MUM1_ENST00000344663.3_Intron	NM_001405.3	NP_001396.2	O43921	EFNA2_HUMAN	ephrin-A2	150	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				axon guidance (GO:0007411)|bone remodeling (GO:0046849)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|olfactory bulb development (GO:0021772)|osteoclast differentiation (GO:0030316)	anchored component of membrane (GO:0031225)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)			lung(2)	2		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGTATTACTACATCTGTGAGT	0.736																																																	0													7.0	9.0	8.0					19																	1295853		2163	4225	6388	SO:0001819	synonymous_variant	0				CCDS12061.1	19p13	2011-03-09			ENSG00000099617	ENSG00000099617		"""Ephrins"""	3222	protein-coding gene	gene with protein product		602756		EPLG6			Standard	NM_001405		Approved	ELF-1, LERK6	uc002lry.2	O43921		ENST00000215368.2:c.450C>T	19.37:g.1295853C>T			O76020	Silent	SNP	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	p.Y150	ENST00000215368.2	37	c.450	CCDS12061.1	19																																																																																			EFNA2	-	pfam_Ephrin,superfamily_Cupredoxin	ENSG00000099617		0.736	EFNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFNA2	HGNC	protein_coding	OTTHUMT00000450016.1	-	0.00	51	0	C	NM_001405		1295853	+1	tier1	-	no_errors	ENST00000215368	ensembl	human	known	74_37	silent	8.51	43	4	SNP	1.000	T
TONSL	4796	genome.wustl.edu	37	8	145662361	145662361	+	Intron	DEL	C	C	-			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr8:145662361delC	ENST00000409379.3	-	14	1756				AC084125.4_ENST00000544423.1_RNA|AC084125.4_ENST00000442850.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein						cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						TGACTCTTCGCCCCACGTGTC	0.632																																																	0													51.0	39.0	43.0					8																	145662361		2203	4300	6503	SO:0001627	intron_variant	0				CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.1726+48G>-	8.37:g.145662361delC			B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	RNA	DEL	-	NULL	ENST00000409379.3	37	NULL	CCDS34968.2	8																																																																																			AC084125.4	-	-	ENSG00000232600		0.632	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232600	Clone_based_vega_gene	protein_coding	OTTHUMT00000329668.2		0.00	68	0	C	NM_013432		145662361	+1	tier1		no_errors	ENST00000544423	ensembl	human	known	74_37	rna	13.27	98	15	DEL	0.000	-
RP11-1134I14.8	0	genome.wustl.edu	37	8	48104491	48104491	+	lincRNA	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr8:48104491G>T	ENST00000528139.1	+	0	2097																											CAATTACAAAGATAAAAGTAT	0.269																																																	0																																												0																															8.37:g.48104491G>T				RNA	SNP	-	NULL	ENST00000528139.1	37	NULL		8																																																																																			RP11-1134I14.8	-	-	ENSG00000255366		0.269	RP11-1134I14.8-001	KNOWN	basic	lincRNA	ENSG00000255366	Clone_based_vega_gene	lincRNA	OTTHUMT00000384713.1		0.00	27	0	G			48104491	+1			no_errors	ENST00000528139	ensembl	human	known	74_37	rna	19.05	17	4	SNP	1.000	T
GNA11	2767	genome.wustl.edu	37	19	3122087	3122087	+	3'UTR	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:3122087G>A	ENST00000078429.4	+	0	2232				AC005262.2_ENST00000585980.1_RNA|AC005262.3_ENST00000587701.1_RNA	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)						action potential (GO:0001508)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cellular response to pH (GO:0071467)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|regulation of melanocyte differentiation (GO:0045634)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)			endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)		CGGAGCCCACGTGGGCTGGGC	0.667			Mis		uveal melanoma																																			Dom	yes		19	19p13.3	2767	"""guanine nucleotide binding protein (G protein), alpha 11 (Gq class)"""		E	0																																										SO:0001624	3_prime_UTR_variant	0			AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256			4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2		1302014, 23802516	Standard	NM_002067		Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.*910G>A	19.37:g.3122087G>A			O15109|Q14350|Q6IB00	RNA	SNP	-	NULL	ENST00000078429.4	37	NULL	CCDS12103.1	19																																																																																			AC005262.2	-	-	ENSG00000267688		0.667	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267688	Clone_based_vega_gene	protein_coding	OTTHUMT00000452261.2	-	0.00	57	0	G	NM_002067		3122087	-1	tier1	-	no_errors	ENST00000585980	ensembl	human	known	74_37	rna	10.53	33	4	SNP	0.000	A
EPHA2	1969	genome.wustl.edu	37	1	16464434	16464434	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:16464434G>T	ENST00000358432.5	-	5	1380	c.1226C>A	c.(1225-1227)aCc>aAc	p.T409N		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	409	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	CACGGTGAAGGTGTAGTTCAT	0.637																																																	0													70.0	68.0	69.0					1																	16464434		2203	4300	6503	SO:0001583	missense	0			BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.1226C>A	1.37:g.16464434G>T	ENSP00000351209:p.Thr409Asn		B5A968|Q8N3Z2	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.T409N	ENST00000358432.5	37	c.1226	CCDS169.1	1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778039	0.90195	.	.	ENSG00000142627	ENST00000358432	T	0.57907	0.37	4.97	4.97	0.65823	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000051	T	0.73385	0.3580	M	0.85777	2.775	0.80722	D	1	D;D	0.59357	0.985;0.982	P;P	0.62184	0.899;0.742	T	0.78760	-0.2078	10	0.87932	D	0	.	16.1088	0.81244	0.0:0.0:1.0:0.0	.	409;409	B5A968;P29317	.;EPHA2_HUMAN	N	409	ENSP00000351209:T409N	ENSP00000351209:T409N	T	-	2	0	EPHA2	16337021	1.000000	0.71417	0.996000	0.52242	0.959000	0.62525	5.616000	0.67709	2.488000	0.83962	0.561000	0.74099	ACC	EPHA2	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000142627		0.637	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA2	HGNC	protein_coding	OTTHUMT00000026322.1	-	0.00	75	0	G	NM_004431		16464434	-1	tier1	-	no_errors	ENST00000358432	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
ESPNL	339768	genome.wustl.edu	37	2	239025586	239025586	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:239025586C>T	ENST00000343063.3	+	5	1161	c.898C>T	c.(898-900)Cgg>Tgg	p.R300W	ESPNL_ENST00000409169.1_Intron	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	300										endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		CCCCTCCCTGCGGGATGAAGA	0.647																																																	0													82.0	72.0	75.0					2																	239025586		2202	4299	6501	SO:0001583	missense	0			AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.898C>T	2.37:g.239025586C>T	ENSP00000339115:p.Arg300Trp		Q66K27|Q6ZVG1|Q8IVU2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R300W	ENST00000343063.3	37	c.898	CCDS2525.1	2	.	.	.	.	.	.	.	.	.	.	C	17.91	3.505060	0.64410	.	.	ENSG00000144488	ENST00000343063	T	0.68903	-0.36	5.48	3.64	0.41730	Ankyrin repeat-containing domain (4);	0.622819	0.14220	N	0.333506	T	0.80221	0.4583	M	0.79123	2.44	0.32919	D	0.515531	D	0.76494	0.999	D	0.65773	0.938	D	0.83377	0.0010	10	0.72032	D	0.01	-35.7073	12.2925	0.54827	0.3072:0.6928:0.0:0.0	.	300	Q6ZVH7	ESPNL_HUMAN	W	300	ENSP00000339115:R300W	ENSP00000339115:R300W	R	+	1	2	ESPNL	238690325	0.000000	0.05858	1.000000	0.80357	0.777000	0.43975	-0.035000	0.12205	0.647000	0.30713	0.460000	0.39030	CGG	ESPNL	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000144488		0.647	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPNL	HGNC	protein_coding	OTTHUMT00000257164.2		0.00	68	0	C	NM_194312		239025586	+1			no_errors	ENST00000343063	ensembl	human	known	74_37	missense	5.45	52	3	SNP	0.600	T
ESYT3	83850	genome.wustl.edu	37	3	138178065	138178065	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr3:138178065G>T	ENST00000389567.4	+	5	804	c.618G>T	c.(616-618)caG>caT	p.Q206H	ESYT3_ENST00000289135.4_Missense_Mutation_p.Q206H	NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	206	Glycerophospholipid-binding barrel-like domain. {ECO:0000250}.				lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						TGGAGCTGCAGAAGATTCAGG	0.612																																																	0													161.0	158.0	159.0					3																	138178065		2203	4300	6503	SO:0001583	missense	0			AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.618G>T	3.37:g.138178065G>T	ENSP00000374218:p.Gln206His		A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,prints_C2_dom,pfscan_C2_dom	p.Q206H	ENST00000389567.4	37	c.618	CCDS3101.2	3	.	.	.	.	.	.	.	.	.	.	G	18.30	3.593394	0.66219	.	.	ENSG00000158220	ENST00000389567;ENST00000289135	T;T	0.80033	-1.33;-1.33	4.98	2.81	0.32909	.	0.338546	0.31392	N	0.007737	T	0.77170	0.4091	L	0.36672	1.1	0.28197	N	0.927496	D	0.61697	0.99	P	0.53593	0.73	T	0.69558	-0.5113	10	0.51188	T	0.08	-14.2324	7.8509	0.29453	0.2251:0.0:0.7749:0.0	.	206	A0FGR9	ESYT3_HUMAN	H	206	ENSP00000374218:Q206H;ENSP00000289135:Q206H	ENSP00000289135:Q206H	Q	+	3	2	ESYT3	139660755	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.559000	0.36320	1.098000	0.41479	0.561000	0.74099	CAG	ESYT3	-	NULL	ENSG00000158220		0.612	ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESYT3	HGNC	protein_coding	OTTHUMT00000303993.1	-	0.00	58	0	G	NM_031913		138178065	+1	tier1	-	no_errors	ENST00000389567	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
EXD3	54932	genome.wustl.edu	37	9	140287583	140287583	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr9:140287583delG	ENST00000465160.2	-	3	255	c.160delC	c.(160-162)ctgfs	p.L54fs	EXD3_ENST00000475006.1_Intron|EXD3_ENST00000479452.1_Intron|EXD3_ENST00000342129.4_Intron|EXD3_ENST00000340951.4_Intron			Q9NX53	MUT7B_HUMAN	exonuclease 3'-5' domain containing 3	0	Pro-rich.									NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)	12						TAGTGTTCCAGGGGGCGCCGA	0.612																																																	0																																										SO:0001589	frameshift_variant	0				CCDS48066.1, CCDS75942.1	9q34.3	2009-03-04			ENSG00000187609	ENSG00000187609			26023	protein-coding gene	gene with protein product							Standard	XM_005266093		Approved	LOC54932, FLJ20433, mut-7	uc004cmp.2	Q8N9H8	OTTHUMG00000156149	ENST00000465160.2:c.160delC	9.37:g.140287583delG	ENSP00000432895:p.Leu54fs		Q6P1M1|Q8IXT8	Frame_Shift_Del	DEL	NULL	p.L54fs	ENST00000465160.2	37	c.160		9																																																																																			EXD3	-	NULL	ENSG00000187609		0.612	EXD3-004	PUTATIVE	basic	protein_coding	EXD3	HGNC	protein_coding	OTTHUMT00000343185.3		0.00	44	0	G	NM_017820		140287583	-1			no_errors	ENST00000465160	ensembl	human	putative	74_37	frame_shift_del	18.60	35	8	DEL	0.996	0
FAM120A	23196	genome.wustl.edu	37	9	96278385	96278385	+	Missense_Mutation	SNP	T	T	C	rs138573585		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr9:96278385T>C	ENST00000277165.6	+	7	1446	c.1252T>C	c.(1252-1254)Tac>Cac	p.Y418H	FAM120A_ENST00000333936.5_Missense_Mutation_p.Y418H|FAM120A_ENST00000375389.3_Missense_Mutation_p.Y418H|FAM120A_ENST00000340893.4_Missense_Mutation_p.Y418H	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	418						cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GCAGAACAGCTACAGCAACAT	0.637																																																	0								T	HIS/TYR	1,3887		0,1,1943	33.0	33.0	33.0		1252	5.4	1.0	9	dbSNP_134	33	0,7826		0,0,3913	no	missense	FAM120A	NM_014612.3	83	0,1,5856	CC,CT,TT		0.0,0.0257,0.0085	possibly-damaging	418/1119	96278385	1,11713	1944	3913	5857	SO:0001583	missense	0			AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.1252T>C	9.37:g.96278385T>C	ENSP00000277165:p.Tyr418His		A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Missense_Mutation	SNP	NULL	p.Y418H	ENST00000277165.6	37	c.1252	CCDS6706.1	9	.	.	.	.	.	.	.	.	.	.	T	21.3	4.128741	0.77549	2.57E-4	0.0	ENSG00000048828	ENST00000375389;ENST00000277165;ENST00000333936;ENST00000340893	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000005	T	0.64724	0.2624	L	0.43152	1.355	0.49687	D	0.999818	D;D;D;D;D	0.89917	0.999;0.993;0.999;0.997;1.0	D;P;D;D;D	0.85130	0.996;0.858;0.994;0.991;0.997	T	0.61787	-0.6991	10	0.31617	T	0.26	-13.7305	15.4422	0.75195	0.0:0.0:0.0:1.0	.	418;418;418;418;418	Q9NZB2-4;Q9NZB2-6;Q9NZB2-5;Q9NZB2;Q9NZB2-2	.;.;.;F120A_HUMAN;.	H	418	ENSP00000364538:Y418H;ENSP00000277165:Y418H;ENSP00000334918:Y418H;ENSP00000344698:Y418H	ENSP00000277165:Y418H	Y	+	1	0	FAM120A	95318206	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.652000	0.74377	2.047000	0.60756	0.482000	0.46254	TAC	FAM120A	-	NULL	ENSG00000048828		0.637	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM120A	HGNC	protein_coding	OTTHUMT00000053160.2	-	0.00	54	0	T	NM_014612		96278385	+1	tier1	rs138573585	no_errors	ENST00000333936	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	C
FAM171A1	221061	genome.wustl.edu	37	10	15255663	15255663	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr10:15255663C>T	ENST00000378116.4	-	8	1930	c.1924G>A	c.(1924-1926)Gcc>Acc	p.A642T	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	642						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.A642T(2)		breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						TGAGAGATGGCCTGGGAAGAC	0.607																																																	2	Substitution - Missense(2)	lung(2)											47.0	55.0	52.0					10																	15255663		2203	4300	6503	SO:0001583	missense	0			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1924G>A	10.37:g.15255663C>T	ENSP00000367356:p.Ala642Thr		D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	pfam_Uncharacterised_FAM171	p.A642T	ENST00000378116.4	37	c.1924	CCDS31154.1	10	.	.	.	.	.	.	.	.	.	.	C	17.93	3.508456	0.64410	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	T	0.31769	1.48	5.25	5.25	0.73442	.	0.055849	0.64402	D	0.000001	T	0.51890	0.1701	L	0.57536	1.79	0.50632	D	0.999884	D	0.89917	1.0	D	0.75484	0.986	T	0.30357	-0.9981	10	0.22706	T	0.39	-29.4218	19.0487	0.93032	0.0:1.0:0.0:0.0	.	642	Q5VUB5	F1711_HUMAN	T	642;641	ENSP00000367356:A642T	ENSP00000367356:A642T	A	-	1	0	FAM171A1	15295669	1.000000	0.71417	0.999000	0.59377	0.897000	0.52465	2.715000	0.47210	2.724000	0.93272	0.563000	0.77884	GCC	FAM171A1	-	pfam_Uncharacterised_FAM171	ENSG00000148468		0.607	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	HGNC	protein_coding	OTTHUMT00000046984.1		0.00	59	0	C	XM_167709		15255663	-1			no_errors	ENST00000378116	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	T
FAM178B	51252	genome.wustl.edu	37	2	97595017	97595017	+	Silent	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:97595017G>T	ENST00000417561.3	-	13	1562	c.1563C>A	c.(1561-1563)gtC>gtA	p.V521V	FAM178B_ENST00000327896.3_Silent_p.V341V|FAM178B_ENST00000490605.2_Silent_p.V373V			Q8IXR5	F178B_HUMAN	family with sequence similarity 178, member B	521										large_intestine(1)|ovary(1)	2						ATGCCTCCCTGACTTCTTGCA	0.597																																																	0													57.0	56.0	56.0					2																	97595017		692	1591	2283	SO:0001819	synonymous_variant	0			AF151068, BC039488	CCDS33252.1, CCDS46366.1, CCDS46366.2	2q11.2	2008-08-08			ENSG00000168754	ENSG00000168754			28036	protein-coding gene	gene with protein product						11042152	Standard	NM_001122646		Approved	LOC51252	uc002sxl.4	Q8IXR5	OTTHUMG00000155257	ENST00000417561.3:c.1563C>A	2.37:g.97595017G>T			A8MXN2|E9PD86|Q8IUY0|Q9P0P4	Silent	SNP	NULL	p.V521	ENST00000417561.3	37	c.1563		2																																																																																			FAM178B	-	NULL	ENSG00000168754		0.597	FAM178B-202	KNOWN	basic	protein_coding	FAM178B	HGNC	protein_coding			0.00	76	0	G	NM_016490		97595017	-1			no_errors	ENST00000417561	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.359	T
FAM188B	84182	genome.wustl.edu	37	7	30893033	30893033	+	Silent	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr7:30893033C>T	ENST00000265299.6	+	12	1712	c.1635C>T	c.(1633-1635)tgC>tgT	p.C545C	INMT-FAM188B_ENST00000458257.1_3'UTR|AQP1_ENST00000434909.2_5'UTR|AQP1_ENST00000509504.1_Silent_p.C8C	NM_032222.2	NP_115598.2	Q4G0A6	F188B_HUMAN	family with sequence similarity 188, member B	545										endometrium(1)|large_intestine(5)|lung(19)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GTTTGACCTGCTATGAGGACC	0.498																																																	0													119.0	118.0	118.0					7																	30893033		2011	4184	6195	SO:0001819	synonymous_variant	0			AK026027	CCDS43565.1	7p14.3	2010-08-17	2009-07-14	2009-07-14	ENSG00000106125	ENSG00000106125			21916	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 67"""	C7orf67			Standard	NM_032222		Approved	FLJ22374	uc003tbt.3	Q4G0A6	OTTHUMG00000152800	ENST00000265299.6:c.1635C>T	7.37:g.30893033C>T			Q71AZ7|Q9H6D2	Silent	SNP	NULL	p.C545	ENST00000265299.6	37	c.1635	CCDS43565.1	7																																																																																			FAM188B	-	NULL	ENSG00000106125		0.498	FAM188B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM188B	HGNC	protein_coding	OTTHUMT00000327962.1		0.00	49	0	C	NM_032222		30893033	+1			no_errors	ENST00000265299	ensembl	human	known	74_37	silent	5.33	71	4	SNP	0.996	T
FAM86C2P	645332	genome.wustl.edu	37	11	67560294	67560294	+	RNA	SNP	A	A	G	rs61894308		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:67560294A>G	ENST00000528089.1	-	0	1456							A6NEL3	F86C2_HUMAN	family with sequence similarity 86, member C2, pseudogene																		GAGGAACCGAATGTGTCCAGG	0.557																																																	0																																												0					11q13.2	2011-07-07			ENSG00000160172	ENSG00000160172			42392	pseudogene	pseudogene							Standard	NR_024249		Approved		uc001omt.4	A6NEL3	OTTHUMG00000167222		11.37:g.67560294A>G				RNA	SNP	-	NULL	ENST00000528089.1	37	NULL		11																																																																																			FAM86C2P	-	-	ENSG00000160172		0.557	FAM86C2P-004	KNOWN	basic	processed_transcript	FAM86C2P	HGNC	pseudogene	OTTHUMT00000393796.1		0.00	26	0	A			67560294	-1			no_errors	ENST00000528089	ensembl	human	known	74_37	rna	9.76	37	4	SNP	0.010	G
FBXW7	55294	genome.wustl.edu	37	4	153332739	153332739	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr4:153332739G>A	ENST00000281708.4	-	2	1446	c.217C>T	c.(217-219)Cag>Tag	p.Q73*	FBXW7_ENST00000603548.1_Nonsense_Mutation_p.Q73*|FBXW7_ENST00000603841.1_Nonsense_Mutation_p.Q73*|FBXW7_ENST00000604872.1_Nonsense_Mutation_p.Q73*	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	73					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)			NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGTCCTTGCTGGGAATCATTT	0.448			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	0													268.0	251.0	257.0					4																	153332739		2203	4300	6503	SO:0001587	stop_gained	0			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.217C>T	4.37:g.153332739G>A	ENSP00000281708:p.Gln73*		B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Nonsense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom,superfamily_WD40_repeat_dom,superfamily_F-box_dom,smart_F-box_dom,smart_WD40_repeat,pfscan_F-box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.Q73*	ENST00000281708.4	37	c.217	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	G	34	5.318354	0.95682	.	.	ENSG00000109670	ENST00000281708	.	.	.	5.78	5.78	0.91487	.	1.522730	0.03658	N	0.242142	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-7.1737	20.0175	0.97485	0.0:0.0:1.0:0.0	.	.	.	.	X	73	.	ENSP00000281708:Q73X	Q	-	1	0	FBXW7	153552189	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.843000	0.62838	2.730000	0.93505	0.650000	0.86243	CAG	FBXW7	-	NULL	ENSG00000109670		0.448	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	-	0.00	68	0	G			153332739	-1	tier1	-	no_errors	ENST00000281708	ensembl	human	known	74_37	nonsense	71.70	15	38	SNP	1.000	A
FMOD	2331	genome.wustl.edu	37	1	203316579	203316579	+	Missense_Mutation	SNP	G	G	A	rs200924838		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:203316579G>A	ENST00000354955.4	-	2	1283	c.820C>T	c.(820-822)Cgg>Tgg	p.R274W	FMOD_ENST00000493296.1_Intron	NM_002023.4	NP_002014.2	Q06828	FMOD_HUMAN	fibromodulin	274					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor complex assembly (GO:0007181)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	17			BRCA - Breast invasive adenocarcinoma(75;0.171)			TGGGACAGCCGCACATACAGC	0.567																																																	0													126.0	122.0	124.0					1																	203316579		2203	4300	6503	SO:0001583	missense	0			U05291	CCDS30976.1	1q32	2008-02-05			ENSG00000122176	ENSG00000122176		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3774	protein-coding gene	gene with protein product	"""fibromodulin proteoglycan"""	600245				7851907	Standard	NM_002023		Approved	SLRR2E	uc001gzr.3	Q06828	OTTHUMG00000035910	ENST00000354955.4:c.820C>T	1.37:g.203316579G>A	ENSP00000347041:p.Arg274Trp		Q15331|Q8IV47	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.R274W	ENST00000354955.4	37	c.820	CCDS30976.1	1	.	.	.	.	.	.	.	.	.	.	G	16.54	3.152547	0.57259	.	.	ENSG00000122176	ENST00000435105;ENST00000354955	T	0.57752	0.38	5.18	3.21	0.36854	.	0.000000	0.85682	D	0.000000	T	0.65974	0.2743	L	0.55017	1.72	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.66646	-0.5871	10	0.87932	D	0	-19.4874	12.2014	0.54328	0.0:0.0:0.4307:0.5693	.	274	Q06828	FMOD_HUMAN	W	261;274	ENSP00000347041:R274W	ENSP00000347041:R274W	R	-	1	2	FMOD	201583202	0.098000	0.21812	1.000000	0.80357	0.997000	0.91878	0.178000	0.16820	0.512000	0.28257	0.655000	0.94253	CGG	FMOD	-	NULL	ENSG00000122176		0.567	FMOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMOD	HGNC	protein_coding	OTTHUMT00000087472.1	-	0.00	62	0	G	NM_002023		203316579	-1	tier1	rs200924838	no_errors	ENST00000354955	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.996	A
FOLR3	2352	genome.wustl.edu	37	11	71847080	71847080	+	Missense_Mutation	SNP	C	C	T	rs1802609	byFrequency	TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:71847080C>T	ENST00000445078.2	+	2	147	c.76C>T	c.(76-78)Cgg>Tgg	p.R26W	FOLR3_ENST00000456237.1_Missense_Mutation_p.R28W|FOLR3_ENST00000442948.2_Missense_Mutation_p.R28W			P41439	FOLR3_HUMAN	folate receptor 3 (gamma)	26					folic acid transport (GO:0015884)	extracellular region (GO:0005576)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	folic acid binding (GO:0005542)			large_intestine(3)|lung(8)|prostate(2)	13					Folic Acid(DB00158)	CAGGAGTGCGCGGGCCAGGAC	0.632																																																	0													104.0	111.0	108.0					11																	71847080		2199	4293	6492	SO:0001583	missense	0			U08471	CCDS73344.1	11q13.4	2012-11-14			ENSG00000110203	ENSG00000110203			3795	protein-coding gene	gene with protein product		602469				8110752	Standard	NM_000804		Approved	FR-G	uc001orx.1	P41439	OTTHUMG00000167870	ENST00000445078.2:c.76C>T	11.37:g.71847080C>T	ENSP00000390338:p.Arg26Trp		J3KQ90|Q05C14	Missense_Mutation	SNP	pfam_Folate_rcpt-like	p.R28W	ENST00000445078.2	37	c.82		11	.	.	.	.	.	.	.	.	.	.	C	11.36	1.616001	0.28801	.	.	ENSG00000110203	ENST00000445078;ENST00000456237;ENST00000442948;ENST00000546166	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	3.8	-2.15	0.07102	.	2.153630	0.03456	U	0.211514	T	0.66307	0.2776	.	.	.	0.09310	N	1	D;B	0.89917	1.0;0.009	P;B	0.61874	0.895;0.006	T	0.52975	-0.8503	9	0.35671	T	0.21	.	1.7779	0.03025	0.1358:0.4256:0.1337:0.3049	.	28;26	E9PGT2;P41439	.;FOLR3_HUMAN	W	26;28;28;26	ENSP00000390338:R26W;ENSP00000399235:R28W;ENSP00000411161:R28W;ENSP00000446279:R26W	ENSP00000325032:R26W	R	+	1	2	FOLR3	71524728	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-1.788000	0.01763	-1.072000	0.03141	0.491000	0.48974	CGG	FOLR3	-	NULL	ENSG00000110203		0.632	FOLR3-001	NOVEL	upstream_ATG|basic	protein_coding	FOLR3	HGNC	protein_coding	OTTHUMT00000396739.1	-	0.00	50	0	C	NM_000804		71847080	+1	tier1	-	no_errors	ENST00000456237	ensembl	human	known	74_37	missense	17.54	47	10	SNP	0.000	T
FOXP2	93986	genome.wustl.edu	37	7	114271582	114271582	+	Splice_Site	SNP	G	G	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr7:114271582G>C	ENST00000393494.2	+	6	876		c.e6-1		AC020606.1_ENST00000580664.1_RNA|FOXP2_ENST00000393498.2_Intron|FOXP2_ENST00000350908.4_Splice_Site|FOXP2_ENST00000393489.3_Splice_Site|FOXP2_ENST00000378237.3_Splice_Site|FOXP2_ENST00000393491.3_Splice_Site|FOXP2_ENST00000403559.4_Splice_Site|FOXP2_ENST00000360232.4_Splice_Site|FOXP2_ENST00000390668.3_Splice_Site|FOXP2_ENST00000393500.3_Splice_Site|FOXP2_ENST00000408937.3_Splice_Site			O15409	FOXP2_HUMAN	forkhead box P2						camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(3)		breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						TCTGATACcagcagcagcagc	0.517																																																	3	Unknown(3)	endometrium(3)																																								SO:0001630	splice_region_variant	0			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.598-1G>C	7.37:g.114271582G>C			A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Splice_Site	SNP	-	e6-1	ENST00000393494.2	37	c.673-1	CCDS5760.1	7																																																																																			FOXP2	-	-	ENSG00000128573		0.517	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	FOXP2	HGNC	protein_coding	OTTHUMT00000317366.1		0.00	40	0	G	NM_014491	Intron	114271582	+1			no_errors	ENST00000408937	ensembl	human	known	74_37	splice_site	6.45	29	2	SNP	0.135	C
FPGT-TNNI3K	100526835	genome.wustl.edu	37	1	74819805	74819805	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:74819805A>G	ENST00000370899.3	+	13	1509	c.1472A>G	c.(1471-1473)tAt>tGt	p.Y491C	RP11-439H8.4_ENST00000415549.2_RNA|FPGT-TNNI3K_ENST00000370895.1_Missense_Mutation_p.Y491C|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.Y504C|TNNI3K_ENST00000326637.3_Missense_Mutation_p.Y390C|TNNI3K_ENST00000370891.2_Missense_Mutation_p.Y491C	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough																		ATGTGGGCTTATGAAAAAGGT	0.378																																																	0													137.0	133.0	134.0					1																	74819805		2203	4300	6503	SO:0001583	missense	0					1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.1472A>G	1.37:g.74819805A>G	ENSP00000359936:p.Tyr491Cys			Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Y504C	ENST00000370899.3	37	c.1511		1	.	.	.	.	.	.	.	.	.	.	A	19.43	3.825944	0.71143	.	.	ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000370895;ENST00000557284;ENST00000370891;ENST00000326637	T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01	5.12	5.12	0.69794	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.36524	0.0970	N	0.00377	-1.585	0.80722	D	1	P;D;D;D	0.89917	0.86;1.0;1.0;1.0	P;D;D;D	0.91635	0.829;0.999;0.999;0.998	T	0.69308	-0.5179	10	0.42905	T	0.14	.	15.086	0.72155	1.0:0.0:0.0:0.0	.	390;491;491;491	Q59H18;Q59H18-1;Q59H18-4;Q59H18-3	TNI3K_HUMAN;.;.;.	C	491;491;491;491;390	ENSP00000359936:Y491C;ENSP00000359932:Y491C;ENSP00000450895:Y491C;ENSP00000359928:Y491C;ENSP00000322251:Y390C	ENSP00000322251:Y390C	Y	+	2	0	RP11-653A5.2;AC093158.1	74592393	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.926000	0.75835	2.148000	0.66965	0.533000	0.62120	TAT	FPGT-TNNI3K	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000259030		0.378	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	FPGT-TNNI3K	HGNC	protein_coding	OTTHUMT00000026438.3	-	0.00	44	0	A			74819805	+1	tier1	-	no_errors	ENST00000557284	ensembl	human	known	74_37	missense	24.44	34	11	SNP	1.000	G
FREM2	341640	genome.wustl.edu	37	13	39264040	39264040	+	Silent	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr13:39264040C>T	ENST00000280481.7	+	1	2775	c.2559C>T	c.(2557-2559)caC>caT	p.H853H		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	853					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CAGAGTTGCACGTGAATGATG	0.502																																																	0													116.0	107.0	110.0					13																	39264040		2203	4300	6503	SO:0001819	synonymous_variant	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.2559C>T	13.37:g.39264040C>T			Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.H853	ENST00000280481.7	37	c.2559	CCDS31960.1	13																																																																																			FREM2	-	NULL	ENSG00000150893		0.502	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	-	0.00	50	0	C	NM_207361		39264040	+1	tier1	-	no_errors	ENST00000280481	ensembl	human	known	74_37	silent	35.29	22	12	SNP	1.000	T
FREM3	166752	genome.wustl.edu	37	4	144617840	144617840	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr4:144617840A>C	ENST00000329798.5	-	1	3988	c.3989T>G	c.(3988-3990)cTc>cGc	p.L1330R		NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	1330					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						TGTGGCCTTGAGGATCCGATT	0.473																																																	0													146.0	121.0	128.0					4																	144617840		692	1591	2283	SO:0001583	missense	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.3989T>G	4.37:g.144617840A>C	ENSP00000332886:p.Leu1330Arg			Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.L1330R	ENST00000329798.5	37	c.3989	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	A	15.77	2.931749	0.52866	.	.	ENSG00000183090	ENST00000329798	T	0.73152	-0.72	4.33	3.15	0.36227	.	0.000000	0.64402	D	0.000008	D	0.87034	0.6077	H	0.97540	4.025	0.51012	D	0.999902	.	.	.	.	.	.	D	0.87521	0.2446	8	0.87932	D	0	-9.3168	8.7474	0.34594	0.9072:0.0:0.0928:0.0	.	.	.	.	R	1330	ENSP00000332886:L1330R	ENSP00000332886:L1330R	L	-	2	0	FREM3	144837290	1.000000	0.71417	0.534000	0.28014	0.755000	0.42902	6.554000	0.73923	0.704000	0.31869	0.533000	0.62120	CTC	FREM3	-	NULL	ENSG00000183090		0.473	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	-	0.00	74	0	A	XM_094074		144617840	-1	tier1	-	no_errors	ENST00000329798	ensembl	human	putative	74_37	missense	28.57	30	12	SNP	0.985	C
FUK	197258	genome.wustl.edu	37	16	70501800	70501800	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr16:70501800G>T	ENST00000288078.6	+	8	826	c.594G>T	c.(592-594)ttG>ttT	p.L198F	FUK_ENST00000571514.1_Intron|FUK_ENST00000378912.2_Missense_Mutation_p.L230F	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	198						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				GCCTTGTTTTGGACATTTACT	0.597																																																	0													82.0	84.0	84.0					16																	70501800		2055	4213	6268	SO:0001583	missense	0				CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.594G>T	16.37:g.70501800G>T	ENSP00000288078:p.Leu198Phe		Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Missense_Mutation	SNP	pfam_Fucokinase,pfam_GHMP_kinase_C_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Trimer_LpxA-like,prints_Galkinase	p.L230F	ENST00000288078.6	37	c.690	CCDS10891.2	16	.	.	.	.	.	.	.	.	.	.	G	14.85	2.658749	0.47467	.	.	ENSG00000157353	ENST00000288078;ENST00000378912	T;T	0.31769	1.48;1.48	5.17	1.98	0.26296	L-fucokinase (1);	0.611647	0.15548	N	0.256570	T	0.31231	0.0790	L	0.38531	1.155	0.80722	D	1	B;D	0.67145	0.138;0.996	B;P	0.59115	0.09;0.852	T	0.33317	-0.9873	10	0.51188	T	0.08	-8.3564	0.9389	0.01351	0.2579:0.1615:0.4139:0.1668	.	230;198	Q8N0W3-2;Q8N0W3	.;FUK_HUMAN	F	198;230	ENSP00000288078:L198F;ENSP00000368192:L230F	ENSP00000288078:L198F	L	+	3	2	FUK	69059301	0.996000	0.38824	1.000000	0.80357	0.417000	0.31264	0.432000	0.21461	1.337000	0.45525	0.561000	0.74099	TTG	FUK	-	pfam_Fucokinase	ENSG00000157353		0.597	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUK	HGNC	protein_coding	OTTHUMT00000157291.2	-	0.00	100	0	G	NM_145059		70501800	+1	tier1	-	no_errors	ENST00000378912	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.975	T
FYB	2533	genome.wustl.edu	37	5	39202766	39202766	+	Silent	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr5:39202766G>T	ENST00000351578.6	-	2	487	c.297C>A	c.(295-297)acC>acA	p.T99T	FYB_ENST00000512982.1_Silent_p.T99T|FYB_ENST00000515010.1_Silent_p.T99T|FYB_ENST00000505428.1_Silent_p.T99T|FYB_ENST00000540520.1_Silent_p.T109T	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	99					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			GGTCTCTGGTGGTCAAGCTGG	0.532																																																	0													60.0	57.0	58.0					5																	39202766		1884	4111	5995	SO:0001819	synonymous_variant	0			U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.297C>A	5.37:g.39202766G>T			A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Silent	SNP	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain	p.T109	ENST00000351578.6	37	c.327	CCDS47200.1	5																																																																																			FYB	-	NULL	ENSG00000082074		0.532	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FYB	HGNC	protein_coding	OTTHUMT00000367098.1	-	0.00	85	0	G	NM_001465		39202766	-1	tier1	-	no_errors	ENST00000540520	ensembl	human	known	74_37	silent	6.25	60	4	SNP	0.000	T
GEMIN4	50628	genome.wustl.edu	37	17	650493	650493	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr17:650493C>T	ENST00000319004.5	-	2	908	c.790G>A	c.(790-792)Gtg>Atg	p.V264M	GEMIN4_ENST00000576778.1_Missense_Mutation_p.V253M|GEMIN4_ENST00000437269.1_Silent_p.P176P	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	264					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		TCCAGATACACGGTTGCAGAC	0.612																																																	0													111.0	122.0	118.0					17																	650493		2171	4260	6431	SO:0001583	missense	0			AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.790G>A	17.37:g.650493C>T	ENSP00000321706:p.Val264Met		Q9NZS7|Q9UG32|Q9Y4Q2	Missense_Mutation	SNP	NULL	p.V264M	ENST00000319004.5	37	c.790	CCDS45559.1	17	.	.	.	.	.	.	.	.	.	.	C	1.846	-0.466137	0.04476	.	.	ENSG00000179409	ENST00000319004	T	0.15487	2.42	5.37	-5.6	0.02497	.	0.824381	0.11210	N	0.587780	T	0.11196	0.0273	L	0.46157	1.445	0.09310	N	0.999999	B	0.22480	0.07	B	0.21546	0.035	T	0.25082	-1.0142	10	0.33141	T	0.24	-7.2753	4.7135	0.12884	0.084:0.5928:0.1672:0.156	.	264	P57678	GEMI4_HUMAN	M	264	ENSP00000321706:V264M	ENSP00000321706:V264M	V	-	1	0	GEMIN4	597243	0.001000	0.12720	0.001000	0.08648	0.237000	0.25408	0.185000	0.16958	-1.393000	0.02079	-2.049000	0.00408	GTG	GEMIN4	-	NULL	ENSG00000179409		0.612	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN4	HGNC	protein_coding	OTTHUMT00000437181.1		0.00	34	0	C	NM_015721		650493	-1			no_errors	ENST00000319004	ensembl	human	known	74_37	missense	15.79	16	3	SNP	0.000	T
GFM1	85476	genome.wustl.edu	37	3	158408049	158408049	+	Silent	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr3:158408049C>T	ENST00000486715.1	+	16	2364	c.2007C>T	c.(2005-2007)aaC>aaT	p.N669N	RP11-379F4.7_ENST00000607624.1_lincRNA|GFM1_ENST00000264263.5_Silent_p.N688N	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			CAGGAATTAACCGACGCCATG	0.418																																																	0													182.0	179.0	180.0					3																	158408049		2203	4300	6503	SO:0001819	synonymous_variant	0			AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.2007C>T	3.37:g.158408049C>T				Silent	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFG/EF2_IV,pfam_EFG_V,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_B-barrel,superfamily_EFG_III-V,smart_Transl_elong_EFG/EF2_IV,smart_EFG_V,prints_EF_GTP-bd_dom,tigrfam_Transl_elong_EFG/EF2,tigrfam_Small_GTP-bd_dom	p.N669	ENST00000486715.1	37	c.2007	CCDS33885.1	3																																																																																			GFM1	-	pfam_EFG_V,superfamily_EFG_III-V,smart_EFG_V,tigrfam_Transl_elong_EFG/EF2	ENSG00000168827		0.418	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFM1	HGNC	protein_coding	OTTHUMT00000352271.1		0.00	97	0	C	NM_024996		158408049	+1			no_errors	ENST00000486715	ensembl	human	known	74_37	silent	5.26	72	4	SNP	1.000	T
GGN	199720	genome.wustl.edu	37	19	38877720	38877720	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:38877720A>G	ENST00000334928.6	-	3	314	c.182T>C	c.(181-183)aTg>aCg	p.M61T	SPRED3_ENST00000586301.1_5'Flank|GGN_ENST00000591809.1_Intron|AC005789.9_ENST00000585411.1_RNA|SPRED3_ENST00000587013.1_5'Flank	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	61	Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCGGGGTACCATGAGTCCCGG	0.697																																																	0													14.0	16.0	15.0					19																	38877720		2145	4182	6327	SO:0001583	missense	0			AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.182T>C	19.37:g.38877720A>G	ENSP00000334940:p.Met61Thr		Q7RTU6|Q86UU4|Q8NAA1	Missense_Mutation	SNP	NULL	p.M61T	ENST00000334928.6	37	c.182	CCDS12516.1	19	.	.	.	.	.	.	.	.	.	.	A	8.518	0.868143	0.17250	.	.	ENSG00000179168	ENST00000334928;ENST00000392116	.	.	.	3.47	2.39	0.29439	.	0.588088	0.12941	N	0.426613	T	0.17577	0.0422	N	0.08118	0	0.18873	N	0.999986	B	0.09022	0.002	B	0.12156	0.007	T	0.18650	-1.0330	9	0.40728	T	0.16	-8.3644	5.7484	0.18132	0.7611:0.0:0.0:0.2389	.	61	Q86UU5	GGN_HUMAN	T	61	.	ENSP00000334940:M61T	M	-	2	0	GGN	43569560	1.000000	0.71417	0.987000	0.45799	0.290000	0.27261	2.718000	0.47236	0.477000	0.27464	0.459000	0.35465	ATG	GGN	-	NULL	ENSG00000179168		0.697	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGN	HGNC	protein_coding	OTTHUMT00000459205.1	-	0.00	77	0	A	NM_152657		38877720	-1	tier1	-	no_errors	ENST00000334928	ensembl	human	known	74_37	missense	31.58	64	30	SNP	0.935	G
GGT7	2686	genome.wustl.edu	37	20	33440292	33440292	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr20:33440292C>T	ENST00000336431.5	-	11	1413	c.1369G>A	c.(1369-1371)Gcc>Acc	p.A457T	GGT7_ENST00000469018.1_5'Flank	NM_178026.2	NP_821158.2	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7	457					glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			NS(2)|breast(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	20						GGGGCAGGGGCTGCCTGGGAG	0.577																																																	0													48.0	52.0	50.0					20																	33440292		2203	4300	6503	SO:0001583	missense	0			AL049709	CCDS13242.2	20q11.22	2008-11-24	2008-03-10	2008-03-10	ENSG00000131067	ENSG00000131067		"""Gamma-glutamyltransferases"""	4259	protein-coding gene	gene with protein product		612342	"""gamma-glutamyltransferase-like 3"""	GGTL5, GGTL3		8104871, 18357469	Standard	NM_178026		Approved	D20S101, dJ18C9.2	uc002xay.3	Q9UJ14	OTTHUMG00000032314	ENST00000336431.5:c.1369G>A	20.37:g.33440292C>T	ENSP00000338964:p.Ala457Thr		Q8N899|Q8NF66|Q9BYP5|Q9BYP6	Missense_Mutation	SNP	pfam_GGT_peptidase,prints_GGT_peptidase	p.A457T	ENST00000336431.5	37	c.1369	CCDS13242.2	20	.	.	.	.	.	.	.	.	.	.	C	11.68	1.710164	0.30322	.	.	ENSG00000131067	ENST00000336431	T	0.06371	3.31	6.17	3.26	0.37387	.	0.665097	0.16541	N	0.209956	T	0.02649	0.0080	N	0.05078	-0.115	0.09310	N	0.999999	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.45716	-0.9242	10	0.21014	T	0.42	-22.6109	3.0826	0.06267	0.1669:0.5435:0.1049:0.1846	.	457;457	A4FU32;Q9UJ14	.;GGT7_HUMAN	T	457	ENSP00000338964:A457T	ENSP00000338964:A457T	A	-	1	0	GGT7	32903953	0.065000	0.20965	0.998000	0.56505	0.998000	0.95712	0.448000	0.21726	0.501000	0.28013	0.655000	0.94253	GCC	GGT7	-	pfam_GGT_peptidase	ENSG00000131067		0.577	GGT7-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	GGT7	HGNC	protein_coding	OTTHUMT00000078816.2	-	0.00	66	0	C	NM_178026		33440292	-1	tier1	-	no_errors	ENST00000336431	ensembl	human	novel	74_37	missense	15.66	70	13	SNP	0.104	T
GJD2	57369	genome.wustl.edu	37	15	35045307	35045307	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr15:35045307A>G	ENST00000290374.4	-	2	814	c.338T>C	c.(337-339)tTc>tCc	p.F113S	RP11-814P5.1_ENST00000503496.1_RNA|RP11-814P5.1_ENST00000558707.1_RNA	NM_020660.2	NP_065711.1	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	113					action potential (GO:0001508)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	19		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		CAGGGCTAGGAAGACTGTAGA	0.562																																																	0													76.0	81.0	79.0					15																	35045307		2201	4298	6499	SO:0001583	missense	0			AB037509	CCDS10040.1	15q13.1	2008-02-04	2007-11-06	2007-11-06	ENSG00000159248	ENSG00000159248		"""Ion channels / Gap junction proteins (connexins)"""	19154	protein-coding gene	gene with protein product	"""connexin 36"""	607058	"""gap junction protein, alpha 9, 36kDa"""	GJA9		10462698	Standard	NM_020660		Approved	CX36	uc001zis.2	Q9UKL4	OTTHUMG00000129674	ENST00000290374.4:c.338T>C	15.37:g.35045307A>G	ENSP00000290374:p.Phe113Ser		Q2M241|Q9P2R0	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin36	p.F113S	ENST00000290374.4	37	c.338	CCDS10040.1	15	.	.	.	.	.	.	.	.	.	.	A	8.737	0.917960	0.17982	.	.	ENSG00000159248	ENST00000290374	D	0.97850	-4.57	4.9	4.9	0.64082	.	0.000000	0.33610	N	0.004739	D	0.92770	0.7701	N	0.14661	0.345	0.58432	D	0.99999	B	0.21520	0.057	B	0.20767	0.031	D	0.90106	0.4188	10	0.07644	T	0.81	.	14.987	0.71356	1.0:0.0:0.0:0.0	.	113	Q9UKL4	CXD2_HUMAN	S	113	ENSP00000290374:F113S	ENSP00000290374:F113S	F	-	2	0	GJD2	32832599	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.498000	0.66931	2.193000	0.70182	0.528000	0.53228	TTC	GJD2	-	NULL	ENSG00000159248		0.562	GJD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJD2	HGNC	protein_coding	OTTHUMT00000251875.2	-	0.00	61	0	A			35045307	-1	tier1	-	no_errors	ENST00000290374	ensembl	human	known	74_37	missense	43.06	41	31	SNP	1.000	G
GPR112	139378	genome.wustl.edu	37	X	135430821	135430821	+	Silent	SNP	T	T	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chrX:135430821T>G	ENST00000394143.1	+	6	5247	c.4956T>G	c.(4954-4956)acT>acG	p.T1652T	GPR112_ENST00000370652.1_Silent_p.T1652T|GPR112_ENST00000287534.4_Silent_p.T1589T|GPR112_ENST00000394141.1_Silent_p.T1447T|GPR112_ENST00000412101.1_Silent_p.T1447T	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1652					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					CAGAGCCAACTTTGCCCTTTG	0.463																																																	0													151.0	149.0	150.0					X																	135430821		2203	4300	6503	SO:0001819	synonymous_variant	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.4956T>G	X.37:g.135430821T>G			A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.T1652	ENST00000394143.1	37	c.4956	CCDS35409.1	X																																																																																			GPR112	-	NULL	ENSG00000156920		0.463	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	-	0.00	19	0	T			135430821	+1	tier1	-	no_errors	ENST00000370652	ensembl	human	known	74_37	silent	41.67	14	10	SNP	0.000	G
GPR112	139378	genome.wustl.edu	37	X	135445724	135445724	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chrX:135445724G>T	ENST00000394143.1	+	13	7657	c.7366G>T	c.(7366-7368)Gtg>Ttg	p.V2456L	GPR112_ENST00000370652.1_Missense_Mutation_p.V2456L|GPR112_ENST00000287534.4_Missense_Mutation_p.V2254L|GPR112_ENST00000394141.1_Missense_Mutation_p.V2251L|GPR112_ENST00000412101.1_Missense_Mutation_p.V2251L	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2456					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TGACAAGATTGTGGATCTTGC	0.358																																																	0													113.0	105.0	108.0					X																	135445724		2203	4300	6503	SO:0001583	missense	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.7366G>T	X.37:g.135445724G>T	ENSP00000377699:p.Val2456Leu		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.V2456L	ENST00000394143.1	37	c.7366	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	G	13.08	2.129848	0.37630	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.28255	1.66;1.66;1.62;1.83;1.62	5.67	2.84	0.33178	.	.	.	.	.	T	0.15782	0.0380	N	0.14661	0.345	0.19300	N	0.999973	B;B	0.16603	0.018;0.01	B;B	0.16722	0.016;0.005	T	0.28170	-1.0052	9	0.24483	T	0.36	.	4.8857	0.13701	0.1881:0.0:0.6331:0.1788	.	2251;2456	Q8IZF6-3;Q8IZF6	.;GP112_HUMAN	L	2456;2456;2251;2254;2251	ENSP00000377699:V2456L;ENSP00000359686:V2456L;ENSP00000416526:V2251L;ENSP00000287534:V2254L;ENSP00000377697:V2251L	ENSP00000287534:V2254L	V	+	1	0	GPR112	135273390	0.962000	0.33011	1.000000	0.80357	0.995000	0.86356	-0.244000	0.08903	0.511000	0.28236	0.600000	0.82982	GTG	GPR112	-	NULL	ENSG00000156920		0.358	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	-	0.00	30	0	G			135445724	+1	tier1	-	no_errors	ENST00000370652	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
GRAMD1C	54762	genome.wustl.edu	37	3	113619948	113619948	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr3:113619948A>T	ENST00000358160.4	+	7	1103	c.611A>T	c.(610-612)gAg>gTg	p.E204V	GRAMD1C_ENST00000452134.2_De_novo_Start_InFrame|GRAMD1C_ENST00000472026.1_Missense_Mutation_p.E37V|GRAMD1C_ENST00000440446.2_De_novo_Start_OutOfFrame|GRAMD1C_ENST00000479212.1_3'UTR	NM_017577.4	NP_060047.3	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	204						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	26						TTAAATGCTGAGGAGATGGAA	0.393																																																	0													108.0	101.0	103.0					3																	113619948		2203	4300	6503	SO:0001583	missense	0				CCDS33826.1, CCDS54625.1	3q13.31	2005-11-02			ENSG00000178075	ENSG00000178075			25252	protein-coding gene	gene with protein product						12975309	Standard	NM_017577		Approved	DKFZp434C0328	uc003eaq.4	Q8IYS0	OTTHUMG00000159340	ENST00000358160.4:c.611A>T	3.37:g.113619948A>T	ENSP00000350881:p.Glu204Val		A8K9Y1|A8KA99|Q6AW94|Q6UWN1|Q8N6S0|Q9UF46	Missense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.E204V	ENST00000358160.4	37	c.611	CCDS33826.1	3	.	.	.	.	.	.	.	.	.	.	A	21.5	4.153770	0.78114	.	.	ENSG00000178075	ENST00000358160;ENST00000472026	T;T	0.57436	1.15;0.4	5.97	4.69	0.59074	.	0.125094	0.51477	D	0.000090	T	0.65626	0.2709	M	0.68593	2.085	0.80722	D	1	D;D	0.67145	0.996;0.964	P;B	0.62298	0.9;0.422	T	0.65689	-0.6107	10	0.49607	T	0.09	.	10.9117	0.47112	0.9195:0.0:0.0805:0.0	.	37;204	E9PHT3;Q8IYS0	.;GRM1C_HUMAN	V	204;37	ENSP00000350881:E204V;ENSP00000419132:E37V	ENSP00000350881:E204V	E	+	2	0	GRAMD1C	115102638	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	3.762000	0.55250	0.956000	0.37904	0.528000	0.53228	GAG	GRAMD1C	-	NULL	ENSG00000178075		0.393	GRAMD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD1C	HGNC	protein_coding	OTTHUMT00000354733.1	-	0.00	58	0	A	NM_017577		113619948	+1	tier1	-	no_errors	ENST00000358160	ensembl	human	known	74_37	missense	25.40	47	16	SNP	1.000	T
GRIN3B	116444	genome.wustl.edu	37	19	1005120	1005120	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:1005120G>T	ENST00000234389.3	+	3	1639	c.1620G>T	c.(1618-1620)caG>caT	p.Q540H	AC004528.4_ENST00000588380.1_RNA|GRIN3B_ENST00000588335.1_3'UTR	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	540					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCCGCTCACAGGTGGTGGACT	0.692																																																	0													44.0	40.0	41.0					19																	1005120		2203	4299	6502	SO:0001583	missense	0				CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.1620G>T	19.37:g.1005120G>T	ENSP00000234389:p.Gln540His		Q5EAK7|Q7RTW9	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.Q540H	ENST00000234389.3	37	c.1620	CCDS32861.1	19	.	.	.	.	.	.	.	.	.	.	G	15.31	2.795003	0.50208	.	.	ENSG00000116032	ENST00000234389	T	0.29917	1.55	4.53	3.46	0.39613	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.392198	0.27544	N	0.018884	T	0.33469	0.0864	M	0.65498	2.005	0.30378	N	0.782246	P	0.48350	0.909	P	0.46659	0.523	T	0.42582	-0.9443	10	0.87932	D	0	.	4.8952	0.13746	0.1826:0.1881:0.6293:0.0	.	540	O60391	NMD3B_HUMAN	H	540	ENSP00000234389:Q540H	ENSP00000234389:Q540H	Q	+	3	2	GRIN3B	956120	0.318000	0.24598	0.949000	0.38748	0.967000	0.64934	0.447000	0.21710	0.889000	0.36185	0.485000	0.47835	CAG	GRIN3B	-	pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000116032		0.692	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3B	HGNC	protein_coding	OTTHUMT00000103923.2		0.00	49	0	G			1005120	+1			no_errors	ENST00000234389	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.660	T
GRM8	2918	genome.wustl.edu	37	7	126173499	126173499	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr7:126173499A>T	ENST00000339582.2	-	9	2745	c.1937T>A	c.(1936-1938)aTc>aAc	p.I646N	GRM8_ENST00000358373.3_Missense_Mutation_p.I646N|GRM8_ENST00000480995.1_5'UTR|GRM8_ENST00000444921.2_Missense_Mutation_p.I646N			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	646					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				GGAGCATATGATTGTATCTGG	0.458										HNSCC(24;0.065)																																							0													88.0	88.0	88.0					7																	126173499		2203	4300	6503	SO:0001583	missense	0				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1937T>A	7.37:g.126173499A>T	ENSP00000344173:p.Ile646Asn		A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_8,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4,pfscan_GPCR_3_C	p.I646N	ENST00000339582.2	37	c.1937	CCDS5794.1	7	.	.	.	.	.	.	.	.	.	.	A	12.17	1.856719	0.32791	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373	D;D;D	0.88509	-2.39;-2.39;-2.39	5.75	5.75	0.90469	GPCR, family 3, C-terminal (2);	0.295498	0.37219	N	0.002190	D	0.87609	0.6220	L	0.46157	1.445	0.80722	D	1	B;B	0.27013	0.027;0.166	B;B	0.35182	0.021;0.197	D	0.85246	0.1041	10	0.45353	T	0.12	.	15.2424	0.73480	1.0:0.0:0.0:0.0	.	646;646	O00222-2;O00222	.;GRM8_HUMAN	N	646	ENSP00000344173:I646N;ENSP00000409790:I646N;ENSP00000351142:I646N	ENSP00000344173:I646N	I	-	2	0	GRM8	125960735	0.389000	0.25205	0.991000	0.47740	0.993000	0.82548	1.122000	0.31295	2.206000	0.71126	0.533000	0.62120	ATC	GRM8	-	pfam_GPCR_3_C,pfscan_GPCR_3_C	ENSG00000179603		0.458	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	HGNC	protein_coding	OTTHUMT00000059209.4	-	0.00	46	0	A			126173499	-1	tier1	-	no_errors	ENST00000339582	ensembl	human	known	74_37	missense	58.06	13	18	SNP	0.995	T
GYG2P1	352887	genome.wustl.edu	37	Y	14495005	14495005	+	RNA	SNP	C	C	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chrY:14495005C>G	ENST00000493160.1	-	0	930									glycogenin 2 pseudogene 1																		TCCACTGGCCCAGGGTGCTCC	0.582																																																	0																																												0					Yq11.21	2010-07-02	2010-03-19	2010-03-19	ENSG00000206159	ENSG00000206159			4701	pseudogene	pseudogene			"""glycogenin 2 pseudogene"""	GYG2P		10542153	Standard	NR_033667		Approved		uc022cji.1		OTTHUMG00000036382		Y.37:g.14495005C>G				RNA	SNP	-	NULL	ENST00000493160.1	37	NULL		Y																																																																																			GYG2P1	-	-	ENSG00000206159		0.582	GYG2P1-003	KNOWN	basic	processed_transcript	GYG2P1	HGNC	pseudogene	OTTHUMT00000088556.1	-	0.00	22	0	C	NG_002811		14495005	-1	tier1	-	no_errors	ENST00000493160	ensembl	human	known	74_37	rna	12.90	27	4	SNP	0.995	G
HACE1	57531	genome.wustl.edu	37	6	105177430	105177430	+	3'UTR	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr6:105177430C>T	ENST00000262903.4	-	0	3113				HACE1_ENST00000369125.2_3'UTR|HACE1_ENST00000517995.1_5'UTR	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1						cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		GAAGCATCAGCCCTGCCTATG	0.358																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.*107G>A	6.37:g.105177430C>T			A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	RNA	SNP	-	NULL	ENST00000262903.4	37	NULL	CCDS5050.1	6																																																																																			HACE1	-	-	ENSG00000085382		0.358	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HACE1	HGNC	protein_coding	OTTHUMT00000041643.2	-	0.00	13	0	C	XM_045095		105177430	-1	tier1	-	no_errors	ENST00000517995	ensembl	human	known	74_37	rna	53.85	6	7	SNP	0.999	T
HAL	3034	genome.wustl.edu	37	12	96379931	96379931	+	Silent	SNP	A	A	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr12:96379931A>G	ENST00000261208.3	-	13	1427	c.1059T>C	c.(1057-1059)caT>caC	p.H353H	HAL_ENST00000538703.1_Silent_p.H353H|HAL_ENST00000541929.1_Silent_p.H145H	NM_002108.3	NP_002099.1	P42357	HUTH_HUMAN	histidine ammonia-lyase	353					biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	histidine ammonia-lyase activity (GO:0004397)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	34					L-Histidine(DB00117)	GTCGAAGAGCATGAATGTCTA	0.423																																					NSCLC(169;943 2815 23563 30031)												0													93.0	81.0	85.0					12																	96379931		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9058.1, CCDS58264.1, CCDS58265.1	12q22-q24.1	1991-07-12				ENSG00000084110	4.3.1.3		4806	protein-coding gene	gene with protein product		609457		HIS			Standard	NM_002108		Approved		uc001tem.2	P42357	OTTHUMG00000170354	ENST00000261208.3:c.1059T>C	12.37:g.96379931A>G			B4DQC1|B4E0V8|F5GXF2|F5H1U5|Q4VB92|Q4VB93	Silent	SNP	pfam_Aromatic_Lyase,superfamily_L-Aspartase-like,tigrfam_HutH	p.H353	ENST00000261208.3	37	c.1059	CCDS9058.1	12																																																																																			HAL	-	pfam_Aromatic_Lyase,superfamily_L-Aspartase-like,tigrfam_HutH	ENSG00000084110		0.423	HAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAL	HGNC	protein_coding	OTTHUMT00000408644.1	-	0.00	43	0	A			96379931	-1	tier1	-	no_errors	ENST00000261208	ensembl	human	known	74_37	silent	34.69	32	17	SNP	0.994	G
HCN2	610	genome.wustl.edu	37	19	603569	603569	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:603569C>A	ENST00000251287.2	+	2	711	c.658C>A	c.(658-660)Ctg>Atg	p.L220M		NM_001194.3	NP_001185.3	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 2	220					cell-cell signaling (GO:0007267)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	cAMP binding (GO:0030552)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.L220L(1)		endometrium(5)|lung(4)	9		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACCATGCTGCTGTTCATGGT	0.627																																					Melanoma(145;1175 2427 8056 36306)												1	Substitution - coding silent(1)	endometrium(1)											52.0	50.0	51.0					19																	603569		2196	4293	6489	SO:0001583	missense	0			AF064877	CCDS12035.1	19p13	2011-07-05				ENSG00000099822		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4846	protein-coding gene	gene with protein product		602781		BCNG2		9405696, 9630217, 16382102	Standard	NM_001194		Approved	BCNG-2, HAC-1	uc002lpe.3	Q9UL51		ENST00000251287.2:c.658C>A	19.37:g.603569C>A	ENSP00000251287:p.Leu220Met		O60742|O60743|O75267|Q9UBS2	Missense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.L220M	ENST00000251287.2	37	c.658	CCDS12035.1	19	.	.	.	.	.	.	.	.	.	.	.	14.28	2.487570	0.44249	.	.	ENSG00000099822	ENST00000251287	D	0.97976	-4.64	3.22	2.16	0.27623	Ion transport N-terminal (1);	.	.	.	.	D	0.94387	0.8195	L	0.28608	0.87	0.48901	D	0.999721	P	0.43701	0.815	B	0.43194	0.411	D	0.91472	0.5197	9	0.45353	T	0.12	.	8.8578	0.35238	0.0:0.8836:0.0:0.1164	.	220	Q9UL51	HCN2_HUMAN	M	220	ENSP00000251287:L220M	ENSP00000251287:L220M	L	+	1	2	HCN2	554569	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.948000	0.40303	0.685000	0.31468	0.479000	0.44913	CTG	HCN2	-	pfam_Ion_trans_N	ENSG00000099822		0.627	HCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN2	HGNC	protein_coding	OTTHUMT00000452100.1		0.00	47	0	C	NM_001194		603569	+1			no_errors	ENST00000251287	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	A
HERPUD1	9709	genome.wustl.edu	37	16	56973168	56973168	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr16:56973168G>A	ENST00000439977.2	+	5	648	c.451G>A	c.(451-453)Gca>Aca	p.A151T	HERPUD1_ENST00000570273.1_3'UTR|HERPUD1_ENST00000379792.2_Missense_Mutation_p.A126T|RP11-325K4.3_ENST00000565861.1_RNA|RP11-325K4.2_ENST00000570210.1_RNA|HERPUD1_ENST00000300302.5_Missense_Mutation_p.A150T|HERPUD1_ENST00000344114.4_Intron	NM_001010989.1|NM_014685.2	NP_001010989.1|NP_055500.1	Q15011	HERP1_HUMAN	homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1	151					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of protein binding (GO:0032092)|regulation of protein ubiquitination (GO:0031396)|response to unfolded protein (GO:0006986)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|stomach(1)	11						TGCCCAGCAGGCATTCCAAGG	0.433			T	ERG	prostate																																			Dom	yes		16	16q12.2-q13	9709	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1"""		E	0													130.0	140.0	136.0					16																	56973168		2198	4300	6498	SO:0001583	missense	0			AB034989	CCDS10771.1, CCDS45492.1	16q13	2008-05-14			ENSG00000051108	ENSG00000051108			13744	protein-coding gene	gene with protein product		608070				10922362, 10708769	Standard	NM_001010989		Approved	KIAA0025, Mif1, HERP, SUP	uc002eke.2	Q15011	OTTHUMG00000133276	ENST00000439977.2:c.451G>A	16.37:g.56973168G>A	ENSP00000409555:p.Ala151Thr		E9PGD1|O60644|Q6IAN8|Q96D92	Missense_Mutation	SNP	pfam_Ubiquitin_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.A151T	ENST00000439977.2	37	c.451	CCDS10771.1	16	.	.	.	.	.	.	.	.	.	.	G	11.90	1.777960	0.31502	.	.	ENSG00000051108	ENST00000439977;ENST00000379792;ENST00000300302	T	0.30448	1.53	5.98	2.8	0.32819	.	0.445998	0.24949	N	0.034309	T	0.12178	0.0296	N	0.05383	-0.06	0.24198	N	0.995524	B;B;B;B	0.06786	0.001;0.001;0.001;0.0	B;B;B;B	0.12156	0.007;0.003;0.005;0.001	T	0.31024	-0.9958	10	0.10111	T	0.7	-19.8585	6.1749	0.20439	0.2512:0.174:0.5748:0.0	.	151;126;150;151	A4UAE9;E9PGD1;Q15011-2;Q15011	.;.;.;HERP1_HUMAN	T	150;126;151	ENSP00000369118:A126T	ENSP00000300302:A151T	A	+	1	0	HERPUD1	55530669	0.333000	0.24731	0.970000	0.41538	0.997000	0.91878	0.814000	0.27239	0.764000	0.33197	0.591000	0.81541	GCA	HERPUD1	-	NULL	ENSG00000051108		0.433	HERPUD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HERPUD1	HGNC	protein_coding	OTTHUMT00000257056.5	-	0.00	93	0	G			56973168	+1	tier1	-	no_errors	ENST00000439977	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.959	A
HK1	3098	genome.wustl.edu	37	10	71148995	71148995	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr10:71148995G>T	ENST00000359426.6	+	14	2082	c.1978G>T	c.(1978-1980)Ggc>Tgc	p.G660C	HK1_ENST00000404387.2_Missense_Mutation_p.G664C|HK1_ENST00000448642.2_Missense_Mutation_p.G695C|HK1_ENST00000298649.3_Missense_Mutation_p.G659C|HK1_ENST00000360289.2_Missense_Mutation_p.G648C	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	660	Catalytic.|Hexokinase type-1 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						CGACACAGTGGGCACCATGAT	0.517																																																	0													200.0	147.0	165.0					10																	71148995		2203	4300	6503	SO:0001583	missense	0			M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.1978G>T	10.37:g.71148995G>T	ENSP00000352398:p.Gly660Cys		E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.G695C	ENST00000359426.6	37	c.2083	CCDS7292.1	10	.	.	.	.	.	.	.	.	.	.	G	32	5.163810	0.94727	.	.	ENSG00000156515	ENST00000360289;ENST00000448642;ENST00000404387;ENST00000298649;ENST00000359426;ENST00000405407	D;D;D;D;D	0.99722	-6.53;-6.53;-6.53;-6.53;-6.53	5.82	5.82	0.92795	Hexokinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99876	0.9941	H	0.98786	4.33	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;1.0;1.0	D	0.96530	0.9392	10	0.87932	D	0	-26.914	19.6856	0.95978	0.0:0.0:1.0:0.0	.	660;660;659;695;664;648	A8K7J7;P19367;P19367-2;E7ENR4;P19367-3;P19367-4	.;HXK1_HUMAN;.;.;.;.	C	648;695;664;659;660;660	ENSP00000353433:G648C;ENSP00000402103:G695C;ENSP00000384774:G664C;ENSP00000298649:G659C;ENSP00000352398:G660C	ENSP00000298649:G659C	G	+	1	0	HK1	70819001	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.768000	0.98965	2.762000	0.94881	0.650000	0.86243	GGC	HK1	-	pfam_Hexokinase_N,prints_Hexokinase	ENSG00000156515		0.517	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HK1	HGNC	protein_coding	OTTHUMT00000048429.2	-	0.00	70	0	G	NM_000188		71148995	+1	tier1	-	no_errors	ENST00000448642	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
HLA-DPA1	3113	genome.wustl.edu	37	6	33037071	33037071	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr6:33037071G>C	ENST00000419277.1	-	4	482	c.353C>G	c.(352-354)cCt>cGt	p.P118R	HLA-DPA1_ENST00000428995.1_Missense_Mutation_p.P118R|HLA-DPA1_ENST00000463066.1_5'UTR	NM_001242524.1|NM_001242525.1	NP_001229453.1|NP_001229454.1	P20036	DPA1_HUMAN	major histocompatibility complex, class II, DP alpha 1	118	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			kidney(5)|large_intestine(1)|lung(6)|prostate(1)|skin(2)	15						GGTCACCTCAGGGGGATCTGG	0.577																																																	0													61.0	80.0	73.0					6																	33037071		1507	2707	4214	SO:0001583	missense	0			X00457	CCDS4764.1	6p21.3	2013-01-11			ENSG00000231389	ENSG00000231389		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4938	protein-coding gene	gene with protein product		142880		HLA-DP1A		6584734	Standard	NM_033554		Approved		uc003ocs.2	P20036	OTTHUMG00000031058	ENST00000419277.1:c.353C>G	6.37:g.33037071G>C	ENSP00000393566:p.Pro118Arg		A9YWH7|B9UKH4|O19722|O46883|P01905|P79554|Q2Q060|Q2Q061|Q5EY03|Q5STP1|Q6DQK4|Q9BCQ1|Q9TPX3|Q9XS10	Missense_Mutation	SNP	pfam_MHC_II_a_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.P118R	ENST00000419277.1	37	c.353	CCDS4764.1	6	.	.	.	.	.	.	.	.	.	.	G	15.48	2.845815	0.51164	.	.	ENSG00000231389	ENST00000419277;ENST00000428995;ENST00000453337	T;T;T	0.58358	3.61;3.61;0.34	3.4	2.5	0.30297	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	U	0.000001	T	0.78457	0.4286	H	0.99454	4.575	0.42707	D	0.993637	D	0.89917	1.0	D	0.91635	0.999	D	0.83492	0.0070	10	0.87932	D	0	.	10.133	0.42691	0.0:0.0:0.7975:0.2025	.	118	P20036	DPA1_HUMAN	R	118	ENSP00000393566:P118R;ENSP00000402872:P118R;ENSP00000390929:P118R	ENSP00000393566:P118R	P	-	2	0	HLA-DPA1	33145049	1.000000	0.71417	0.325000	0.25375	0.811000	0.45836	4.608000	0.61141	0.677000	0.31305	0.643000	0.83706	CCT	HLA-DPA1	-	pfscan_Ig-like_dom	ENSG00000231389		0.577	HLA-DPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DPA1	HGNC	protein_coding	OTTHUMT00000076071.3	-	0.00	54	0	G	NM_033554		33037071	-1	tier1	-	no_errors	ENST00000419277	ensembl	human	known	74_37	missense	25.58	32	11	SNP	0.997	C
HNF4A	3172	genome.wustl.edu	37	20	43030116	43030116	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr20:43030116C>T	ENST00000316099.4	+	1	193	c.104C>T	c.(103-105)aCg>aTg	p.T35M	HNF4A_ENST00000609795.1_Intron|HNF4A_ENST00000443598.2_Missense_Mutation_p.T35M|HNF4A_ENST00000316673.4_Intron|HNF4A_ENST00000415691.2_Missense_Mutation_p.T35M|HNF4A_ENST00000457232.1_Intron	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	35					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.T35K(2)		endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CAGGTGTTGACGATGGGCAAT	0.587																																					Colon(79;2 1269 8820 14841 52347)												2	Substitution - Missense(2)	lung(2)											139.0	106.0	117.0					20																	43030116		2203	4300	6503	SO:0001583	missense	0			X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.104C>T	20.37:g.43030116C>T	ENSP00000312987:p.Thr35Met		A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_COUP_TF,prints_Retinoid-X_rcpt/HNF4	p.T35M	ENST00000316099.4	37	c.104	CCDS13330.1	20	.	.	.	.	.	.	.	.	.	.	C	20.3	3.965430	0.74131	.	.	ENSG00000101076	ENST00000316099;ENST00000443598;ENST00000338692;ENST00000415691	D;D;D	0.92647	-2.99;-3.08;-2.99	5.23	5.23	0.72850	.	820.741000	0.00166	N	0.000000	D	0.91112	0.7202	N	0.08118	0	0.32938	D	0.518044	P;P;D	0.60575	0.771;0.771;0.988	B;B;P	0.56343	0.205;0.411;0.796	D	0.83406	0.0025	10	0.42905	T	0.14	.	13.4078	0.60924	0.1572:0.8428:0.0:0.0	.	35;35;35	P41235;F1D8S2;P41235-3	HNF4A_HUMAN;.;.	M	35	ENSP00000312987:T35M;ENSP00000410911:T35M;ENSP00000412111:T35M	ENSP00000312987:T35M	T	+	2	0	HNF4A	42463530	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	5.771000	0.68881	2.440000	0.82611	0.555000	0.69702	ACG	HNF4A	-	NULL	ENSG00000101076		0.587	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF4A	HGNC	protein_coding	OTTHUMT00000079363.3		0.00	59	0	C			43030116	+1			no_errors	ENST00000316099	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	T
HPS3	84343	genome.wustl.edu	37	3	148877872	148877872	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr3:148877872G>T	ENST00000296051.2	+	11	2052	c.1912G>T	c.(1912-1914)Gag>Tag	p.E638*	HPS3_ENST00000460120.1_Nonsense_Mutation_p.E473*	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	638					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			TTATGTGGCTGAGCCAAAGCA	0.408									Hermansky-Pudlak syndrome																																								0													163.0	161.0	162.0					3																	148877872		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	HPS, HPS1-8	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.1912G>T	3.37:g.148877872G>T	ENSP00000296051:p.Glu638*		A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Nonsense_Mutation	SNP	pirsf_HPS3	p.E638*	ENST00000296051.2	37	c.1912	CCDS3140.1	3	.	.	.	.	.	.	.	.	.	.	G	42	9.512128	0.99192	.	.	ENSG00000163755	ENST00000296051;ENST00000460120	.	.	.	5.41	5.41	0.78517	.	0.143868	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-16.0404	19.5526	0.95328	0.0:0.0:1.0:0.0	.	.	.	.	X	638;473	.	ENSP00000296051:E638X	E	+	1	0	HPS3	150360562	1.000000	0.71417	0.992000	0.48379	0.997000	0.91878	7.762000	0.85270	2.701000	0.92244	0.563000	0.77884	GAG	HPS3	-	pirsf_HPS3	ENSG00000163755		0.408	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS3	HGNC	protein_coding	OTTHUMT00000356151.1	-	0.00	80	0	G	NM_032383		148877872	+1	tier1	-	no_errors	ENST00000296051	ensembl	human	known	74_37	nonsense	7.14	52	4	SNP	1.000	T
HRC	3270	genome.wustl.edu	37	19	49657890	49657892	+	In_Frame_Del	DEL	TCC	TCC	-	rs369248456|rs571697189	byFrequency	TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:49657890_49657892delTCC	ENST00000252825.4	-	1	789_791	c.603_605delGGA	c.(601-606)gaggaa>gaa	p.201_202EE>E	HRC_ENST00000595625.1_In_Frame_Del_p.201_202EE>E	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	201	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Glu-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		GGcctcctcttcctcctcctcct	0.562																																					Melanoma(37;75 1097 24567 25669 30645)												0																																										SO:0001651	inframe_deletion	0				CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.603_605delGGA	19.37:g.49657899_49657901delTCC	ENSP00000252825:p.Glu204del		Q504Y6	In_Frame_Del	DEL	pfam_Hist_rich_Ca-bd	p.E204in_frame_del	ENST00000252825.4	37	c.605_603	CCDS12759.1	19																																																																																			HRC	-	NULL	ENSG00000130528		0.562	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRC	HGNC	protein_coding	OTTHUMT00000465649.1		0.00	36	0	TCC	NM_002152		49657892	-1	tier1		no_errors	ENST00000252825	ensembl	human	known	74_37	in_frame_del	8.57	32	3	DEL	0.004:0.016:0.003	-
HTR3B	9177	genome.wustl.edu	37	11	113803807	113803807	+	Nonsense_Mutation	SNP	C	C	T	rs370926260		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:113803807C>T	ENST00000260191.2	+	6	945	c.688C>T	c.(688-690)Cag>Tag	p.Q230*	HTR3B_ENST00000537778.1_Nonsense_Mutation_p.Q219*	NM_006028.4	NP_006019.1	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B, ionotropic	230					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ion channel activity (GO:0005216)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(11)	20		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)	Ergoloid mesylate(DB01049)	TGCACAGATTCAGTTTAATGT	0.483																																																	0								C	stop/GLN	0,4402		0,0,2201	109.0	99.0	103.0		688	5.7	1.0	11		103	1,8591	1.2+/-3.3	0,1,4295	no	stop-gained	HTR3B	NM_006028.4		0,1,6496	TT,TC,CC		0.0116,0.0,0.0077		230/442	113803807	1,12993	2201	4296	6497	SO:0001587	stop_gained	0			AF080582	CCDS8364.1	11q23.1	2012-05-22	2012-02-03		ENSG00000149305	ENSG00000149305		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5298	protein-coding gene	gene with protein product		604654	"""5-hydroxytryptamine (serotonin) receptor 3B"""			9950429, 10521471	Standard	NM_006028		Approved	5-HT3B	uc001pok.3	O95264	OTTHUMG00000168210	ENST00000260191.2:c.688C>T	11.37:g.113803807C>T	ENSP00000260191:p.Gln230*		B0YJ23|Q0VJC3	Nonsense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_5HT3_rcpt_B,prints_5HT3_rcpt,prints_Neur_channel,prints_5HT3_rcpt_A,tigrfam_Neur_channel	p.Q230*	ENST00000260191.2	37	c.688	CCDS8364.1	11	.	.	.	.	.	.	.	.	.	.	C	39	7.528372	0.98339	0.0	1.16E-4	ENSG00000149305	ENST00000260191;ENST00000537778	.	.	.	5.65	5.65	0.86999	.	0.120924	0.56097	D	0.000021	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-5.1798	14.1014	0.65059	0.1509:0.8491:0.0:0.0	.	.	.	.	X	230;219	.	ENSP00000260191:Q230X	Q	+	1	0	HTR3B	113309017	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.519000	0.35888	2.941000	0.99782	0.655000	0.94253	CAG	HTR3B	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000149305		0.483	HTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR3B	HGNC	protein_coding	OTTHUMT00000398842.1	-	0.00	75	0	C	NM_006028		113803807	+1	tier1	-	no_errors	ENST00000260191	ensembl	human	known	74_37	nonsense	21.62	58	16	SNP	1.000	T
ID1	3397	genome.wustl.edu	37	20	30193543	30193543	+	Missense_Mutation	SNP	C	C	T	rs200577120	byFrequency	TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr20:30193543C>T	ENST00000376112.3	+	1	458	c.353C>T	c.(352-354)cCc>cTc	p.P118L	MIR3193_ENST00000578262.1_RNA|ID1_ENST00000376105.3_Missense_Mutation_p.P118L	NM_002165.3	NP_002156.2	P41134	ID1_HUMAN	inhibitor of DNA binding 1, dominant negative helix-loop-helix protein	118					angiogenesis (GO:0001525)|blood vessel endothelial cell migration (GO:0043534)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|collagen metabolic process (GO:0032963)|endothelial cell morphogenesis (GO:0001886)|heart development (GO:0007507)|lung morphogenesis (GO:0060425)|lung vasculature development (GO:0060426)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein destabilization (GO:0031648)|regulation of angiogenesis (GO:0045765)|regulation of MAPK cascade (GO:0043408)|response to antibiotic (GO:0046677)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|ovary(1)|pancreas(1)	4	all_cancers(5;7.12e-06)|Lung NSC(7;3.95e-06)|all_epithelial(3;4.36e-06)|all_lung(7;6.68e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;1.99e-05)|all cancers(5;0.000169)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			GTTGGAACCCCCGGGGGCCGA	0.622													C|||	2	0.000399361	0.0	0.0	5008	,	,		16222	0.0		0.002	False		,,,				2504	0.0				NSCLC(123;1618 1779 21803 28680 33854)												0								C	LEU/PRO,LEU/PRO	0,4406		0,0,2203	16.0	20.0	19.0		353,353	5.0	0.2	20		19	8,8590		0,8,4291	no	missense,missense	ID1	NM_002165.3,NM_181353.2	98,98	0,8,6494	TT,TC,CC		0.093,0.0,0.0615	benign,benign	118/156,118/150	30193543	8,12996	2203	4299	6502	SO:0001583	missense	0				CCDS13185.1, CCDS13186.1	20q11	2013-05-21			ENSG00000125968	ENSG00000125968		"""Basic helix-loop-helix proteins"""	5360	protein-coding gene	gene with protein product	"""DNA-binding protein inhibitor ID-1"""	600349				8294468	Standard	NM_002165		Approved	dJ857M17.1.2, bHLHb24	uc002wwg.2	P41134	OTTHUMG00000032181	ENST00000376112.3:c.353C>T	20.37:g.30193543C>T	ENSP00000365280:p.Pro118Leu		A8K537|E1P5L4|O00651|O00652|Q16371|Q16377|Q5TE66|Q5TE67|Q969Z7|Q9H0Z5|Q9H109	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.P118L	ENST00000376112.3	37	c.353	CCDS13185.1	20	.	.	.	.	.	.	.	.	.	.	C	12.47	1.948446	0.34377	0.0	9.3E-4	ENSG00000125968	ENST00000376112;ENST00000376105	T;T	0.49720	0.77;0.77	4.97	4.97	0.65823	Helix-loop-helix DNA-binding (1);	0.414644	0.24508	N	0.037914	T	0.29458	0.0734	N	0.08118	0	0.44677	D	0.997664	P;B	0.35575	0.51;0.001	B;B	0.35413	0.202;0.001	T	0.11084	-1.0602	10	0.18710	T	0.47	-15.5649	17.3358	0.87280	0.0:1.0:0.0:0.0	.	118;118	P41134-2;P41134	.;ID1_HUMAN	L	118	ENSP00000365280:P118L;ENSP00000365273:P118L	ENSP00000365273:P118L	P	+	2	0	ID1	29657204	0.208000	0.23494	0.184000	0.23157	0.001000	0.01503	3.601000	0.54059	2.735000	0.93741	0.655000	0.94253	CCC	ID1	-	superfamily_bHLH_dom	ENSG00000125968		0.622	ID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ID1	HGNC	protein_coding	OTTHUMT00000078550.1	-	0.00	47	0	C	NM_002165		30193543	+1	tier1	rs200577120	no_errors	ENST00000376112	ensembl	human	known	74_37	missense	49.15	30	29	SNP	1.000	T
IGSF10	285313	genome.wustl.edu	37	3	151155705	151155705	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr3:151155705G>A	ENST00000282466.3	-	6	6643	c.6644C>T	c.(6643-6645)gCc>gTc	p.A2215V	IGSF10_ENST00000495443.1_5'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2215	Ig-like C2-type 8.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GGGATTTCGGGCTACACATAC	0.403																																																	0													115.0	109.0	111.0					3																	151155705		2203	4300	6503	SO:0001583	missense	0			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.6644C>T	3.37:g.151155705G>A	ENSP00000282466:p.Ala2215Val		Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.A2215V	ENST00000282466.3	37	c.6644	CCDS3160.1	3	.	.	.	.	.	.	.	.	.	.	G	22.0	4.231499	0.79688	.	.	ENSG00000152580	ENST00000282466	T	0.72505	-0.66	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.47852	D	0.000219	D	0.84660	0.5521	M	0.75884	2.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.83357	-0.0000	10	0.44086	T	0.13	.	19.9792	0.97320	0.0:0.0:1.0:0.0	.	2215;242	Q6WRI0;Q6WRI0-2	IGS10_HUMAN;.	V	2215	ENSP00000282466:A2215V	ENSP00000282466:A2215V	A	-	2	0	IGSF10	152638395	1.000000	0.71417	0.572000	0.28498	0.921000	0.55340	9.414000	0.97362	2.727000	0.93392	0.591000	0.81541	GCC	IGSF10	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000152580		0.403	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	HGNC	protein_coding	OTTHUMT00000357782.1		0.00	68	0	G	NM_178822		151155705	-1			no_errors	ENST00000282466	ensembl	human	known	74_37	missense	5.45	52	3	SNP	1.000	A
IL27RA	9466	genome.wustl.edu	37	19	14160008	14160008	+	Silent	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:14160008C>T	ENST00000263379.2	+	10	1409	c.1284C>T	c.(1282-1284)gcC>gcT	p.A428A		NM_004843.3	NP_004834.1	Q6UWB1	I27RA_HUMAN	interleukin 27 receptor, alpha	428	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T-helper 1 type immune response (GO:0002827)|regulation of isotype switching to IgG isotypes (GO:0048302)	integral component of plasma membrane (GO:0005887)	interleukin-27 receptor activity (GO:0045509)|transmembrane signaling receptor activity (GO:0004888)			breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	26						TCCAAGATGCCCCTCCAGGGA	0.642											OREG0025303	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Colon(164;1849 1896 4443 37792 47834)												0													44.0	47.0	46.0					19																	14160008		2203	4300	6503	SO:0001819	synonymous_variant	0			AF053004	CCDS12303.1	19p13.11	2013-02-11				ENSG00000104998		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	17290	protein-coding gene	gene with protein product	"""T-cell cytokine receptor type 1"""	605350				9600072, 11057672	Standard	NM_004843		Approved	WSX-1, TCCR, CRL1, WSX1, zcytor1, IL-27R	uc002mxx.4	Q6UWB1		ENST00000263379.2:c.1284C>T	19.37:g.14160008C>T		693	A0N0L1|O60624	Silent	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.A428	ENST00000263379.2	37	c.1284	CCDS12303.1	19																																																																																			IL27RA	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000104998		0.642	IL27RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL27RA	HGNC	protein_coding	OTTHUMT00000458539.1	-	0.00	62	0	C	NM_004843		14160008	+1	tier1	-	no_errors	ENST00000263379	ensembl	human	known	74_37	silent	26.32	28	10	SNP	0.000	T
INTS1	26173	genome.wustl.edu	37	7	1536943	1536943	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr7:1536943G>A	ENST00000404767.3	-	11	1518	c.1433C>T	c.(1432-1434)gCc>gTc	p.A478V	INTS1_ENST00000389470.4_Missense_Mutation_p.A606V|INTS1_ENST00000493531.1_5'Flank	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	478					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		GAACACCATGGCCAGGAACTG	0.652																																																	0													32.0	35.0	34.0					7																	1536943		2033	4179	6212	SO:0001583	missense	0			AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.1433C>T	7.37:g.1536943G>A	ENSP00000385722:p.Ala478Val		A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	pfam_DUF3677,superfamily_ARM-type_fold	p.A606V	ENST00000404767.3	37	c.1817	CCDS47526.1	7	.	.	.	.	.	.	.	.	.	.	G	19.50	3.838823	0.71373	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.68331	2.62;-0.32	5.29	4.4	0.53042	.	0.000000	0.85682	D	0.000000	T	0.81123	0.4757	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.83875	0.0276	10	0.87932	D	0	.	15.4702	0.75434	0.0:0.0:0.8605:0.1395	.	478	Q8N201	INT1_HUMAN	V	478;606	ENSP00000385722:A478V;ENSP00000374121:A606V	ENSP00000374121:A606V	A	-	2	0	INTS1	1503469	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.626000	0.98410	1.218000	0.43458	0.655000	0.94253	GCC	INTS1	-	NULL	ENSG00000164880		0.652	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS1	HGNC	protein_coding	OTTHUMT00000323683.1	-	0.00	25	0	G			1536943	-1	tier1	-	no_errors	ENST00000389470	ensembl	human	known	74_37	missense	31.58	26	12	SNP	1.000	A
ITGA4	3676	genome.wustl.edu	37	2	182363438	182363438	+	Silent	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:182363438G>T	ENST00000397033.2	+	15	2059	c.1629G>T	c.(1627-1629)gtG>gtT	p.V543V		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	543					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	CTTCTGACGTGATTACAGGAA	0.358																																																	0													98.0	95.0	96.0					2																	182363438		2009	4179	6188	SO:0001819	synonymous_variant	0				CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.1629G>T	2.37:g.182363438G>T			D3DPG4|Q7Z4L6	Silent	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.V543	ENST00000397033.2	37	c.1629	CCDS42788.1	2																																																																																			ITGA4	-	pfam_Integrin_alpha-2	ENSG00000115232		0.358	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA4	HGNC	protein_coding	OTTHUMT00000334427.1	-	0.00	52	0	G			182363438	+1	tier1	-	no_errors	ENST00000397033	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.367	T
ITM2B	9445	genome.wustl.edu	37	13	48807528	48807528	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr13:48807528C>T	ENST00000378565.5	+	1	235	c.32C>T	c.(31-33)gCc>gTc	p.A11V	ITM2B_ENST00000378549.5_Missense_Mutation_p.A11V	NM_021999.4	NP_068839.1	Q9Y287	ITM2B_HUMAN	integral membrane protein 2B	11					extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|nervous system development (GO:0007399)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle membrane (GO:0030660)|integral component of organelle membrane (GO:0031301)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|beta-amyloid binding (GO:0001540)			endometrium(1)|large_intestine(2)|lung(3)	6		all_cancers(8;2.2e-31)|all_epithelial(8;6.77e-15)|all_lung(13;9.67e-07)|all_hematologic(8;9.72e-06)|Lung NSC(96;8.3e-05)|Breast(56;0.000141)|Acute lymphoblastic leukemia(8;0.00045)|Prostate(109;0.000669)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;1.97e-06)		TCCGCTCTGGCCCAGAAGGAG	0.741																																																	0													11.0	10.0	10.0					13																	48807528		2153	4245	6398	SO:0001583	missense	0			AF092128	CCDS9409.1	13q14.2	2012-10-10			ENSG00000136156	ENSG00000136156		"""BRICHOS domain containing"""	6174	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2B"""	603904				9795190	Standard	NM_021999		Approved	BRI, E25B, E3-16, BRICD2B	uc001vbz.3	Q9Y287	OTTHUMG00000016894	ENST00000378565.5:c.32C>T	13.37:g.48807528C>T	ENSP00000367828:p.Ala11Val		Q5W0A3|Q96B24|Q9NYH1	Missense_Mutation	SNP	pfam_BRICHOS_dom,pfscan_BRICHOS_dom	p.A11V	ENST00000378565.5	37	c.32	CCDS9409.1	13	.	.	.	.	.	.	.	.	.	.	C	24.8	4.570249	0.86542	.	.	ENSG00000136156	ENST00000378565;ENST00000378549	T;T	0.46063	0.99;0.88	5.04	5.04	0.67666	.	0.130895	0.50627	D	0.000118	T	0.37812	0.1017	L	0.47716	1.5	0.34835	D	0.740047	B	0.31383	0.321	B	0.30251	0.113	T	0.54781	-0.8242	10	0.59425	D	0.04	-1.2075	13.8841	0.63698	0.0:1.0:0.0:0.0	.	11	Q9Y287	ITM2B_HUMAN	V	11	ENSP00000367828:A11V;ENSP00000367811:A11V	ENSP00000367811:A11V	A	+	2	0	ITM2B	47705529	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.929000	0.56514	2.333000	0.79357	0.561000	0.74099	GCC	ITM2B	-	NULL	ENSG00000136156		0.741	ITM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITM2B	HGNC	protein_coding	OTTHUMT00000044870.3	-	0.00	70	0	C	NM_021999		48807528	+1	tier1	-	no_errors	ENST00000378565	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
ITPR2	3709	genome.wustl.edu	37	12	26750058	26750058	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr12:26750058C>T	ENST00000381340.3	-	31	4428	c.4012G>A	c.(4012-4014)Ggg>Agg	p.G1338R		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1338					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)	p.G1338W(1)	ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TCTTCACCCCCATTTATCAAC	0.408																																																	1	Substitution - Missense(1)	lung(1)											150.0	140.0	143.0					12																	26750058		1917	4135	6052	SO:0001583	missense	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.4012G>A	12.37:g.26750058C>T	ENSP00000370744:p.Gly1338Arg		O94773	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.G1338R	ENST00000381340.3	37	c.4012	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	C	19.99	3.929393	0.73327	.	.	ENSG00000123104	ENST00000381340	D	0.95171	-3.63	4.3	3.33	0.38152	Intracellular calcium-release channel (1);	0.120408	0.56097	D	0.000027	D	0.94673	0.8282	L	0.47716	1.5	0.80722	D	1	D	0.57899	0.981	D	0.65573	0.936	D	0.91949	0.5569	10	0.22109	T	0.4	.	12.2914	0.54820	0.2744:0.7256:0.0:0.0	.	1338	Q14571	ITPR2_HUMAN	R	1338	ENSP00000370744:G1338R	ENSP00000370744:G1338R	G	-	1	0	ITPR2	26641325	0.996000	0.38824	0.999000	0.59377	0.997000	0.91878	3.718000	0.54919	2.371000	0.80710	0.555000	0.69702	GGG	ITPR2	-	pfam_Ca-rel_channel,superfamily_ARM-type_fold	ENSG00000123104		0.408	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1		0.00	59	0	C	NM_002223		26750058	-1			no_errors	ENST00000381340	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.996	T
IVL	3713	genome.wustl.edu	37	1	152882812	152882812	+	Missense_Mutation	SNP	A	A	G	rs111814755		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:152882812A>G	ENST00000368764.3	+	2	603	c.539A>G	c.(538-540)gAg>gGg	p.E180G	IVL_ENST00000392667.2_Missense_Mutation_p.E34G			P07476	INVO_HUMAN	involucrin	180	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gagcagcaggaggggcagctg	0.652																																																	0													13.0	14.0	14.0					1																	152882812		2200	4293	6493	SO:0001583	missense	0			BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.539A>G	1.37:g.152882812A>G	ENSP00000357753:p.Glu180Gly		Q5T7P4	Missense_Mutation	SNP	pfam_Involucrin_N,pfam_Involucrin_rpt	p.E180G	ENST00000368764.3	37	c.539	CCDS1030.1	1	.	.	.	.	.	.	.	.	.	.	A	10.24	1.294930	0.23564	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.12465	2.9;2.68	3.55	0.964	0.19655	.	.	.	.	.	T	0.07007	0.0178	L	0.59436	1.845	0.09310	N	1	D	0.53619	0.961	P	0.48552	0.581	T	0.17289	-1.0374	9	0.49607	T	0.09	.	3.986	0.09516	0.4395:0.1912:0.0:0.3693	.	180	P07476	INVO_HUMAN	G	180;34	ENSP00000357753:E180G;ENSP00000376435:E34G	ENSP00000357753:E180G	E	+	2	0	IVL	151149436	0.000000	0.05858	0.003000	0.11579	0.002000	0.02628	0.325000	0.19628	0.063000	0.16370	-0.842000	0.03052	GAG	IVL	-	pfam_Involucrin_rpt	ENSG00000163207		0.652	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVL	HGNC	protein_coding	OTTHUMT00000034664.1	-	0.00	118	0	A	NM_005547		152882812	+1	tier1	-	no_errors	ENST00000368764	ensembl	human	known	74_37	missense	27.73	86	33	SNP	0.003	G
KAT6B	23522	genome.wustl.edu	37	10	76735386	76735386	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr10:76735386A>C	ENST00000287239.4	+	8	1780	c.1291A>C	c.(1291-1293)Acc>Ccc	p.T431P	KAT6B_ENST00000372724.1_Intron|KAT6B_ENST00000372711.1_Missense_Mutation_p.T431P|KAT6B_ENST00000372714.1_Intron|KAT6B_ENST00000372725.1_Intron	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	431	Negatively regulates HAT activity.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TAACAAGAAAACCAAAGGGCT	0.458																																																	0													113.0	95.0	101.0					10																	76735386		2203	4300	6503	SO:0001583	missense	0			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.1291A>C	10.37:g.76735386A>C	ENSP00000287239:p.Thr431Pro		O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,pfam_Histone_H1/H5_H15,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5_H15,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.T431P	ENST00000287239.4	37	c.1291	CCDS7345.1	10	.	.	.	.	.	.	.	.	.	.	A	9.601	1.128775	0.21041	.	.	ENSG00000156650	ENST00000287239;ENST00000372711	T;T	0.79940	-1.32;-1.15	5.97	4.82	0.62117	.	0.000000	0.51477	D	0.000089	T	0.80374	0.4611	L	0.29908	0.895	0.38250	D	0.941561	D;D	0.60160	0.986;0.987	P;P	0.59546	0.859;0.726	T	0.80495	-0.1357	9	.	.	.	-9.2405	12.3478	0.55130	0.9329:0.0:0.0671:0.0	.	431;431	Q8WYB5-2;Q8WYB5	.;KAT6B_HUMAN	P	431	ENSP00000287239:T431P;ENSP00000361796:T431P	.	T	+	1	0	KAT6B	76405392	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.159000	0.77483	2.283000	0.76528	0.533000	0.62120	ACC	KAT6B	-	NULL	ENSG00000156650		0.458	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6B	HGNC	protein_coding	OTTHUMT00000048771.1	-	0.00	77	0	A	NM_012330		76735386	+1	tier1	-	no_errors	ENST00000287239	ensembl	human	known	74_37	missense	21.92	57	16	SNP	1.000	C
KCNA5	3741	genome.wustl.edu	37	12	5153505	5153505	+	Silent	SNP	G	G	A	rs144879674|rs71581015	byFrequency	TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr12:5153505G>A	ENST00000252321.3	+	1	421	c.192G>A	c.(190-192)gtG>gtA	p.V64V		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	64	2 X 11 AA tandem repeat of D-[SP]-G-V-R- P-L-P-P-L-P.				atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	ACTCGGGAGTGCGGCCCTTGC	0.756																																																	0													4.0	6.0	5.0					12																	5153505		1950	3857	5807	SO:0001819	synonymous_variant	0			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.192G>A	12.37:g.5153505G>A			Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.V64	ENST00000252321.3	37	c.192	CCDS8536.1	12																																																																																			KCNA5	-	prints_K_chnl_volt-dep_Kv1.5	ENSG00000130037		0.756	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	HGNC	protein_coding	OTTHUMT00000398925.2	-	0.00	30	0	G	NM_002234		5153505	+1	tier1	-	no_errors	ENST00000252321	ensembl	human	known	74_37	silent	45.83	13	11	SNP	0.000	A
KCND2	3751	genome.wustl.edu	37	7	119915600	119915600	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr7:119915600G>T	ENST00000331113.4	+	1	1879	c.914G>T	c.(913-915)cGc>cTc	p.R305L		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	305					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	AAGTTTTCCCGCCACTCTCAA	0.512																																																	0													77.0	69.0	72.0					7																	119915600		2203	4300	6503	SO:0001583	missense	0			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.914G>T	7.37:g.119915600G>T	ENSP00000333496:p.Arg305Leu		O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Shal-type,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.2,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.R305L	ENST00000331113.4	37	c.914	CCDS5776.1	7	.	.	.	.	.	.	.	.	.	.	G	25.6	4.658000	0.88154	.	.	ENSG00000184408	ENST00000331113	D	0.98747	-5.11	5.4	5.4	0.78164	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99521	0.9829	H	0.97240	3.965	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98080	1.0403	9	.	.	.	.	19.5371	0.95257	0.0:0.0:1.0:0.0	.	305	Q9NZV8	KCND2_HUMAN	L	305	ENSP00000333496:R305L	.	R	+	2	0	KCND2	119702836	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.813000	0.99286	2.706000	0.92434	0.557000	0.71058	CGC	KCND2	-	pfam_Ion_trans_dom,prints_K_chnl,prints_K_chnl_volt-dep_Kv	ENSG00000184408		0.512	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCND2	HGNC	protein_coding	OTTHUMT00000346996.1		0.00	56	0	G	NM_012281		119915600	+1			no_errors	ENST00000331113	ensembl	human	known	74_37	missense	6.67	41	3	SNP	1.000	T
KCNT2	343450	genome.wustl.edu	37	1	196459055	196459055	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:196459055C>T	ENST00000294725.9	-	3	1103	c.188G>A	c.(187-189)cGc>cAc	p.R63H	KCNT2_ENST00000367433.5_Missense_Mutation_p.R63H|KCNT2_ENST00000367431.4_Missense_Mutation_p.R63H|KCNT2_ENST00000451324.2_5'UTR|KCNT2_ENST00000609185.1_Missense_Mutation_p.R63H			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	63					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.R63P(1)|p.R63H(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						ATTGAACAGGCGTATCCTTAG	0.289																																																	2	Substitution - Missense(2)	prostate(1)|lung(1)											90.0	97.0	94.0					1																	196459055		2203	4291	6494	SO:0001583	missense	0			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.188G>A	1.37:g.196459055C>T	ENSP00000294725:p.Arg63His		Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom	p.R63H	ENST00000294725.9	37	c.188	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.785763	0.90282	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.21361	2.01;2.04;2.27	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000007	T	0.51787	0.1695	M	0.86178	2.8	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.79784	0.978;0.993;0.954;0.978	T	0.54111	-0.8342	10	0.51188	T	0.08	-6.2909	17.1485	0.86772	0.0:1.0:0.0:0.0	.	63;63;63;63	A9LNM6;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	H	63	ENSP00000356403:R63H;ENSP00000356401:R63H;ENSP00000294725:R63H	ENSP00000294725:R63H	R	-	2	0	KCNT2	194725678	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.744000	0.74854	2.723000	0.93209	0.655000	0.94253	CGC	KCNT2	-	NULL	ENSG00000162687		0.289	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2		0.00	35	0	C	NM_198503		196459055	-1			no_errors	ENST00000294725	ensembl	human	known	74_37	missense	5.41	34	2	SNP	1.000	T
KDM2A	22992	genome.wustl.edu	37	11	67024132	67024132	+	3'UTR	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:67024132C>T	ENST00000529006.2	+	0	5541				KDM2A_ENST00000398645.2_3'UTR|KDM2A_ENST00000526258.1_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A						histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						AAAGTGTGAGCCACTGAGAAG	0.557																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.*1606C>T	11.37:g.67024132C>T			D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	RNA	SNP	-	NULL	ENST00000529006.2	37	NULL	CCDS44657.1	11																																																																																			KDM2A	-	-	ENSG00000173120		0.557	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	HGNC	protein_coding	OTTHUMT00000393140.2	-	0.00	52	0	C	NM_012308		67024132	+1	tier1	-	no_errors	ENST00000524657	ensembl	human	known	74_37	rna	30.77	36	16	SNP	0.737	T
KDM4C	23081	genome.wustl.edu	37	9	6805609	6805609	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr9:6805609C>A	ENST00000381309.3	+	3	720	c.155C>A	c.(154-156)cCt>cAt	p.P52H	KDM4C_ENST00000536108.1_5'UTR|KDM4C_ENST00000401787.3_Missense_Mutation_p.P52H|KDM4C_ENST00000535193.1_Missense_Mutation_p.P74H|KDM4C_ENST00000543771.1_Missense_Mutation_p.P52H|KDM4C_ENST00000489243.1_3'UTR|KDM4C_ENST00000442236.2_Intron|KDM4C_ENST00000381306.3_Missense_Mutation_p.P52H	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	52	JmjN. {ECO:0000255|PROSITE- ProRule:PRU00537}.				histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)	p.P52L(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						GTGATTCCTCCTAAGGAGTGG	0.353																																																	1	Substitution - Missense(1)	large_intestine(1)											64.0	61.0	62.0					9																	6805609		2203	4300	6503	SO:0001583	missense	0			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.155C>A	9.37:g.6805609C>A	ENSP00000370710:p.Pro52His		B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,superfamily_Chorismate_mutase_type_II,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.P52H	ENST00000381309.3	37	c.155	CCDS6471.1	9	.	.	.	.	.	.	.	.	.	.	C	26.7	4.762404	0.89932	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000401787;ENST00000381309;ENST00000381306	T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51	5.72	5.72	0.89469	Transcription factor jumonji, JmjN (2);	0.058147	0.64402	D	0.000001	D	0.84124	0.5403	H	0.98133	4.155	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;0.999;1.0	D	0.89612	0.3842	10	0.87932	D	0	-30.6787	19.9401	0.97155	0.0:1.0:0.0:0.0	.	52;52;52;74;52;52	F5H347;B4E1Y4;B0QZ60;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;.;KDM4C_HUMAN;.	H	74;52;52;52;52	ENSP00000442382:P74H;ENSP00000445427:P52H;ENSP00000383990:P52H;ENSP00000370710:P52H;ENSP00000370707:P52H	ENSP00000370707:P52H	P	+	2	0	KDM4C	6795609	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.699000	0.84547	2.712000	0.92718	0.650000	0.86243	CCT	KDM4C	-	smart_TF_JmjN,pfscan_TF_JmjN	ENSG00000107077		0.353	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	HGNC	protein_coding	OTTHUMT00000051692.1		0.00	28	0	C	NM_015061		6805609	+1			no_errors	ENST00000381309	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	A
KIAA1429	25962	genome.wustl.edu	37	8	95538801	95538801	+	Silent	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr8:95538801G>A	ENST00000297591.5	-	8	1746	c.1671C>T	c.(1669-1671)tgC>tgT	p.C557C	KIAA1429_ENST00000421249.2_Silent_p.C557C|KIAA1429_ENST00000437199.1_Silent_p.C557C	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	557					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CATAGAAATGGCATTTTTGGA	0.403																																																	0													115.0	114.0	114.0					8																	95538801		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.1671C>T	8.37:g.95538801G>A			Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Silent	SNP	superfamily_ARM-type_fold	p.C557	ENST00000297591.5	37	c.1671	CCDS34923.1	8																																																																																			KIAA1429	-	NULL	ENSG00000164944		0.403	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1429	HGNC	protein_coding	OTTHUMT00000378720.2		0.00	55	0	G	NM_015496		95538801	-1			no_errors	ENST00000297591	ensembl	human	known	74_37	silent	5.08	56	3	SNP	1.000	A
KHDRBS3	10656	genome.wustl.edu	37	8	136533590	136533590	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr8:136533590T>G	ENST00000355849.5	+	2	609	c.199T>G	c.(199-201)Ttc>Gtc	p.F67V	KHDRBS3_ENST00000520981.1_Missense_Mutation_p.F40V	NM_006558.1	NP_006549.1	O75525	KHDR3_HUMAN	KH domain containing, RNA binding, signal transduction associated 3	67	KH.				regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	26	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)			CGTAAAACAGTTCCCTAAGGT	0.373																																																	0													103.0	93.0	96.0					8																	136533590		2203	4300	6503	SO:0001583	missense	0			AF069681	CCDS6374.1	8q24.23	2008-05-15			ENSG00000131773	ENSG00000131773			18117	protein-coding gene	gene with protein product		610421				10332027, 10564820	Standard	XR_242372		Approved	T-STAR, Etle, etoile, SALP, SLM2, SLM-2	uc003yuv.3	O75525	OTTHUMG00000164164	ENST00000355849.5:c.199T>G	8.37:g.136533590T>G	ENSP00000348108:p.Phe67Val		Q6NUL8|Q9UPA8	Missense_Mutation	SNP	smart_KH_dom	p.F67V	ENST00000355849.5	37	c.199	CCDS6374.1	8	.	.	.	.	.	.	.	.	.	.	T	19.05	3.752334	0.69533	.	.	ENSG00000131773	ENST00000355849;ENST00000524199;ENST00000520981;ENST00000517394	T;T;T;T	0.41400	2.25;2.25;1.0;2.25	5.81	5.81	0.92471	K Homology (1);	0.044508	0.85682	D	0.000000	T	0.47488	0.1448	L	0.41492	1.28	0.32601	N	0.525858	P;B	0.50528	0.936;0.165	P;B	0.51415	0.669;0.183	T	0.61272	-0.7096	10	0.72032	D	0.01	-24.5174	15.3502	0.74376	0.0:0.0:0.0:1.0	.	67;67	O75525-2;O75525	.;KHDR3_HUMAN	V	67;39;40;40	ENSP00000348108:F67V;ENSP00000431022:F39V;ENSP00000428607:F40V;ENSP00000430284:F40V	ENSP00000348108:F67V	F	+	1	0	KHDRBS3	136602772	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.635000	0.83286	2.213000	0.71641	0.533000	0.62120	TTC	KHDRBS3	-	smart_KH_dom	ENSG00000131773		0.373	KHDRBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS3	HGNC	protein_coding	OTTHUMT00000377529.1	-	0.00	60	0	T			136533590	+1	tier1	-	no_errors	ENST00000355849	ensembl	human	known	74_37	missense	21.74	36	10	SNP	1.000	G
KIAA1551	55196	genome.wustl.edu	37	12	32135664	32135664	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr12:32135664G>A	ENST00000312561.4	+	4	2189	c.1775G>A	c.(1774-1776)cGt>cAt	p.R592H	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	592																	TCACAGGCACGTAAGACTCAG	0.353																																																	0													36.0	37.0	37.0					12																	32135664		2203	4299	6502	SO:0001583	missense	0			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.1775G>A	12.37:g.32135664G>A	ENSP00000310338:p.Arg592His		B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	NULL	p.R592H	ENST00000312561.4	37	c.1775	CCDS8725.2	12	.	.	.	.	.	.	.	.	.	.	G	9.079	0.998876	0.19121	.	.	ENSG00000174718	ENST00000312561;ENST00000381054	T;T	0.05925	4.01;3.37	4.46	-3.92	0.04155	.	2.166970	0.02353	N	0.076177	T	0.03220	0.0094	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41106	-0.9527	9	.	.	.	.	5.8189	0.18516	0.4641:0.0:0.4044:0.1315	.	592	Q9HCM1	CL035_HUMAN	H	592	ENSP00000310338:R592H;ENSP00000370442:R592H	.	R	+	2	0	C12orf35	32026931	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.304000	0.19228	-0.518000	0.06452	-1.264000	0.01445	CGT	KIAA1551	-	NULL	ENSG00000174718		0.353	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1551	HGNC	protein_coding	OTTHUMT00000250307.2	-	0.00	65	0	G	NM_018169		32135664	+1	tier1	-	no_errors	ENST00000312561	ensembl	human	known	74_37	missense	13.04	20	3	SNP	0.000	A
KIF1A	547	genome.wustl.edu	37	2	241725750	241725750	+	Splice_Site	SNP	A	A	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:241725750A>C	ENST00000320389.7	-	6	767		c.e6+1		KIF1A_ENST00000498729.2_Splice_Site	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		CCCTCCACCCACCTGGCCTTG	0.637																																																	0													87.0	92.0	91.0					2																	241725750		2104	4234	6338	SO:0001630	splice_region_variant	0			AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.608+1T>G	2.37:g.241725750A>C			B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Splice_Site	SNP	-	e5+2	ENST00000320389.7	37	c.608+2	CCDS46561.1	2	.	.	.	.	.	.	.	.	.	.	A	5.716	0.316603	0.10845	.	.	ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283;ENST00000428768	.	.	.	4.43	3.27	0.37495	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.673	0.40023	0.9165:0.0:0.0835:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIF1A	241374423	1.000000	0.71417	0.585000	0.28666	0.000000	0.00434	7.189000	0.77747	0.576000	0.29452	-0.395000	0.06472	.	KIF1A	-	-	ENSG00000130294		0.637	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1A	HGNC	protein_coding	OTTHUMT00000324536.3	-	0.00	62	0	A	NM_138483	Intron	241725750	-1	tier1	-	no_errors	ENST00000498729	ensembl	human	known	74_37	splice_site	7.94	58	5	SNP	0.992	C
KMT2D	8085	genome.wustl.edu	37	12	49422664	49422664	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr12:49422664C>T	ENST00000301067.7	-	45	14328	c.14329G>A	c.(14329-14331)Ggc>Agc	p.G4777S		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4777					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CTTCCTTTGCCCTTTTCCCAA	0.542																																																	0													154.0	161.0	159.0					12																	49422664		2000	4168	6168	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.14329G>A	12.37:g.49422664C>T	ENSP00000301067:p.Gly4777Ser		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.G4777S	ENST00000301067.7	37	c.14329	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	C	11.53	1.667609	0.29604	.	.	ENSG00000167548	ENST00000301067	T	0.78816	-1.21	5.04	3.19	0.36642	.	0.427611	0.17413	N	0.175107	T	0.52613	0.1745	N	0.02315	-0.6	0.27963	N	0.936698	B	0.14438	0.01	B	0.15484	0.013	T	0.52601	-0.8554	10	0.87932	D	0	.	8.5753	0.33595	0.0:0.817:0.0:0.183	.	4777	O14686	MLL2_HUMAN	S	4777	ENSP00000301067:G4777S	ENSP00000301067:G4777S	G	-	1	0	MLL2	47708931	0.983000	0.35010	1.000000	0.80357	0.460000	0.32559	0.586000	0.23894	1.273000	0.44346	0.462000	0.41574	GGC	KMT2D	-	NULL	ENSG00000167548		0.542	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	-	0.00	31	0	C			49422664	-1	tier1	-	no_errors	ENST00000301067	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
KRTAP11-1	337880	genome.wustl.edu	37	21	32253808	32253808	+	Silent	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr21:32253808G>A	ENST00000332378.4	-	1	66	c.36C>T	c.(34-36)tcC>tcT	p.S12S		NM_175858.2	NP_787054.1	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	12						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|pancreas(1)	18						CAATGGGCCTGGAAGAGCAAT	0.532																																																	0													98.0	91.0	93.0					21																	32253808		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ457065	CCDS13608.1	21q22.1	2003-03-11			ENSG00000182591	ENSG00000182591		"""Keratin associated proteins"""	18922	protein-coding gene	gene with protein product		600064				12359730	Standard	NM_175858		Approved	KAP11.1	uc002yov.3	Q8IUC1	OTTHUMG00000057773	ENST00000332378.4:c.36C>T	21.37:g.32253808G>A			A1L4I8	Silent	SNP	pfam_KRTAP_PMG	p.S12	ENST00000332378.4	37	c.36	CCDS13608.1	21																																																																																			KRTAP11-1	-	pfam_KRTAP_PMG	ENSG00000182591		0.532	KRTAP11-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP11-1	HGNC	protein_coding	OTTHUMT00000128225.1	-	0.00	38	0	G			32253808	-1	tier1	-	no_errors	ENST00000332378	ensembl	human	known	74_37	silent	29.41	24	10	SNP	0.991	A
LAMB1	3912	genome.wustl.edu	37	7	107569652	107569652	+	Splice_Site	SNP	T	T	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr7:107569652T>G	ENST00000222399.6	-	31	4976		c.e31-2		LAMB1_ENST00000474380.1_5'Flank|LAMB1_ENST00000393561.1_Splice_Site	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						GCACTTTTGCTGAGTAAAAAA	0.388																																																	0													118.0	112.0	114.0					7																	107569652		2203	4300	6503	SO:0001630	splice_region_variant	0			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.4746-2A>C	7.37:g.107569652T>G			Q14D91	Splice_Site	SNP	-	e30-2	ENST00000222399.6	37	c.4746-2	CCDS5750.1	7	.	.	.	.	.	.	.	.	.	.	T	17.93	3.509945	0.64522	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4532	0.75294	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	LAMB1	107356888	1.000000	0.71417	0.990000	0.47175	0.763000	0.43281	5.276000	0.65580	2.238000	0.73509	0.533000	0.62120	.	LAMB1	-	-	ENSG00000091136		0.388	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	HGNC	protein_coding	OTTHUMT00000314584.1	-	0.00	83	0	T	NM_002291	Intron	107569652	-1	tier1	-	no_errors	ENST00000222399	ensembl	human	known	74_37	splice_site	76.27	14	45	SNP	1.000	G
LINC00588	26138	genome.wustl.edu	37	8	58196770	58196770	+	lincRNA	SNP	T	T	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr8:58196770T>C	ENST00000521663.1	+	0	1517					NR_026772.1		Q9Y4M8	CH071_HUMAN	long intergenic non-protein coding RNA 588																		GTGGTAACTTTTCTGGTGCAC	0.418																																																	0																																												0					8q12.1	2012-10-12	2012-04-17	2012-04-17	ENSG00000215117	ENSG00000215117		"""Long non-coding RNAs"""	24494	non-coding RNA	RNA, long non-coding			"""chromosome 8 open reading frame 71"""	C8orf71		11230166	Standard	NR_026772		Approved	DKFZP434F122	uc003xtg.3	Q9Y4M8	OTTHUMG00000164424		8.37:g.58196770T>C				RNA	SNP	-	NULL	ENST00000521663.1	37	NULL		8																																																																																			LINC00588	-	-	ENSG00000215117		0.418	LINC00588-001	KNOWN	basic	lincRNA	LINC00588	HGNC	lincRNA	OTTHUMT00000378704.1	-	0.00	24	0	T	NR_026772		58196770	+1	tier1	-	no_errors	ENST00000521663	ensembl	human	known	74_37	rna	47.37	10	9	SNP	0.977	C
SLC28A2	9153	genome.wustl.edu	37	15	45545880	45545881	+	Intron	INS	-	-	A	rs201196971		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr15:45545880_45545881insA	ENST00000347644.3	+	3	235				CTD-2651B20.3_ENST00000560344.1_RNA|CTD-2651B20.3_ENST00000559003.1_RNA|CTD-2651B20.3_ENST00000561404.1_RNA	NM_004212.3	NP_004203.2	O43868	S28A2_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 2						nucleobase-containing compound metabolic process (GO:0006139)|purine nucleoside transmembrane transport (GO:0015860)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside:sodium symporter activity (GO:0005415)|purine nucleoside transmembrane transporter activity (GO:0015211)			NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(4)|skin(1)	26		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)	Mercaptopurine(DB01033)	ATAAACTCCATAAAAAAAAAGG	0.312																																					NSCLC(92;493 1501 26361 28917 47116)												0																																										SO:0001627	intron_variant	0			U84392	CCDS10121.1	15q15	2013-07-17	2013-07-17		ENSG00000137860	ENSG00000137860		"""Solute carriers"""	11002	protein-coding gene	gene with protein product		606208	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 2"""			9435697	Standard	NM_004212		Approved	CNT2, SPNT1, HCNT2, HsT17153	uc001zva.2	O43868	OTTHUMG00000131426	ENST00000347644.3:c.170+162->A	15.37:g.45545889_45545889dupA			A8K7F9|O43239|Q52LZ0	RNA	INS	-	NULL	ENST00000347644.3	37	NULL	CCDS10121.1	15																																																																																			CTD-2651B20.3	-	-	ENSG00000259520		0.312	SLC28A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101928414	Clone_based_vega_gene	protein_coding	OTTHUMT00000254219.2		0.00	17	0	-	NM_004212		45545881	-1	tier1		no_errors	ENST00000560344	ensembl	human	known	74_37	rna	18.18	18	4	INS	0.073:0.086	A
LPCAT4	254531	genome.wustl.edu	37	15	34655019	34655019	+	Silent	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr15:34655019G>A	ENST00000314891.6	-	8	942	c.765C>T	c.(763-765)ctC>ctT	p.L255L	LPCAT4_ENST00000562431.1_5'Flank	NM_153613.2	NP_705841.2	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4	255					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphoethanolamine O-acyltransferase activity (GO:0047166)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)|lysophospholipid acyltransferase activity (GO:0071617)			NS(1)|breast(1)|large_intestine(2)|lung(5)|prostate(1)	10						GAGAGGCTGTGAGCCAGAGGA	0.552																																																	0													79.0	79.0	79.0					15																	34655019		2201	4298	6499	SO:0001819	synonymous_variant	0			AF542964	CCDS32191.1	15q14	2008-07-02	2008-06-24	2008-06-24		ENSG00000176454			30059	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 2"""	612039	"""acyltransferase like 3"", ""1-acylglycerol-3-phosphate O-acyltransferase 7 (lysophosphatidic acid acyltransferase, eta)"""	AYTL3, AGPAT7		8619474, 9110174, 16243729, 18458083	Standard	XR_243087		Approved	FLJ10257, LPAAT-eta, LPEAT2	uc001zig.3	Q643R3		ENST00000314891.6:c.765C>T	15.37:g.34655019G>A			A8K2K8|O43412|Q7Z4P4|Q8IUL7|Q8TB38	Silent	SNP	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.L255	ENST00000314891.6	37	c.765	CCDS32191.1	15																																																																																			LPCAT4	-	NULL	ENSG00000176454		0.552	LPCAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT4	HGNC	protein_coding	OTTHUMT00000418028.2	-	0.00	41	0	G	NM_153613		34655019	-1	tier1	-	no_errors	ENST00000314891	ensembl	human	known	74_37	silent	30.14	51	22	SNP	1.000	A
LPCAT4	254531	genome.wustl.edu	37	15	34656266	34656266	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr15:34656266G>C	ENST00000314891.6	-	5	777	c.600C>G	c.(598-600)ttC>ttG	p.F200L	LPCAT4_ENST00000562431.1_5'Flank	NM_153613.2	NP_705841.2	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4	200					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphoethanolamine O-acyltransferase activity (GO:0047166)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)|lysophospholipid acyltransferase activity (GO:0071617)			NS(1)|breast(1)|large_intestine(2)|lung(5)|prostate(1)	10						CCTCAGGAAAGAATAGCACCT	0.463																																																	0													100.0	107.0	105.0					15																	34656266		2201	4298	6499	SO:0001583	missense	0			AF542964	CCDS32191.1	15q14	2008-07-02	2008-06-24	2008-06-24		ENSG00000176454			30059	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 2"""	612039	"""acyltransferase like 3"", ""1-acylglycerol-3-phosphate O-acyltransferase 7 (lysophosphatidic acid acyltransferase, eta)"""	AYTL3, AGPAT7		8619474, 9110174, 16243729, 18458083	Standard	XR_243087		Approved	FLJ10257, LPAAT-eta, LPEAT2	uc001zig.3	Q643R3		ENST00000314891.6:c.600C>G	15.37:g.34656266G>C	ENSP00000317300:p.Phe200Leu		A8K2K8|O43412|Q7Z4P4|Q8IUL7|Q8TB38	Missense_Mutation	SNP	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.F200L	ENST00000314891.6	37	c.600	CCDS32191.1	15	.	.	.	.	.	.	.	.	.	.	G	15.79	2.937857	0.52972	.	.	ENSG00000176454	ENST00000314891	D	0.92299	-3.01	5.54	1.72	0.24424	Phospholipid/glycerol acyltransferase (2);	0.098803	0.64402	D	0.000001	D	0.83004	0.5160	N	0.13299	0.325	0.40259	D	0.978155	B	0.30326	0.276	B	0.36378	0.223	T	0.73496	-0.3964	10	0.26408	T	0.33	-19.5567	7.4739	0.27365	0.5257:0.0:0.4743:0.0	.	200	Q643R3	LPCT4_HUMAN	L	200	ENSP00000317300:F200L	ENSP00000317300:F200L	F	-	3	2	LPCAT4	32443558	1.000000	0.71417	0.996000	0.52242	0.770000	0.43624	0.540000	0.23191	0.500000	0.27991	0.561000	0.74099	TTC	LPCAT4	-	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	ENSG00000176454		0.463	LPCAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT4	HGNC	protein_coding	OTTHUMT00000418028.2	-	0.00	60	0	G	NM_153613		34656266	-1	tier1	-	no_errors	ENST00000314891	ensembl	human	known	74_37	missense	37.37	62	37	SNP	0.999	C
LRRC16A	55604	genome.wustl.edu	37	6	25488781	25488781	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr6:25488781T>G	ENST00000329474.6	+	13	1401	c.1033T>G	c.(1033-1035)Tca>Gca	p.S345A		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	345					actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						CCTCGACCTCTCAGGGAACGT	0.458																																																	0													193.0	187.0	189.0					6																	25488781		1933	4136	6069	SO:0001583	missense	0			AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.1033T>G	6.37:g.25488781T>G	ENSP00000331983:p.Ser345Ala		B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.S345A	ENST00000329474.6	37	c.1033	CCDS54973.1	6	.	.	.	.	.	.	.	.	.	.	T	24.7	4.557996	0.86231	.	.	ENSG00000079691	ENST00000329474;ENST00000399313	T	0.60299	0.2	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.70386	0.3218	M	0.78916	2.43	0.80722	D	1	D;D;D	0.76494	0.996;0.996;0.999	D;D;D	0.80764	0.99;0.915;0.994	T	0.75079	-0.3444	10	0.59425	D	0.04	.	14.9916	0.71393	0.0:0.0:0.0:1.0	.	345;345;345	Q5VZK9;B2RTQ5;Q5VZK9-2	LR16A_HUMAN;.;.	A	345	ENSP00000331983:S345A	ENSP00000331983:S345A	S	+	1	0	LRRC16A	25596760	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.371000	0.79600	1.995000	0.58328	0.533000	0.62120	TCA	LRRC16A	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000079691		0.458	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC16A	HGNC	protein_coding	OTTHUMT00000040045.2	-	0.00	98	0	T	NM_017640		25488781	+1	tier1	-	no_errors	ENST00000329474	ensembl	human	novel	74_37	missense	38.03	44	27	SNP	1.000	G
LRRC4B	94030	genome.wustl.edu	37	19	51022077	51022077	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:51022077G>A	ENST00000599957.1	-	3	1090	c.893C>T	c.(892-894)aCg>aTg	p.T298M	LRRC4B_ENST00000389201.3_Missense_Mutation_p.T298M			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	298					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.T298M(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		GTGCAGGGGCGTGAAGAGGTC	0.637																																																	1	Substitution - Missense(1)	prostate(1)											86.0	103.0	97.0					19																	51022077		2169	4264	6433	SO:0001583	missense	0			BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.893C>T	19.37:g.51022077G>A	ENSP00000471502:p.Thr298Met		Q3ZCQ4|Q58F20	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T298M	ENST00000599957.1	37	c.893	CCDS42595.1	19	.	.	.	.	.	.	.	.	.	.	G	16.02	3.004646	0.54254	.	.	ENSG00000131409	ENST00000389201;ENST00000535879	T	0.57907	0.37	3.7	3.7	0.42460	.	0.000000	0.85682	U	0.000000	T	0.60932	0.2307	L	0.37507	1.11	0.48632	D	0.999681	D	0.89917	1.0	D	0.74023	0.982	T	0.63431	-0.6639	10	0.54805	T	0.06	.	13.3505	0.60599	0.0:0.0:1.0:0.0	.	298	Q9NT99	LRC4B_HUMAN	M	298	ENSP00000373853:T298M	ENSP00000373853:T298M	T	-	2	0	LRRC4B	55713889	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.666000	0.83877	2.084000	0.62774	0.561000	0.74099	ACG	LRRC4B	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000131409		0.637	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC4B	HGNC	protein_coding	OTTHUMT00000464907.1	-	0.00	85	0	G	NM_001080457		51022077	-1	tier1	-	no_errors	ENST00000389201	ensembl	human	known	74_37	missense	41.03	46	32	SNP	1.000	A
LRRC53	100144878	genome.wustl.edu	37	1	74941009	74941009	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:74941009T>G	ENST00000294635.4	-	4	1504	c.1390A>C	c.(1390-1392)Act>Cct	p.T464P	FPGT-TNNI3K_ENST00000557284.2_Intron|TNNI3K_ENST00000326637.3_Intron|LRRC53_ENST00000416014.2_Missense_Mutation_p.T464P|TNNI3K_ENST00000370891.2_Intron			A6NM62	LRC53_HUMAN	leucine rich repeat containing 53	464						integral component of membrane (GO:0016021)				NS(1)|breast(1)|lung(2)	4						TGTTGCAGAGTTTGAGGCTGG	0.388																																																	0																																										SO:0001583	missense	0					1p31.3	2010-08-31			ENSG00000162621	ENSG00000162621			25255	protein-coding gene	gene with protein product							Standard			Approved			A6NM62	OTTHUMG00000009621	ENST00000294635.4:c.1390A>C	1.37:g.74941009T>G	ENSP00000294635:p.Thr464Pro			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.T464P	ENST00000294635.4	37	c.1390		1	.	.	.	.	.	.	.	.	.	.	T	6.377	0.437593	0.12104	.	.	ENSG00000162621	ENST00000416014;ENST00000294635	T;T	0.55930	0.64;0.49	5.46	1.9	0.25705	.	1.086330	0.07172	N	0.852582	T	0.21761	0.0524	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36456	-0.9747	7	0.39692	T	0.17	0.4306	4.2699	0.10782	0.1477:0.1607:0.0:0.6916	.	.	.	.	P	464	ENSP00000391861:T464P;ENSP00000294635:T464P	ENSP00000294635:T464P	T	-	1	0	LRRC53	74713597	0.011000	0.17503	0.004000	0.12327	0.012000	0.07955	0.373000	0.20484	0.161000	0.19458	-0.250000	0.11733	ACT	LRRC53	-	NULL	ENSG00000162621		0.388	LRRC53-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	LRRC53	HGNC	protein_coding	OTTHUMT00000026515.2	-	0.00	60	0	T			74941009	-1	tier1	-	no_errors	ENST00000294635	ensembl	human	novel	74_37	missense	19.61	41	10	SNP	0.003	G
LRRK2	120892	genome.wustl.edu	37	12	40631771	40631771	+	Splice_Site	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr12:40631771G>A	ENST00000298910.7	+	5	495	c.437G>A	c.(436-438)gGt>gAt	p.G146D	LRRK2_ENST00000343742.2_Splice_Site_p.G146D	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	146					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.G146D(2)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TTTAAAATAGGTAAAATCACC	0.303																																																	2	Substitution - Missense(2)	NS(2)											76.0	79.0	78.0					12																	40631771		2202	4300	6502	SO:0001630	splice_region_variant	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.437-1G>A	12.37:g.40631771G>A			A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.G146D	ENST00000298910.7	37	c.437	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	G	6.407	0.443198	0.12164	.	.	ENSG00000188906	ENST00000416796;ENST00000343742;ENST00000298910	T;T;T	0.20069	2.1;2.1;2.1	5.27	4.27	0.50696	.	0.125717	0.53938	D	0.000059	T	0.06188	0.0160	N	0.02011	-0.69	0.37613	D	0.921021	B	0.15141	0.012	B	0.16289	0.015	T	0.32955	-0.9887	9	.	.	.	.	4.136	0.10170	0.3217:0.0:0.6783:0.0	.	146	Q5S007	LRRK2_HUMAN	D	75;146;146	ENSP00000398726:G75D;ENSP00000341930:G146D;ENSP00000298910:G146D	.	G	+	2	0	LRRK2	38918038	1.000000	0.71417	0.985000	0.45067	0.883000	0.51084	4.692000	0.61746	2.473000	0.83533	0.563000	0.77884	GGT	LRRK2	-	superfamily_ARM-type_fold	ENSG00000188906		0.303	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1		0.00	71	0	G	XM_058513	Missense_Mutation	40631771	+1			no_errors	ENST00000298910	ensembl	human	known	74_37	missense	6.52	43	3	SNP	1.000	A
LRRIQ1	84125	genome.wustl.edu	37	12	85517975	85517975	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr12:85517975G>T	ENST00000393217.2	+	17	3746	c.3685G>T	c.(3685-3687)Gaa>Taa	p.E1229*		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1229										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		AGATGAATCAGAAGCCCAGAA	0.418																																																	0													99.0	104.0	102.0					12																	85517975		2203	4300	6503	SO:0001587	stop_gained	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.3685G>T	12.37:g.85517975G>T	ENSP00000376910:p.Glu1229*		Q567P4|Q9BS17|Q9HA36	Nonsense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.E1229*	ENST00000393217.2	37	c.3685	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.453099	0.97581	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	.	.	.	5.61	2.71	0.32032	.	0.373373	0.24328	N	0.039484	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	8.6986	0.34312	0.2443:0.0:0.7557:0.0	.	.	.	.	X	1229;1204;1229	.	ENSP00000256007:E1229X	E	+	1	0	LRRIQ1	84042106	0.909000	0.30893	0.001000	0.08648	0.342000	0.28953	1.660000	0.37397	0.272000	0.22027	0.585000	0.79938	GAA	LRRIQ1	-	NULL	ENSG00000133640		0.418	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	-	0.00	52	0	G	NM_032165		85517975	+1	tier1	-	no_errors	ENST00000393217	ensembl	human	known	74_37	nonsense	12.50	19	3	SNP	0.210	T
LTBP1	4052	genome.wustl.edu	37	2	33482427	33482427	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:33482427C>G	ENST00000404816.2	+	12	2597	c.2244C>G	c.(2242-2244)caC>caG	p.H748Q	LTBP1_ENST00000407925.1_Missense_Mutation_p.H422Q|LTBP1_ENST00000418533.2_Missense_Mutation_p.H422Q|LTBP1_ENST00000402934.1_Intron|LTBP1_ENST00000404525.1_Intron|LTBP1_ENST00000354476.3_Missense_Mutation_p.H748Q|LTBP1_ENST00000390003.4_Missense_Mutation_p.H422Q			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	748					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CAATCCATCACCATGTAGGTA	0.463																																																	0													118.0	103.0	108.0					2																	33482427		2203	4300	6503	SO:0001583	missense	0				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.2244C>G	2.37:g.33482427C>G	ENSP00000386043:p.His748Gln		A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.H748Q	ENST00000404816.2	37	c.2244	CCDS33177.2	2	.	.	.	.	.	.	.	.	.	.	C	11.48	1.650332	0.29336	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000407925;ENST00000468091	T;T;T;T;T;T	0.79653	-1.29;-1.27;-1.23;-1.19;-1.2;0.42	5.91	5.01	0.66863	.	.	.	.	.	T	0.70928	0.3280	L	0.29908	0.895	0.80722	D	1	B;B;B;B	0.12013	0.0;0.001;0.001;0.005	B;B;B;B	0.09377	0.001;0.003;0.003;0.004	T	0.64711	-0.6343	9	0.25106	T	0.35	.	15.1096	0.72346	0.0:0.8541:0.1459:0.0	.	422;422;422;748	E7EV71;Q14766-2;Q14766-5;Q14766-4	.;.;.;.	Q	748;748;422;422;422;65	ENSP00000386043:H748Q;ENSP00000346467:H748Q;ENSP00000374653:H422Q;ENSP00000393057:H422Q;ENSP00000384091:H422Q;ENSP00000417591:H65Q	ENSP00000346467:H748Q	H	+	3	2	LTBP1	33335931	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.803000	0.55560	1.459000	0.47892	0.655000	0.94253	CAC	LTBP1	-	NULL	ENSG00000049323		0.463	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	LTBP1	HGNC	protein_coding	OTTHUMT00000326227.2	-	0.00	88	0	C	NM_206943		33482427	+1	tier1	-	no_errors	ENST00000354476	ensembl	human	known	74_37	missense	51.76	41	44	SNP	1.000	G
MAGEB4	4115	genome.wustl.edu	37	X	30261121	30261121	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chrX:30261121C>T	ENST00000378982.2	+	1	1065	c.869C>T	c.(868-870)gCc>gTc	p.A290V	MAGEB1_ENST00000397550.1_5'Flank|MAGEB1_ENST00000378981.3_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	290	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.A290D(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						GAGTTTTTGGCCAAGGTGAAT	0.527																																																	1	Substitution - Missense(1)	breast(1)											74.0	74.0	74.0					X																	30261121		2202	4300	6502	SO:0001583	missense	0				CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.869C>T	X.37:g.30261121C>T	ENSP00000368266:p.Ala290Val		B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.A290V	ENST00000378982.2	37	c.869	CCDS14221.1	X	.	.	.	.	.	.	.	.	.	.	C	17.75	3.466536	0.63625	.	.	ENSG00000120289	ENST00000378982	T	0.02498	4.27	3.16	1.29	0.21616	.	0.273246	0.27509	U	0.019058	T	0.13030	0.0316	M	0.89715	3.055	0.09310	N	1	D	0.69078	0.997	D	0.66602	0.945	T	0.05037	-1.0910	10	0.87932	D	0	.	5.1271	0.14890	0.2376:0.535:0.2275:0.0	.	290	O15481	MAGB4_HUMAN	V	290	ENSP00000368266:A290V	ENSP00000368266:A290V	A	+	2	0	MAGEB4	30171042	0.006000	0.16342	0.001000	0.08648	0.733000	0.41908	0.121000	0.15667	0.201000	0.20466	0.600000	0.82982	GCC	MAGEB4	-	pfscan_MAGE	ENSG00000120289		0.527	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB4	HGNC	protein_coding	OTTHUMT00000056159.1	-	0.00	39	0	C	NM_002367		30261121	+1	tier1	-	no_errors	ENST00000378982	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.001	T
METTL14	57721	genome.wustl.edu	37	4	119609098	119609098	+	Silent	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr4:119609098C>T	ENST00000388822.5	+	2	254	c.87C>T	c.(85-87)gaC>gaT	p.D29D	METTL14_ENST00000506780.1_5'UTR			Q9HCE5	MET14_HUMAN	methyltransferase like 14	29					mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)	16						AAAGTGCCGACAGCATTGGTG	0.373																																																	0													93.0	92.0	92.0					4																	119609098		2203	4300	6503	SO:0001819	synonymous_variant	0			AB046847	CCDS34053.1	4q26	2009-02-24			ENSG00000145388	ENSG00000145388			29330	protein-coding gene	gene with protein product						10997877	Standard	NM_020961		Approved	KIAA1627	uc003icf.3	Q9HCE5	OTTHUMG00000161167	ENST00000388822.5:c.87C>T	4.37:g.119609098C>T			A6NIG1|Q969V2	Silent	SNP	pfam_MT-A70-like,pfscan_MT-A70-like	p.D29	ENST00000388822.5	37	c.87	CCDS34053.1	4																																																																																			METTL14	-	NULL	ENSG00000145388		0.373	METTL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL14	HGNC	protein_coding	OTTHUMT00000364034.3	-	0.00	62	0	C	NM_020961		119609098	+1	tier1	-	no_errors	ENST00000388822	ensembl	human	known	74_37	silent	9.30	39	4	SNP	1.000	T
METTL25	84190	genome.wustl.edu	37	12	82796879	82796879	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr12:82796879T>A	ENST00000248306.3	+	5	1318	c.1249T>A	c.(1249-1251)Tta>Ata	p.L417I	METTL25_ENST00000547357.1_3'UTR	NM_032230.2	NP_115606.2	Q8N6Q8	MET25_HUMAN	methyltransferase like 25	417							methyltransferase activity (GO:0008168)										CTACCACCTCTTATCTGAAGA	0.368																																																	0													92.0	88.0	89.0					12																	82796879		2203	4300	6503	SO:0001583	missense	0			BC029120	CCDS9024.1	12q21.31	2012-08-13	2012-08-13	2012-08-13	ENSG00000127720	ENSG00000127720			26228	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 26"""	C12orf26			Standard	NM_032230		Approved	FLJ22789	uc001szq.3	Q8N6Q8	OTTHUMG00000170252	ENST00000248306.3:c.1249T>A	12.37:g.82796879T>A	ENSP00000248306:p.Leu417Ile		Q9H5Y3	Missense_Mutation	SNP	NULL	p.L417I	ENST00000248306.3	37	c.1249	CCDS9024.1	12	.	.	.	.	.	.	.	.	.	.	T	19.15	3.772267	0.69992	.	.	ENSG00000127720	ENST00000248306;ENST00000550298	T;T	0.56444	0.46;0.46	5.49	4.31	0.51392	.	0.000000	0.64402	D	0.000001	T	0.68751	0.3035	M	0.80422	2.495	0.45427	D	0.998404	D	0.64830	0.994	D	0.66084	0.941	T	0.67848	-0.5564	10	0.39692	T	0.17	-10.013	9.6053	0.39630	0.0:0.1442:0.0:0.8558	.	417	Q8N6Q8	CL026_HUMAN	I	417;52	ENSP00000248306:L417I;ENSP00000449730:L52I	ENSP00000248306:L417I	L	+	1	2	C12orf26	81321010	0.992000	0.36948	1.000000	0.80357	0.998000	0.95712	2.175000	0.42491	0.864000	0.35578	0.482000	0.46254	TTA	METTL25	-	NULL	ENSG00000127720		0.368	METTL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL25	HGNC	protein_coding	OTTHUMT00000408192.1	-	0.00	69	0	T	NM_032230		82796879	+1	tier1	-	no_errors	ENST00000248306	ensembl	human	known	74_37	missense	28.81	42	17	SNP	1.000	A
WDR81	124997	genome.wustl.edu	37	17	1617203	1617203	+	5'Flank	DEL	G	G	-			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr17:1617203delG	ENST00000309182.5	+	0	0				WDR81_ENST00000446363.1_5'Flank|MIR22HG_ENST00000362190.1_lincRNA|WDR81_ENST00000437219.2_5'Flank	NM_152348.3	NP_689561.2	Q562E7	WDR81_HUMAN	WD repeat domain 81						negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CAGGGGCAGAGGGCAACAGTT	0.562																																																	0													63.0	61.0	61.0					17																	1617203		1568	3582	5150	SO:0001631	upstream_gene_variant	0			AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941		17.37:g.1617203delG	Exception_encountered		B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	RNA	DEL	-	NULL	ENST00000309182.5	37	NULL		17																																																																																			MIR22HG	-	-	ENSG00000186594		0.562	WDR81-002	KNOWN	basic|appris_candidate	protein_coding	MIR22HG	HGNC	protein_coding	OTTHUMT00000338064.3		0.00	57	0	G	NM_152348		1617203	-1	tier1		no_errors	ENST00000334146	ensembl	human	known	74_37	rna	9.52	19	2	DEL	1.000	-
MKLN1	4289	genome.wustl.edu	37	7	131149111	131149111	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr7:131149111G>T	ENST00000352689.6	+	14	1772	c.1732G>T	c.(1732-1734)Gaa>Taa	p.E578*	MKLN1_ENST00000421797.2_Nonsense_Mutation_p.E486*|MKLN1_ENST00000498778.1_3'UTR	NM_013255.4	NP_037387.2	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing kelch motifs	578					signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	28	Melanoma(18;0.162)					AAGTCTTCAGGAAGAAGAACC	0.403																																																	0													142.0	123.0	129.0					7																	131149111		2203	4300	6503	SO:0001587	stop_gained	0			AF047489	CCDS34754.1	7q32	2008-07-18			ENSG00000128585	ENSG00000128585			7109	protein-coding gene	gene with protein product		605623				10640805	Standard	NM_001145354		Approved	TWA2	uc011kpm.2	Q9UL63	OTTHUMG00000154880	ENST00000352689.6:c.1732G>T	7.37:g.131149111G>T	ENSP00000323527:p.Glu578*		A4D1M8|A6NG43|Q9NSK4|Q9NUS8	Nonsense_Mutation	SNP	pfam_Muskelin_N,pfam_Kelch_1,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_LisH_dimerisation,pfscan_LisH_dimerisation,pfscan_CTLH_C	p.E578*	ENST00000352689.6	37	c.1732	CCDS34754.1	7	.	.	.	.	.	.	.	.	.	.	G	40	8.284837	0.98742	.	.	ENSG00000128585	ENST00000421797;ENST00000352689;ENST00000388758	.	.	.	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-19.6082	19.2671	0.93993	0.0:0.0:1.0:0.0	.	.	.	.	X	486;578;68	.	ENSP00000323527:E578X	E	+	1	0	MKLN1	130799651	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.150000	0.94667	2.788000	0.95919	0.650000	0.86243	GAA	MKLN1	-	NULL	ENSG00000128585		0.403	MKLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MKLN1	HGNC	protein_coding	OTTHUMT00000337473.4	-	0.00	60	0	G	NM_013255		131149111	+1	tier1	-	no_errors	ENST00000352689	ensembl	human	known	74_37	nonsense	6.45	58	4	SNP	1.000	T
MS4A12	54860	genome.wustl.edu	37	11	60264806	60264806	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:60264806G>T	ENST00000016913.4	+	2	72	c.15G>T	c.(13-15)aaG>aaT	p.K5N	MS4A12_ENST00000525951.1_3'UTR|MS4A12_ENST00000537076.1_Missense_Mutation_p.K5N	NM_017716.2	NP_060186.2	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member 12	5						integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)	17						TGTCATCCAAGCCAACAAGCC	0.388																																																	0													116.0	118.0	118.0					11																	60264806		2203	4300	6503	SO:0001583	missense	0			AK000224	CCDS7988.1, CCDS53638.1	11q12	2008-03-25				ENSG00000071203			13370	protein-coding gene	gene with protein product		606550				11401424, 11486273	Standard	NM_017716		Approved	Ms4a10, FLJ20217	uc001npr.3	Q9NXJ0		ENST00000016913.4:c.15G>T	11.37:g.60264806G>T	ENSP00000016913:p.Lys5Asn		F5GX98|Q8N6L4	Missense_Mutation	SNP	pfam_CD20-like	p.K5N	ENST00000016913.4	37	c.15	CCDS7988.1	11	.	.	.	.	.	.	.	.	.	.	G	5.331	0.246357	0.10130	.	.	ENSG00000071203	ENST00000537076;ENST00000526784;ENST00000016913;ENST00000530007	T;T;T;T	0.47177	1.84;0.85;3.46;0.85	4.71	2.61	0.31194	.	3.163830	0.00777	N	0.001246	T	0.34832	0.0911	N	0.19112	0.55	0.09310	N	1	B;B	0.24258	0.1;0.015	B;B	0.20955	0.032;0.008	T	0.19289	-1.0310	10	0.17369	T	0.5	0.3387	9.2304	0.37432	0.0:0.0:0.5659:0.4341	.	5;5	E9PNI3;Q9NXJ0	.;M4A12_HUMAN	N	5	ENSP00000440424:K5N;ENSP00000431959:K5N;ENSP00000016913:K5N;ENSP00000434783:K5N	ENSP00000016913:K5N	K	+	3	2	MS4A12	60021382	0.000000	0.05858	0.007000	0.13788	0.101000	0.19017	0.155000	0.16362	1.242000	0.43836	0.563000	0.77884	AAG	MS4A12	-	NULL	ENSG00000071203		0.388	MS4A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A12	HGNC	protein_coding	OTTHUMT00000383627.1		0.00	72	0	G			60264806	+1			no_errors	ENST00000016913	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.002	T
MT-ND2	4536	genome.wustl.edu	37	M	1509	1509	+	5'Flank	SNP	T	T	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chrM:1509T>A	ENST00000361453.3	+	0	0				MT-RNR1_ENST00000389680.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TM_ENST00000387377.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TF_ENST00000387314.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						CCTCAAGTATACTTCAAAGGA	0.463																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.1509T>A	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			MT-RNR1	-	-	ENSG00000211459		0.463	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR1	HGNC	protein_coding		-	0.00	28	0	T	YP_003024027		1509	+1	tier1	-	no_errors	ENST00000389680	ensembl	human	known	74_37	rna	28.57	5	2	SNP	NULL	A
MT-ND2	4536	genome.wustl.edu	37	M	1732	1732	+	5'Flank	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chrM:1732C>T	ENST00000361453.3	+	0	0				MT-RNR1_ENST00000389680.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TM_ENST00000387377.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TF_ENST00000387314.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						CCAAACCATTTACCCAAATAA	0.398																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.1732C>T	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			MT-RNR2	-	-	ENSG00000210082		0.398	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		-	0.00	51	0	C	YP_003024027		1732	+1	tier1	-	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	25.00	6	2	SNP	NULL	T
MTMR9	66036	genome.wustl.edu	37	8	11180257	11180257	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr8:11180257C>T	ENST00000221086.3	+	10	2083	c.1610C>T	c.(1609-1611)gCa>gTa	p.A537V	MTMR9_ENST00000526292.1_Missense_Mutation_p.A452V|AF131216.6_ENST00000498997.2_RNA	NM_015458.3	NP_056273.2	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	537						cytoplasm (GO:0005737)	enzyme regulator activity (GO:0030234)|phosphatase activity (GO:0016791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	16			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		AGGCAGTTGGCAGAACTGGAA	0.453																																																	0													78.0	76.0	77.0					8																	11180257		2203	4300	6503	SO:0001583	missense	0			AJ297823	CCDS5979.1	8p23-p22	2011-06-09	2002-09-05	2002-09-06	ENSG00000104643	ENSG00000104643		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	14596	protein-coding gene	gene with protein product		606260	"""myotubularin related protein 8"""	C8orf9, MTMR8		11472061, 11896452, 12890864	Standard	NM_015458		Approved	DKFZp434K171, LIP-STYX	uc003wtm.3	Q96QG7	OTTHUMG00000090647	ENST00000221086.3:c.1610C>T	8.37:g.11180257C>T	ENSP00000221086:p.Ala537Val		B7Z291|Q52LU3|Q8WW11|Q96QG6|Q9NX50	Missense_Mutation	SNP	pfam_Myotubularin-like_Pase_dom	p.A537V	ENST00000221086.3	37	c.1610	CCDS5979.1	8	.	.	.	.	.	.	.	.	.	.	C	8.164	0.790117	0.16258	.	.	ENSG00000104643	ENST00000221086;ENST00000526292	D;D	0.95205	-3.56;-3.64	5.7	4.82	0.62117	.	0.047211	0.85682	D	0.000000	D	0.92090	0.7493	L	0.53617	1.68	0.80722	D	1	B	0.15719	0.014	B	0.14023	0.01	D	0.88754	0.3252	10	0.37606	T	0.19	.	13.7223	0.62735	0.0:0.9263:0.0:0.0737	.	537	Q96QG7	MTMR9_HUMAN	V	537;452	ENSP00000221086:A537V;ENSP00000433239:A452V	ENSP00000221086:A537V	A	+	2	0	MTMR9	11217667	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	5.607000	0.67648	1.409000	0.46915	0.655000	0.94253	GCA	MTMR9	-	NULL	ENSG00000104643		0.453	MTMR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR9	HGNC	protein_coding	OTTHUMT00000207307.2	-	0.00	61	0	C	NM_015458		11180257	+1	tier1	-	no_errors	ENST00000221086	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
MUC5B	727897	genome.wustl.edu	37	11	1263020	1263020	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:1263020C>T	ENST00000529681.1	+	31	4968	c.4910C>T	c.(4909-4911)cCg>cTg	p.P1637L	MUC5B_ENST00000447027.1_Missense_Mutation_p.P1640L|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1637	7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACGAGTAGCCCGGGGCTGACC	0.667																																																	0													23.0	31.0	28.0					11																	1263020		2032	4153	6185	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.4910C>T	11.37:g.1263020C>T	ENSP00000436812:p.Pro1637Leu		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.P1640L	ENST00000529681.1	37	c.4919	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	c	7.855	0.724727	0.15439	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.15372	2.43;2.61	3.47	-1.27	0.09347	.	.	.	.	.	T	0.09158	0.0226	N	0.12182	0.205	0.09310	N	1	B;B	0.15473	0.013;0.007	B;B	0.06405	0.002;0.001	T	0.29579	-1.0007	9	0.87932	D	0	.	8.1936	0.31383	0.1273:0.7105:0.0:0.1622	.	2330;1640	A7Y9J9;E9PBJ0	.;.	L	1637;1640;1638;1707	ENSP00000436812:P1637L;ENSP00000415793:P1640L	ENSP00000343037:P1638L	P	+	2	0	MUC5B	1219596	0.809000	0.29036	0.000000	0.03702	0.007000	0.05969	0.878000	0.28126	-0.620000	0.05641	-2.161000	0.00327	CCG	MUC5B	-	NULL	ENSG00000117983		0.667	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	-	0.00	52	0	C	XM_001126093		1263020	+1	tier1	-	no_errors	ENST00000447027	ensembl	human	known	74_37	missense	57.45	20	27	SNP	0.000	T
MUC5B	727897	genome.wustl.edu	37	11	1269837	1269837	+	Silent	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:1269837C>T	ENST00000529681.1	+	31	11785	c.11727C>T	c.(11725-11727)gtC>gtT	p.V3909V	MUC5B_ENST00000447027.1_Silent_p.V3912V|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3909	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			V -> I (in Ref. 4; CAA96577). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTCCTCCGTCCCGGGGACCA	0.647																																																	0													89.0	101.0	97.0					11																	1269837		2052	4166	6218	SO:0001819	synonymous_variant	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.11727C>T	11.37:g.1269837C>T			O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.V3912	ENST00000529681.1	37	c.11736	CCDS44515.2	11																																																																																			MUC5B	-	NULL	ENSG00000117983		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	-	0.00	209	0	C	XM_001126093		1269837	+1	tier1	-	no_errors	ENST00000447027	ensembl	human	known	74_37	silent	39.26	147	95	SNP	0.000	T
MVB12B	89853	genome.wustl.edu	37	9	129268626	129268626	+	3'UTR	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr9:129268626G>A	ENST00000361171.3	+	0	4125				MVB12B_ENST00000485886.1_3'UTR	NM_033446.2	NP_258257.1	Q9H7P6	MB12B_HUMAN	multivesicular body subunit 12B						protein transport (GO:0015031)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytosol (GO:0005829)|early endosome (GO:0005769)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	lipid binding (GO:0008289)										tgtcagagttgaagaggctga	0.552																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK000001	CCDS35142.1	9q34.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000196814	ENSG00000196814			23368	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 28"", ""family with sequence similarity 125, member B"""	C9orf28, FAM125B		18005716, 20654576, 22232651	Standard	NM_033446		Approved	FLJ00001	uc004bqh.2	Q9H7P6	OTTHUMG00000020687	ENST00000361171.3:c.*3084G>A	9.37:g.129268626G>A			Q8N6S7	RNA	SNP	-	NULL	ENST00000361171.3	37	NULL	CCDS35142.1	9																																																																																			MVB12B	-	-	ENSG00000196814		0.552	MVB12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MVB12B	HGNC	protein_coding	OTTHUMT00000054110.1	-	0.00	35	0	G	XM_088525		129268626	+1	tier1	-	no_errors	ENST00000485886	ensembl	human	known	74_37	rna	15.38	22	4	SNP	0.001	A
MYH9	4627	genome.wustl.edu	37	22	36685195	36685195	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr22:36685195A>C	ENST00000216181.5	-	32	4723	c.4493T>G	c.(4492-4494)cTc>cGc	p.L1498R		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1498					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CTGCTTGTTGAGCCGCTCCAG	0.642			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																															Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0													94.0	71.0	78.0					22																	36685195		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.4493T>G	22.37:g.36685195A>C	ENSP00000216181:p.Leu1498Arg		A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1498R	ENST00000216181.5	37	c.4493	CCDS13927.1	22	.	.	.	.	.	.	.	.	.	.	a	9.448	1.089726	0.20390	.	.	ENSG00000100345	ENST00000337818;ENST00000397231;ENST00000216181	T	0.77229	-1.08	5.11	5.11	0.69529	Myosin tail (1);	0.263159	0.37857	N	0.001916	T	0.77096	0.4080	L	0.55481	1.735	0.80722	D	1	B	0.15719	0.014	B	0.30716	0.119	T	0.75897	-0.3155	10	0.87932	D	0	.	15.2021	0.73147	1.0:0.0:0.0:0.0	.	1498	P35579	MYH9_HUMAN	R	920;100;1498	ENSP00000216181:L1498R	ENSP00000216181:L1498R	L	-	2	0	MYH9	35015141	0.968000	0.33430	1.000000	0.80357	0.997000	0.91878	1.966000	0.40481	2.053000	0.61076	0.398000	0.26397	CTC	MYH9	-	pfam_Myosin_tail,superfamily_Prefoldin	ENSG00000100345		0.642	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	-	0.00	33	0	A	NM_002473		36685195	-1	tier1	-	no_errors	ENST00000216181	ensembl	human	known	74_37	missense	69.57	7	16	SNP	1.000	C
MYO6	4646	genome.wustl.edu	37	6	76602272	76602272	+	Missense_Mutation	SNP	G	G	A	rs529167250		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr6:76602272G>A	ENST00000369977.3	+	28	3111	c.2972G>A	c.(2971-2973)cGa>cAa	p.R991Q	MYO6_ENST00000369985.4_Missense_Mutation_p.R991Q|MYO6_ENST00000369975.1_Missense_Mutation_p.R991Q|MYO6_ENST00000369981.3_Missense_Mutation_p.R991Q	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	991	Glu-rich.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		CAGCTGGCCCGACAGAAGGAG	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		16038	0.001		0.0	False		,,,				2504	0.0																0													100.0	109.0	106.0					6																	76602272		2203	4300	6503	SO:0001583	missense	0			U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2972G>A	6.37:g.76602272G>A	ENSP00000358994:p.Arg991Gln		A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.R991Q	ENST00000369977.3	37	c.2972	CCDS34487.1	6	.	.	.	.	.	.	.	.	.	.	G	11.06	1.527969	0.27299	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975;ENST00000430435	T;T;T;T;T	0.57436	2.14;2.6;2.6;2.14;0.4	5.75	3.97	0.46021	.	0.350255	0.33477	N	0.004873	T	0.33381	0.0861	L	0.61218	1.895	0.09310	N	1	B;P	0.37781	0.049;0.608	B;B	0.37267	0.015;0.245	T	0.18398	-1.0338	10	0.54805	T	0.06	.	11.8787	0.52562	0.1401:0.0:0.8599:0.0	.	991;991	Q9UM54-2;Q9UM54-1	.;.	Q	991;991;991;991;991;54	ENSP00000358998:R991Q;ENSP00000359002:R991Q;ENSP00000358994:R991Q;ENSP00000358992:R991Q;ENSP00000399406:R54Q	ENSP00000358992:R991Q	R	+	2	0	MYO6	76658992	0.031000	0.19500	0.018000	0.16275	0.286000	0.27126	0.655000	0.24933	1.448000	0.47680	0.491000	0.48974	CGA	MYO6	-	NULL	ENSG00000196586		0.532	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO6	HGNC	protein_coding	OTTHUMT00000041279.2	-	0.00	73	0	G	NM_004999		76602272	+1	tier1	-	no_errors	ENST00000369981	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.011	A
MYT1	4661	genome.wustl.edu	37	20	62839660	62839660	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr20:62839660G>T	ENST00000328439.1	+	7	1475	c.1111G>T	c.(1111-1113)Gac>Tac	p.D371Y	MYT1_ENST00000536311.1_Missense_Mutation_p.D371Y|MYT1_ENST00000360149.4_Intron	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					GGAGATGCAGGACATGATGAC	0.622																																					GBM(59;481 1041 20555 21139 33705)												0													81.0	74.0	77.0					20																	62839660		2203	4300	6503	SO:0001583	missense	0			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.1111G>T	20.37:g.62839660G>T	ENSP00000327465:p.Asp371Tyr		B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.D371Y	ENST00000328439.1	37	c.1111	CCDS13558.1	20	.	.	.	.	.	.	.	.	.	.	g	14.73	2.623572	0.46840	.	.	ENSG00000196132	ENST00000328439;ENST00000536311	T;T	0.29655	2.55;1.56	4.46	4.46	0.54185	.	0.055231	0.64402	D	0.000001	T	0.57695	0.2071	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;0.97	D;P	0.91635	0.999;0.735	T	0.63532	-0.6616	10	0.54805	T	0.06	-22.5659	17.157	0.86794	0.0:0.0:1.0:0.0	.	371;371	F5H7M8;Q01538	.;MYT1_HUMAN	Y	371	ENSP00000327465:D371Y;ENSP00000442412:D371Y	ENSP00000327465:D371Y	D	+	1	0	MYT1	62310104	1.000000	0.71417	0.902000	0.35471	0.467000	0.32768	9.529000	0.98049	2.051000	0.60960	0.450000	0.29827	GAC	MYT1	-	NULL	ENSG00000196132		0.622	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYT1	HGNC	protein_coding	OTTHUMT00000080297.1	-	0.00	34	0	G	NM_004535		62839660	+1	tier1	-	no_errors	ENST00000536311	ensembl	human	known	74_37	missense	29.27	29	12	SNP	1.000	T
NANOS2	339345	genome.wustl.edu	37	19	46417601	46417601	+	Silent	SNP	G	G	A	rs575299215		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:46417601G>A	ENST00000341294.2	-	1	435	c.351C>T	c.(349-351)aaC>aaT	p.N117N		NM_001029861.2	NP_001025032.1	P60321	NANO2_HUMAN	nanos homolog 2 (Drosophila)	117					germ-line stem cell maintenance (GO:0030718)|mRNA catabolic process (GO:0006402)|multicellular organismal development (GO:0007275)|negative regulation of meiosis (GO:0045835)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	mRNA binding (GO:0003729)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)	6		Ovarian(192;0.0308)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0668)|Epithelial(262;0.231)		GCTGGCCACCGTTAAGCGGGC	0.672													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14519	0.0		0.0	False		,,,				2504	0.0																0													47.0	44.0	45.0					19																	46417601		2203	4300	6503	SO:0001819	synonymous_variant	0			BC042883	CCDS33056.1	19q13.32	2003-12-01				ENSG00000188425			23292	protein-coding gene	gene with protein product		608228				12947200, 12690449	Standard	NM_001029861		Approved	NOS2	uc002pdu.3	P60321		ENST00000341294.2:c.351C>T	19.37:g.46417601G>A			Q17R30|Q4G0P8	Silent	SNP	pfam_Znf_nanos-typ	p.N117	ENST00000341294.2	37	c.351	CCDS33056.1	19																																																																																			NANOS2	-	NULL	ENSG00000188425		0.672	NANOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NANOS2	HGNC	protein_coding	OTTHUMT00000461685.1	-	0.00	113	0	G			46417601	-1	tier1	-	no_errors	ENST00000341294	ensembl	human	known	74_37	silent	64.18	100	181	SNP	0.268	A
NARF	26502	genome.wustl.edu	37	17	80417920	80417920	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr17:80417920C>T	ENST00000309794.11	+	2	278	c.80C>T	c.(79-81)gCa>gTa	p.A27V	NARF_ENST00000457415.3_Missense_Mutation_p.A27V|NARF_ENST00000412079.2_5'UTR|NARF_ENST00000345415.7_Missense_Mutation_p.A27V|RP13-20L14.6_ENST00000579095.1_RNA|NARF_ENST00000581743.1_3'UTR|RP13-20L14.6_ENST00000578344.1_RNA|NARF_ENST00000390006.4_5'UTR	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	27						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			TCAGCCGATGCACCGAGTCCA	0.418																																																	0													108.0	109.0	108.0					17																	80417920		2203	4300	6503	SO:0001583	missense	0			BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.80C>T	17.37:g.80417920C>T	ENSP00000309899:p.Ala27Val		A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Missense_Mutation	SNP	pfam_Fe_hydrogenase_lsu_C,pfam_Fe_hydrogenase_ssu-like,superfamily_Fe_hydrogenase,smart_Fe_hydrogenase_ssu-like	p.A27V	ENST00000309794.11	37	c.80	CCDS32777.1	17	.	.	.	.	.	.	.	.	.	.	C	11.64	1.699274	0.30142	.	.	ENSG00000141562	ENST00000374611;ENST00000309794;ENST00000345415;ENST00000457415	T;T;T	0.42900	0.96;1.06;0.96	4.22	0.876	0.19138	.	1.235800	0.05683	N	0.590733	T	0.19127	0.0459	N	0.03608	-0.345	0.09310	N	0.999999	B;B;B;B;B	0.09022	0.002;0.002;0.0;0.001;0.0	B;B;B;B;B	0.09377	0.004;0.003;0.002;0.001;0.001	T	0.17776	-1.0358	10	0.33940	T	0.23	-17.6979	3.392	0.07293	0.0:0.2857:0.2198:0.4945	.	27;27;27;27;27	B4DND8;Q9UHQ1-2;Q9UHQ1-3;E9PH27;Q9UHQ1	.;.;.;.;NARF_HUMAN	V	27	ENSP00000309899:A27V;ENSP00000283996:A27V;ENSP00000414678:A27V	ENSP00000309899:A27V	A	+	2	0	NARF	78011209	0.000000	0.05858	0.000000	0.03702	0.389000	0.30415	-0.539000	0.06113	0.070000	0.16634	0.563000	0.77884	GCA	NARF	-	NULL	ENSG00000141562		0.418	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARF	HGNC	protein_coding	OTTHUMT00000443573.2	-	0.00	75	0	C	NM_031968		80417920	+1	tier1	-	no_errors	ENST00000309794	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.000	T
NCOA1	8648	genome.wustl.edu	37	2	24974968	24974968	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:24974968C>T	ENST00000406961.1	+	20	4476	c.3824C>T	c.(3823-3825)tCc>tTc	p.S1275F	NCOA1_ENST00000348332.3_Missense_Mutation_p.S1275F|NCOA1_ENST00000288599.5_Missense_Mutation_p.S1275F|NCOA1_ENST00000407230.1_Missense_Mutation_p.S1124F|NCOA1_ENST00000395856.3_Missense_Mutation_p.S1275F|NCOA1_ENST00000538539.1_Missense_Mutation_p.S1275F|NCOA1_ENST00000405141.1_Missense_Mutation_p.S1275F			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	1275					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCACCTGCCTCCGGGTATCAG	0.522			T	PAX3	alveolar rhadomyosarcoma																																			Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	0													66.0	63.0	64.0					2																	24974968		2203	4300	6503	SO:0001583	missense	0			U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.3824C>T	2.37:g.24974968C>T	ENSP00000385216:p.Ser1275Phe		O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.S1275F	ENST00000406961.1	37	c.3824	CCDS1712.1	2	.	.	.	.	.	.	.	.	.	.	C	21.0	4.090126	0.76756	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T;T	0.02301	4.48;4.48;4.35;4.48;4.48;4.48;4.48	5.28	5.28	0.74379	.	0.061358	0.64402	D	0.000003	T	0.03695	0.0105	N	0.24115	0.695	0.39244	D	0.9639	P;P;P;P;P	0.50943	0.875;0.924;0.94;0.924;0.875	B;P;P;P;B	0.47981	0.276;0.563;0.459;0.563;0.36	T	0.60444	-0.7262	10	0.42905	T	0.14	.	18.6754	0.91526	0.0:1.0:0.0:0.0	.	1275;1275;1275;1275;1124	A8K1V4;Q15788-3;Q15788;Q15788-2;B5MCN7	.;.;NCOA1_HUMAN;.;.	F	1275;1275;1124;1275;1275;1275;1275	ENSP00000385216:S1275F;ENSP00000385097:S1275F;ENSP00000385195:S1124F;ENSP00000444039:S1275F;ENSP00000320940:S1275F;ENSP00000288599:S1275F;ENSP00000379197:S1275F	ENSP00000288599:S1275F	S	+	2	0	NCOA1	24828472	0.995000	0.38212	0.978000	0.43139	0.854000	0.48673	6.537000	0.73847	2.740000	0.93945	0.585000	0.79938	TCC	NCOA1	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000084676		0.522	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA1	HGNC	protein_coding	OTTHUMT00000246852.3	-	0.00	45	0	C	NM_147223		24974968	+1	tier1	-	no_errors	ENST00000348332	ensembl	human	known	74_37	missense	38.46	40	25	SNP	0.990	T
NELFCD	51497	genome.wustl.edu	37	20	57569723	57569723	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr20:57569723G>T	ENST00000344018.3	+	15	1792	c.1765G>T	c.(1765-1767)Gtg>Ttg	p.V589L	NELFCD_ENST00000479207.1_3'UTR|NELFCD_ENST00000602795.1_Missense_Mutation_p.V598L			Q8IXH7	NELFD_HUMAN	negative elongation factor complex member C/D	589					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	membrane (GO:0016020)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)											CTTCATCATGGTGAACTAATT	0.398																																																	0													119.0	114.0	116.0					20																	57569723		2203	4300	6503	SO:0001583	missense	0			AF161479	CCDS13473.1, CCDS13473.2	20q13	2013-01-31	2013-01-31	2013-01-31	ENSG00000101158	ENSG00000101158			15934	protein-coding gene	gene with protein product	"""trihydrophobin 1"""	605297	"""TH1-like (Drosophila homolog)"", ""TH1-like (Drosophila)"""	TH1L		11030415, 11042152	Standard	NM_198976		Approved	HSPC130, TH1, NELF-C, NELF-D	uc002yag.4	Q8IXH7	OTTHUMG00000032861	ENST00000344018.3:c.1765G>T	20.37:g.57569723G>T	ENSP00000342300:p.Val589Leu		B4DE06|Q9BYL2|Q9H405|Q9H888|Q9H8T3|Q9NVX5|Q9P029|Q9UGN1|Q9UGN2|Q9UGN3	Missense_Mutation	SNP	pfam_TH1	p.V598L	ENST00000344018.3	37	c.1792		20	.	.	.	.	.	.	.	.	.	.	G	14.89	2.670197	0.47677	.	.	ENSG00000101158	ENST00000344018	.	.	.	5.15	4.2	0.49525	.	0.187418	0.48767	D	0.000163	T	0.36441	0.0967	N	0.13043	0.29	0.43355	D	0.995426	B	0.02656	0.0	B	0.04013	0.001	T	0.13469	-1.0508	9	0.29301	T	0.29	-26.6844	8.5049	0.33181	0.2496:0.0:0.7504:0.0	.	589	Q8IXH7	NELFD_HUMAN	L	589	.	ENSP00000342300:V589L	V	+	1	0	TH1L	57003118	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.839000	0.39220	1.308000	0.44962	-0.251000	0.11542	GTG	NELFCD	-	pfam_TH1	ENSG00000101158		0.398	NELFCD-201	KNOWN	basic|appris_principal	protein_coding	NELFCD	HGNC	protein_coding		-	0.00	91	0	G	NM_198976		57569723	+1	tier1	-	no_errors	ENST00000602795	ensembl	human	known	74_37	missense	41.38	51	36	SNP	1.000	T
NKX6-3	157848	genome.wustl.edu	37	8	41505662	41505662	+	5'Flank	SNP	C	C	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr8:41505662C>G	ENST00000524115.2	-	0	0					NM_152568.2	NP_689781.1	A6NJ46	NKX63_HUMAN	NK6 homeobox 3						cell fate determination (GO:0001709)|glandular epithelial cell differentiation (GO:0002067)|negative regulation of epithelial cell differentiation (GO:0030857)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(1)	1	Ovarian(28;0.00541)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Esophageal squamous(32;0.0844)|Hepatocellular(245;0.154)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TTGGTCTGCTCAAAGGTTTTC	0.602																																																	0																																										SO:0001631	upstream_gene_variant	0			AK057898	CCDS6118.1	8p11.21	2014-08-12	2007-07-09		ENSG00000165066	ENSG00000165066		"""Homeoboxes / ANTP class : NKL subclass"""	26328	protein-coding gene	gene with protein product		610772	"""NK6 transcription factor related, locus 3 (Drosophila)"""			16326147	Standard	XM_005273422		Approved	FLJ25169	uc003xoa.2	A6NJ46	OTTHUMG00000164083		8.37:g.41505662C>G	Exception_encountered		Q96LR0	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.E159Q	ENST00000524115.2	37	c.475	CCDS6118.1	8	.	.	.	.	.	.	.	.	.	.	C	36	5.812194	0.96975	.	.	ENSG00000165066	ENST00000425142;ENST00000518699	D	0.96136	-3.92	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.96880	0.8981	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.95707	0.8754	7	0.35671	T	0.21	.	19.1261	0.93384	0.0:1.0:0.0:0.0	.	.	.	.	Q	159	ENSP00000428361:E159Q	ENSP00000414183:E159Q	E	-	1	0	NKX6-3	41624819	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.298000	0.78815	2.779000	0.95612	0.655000	0.94253	GAG	NKX6-3	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000165066		0.602	NKX6-3-002	KNOWN	basic|exp_conf|CCDS	protein_coding	NKX6-3	HGNC	protein_coding	OTTHUMT00000377166.2	-	0.00	72	0	C	NM_152568		41505662	-1	tier1	-	no_errors	ENST00000518699	ensembl	human	known	74_37	missense	40.32	37	25	SNP	1.000	G
NLRP12	91662	genome.wustl.edu	37	19	54312916	54312916	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:54312916T>A	ENST00000324134.6	-	3	2165	c.1997A>T	c.(1996-1998)tAt>tTt	p.Y666F	NLRP12_ENST00000535162.1_Missense_Mutation_p.Y666F|NLRP12_ENST00000345770.5_Missense_Mutation_p.Y666F|NLRP12_ENST00000391772.1_Missense_Mutation_p.Y666F|NLRP12_ENST00000391773.1_Missense_Mutation_p.Y666F|NLRP12_ENST00000354278.3_Missense_Mutation_p.Y666F|NLRP12_ENST00000391775.3_Missense_Mutation_p.Y666F|NLRP12_ENST00000351894.4_Missense_Mutation_p.Y666F	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	666					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GGTGGCGCCATACAAGTGCAG	0.617																																																	0													46.0	42.0	44.0					19																	54312916		2203	4300	6503	SO:0001583	missense	0			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1997A>T	19.37:g.54312916T>A	ENSP00000319377:p.Tyr666Phe		A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.Y666F	ENST00000324134.6	37	c.1997	CCDS12864.1	19	.	.	.	.	.	.	.	.	.	.	T	3.452	-0.111736	0.06881	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	D;D;D;D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43;-2.43;-2.43;-2.43	3.86	-2.95	0.05564	.	2.159180	0.02576	N	0.098305	T	0.74981	0.3788	N	0.15975	0.35	0.09310	N	0.999997	B;B;B;B	0.06786	0.001;0.0;0.001;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.64175	-0.6469	10	0.10636	T	0.68	.	3.1266	0.06409	0.5031:0.2209:0.0:0.276	.	666;666;666;666	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	F	666	ENSP00000319377:Y666F;ENSP00000438030:Y666F;ENSP00000340473:Y666F;ENSP00000346231:Y666F;ENSP00000375655:Y666F;ENSP00000375653:Y666F;ENSP00000375652:Y666F	ENSP00000319377:Y666F	Y	-	2	0	NLRP12	59004728	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.021000	0.12504	-0.259000	0.09432	-0.686000	0.03744	TAT	NLRP12	-	NULL	ENSG00000142405		0.617	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NLRP12	HGNC	protein_coding	OTTHUMT00000134340.1	-	0.00	50	0	T	NM_144687		54312916	-1	tier1	-	no_errors	ENST00000324134	ensembl	human	known	74_37	missense	40.82	29	20	SNP	0.000	A
NMNAT1	64802	genome.wustl.edu	37	1	10035755	10035755	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:10035755C>G	ENST00000377205.1	+	3	365	c.221C>G	c.(220-222)aCc>aGc	p.T74S	NMNAT1_ENST00000403197.1_Missense_Mutation_p.T74S	NM_022787.3	NP_073624.2	Q9HAN9	NMNA1_HUMAN	nicotinamide nucleotide adenylyltransferase 1	74					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			large_intestine(2)|lung(2)|stomach(1)	5		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.31e-08)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(185;0.00028)|BRCA - Breast invasive adenocarcinoma(304;0.00032)|KIRC - Kidney renal clear cell carcinoma(229;0.00101)|STAD - Stomach adenocarcinoma(132;0.00908)|READ - Rectum adenocarcinoma(331;0.0419)		GAACTTGCTACCAAGAATTCT	0.433																																																	0													138.0	126.0	130.0					1																	10035755		2203	4300	6503	SO:0001583	missense	0			AF312734	CCDS108.1, CCDS72698.1	1p36.22	2014-01-28	2003-04-30	2003-05-02	ENSG00000173614	ENSG00000173614	2.7.7.1		17877	protein-coding gene	gene with protein product		608700	"""nicotinamide nucleotide adenylyltransferase"", ""Leber congenital amaurosis 9"", ""Leber's congenital amaurosis 9"""	LCA9		11248244, 11027696, 22842227	Standard	XR_244792		Approved	NMNAT, PNAT1	uc001aqp.3	Q9HAN9	OTTHUMG00000001799	ENST00000377205.1:c.221C>G	1.37:g.10035755C>G	ENSP00000366410:p.Thr74Ser		B1AN63|Q8TAE9|Q9H247|Q9H6B6	Missense_Mutation	SNP	pfam_Cyt_trans-like,tigrfam_NAMN_adtrnsfrase	p.T74S	ENST00000377205.1	37	c.221	CCDS108.1	1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.556163	0.45487	.	.	ENSG00000173614	ENST00000403197;ENST00000377205	D;D	0.97831	-4.56;-4.56	4.93	4.02	0.46733	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.056868	0.64402	D	0.000002	D	0.97111	0.9056	M	0.76574	2.34	0.53005	D	0.999963	P	0.41232	0.743	P	0.46543	0.52	D	0.95781	0.8817	10	0.20046	T	0.44	-9.2419	13.3952	0.60849	0.0:0.9238:0.0:0.0762	.	74	Q9HAN9	NMNA1_HUMAN	S	74	ENSP00000385131:T74S;ENSP00000366410:T74S	ENSP00000366410:T74S	T	+	2	0	NMNAT1	9958342	1.000000	0.71417	0.980000	0.43619	0.661000	0.39034	4.022000	0.57203	1.208000	0.43306	0.643000	0.83706	ACC	NMNAT1	-	pfam_Cyt_trans-like,tigrfam_NAMN_adtrnsfrase	ENSG00000173614		0.433	NMNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMNAT1	HGNC	protein_coding	OTTHUMT00000005029.1	-	0.00	79	0	C			10035755	+1	tier1	-	no_errors	ENST00000377205	ensembl	human	known	74_37	missense	26.39	53	19	SNP	1.000	G
NOA1	84273	genome.wustl.edu	37	4	57842621	57842621	+	Silent	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr4:57842621G>T	ENST00000264230.4	-	1	2368	c.1131C>A	c.(1129-1131)atC>atA	p.I377I	POLR2B_ENST00000381227.1_5'Flank|POLR2B_ENST00000431623.2_5'Flank|POLR2B_ENST00000314595.5_5'Flank|POLR2B_ENST00000441246.2_5'Flank	NM_032313.2	NP_115689.1	Q8NC60	NOA1_HUMAN	nitric oxide associated 1	377	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				apoptotic process (GO:0006915)|GTP catabolic process (GO:0006184)|mitochondrial translation (GO:0032543)|regulation of cell death (GO:0010941)|regulation of cellular respiration (GO:0043457)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)										GCCAAGGGGAGATGGTGGCTC	0.597																																																	0													62.0	61.0	61.0					4																	57842621		2203	4300	6503	SO:0001819	synonymous_variant	0			AK098215	CCDS3510.1	4q12	2013-05-24	2011-10-19	2011-10-19	ENSG00000084092	ENSG00000084092			28473	protein-coding gene	gene with protein product	"""nitric oxide synthase, mitochondrial (putative)"", ""mitochondrial GTPase 3 homolog (S. cerevisiae)"""	614919	"""chromosome 4 open reading frame 14"""	C4orf14		16380119, 2118999, 21771794, 22447445	Standard	NM_032313		Approved	MGC3232, hAtNOS1, hNOA1, MTG3	uc003hck.3	Q8NC60	OTTHUMG00000128773	ENST00000264230.4:c.1131C>A	4.37:g.57842621G>T			Q8N7L6|Q9BSQ9	Silent	SNP	superfamily_P-loop_NTPase	p.I377	ENST00000264230.4	37	c.1131	CCDS3510.1	4																																																																																			NOA1	-	superfamily_P-loop_NTPase	ENSG00000084092		0.597	NOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOA1	HGNC	protein_coding	OTTHUMT00000250694.2	-	0.00	19	0	G	NM_032313		57842621	-1	tier1	-	no_errors	ENST00000264230	ensembl	human	known	74_37	silent	60.00	8	12	SNP	1.000	T
NOTCH1	4851	genome.wustl.edu	37	9	139397714	139397714	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr9:139397714G>A	ENST00000277541.6	-	27	5162	c.5087C>T	c.(5086-5088)gCc>gTc	p.A1696V		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	1696					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A1697D(2)|p.A1696D(1)		breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CACGTCGGTGGCACTCTGGAA	0.642			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																														Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	3	Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(3)											59.0	70.0	66.0					9																	139397714		2146	4268	6414	SO:0001583	missense	0			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.5087C>T	9.37:g.139397714G>A	ENSP00000277541:p.Ala1696Val		Q59ED8|Q5SXM3	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_EGF_extracell,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_1,prints_Notch_dom	p.A1696V	ENST00000277541.6	37	c.5087	CCDS43905.1	9	.	.	.	.	.	.	.	.	.	.	G	35	5.449504	0.96205	.	.	ENSG00000148400	ENST00000277541	T	0.49139	0.79	4.95	4.95	0.65309	Notch, NODP domain (1);	0.175105	0.50627	D	0.000111	T	0.64538	0.2607	M	0.82823	2.61	0.80722	D	1	P	0.43024	0.798	P	0.51516	0.672	T	0.65236	-0.6217	10	0.33940	T	0.23	.	17.524	0.87794	0.0:0.0:1.0:0.0	.	1696	P46531	NOTC1_HUMAN	V	1696	ENSP00000277541:A1696V	ENSP00000277541:A1696V	A	-	2	0	NOTCH1	138517535	1.000000	0.71417	0.892000	0.35008	0.649000	0.38597	9.579000	0.98204	2.457000	0.83068	0.561000	0.74099	GCC	NOTCH1	-	pfam_Notch_NODP_dom,pirsf_Notch	ENSG00000148400		0.642	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1	-	0.00	65	0	G	NM_017617		139397714	-1	tier1	-	no_errors	ENST00000277541	ensembl	human	known	74_37	missense	16.28	36	7	SNP	1.000	A
NR1H2	7376	genome.wustl.edu	37	19	50885724	50885724	+	Silent	SNP	C	C	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:50885724C>G	ENST00000253727.5	+	10	1483	c.1248C>G	c.(1246-1248)cgC>cgG	p.R416R	POLD1_ENST00000599857.1_5'Flank|NR1H2_ENST00000598168.1_Silent_p.R386R|NR1H2_ENST00000411902.2_Silent_p.R319R|POLD1_ENST00000440232.2_5'Flank|NR1H2_ENST00000593926.1_Silent_p.R416R|NR1H2_ENST00000542413.1_Silent_p.R147R|NR1H2_ENST00000599105.1_Silent_p.R372R	NM_007121.5	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	416	Ligand-binding. {ECO:0000255}.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		ACCAGCTGCGCTTCCCGCGCA	0.682																																																	0													10.0	13.0	12.0					19																	50885724		2071	4217	6288	SO:0001819	synonymous_variant	0			U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000253727.5:c.1248C>G	19.37:g.50885724C>G			A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Liver_X_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Ecdystd_rcpt,prints_ThyrH_rcpt	p.R416	ENST00000253727.5	37	c.1248	CCDS42593.1	19																																																																																			NR1H2	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core	ENSG00000131408		0.682	NR1H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1H2	HGNC	protein_coding	OTTHUMT00000464724.2	-	0.00	31	0	C			50885724	+1	tier1	-	no_errors	ENST00000253727	ensembl	human	known	74_37	silent	30.95	29	13	SNP	1.000	G
NUB1	51667	genome.wustl.edu	37	7	151042544	151042544	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr7:151042544G>A	ENST00000355851.4	+	2	186	c.109G>A	c.(109-111)Gca>Aca	p.A37T	NUB1_ENST00000413040.2_Missense_Mutation_p.A61T|NUB1_ENST00000566856.1_Missense_Mutation_p.A37T|NUB1_ENST00000568733.1_Missense_Mutation_p.A61T	NM_001243351.1	NP_001230280.1	Q9Y5A7	NUB1_HUMAN	negative regulator of ubiquitin-like proteins 1	37					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|response to interferon-gamma (GO:0034341)|response to tumor necrosis factor (GO:0034612)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(1)|large_intestine(7)|lung(3)	11			OV - Ovarian serous cystadenocarcinoma(82;0.00569)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		AGTTGGTTTGGCATTAAAGGT	0.303																																																	0													47.0	46.0	46.0					7																	151042544		1797	4071	5868	SO:0001583	missense	0			AF300717	CCDS47751.1, CCDS47751.2, CCDS59089.1	7q36	2006-07-27			ENSG00000013374	ENSG00000013374			17623	protein-coding gene	gene with protein product	"""NEDD8 ultimate buster-1"""	607981				10508479, 11259415	Standard	NM_001243351		Approved	BS4, NYREN18	uc003wjx.3	Q9Y5A7	OTTHUMG00000157365	ENST00000355851.4:c.109G>A	7.37:g.151042544G>A	ENSP00000348110:p.Ala37Thr		O95422|Q75MR9|Q8IX22|Q9BXR2	Missense_Mutation	SNP	pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.A61T	ENST00000355851.4	37	c.181		7	.	.	.	.	.	.	.	.	.	.	G	17.77	3.471204	0.63625	.	.	ENSG00000013374	ENST00000413040;ENST00000355851;ENST00000470229;ENST00000490215;ENST00000483358	T;T;T	0.47528	0.84;0.84;0.84	5.38	5.38	0.77491	.	0.464508	0.23700	N	0.045427	T	0.41373	0.1156	L	0.36672	1.1	0.34404	D	0.695572	D;B;B	0.53745	0.962;0.046;0.045	B;B;B	0.43536	0.423;0.014;0.031	T	0.50398	-0.8833	10	0.22109	T	0.4	-10.8389	16.6565	0.85230	0.0:0.0:1.0:0.0	.	37;37;37	F8WDL9;Q9Y5A7;Q9Y5A7-2	.;NUB1_HUMAN;.	T	37	ENSP00000348110:A37T;ENSP00000418234:A37T;ENSP00000420086:A37T	ENSP00000348110:A37T	A	+	1	0	NUB1	150673477	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.724000	0.68500	2.515000	0.84797	0.655000	0.94253	GCA	NUB1	-	NULL	ENSG00000013374		0.303	NUB1-201	KNOWN	basic|appris_principal	protein_coding	NUB1	HGNC	protein_coding			0.00	66	0	G	NM_016118		151042544	+1			no_errors	ENST00000568733	ensembl	human	known	74_37	missense	5.19	72	4	SNP	1.000	A
NUDT14	256281	genome.wustl.edu	37	14	105639420	105639420	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr14:105639420C>T	ENST00000392568.2	-	5	700	c.607G>A	c.(607-609)Ggc>Agc	p.G203S	NUDT14_ENST00000550912.1_5'UTR|RP11-44N21.4_ENST00000548203.1_RNA	NM_177533.4	NP_803877.2	O95848	NUD14_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 14	203	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ADP-ribose diphosphatase activity (GO:0047631)|metal ion binding (GO:0046872)|UDP-sugar diphosphatase activity (GO:0008768)			cervix(2)|endometrium(1)|lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	14		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		AAGATGACGCCGAGGGTCTTG	0.627										HNSCC(42;0.11)																																							0													78.0	79.0	79.0					14																	105639420		2202	4293	6495	SO:0001583	missense	0			AB087802	CCDS10000.1	14q32.33	2013-02-15			ENSG00000183828	ENSG00000183828		"""Nudix motif containing"""	20141	protein-coding gene	gene with protein product		609219				12429023	Standard	NM_177533		Approved	UGPP	uc010tyn.3	O95848	OTTHUMG00000170372	ENST00000392568.2:c.607G>A	14.37:g.105639420C>T	ENSP00000376349:p.Gly203Ser		Q86SJ8	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,tigrfam_NDP_pyrophosphatase	p.G203S	ENST00000392568.2	37	c.607	CCDS10000.1	14	.	.	.	.	.	.	.	.	.	.	C	4.989	0.183758	0.09495	.	.	ENSG00000183828	ENST00000392568	T	0.39787	1.06	3.32	2.42	0.29668	NUDIX hydrolase domain (2);NUDIX hydrolase domain-like (1);	0.000000	0.85682	D	0.000000	T	0.28466	0.0704	L	0.41236	1.265	0.58432	D	0.999999	D	0.55172	0.97	P	0.44447	0.45	T	0.15093	-1.0449	10	0.09084	T	0.74	-14.3747	6.3717	0.21485	0.0:0.8646:0.0:0.1354	.	203	O95848	NUD14_HUMAN	S	203	ENSP00000376349:G203S	ENSP00000376349:G203S	G	-	1	0	NUDT14	104710465	0.226000	0.23696	0.023000	0.16930	0.179000	0.23085	1.183000	0.32041	0.972000	0.38314	0.462000	0.41574	GGC	NUDT14	-	superfamily_NUDIX_hydrolase_dom-like,tigrfam_NDP_pyrophosphatase	ENSG00000183828		0.627	NUDT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT14	HGNC	protein_coding	OTTHUMT00000074544.4	-	0.00	31	0	C	NM_177533		105639420	-1	tier1	-	no_errors	ENST00000392568	ensembl	human	known	74_37	missense	84.21	3	16	SNP	0.975	T
NUP188	23511	genome.wustl.edu	37	9	131767801	131767801	+	Silent	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr9:131767801C>T	ENST00000372577.2	+	40	4750	c.4729C>T	c.(4729-4731)Ctg>Ttg	p.L1577L	RP11-167N5.5_ENST00000594418.1_lincRNA	NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1577					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						CCAGATTCTGCTGGATCAGGT	0.577																																																	0													95.0	93.0	93.0					9																	131767801		2203	4300	6503	SO:0001819	synonymous_variant	0			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.4729C>T	9.37:g.131767801C>T			Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Silent	SNP	pfam_Nucleoporin_Nup188,superfamily_ARM-type_fold	p.L1577	ENST00000372577.2	37	c.4729	CCDS35156.1	9																																																																																			NUP188	-	NULL	ENSG00000095319		0.577	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP188	HGNC	protein_coding	OTTHUMT00000054529.2	-	0.00	26	0	C			131767801	+1	tier1	-	no_errors	ENST00000372577	ensembl	human	known	74_37	silent	14.81	23	4	SNP	0.997	T
NUP210	23225	genome.wustl.edu	37	3	13368884	13368884	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr3:13368884C>T	ENST00000254508.5	-	32	4422	c.4340G>A	c.(4339-4341)cGc>cAc	p.R1447H		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1447					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					GCTGACTGTGCGGACAACGCA	0.617																																																	0													54.0	42.0	46.0					3																	13368884		2203	4300	6503	SO:0001583	missense	0			AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.4340G>A	3.37:g.13368884C>T	ENSP00000254508:p.Arg1447His		A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,superfamily_Cadherin-like,smart_Big_2	p.R1447H	ENST00000254508.5	37	c.4340	CCDS33704.1	3	.	.	.	.	.	.	.	.	.	.	C	14.73	2.621468	0.46736	.	.	ENSG00000132182	ENST00000254508	T	0.05717	3.4	5.74	5.74	0.90152	.	0.126644	0.49916	D	0.000139	T	0.22975	0.0555	L	0.55743	1.74	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	T	0.00054	-1.2184	10	0.40728	T	0.16	.	19.9197	0.97082	0.0:1.0:0.0:0.0	.	1447	Q8TEM1	PO210_HUMAN	H	1447	ENSP00000254508:R1447H	ENSP00000254508:R1447H	R	-	2	0	NUP210	13343884	1.000000	0.71417	0.111000	0.21465	0.008000	0.06430	4.880000	0.63107	2.702000	0.92279	0.655000	0.94253	CGC	NUP210	-	NULL	ENSG00000132182		0.617	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	NUP210	HGNC	protein_coding	OTTHUMT00000340085.1	-	0.00	33	0	C	NM_024923		13368884	-1	tier1	-	no_errors	ENST00000254508	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.987	T
PCMT1	5110	genome.wustl.edu	37	6	150070753	150070753	+	5'Flank	SNP	G	G	C	rs566491213		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr6:150070753G>C	ENST00000367380.5	+	0	0				NUP43_ENST00000367403.3_5'Flank|PCMT1_ENST00000464889.1_5'UTR|PCMT1_ENST00000367384.2_5'UTR|PCMT1_ENST00000367378.1_5'UTR|PCMT1_ENST00000544496.1_5'Flank|NUP43_ENST00000463048.3_5'UTR	NM_001252049.1|NM_001252050.1|NM_001252051.1|NM_001252052.1|NM_005389.2	NP_001238978.1|NP_001238979.1|NP_001238980.1|NP_001238981.1|NP_005380.2	P22061	PIMT_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase						protein methylation (GO:0006479)|protein repair (GO:0030091)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		CCCTGGCAGCGGTAGCAGCCA	0.746																																																	0																																										SO:0001631	upstream_gene_variant	0				CCDS5219.1, CCDS5219.2, CCDS59041.1, CCDS75533.1, CCDS75534.1	6q22.3-q24	2008-02-05			ENSG00000120265	ENSG00000120265	2.1.1.77		8728	protein-coding gene	gene with protein product		176851				1478665, 10343128	Standard	NM_005389		Approved		uc003qne.3	P22061	OTTHUMG00000015794		6.37:g.150070753G>C	Exception_encountered		A8K109|J3KP72|Q14661|Q16556|Q5VYC1|Q5VYC2|Q93061|Q96II9|Q99625|Q9BQV7|Q9BQV8|Q9NP03	RNA	SNP	-	NULL	ENST00000367380.5	37	NULL		6																																																																																			NUP43	-	-	ENSG00000120253		0.746	PCMT1-201	KNOWN	basic|appris_principal	protein_coding	NUP43	HGNC	protein_coding		-	0.00	15	0	G			150070753	-1	tier1	-	no_errors	ENST00000463048	ensembl	human	known	74_37	rna	40.00	9	6	SNP	0.000	C
OPCML	4978	genome.wustl.edu	37	11	132527063	132527063	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:132527063C>G	ENST00000331898.7	-	2	897	c.319G>C	c.(319-321)Gtg>Ctg	p.V107L	OPCML_ENST00000541867.1_Missense_Mutation_p.V107L|OPCML_ENST00000524381.1_Missense_Mutation_p.V100L|OPCML_ENST00000374778.4_Missense_Mutation_p.V66L|OPCML_ENST00000529038.1_5'UTR	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	107	Ig-like C2-type 1.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)			endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		TCGTCATACACATCCACATTT	0.498																																																	0													255.0	195.0	215.0					11																	132527063		2201	4297	6498	SO:0001583	missense	0			BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.319G>C	11.37:g.132527063C>G	ENSP00000330862:p.Val107Leu		B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.V107L	ENST00000331898.7	37	c.319	CCDS8492.1	11	.	.	.	.	.	.	.	.	.	.	C	13.49	2.252937	0.39797	.	.	ENSG00000183715	ENST00000331898;ENST00000524381;ENST00000374778;ENST00000416724;ENST00000541867	T;T;T;T	0.25912	1.77;1.77;1.77;1.77	5.83	5.83	0.93111	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.144593	0.45606	D	0.000348	T	0.18341	0.0440	N	0.22421	0.69	0.32524	N	0.535804	B;B;B;B	0.19817	0.039;0.022;0.022;0.022	B;B;B;B	0.26969	0.075;0.075;0.075;0.075	T	0.11372	-1.0590	10	0.38643	T	0.18	-12.165	9.8141	0.40842	0.0:0.8107:0.0:0.1893	.	107;100;107;107	B7ZLQ1;Q7Z3W6;B7ZLQ0;Q14982	.;.;.;OPCM_HUMAN	L	107;100;66;74;107	ENSP00000330862:V107L;ENSP00000434750:V100L;ENSP00000363910:V66L;ENSP00000445496:V107L	ENSP00000330862:V107L	V	-	1	0	OPCML	132032273	0.982000	0.34865	1.000000	0.80357	0.984000	0.73092	2.014000	0.40951	2.762000	0.94881	0.655000	0.94253	GTG	OPCML	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000183715		0.498	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPCML	HGNC	protein_coding	OTTHUMT00000374689.3	-	0.00	68	0	C	NM_001012393		132527063	-1	tier1	-	no_errors	ENST00000541867	ensembl	human	known	74_37	missense	22.95	47	14	SNP	0.994	G
OR2A1	346528	genome.wustl.edu	37	7	144015712	144015712	+	Silent	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr7:144015712G>T	ENST00000408951.1	+	1	495	c.495G>T	c.(493-495)ctG>ctT	p.L165L	OR2A1-AS1_ENST00000488041.1_RNA|OR2A1-AS1_ENST00000489488.1_RNA|OR2A1-AS1_ENST00000487102.1_RNA|OR2A1-AS1_ENST00000486094.1_RNA|OR2A1-AS1_ENST00000475089.1_RNA|OR2A1-AS1_ENST00000478925.1_RNA|OR2A1-AS1_ENST00000493539.1_RNA|OR2A1-AS1_ENST00000463561.1_RNA|OR2A1-AS1_ENST00000461843.1_RNA|OR2A1-AS1_ENST00000478806.1_RNA|OR2A1-AS1_ENST00000496968.1_RNA|OR2A1-AS1_ENST00000467944.1_RNA|OR2A1-AS1_ENST00000476560.1_RNA	NM_001005287.1	NP_001005287.1	Q8NGT9	OR2A1_HUMAN	olfactory receptor, family 2, subfamily A, member 1	165						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(1)|lung(3)|skin(2)	6	Melanoma(164;0.14)					TCCTAAGACTGCCCTTCTCTG	0.567																																																	0													6.0	6.0	6.0					7																	144015712		1606	3678	5284	SO:0001819	synonymous_variant	0				CCDS43673.1	7q35	2013-09-20			ENSG00000221970	ENSG00000221970		"""GPCR / Class A : Olfactory receptors"""	8229	protein-coding gene	gene with protein product							Standard	NM_001005287		Approved		uc011kub.2	Q8NGT9	OTTHUMG00000158005	ENST00000408951.1:c.495G>T	7.37:g.144015712G>T			Q6IF44|Q96R46	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L165	ENST00000408951.1	37	c.495	CCDS43673.1	7																																																																																			OR2A1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000221970		0.567	OR2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A1	HGNC	protein_coding	OTTHUMT00000349985.1	-	0.00	21	0	G			144015712	+1	tier1	-	no_errors	ENST00000408951	ensembl	human	known	74_37	silent	31.82	15	7	SNP	0.823	T
OR2V1	26693	genome.wustl.edu	37	5	180551778	180551778	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr5:180551778T>C	ENST00000329365.2	-	1	526	c.527A>G	c.(526-528)gAt>gGt	p.D176G		NM_001258283.1	NP_001245212.1	Q8NHB1	OR2V1_HUMAN	olfactory receptor, family 2, subfamily V, member 1	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(4)	4						GAAAAAGTGATCCACGCTCCT	0.498																																																	0																																										SO:0001583	missense	0			AB065465	CCDS58992.1	5q35.3	2012-08-09		2004-03-10	ENSG00000185372	ENSG00000185372		"""GPCR / Class A : Olfactory receptors"""	8280	protein-coding gene	gene with protein product				OR2V1P			Standard	NM_001258283		Approved	OST265	uc031smg.1	Q8NHB1	OTTHUMG00000162118	ENST00000329365.2:c.527A>G	5.37:g.180551778T>C	ENSP00000404102:p.Asp176Gly			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D176G	ENST00000329365.2	37	c.527	CCDS58992.1	5	.	.	.	.	.	.	.	.	.	.	.	8.705	0.910603	0.17833	.	.	ENSG00000185372	ENST00000329365	T	0.00169	8.63	5.08	5.08	0.68730	.	.	.	.	.	T	0.00271	0.0008	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.60156	-0.7318	6	0.51188	T	0.08	.	12.8548	0.57880	0.0:0.0:0.0:1.0	.	.	.	.	G	176	ENSP00000404102:D176G	ENSP00000404102:D176G	D	-	2	0	OR2V1	180484384	0.019000	0.18553	0.047000	0.18901	0.002000	0.02628	2.118000	0.41949	2.132000	0.65825	0.418000	0.28097	GAT	OR2V1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000185372		0.498	OR2V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2V1	HGNC	protein_coding	OTTHUMT00000367367.1	-	0.00	32	0	T			180551778	-1	tier1	-	no_errors	ENST00000329365	ensembl	human	known	74_37	missense	15.15	28	5	SNP	0.007	C
OTOF	9381	genome.wustl.edu	37	2	26703132	26703132	+	Silent	SNP	C	C	T	rs558573899		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:26703132C>T	ENST00000272371.2	-	16	1977	c.1851G>A	c.(1849-1851)ctG>ctA	p.L617L	OTOF_ENST00000338581.6_5'Flank|OTOF_ENST00000402415.3_5'Flank|OTOF_ENST00000339598.3_5'Flank|OTOF_ENST00000403946.3_Silent_p.L617L	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	617					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGAGGCCTCCAGGAAGGCTC	0.562																																					GBM(102;732 1451 20652 24062 31372)												0													93.0	93.0	93.0					2																	26703132		2203	4300	6503	SO:0001819	synonymous_variant	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.1851G>A	2.37:g.26703132C>T			B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Silent	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.L617	ENST00000272371.2	37	c.1851	CCDS1725.1	2																																																																																			OTOF	-	NULL	ENSG00000115155		0.562	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3	-	0.00	60	0	C			26703132	-1	tier1	-	no_errors	ENST00000272371	ensembl	human	known	74_37	silent	9.78	83	9	SNP	1.000	T
P2RY1	5028	genome.wustl.edu	37	3	152554373	152554373	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr3:152554373G>T	ENST00000305097.3	+	1	1638	c.802G>T	c.(802-804)Gtt>Ttt	p.V268F	RP11-38P22.2_ENST00000460407.1_lincRNA	NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	268					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			TGTACTGACTGTTTTTGCTGT	0.428																																																	0													115.0	113.0	114.0					3																	152554373		2203	4300	6503	SO:0001583	missense	0			U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.802G>T	3.37:g.152554373G>T	ENSP00000304767:p.Val268Phe			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_P2Y1_rcpt,prints_GPCR_Rhodpsn	p.V268F	ENST00000305097.3	37	c.802	CCDS3169.1	3	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919235	0.73098	.	.	ENSG00000169860	ENST00000305097	T	0.75938	-0.98	5.58	5.58	0.84498	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.88411	0.6429	M	0.88775	2.98	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	D	0.88816	0.3295	10	0.46703	T	0.11	.	18.5615	0.91101	0.0:0.0:1.0:0.0	.	268	P47900	P2RY1_HUMAN	F	268	ENSP00000304767:V268F	ENSP00000304767:V268F	V	+	1	0	P2RY1	154037063	1.000000	0.71417	0.828000	0.32881	0.918000	0.54935	9.731000	0.98807	2.618000	0.88619	0.563000	0.77884	GTT	P2RY1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000169860		0.428	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY1	HGNC	protein_coding	OTTHUMT00000356943.1		0.00	37	0	G	NM_002563		152554373	+1			no_errors	ENST00000305097	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.999	T
P2RY6	5031	genome.wustl.edu	37	11	73007861	73007861	+	Missense_Mutation	SNP	C	C	T	rs574690210		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:73007861C>T	ENST00000393590.2	+	2	597	c.298C>T	c.(298-300)Cgc>Tgc	p.R100C	P2RY6_ENST00000542092.1_Missense_Mutation_p.R100C|P2RY6_ENST00000540124.1_Missense_Mutation_p.R100C|P2RY6_ENST00000393592.2_Missense_Mutation_p.R100C|P2RY6_ENST00000349767.2_Missense_Mutation_p.R100C|P2RY6_ENST00000538328.1_Missense_Mutation_p.R100C|P2RY6_ENST00000540342.1_Missense_Mutation_p.R100C|P2RY6_ENST00000393591.1_Missense_Mutation_p.R100C	NM_001277207.1|NM_001277208.1	NP_001264136.1|NP_001264137.1	Q15077	P2RY6_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 6	100					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)	14						CTTCGCCTGCCGCCTGGTCCG	0.602													C|||	0	0.0	0.0	0.0	5008	,	,		19390	0.0		0.0	False		,,,				2504	0.0																0													137.0	122.0	127.0					11																	73007861		2200	4293	6493	SO:0001583	missense	0				CCDS8220.1	11q13.5	2012-08-08				ENSG00000171631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8543	protein-coding gene	gene with protein product		602451				8670200	Standard	NM_176797		Approved	P2Y6	uc001otr.4	Q15077		ENST00000393590.2:c.298C>T	11.37:g.73007861C>T	ENSP00000377215:p.Arg100Cys		Q15754	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_P2Y6_rcpt,prints_GPCR_Rhodpsn,prints_P2Y3_rcpt,prints_Protea_act_rcpt	p.R100C	ENST00000393590.2	37	c.298	CCDS8220.1	11	.	.	.	.	.	.	.	.	.	.	C	15.94	2.981482	0.53827	.	.	ENSG00000171631	ENST00000540342;ENST00000542092;ENST00000349767;ENST00000393592;ENST00000544437;ENST00000393591;ENST00000540124;ENST00000393590;ENST00000535931;ENST00000538328	T;T;T;T;T;T;T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74	4.36	2.46	0.29980	GPCR, rhodopsin-like superfamily (1);	0.138244	0.43919	D	0.000510	D	0.85801	0.5781	M	0.91140	3.18	0.46586	D	0.999118	D	0.89917	1.0	D	0.70935	0.971	D	0.84653	0.0702	10	0.87932	D	0	.	6.9765	0.24679	0.3231:0.5901:0.0:0.0868	.	100	Q15077	P2RY6_HUMAN	C	100	ENSP00000443427:R100C;ENSP00000445652:R100C;ENSP00000309771:R100C;ENSP00000377217:R100C;ENSP00000441079:R100C;ENSP00000377216:R100C;ENSP00000442551:R100C;ENSP00000377215:R100C;ENSP00000440770:R100C;ENSP00000442990:R100C	ENSP00000309771:R100C	R	+	1	0	P2RY6	72685509	1.000000	0.71417	1.000000	0.80357	0.652000	0.38707	2.254000	0.43214	0.566000	0.29273	0.491000	0.48974	CGC	P2RY6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000171631		0.602	P2RY6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	P2RY6	HGNC	protein_coding	OTTHUMT00000397349.1	-	0.00	50	0	C			73007861	+1	tier1	-	no_errors	ENST00000349767	ensembl	human	known	74_37	missense	41.30	27	19	SNP	1.000	T
PAK1	5058	genome.wustl.edu	37	11	77034400	77034400	+	Missense_Mutation	SNP	T	T	A	rs114048423	byFrequency	TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:77034400T>A	ENST00000356341.3	-	15	2088	c.1557A>T	c.(1555-1557)caA>caT	p.Q519H	PAK1_ENST00000525542.1_5'UTR|PAK1_ENST00000530617.1_Intron|PAK1_ENST00000278568.4_Missense_Mutation_p.I536F|PAK1_ENST00000528203.1_Missense_Mutation_p.I438F	NM_002576.4	NP_002567.3	Q13153	PAK1_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 1	519	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to insulin stimulus (GO:0032869)|dendrite development (GO:0016358)|exocytosis (GO:0006887)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor clustering (GO:0043113)|response to hypoxia (GO:0001666)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|wound healing (GO:0042060)	axon (GO:0030424)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|Z disc (GO:0030018)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.Q519Q(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(13)|skin(2)|stomach(1)	29	all_cancers(14;1.75e-18)					TCTTCAGGAATTGATGCTAGA	0.433																																																	1	Substitution - coding silent(1)	lung(1)											152.0	123.0	133.0					11																	77034400		2200	4292	6492	SO:0001583	missense	0			U51120	CCDS8250.1, CCDS44687.1	11q13-q14	2008-06-17	2008-06-17						8590	protein-coding gene	gene with protein product	"""STE20 homolog, yeast"""	602590	"""p21/Cdc42/Rac1-activated kinase 1 (yeast Ste20-related)"", ""p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)"""			8805275, 9533029	Standard	NM_002576		Approved		uc001oyg.4	Q13153		ENST00000356341.3:c.1557A>T	11.37:g.77034400T>A	ENSP00000348696:p.Gln519His		O75561|Q13567|Q32M53|Q32M54|Q86W79	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,superfamily_WASP_C,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.I536F	ENST00000356341.3	37	c.1606	CCDS8250.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.42|14.42	2.531502|2.531502	0.45073|0.45073	.|.	.|.	ENSG00000149269|ENSG00000149269	ENST00000278568;ENST00000528203|ENST00000356341	T;T|T	0.71222|0.13778	-0.55;-0.54|2.56	6.03|6.03	0.605|0.605	0.17553|0.17553	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	3.320980|.	0.00945|.	N|.	0.002896|.	T|T	0.18635|0.18635	0.0447|0.0447	L|L	0.46157|0.46157	1.445|1.445	0.30705|0.30705	N|N	0.749918|0.749918	B;B|B	0.19817|0.29232	0.023;0.039|0.238	B;B|B	0.23574|0.41510	0.021;0.047|0.359	T|T	0.31166|0.31166	-0.9953|-0.9953	10|9	0.54805|0.66056	T|D	0.06|0.02	.|.	10.9488|10.9488	0.47317|0.47317	0.0:0.7011:0.0:0.2989|0.0:0.7011:0.0:0.2989	.|.	438;536|519	E9PM17;Q13153-2|Q13153	.;.|PAK1_HUMAN	F|H	536;438|519	ENSP00000278568:I536F;ENSP00000433211:I438F|ENSP00000348696:Q519H	ENSP00000278568:I536F|ENSP00000348696:Q519H	I|Q	-|-	1|3	0|2	PAK1|PAK1	76712048|76712048	0.988000|0.988000	0.35896|0.35896	0.995000|0.995000	0.50966|0.50966	0.982000|0.982000	0.71751|0.71751	0.307000|0.307000	0.19296|0.19296	-0.136000|-0.136000	0.11475|0.11475	-0.290000|-0.290000	0.09829|0.09829	ATT|CAA	PAK1	-	NULL	ENSG00000149269		0.433	PAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAK1	HGNC	protein_coding	OTTHUMT00000382083.2	-	0.00	56	0	T	NM_002576		77034400	-1	tier1	-	no_errors	ENST00000278568	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	A
PCDH10	57575	genome.wustl.edu	37	4	134072935	134072935	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr4:134072935A>T	ENST00000264360.5	+	1	2466	c.1640A>T	c.(1639-1641)gAc>gTc	p.D547V	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	547	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		GAAGCCCGGGACGCTGGCAGC	0.572																																																	0													50.0	56.0	54.0					4																	134072935		2075	4081	6156	SO:0001583	missense	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1640A>T	4.37:g.134072935A>T	ENSP00000264360:p.Asp547Val		Q4W5F6|Q96SF0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D547V	ENST00000264360.5	37	c.1640	CCDS34063.1	4	.	.	.	.	.	.	.	.	.	.	A	27.1	4.800482	0.90538	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.80909	-1.43	4.51	4.51	0.55191	Cadherin (5);Cadherin-like (1);	0.000000	0.45867	D	0.000336	D	0.93572	0.7948	H	0.98849	4.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.95501	0.8577	10	0.87932	D	0	.	12.9618	0.58462	1.0:0.0:0.0:0.0	.	547;547	Q9P2E7;Q96SF0	PCD10_HUMAN;.	V	547	ENSP00000264360:D547V	ENSP00000264360:D547V	D	+	2	0	PCDH10	134292385	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.295000	0.78780	1.889000	0.54706	0.533000	0.62120	GAC	PCDH10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000138650		0.572	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	-	0.00	12	0	A	NM_032961		134072935	+1	tier1	-	no_errors	ENST00000264360	ensembl	human	known	74_37	missense	40.00	6	4	SNP	1.000	T
PCDH15	65217	genome.wustl.edu	37	10	55973754	55973754	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr10:55973754A>C	ENST00000320301.6	-	10	1434	c.1040T>G	c.(1039-1041)cTt>cGt	p.L347R	PCDH15_ENST00000395433.1_Missense_Mutation_p.L325R|PCDH15_ENST00000361849.3_Missense_Mutation_p.L347R|PCDH15_ENST00000373955.1_Missense_Mutation_p.L347R|PCDH15_ENST00000437009.1_Missense_Mutation_p.L347R|PCDH15_ENST00000395445.1_Missense_Mutation_p.L347R|PCDH15_ENST00000395438.1_Missense_Mutation_p.L347R|PCDH15_ENST00000395432.2_Missense_Mutation_p.L310R|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395440.1_Missense_Mutation_p.L347R|PCDH15_ENST00000395446.1_Missense_Mutation_p.L347R|PCDH15_ENST00000395430.1_Missense_Mutation_p.L347R|PCDH15_ENST00000395442.1_Missense_Mutation_p.L347R|PCDH15_ENST00000414778.1_Missense_Mutation_p.L352R|PCDH15_ENST00000373957.3_Missense_Mutation_p.L325R|PCDH15_ENST00000373965.2_Missense_Mutation_p.L347R	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	347	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.L352R(2)|p.L347R(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CAGGAGACTAAGTTCTGCTGT	0.363										HNSCC(58;0.16)																																							3	Substitution - Missense(3)	large_intestine(3)											88.0	89.0	89.0					10																	55973754		2203	4300	6503	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1040T>G	10.37:g.55973754A>C	ENSP00000322604:p.Leu347Arg		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L347R	ENST00000320301.6	37	c.1040	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	A	20.2	3.943138	0.73672	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4;0.4;1.7;0.4;0.4;0.4;0.4;0.4;0.4;0.4	4.99	4.99	0.66335	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.74199	0.3685	M	0.82323	2.585	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;0.999;0.999;1.0;1.0;0.998;0.998;0.998;0.998;0.999;0.999;0.998;0.998	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.87578	0.998;0.969;0.969;0.985;0.987;0.98;0.998;0.98;0.969;0.969;0.973;0.989;0.991;0.964;0.969	T	0.79165	-0.1916	9	0.87932	D	0	.	14.6174	0.68558	1.0:0.0:0.0:0.0	.	325;347;347;352;347;310;347;347;347;347;347;352;347;325;347	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	R	347;352;347;347;347;347;347;347;310;347;325;325;347;347;352;347;347	ENSP00000363076:L347R;ENSP00000410304:L352R;ENSP00000378826:L347R;ENSP00000378832:L347R;ENSP00000378833:L347R;ENSP00000378829:L347R;ENSP00000378827:L347R;ENSP00000378820:L310R;ENSP00000354950:L347R;ENSP00000378821:L325R;ENSP00000363068:L325R;ENSP00000322604:L347R;ENSP00000378818:L347R;ENSP00000412628:L347R;ENSP00000363066:L347R	ENSP00000322604:L347R	L	-	2	0	PCDH15	55643760	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	6.592000	0.74095	1.998000	0.58463	0.455000	0.32223	CTT	PCDH15	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000150275		0.363	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	-	0.00	39	0	A	NM_033056		55973754	-1	tier1	-	no_errors	ENST00000320301	ensembl	human	known	74_37	missense	58.14	18	25	SNP	1.000	C
PCDHGB7	56099	genome.wustl.edu	37	5	140798869	140798869	+	Silent	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr5:140798869C>T	ENST00000398594.2	+	1	1443	c.1443C>T	c.(1441-1443)ttC>ttT	p.F481F	PCDHGA7_ENST00000518325.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGB3_ENST00000576222.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	481	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F481L(1)		central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCCAGACTTCGGGCTCAACG	0.622																																																	1	Substitution - Missense(1)	kidney(1)											78.0	89.0	85.0					5																	140798869		2138	4234	6372	SO:0001819	synonymous_variant	0			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1443C>T	5.37:g.140798869C>T			Q9UN63	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F481	ENST00000398594.2	37	c.1443	CCDS47293.1	5																																																																																			PCDHGB7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000254122		0.622	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB7	HGNC	protein_coding	OTTHUMT00000376973.1		0.00	53	0	C	NM_018927		140798869	+1			no_errors	ENST00000398594	ensembl	human	known	74_37	silent	5.00	38	2	SNP	0.012	T
PER2	8864	genome.wustl.edu	37	2	239185809	239185809	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:239185809C>T	ENST00000254657.3	-	3	535	c.256G>A	c.(256-258)Gca>Aca	p.A86T	PER2_ENST00000440245.1_Missense_Mutation_p.A86T|PER2_ENST00000355768.2_Missense_Mutation_p.A86T|PER2_ENST00000254658.3_Missense_Mutation_p.A86T	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	86					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)	p.A86T(1)		NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TCAGATTTTGCCATCATCAGG	0.383																																																	1	Substitution - Missense(1)	urinary_tract(1)											227.0	239.0	235.0					2																	239185809		2203	4300	6503	SO:0001583	missense	0			AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.256G>A	2.37:g.239185809C>T	ENSP00000254657:p.Ala86Thr		A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,superfamily_PAS,smart_PAS,pfscan_PAS	p.A86T	ENST00000254657.3	37	c.256	CCDS2528.1	2	.	.	.	.	.	.	.	.	.	.	C	0.421	-0.908299	0.02434	.	.	ENSG00000132326	ENST00000254657;ENST00000254658;ENST00000440245;ENST00000355768;ENST00000431832	T;T;T;T;T	0.53423	2.72;0.68;1.71;0.68;0.62	4.96	2.12	0.27331	.	0.345872	0.34110	N	0.004259	T	0.34308	0.0893	L	0.34521	1.04	0.20074	N	0.999938	B;B;B;B	0.10296	0.003;0.0;0.001;0.0	B;B;B;B	0.12837	0.008;0.001;0.005;0.001	T	0.18053	-1.0349	10	0.31617	T	0.26	-1.2378	11.0032	0.47618	0.0:0.7639:0.0:0.2361	.	86;86;86;86	F5GYD5;B4DH14;O15055-2;O15055	.;.;.;PER2_HUMAN	T	86	ENSP00000254657:A86T;ENSP00000254658:A86T;ENSP00000397516:A86T;ENSP00000348013:A86T;ENSP00000405891:A86T	ENSP00000254657:A86T	A	-	1	0	PER2	238850548	0.693000	0.27728	0.002000	0.10522	0.041000	0.13682	0.717000	0.25851	-0.004000	0.14419	-0.797000	0.03246	GCA	PER2	-	NULL	ENSG00000132326		0.383	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER2	HGNC	protein_coding	OTTHUMT00000257167.1	-	0.00	65	0	C	NM_022817		239185809	-1	tier1	-	no_errors	ENST00000254657	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.323	T
PFKFB1	5207	genome.wustl.edu	37	X	54982677	54982677	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chrX:54982677C>T	ENST00000375006.3	-	7	617	c.547G>A	c.(547-549)Gac>Aac	p.D183N	PFKFB1_ENST00000374992.2_Intron|PFKFB1_ENST00000545676.1_Missense_Mutation_p.D118N	NM_002625.2	NP_002616.2	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1	183	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|intracellular signal transduction (GO:0035556)|organ regeneration (GO:0031100)|positive regulation of glucokinase activity (GO:0033133)|response to cAMP (GO:0051591)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase complex (GO:0043540)|cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|fructose-6-phosphate binding (GO:0070095)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)	24						CGGTCACAGTCTATATAATCA	0.473																																																	0													74.0	66.0	69.0					X																	54982677		2203	4300	6503	SO:0001583	missense	0				CCDS14364.1, CCDS65273.1	Xp11.21	2012-07-13			ENSG00000158571	ENSG00000158571	2.7.1.105, 3.1.3.46		8872	protein-coding gene	gene with protein product		311790		PFRX		9119406	Standard	NM_002625		Approved		uc004dty.2	P16118	OTTHUMG00000021643	ENST00000375006.3:c.547G>A	X.37:g.54982677C>T	ENSP00000364145:p.Asp183Asn		B2RA88|B4DUN5|Q5JXS5|Q99951	Missense_Mutation	SNP	pfam_6Phosfructo_kin,pfam_His_Pase_superF_clade-1,pfam_Zeta_toxin_domain,superfamily_P-loop_NTPase,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	p.D183N	ENST00000375006.3	37	c.547	CCDS14364.1	X	.	.	.	.	.	.	.	.	.	.	C	6.794	0.515493	0.12944	.	.	ENSG00000158571	ENST00000375006;ENST00000545676	.	.	.	4.65	2.86	0.33363	6-phosphofructo-2-kinase (1);	0.196263	0.51477	D	0.000095	T	0.34308	0.0893	N	0.16656	0.425	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.001	T	0.07790	-1.0754	9	0.09338	T	0.73	-7.3822	8.9372	0.35706	0.0:0.7647:0.1468:0.0886	.	118;183	B4DUN5;P16118	.;F261_HUMAN	N	183;118	.	ENSP00000364145:D183N	D	-	1	0	PFKFB1	54999402	0.998000	0.40836	0.846000	0.33378	0.487000	0.33371	3.831000	0.55776	0.471000	0.27319	0.600000	0.82982	GAC	PFKFB1	-	pfam_6Phosfructo_kin,superfamily_P-loop_NTPase,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	ENSG00000158571		0.473	PFKFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKFB1	HGNC	protein_coding	OTTHUMT00000056847.1	-	0.00	36	0	C			54982677	-1	tier1	-	no_errors	ENST00000375006	ensembl	human	known	74_37	missense	80.00	3	12	SNP	0.991	T
PHGR1	644844	genome.wustl.edu	37	15	40648331	40648331	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr15:40648331G>C	ENST00000448599.2	+	4	132	c.76G>C	c.(76-78)Ggc>Cgc	p.G26R	DISP2_ENST00000267889.3_5'Flank	NM_001145643.1	NP_001139115.1	C9JFL3	PHGR1_HUMAN	proline/histidine/glycine-rich 1	26	Gly-rich.																GCCACCCCCTGGCCATGGCCC	0.711																																																	0													3.0	4.0	3.0					15																	40648331		643	1515	2158	SO:0001583	missense	0				CCDS45225.1	15q15.1	2009-10-08				ENSG00000233041			37226	protein-coding gene	gene with protein product							Standard	NM_001145643		Approved		uc010uco.2	C9JFL3		ENST00000448599.2:c.76G>C	15.37:g.40648331G>C	ENSP00000410024:p.Gly26Arg			Missense_Mutation	SNP	NULL	p.G26R	ENST00000448599.2	37	c.76	CCDS45225.1	15	.	.	.	.	.	.	.	.	.	.	G	7.403	0.633206	0.14322	.	.	ENSG00000233041	ENST00000535816;ENST00000448599	.	.	.	3.76	1.66	0.24008	.	.	.	.	.	T	0.47173	0.1431	.	.	.	0.09310	N	1	D	0.58268	0.982	P	0.54210	0.745	T	0.31447	-0.9943	7	0.87932	D	0	.	5.4875	0.16757	0.1183:0.2014:0.6803:0.0	.	26	C9JFL3	PHGR1_HUMAN	R	25;26	.	ENSP00000410024:G26R	G	+	1	0	PHGR1	38435623	0.038000	0.19896	0.032000	0.17829	0.086000	0.17979	0.650000	0.24858	0.777000	0.33496	0.556000	0.70494	GGC	PHGR1	-	NULL	ENSG00000233041		0.711	PHGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHGR1	HGNC	protein_coding	OTTHUMT00000418450.1		0.00	16	0	G	NM_001145643		40648331	+1			no_errors	ENST00000448599	ensembl	human	known	74_37	missense	14.63	35	6	SNP	0.006	C
PICALM	8301	genome.wustl.edu	37	11	85722153	85722153	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:85722153G>T	ENST00000393346.3	-	7	833	c.685C>A	c.(685-687)Caa>Aaa	p.Q229K	PICALM_ENST00000356360.5_Missense_Mutation_p.Q229K|PICALM_ENST00000528398.1_Missense_Mutation_p.Q178K|PICALM_ENST00000532317.1_Missense_Mutation_p.Q229K|PICALM_ENST00000526033.1_Missense_Mutation_p.Q229K			Q13492	PICAL_HUMAN	phosphatidylinositol binding clathrin assembly protein	229	Interaction with FAM64A.				axonogenesis (GO:0007409)|cargo loading into vesicle (GO:0035459)|cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|hemopoiesis (GO:0030097)|iron ion homeostasis (GO:0055072)|iron ion import into cell (GO:0097459)|negative regulation of gene expression (GO:0010629)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of receptor-mediated endocytosis (GO:0048261)|positive regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902961)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902959)|regulation of endocytosis (GO:0030100)|regulation of protein localization (GO:0032880)|synaptic vesicle maturation (GO:0016188)|vesicle-mediated transport (GO:0016192)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neurofibrillary tangle (GO:0097418)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|vesicle (GO:0031982)	1-phosphatidylinositol binding (GO:0005545)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|clathrin heavy chain binding (GO:0032050)	p.Q229*(1)		endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				TCTTTGCATTGGTTCTTTTTC	0.303			T	"""MLLT10, MLL"""	"""TALL, AML, """																																			Dom	yes		11	11q14	8301	phosphatidylinositol binding clathrin assembly protein (CALM)		L	1	Substitution - Nonsense(1)	lung(1)											102.0	91.0	95.0					11																	85722153		2202	4298	6500	SO:0001583	missense	0			BC048259	CCDS8272.1, CCDS31653.1, CCDS55783.1, CCDS55784.1	11q14	2008-02-01			ENSG00000073921	ENSG00000073921			15514	protein-coding gene	gene with protein product		603025				8643484	Standard	NM_001206947		Approved	CALM, CLTH	uc001pbm.3	Q13492	OTTHUMG00000166981	ENST00000393346.3:c.685C>A	11.37:g.85722153G>T	ENSP00000377015:p.Gln229Lys		B4DTM3|E9PN05|F8VPG7|O60700|Q4LE54|Q6GMQ6|Q86XZ9	Missense_Mutation	SNP	pfam_ANTH_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.Q229K	ENST00000393346.3	37	c.685	CCDS8272.1	11	.	.	.	.	.	.	.	.	.	.	G	28.0	4.879261	0.91740	.	.	ENSG00000073921	ENST00000532317;ENST00000526033;ENST00000447890;ENST00000393346;ENST00000528398;ENST00000356360	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	5.58	5.58	0.84498	ANTH (1);Clathrin adaptor, phosphoinositide-binding, GAT-like (1);	0.000000	0.85682	D	0.000000	T	0.69913	0.3164	M	0.85197	2.74	0.80722	D	1	D;D;D;D	0.89917	0.987;1.0;0.962;0.999	D;D;P;D	0.74348	0.967;0.983;0.829;0.983	T	0.71928	-0.4444	9	.	.	.	-9.6415	19.9313	0.97120	0.0:0.0:1.0:0.0	.	178;229;229;229	E9PN05;F8VPG7;Q13492;Q13492-3	.;.;PICAL_HUMAN;.	K	229;229;229;229;178;229	ENSP00000436958:Q229K;ENSP00000433846:Q229K;ENSP00000377015:Q229K;ENSP00000434884:Q178K;ENSP00000348718:Q229K	.	Q	-	1	0	PICALM	85399801	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.863000	0.87023	2.778000	0.95560	0.655000	0.94253	CAA	PICALM	-	pfam_ANTH_dom	ENSG00000073921		0.303	PICALM-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PICALM	HGNC	protein_coding	OTTHUMT00000392224.1		0.00	40	0	G	NM_007166		85722153	-1			no_errors	ENST00000393346	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
PICK1	9463	genome.wustl.edu	37	22	38471034	38471036	+	In_Frame_Del	DEL	GGA	GGA	-			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	GGA	GGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr22:38471034_38471036delGGA	ENST00000404072.3	+	13	1490_1492	c.1143_1145delGGA	c.(1141-1146)ggggag>ggg	p.E388del	PICK1_ENST00000356976.3_In_Frame_Del_p.E388del|RP5-1039K5.13_ENST00000445483.1_RNA	NM_001039583.1|NM_001039584.1	NP_001034672.1|NP_001034673.1	Q9NRD5	PICK1_HUMAN	protein interacting with PRKCA 1	388	Poly-Glu.				ATP catabolic process (GO:0006200)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|dendritic spine maintenance (GO:0097062)|dendritic spine organization (GO:0097061)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|glial cell development (GO:0021782)|long term synaptic depression (GO:0060292)|monoamine transport (GO:0015844)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|neuronal ion channel clustering (GO:0045161)|positive regulation of receptor internalization (GO:0002092)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|protein targeting (GO:0006605)|receptor clustering (GO:0043113)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endocytic vesicle membrane (GO:0030666)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein kinase C binding (GO:0005080)|receptor binding (GO:0005102)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	Melanoma(58;0.045)					TCACAGATGGggaggaggaggag	0.635																																																	0																																										SO:0001651	inframe_deletion	0			AL049654	CCDS13965.1	22q13.1	2006-02-14	2006-02-14	2006-02-14	ENSG00000100151	ENSG00000100151			9394	protein-coding gene	gene with protein product		605926	"""protein kinase C, alpha binding protein"", ""protein interacting with PRKCA"""	PRKCABP		10340301, 10591208	Standard	XM_006724377		Approved	dJ1039K5, MGC15204	uc003aus.3	Q9NRD5	OTTHUMG00000151159	ENST00000404072.3:c.1143_1145delGGA	22.37:g.38471043_38471045delGGA	ENSP00000385205:p.Glu388del		B3KS52|O95906	In_Frame_Del	DEL	pfam_AH_dom,pfam_PDZ,pfam_BAR_dom,superfamily_PDZ,smart_PDZ,pfscan_AH_dom,pfscan_PDZ	p.E385in_frame_del	ENST00000404072.3	37	c.1143_1145	CCDS13965.1	22																																																																																			PICK1	-	NULL	ENSG00000100151		0.635	PICK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PICK1	HGNC	protein_coding	OTTHUMT00000321569.2		0.00	29	0	GGA	NM_012407		38471036	+1	tier1		no_errors	ENST00000356976	ensembl	human	known	74_37	in_frame_del	9.09	20	2	DEL	0.071:1.000:1.000	-
PIRT	644139	genome.wustl.edu	37	17	10728672	10728672	+	Silent	SNP	C	C	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr17:10728672C>A	ENST00000580256.2	-	2	929	c.291G>T	c.(289-291)ctG>ctT	p.L97L		NM_001101387.1	NP_001094857.1	P0C851	PIRT_HUMAN	phosphoinositide-interacting regulator of transient receptor potential channels	97						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)	8						GTCCCAGGGACAGGAAGCCAG	0.532																																																	0													97.0	99.0	99.0					17																	10728672		2100	4221	6321	SO:0001819	synonymous_variant	0			AK021549	CCDS45614.1	17p12	2010-06-04			ENSG00000233670	ENSG00000233670			37239	protein-coding gene	gene with protein product	"""phosphoinositide-interacting regulator of TRPV1"""	612068				18455988	Standard	NM_001101387		Approved		uc010col.3	P0C851		ENST00000580256.2:c.291G>T	17.37:g.10728672C>A			B7Z648	Silent	SNP	NULL	p.L97	ENST00000580256.2	37	c.291	CCDS45614.1	17																																																																																			PIRT	-	NULL	ENSG00000233670		0.532	PIRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIRT	HGNC	protein_coding	OTTHUMT00000441078.2	-	0.00	82	0	C	NM_001101387		10728672	-1	tier1	-	no_errors	ENST00000580256	ensembl	human	known	74_37	silent	45.65	25	21	SNP	1.000	A
PKDCC	91461	genome.wustl.edu	37	2	42285285	42285285	+	3'UTR	SNP	C	C	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:42285285C>G	ENST00000294964.5	+	0	2119				PKDCC_ENST00000480099.1_3'UTR	NM_138370.2	NP_612379.2			protein kinase domain containing, cytoplasmic											breast(2)|kidney(1)|lung(5)	8						CAGCTTAGGTCTGGACAGGAG	0.607																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS33186.2	2p21	2014-01-28	2012-12-07		ENSG00000162878	ENSG00000162878			25123	protein-coding gene	gene with protein product	"""vertebrate lonesome kinase"""	614150	"""protein kinase domain containing, cytoplasmic homolog (mouse)"""			19097194, 19465597	Standard	NM_138370		Approved	SgK493, Vlk	uc002rsg.3	Q504Y2	OTTHUMG00000152303	ENST00000294964.5:c.*457C>G	2.37:g.42285285C>G				RNA	SNP	-	NULL	ENST00000294964.5	37	NULL	CCDS33186.2	2																																																																																			PKDCC	-	-	ENSG00000162878		0.607	PKDCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKDCC	HGNC	protein_coding	OTTHUMT00000325745.3	-	0.00	66	0	C			42285285	+1	tier1	-	no_errors	ENST00000480099	ensembl	human	known	74_37	rna	21.13	56	15	SNP	0.004	G
PLOD1	5351	genome.wustl.edu	37	1	12014761	12014761	+	Intron	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:12014761C>T	ENST00000196061.4	+	6	606				PLOD1_ENST00000485046.1_Intron|PLOD1_ENST00000376369.3_Intron	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1						cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	CCTGATGTGACGTGGCAGAGT	0.602																																																	0																																										SO:0001627	intron_variant	0			BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.580-126C>T	1.37:g.12014761C>T			B4DR87|Q96AV9|Q9H132	RNA	SNP	-	NULL	ENST00000196061.4	37	NULL	CCDS142.1	1																																																																																			PLOD1	-	-	ENSG00000083444		0.602	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD1	HGNC	protein_coding	OTTHUMT00000006865.1	-	0.00	51	0	C	NM_000302		12014761	+1	tier1	-	no_errors	ENST00000358133	ensembl	human	known	74_37	rna	58.18	23	32	SNP	0.000	T
PKLR	5313	genome.wustl.edu	37	1	155260412	155260412	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:155260412C>T	ENST00000342741.4	-	11	1714	c.1676G>A	c.(1675-1677)cGa>cAa	p.R559Q	PKLR_ENST00000392414.3_Missense_Mutation_p.R528Q	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	559	Allosteric activator binding.		R -> G (in PKRD).		ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	GGAGCCAGGTCGCCAGCCTGT	0.587																																																	0													71.0	56.0	61.0					1																	155260412		2203	4300	6503	SO:0001583	missense	0			BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.1676G>A	1.37:g.155260412C>T	ENSP00000339933:p.Arg559Gln		O75758|P11973	Missense_Mutation	SNP	pfam_Pyrv_Knase_brl,pfam_Pyrv_Knase_C,superfamily_Pyrv/PenolPyrv_Kinase-like_dom,superfamily_Pyrv_Knase_C,superfamily_Pyrv_Knase-like_insert_dom,prints_Pyr_Knase,tigrfam_Pyr_Knase	p.R559Q	ENST00000342741.4	37	c.1676	CCDS1109.1	1	.	.	.	.	.	.	.	.	.	.	c	18.12	3.552284	0.65311	.	.	ENSG00000143627	ENST00000423816;ENST00000392414;ENST00000342741;ENST00000271946	D;D	0.99014	-5.33;-5.33	4.54	3.63	0.41609	Pyruvate kinase, C-terminal (2);Pyruvate kinase, alpha/beta (1);	0.176883	0.46442	N	0.000282	D	0.94561	0.8248	L	0.43757	1.38	0.48511	D	0.999663	B;B	0.31519	0.327;0.327	B;B	0.21360	0.034;0.034	D	0.94221	0.7467	10	0.28530	T	0.3	-5.7578	10.7042	0.45946	0.0:0.9053:0.0:0.0947	.	559;550	P30613;B1AVT1	KPYR_HUMAN;.	Q	584;528;559;473	ENSP00000376214:R528Q;ENSP00000339933:R559Q	ENSP00000271946:R473Q	R	-	2	0	PKLR	153527036	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	5.810000	0.69179	1.266000	0.44231	0.457000	0.33378	CGA	PKLR	-	pfam_Pyrv_Knase_C,superfamily_Pyrv_Knase_C,tigrfam_Pyr_Knase	ENSG00000143627		0.587	PKLR-001	KNOWN	basic|CCDS	protein_coding	PKLR	HGNC	protein_coding	OTTHUMT00000087407.2	-	0.00	55	0	C	NM_000298		155260412	-1	tier1	-	no_errors	ENST00000342741	ensembl	human	known	74_37	missense	19.70	53	13	SNP	1.000	T
PLOD2	5352	genome.wustl.edu	37	3	145841106	145841106	+	Intron	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr3:145841106C>T	ENST00000360060.3	-	2	379				PLOD2_ENST00000282903.5_Intron|PLOD2_ENST00000494950.1_Intron	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2						cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	CTGACAGATCCTTCTTTCTAT	0.323																																																	0																																										SO:0001627	intron_variant	0			U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.201+818G>A	3.37:g.145841106C>T			B3KWS3|Q59ED2|Q8N170	Missense_Mutation	SNP	NULL	p.G70R	ENST00000360060.3	37	c.208	CCDS3131.1	3																																																																																			PLOD2	-	NULL	ENSG00000152952		0.323	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD2	HGNC	protein_coding	OTTHUMT00000355185.1	-	0.00	111	0	C	NM_000935		145841106	-1	tier1	-	no_errors	ENST00000480704	ensembl	human	known	74_37	missense	27.88	75	29	SNP	0.000	T
POTEE	445582	genome.wustl.edu	37	2	132021884	132021884	+	Silent	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:132021884C>T	ENST00000356920.5	+	15	2950	c.2856C>T	c.(2854-2856)aaC>aaT	p.N952N	POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	952	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											CCATCGGCAACGAGCGGTTCC	0.602																																																	0																																										SO:0001819	synonymous_variant	0			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2856C>T	2.37:g.132021884C>T			Q6S8J4|Q6S8J5|Q6S8J8	Silent	SNP	pfam_Actin-related,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-related,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-related	p.N952	ENST00000356920.5	37	c.2856	CCDS46414.1	2																																																																																			POTEE	-	pfam_Actin-related,smart_Actin-related,prints_Actin-related	ENSG00000188219		0.602	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEE	HGNC	protein_coding		-	0.00	157	0	C	NM_001083538		132021884	+1	tier1	-	no_errors	ENST00000356920	ensembl	human	known	74_37	silent	22.60	113	33	SNP	1.000	T
PPOX	5498	genome.wustl.edu	37	1	161137901	161137901	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:161137901G>A	ENST00000367999.4	+	5	721	c.455G>A	c.(454-456)cGc>cAc	p.R152H	PPOX_ENST00000535223.1_Intron|PPOX_ENST00000544598.1_Intron|PPOX_ENST00000495483.1_Intron|PPOX_ENST00000352210.5_Missense_Mutation_p.R152H|PPOX_ENST00000432542.2_Intron	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	152			R -> C (in VP; strongly decreases enzyme activity). {ECO:0000269|PubMed:10486317, ECO:0000269|PubMed:11474578, ECO:0000269|PubMed:12859407, ECO:0000269|PubMed:9763307}.		heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TTTGCCCAGCGCCGCCTTGGA	0.597																																																	0													45.0	47.0	47.0					1																	161137901		2203	4300	6503	SO:0001583	missense	0			BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.455G>A	1.37:g.161137901G>A	ENSP00000356978:p.Arg152His		D3DVG0|Q5VTW8	Missense_Mutation	SNP	pfam_Amino_oxidase,tigrfam_Protoporphyrinogen_oxidase	p.R152H	ENST00000367999.4	37	c.455	CCDS1221.1	1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.032949	0.93575	.	.	ENSG00000143224	ENST00000352210;ENST00000367999	D;D	0.92699	-3.09;-3.09	5.69	5.69	0.88448	Amine oxidase (1);	0.000000	0.85682	D	0.000000	D	0.96947	0.9003	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.97183	0.9852	10	0.59425	D	0.04	-5.7487	17.3153	0.87221	0.0:0.0:1.0:0.0	.	152	P50336	PPOX_HUMAN	H	152	ENSP00000343943:R152H;ENSP00000356978:R152H	ENSP00000343943:R152H	R	+	2	0	PPOX	159404525	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.917000	0.75782	2.679000	0.91253	0.650000	0.86243	CGC	PPOX	-	pfam_Amino_oxidase,tigrfam_Protoporphyrinogen_oxidase	ENSG00000143224		0.597	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PPOX	HGNC	protein_coding	OTTHUMT00000082993.1	-	0.00	55	0	G	NM_000309		161137901	+1	tier1	-	no_errors	ENST00000352210	ensembl	human	known	74_37	missense	15.00	50	9	SNP	1.000	A
PPP1R26	9858	genome.wustl.edu	37	9	138379218	138379218	+	Silent	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr9:138379218C>T	ENST00000356818.2	+	4	3411	c.2862C>T	c.(2860-2862)agC>agT	p.S954S	PPP1R26_ENST00000604351.1_Silent_p.S954S|PPP1R26_ENST00000605286.1_Silent_p.S954S|PPP1R26_ENST00000401470.3_Silent_p.S954S|PPP1R26_ENST00000605660.1_Silent_p.S954S|PPP1R26_ENST00000602993.1_Intron	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	954					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										TCTCAGTGAGCAGGAGAAATG	0.657																																																	0													31.0	35.0	34.0					9																	138379218		2066	4055	6121	SO:0001819	synonymous_variant	0			AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.2862C>T	9.37:g.138379218C>T			Q86WU0|Q8WVV0|Q9Y4D3	Silent	SNP	NULL	p.S954	ENST00000356818.2	37	c.2862	CCDS6988.1	9																																																																																			PPP1R26	-	NULL	ENSG00000196422		0.657	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R26	HGNC	protein_coding	OTTHUMT00000054987.1	-	0.00	47	0	C	NM_014811		138379218	+1	tier1	-	no_errors	ENST00000356818	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.000	T
PRAMEF17	391004	genome.wustl.edu	37	1	13716931	13716931	+	Silent	SNP	A	A	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:13716931A>C	ENST00000376098.4	+	2	444	c.418A>C	c.(418-420)Agg>Cgg	p.R140R		NM_001099851.1	NP_001093321.1	Q5VTA0	PRA17_HUMAN	PRAME family member 17	140					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					kidney(1)|lung(2)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;9.86e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|COAD - Colon adenocarcinoma(227;0.000502)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGACTATCCAAGGACGGGAGA	0.537																																																	0													108.0	127.0	121.0					1																	13716931		2165	4255	6420	SO:0001819	synonymous_variant	0				CCDS41264.1	1p36.21	2013-01-17			ENSG00000204479	ENSG00000204479		"""-"""	29485	protein-coding gene	gene with protein product							Standard	NM_001099851		Approved	OTTHUMG00000007909	uc009vnz.1	Q5VTA0	OTTHUMG00000007909	ENST00000376098.4:c.418A>C	1.37:g.13716931A>C			B2RUU4	Silent	SNP	NULL	p.R140	ENST00000376098.4	37	c.418	CCDS41264.1	1																																																																																			PRAMEF17	-	NULL	ENSG00000204479		0.537	PRAMEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF17	HGNC	protein_coding	OTTHUMT00000021780.2	-	0.00	334	0	A	NM_001099851		13716931	+1	tier1	-	no_errors	ENST00000376098	ensembl	human	known	74_37	silent	27.97	170	66	SNP	0.000	C
PREX1	57580	genome.wustl.edu	37	20	47351176	47351176	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr20:47351176G>C	ENST00000371941.3	-	4	448	c.426C>G	c.(424-426)ttC>ttG	p.F142L	PREX1_ENST00000396220.1_Missense_Mutation_p.F142L	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	142	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CGTACACGCAGAACTTGTCCT	0.562																																																	0													136.0	108.0	117.0					20																	47351176		2203	4300	6503	SO:0001583	missense	0			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.426C>G	20.37:g.47351176G>C	ENSP00000361009:p.Phe142Leu		E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.F142L	ENST00000371941.3	37	c.426	CCDS13410.1	20	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850404	0.71719	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.68025	-0.3;-0.3	5.5	2.52	0.30459	Dbl homology (DH) domain (5);	0.000000	0.64402	U	0.000019	T	0.70064	0.3181	L	0.35593	1.075	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.66532	-0.5900	10	0.45353	T	0.12	.	10.2284	0.43241	0.2163:0.0:0.7837:0.0	.	142	Q8TCU6	PREX1_HUMAN	L	142	ENSP00000361009:F142L;ENSP00000379522:F142L	ENSP00000361009:F142L	F	-	3	2	PREX1	46784583	1.000000	0.71417	0.994000	0.49952	0.945000	0.59286	1.598000	0.36740	0.300000	0.22699	0.650000	0.86243	TTC	PREX1	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000124126		0.562	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PREX1	HGNC	protein_coding	OTTHUMT00000079623.1	-	0.00	24	0	G	NM_020820		47351176	-1	tier1	-	no_errors	ENST00000371941	ensembl	human	known	74_37	missense	42.50	23	17	SNP	1.000	C
CERS3	204219	genome.wustl.edu	37	15	101088125	101088126	+	5'Flank	INS	-	-	T	rs532048470|rs574236631|rs111634080	byFrequency	TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr15:101088125_101088126insT	ENST00000560944.1	-	0	0				RP11-526I2.5_ENST00000602585.1_lincRNA			Q8IU89	CERS3_HUMAN	ceramide synthase 3						ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										ACATGCTACAGTTTTTTTTTTC	0.347													|||unknown(HR)	294	0.0587061	0.0204	0.1902	5008	,	,		16134	0.0437		0.0487	False		,,,				2504	0.0429																0																																										SO:0001631	upstream_gene_variant	0				CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568		15.37:g.101088135_101088135dupT	Exception_encountered		Q8NE64|Q8NEN6	RNA	INS	-	NULL	ENST00000560944.1	37	NULL		15																																																																																			RP11-526I2.5	-	-	ENSG00000270127		0.347	CERS3-009	KNOWN	basic	processed_transcript	PRKXP1	Clone_based_vega_gene	protein_coding	OTTHUMT00000417720.1		0.00	25	0	-	NM_178842		101088126	-1	tier1		no_errors	ENST00000602585	ensembl	human	known	74_37	rna	15.62	27	5	INS	0.000:0.000	T
PRPH2	5961	genome.wustl.edu	37	6	42689525	42689525	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr6:42689525C>T	ENST00000230381.5	-	1	787	c.548G>A	c.(547-549)cGc>cAc	p.R183H		NM_000322.4	NP_000313.2	P23942	PRPH2_HUMAN	peripherin 2 (retinal degeneration, slow)	183					cell adhesion (GO:0007155)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.R183H(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	18	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)			GTCCAGGTAGCGATTGCTGAT	0.493																																																	1	Substitution - Missense(1)	large_intestine(1)											151.0	145.0	147.0					6																	42689525		2203	4300	6503	SO:0001583	missense	0				CCDS4871.1	6p21.1	2013-09-20	2006-11-23	2006-11-23	ENSG00000112619	ENSG00000112619		"""Tetraspanins"""	9942	protein-coding gene	gene with protein product	retinal peripherin	179605	"""retinal degeneration, slow (retinitis pigmentosa 7)"", ""retinal degeneration, slow"""	RP7, RDS		1749427	Standard	NM_000322		Approved	TSPAN22, rd2, CACD2	uc003osk.3	P23942	OTTHUMG00000014701	ENST00000230381.5:c.548G>A	6.37:g.42689525C>T	ENSP00000230381:p.Arg183His		Q5TFH5|Q6DK65	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Peripherin/rom-1	p.R183H	ENST00000230381.5	37	c.548	CCDS4871.1	6	.	.	.	.	.	.	.	.	.	.	C	33	5.280797	0.95489	.	.	ENSG00000112619	ENST00000230381	T	0.80304	-1.36	5.63	5.63	0.86233	Tetraspanin, EC2 domain (1);	0.000000	0.85682	D	0.000000	D	0.90590	0.7050	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.90821	0.4709	10	0.66056	D	0.02	.	20.0442	0.97604	0.0:1.0:0.0:0.0	.	183	P23942	PRPH2_HUMAN	H	183	ENSP00000230381:R183H	ENSP00000230381:R183H	R	-	2	0	PRPH2	42797503	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.708000	0.84633	2.814000	0.96858	0.655000	0.94253	CGC	PRPH2	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Peripherin/rom-1	ENSG00000112619		0.493	PRPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPH2	HGNC	protein_coding	OTTHUMT00000040556.1	-	0.00	64	0	C	NM_000322		42689525	-1	tier1	-	no_errors	ENST00000230381	ensembl	human	known	74_37	missense	62.90	21	39	SNP	1.000	T
PRRC2C	23215	genome.wustl.edu	37	1	171558576	171558576	+	Silent	SNP	T	T	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:171558576T>C	ENST00000392078.3	+	34	8549	c.8268T>C	c.(8266-8268)ccT>ccC	p.P2756P	PRRC2C_ENST00000367742.3_Intron|PRRC2C_ENST00000426496.2_Intron|PRRC2C_ENST00000338920.4_Intron			Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	2754					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										TCCCAGCGCCTGTTCAGAGGC	0.532																																																	0																																										SO:0001819	synonymous_variant	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000392078.3:c.8268T>C	1.37:g.171558576T>C			Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Silent	SNP	pfam_BAT2_N	p.P2756	ENST00000392078.3	37	c.8268		1																																																																																			PRRC2C	-	NULL	ENSG00000117523		0.532	PRRC2C-201	KNOWN	basic	protein_coding	PRRC2C	HGNC	protein_coding		-	0.00	43	0	T	NM_015172		171558576	+1	tier1	-	no_errors	ENST00000392078	ensembl	human	known	74_37	silent	8.33	44	4	SNP	1.000	C
PRTG	283659	genome.wustl.edu	37	15	55971641	55971641	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr15:55971641G>C	ENST00000389286.4	-	7	1023	c.976C>G	c.(976-978)Cct>Gct	p.P326A	RP11-420M1.2_ENST00000561155.1_RNA	NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		AATGAAGGAGGAGCTATTTTT	0.413																																																	0													54.0	47.0	49.0					15																	55971641		1817	4075	5892	SO:0001583	missense	0			AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.976C>G	15.37:g.55971641G>C	ENSP00000373937:p.Pro326Ala			Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P326A	ENST00000389286.4	37	c.976	CCDS42040.1	15	.	.	.	.	.	.	.	.	.	.	G	21.2	4.118056	0.77323	.	.	ENSG00000166450	ENST00000389286	T	0.31769	1.48	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.46718	0.1407	L	0.37697	1.125	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.11690	-1.0577	10	0.23891	T	0.37	-18.0534	18.8612	0.92273	0.0:0.0:1.0:0.0	.	326	Q2VWP7	PRTG_HUMAN	A	326	ENSP00000373937:P326A	ENSP00000373937:P326A	P	-	1	0	PRTG	53758933	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.457000	0.80775	2.690000	0.91761	0.591000	0.81541	CCT	PRTG	-	NULL	ENSG00000166450		0.413	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRTG	HGNC	protein_coding	OTTHUMT00000419357.1	-	0.00	31	0	G	NM_173814		55971641	-1	tier1	-	no_errors	ENST00000389286	ensembl	human	known	74_37	missense	54.84	14	17	SNP	1.000	C
PSMG1	8624	genome.wustl.edu	37	21	40555233	40555235	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	CCT	CCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr21:40555233_40555235delCCT	ENST00000331573.3	-	1	542_544	c.77_79delAGG	c.(76-81)gagggg>ggg	p.E26del	PSMG1_ENST00000380900.2_In_Frame_Del_p.E26del|AF129408.17_ENST00000608767.1_RNA	NM_001261824.1|NM_003720.3	NP_001248753.1|NP_003711.1	O95456	PSMG1_HUMAN	proteasome (prosome, macropain) assembly chaperone 1	26					cerebellar granule cell precursor proliferation (GO:0021930)|proteasome assembly (GO:0043248)|proteasome core complex assembly (GO:0080129)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(2)	8		Prostate(19;8.44e-08)				tccctccgcccctcctcctcctc	0.695																																																	0									,	99,4141		7,85,2028					,	0.8	0.0			23	264,7976		23,218,3879	no	coding,coding	PSMG1	NM_203433.1,NM_003720.2	,	30,303,5907	A1A1,A1R,RR		3.2039,2.3349,2.9087	,	,		363,12117				SO:0001651	inframe_deletion	0			AJ006291	CCDS13660.1, CCDS13661.1	21q22.3	2007-10-23	2007-10-23	2007-10-23	ENSG00000183527	ENSG00000183527			3043	protein-coding gene	gene with protein product		605296	"""Down syndrome critical region gene 2"""	DSCR2		10872820, 17189198	Standard	NM_003720		Approved	c21-LRP, LRPC21, PAC1	uc002yxi.4	O95456	OTTHUMG00000066034	ENST00000331573.3:c.77_79delAGG	21.37:g.40555242_40555244delCCT	ENSP00000329915:p.Glu26del		B5BUN2|Q6FHA3|Q6FHD3|Q6S713	In_Frame_Del	DEL	pirsf_Proteasome_assmbl_chp_1	p.E26in_frame_del	ENST00000331573.3	37	c.79_77	CCDS13660.1	21																																																																																			PSMG1	-	pirsf_Proteasome_assmbl_chp_1	ENSG00000183527		0.695	PSMG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMG1	HGNC	protein_coding	OTTHUMT00000141404.2		0.00	18	0	CCT	NM_003720		40555235	-1	tier1		no_errors	ENST00000331573	ensembl	human	known	74_37	in_frame_del	22.22	7	2	DEL	0.012:0.015:0.023	-
PTPLAD1	51495	genome.wustl.edu	37	15	65864687	65864687	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr15:65864687T>C	ENST00000261875.5	+	10	1161	c.995T>C	c.(994-996)cTt>cCt	p.L332P	PTPLAD1_ENST00000566511.1_Missense_Mutation_p.L215P|snoU13_ENST00000459019.1_RNA|PTPLAD1_ENST00000565299.1_Missense_Mutation_p.L370P|PTPLAD1_ENST00000566074.1_Missense_Mutation_p.L215P|PTPLAD1_ENST00000568793.1_Missense_Mutation_p.L307P|PTPLAD1_ENST00000442729.2_Missense_Mutation_p.L277P|PTPLAD1_ENST00000569894.1_Missense_Mutation_p.L215P|PTPLAD1_ENST00000562901.1_Missense_Mutation_p.L215P	NM_016395.2	NP_057479.2	Q9P035	HACD3_HUMAN	protein tyrosine phosphatase-like A domain containing 1	332					activation of JUN kinase activity (GO:0007257)|fatty acid biosynthetic process (GO:0006633)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|positive regulation of GTPase activity (GO:0043547)|Rac protein signal transduction (GO:0016601)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)	GTPase activator activity (GO:0005096)|lyase activity (GO:0016829)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|pancreas(1)	5						CAGATTTATCTTATAATGATA	0.299																																																	0													51.0	47.0	48.0					15																	65864687		1790	4059	5849	SO:0001583	missense	0				CCDS45282.1	15q22.2	2005-11-11				ENSG00000074696			24175	protein-coding gene	gene with protein product		615940				10747961, 11042152	Standard	NM_016395		Approved	B-ind1, HSPC121	uc002apc.3	Q9P035		ENST00000261875.5:c.995T>C	15.37:g.65864687T>C	ENSP00000261875:p.Leu332Pro		A0PJA1|B4DRF4|Q280Z3|Q6PD63|Q8IUI5|Q8NC86|Q8NCB1|Q96T12|Q9NQA7	Missense_Mutation	SNP	pfam_Tyr_Pase-like_PTPLA,pfam_CS_dom,superfamily_HSP20-like_chaperone,pfscan_CS_dom	p.L332P	ENST00000261875.5	37	c.995	CCDS45282.1	15	.	.	.	.	.	.	.	.	.	.	T	23.9	4.465721	0.84425	.	.	ENSG00000074696	ENST00000442729;ENST00000261875	T;T	0.45668	0.89;0.89	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.71290	0.3322	M	0.88241	2.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77035	-0.2737	10	0.87932	D	0	-15.0624	16.8222	0.85835	0.0:0.0:0.0:1.0	.	277;332	B4DRF4;Q9P035	.;HACD3_HUMAN	P	277;332	ENSP00000392491:L277P;ENSP00000261875:L332P	ENSP00000261875:L332P	L	+	2	0	PTPLAD1	63651740	1.000000	0.71417	0.986000	0.45419	0.998000	0.95712	7.657000	0.83745	2.371000	0.80710	0.533000	0.62120	CTT	PTPLAD1	-	pfam_Tyr_Pase-like_PTPLA	ENSG00000074696		0.299	PTPLAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPLAD1	HGNC	protein_coding	OTTHUMT00000419739.1	-	0.00	62	0	T	NM_016395		65864687	+1	tier1	-	no_errors	ENST00000261875	ensembl	human	known	74_37	missense	34.25	48	25	SNP	1.000	C
PTPN13	5783	genome.wustl.edu	37	4	87718046	87718046	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr4:87718046G>A	ENST00000411767.2	+	41	6428	c.6365G>A	c.(6364-6366)tGt>tAt	p.C2122Y	PTPN13_ENST00000511467.1_Missense_Mutation_p.C2127Y|PTPN13_ENST00000436978.1_Missense_Mutation_p.C2127Y|PTPN13_ENST00000316707.6_Missense_Mutation_p.C1931Y|PTPN13_ENST00000427191.2_Missense_Mutation_p.C2103Y			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	2122					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		ATGAATGGCTGTGAAGAATAT	0.279																																																	0													45.0	40.0	42.0					4																	87718046		1791	4065	5856	SO:0001583	missense	0				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.6365G>A	4.37:g.87718046G>A	ENSP00000407249:p.Cys2122Tyr		B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.C2127Y	ENST00000411767.2	37	c.6380	CCDS47094.1	4	.	.	.	.	.	.	.	.	.	.	G	0.247	-1.009573	0.02095	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.51574	0.7;0.73;0.81;0.7;0.73	4.88	2.96	0.34315	.	0.271846	0.26055	N	0.026603	T	0.31765	0.0807	L	0.47716	1.5	0.37193	D	0.904033	B;B;B;B	0.09022	0.001;0.002;0.001;0.002	B;B;B;B	0.06405	0.002;0.002;0.001;0.002	T	0.21381	-1.0247	10	0.02654	T	1	.	7.3233	0.26540	0.099:0.1666:0.7344:0.0	.	1931;2103;2122;2127	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	Y	2103;2127;1931;2122;2127;2071	ENSP00000408368:C2103Y;ENSP00000394794:C2127Y;ENSP00000322675:C1931Y;ENSP00000407249:C2122Y;ENSP00000426626:C2127Y	ENSP00000322675:C1931Y	C	+	2	0	PTPN13	87937070	1.000000	0.71417	0.747000	0.31113	0.916000	0.54674	0.982000	0.29539	0.943000	0.37553	0.655000	0.94253	TGT	PTPN13	-	pirsf_Tyr_Pase_non-rcpt_typ-13	ENSG00000163629		0.279	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	HGNC	protein_coding	OTTHUMT00000363191.1	-	0.00	130	0	G			87718046	+1	tier1	-	no_errors	ENST00000436978	ensembl	human	known	74_37	missense	70.00	20	49	SNP	0.999	A
PTPRN2	5799	genome.wustl.edu	37	7	157475486	157475486	+	Silent	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr7:157475486C>T	ENST00000389418.4	-	13	1941	c.1932G>A	c.(1930-1932)caG>caA	p.Q644Q	PTPRN2_ENST00000409483.1_Silent_p.Q606Q|PTPRN2_ENST00000404321.2_Silent_p.Q667Q|PTPRN2_ENST00000389416.4_Silent_p.Q627Q|PTPRN2_ENST00000389413.3_Silent_p.Q615Q	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	644					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		TCAGCCTGTGCTGAGAGCTAT	0.587																																																	0													92.0	102.0	99.0					7																	157475486		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.1932G>A	7.37:g.157475486C>T			E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.Q667	ENST00000389418.4	37	c.2001	CCDS5947.1	7																																																																																			PTPRN2	-	NULL	ENSG00000155093		0.587	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTPRN2	HGNC	protein_coding	OTTHUMT00000353214.1	-	0.00	49	0	C			157475486	-1	tier1	-	no_errors	ENST00000404321	ensembl	human	known	74_37	silent	8.33	43	4	SNP	0.961	T
RAB4A	5867	genome.wustl.edu	37	1	229433269	229433269	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:229433269G>T	ENST00000366690.4	+	5	539	c.331G>T	c.(331-333)Gcc>Tcc	p.A111S	RAB4A_ENST00000473894.1_3'UTR	NM_004578.2	NP_004569.2	P20338	RAB4A_HUMAN	RAB4A, member RAS oncogene family	111					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|regulation of endocytosis (GO:0030100)|small GTPase mediated signal transduction (GO:0007264)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein transporter activity (GO:0008565)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.178)				GTTAACAGATGCCCGAATGCT	0.398																																					Esophageal Squamous(11;250 603 9619 16563)												0													130.0	123.0	125.0					1																	229433269		2203	4300	6503	SO:0001583	missense	0			BC004309	CCDS31050.1, CCDS73046.1	1q42-q43	2014-04-03		2002-02-28	ENSG00000168118	ENSG00000168118		"""RAB, member RAS oncogene"""	9781	protein-coding gene	gene with protein product		179511		RAB4			Standard	NM_004578		Approved	HRES-1/RAB4	uc001hth.4	P20338	OTTHUMG00000037627	ENST00000366690.4:c.331G>T	1.37:g.229433269G>T	ENSP00000355651:p.Ala111Ser		Q5T7P7|Q9BQ44	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.A111S	ENST00000366690.4	37	c.331	CCDS31050.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.587030	0.96578	.	.	ENSG00000168118	ENST00000366690	T	0.77229	-1.08	5.48	5.48	0.80851	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.88937	0.6573	M	0.81942	2.565	0.80722	D	1	D	0.57571	0.98	D	0.70227	0.968	D	0.89976	0.4097	10	0.87932	D	0	.	19.364	0.94454	0.0:0.0:1.0:0.0	.	106	P20338	RAB4A_HUMAN	S	111	ENSP00000355651:A111S	ENSP00000355651:A111S	A	+	1	0	RAB4A	227499892	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.547000	0.85894	0.655000	0.94253	GCC	RAB4A	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000168118		0.398	RAB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB4A	HGNC	protein_coding	OTTHUMT00000091727.3		0.00	39	0	G	NM_004578		229433269	+1			no_errors	ENST00000366690	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
RALBP1	10928	genome.wustl.edu	37	18	9517255	9517255	+	Nonsense_Mutation	SNP	C	C	A	rs568114638		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr18:9517255C>A	ENST00000019317.4	+	3	880	c.657C>A	c.(655-657)taC>taA	p.Y219*	RP11-61L19.3_ENST00000609094.1_RNA|RNU2-27P_ENST00000516185.1_RNA|RALBP1_ENST00000383432.3_Nonsense_Mutation_p.Y219*			Q15311	RBP1_HUMAN	ralA binding protein 1	219	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				ATP catabolic process (GO:0006200)|chemotaxis (GO:0006935)|positive regulation of Cdc42 GTPase activity (GO:0043089)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|transport (GO:0006810)	cytosol (GO:0005829)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ATPase activity, coupled to movement of substances (GO:0043492)|GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(3)|upper_aerodigestive_tract(1)	14					Carbamazepine(DB00564)|Doxorubicin(DB00997)|Sorafenib(DB00398)|Vincristine(DB00541)	GTATAGATTACGTAGAGAAGT	0.413																																																	0													76.0	73.0	74.0					18																	9517255		2203	4300	6503	SO:0001587	stop_gained	0			L42542	CCDS11845.1	18p11.22	2006-04-22			ENSG00000017797	ENSG00000017797			9841	protein-coding gene	gene with protein product		605801				7673236	Standard	NM_006788		Approved	RLIP76, RIP1, RIP	uc002koc.3	Q15311	OTTHUMG00000131596	ENST00000019317.4:c.657C>A	18.37:g.9517255C>A	ENSP00000019317:p.Tyr219*		D3DUI0	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.Y219*	ENST00000019317.4	37	c.657	CCDS11845.1	18	.	.	.	.	.	.	.	.	.	.	C	21.9	4.211523	0.79240	.	.	ENSG00000017797	ENST00000019317;ENST00000383432;ENST00000458039	.	.	.	5.1	-3.48	0.04739	.	0.058024	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.1972	13.0477	0.58937	0.0:0.6122:0.0:0.3878	.	.	.	.	X	219	.	ENSP00000019317:Y219X	Y	+	3	2	RALBP1	9507255	0.851000	0.29673	0.603000	0.28903	0.999000	0.98932	0.025000	0.13577	-0.741000	0.04797	0.655000	0.94253	TAC	RALBP1	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000017797		0.413	RALBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RALBP1	HGNC	protein_coding	OTTHUMT00000254479.1		0.00	68	0	C	NM_006788		9517255	+1			no_errors	ENST00000019317	ensembl	human	known	74_37	nonsense	5.88	32	2	SNP	0.997	A
RASSF2	9770	genome.wustl.edu	37	20	4776546	4776546	+	Silent	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr20:4776546G>A	ENST00000379400.3	-	5	397	c.202C>T	c.(202-204)Ctg>Ttg	p.L68L	RASSF2_ENST00000478553.1_5'Flank|RASSF2_ENST00000379376.2_Silent_p.L68L	NM_014737.2	NP_055552.1	P50749	RASF2_HUMAN	Ras association (RalGDS/AF-6) domain family member 2	68					bone remodeling (GO:0046849)|cell cycle (GO:0007049)|epidermal growth factor receptor signaling pathway via I-kappaB kinase/NF-kappaB cascade (GO:0038168)|homeostasis of number of cells (GO:0048872)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|ossification (GO:0001503)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|pancreas(2)|prostate(2)|skin(2)	34						TGCATCTGCAGGCGAATGGGC	0.592																																					Melanoma(158;1891 3343 50738)												0													104.0	99.0	101.0					20																	4776546		2203	4300	6503	SO:0001819	synonymous_variant	0			D79990	CCDS13083.1	20p13	2011-08-12	2008-02-22		ENSG00000101265	ENSG00000101265			9883	protein-coding gene	gene with protein product	"""centromere protein 34"""	609492				8724849, 15806169	Standard	NM_014737		Approved	KIAA0168, CENP-34	uc002wld.3	P50749	OTTHUMG00000031790	ENST00000379400.3:c.202C>T	20.37:g.4776546G>A			A6NIX9|A8K5Z3|Q17S06|Q53HD0|Q6AHZ2|Q8IZA5	Silent	SNP	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SARAH_dom	p.L68	ENST00000379400.3	37	c.202	CCDS13083.1	20																																																																																			RASSF2	-	NULL	ENSG00000101265		0.592	RASSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF2	HGNC	protein_coding	OTTHUMT00000077828.1	-	0.00	41	0	G	NM_014737		4776546	-1	tier1	-	no_errors	ENST00000379376	ensembl	human	known	74_37	silent	27.08	35	13	SNP	0.986	A
RBM4	5936	genome.wustl.edu	37	11	66413571	66413571	+	3'UTR	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:66413571C>T	ENST00000409406.1	+	0	1954				RBM4_ENST00000515838.2_3'UTR|RBM4_ENST00000530235.1_3'UTR|RBM4_ENST00000506523.2_Intron|RBM4_ENST00000514361.3_3'UTR|RBM4_ENST00000310092.7_3'UTR|RBM14-RBM4_ENST00000412278.2_3'UTR|RBM4_ENST00000396053.4_Intron|RBM4_ENST00000578778.1_Intron|RBM4_ENST00000408993.2_3'UTR|RBM4_ENST00000398692.4_3'UTR|RBM14-RBM4_ENST00000500635.2_3'UTR			Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4						cap-independent translational initiation (GO:0002190)|cell differentiation (GO:0030154)|circadian regulation of translation (GO:0097167)|entrainment of circadian clock by photoperiod (GO:0043153)|IRES-dependent translational initiation (GO:0002192)|mRNA processing (GO:0006397)|negative regulation of translation (GO:0017148)|negative regulation of translation in response to stress (GO:0032055)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of nucleocytoplasmic transport (GO:0046822)|response to arsenic-containing substance (GO:0046685)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|stress-activated MAPK cascade (GO:0051403)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	miRNA binding (GO:0035198)|mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|pre-mRNA intronic pyrimidine-rich binding (GO:0097158)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)		ACCCCATCTCCGGGACGTTCT	0.517																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U89505	CCDS41676.1, CCDS55776.1, CCDS55777.1	11q13	2013-02-12			ENSG00000173933	ENSG00000173933		"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	9901	protein-coding gene	gene with protein product		602571				9169144, 16260624	Standard	NM_002896		Approved	LARK, RBM4A, ZCRB3A, ZCCHC21		Q9BWF3	OTTHUMG00000154171	ENST00000409406.1:c.*82C>T	11.37:g.66413571C>T			B3KUN0|B4E1U0|E7EQS3|O02916|Q4VC48|Q6P1P2|Q8WU85	RNA	SNP	-	NULL	ENST00000409406.1	37	NULL	CCDS41676.1	11																																																																																			RBM4	-	-	ENSG00000173933		0.517	RBM4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RBM4	HGNC	protein_coding	OTTHUMT00000334212.1	-	0.00	86	0	C	NM_002896		66413571	+1	tier1	-	no_errors	ENST00000515838	ensembl	human	putative	74_37	rna	45.30	64	53	SNP	1.000	T
RIMKLA	284716	genome.wustl.edu	37	1	42875740	42875740	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:42875740G>T	ENST00000431473.3	+	4	696	c.567G>T	c.(565-567)caG>caT	p.Q189H		NM_173642.3	NP_775913.2	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family member A	189	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)			NS(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	13						ACCTGTTCCAGAAGTACGTGA	0.512																																																	0													166.0	160.0	162.0					1																	42875740		2203	4300	6503	SO:0001583	missense	0			BC039737	CCDS466.2	1p34.2	2011-09-21	2008-10-13	2008-10-13	ENSG00000177181	ENSG00000177181	6.3.2.N6		28725	protein-coding gene	gene with protein product	"""N-acetylaspartylglutamate synthetase II"""		"""family with sequence similarity 80, member A"""	FAM80A		20657015, 21454531	Standard	NM_173642		Approved	MGC47816, RP11-157D18.1, NAAGS-II	uc001chi.2	Q8IXN7	OTTHUMG00000007335	ENST00000431473.3:c.567G>T	1.37:g.42875740G>T	ENSP00000414330:p.Gln189His		Q5VUS5	Missense_Mutation	SNP	pfam_ATP-grasp_RimK-type,pfam_GSHS_ATP-bd,pfam_ATP-grasp_DUF201-type,pfscan_ATP-grasp,tigrfam_RpS6_RimK/Lys_biosynth_LsyX	p.Q189H	ENST00000431473.3	37	c.567	CCDS466.2	1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.787680	0.90367	.	.	ENSG00000177181	ENST00000410070;ENST00000431473	.	.	.	5.45	5.45	0.79879	ATP-grasp fold (1);ATP-grasp fold, RimK-type (1);ATP-grasp fold, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.86506	0.5949	M	0.93420	3.415	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89852	0.4010	9	0.87932	D	0	-13.2234	16.7969	0.85604	0.0:0.0:1.0:0.0	.	189	Q8IXN7	RIMKA_HUMAN	H	65;189	.	ENSP00000387064:Q65H	Q	+	3	2	RIMKLA	42648327	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.058000	0.64300	2.552000	0.86080	0.650000	0.86243	CAG	RIMKLA	-	pfam_ATP-grasp_RimK-type,pfam_GSHS_ATP-bd,pfam_ATP-grasp_DUF201-type,pfscan_ATP-grasp,tigrfam_RpS6_RimK/Lys_biosynth_LsyX	ENSG00000177181		0.512	RIMKLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMKLA	HGNC	protein_coding	OTTHUMT00000019174.3	-	0.00	65	0	G	NM_173642		42875740	+1	tier1	-	no_errors	ENST00000431473	ensembl	human	known	74_37	missense	9.38	58	6	SNP	1.000	T
RNF213	57674	genome.wustl.edu	37	17	78363879	78363879	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr17:78363879G>T	ENST00000582970.1	+	67	15496	c.15353G>T	c.(15352-15354)aGc>aTc	p.S5118I	CTD-2047H16.4_ENST00000572151.1_RNA|CTD-2047H16.4_ENST00000573394.1_RNA|RNF213_ENST00000427003.3_3'UTR|CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000336301.6_Missense_Mutation_p.S3191I|RNF213_ENST00000508628.2_Missense_Mutation_p.S5167I	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	5118					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			AAGCTCCTCAGCACATTCCTA	0.473																																																	0													101.0	107.0	105.0					17																	78363879		2203	4300	6503	SO:0001583	missense	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.15353G>T	17.37:g.78363879G>T	ENSP00000464087:p.Ser5118Ile		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.S5118I	ENST00000582970.1	37	c.15353	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	G	11.43	1.636517	0.29068	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301;ENST00000427003	T	0.23348	1.91	5.67	2.1	0.27182	.	0.463570	0.24305	N	0.039690	T	0.18800	0.0451	L	0.60455	1.87	0.09310	N	1	P;B	0.35656	0.514;0.067	B;B	0.32090	0.14;0.02	T	0.11842	-1.0571	10	0.35671	T	0.21	.	3.4515	0.07499	0.4524:0.204:0.3436:0.0	.	5118;3191	D6RI12;Q63HN8	.;RN213_HUMAN	I	5118;5167;3191;468	ENSP00000338218:S3191I	ENSP00000338218:S3191I	S	+	2	0	RNF213	75978474	0.000000	0.05858	0.001000	0.08648	0.786000	0.44442	0.169000	0.16641	0.663000	0.31027	0.655000	0.94253	AGC	RNF213	-	NULL	ENSG00000173821		0.473	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1		0.00	45	0	G	NM_020914		78363879	+1			no_errors	ENST00000582970	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.008	T
RP1	6101	genome.wustl.edu	37	8	55540273	55540273	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr8:55540273T>G	ENST00000220676.1	+	4	3979	c.3831T>G	c.(3829-3831)agT>agG	p.S1277R		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1277					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GTAACCCCAGTGACACTTTTT	0.418																																					Colon(91;1014 1389 7634 14542 40420)												0													155.0	152.0	153.0					8																	55540273		2203	4300	6503	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.3831T>G	8.37:g.55540273T>G	ENSP00000220676:p.Ser1277Arg			Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.S1277R	ENST00000220676.1	37	c.3831	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	T	5.316	0.243590	0.10077	.	.	ENSG00000104237	ENST00000220676	T	0.25414	1.8	5.38	-4.12	0.03916	.	0.926684	0.09173	N	0.838552	T	0.14527	0.0351	L	0.32530	0.975	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.33854	-0.9852	10	0.72032	D	0.01	.	2.1525	0.03803	0.1268:0.1573:0.3908:0.3251	.	1277	P56715	RP1_HUMAN	R	1277	ENSP00000220676:S1277R	ENSP00000220676:S1277R	S	+	3	2	RP1	55702826	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.467000	0.06664	-0.633000	0.05545	0.533000	0.62120	AGT	RP1	-	NULL	ENSG00000104237		0.418	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	-	0.00	102	0	T	NM_006269		55540273	+1	tier1	-	no_errors	ENST00000220676	ensembl	human	known	74_37	missense	36.46	61	35	SNP	0.000	G
RTN4	57142	genome.wustl.edu	37	2	55199859	55199859	+	3'UTR	SNP	A	A	G	rs552242458		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:55199859A>G	ENST00000337526.6	-	0	4255				RTN4_ENST00000404909.1_3'UTR|RTN4_ENST00000317610.7_3'UTR|RTN4_ENST00000405240.1_3'UTR|RTN4_ENST00000486085.1_5'UTR|RTN4_ENST00000357376.3_3'UTR|RTN4_ENST00000357732.4_3'UTR|RTN4_ENST00000394611.2_3'UTR|RTN4_ENST00000394609.2_3'UTR	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						GATCTCGTCTAAACAAACATT	0.348																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.*433T>C	2.37:g.55199859A>G			O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	RNA	SNP	-	NULL	ENST00000337526.6	37	NULL	CCDS42684.1	2																																																																																			RTN4	-	-	ENSG00000115310		0.348	RTN4-001	KNOWN	basic|CCDS	protein_coding	RTN4	HGNC	protein_coding	OTTHUMT00000251484.1	-	0.00	16	0	A			55199859	-1	tier1	-	no_errors	ENST00000486085	ensembl	human	known	74_37	rna	94.74	1	18	SNP	1.000	G
RYR1	6261	genome.wustl.edu	37	19	38946168	38946168	+	Missense_Mutation	SNP	C	C	T	rs193922770		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:38946168C>T	ENST00000359596.3	+	15	1654	c.1654C>T	c.(1654-1656)Cgg>Tgg	p.R552W	RYR1_ENST00000355481.4_Missense_Mutation_p.R552W|RYR1_ENST00000360985.3_Missense_Mutation_p.R552W			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	552			R -> W (in MHS1). {ECO:0000269|PubMed:16163667, ECO:0000269|PubMed:9138151}.		calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CAAGCTGGATCGGCTGGAGGC	0.602																																																	0			GRCh37	CM971325	RYR1	M							75.0	69.0	71.0					19																	38946168		2203	4300	6503	SO:0001583	missense	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.1654C>T	19.37:g.38946168C>T	ENSP00000352608:p.Arg552Trp		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.R552W	ENST00000359596.3	37	c.1654	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	C	14.15	2.448136	0.43429	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.95656	-3.77;-3.77;-3.77	4.01	2.94	0.34122	Intracellular calcium-release channel (1);	0.000000	0.64402	U	0.000004	D	0.96917	0.8993	M	0.76002	2.32	0.44843	D	0.997851	D;D	0.89917	1.0;0.995	D;D	0.91635	0.999;0.957	D	0.96215	0.9156	10	0.56958	D	0.05	.	10.9388	0.47262	0.4619:0.5381:0.0:0.0	.	552;552	P21817-2;P21817	.;RYR1_HUMAN	W	552	ENSP00000352608:R552W;ENSP00000347667:R552W;ENSP00000354254:R552W	ENSP00000347667:R552W	R	+	1	2	RYR1	43638008	0.184000	0.23200	1.000000	0.80357	0.984000	0.73092	0.799000	0.27028	0.845000	0.35118	0.407000	0.27541	CGG	RYR1	-	pfam_Ca-rel_channel	ENSG00000196218		0.602	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	-	0.00	70	0	C			38946168	+1	tier1	rs193922770	no_errors	ENST00000359596	ensembl	human	known	74_37	missense	16.90	59	12	SNP	1.000	T
SALL1	6299	genome.wustl.edu	37	16	51174681	51174681	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr16:51174681G>T	ENST00000251020.4	-	2	1485	c.1452C>A	c.(1450-1452)aaC>aaA	p.N484K	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.N387K|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	484					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TGGAGAACCTGTTCCCGCAGA	0.527																																					GBM(103;1352 1446 1855 4775 8890)												0													99.0	97.0	98.0					16																	51174681		2198	4300	6498	SO:0001583	missense	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1452C>A	16.37:g.51174681G>T	ENSP00000251020:p.Asn484Lys		Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N484K	ENST00000251020.4	37	c.1452	CCDS10747.1	16	.	.	.	.	.	.	.	.	.	.	G	16.70	3.195191	0.58017	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.10382	2.88;2.88	5.29	4.32	0.51571	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.04092	0.0114	N	0.00023	-2.715	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.56372	-0.7990	10	0.02654	T	1	.	14.1704	0.65506	0.0733:0.0:0.9267:0.0	.	484	Q9NSC2	SALL1_HUMAN	K	484;387;448	ENSP00000251020:N484K;ENSP00000407914:N387K	ENSP00000251020:N484K	N	-	3	2	SALL1	49732182	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.968000	0.63728	2.458000	0.83093	0.563000	0.77884	AAC	SALL1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000103449		0.527	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	HGNC	protein_coding	OTTHUMT00000256883.2	-	0.00	30	0	G	NM_002968		51174681	-1	tier1	-	no_errors	ENST00000251020	ensembl	human	known	74_37	missense	81.48	5	22	SNP	1.000	T
SCAP	22937	genome.wustl.edu	37	3	47467561	47467561	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr3:47467561T>A	ENST00000265565.5	-	7	1248	c.836A>T	c.(835-837)gAg>gTg	p.E279V	SCAP_ENST00000441517.2_Missense_Mutation_p.E24V|SCAP_ENST00000545718.1_Intron	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	279					aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		GACACCAATCTCCTCCTTGAA	0.602																																					Pancreas(149;978 1908 29304 37806 46700)												0													179.0	144.0	156.0					3																	47467561		2203	4300	6503	SO:0001583	missense	0			BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.836A>T	3.37:g.47467561T>A	ENSP00000265565:p.Glu279Val		Q8N2E0|Q8WUA1	Missense_Mutation	SNP	pfam_Patched,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_SSD,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E279V	ENST00000265565.5	37	c.836	CCDS2755.2	3	.	.	.	.	.	.	.	.	.	.	T	34	5.338592	0.95783	.	.	ENSG00000114650	ENST00000339815;ENST00000265565;ENST00000441517	D;D	0.82619	-1.63;-1.54	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.90232	0.6946	M	0.73962	2.25	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.924;0.978	D	0.91532	0.5243	10	0.87932	D	0	-29.4961	14.9004	0.70675	0.0:0.0:0.0:1.0	.	24;279	F8W921;Q12770	.;SCAP_HUMAN	V	279;279;24	ENSP00000265565:E279V;ENSP00000416847:E24V	ENSP00000265565:E279V	E	-	2	0	SCAP	47442565	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.670000	0.83925	2.108000	0.64289	0.528000	0.53228	GAG	SCAP	-	NULL	ENSG00000114650		0.602	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAP	HGNC	protein_coding	OTTHUMT00000246872.2	-	0.00	50	0	T	NM_012235		47467561	-1	tier1	-	no_errors	ENST00000265565	ensembl	human	known	74_37	missense	68.75	10	22	SNP	1.000	A
SCN2A	6326	genome.wustl.edu	37	2	166245328	166245328	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:166245328T>C	ENST00000375437.2	+	27	5302	c.5012T>C	c.(5011-5013)aTg>aCg	p.M1671T	SCN2A_ENST00000283256.6_Missense_Mutation_p.M1671T|SCN2A_ENST00000357398.3_Missense_Mutation_p.M1671T|SCN2A_ENST00000375427.2_Missense_Mutation_p.M1671T	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1671					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTCCTGGTCATGTTCATCTAC	0.473																																																	0													184.0	173.0	177.0					2																	166245328		2203	4300	6503	SO:0001583	missense	0			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.5012T>C	2.37:g.166245328T>C	ENSP00000364586:p.Met1671Thr		A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.M1671T	ENST00000375437.2	37	c.5012	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	T	15.98	2.992545	0.54041	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.98474	-4.95;-4.95;-4.95;-4.95	5.38	5.38	0.77491	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99105	0.9692	M	0.91038	3.17	0.80722	D	1	D;P	0.76494	0.999;0.862	D;P	0.73708	0.981;0.566	D	0.99486	1.0949	10	0.87932	D	0	.	15.7225	0.77724	0.0:0.0:0.0:1.0	.	1671;1671	Q99250-2;Q99250	.;SCN2A_HUMAN	T	1671	ENSP00000364586:M1671T;ENSP00000349973:M1671T;ENSP00000283256:M1671T;ENSP00000364576:M1671T	ENSP00000283256:M1671T	M	+	2	0	SCN2A	165953574	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.994000	0.88315	2.173000	0.68751	0.451000	0.29950	ATG	SCN2A	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000136531		0.473	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	-	0.00	144	0	T	NM_021007		166245328	+1	tier1	-	no_errors	ENST00000283256	ensembl	human	known	74_37	missense	35.71	90	50	SNP	1.000	C
SCN3B	55800	genome.wustl.edu	37	11	123513207	123513207	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:123513207T>A	ENST00000392770.2	-	3	1194	c.392A>T	c.(391-393)cAt>cTt	p.H131L	SCN3B_ENST00000299333.3_Missense_Mutation_p.H131L|SCN3B_ENST00000530277.1_Missense_Mutation_p.H131L	NM_018400.3	NP_060870.1	Q9NY72	SCN3B_HUMAN	sodium channel, voltage-gated, type III, beta subunit	131	Ig-like C2-type.				atrial cardiac muscle cell action potential (GO:0086014)|axon guidance (GO:0007411)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of heart rate (GO:0010460)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|ventricular cardiac muscle cell action potential (GO:0086005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|skin(2)	26		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)	Valproic Acid(DB00313)|Zonisamide(DB00909)	AAAGGGCCGATGCGCCTCAAA	0.592																																																	0													96.0	87.0	90.0					11																	123513207		2202	4299	6501	SO:0001583	missense	0			AJ243396	CCDS8442.1	11q24.1	2014-09-17	2012-02-28		ENSG00000166257	ENSG00000166257		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	20665	protein-coding gene	gene with protein product		608214	"""sodium channel, voltage-gated, type III, beta"""			10688874	Standard	XR_428980		Approved	HSA243396	uc001pzb.1	Q9NY72	OTTHUMG00000166006	ENST00000392770.2:c.392A>T	11.37:g.123513207T>A	ENSP00000376523:p.His131Leu		A5H1I5|Q17RL3|Q9ULR2	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	p.H131L	ENST00000392770.2	37	c.392	CCDS8442.1	11	.	.	.	.	.	.	.	.	.	.	T	19.90	3.913641	0.72983	.	.	ENSG00000166257	ENST00000392770;ENST00000299333;ENST00000530277;ENST00000527836	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	6.03	6.03	0.97812	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.189308	0.56097	D	0.000022	T	0.60340	0.2261	L	0.47716	1.5	0.52099	D	0.999948	P	0.34462	0.454	B	0.37780	0.258	T	0.58792	-0.7574	10	0.37606	T	0.19	-18.4243	16.5655	0.84588	0.0:0.0:0.0:1.0	.	131	Q9NY72	SCN3B_HUMAN	L	131	ENSP00000376523:H131L;ENSP00000299333:H131L;ENSP00000432785:H131L;ENSP00000435554:H131L	ENSP00000299333:H131L	H	-	2	0	SCN3B	123018417	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.093000	0.50217	2.302000	0.77476	0.533000	0.62120	CAT	SCN3B	-	pfam_Ig_V-set,smart_Ig_sub	ENSG00000166257		0.592	SCN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN3B	HGNC	protein_coding	OTTHUMT00000387412.1	-	0.00	54	0	T	NM_018400		123513207	-1	tier1	-	no_errors	ENST00000299333	ensembl	human	known	74_37	missense	40.62	38	26	SNP	1.000	A
SEL1L3	23231	genome.wustl.edu	37	4	25783966	25783968	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	CTT	CTT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr4:25783966_25783968delCTT	ENST00000399878.3	-	15	2475_2477	c.2353_2355delAAG	c.(2353-2355)aagdel	p.K785del	SEL1L3_ENST00000502949.1_In_Frame_Del_p.K632del|SEL1L3_ENST00000264868.5_In_Frame_Del_p.K750del	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	785						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						TTAACCAGTACTTTGCTGCTTTG	0.429																																																	0																																										SO:0001651	inframe_deletion	0			BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.2353_2355delAAG	4.37:g.25783966_25783968delCTT	ENSP00000382767:p.Lys785del		A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	In_Frame_Del	DEL	pfam_Sel1-like,superfamily_ConA-like_lec_gl_sf,smart_Sel1-like	p.K785in_frame_del	ENST00000399878.3	37	c.2355_2353	CCDS47037.1	4																																																																																			SEL1L3	-	pfam_Sel1-like,smart_Sel1-like	ENSG00000091490		0.429	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEL1L3	HGNC	protein_coding	OTTHUMT00000360261.1		0.00	78	0	CTT	NM_015187		25783968	-1	tier1		no_errors	ENST00000399878	ensembl	human	known	74_37	in_frame_del	64.71	12	22	DEL	0.999:0.999:0.964	-
SEMA5B	54437	genome.wustl.edu	37	3	122632261	122632261	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr3:122632261G>A	ENST00000357599.3	-	17	2677	c.2291C>T	c.(2290-2292)aCg>aTg	p.T764M	SEMA5B_ENST00000195173.4_Missense_Mutation_p.T763M|SEMA5B_ENST00000451055.2_Missense_Mutation_p.T818M	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	764	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GGGGTTGCACGTCTTGAACTC	0.726																																																	0													7.0	9.0	9.0					3																	122632261		2159	4245	6404	SO:0001583	missense	0			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2291C>T	3.37:g.122632261G>A	ENSP00000350215:p.Thr764Met		A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.T818M	ENST00000357599.3	37	c.2453	CCDS35491.1	3	.	.	.	.	.	.	.	.	.	.	G	19.47	3.834620	0.71373	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	4.21	4.21	0.49690	.	0.237508	0.42682	D	0.000667	T	0.57021	0.2025	L	0.38838	1.175	0.51767	D	0.999937	D;D;D	0.76494	0.999;0.999;0.999	P;D;D	0.66716	0.852;0.946;0.946	T	0.57860	-0.7738	10	0.44086	T	0.13	.	15.7333	0.77822	0.0:0.0:1.0:0.0	.	706;764;764	D3YTI7;B5ME80;Q9P283	.;.;SEM5B_HUMAN	M	764;763;706;818;764	ENSP00000350215:T764M;ENSP00000195173:T763M;ENSP00000389588:T818M;ENSP00000377208:T764M	ENSP00000195173:T763M	T	-	2	0	SEMA5B	124114951	1.000000	0.71417	0.971000	0.41717	0.642000	0.38348	9.501000	0.97979	2.182000	0.69389	0.561000	0.74099	ACG	SEMA5B	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000082684		0.726	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	SEMA5B	HGNC	protein_coding	OTTHUMT00000277165.1	-	0.00	19	0	G	NM_001031702		122632261	-1	tier1	-	no_errors	ENST00000451055	ensembl	human	known	74_37	missense	37.50	5	3	SNP	0.999	A
SF3B2	10992	genome.wustl.edu	37	11	65824803	65824803	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:65824803G>A	ENST00000322535.6	+	7	783	c.734G>A	c.(733-735)cGg>cAg	p.R245Q	SF3B2_ENST00000528302.1_Missense_Mutation_p.R228Q	NM_006842.2	NP_006833.2	Q13435	SF3B2_HUMAN	splicing factor 3b, subunit 2, 145kDa	245					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	41						CCTGTTCCCCGGCCTCGTGGT	0.542																																																	0													64.0	79.0	74.0					11																	65824803		2199	4294	6493	SO:0001583	missense	0			U41371	CCDS31612.1	11q13	2010-07-21	2002-08-29		ENSG00000087365	ENSG00000087365			10769	protein-coding gene	gene with protein product		605591	"""splicing factor 3b, subunit 2, 145kD"""			8566756	Standard	XM_005273726		Approved	SAP145, SF3b1, Cus1, SF3b145	uc001ogy.1	Q13435	OTTHUMG00000166751	ENST00000322535.6:c.734G>A	11.37:g.65824803G>A	ENSP00000318861:p.Arg245Gln		A8K485|B4DT19|Q7L4T5|Q7Z627|Q969K1|Q96CM6|Q9BWD2	Missense_Mutation	SNP	pfam_DUF382,pfam_PSP,pfam_SAP_dom,smart_SAP_dom,smart_PSP,pfscan_SAP_dom	p.R245Q	ENST00000322535.6	37	c.734	CCDS31612.1	11	.	.	.	.	.	.	.	.	.	.	G	17.88	3.497616	0.64186	.	.	ENSG00000087365	ENST00000528302;ENST00000322535;ENST00000533595;ENST00000524627;ENST00000530322	.	.	.	5.31	5.31	0.75309	.	0.224693	0.46758	D	0.000274	T	0.25382	0.0617	N	0.14661	0.345	0.32340	N	0.559922	P	0.48640	0.913	B	0.33799	0.17	T	0.41520	-0.9504	9	0.72032	D	0.01	-10.5252	16.8205	0.85744	0.0:0.0:1.0:0.0	.	245	Q13435	SF3B2_HUMAN	Q	228;245;243;244;239	.	ENSP00000318861:R245Q	R	+	2	0	SF3B2	65581379	0.982000	0.34865	0.964000	0.40570	0.993000	0.82548	4.791000	0.62460	2.643000	0.89663	0.650000	0.86243	CGG	SF3B2	-	NULL	ENSG00000087365		0.542	SF3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B2	HGNC	protein_coding	OTTHUMT00000391352.2	-	0.00	55	0	G			65824803	+1	tier1	-	no_errors	ENST00000322535	ensembl	human	known	74_37	missense	39.53	25	17	SNP	0.645	A
SFMBT2	57713	genome.wustl.edu	37	10	7218087	7218087	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr10:7218087G>A	ENST00000361972.4	-	17	1939	c.1849C>T	c.(1849-1851)Cgg>Tgg	p.R617W	SFMBT2_ENST00000397167.1_Missense_Mutation_p.R617W	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	617					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.R617G(1)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						TCAGATGTCCGTACGATTTTG	0.468																																																	1	Substitution - Missense(1)	breast(1)											108.0	107.0	107.0					10																	7218087		2203	4300	6503	SO:0001583	missense	0			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1849C>T	10.37:g.7218087G>A	ENSP00000355109:p.Arg617Trp		A7MD09|Q9HCF5	Missense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,superfamily_ARM-type_fold,smart_Mbt,smart_SAM,pfscan_Mbt	p.R617W	ENST00000361972.4	37	c.1849	CCDS31138.1	10	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648095	0.67358	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.47528	0.84;0.84	5.96	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.68522	0.3010	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72868	-0.4162	10	0.72032	D	0.01	.	16.3303	0.83006	0.0:0.0:0.8669:0.1331	.	617	Q5VUG0	SMBT2_HUMAN	W	617	ENSP00000355109:R617W;ENSP00000380353:R617W	ENSP00000355109:R617W	R	-	1	2	SFMBT2	7258093	1.000000	0.71417	0.041000	0.18516	0.283000	0.27025	5.140000	0.64807	1.468000	0.48064	0.655000	0.94253	CGG	SFMBT2	-	pfam_DUF3588	ENSG00000198879		0.468	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT2	HGNC	protein_coding	OTTHUMT00000046673.1		0.00	62	0	G	NM_001029880		7218087	-1			no_errors	ENST00000361972	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.998	A
SIRPG	55423	genome.wustl.edu	37	20	1615969	1615969	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr20:1615969C>T	ENST00000303415.3	-	4	1089	c.1025G>A	c.(1024-1026)cGc>cAc	p.R342H	SIRPG_ENST00000381583.2_Intron|SIRPG_ENST00000344103.4_Intron|RP11-77C3.3_ENST00000437384.1_RNA|SIRPG_ENST00000381580.1_Missense_Mutation_p.R309H|SIRPG_ENST00000216927.4_Intron|RP11-77C3.3_ENST00000456177.1_RNA	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	342					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						TAGGGCAAGGCGTTTGCTGAC	0.493																																																	0													102.0	85.0	91.0					20																	1615969		2203	4300	6503	SO:0001583	missense	0			AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.1025G>A	20.37:g.1615969C>T	ENSP00000305529:p.Arg342His		B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_C1-set,pfscan_Ig-like_dom	p.R342H	ENST00000303415.3	37	c.1025	CCDS13020.2	20	.	.	.	.	.	.	.	.	.	.	.	7.077	0.569474	0.13560	.	.	ENSG00000089012	ENST00000381580;ENST00000303415	T;T	0.11930	3.14;2.73	1.6	0.301	0.15781	Immunoglobulin-like fold (1);	1.836230	0.02430	N	0.083472	T	0.07683	0.0193	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.32534	-0.9903	10	0.59425	D	0.04	.	3.2624	0.06853	0.0:0.463:0.0:0.537	.	342	Q9P1W8	SIRPG_HUMAN	H	309;342	ENSP00000370992:R309H;ENSP00000305529:R342H	ENSP00000305529:R342H	R	-	2	0	SIRPG	1563969	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.485000	0.02314	0.058000	0.16222	0.195000	0.17529	CGC	SIRPG	-	smart_Ig_sub	ENSG00000089012		0.493	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRPG	HGNC	protein_coding	OTTHUMT00000077566.2	-	0.00	106	0	C	NM_018556		1615969	-1	tier1	-	no_errors	ENST00000303415	ensembl	human	known	74_37	missense	40.00	63	42	SNP	0.000	T
SKIV2L2	23517	genome.wustl.edu	37	5	54710013	54710013	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr5:54710013A>G	ENST00000230640.5	+	24	3009	c.2755A>G	c.(2755-2757)Agt>Ggt	p.S919G	SKIV2L2_ENST00000545714.1_Missense_Mutation_p.S818G	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	919					maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				TTTATAGTCTAGTGAGATGCC	0.299																																					Melanoma(2;92 134 23744 29976 33782)												0													136.0	136.0	136.0					5																	54710013		2203	4300	6503	SO:0001583	missense	0			D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.2755A>G	5.37:g.54710013A>G	ENSP00000230640:p.Ser919Gly		Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	pfam_DSH_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pirsf_RNA_helicase_ATP-dep_SK12/DOB1,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S919G	ENST00000230640.5	37	c.2755	CCDS3967.1	5	.	.	.	.	.	.	.	.	.	.	A	15.46	2.839017	0.51057	.	.	ENSG00000039123	ENST00000230640;ENST00000545714	T;T	0.22539	1.95;1.95	5.42	5.42	0.78866	DSH, C-terminal (1);	0.245688	0.47455	D	0.000223	T	0.18841	0.0452	L	0.33093	0.98	0.58432	D	0.999994	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.003	T	0.02150	-1.1205	10	0.40728	T	0.16	-31.3837	15.7467	0.77949	1.0:0.0:0.0:0.0	.	818;919	F5H7E2;P42285	.;SK2L2_HUMAN	G	919;818	ENSP00000230640:S919G;ENSP00000442583:S818G	ENSP00000230640:S919G	S	+	1	0	SKIV2L2	54745770	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.690000	0.91272	2.179000	0.69175	0.482000	0.46254	AGT	SKIV2L2	-	pfam_DSH_C,pirsf_RNA_helicase_ATP-dep_SK12/DOB1	ENSG00000039123		0.299	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIV2L2	HGNC	protein_coding	OTTHUMT00000214108.1	-	0.00	87	0	A			54710013	+1	tier1	-	no_errors	ENST00000230640	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	G
SLC14A2	8170	genome.wustl.edu	37	18	43248375	43248375	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr18:43248375G>A	ENST00000255226.6	+	15	2785	c.1969G>A	c.(1969-1971)Gtg>Atg	p.V657M	SLC14A2_ENST00000586448.1_Missense_Mutation_p.V657M|RP11-116O18.3_ENST00000589510.1_RNA|SLC14A2_ENST00000589658.1_Missense_Mutation_p.V134M	NM_007163.3	NP_009094.3	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter), member 2	657					transmembrane transport (GO:0055085)|urea transport (GO:0015840)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|urea transmembrane transporter activity (GO:0015204)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(35)|ovary(1)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GCTGATGGCCGTGTTCTCAGA	0.557																																																	0													199.0	165.0	176.0					18																	43248375		2203	4300	6503	SO:0001583	missense	0			X96969	CCDS11924.1	18q12.1-q21.1	2013-05-22			ENSG00000132874	ENSG00000132874		"""Solute carriers"""	10919	protein-coding gene	gene with protein product		601611				8647271	Standard	NM_007163		Approved	HUT2, UT2	uc010dnj.3	Q15849	OTTHUMG00000132616	ENST00000255226.6:c.1969G>A	18.37:g.43248375G>A	ENSP00000255226:p.Val657Met		A8K8Q7|Q2TBD6|Q96PH5	Missense_Mutation	SNP	pfam_Urea_transporter	p.V657M	ENST00000255226.6	37	c.1969	CCDS11924.1	18	.	.	.	.	.	.	.	.	.	.	G	27.1	4.803356	0.90623	.	.	ENSG00000132874	ENST00000255226	T	0.53206	0.63	4.83	4.83	0.62350	.	0.000000	0.48286	D	0.000189	T	0.77896	0.4199	H	0.94582	3.555	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.84991	0.0894	10	0.87932	D	0	-24.2659	18.1372	0.89623	0.0:0.0:1.0:0.0	.	657	Q15849	UT2_HUMAN	M	657	ENSP00000255226:V657M	ENSP00000255226:V657M	V	+	1	0	SLC14A2	41502373	1.000000	0.71417	0.990000	0.47175	0.969000	0.65631	7.101000	0.76997	2.503000	0.84419	0.563000	0.77884	GTG	SLC14A2	-	pfam_Urea_transporter	ENSG00000132874		0.557	SLC14A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC14A2	HGNC	protein_coding	OTTHUMT00000255858.1	-	0.00	82	0	G			43248375	+1	tier1	-	no_errors	ENST00000255226	ensembl	human	known	74_37	missense	10.00	45	5	SNP	1.000	A
SLC17A6	57084	genome.wustl.edu	37	11	22384351	22384351	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:22384351C>A	ENST00000263160.3	+	6	1165	c.728C>A	c.(727-729)tCt>tAt	p.S243Y	CTD-2140G10.4_ENST00000534543.1_RNA	NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	243					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						ACTGGCTGGTCTTCAGTGTTT	0.403																																																	0													209.0	179.0	189.0					11																	22384351		2203	4300	6503	SO:0001583	missense	0			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.728C>A	11.37:g.22384351C>A	ENSP00000263160:p.Ser243Tyr		A6NKS2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S243Y	ENST00000263160.3	37	c.728	CCDS7856.1	11	.	.	.	.	.	.	.	.	.	.	C	27.8	4.867002	0.91511	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.59083	0.29	5.53	5.53	0.82687	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.69424	0.3109	M	0.78344	2.41	0.80722	D	1	B	0.28760	0.221	B	0.39771	0.309	T	0.70513	-0.4851	10	0.87932	D	0	.	19.8372	0.96661	0.0:1.0:0.0:0.0	.	243	Q9P2U8	VGLU2_HUMAN	Y	243;131	ENSP00000263160:S243Y	ENSP00000263160:S243Y	S	+	2	0	SLC17A6	22340927	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.047000	0.71038	2.770000	0.95276	0.655000	0.94253	TCT	SLC17A6	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000091664		0.403	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	HGNC	protein_coding	OTTHUMT00000387671.1	-	0.00	102	0	C	NM_020346		22384351	+1	tier1	-	no_errors	ENST00000263160	ensembl	human	known	74_37	missense	32.39	48	23	SNP	1.000	A
SLC17A6	57084	genome.wustl.edu	37	11	22384363	22384363	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:22384363A>G	ENST00000263160.3	+	6	1177	c.740A>G	c.(739-741)tAt>tGt	p.Y247C	CTD-2140G10.4_ENST00000534543.1_RNA	NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	247					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						TCAGTGTTTTATGTCTACGGT	0.393																																																	0													182.0	159.0	166.0					11																	22384363		2203	4300	6503	SO:0001583	missense	0			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.740A>G	11.37:g.22384363A>G	ENSP00000263160:p.Tyr247Cys		A6NKS2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.Y247C	ENST00000263160.3	37	c.740	CCDS7856.1	11	.	.	.	.	.	.	.	.	.	.	A	24.2	4.500554	0.85176	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.61158	0.13	5.53	5.53	0.82687	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.85075	0.5614	H	0.98238	4.18	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90754	0.4659	10	0.87932	D	0	.	15.9669	0.79979	1.0:0.0:0.0:0.0	.	247	Q9P2U8	VGLU2_HUMAN	C	247;135	ENSP00000263160:Y247C	ENSP00000263160:Y247C	Y	+	2	0	SLC17A6	22340939	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.287000	0.95975	2.236000	0.73375	0.533000	0.62120	TAT	SLC17A6	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000091664		0.393	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	HGNC	protein_coding	OTTHUMT00000387671.1	-	0.00	103	0	A	NM_020346		22384363	+1	tier1	-	no_errors	ENST00000263160	ensembl	human	known	74_37	missense	31.82	44	21	SNP	1.000	G
SLC26A9	115019	genome.wustl.edu	37	1	205890954	205890954	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:205890954G>C	ENST00000367135.3	-	17	1908	c.1795C>G	c.(1795-1797)Cag>Gag	p.Q599E	SLC26A9_ENST00000340781.4_Missense_Mutation_p.Q599E|SLC26A9_ENST00000367134.2_Missense_Mutation_p.Q599E	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	599	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)			NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			AAGTCCTGCTGCAGCTCCTGC	0.612																																																	0													57.0	49.0	52.0					1																	205890954		2203	4299	6502	SO:0001583	missense	0			AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.1795C>G	1.37:g.205890954G>C	ENSP00000356103:p.Gln599Glu		A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.Q599E	ENST00000367135.3	37	c.1795	CCDS30990.1	1	.	.	.	.	.	.	.	.	.	.	G	7.601	0.672711	0.14776	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.92495	-3.05;-3.01;-3.05	4.43	3.5	0.40072	Sulphate transporter/antisigma-factor antagonist STAS (3);	0.412521	0.25792	N	0.028262	D	0.90861	0.7129	M	0.62723	1.935	0.41790	D	0.989866	P;P	0.48503	0.911;0.911	B;P	0.48770	0.301;0.589	D	0.88558	0.3121	10	0.06891	T	0.86	.	14.0292	0.64604	0.0:0.0:0.8471:0.1529	.	599;599	Q7LBE3;B1AVM8	S26A9_HUMAN;.	E	599	ENSP00000341682:Q599E;ENSP00000356103:Q599E;ENSP00000356102:Q599E	ENSP00000341682:Q599E	Q	-	1	0	SLC26A9	204157577	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	7.631000	0.83237	1.149000	0.42402	-0.182000	0.12963	CAG	SLC26A9	-	pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	ENSG00000174502		0.612	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A9	HGNC	protein_coding	OTTHUMT00000087742.1	-	0.00	44	0	G	NM_052934		205890954	-1	tier1	-	no_errors	ENST00000340781	ensembl	human	known	74_37	missense	15.09	45	8	SNP	1.000	C
SLC28A3	64078	genome.wustl.edu	37	9	86905095	86905095	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr9:86905095C>T	ENST00000376238.4	-	11	1172	c.1123G>A	c.(1123-1125)Gtg>Atg	p.V375M	RP11-380F14.2_ENST00000419815.1_RNA|SLC28A3_ENST00000537648.1_Missense_Mutation_p.V306M	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	375					pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)			endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	GCACCTAGCACGCTTCCAGCA	0.423																																					Ovarian(106;425 1539 34835 42413 43572)												0													112.0	105.0	107.0					9																	86905095		2203	4300	6503	SO:0001583	missense	0			AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.1123G>A	9.37:g.86905095C>T	ENSP00000365413:p.Val375Met		A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Missense_Mutation	SNP	pfam_Nucleos_tra2_C,pfam_Nuclsd_transpt2,pfam_Nucleoside_recog_Gate,tigrfam_C_nuclsd_transpt_met_bac	p.V375M	ENST00000376238.4	37	c.1123	CCDS6670.1	9	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046206	0.75846	.	.	ENSG00000197506	ENST00000376238;ENST00000537648	T;T	0.32272	1.46;1.46	5.82	3.98	0.46160	Nucleoside recognition (1);	0.120277	0.56097	D	0.000025	T	0.49474	0.1559	M	0.66297	2.02	0.54753	D	0.999981	D	0.65815	0.995	D	0.65684	0.937	T	0.47837	-0.9086	10	0.59425	D	0.04	-29.8803	11.1163	0.48262	0.129:0.8047:0.0:0.0663	.	375	Q9HAS3	S28A3_HUMAN	M	375;306	ENSP00000365413:V375M;ENSP00000446438:V306M	ENSP00000365413:V375M	V	-	1	0	SLC28A3	86094915	1.000000	0.71417	0.051000	0.19133	0.903000	0.53119	4.832000	0.62759	0.803000	0.34113	0.563000	0.77884	GTG	SLC28A3	-	pfam_Nucleoside_recog_Gate,tigrfam_C_nuclsd_transpt_met_bac	ENSG00000197506		0.423	SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC28A3	HGNC	protein_coding	OTTHUMT00000052874.1	-	0.00	81	0	C	NM_022127		86905095	-1	tier1	-	no_errors	ENST00000376238	ensembl	human	known	74_37	missense	42.03	40	29	SNP	0.998	T
SLC35F5	80255	genome.wustl.edu	37	2	114475412	114475412	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:114475412G>C	ENST00000245680.2	-	15	1925	c.1512C>G	c.(1510-1512)agC>agG	p.S504R	SLC35F5_ENST00000470204.2_5'UTR	NM_025181.2	NP_079457.2	Q8WV83	S35F5_HUMAN	solute carrier family 35, member F5	504					transport (GO:0006810)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|ovary(2)|prostate(3)|skin(1)	20						CACACTGTTCGCTGTCTTCTG	0.418																																																	0													110.0	100.0	103.0					2																	114475412		2203	4300	6503	SO:0001583	missense	0			AF529364	CCDS2119.1	2q14.1	2013-05-22			ENSG00000115084	ENSG00000115084		"""Solute carriers"""	23617	protein-coding gene	gene with protein product							Standard	XM_005263799		Approved	FLJ22004	uc002tku.1	Q8WV83	OTTHUMG00000131361	ENST00000245680.2:c.1512C>G	2.37:g.114475412G>C	ENSP00000245680:p.Ser504Arg		Q9H6P8|Q9H7D8	Missense_Mutation	SNP	pfam_DMT	p.S504R	ENST00000245680.2	37	c.1512	CCDS2119.1	2	.	.	.	.	.	.	.	.	.	.	G	10.75	1.439434	0.25900	.	.	ENSG00000115084	ENST00000245680;ENST00000409106;ENST00000420066	T;T	0.45668	0.89;0.89	4.74	-0.489	0.12052	.	0.162143	0.53938	D	0.000060	T	0.25606	0.0623	L	0.29908	0.895	0.80722	D	1	P	0.46621	0.881	B	0.39738	0.308	T	0.02625	-1.1132	10	0.36615	T	0.2	-13.0643	9.0303	0.36254	0.742:0.0:0.258:0.0	.	504	Q8WV83	S35F5_HUMAN	R	504;498;35	ENSP00000245680:S504R;ENSP00000386754:S498R	ENSP00000245680:S504R	S	-	3	2	SLC35F5	114191882	0.983000	0.35010	0.997000	0.53966	0.998000	0.95712	0.294000	0.19047	-0.229000	0.09854	0.591000	0.81541	AGC	SLC35F5	-	NULL	ENSG00000115084		0.418	SLC35F5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35F5	HGNC	protein_coding	OTTHUMT00000254150.1	-	0.00	30	0	G	NM_025181		114475412	-1	tier1	-	no_errors	ENST00000245680	ensembl	human	known	74_37	missense	42.42	19	14	SNP	0.998	C
SMAD4	4089	genome.wustl.edu	37	18	48591919	48591919	+	Missense_Mutation	SNP	G	G	A	rs377767347		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr18:48591919G>A	ENST00000342988.3	+	9	1620	c.1082G>A	c.(1081-1083)cGc>cAc	p.R361H	SMAD4_ENST00000588745.1_Missense_Mutation_p.R265H|SMAD4_ENST00000398417.2_Missense_Mutation_p.R361H	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	361	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.		R -> C (in JPS; dbSNP:rs80338963). {ECO:0000269|PubMed:9811934}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.R361H(12)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GGAGGAGATCGCTTTTGTTTG	0.413																																																	50	Whole gene deletion(36)|Substitution - Missense(12)|Unknown(2)	pancreas(26)|large_intestine(13)|lung(3)|breast(3)|upper_aerodigestive_tract(2)|stomach(2)|oesophagus(1)	GRCh37	CM004254	SMAD4	M							167.0	138.0	148.0					18																	48591919		2203	4300	6503	SO:0001583	missense	0			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1082G>A	18.37:g.48591919G>A	ENSP00000341551:p.Arg361His		A8K405	Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.R361H	ENST00000342988.3	37	c.1082	CCDS11950.1	18	.	.	.	.	.	.	.	.	.	.	G	35	5.477304	0.96291	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.98120	-4.73;-4.73	5.86	5.86	0.93980	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98852	0.9612	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99741	1.1015	10	0.87932	D	0	.	18.9646	0.92691	0.0:0.0:1.0:0.0	.	361	Q13485	SMAD4_HUMAN	H	361	ENSP00000341551:R361H;ENSP00000381452:R361H	ENSP00000341551:R361H	R	+	2	0	SMAD4	46845917	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.828000	0.86729	2.771000	0.95319	0.563000	0.77884	CGC	SMAD4	-	pfam_SMAD_dom_Dwarfin-type,superfamily_SMAD_FHA_domain,smart_SMAD_dom_Dwarfin-type,pfscan_SMAD_dom_Dwarfin-type	ENSG00000141646		0.413	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD4	HGNC	protein_coding	OTTHUMT00000255993.3	-	0.00	87	0	G	NM_005359		48591919	+1	tier1	-	no_errors	ENST00000342988	ensembl	human	known	74_37	missense	76.60	11	36	SNP	1.000	A
SMO	6608	genome.wustl.edu	37	7	128845505	128845505	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr7:128845505T>C	ENST00000249373.3	+	4	1082	c.802T>C	c.(802-804)Ttc>Ctc	p.F268L		NM_005631.4	NP_005622.1	Q99835	SMO_HUMAN	smoothened, frizzled class receptor	268					adenohypophysis development (GO:0021984)|anterior/posterior pattern specification (GO:0009952)|atrial septum morphogenesis (GO:0060413)|axon extension involved in axon guidance (GO:0048846)|canonical Wnt signaling pathway (GO:0060070)|cardioblast differentiation (GO:0010002)|cell fate specification (GO:0001708)|cellular response to cholesterol (GO:0071397)|central nervous system neuron differentiation (GO:0021953)|cerebellar cortex morphogenesis (GO:0021696)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|detection of cell density by contact stimulus involved in contact inhibition (GO:0060248)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|epithelial-mesenchymal cell signaling (GO:0060684)|exocrine pancreas development (GO:0031017)|facial nerve development (GO:0021561)|floor plate formation (GO:0021508)|forebrain morphogenesis (GO:0048853)|gonad development (GO:0008406)|hair follicle morphogenesis (GO:0031069)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal to epithelial transition involved in metanephric renal vesicle formation (GO:0072285)|midgut development (GO:0007494)|multicellular organism growth (GO:0035264)|muscle cell fate commitment (GO:0042693)|myoblast migration (GO:0051451)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of gene expression (GO:0010629)|negative regulation of hair follicle development (GO:0051799)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate commitment (GO:0048663)|neuron projection regeneration (GO:0031102)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|otolith morphogenesis (GO:0032474)|pancreas morphogenesis (GO:0061113)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of heart morphogenesis (GO:2000826)|regulation of stem cell maintenance (GO:2000036)|renal system development (GO:0072001)|semicircular canal morphogenesis (GO:0048752)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021910)|somite development (GO:0061053)|spermatogenesis (GO:0007283)|thalamus development (GO:0021794)|type B pancreatic cell development (GO:0003323)|vasculogenesis (GO:0001570)|ventral midline determination (GO:0007371)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	drug binding (GO:0008144)|G-protein coupled receptor activity (GO:0004930)|patched binding (GO:0005113)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			biliary_tract(1)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(14)|liver(1)|lung(11)|pancreas(2)|prostate(1)|skin(20)|upper_aerodigestive_tract(3)|urinary_tract(1)	64					Fluocinonide(DB01047)|Vismodegib(DB08828)	TGTTATTCTCTTCTACGTCAA	0.552			Mis		skin basal cell																																			Dom	yes		7	7q31-q32	6608	smoothened homolog (Drosophila)		E	0													118.0	112.0	114.0					7																	128845505		2203	4300	6503	SO:0001583	missense	0			U84401	CCDS5811.1	7q32.1	2014-01-29	2014-01-29	2003-01-17	ENSG00000128602	ENSG00000128602		"""GPCR / Class F : Frizzled receptors"""	11119	protein-coding gene	gene with protein product	"""frizzled family member 11"""	601500	"""smoothened (Drosophila) homolog"", ""smoothened homolog (Drosophila)"", ""smoothened, seven transmembrane spanning receptor"", ""smoothened, frizzled family receptor"""	SMOH		9628830	Standard	NM_005631		Approved	FZD11	uc003vor.3	Q99835	OTTHUMG00000158421	ENST00000249373.3:c.802T>C	7.37:g.128845505T>C	ENSP00000249373:p.Phe268Leu		A4D1K5	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,pfam_GPCR_2_secretin-like,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.F268L	ENST00000249373.3	37	c.802	CCDS5811.1	7	.	.	.	.	.	.	.	.	.	.	T	24.2	4.501840	0.85176	.	.	ENSG00000128602	ENST00000249373	T	0.80824	-1.42	5.57	5.57	0.84162	GPCR, family 2-like (1);	0.093062	0.85682	D	0.000000	T	0.79516	0.4459	L	0.60067	1.865	0.80722	D	1	B	0.25563	0.129	B	0.30782	0.12	T	0.77270	-0.2650	10	0.49607	T	0.09	.	14.8984	0.70659	0.0:0.0:0.0:1.0	.	268	Q99835	SMO_HUMAN	L	268	ENSP00000249373:F268L	ENSP00000249373:F268L	F	+	1	0	SMO	128632741	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.982000	0.88131	2.117000	0.64856	0.402000	0.26972	TTC	SMO	-	pfam_Frizzled,pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_Frizzled	ENSG00000128602		0.552	SMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMO	HGNC	protein_coding	OTTHUMT00000350986.1	-	0.00	40	0	T	NM_005631		128845505	+1	tier1	-	no_errors	ENST00000249373	ensembl	human	known	74_37	missense	80.49	8	33	SNP	1.000	C
SOX17	64321	genome.wustl.edu	37	8	55372131	55372131	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr8:55372131T>G	ENST00000297316.4	+	2	1025	c.821T>G	c.(820-822)cTc>cGc	p.L274R		NM_022454.3	NP_071899.1	Q9H6I2	SOX17_HUMAN	SRY (sex determining region Y)-box 17	274					angiogenesis (GO:0001525)|canonical Wnt signaling pathway (GO:0060070)|cardiac cell fate determination (GO:0060913)|cardiogenic plate morphogenesis (GO:0003142)|cell migration involved in gastrulation (GO:0042074)|common bile duct development (GO:0061009)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cell differentiation (GO:0060956)|endocardium formation (GO:0060214)|endoderm formation (GO:0001706)|endodermal cell fate determination (GO:0007493)|endodermal digestive tract morphogenesis (GO:0061031)|gall bladder development (GO:0061010)|heart formation (GO:0060914)|heart looping (GO:0001947)|inner cell mass cellular morphogenesis (GO:0001828)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth (GO:0030308)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell differentiation (GO:0045597)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein destabilization (GO:0031648)|protein stabilization (GO:0050821)|regulation of cardiac cell fate specification (GO:2000043)|regulation of embryonic development (GO:0045995)|regulation of stem cell division (GO:2000035)|regulation of stem cell proliferation (GO:0072091)|regulation of transcription from RNA polymerase II promoter involved in definitive endodermal cell fate specification (GO:0060807)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|rostrocaudal neural tube patterning (GO:0021903)|signal transduction involved in regulation of gene expression (GO:0023019)|spermatogenesis (GO:0007283)|stem cell fate specification (GO:0048866)|vasculogenesis (GO:0001570)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)	18		Lung NSC(129;0.109)|all_epithelial(80;0.176)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;1.9e-07)|Epithelial(17;1.7e-05)|all cancers(17;0.000159)			CACCCCCGACTCGGCCCAGAG	0.766																																																	0													2.0	2.0	2.0					8																	55372131		1289	2853	4142	SO:0001583	missense	0			AB073988	CCDS6159.1	8q11.23	2014-09-04			ENSG00000164736	ENSG00000164736		"""SRY (sex determining region Y)-boxes"""	18122	protein-coding gene	gene with protein product		610928				11786926	Standard	NM_022454		Approved		uc003xsb.4	Q9H6I2	OTTHUMG00000164377	ENST00000297316.4:c.821T>G	8.37:g.55372131T>G	ENSP00000297316:p.Leu274Arg			Missense_Mutation	SNP	pfam_Sox_C_TAD,pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.L274R	ENST00000297316.4	37	c.821	CCDS6159.1	8	.	.	.	.	.	.	.	.	.	.	T	9.446	1.089231	0.20390	.	.	ENSG00000164736	ENST00000297316	T	0.75938	-0.98	4.44	3.11	0.35812	.	0.386732	0.25494	N	0.030299	T	0.64538	0.2607	L	0.40543	1.245	0.09310	N	1	P	0.38250	0.624	B	0.41332	0.354	T	0.52779	-0.8530	10	0.16896	T	0.51	.	10.4022	0.44235	0.1576:0.0:0.0:0.8424	.	274	Q9H6I2	SOX17_HUMAN	R	274	ENSP00000297316:L274R	ENSP00000297316:L274R	L	+	2	0	SOX17	55534684	0.000000	0.05858	0.743000	0.31040	0.112000	0.19704	0.358000	0.20216	1.630000	0.50440	0.374000	0.22700	CTC	SOX17	-	pfam_Sox_C_TAD	ENSG00000164736		0.766	SOX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX17	HGNC	protein_coding	OTTHUMT00000378526.2	-	0.00	18	0	T			55372131	+1	tier1	-	no_errors	ENST00000297316	ensembl	human	known	74_37	missense	55.56	8	10	SNP	0.023	G
SPEN	23013	genome.wustl.edu	37	1	16255142	16255143	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	GA	GA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:16255142_16255143delGA	ENST00000375759.3	+	11	2611_2612	c.2407_2408delGA	c.(2407-2409)gagfs	p.E803fs		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	803	Arg-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GGAGAGAGTGGAGAGAGAGAGA	0.431																																																	0																																										SO:0001589	frameshift_variant	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.2407_2408delGA	1.37:g.16255152_16255153delGA	ENSP00000364912:p.Glu803fs		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Frame_Shift_Del	DEL	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC_like_C_dom,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.R806fs	ENST00000375759.3	37	c.2407_2408	CCDS164.1	1																																																																																			SPEN	-	NULL	ENSG00000065526		0.431	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1		0.00	52	0	GA	NM_015001		16255143	+1	tier1		no_errors	ENST00000375759	ensembl	human	known	74_37	frame_shift_del	10.00	36	4	DEL	0.999:1.000	-
SPOCK3	50859	genome.wustl.edu	37	4	167833799	167833799	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr4:167833799C>T	ENST00000357154.3	-	6	592	c.455G>A	c.(454-456)gGt>gAt	p.G152D	SPOCK3_ENST00000541637.1_Intron|SPOCK3_ENST00000535728.1_Missense_Mutation_p.G60D|SPOCK3_ENST00000511269.1_Missense_Mutation_p.G149D|SPOCK3_ENST00000512648.1_Missense_Mutation_p.G149D|SPOCK3_ENST00000512681.1_Intron|SPOCK3_ENST00000541354.1_Missense_Mutation_p.G32D|SPOCK3_ENST00000510741.1_Missense_Mutation_p.G149D|SPOCK3_ENST00000511531.1_Missense_Mutation_p.G152D|SPOCK3_ENST00000504953.1_Missense_Mutation_p.G149D|SPOCK3_ENST00000421836.2_Missense_Mutation_p.G101D|SPOCK3_ENST00000502330.1_Missense_Mutation_p.G152D|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000357545.4_Missense_Mutation_p.G149D|SPOCK3_ENST00000506886.1_Missense_Mutation_p.G152D|SPOCK3_ENST00000534949.1_Missense_Mutation_p.G56D	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	152	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		ACCATCTGAACCACAAACAGG	0.433																																																	0													126.0	121.0	123.0					4																	167833799		2203	4300	6503	SO:0001583	missense	0			AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.455G>A	4.37:g.167833799C>T	ENSP00000349677:p.Gly152Asp		B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Missense_Mutation	SNP	pfam_SPARC/Testican_Ca-bd-dom,pfam_Thyroglobulin_1,pfam_Kazal_dom,superfamily_Thyroglobulin_1,smart_Kazal_dom,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	p.G152D	ENST00000357154.3	37	c.455	CCDS54817.1	4	.	.	.	.	.	.	.	.	.	.	C	17.72	3.460208	0.63401	.	.	ENSG00000196104	ENST00000357154;ENST00000357545;ENST00000504953;ENST00000506886;ENST00000511531;ENST00000502330;ENST00000510741;ENST00000541354;ENST00000511269;ENST00000535728;ENST00000421836;ENST00000534949;ENST00000512648;ENST00000509854	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13	5.04	4.19	0.49359	Proteinase inhibitor I1, Kazal (1);EF-hand-like domain (1);Protease inhibitor, Kazal-type (1);	0.000000	0.85682	D	0.000000	D	0.88411	0.6429	H	0.99634	4.67	0.53688	D	0.999973	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.987;0.984;0.993;0.98;0.984	D;D;D;P;P;P;P	0.97110	1.0;0.998;0.915;0.885;0.865;0.817;0.885	D	0.93283	0.6662	10	0.87932	D	0	5.5322	14.8034	0.69932	0.1456:0.8544:0.0:0.0	.	56;101;161;149;152;149;152	F5H099;B4DHB4;B4DFW5;E7EP61;Q9BQ16-2;Q9BQ16-1;Q9BQ16	.;.;.;.;.;.;TICN3_HUMAN	D	152;149;149;152;152;152;149;32;149;60;101;56;149;149	ENSP00000349677:G152D;ENSP00000350153:G149D;ENSP00000425570:G149D;ENSP00000420920:G152D;ENSP00000423421:G152D;ENSP00000423606:G152D;ENSP00000426716:G149D;ENSP00000444789:G32D;ENSP00000425502:G149D;ENSP00000441396:G60D;ENSP00000411344:G101D;ENSP00000438142:G56D;ENSP00000426177:G149D;ENSP00000423367:G149D	ENSP00000349677:G152D	G	-	2	0	SPOCK3	168070374	1.000000	0.71417	0.990000	0.47175	0.358000	0.29455	5.440000	0.66563	1.233000	0.43693	0.643000	0.83706	GGT	SPOCK3	-	pfam_Kazal_dom,smart_Kazal_dom	ENSG00000196104		0.433	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCK3	HGNC	protein_coding	OTTHUMT00000364091.1		0.00	87	0	C			167833799	-1			no_errors	ENST00000357154	ensembl	human	known	74_37	missense	6.98	40	3	SNP	1.000	T
SPSB2	84727	genome.wustl.edu	37	12	6981290	6981290	+	Intron	SNP	T	T	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr12:6981290T>A	ENST00000524270.1	-	2	851				LRRC23_ENST00000433346.1_5'Flank|RPL13P5_ENST00000412023.1_RNA|SPSB2_ENST00000523102.1_Intron|SPSB2_ENST00000519357.1_Missense_Mutation_p.Q259L	NM_032641.3	NP_116030.1	Q99619	SPSB2_HUMAN	splA/ryanodine receptor domain and SOCS box containing 2						intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				kidney(2)|lung(2)|upper_aerodigestive_tract(1)	5						GAACAGAGGTTGAGGCAGGCT	0.502											OREG0021639	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0			AF403027	CCDS8567.1	12p13.31	2008-02-05				ENSG00000111671			29522	protein-coding gene	gene with protein product		611658				8723724, 12076535	Standard	NM_001146316		Approved	GRCC9, SSB-2	uc001qrl.3	Q99619		ENST00000524270.1:c.664+111A>T	12.37:g.6981290T>A		638	B7Z4W1|D3DUT0	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	p.Q259L	ENST00000524270.1	37	c.776	CCDS8567.1	12	.	.	.	.	.	.	.	.	.	.	T	0.196	-1.048712	0.01981	.	.	ENSG00000111671	ENST00000519357	T	0.48201	0.82	2.51	-5.02	0.02982	.	.	.	.	.	T	0.25044	0.0608	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.06807	-1.0806	8	0.21014	T	0.42	.	4.3841	0.11307	0.3729:0.0:0.1756:0.4515	.	259	B7Z4W1	.	L	259	ENSP00000431037:Q259L	ENSP00000431037:Q259L	Q	-	2	0	SPSB2	6851551	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.285000	0.08410	-3.362000	0.00179	-2.249000	0.00283	CAA	SPSB2	-	NULL	ENSG00000111671		0.502	SPSB2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SPSB2	HGNC	protein_coding	OTTHUMT00000375721.1	-	0.00	49	0	T	NM_032641		6981290	-1	tier1	-	no_errors	ENST00000519357	ensembl	human	putative	74_37	missense	52.50	19	21	SNP	0.000	A
SRCIN1	80725	genome.wustl.edu	37	17	36708244	36708244	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr17:36708244G>T	ENST00000264659.7	-	14	2829	c.2605C>A	c.(2605-2607)Ctg>Atg	p.L869M	SRCIN1_ENST00000578925.1_Missense_Mutation_p.L903M|SRCIN1_ENST00000398579.4_5'UTR	NM_025248.2	NP_079524.2	Q9C0H9	SRCN1_HUMAN	SRC kinase signaling inhibitor 1	741	Pro-rich.				exocytosis (GO:0006887)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	protein kinase binding (GO:0019901)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	19						TGCAGGTTCAGCGGGGGGCTG	0.612																																																	0													36.0	42.0	40.0					17																	36708244		1917	4105	6022	SO:0001583	missense	0				CCDS45660.1	17q12	2009-12-14			ENSG00000017373	ENSG00000277363			29506	protein-coding gene	gene with protein product	"""p130Cas-associated protein"", ""SNAP-25-interacting protein"""	610786				11214970	Standard	NM_025248		Approved	SNIP, p140Cap, KIAA1684	uc002hqd.3	Q9C0H9		ENST00000264659.7:c.2605C>A	17.37:g.36708244G>T	ENSP00000264659:p.Leu869Met		Q75T46|Q8N4W8	Missense_Mutation	SNP	pfam_AIP3_C	p.L869M	ENST00000264659.7	37	c.2605	CCDS45660.1	17	.	.	.	.	.	.	.	.	.	.	G	10.20	1.285406	0.23478	.	.	ENSG00000017373	ENST00000264659;ENST00000542707;ENST00000398579	T	0.50001	0.76	4.69	1.51	0.23008	.	0.544123	0.18935	N	0.127094	T	0.34454	0.0898	L	0.35341	1.055	0.22961	N	0.9985	P;P;P;P	0.44578	0.838;0.587;0.587;0.587	P;B;B;B	0.45099	0.469;0.177;0.177;0.177	T	0.10847	-1.0612	10	0.33141	T	0.24	-11.1366	4.361	0.11203	0.1743:0.0:0.4053:0.4204	.	175;741;741;869	Q9C0H9-4;Q9C0H9-2;Q9C0H9;Q9C0H9-5	.;.;SRCN1_HUMAN;.	M	869;650;723	ENSP00000264659:L869M	ENSP00000264659:L869M	L	-	1	2	SRCIN1	33961770	0.704000	0.27836	0.002000	0.10522	0.659000	0.38960	0.785000	0.26830	0.274000	0.22072	0.561000	0.74099	CTG	SRCIN1	-	NULL	ENSG00000017373		0.612	SRCIN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SRCIN1	HGNC	protein_coding	OTTHUMT00000441878.4		0.00	70	0	G	NM_025248		36708244	-1			no_errors	ENST00000264659	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.181	T
SSPO	23145	genome.wustl.edu	37	7	149518163	149518163	+	RNA	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr7:149518163G>T	ENST00000378016.2	+	0	12506							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TCGGCCTGGAGTCCCTGCAGC	0.682																																																	0													4.0	6.0	6.0					7																	149518163		1903	4025	5928			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149518163G>T			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.682	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		-	0.00	9	0	G			149518163	+1	tier1	-	no_errors	ENST00000378016	ensembl	human	known	74_37	rna	57.14	3	4	SNP	0.998	T
SUN5	140732	genome.wustl.edu	37	20	31575539	31575539	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr20:31575539T>C	ENST00000356173.3	-	10	748	c.656A>G	c.(655-657)cAt>cGt	p.H219R	SUN5_ENST00000375523.3_Missense_Mutation_p.H194R	NM_080675.3	NP_542406.2	Q8TC36	SUN5_HUMAN	Sad1 and UNC84 domain containing 5	219	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	25						GGCCTTCTCATGGTTATAGGT	0.597																																																	0													112.0	81.0	92.0					20																	31575539		2203	4300	6503	SO:0001583	missense	0			AL121756	CCDS13209.1	20q11.21	2010-01-27	2010-01-27	2010-01-27	ENSG00000167098	ENSG00000167098			16252	protein-coding gene	gene with protein product	"""testis and spermatogenesis related gene 4"""	613942	"""sperm associated antigen 4-like"""	SPAG4L		9691178, 10373309	Standard	NM_080675		Approved	dJ726C3.1, TSARG4	uc002wyi.3	Q8TC36	OTTHUMG00000032239	ENST00000356173.3:c.656A>G	20.37:g.31575539T>C	ENSP00000348496:p.His219Arg		A6NJ82|Q5T9R0	Missense_Mutation	SNP	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	p.H219R	ENST00000356173.3	37	c.656	CCDS13209.1	20	.	.	.	.	.	.	.	.	.	.	T	9.120	1.008648	0.19199	.	.	ENSG00000167098	ENST00000356173;ENST00000375523	T;T	0.11277	2.79;2.81	4.91	1.35	0.21983	Sad1/UNC-like, C-terminal (1);	0.399780	0.25205	N	0.032355	T	0.04543	0.0124	N	0.25647	0.755	0.34829	D	0.739528	P	0.49961	0.93	B	0.34722	0.188	T	0.47560	-0.9108	10	0.22109	T	0.4	-26.5921	3.9671	0.09436	0.0:0.167:0.1965:0.6366	.	219	Q8TC36	SUN5_HUMAN	R	219;194	ENSP00000348496:H219R;ENSP00000364673:H194R	ENSP00000348496:H219R	H	-	2	0	SUN5	31039200	0.954000	0.32549	0.994000	0.49952	0.780000	0.44128	1.437000	0.34991	0.688000	0.31529	0.459000	0.35465	CAT	SUN5	-	superfamily_Galactose-bd-like	ENSG00000167098		0.597	SUN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUN5	HGNC	protein_coding	OTTHUMT00000078659.1	-	0.00	38	0	T	NM_080675		31575539	-1	tier1	-	no_errors	ENST00000356173	ensembl	human	known	74_37	missense	35.42	31	17	SNP	0.625	C
SYCP2	10388	genome.wustl.edu	37	20	58494490	58494490	+	Intron	SNP	T	T	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr20:58494490T>C	ENST00000357552.3	-	6	628				SYCP2_ENST00000371001.2_Intron|SYCP2_ENST00000476314.1_5'UTR			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2						female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			AGAACACAAATTGTTTTTTAA	0.333																																																	0																																										SO:0001627	intron_variant	0			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.402+57A>G	20.37:g.58494490T>C			A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	RNA	SNP	-	NULL	ENST00000357552.3	37	NULL	CCDS13482.1	20																																																																																			SYCP2	-	-	ENSG00000196074		0.333	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	HGNC	protein_coding	OTTHUMT00000079930.3	-	0.00	34	0	T	NM_014258		58494490	-1	tier1	-	no_errors	ENST00000476314	ensembl	human	putative	74_37	rna	50.00	25	25	SNP	0.003	C
VAMP1	6843	genome.wustl.edu	37	12	6575561	6575561	+	Intron	SNP	G	G	T	rs550029395		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr12:6575561G>T	ENST00000396308.3	-	2	148				VAMP1_ENST00000361716.3_Intron|TAPBPL_ENST00000545700.1_3'UTR|VAMP1_ENST00000400911.3_Intron|VAMP1_ENST00000544432.1_Intron|VAMP1_ENST00000535180.1_Intron	NM_014231.3|NM_199245.1	NP_055046.1|NP_954740.1	P23763	VAMP1_HUMAN	vesicle-associated membrane protein 1 (synaptobrevin 1)						neurotransmitter secretion (GO:0007269)|SNARE complex assembly (GO:0035493)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuron projection (GO:0043005)|synapse (GO:0045202)				endometrium(1)|large_intestine(1)|prostate(1)	3					Botulinum Toxin Type B(DB00042)	ACCAAGACAAGAAAGGAgctg	0.597													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18649	0.0		0.0	False		,,,				2504	0.0																0													28.0	30.0	29.0					12																	6575561		2203	4300	6503	SO:0001627	intron_variant	0				CCDS31731.1, CCDS41740.1, CCDS44809.1, CCDS73422.1	12p	2013-02-13			ENSG00000139190	ENSG00000139190		"""Vesicle-associated membrane proteins"""	12642	protein-coding gene	gene with protein product		185880		SYB1		1976629	Standard	XM_006719011		Approved	VAMP-1	uc001qok.3	P23763	OTTHUMG00000168269	ENST00000396308.3:c.3-44C>A	12.37:g.6575561G>T			A8MVP3|D3DUR3|O75468|Q15857|Q6FG94|Q8IVC9	RNA	SNP	-	NULL	ENST00000396308.3	37	NULL	CCDS41740.1	12																																																																																			TAPBPL	-	-	ENSG00000139192		0.597	VAMP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TAPBPL	HGNC	protein_coding	OTTHUMT00000399078.1	-	0.00	28	0	G			6575561	+1	tier1	-	no_errors	ENST00000545700	ensembl	human	known	74_37	rna	26.09	17	6	SNP	0.032	T
TAS2R20	259295	genome.wustl.edu	37	12	11150474	11150474	+	Splice_Site	SNP	T	T	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr12:11150474T>C	ENST00000538986.1	-	1	0	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176889.2	NP_795370.2	P59543	T2R20_HUMAN	taste receptor, type 2, member 20	1					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						AAACTCATCATGTCTAAACAA	0.328																																																	0													18.0	20.0	19.0					12																	11150474		2197	4289	6486	SO:0001630	splice_region_variant	0			AX097732, AF494236	CCDS8639.1	12p13.2	2012-08-22			ENSG00000255837	ENSG00000255837		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19109	protein-coding gene	gene with protein product		613962	"""taste receptor, type 2, member 49"""	TAS2R49			Standard	NM_176889		Approved	T2R20, T2R56	uc001qzm.2	P59543	OTTHUMG00000162695	ENST00000538986.1:c.1-1A>G	12.37:g.11150474T>C			P59549|Q2HIZ4|Q496D8|Q645X9	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.M1V	ENST00000538986.1	37	c.1	CCDS8639.1	12	.	.	.	.	.	.	.	.	.	.	T	8.560	0.877616	0.17395	.	.	ENSG00000255837	ENST00000538986	T	0.02121	4.44	3.06	0.476	0.16779	.	0.067037	0.53938	U	0.000048	T	0.02610	0.0079	.	.	.	0.09310	N	0.99999	P	0.35944	0.529	B	0.41619	0.361	T	0.39502	-0.9611	9	0.87932	D	0	.	3.0722	0.06235	0.0:0.259:0.2255:0.5156	.	1	P59543	T2R20_HUMAN	V	1	ENSP00000441624:M1V	ENSP00000441624:M1V	M	-	1	0	TAS2R20	11041741	0.061000	0.20836	0.003000	0.11579	0.031000	0.12232	1.270000	0.33086	-0.094000	0.12374	0.477000	0.44152	ATG	TAS2R20	-	pfam_TAS2_rcpt	ENSG00000255837		0.328	TAS2R20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R20	HGNC	protein_coding	OTTHUMT00000370130.2	-	0.00	8	0	T	NM_176889	Missense_Mutation	11150474	-1	tier1	-	no_errors	ENST00000538986	ensembl	human	known	74_37	missense	44.44	5	4	SNP	0.014	C
TBC1D8B	54885	genome.wustl.edu	37	X	106066577	106066577	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chrX:106066577C>G	ENST00000357242.5	+	5	882	c.708C>G	c.(706-708)caC>caG	p.H236Q	TBC1D8B_ENST00000276175.3_Missense_Mutation_p.H236Q|TBC1D8B_ENST00000310452.2_Missense_Mutation_p.H236Q|TBC1D8B_ENST00000481617.2_Missense_Mutation_p.H236Q	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	236							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TGTTTTTGCACATTAACCAAA	0.353																																																	0													125.0	110.0	115.0					X																	106066577		2203	4300	6503	SO:0001583	missense	0			AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.708C>G	X.37:g.106066577C>G	ENSP00000349781:p.His236Gln		B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_hand_dom,pfscan_Rab-GTPase-TBC_dom	p.H236Q	ENST00000357242.5	37	c.708	CCDS14522.1	X	.	.	.	.	.	.	.	.	.	.	C	15.67	2.901460	0.52227	.	.	ENSG00000133138	ENST00000357242;ENST00000310452;ENST00000481617;ENST00000276175	T;T;T;T	0.22539	3.14;2.56;1.95;3.13	5.73	1.78	0.24846	.	0.063738	0.64402	D	0.000008	T	0.30541	0.0768	M	0.66939	2.045	0.38813	D	0.955466	D;B;P	0.57899	0.981;0.415;0.872	P;B;B	0.53360	0.724;0.196;0.301	T	0.05305	-1.0893	10	0.62326	D	0.03	-13.8434	7.7212	0.28733	0.0:0.5954:0.0:0.4046	.	236;236;236	Q0IIM8;B9A6K6;D6RFZ2	TBC8B_HUMAN;.;.	Q	236	ENSP00000349781:H236Q;ENSP00000310675:H236Q;ENSP00000421375:H236Q;ENSP00000276175:H236Q	ENSP00000276175:H236Q	H	+	3	2	TBC1D8B	105953233	0.997000	0.39634	0.991000	0.47740	0.922000	0.55478	0.526000	0.22971	-0.083000	0.12618	-0.931000	0.02705	CAC	TBC1D8B	-	NULL	ENSG00000133138		0.353	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D8B	HGNC	protein_coding	OTTHUMT00000057807.2	-	0.00	55	0	C	NM_017752		106066577	+1	tier1	-	no_errors	ENST00000357242	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	G
TCEA1	6917	genome.wustl.edu	37	8	54906287	54906287	+	Silent	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr8:54906287G>A	ENST00000521604.2	-	4	664	c.261C>T	c.(259-261)gaC>gaT	p.D87D	TCEA1_ENST00000521086.2_5'UTR|TCEA1_ENST00000396401.3_Silent_p.D66D|TCEA1_ENST00000522635.1_Intron|TCEA1_ENST00000520534.1_Silent_p.D87D	NM_006756.2	NP_006747.1	P23193	TCEA1_HUMAN	transcription elongation factor A (SII), 1	87					DNA repair (GO:0006281)|erythrocyte differentiation (GO:0030218)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|regulation of DNA-templated transcription, elongation (GO:0032784)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;9.1e-07)|Epithelial(17;9.44e-05)|all cancers(17;0.000699)			TCTTCTTTTCGTCAAGGTCTT	0.353			T	PLAG1	salivary adenoma																																			Dom	yes		8	8q11.2	6917	"""transcription elongation factor A (SII), 1"""		E	0													196.0	182.0	186.0					8																	54906287		1824	4085	5909	SO:0001819	synonymous_variant	0			X62585	CCDS47857.1, CCDS47858.1	8q11.2	2011-01-25			ENSG00000187735	ENSG00000187735		"""General transcription factors"""	11612	protein-coding gene	gene with protein product		601425		TCEA, GTF2S		8812434, 8112616	Standard	NM_006756		Approved	SII, TF2S, TFIIS	uc003xru.3	P23193	OTTHUMG00000164262	ENST00000521604.2:c.261C>T	8.37:g.54906287G>A			A6NF25|A8K339|Q15563|Q6FG87	Silent	SNP	pfam_TFIIS_cen_dom,pfam_Znf_TFIIS,pfam_TFIIS_N,superfamily_TFIIS_cen_dom,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,smart_TFS2M,smart_Znf_TFIIS,pirsf_TF_IIS-rel,pfscan_Znf_TFIIS,tigrfam_TFSII	p.D87	ENST00000521604.2	37	c.261	CCDS47858.1	8																																																																																			TCEA1	-	superfamily_TFIIS_N,pirsf_TF_IIS-rel,tigrfam_TFSII	ENSG00000187735		0.353	TCEA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEA1	HGNC	protein_coding	OTTHUMT00000377975.2	-	0.00	45	0	G	NM_006756		54906287	-1	tier1	-	no_errors	ENST00000521604	ensembl	human	known	74_37	silent	36.92	41	24	SNP	1.000	A
TIGD7	91151	genome.wustl.edu	37	16	3350367	3350367	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr16:3350367G>A	ENST00000396862.1	-	2	2076	c.248C>T	c.(247-249)gCg>gTg	p.A83V	TIGD7_ENST00000268674.2_Missense_Mutation_p.A83V|TIGD7_ENST00000574598.1_5'Flank	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	83	HTH CENPB-type. {ECO:0000255|PROSITE- ProRule:PRU00583}.					nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A83V(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						CATGTAGACCGCATCATCTAC	0.502																																																	1	Substitution - Missense(1)	kidney(1)											159.0	152.0	154.0					16																	3350367		2197	4300	6497	SO:0001583	missense	0			AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.248C>T	16.37:g.3350367G>A	ENSP00000380071:p.Ala83Val		Q9BXZ0	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.A83V	ENST00000396862.1	37	c.248	CCDS10500.1	16	.	.	.	.	.	.	.	.	.	.	G	13.87	2.365975	0.41902	.	.	ENSG00000140993	ENST00000426381;ENST00000396862;ENST00000268674	T;T	0.36157	1.27;1.27	4.38	4.38	0.52667	Homeodomain-related (1);Pogo transposase / Cenp-B / PDC2, DNA-binding HTH domain (3);Homeodomain-like (1);	0.000000	0.35646	U	0.003075	T	0.46386	0.1390	L	0.43646	1.37	0.32140	N	0.585616	D	0.89917	1.0	D	0.85130	0.997	T	0.40478	-0.9561	10	0.10902	T	0.67	.	12.3228	0.54993	0.0:0.0:1.0:0.0	.	83	Q6NT04	TIGD7_HUMAN	V	83	ENSP00000380071:A83V;ENSP00000268674:A83V	ENSP00000268674:A83V	A	-	2	0	TIGD7	3290368	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.166000	0.58203	2.283000	0.76528	0.655000	0.94253	GCG	TIGD7	-	pfam_HTH_CenpB_DNA-bd_dom,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom	ENSG00000140993		0.502	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD7	HGNC	protein_coding	OTTHUMT00000251465.1		0.00	51	0	G	NM_033208		3350367	-1			no_errors	ENST00000268674	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	A
TNFRSF18	8784	genome.wustl.edu	37	1	1139264	1139264	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:1139264G>A	ENST00000379268.2	-	5	805	c.686C>T	c.(685-687)tCg>tTg	p.S229L	TNFRSF18_ENST00000486728.1_Missense_Mutation_p.S157L|TNFRSF18_ENST00000379265.5_Missense_Mutation_p.S222L|TNFRSF18_ENST00000328596.6_Missense_Mutation_p.R159W	NM_004195.2|NM_148902.1	NP_004186.1|NP_683700.1	Q9Y5U5	TNR18_HUMAN	tumor necrosis factor receptor superfamily, member 18	229					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	tumor necrosis factor-activated receptor activity (GO:0005031)			lung(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CTCCTCTGCCGATCGCTCGCC	0.726																																					GBM(157;472 1934 13810 14591 35952)												0													11.0	14.0	13.0					1																	1139264		2152	4243	6395	SO:0001583	missense	0			AF125304	CCDS9.1, CCDS10.1, CCDS30552.1	1p36.3	2011-08-11			ENSG00000186891	ENSG00000186891		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11914	protein-coding gene	gene with protein product		603905				9177197, 10037686	Standard	NM_004195		Approved	AITR, GITR, CD357	uc001add.3	Q9Y5U5	OTTHUMG00000001414	ENST00000379268.2:c.686C>T	1.37:g.1139264G>A	ENSP00000368570:p.Ser229Leu		B1AME1|O95851|Q5U0I4|Q9NYJ9	Missense_Mutation	SNP	prints_TNFR_18	p.R159W	ENST00000379268.2	37	c.475	CCDS10.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.058|0.058	-1.232438|-1.232438	0.01505|0.01505	.|.	.|.	ENSG00000186891|ENSG00000186891	ENST00000328596|ENST00000379268;ENST00000379265	T|T;T	0.30714|0.58358	1.52|0.71;0.34	3.33|3.33	-1.32|-1.32	0.09201|0.09201	.|.	.|.	.|.	.|.	.|.	T|T	0.34716|0.34716	0.0907|0.0907	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|B;B	0.02656|0.02656	0.0|0.0;0.0	B|B;B	0.01281|0.01281	0.0|0.0;0.0	T|T	0.19582|0.19582	-1.0301|-1.0301	8|8	0.87932|0.26408	D|T	0|0.33	.|.	9.0398|9.0398	0.36311|0.36311	0.465:0.0:0.535:0.0|0.465:0.0:0.535:0.0	.|.	159|229;222	Q9Y5U5-2|Q9Y5U5;B1AME3	.|TNR18_HUMAN;.	W|L	159|229;222	ENSP00000328207:R159W|ENSP00000368570:S229L;ENSP00000368567:S222L	ENSP00000328207:R159W|ENSP00000368567:S222L	R|S	-|-	1|2	2|0	TNFRSF18|TNFRSF18	1129127|1129127	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.586000|-0.586000	0.05787|0.05787	-0.418000|-0.418000	0.07450|0.07450	-1.912000|-1.912000	0.00520|0.00520	CGG|TCG	TNFRSF18	-	NULL	ENSG00000186891		0.726	TNFRSF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNFRSF18	HGNC	protein_coding	OTTHUMT00000004083.2	-	0.00	22	0	G	NM_004195		1139264	-1	tier1	-	no_errors	ENST00000328596	ensembl	human	known	74_37	missense	16.22	31	6	SNP	0.000	A
TNR	7143	genome.wustl.edu	37	1	175372725	175372725	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:175372725C>T	ENST00000367674.2	-	4	1235	c.527G>A	c.(526-528)aGt>aAt	p.S176N	TNR_ENST00000263525.2_Missense_Mutation_p.S176N			Q92752	TENR_HUMAN	tenascin R	176	Cys-rich.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GCCGTGGCCACTGCAGTGAGG	0.562																																																	0													73.0	76.0	75.0					1																	175372725		2203	4300	6503	SO:0001583	missense	0			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.527G>A	1.37:g.175372725C>T	ENSP00000356646:p.Ser176Asn		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.S176N	ENST00000367674.2	37	c.527	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.767145	0.69878	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.21543	2.0;2.0	6.02	5.11	0.69529	.	0.047492	0.85682	D	0.000000	T	0.24236	0.0587	L	0.47016	1.485	0.48288	D	0.999629	P;P	0.48911	0.915;0.917	B;B	0.44278	0.395;0.445	T	0.01401	-1.1364	10	0.37606	T	0.19	.	15.2273	0.73361	0.0:0.9321:0.0:0.0679	.	176;176	B4DIX8;Q92752	.;TENR_HUMAN	N	176	ENSP00000356646:S176N;ENSP00000263525:S176N	ENSP00000263525:S176N	S	-	2	0	TNR	173639348	1.000000	0.71417	0.953000	0.39169	0.996000	0.88848	5.757000	0.68766	1.565000	0.49641	0.655000	0.94253	AGT	TNR	-	NULL	ENSG00000116147		0.562	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	-	0.00	52	0	C	NM_003285		175372725	-1	tier1	-	no_errors	ENST00000263525	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
TOPBP1	11073	genome.wustl.edu	37	3	133339082	133339082	+	Silent	SNP	T	T	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr3:133339082T>C	ENST00000260810.5	-	20	3419	c.3288A>G	c.(3286-3288)agA>agG	p.R1096R		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	1096					cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						TACAACCACTTCTTGAAAGGG	0.493								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)												0													170.0	166.0	167.0					3																	133339082		1986	4170	6156	SO:0001819	synonymous_variant	0			AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.3288A>G	3.37:g.133339082T>C			B7Z7W8|Q7LGC1|Q9UEB9	Silent	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_Secretoglobin,smart_BRCT_dom,pfscan_BRCT_dom	p.R1096	ENST00000260810.5	37	c.3288	CCDS46919.1	3																																																																																			TOPBP1	-	NULL	ENSG00000163781		0.493	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPBP1	HGNC	protein_coding	OTTHUMT00000357254.1	-	0.00	83	0	T	NM_007027		133339082	-1	tier1	-	no_errors	ENST00000260810	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.991	C
TP53	7157	genome.wustl.edu	37	17	7578222	7578223	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr17:7578222_7578223delTC	ENST00000269305.4	-	6	815_816	c.626_627delGA	c.(625-627)agafs	p.R209fs	TP53_ENST00000413465.2_Frame_Shift_Del_p.R209fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.R209fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.R209fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.R209fs|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Frame_Shift_Del_p.R209fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	209	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> I (in sporadic cancers; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).|R -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R209fs*6(38)|p.0?(8)|p.R209K(7)|p.?(5)|p.R209T(3)|p.R77fs*6(2)|p.R209fs*35(2)|p.D207fs*6(2)|p.R209fs*38(2)|p.R116fs*6(2)|p.R77K(1)|p.R116K(1)|p.E204_N210delEYLDDRN(1)|p.R209fs*36(1)|p.D207_R213delDDRNTFR(1)|p.D208_V216delDRNTFRHSV(1)|p.D208fs*1(1)|p.N210fs*7(1)|p.R209S(1)|p.R209I(1)|p.R209_R213delRNTFR(1)|p.D207_V216del10(1)|p.R209fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAAAAGTGTTTCTGTCATCCAA	0.535		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	84	Deletion - Frameshift(51)|Substitution - Missense(14)|Whole gene deletion(8)|Deletion - In frame(5)|Unknown(5)|Insertion - Frameshift(1)	biliary_tract(11)|breast(9)|upper_aerodigestive_tract(8)|oesophagus(7)|large_intestine(6)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(5)|prostate(5)|lung(4)|bone(4)|stomach(3)|soft_tissue(3)|ovary(3)|pancreas(3)|salivary_gland(2)|skin(2)|cervix(1)|urinary_tract(1)|liver(1)|thyroid(1)	GRCh37	CD962734	TP53	D																																				SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.626_627delGA	17.37:g.7578222_7578223delTC	ENSP00000269305:p.Arg209fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R209fs	ENST00000269305.4	37	c.627_626	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.535	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1		0.00	55	0	TC	NM_000546		7578223	-1	tier1		no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	66.67	15	30	DEL	0.000:0.000	-
TP53BP1	7158	genome.wustl.edu	37	15	43699688	43699688	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr15:43699688G>A	ENST00000263801.3	-	28	6064	c.5812C>T	c.(5812-5814)Cag>Tag	p.Q1938*	TP53BP1_ENST00000382039.3_Nonsense_Mutation_p.Q1893*|TP53BP1_ENST00000450115.2_Nonsense_Mutation_p.Q1941*|TP53BP1_ENST00000382044.4_Nonsense_Mutation_p.Q1943*	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1938	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		ACAGGCAGCTGCAATGCTTCA	0.493								Other conserved DNA damage response genes																																									0													124.0	111.0	115.0					15																	43699688		2201	4298	6499	SO:0001587	stop_gained	0			U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.5812C>T	15.37:g.43699688G>A	ENSP00000263801:p.Gln1938*		F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Nonsense_Mutation	SNP	pfam_53-BP1_Tudor,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.Q1943*	ENST00000263801.3	37	c.5827	CCDS10096.1	15	.	.	.	.	.	.	.	.	.	.	G	46	12.434386	0.99667	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115	.	.	.	5.34	5.34	0.76211	.	0.358888	0.30800	N	0.008846	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-7.9506	10.7513	0.46211	0.0:0.1404:0.7145:0.1452	.	.	.	.	X	1938;1943;1893;1941	.	ENSP00000263801:Q1938X	Q	-	1	0	TP53BP1	41486980	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.901000	0.48695	2.656000	0.90262	0.460000	0.39030	CAG	TP53BP1	-	superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	ENSG00000067369		0.493	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TP53BP1	HGNC	protein_coding	OTTHUMT00000132897.3		0.00	26	0	G			43699688	-1			no_errors	ENST00000382044	ensembl	human	known	74_37	nonsense	6.25	30	2	SNP	1.000	A
TPTE2P6	374491	genome.wustl.edu	37	13	25160825	25160825	+	RNA	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr13:25160825G>A	ENST00000453498.1	+	0	780				TPTE2P6_ENST00000440905.1_RNA																							AAAGGACAAGGCTGAGAGAAT	0.443																																																	0																																												0																															13.37:g.25160825G>A				RNA	SNP	-	NULL	ENST00000453498.1	37	NULL		13																																																																																			TPTE2P6	-	-	ENSG00000205822		0.443	RP11-556N21.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	TPTE2P6	HGNC	processed_transcript	OTTHUMT00000044193.1		0.00	38	0	G			25160825	+1			no_errors	ENST00000440905	ensembl	human	known	74_37	rna	11.54	23	3	SNP	0.005	A
TPTEP1	387590	genome.wustl.edu	37	22	17083058	17083058	+	lincRNA	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr22:17083058G>A	ENST00000426585.1	+	0	125									transmembrane phosphatase with tensin homology pseudogene 1																		AAAAGACCTCGGGGCCGGCCT	0.711																																																	0																																												0					22q11.1	2013-10-15			ENSG00000100181	ENSG00000100181			43648	pseudogene	pseudogene						14659893	Standard	NR_001591		Approved	psiTPTE22	uc002zlr.3		OTTHUMG00000141300		22.37:g.17083058G>A				RNA	SNP	-	NULL	ENST00000426585.1	37	NULL		22																																																																																			TPTEP1	-	-	ENSG00000100181		0.711	TPTEP1-002	KNOWN	basic	lincRNA	TPTEP1	HGNC	lincRNA	OTTHUMT00000280575.1	-	0.00	68	0	G	NR_001591		17083058	+1	tier1	-	no_errors	ENST00000400593	ensembl	human	known	74_37	rna	30.30	23	10	SNP	1.000	A
TRAM1	23471	genome.wustl.edu	37	8	71520334	71520335	+	Frame_Shift_Ins	INS	-	-	AGAC			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr8:71520334_71520335insAGAC	ENST00000262213.2	-	1	269_270	c.100_101insGTCT	c.(100-102)ttcfs	p.F34fs	TRAM1_ENST00000521049.1_5'UTR|RP11-382J12.1_ENST00000499227.2_5'Flank|TRAM1_ENST00000536748.1_Frame_Shift_Ins_p.F3fs|TRAM1_ENST00000521425.1_5'Flank	NM_014294.5	NP_055109.1	Q15629	TRAM1_HUMAN	translocation associated membrane protein 1	34					cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	17			Epithelial(68;0.00679)|all cancers(69;0.0324)|OV - Ovarian serous cystadenocarcinoma(28;0.0509)			CCCCAGCAGGAAGACCATCGCC	0.653																																					Ovarian(85;984 1334 5116 12432 40638)												0																																										SO:0001589	frameshift_variant	0			X63679	CCDS6207.1	8q13.1	2004-01-22			ENSG00000067167	ENSG00000067167			20568	protein-coding gene	gene with protein product		605190				1315422	Standard	NM_014294		Approved	TRAM, TRAMP	uc003xyo.2	Q15629	OTTHUMG00000164428	ENST00000262213.2:c.97_100dupGTCT	8.37:g.71520335_71520338dupAGAC	ENSP00000262213:p.Phe34fs		B4E0K2	Frame_Shift_Ins	INS	pfam_TRAM1,pfam_TLC-dom,smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom	p.F34fs	ENST00000262213.2	37	c.101_100	CCDS6207.1	8																																																																																			TRAM1	-	pirsf_Translocation_assoc_membrane	ENSG00000067167		0.653	TRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAM1	HGNC	protein_coding	OTTHUMT00000378738.1		0.00	128	0	-	NM_014294		71520335	-1	tier1		no_errors	ENST00000262213	ensembl	human	known	74_37	frame_shift_ins	28.93	86	35	INS	1.000:1.000	AGAC
TRPM1	4308	genome.wustl.edu	37	15	31330034	31330034	+	Silent	SNP	T	T	C	rs375858952		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr15:31330034T>C	ENST00000256552.6	-	20	2598	c.2451A>G	c.(2449-2451)gcA>gcG	p.A817A	TRPM1_ENST00000397795.2_Silent_p.A795A|TRPM1_ENST00000542188.1_Silent_p.A834A|RP11-348B17.1_ENST00000561299.1_RNA|RP11-348B17.1_ENST00000558755.1_RNA	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		AGCCAGCATCTGCATTTGCAT	0.478																																																	0								T		1,4031		0,1,2015	123.0	112.0	116.0		2385	2.2	1.0	15		116	0,8398		0,0,4199	no	coding-synonymous	TRPM1	NM_002420.4		0,1,6214	CC,CT,TT		0.0,0.0248,0.0080		795/1604	31330034	1,12429	2016	4199	6215	SO:0001819	synonymous_variant	0			AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.2451A>G	15.37:g.31330034T>C				Silent	SNP	pfam_Ion_trans_dom	p.A834	ENST00000256552.6	37	c.2502	CCDS58346.1	15																																																																																			TRPM1	-	NULL	ENSG00000134160		0.478	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	TRPM1	HGNC	protein_coding	OTTHUMT00000417166.2	-	0.00	73	0	T	NM_002420		31330034	-1	tier1	-	no_errors	ENST00000542188	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.994	C
TRPM2	7226	genome.wustl.edu	37	21	45799027	45799027	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr21:45799027C>G	ENST00000397928.1	+	8	1607	c.1162C>G	c.(1162-1164)Cag>Gag	p.Q388E	TRPM2_ENST00000397932.2_Missense_Mutation_p.Q388E|TRPM2_ENST00000300482.5_Missense_Mutation_p.Q388E|TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000300481.9_Missense_Mutation_p.Q388E	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	388					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						CGTGTTCTTCCAGGAGATGTT	0.587																																																	0													126.0	91.0	103.0					21																	45799027		2203	4300	6503	SO:0001583	missense	0			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.1162C>G	21.37:g.45799027C>G	ENSP00000381023:p.Gln388Glu		D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	pfam_Ion_trans_dom,superfamily_NUDIX_hydrolase_dom-like	p.Q388E	ENST00000397928.1	37	c.1162	CCDS13710.1	21	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.488311	0.01018	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.22743	1.94;1.94;1.94;1.94	3.84	3.84	0.44239	.	0.501016	0.21925	N	0.067109	T	0.13415	0.0325	N	0.21282	0.65	0.27614	N	0.948552	B;B	0.31435	0.323;0.323	B;B	0.27380	0.079;0.079	T	0.12734	-1.0536	10	0.31617	T	0.26	-30.8331	12.0439	0.53469	0.1729:0.8271:0.0:0.0	.	388;388	E9PGK7;O94759	.;TRPM2_HUMAN	E	388	ENSP00000300482:Q388E;ENSP00000381023:Q388E;ENSP00000300481:Q388E;ENSP00000381026:Q388E	ENSP00000300481:Q388E	Q	+	1	0	TRPM2	44623455	0.951000	0.32395	1.000000	0.80357	0.391000	0.30476	1.779000	0.38624	1.971000	0.57363	0.563000	0.77884	CAG	TRPM2	-	NULL	ENSG00000142185		0.587	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	HGNC	protein_coding	OTTHUMT00000098086.1		0.00	52	0	C	NM_003307		45799027	+1			no_errors	ENST00000300482	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	G
TRPM5	29850	genome.wustl.edu	37	11	2436661	2436661	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr11:2436661C>G	ENST00000155858.6	-	9	1177	c.1169G>C	c.(1168-1170)aGc>aCc	p.S390T	TRPM5_ENST00000533060.1_Missense_Mutation_p.S390T|TRPM5_ENST00000528453.1_Missense_Mutation_p.S390T|TRPM5_ENST00000452833.1_Missense_Mutation_p.S392T	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		GGGCTTGTTGCTGACCAGGGC	0.632																																					NSCLC(1;49 61 17205 18850 43201)												0													23.0	22.0	22.0					11																	2436661		2197	4295	6492	SO:0001583	missense	0			AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.1169G>C	11.37:g.2436661C>G	ENSP00000155858:p.Ser390Thr			Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom	p.S392T	ENST00000155858.6	37	c.1175	CCDS31340.1	11	.	.	.	.	.	.	.	.	.	.	C	16.47	3.132516	0.56828	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453;ENST00000437542	T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54	3.21	1.59	0.23543	.	0.137826	0.48767	D	0.000167	T	0.14485	0.0350	N	0.17474	0.49	0.28522	N	0.913022	P;P;B	0.45348	0.856;0.856;0.203	B;B;B	0.43536	0.423;0.423;0.09	T	0.10636	-1.0621	10	0.09843	T	0.71	-13.0414	4.0707	0.09880	0.0:0.4812:0.0:0.5188	.	390;392;390	E9PRW0;Q9NZQ8-2;Q9NZQ8	.;.;TRPM5_HUMAN	T	384;390;392;390;390;390	ENSP00000434383:S384T;ENSP00000155858:S390T;ENSP00000387965:S392T;ENSP00000434121:S390T;ENSP00000436809:S390T	ENSP00000155858:S390T	S	-	2	0	TRPM5	2393237	1.000000	0.71417	0.989000	0.46669	0.986000	0.74619	4.524000	0.60552	0.695000	0.31675	0.491000	0.48974	AGC	TRPM5	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000070985		0.632	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPM5	HGNC	protein_coding	OTTHUMT00000027378.1	-	0.00	54	0	C	NM_014555		2436661	-1	tier1	-	no_errors	ENST00000452833	ensembl	human	known	74_37	missense	26.19	31	11	SNP	1.000	G
TTC37	9652	genome.wustl.edu	37	5	94833131	94833131	+	Silent	SNP	G	G	T	rs140800288		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr5:94833131G>T	ENST00000358746.2	-	34	3923	c.3625C>A	c.(3625-3627)Cga>Aga	p.R1209R		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	1209						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						TTTGCATTTCGTTGAGCATAC	0.368																																																	0													119.0	106.0	110.0					5																	94833131		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.3625C>A	5.37:g.94833131G>T			O15077|Q6PJI3	Silent	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R1209	ENST00000358746.2	37	c.3625	CCDS4072.1	5																																																																																			TTC37	-	NULL	ENSG00000198677		0.368	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC37	HGNC	protein_coding	OTTHUMT00000241651.1	-	0.00	76	0	G	NM_014639		94833131	-1	tier1	-	no_errors	ENST00000358746	ensembl	human	known	74_37	silent	11.54	23	3	SNP	0.120	T
TTLL5	23093	genome.wustl.edu	37	14	76175543	76175543	+	Intron	SNP	A	A	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr14:76175543A>G	ENST00000298832.9	+	9	945				TTLL5_ENST00000286650.5_Silent_p.G254G|TTLL5_ENST00000555422.1_3'UTR|TTLL5_ENST00000557636.1_Intron	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5						fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		GGAAGATGGGAAATACCATGG	0.348																																																	0													46.0	40.0	42.0					14																	76175543		876	1991	2867	SO:0001627	intron_variant	0			AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.740+1493A>G	14.37:g.76175543A>G			B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	Silent	SNP	pfam_TTL/TTLL_fam	p.G254	ENST00000298832.9	37	c.762	CCDS32124.1	14																																																																																			TTLL5	-	NULL	ENSG00000119685		0.348	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL5	HGNC	protein_coding	OTTHUMT00000414453.1	-	0.00	82	0	A	NM_015072		76175543	+1	tier1	-	no_errors	ENST00000286650	ensembl	human	novel	74_37	silent	6.78	55	4	SNP	0.011	G
TTN	7273	genome.wustl.edu	37	2	179598557	179598557	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:179598557G>T	ENST00000591111.1	-	51	14832	c.14608C>A	c.(14608-14610)Ctg>Atg	p.L4870M	TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.L3943M|TTN_ENST00000589042.1_Missense_Mutation_p.L5187M|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000582847.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12252	Ig-like 29.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.L3943M(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCAGCTTGCAGGGTAACGGTT	0.408																																																	1	Substitution - Missense(1)	lung(1)											123.0	118.0	119.0					2																	179598557		1939	4144	6083	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.14608C>A	2.37:g.179598557G>T	ENSP00000465570:p.Leu4870Met		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.L3943M	ENST00000591111.1	37	c.11827		2	.	.	.	.	.	.	.	.	.	.	G	10.68	1.419087	0.25552	.	.	ENSG00000155657	ENST00000342992	T	0.74842	-0.88	5.99	3.64	0.41730	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);	.	.	.	.	T	0.70527	0.3234	M	0.64260	1.97	0.80722	D	1	P	0.47604	0.898	P	0.45167	0.472	T	0.69079	-0.5240	9	0.87932	D	0	.	5.2814	0.15678	0.7285:0.0:0.1415:0.13	.	4870	Q8WZ42	TITIN_HUMAN	M	3943	ENSP00000343764:L3943M	ENSP00000343764:L3943M	L	-	1	2	TTN	179306802	1.000000	0.71417	0.990000	0.47175	0.894000	0.52154	3.275000	0.51639	0.515000	0.28320	-0.302000	0.09304	CTG	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	52	0	G	NM_133378		179598557	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.977	T
UBR4	23352	genome.wustl.edu	37	1	19499498	19499498	+	Silent	SNP	C	C	T	rs374365470		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:19499498C>T	ENST00000375254.3	-	25	3408	c.3381G>A	c.(3379-3381)gcG>gcA	p.A1127A	UBR4_ENST00000375267.2_Silent_p.A1127A|UBR4_ENST00000375217.2_Silent_p.A1127A|UBR4_ENST00000375226.2_Silent_p.A1127A	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1127					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CCTTTGAGATCGCGGCATCAA	0.448																																																	0								G		1,4405		0,1,2202	87.0	79.0	82.0		3381	-5.2	0.7	1		82	0,8600		0,0,4300	no	coding-synonymous	UBR4	NM_020765.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		1127/5184	19499498	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.3381G>A	1.37:g.19499498C>T			A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.A1127	ENST00000375254.3	37	c.3381	CCDS189.1	1																																																																																			UBR4	-	NULL	ENSG00000127481		0.448	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	-	0.00	53	0	C	NM_020765		19499498	-1	tier1	-	no_errors	ENST00000375267	ensembl	human	known	74_37	silent	15.00	68	12	SNP	0.740	T
TXNIP	10628	genome.wustl.edu	37	1	145442477	145442477	+	3'UTR	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:145442477G>T	ENST00000369317.4	+	0	2769				TXNIP_ENST00000475171.1_3'UTR	NM_006472.3	NP_006463.3	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein						cell cycle (GO:0007049)|cellular response to tumor cell (GO:0071228)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|negative regulation of cell division (GO:0051782)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|protein import into nucleus (GO:0006606)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	21	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					ATTACAGCCAGAAAGTGTGGG	0.408																																																	0																																										SO:0001624	3_prime_UTR_variant	0			S73591	CCDS72876.1	1q11	2008-07-18			ENSG00000117289	ENSG00000265972			16952	protein-coding gene	gene with protein product	"""upregulated by 1,25-dihydroxyvitamin D-3"", ""thioredoxin binding protein 2"""	606599				8086474	Standard	NM_006472		Approved	VDUP1, EST01027, HHCPA78, THIF	uc001enn.4	Q9H3M7	OTTHUMG00000013755	ENST00000369317.4:c.*1259G>T	1.37:g.145442477G>T			B4E3D3|Q16226|Q6PML0|Q9BXG9	RNA	SNP	-	NULL	ENST00000369317.4	37	NULL	CCDS913.1	1																																																																																			TXNIP	-	-	ENSG00000117289		0.408	TXNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNIP	HGNC	protein_coding	OTTHUMT00000038547.1	-	0.00	78	0	G	NM_006472		145442477	+1	tier1	-	no_errors	ENST00000475171	ensembl	human	known	74_37	rna	6.45	58	4	SNP	0.998	T
UNC80	285175	genome.wustl.edu	37	2	210683747	210683747	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr2:210683747C>T	ENST00000439458.1	+	12	1804	c.1724C>T	c.(1723-1725)gCg>gTg	p.A575V	UNC80_ENST00000272845.6_Missense_Mutation_p.A575V	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	575					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						ATCACAGTTGCGACCTTCAAT	0.423																																																	0													129.0	104.0	112.0					2																	210683747		692	1591	2283	SO:0001583	missense	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.1724C>T	2.37:g.210683747C>T	ENSP00000391088:p.Ala575Val		B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NULL	p.A575V	ENST00000439458.1	37	c.1724	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	C	26.5	4.745388	0.89663	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.35236	1.33;1.32	5.82	5.82	0.92795	.	.	.	.	.	T	0.47581	0.1453	N	0.19112	0.55	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.37663	-0.9696	9	0.34782	T	0.22	-5.4664	20.0951	0.97834	0.0:1.0:0.0:0.0	.	575	Q8N2C7	UNC80_HUMAN	V	575	ENSP00000391088:A575V;ENSP00000272845:A575V	ENSP00000272845:A575V	A	+	2	0	UNC80	210391992	1.000000	0.71417	0.956000	0.39512	0.495000	0.33615	7.818000	0.86416	2.753000	0.94483	0.467000	0.42956	GCG	UNC80	-	NULL	ENSG00000144406		0.423	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding			0.00	40	0	C	NM_182587		210683747	+1			no_errors	ENST00000439458	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
USP14	9097	genome.wustl.edu	37	18	203144	203144	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr18:203144G>T	ENST00000261601.7	+	12	1080	c.989G>T	c.(988-990)cGa>cTa	p.R330L	USP14_ENST00000400266.3_Missense_Mutation_p.R319L|USP14_ENST00000383589.2_Missense_Mutation_p.R284L|USP14_ENST00000582707.1_Missense_Mutation_p.R295L	NM_005151.3	NP_005142.1	P54578	UBP14_HUMAN	ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)	330	USP.				negative regulation of endopeptidase activity (GO:0010951)|protein deubiquitination (GO:0016579)|regulation of chemotaxis (GO:0050920)|regulation of proteasomal protein catabolic process (GO:0061136)|synaptic transmission (GO:0007268)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)|synapse (GO:0045202)	cysteine-type endopeptidase activity (GO:0004197)|endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)|tRNA guanylyltransferase activity (GO:0008193)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(2)	11		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				CAGATGGTTCGATTTTTTTAT	0.343																																																	0													71.0	75.0	73.0					18																	203144		2203	4300	6503	SO:0001583	missense	0			U30888	CCDS32780.1, CCDS32781.1	18p11.32	2006-10-06	2005-08-08			ENSG00000101557		"""Ubiquitin-specific peptidases"""	12612	protein-coding gene	gene with protein product		607274	"""ubiquitin specific protease 14 (tRNA-guanine transglycosylase)"""			12838346	Standard	NM_001037334		Approved	TGT	uc002kkf.1	P54578		ENST00000261601.7:c.989G>T	18.37:g.203144G>T	ENSP00000261601:p.Arg330Leu		J3QRZ5|Q53XY5	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,smart_Ubiquitin_dom,pfscan_Peptidase_C19/C67,pfscan_Ubiquitin_supergroup	p.R330L	ENST00000261601.7	37	c.989	CCDS32780.1	18	.	.	.	.	.	.	.	.	.	.	g	35	5.467976	0.96257	.	.	ENSG00000101557	ENST00000261601;ENST00000383589;ENST00000400266	T;T	0.61040	0.14;0.14	5.8	5.8	0.92144	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.061993	0.64402	D	0.000002	D	0.85057	0.5610	H	0.96943	3.91	0.80722	D	1	D;D;D	0.76494	0.999;0.989;0.994	D;D;D	0.74348	0.983;0.959;0.944	D	0.89457	0.3734	10	0.87932	D	0	-11.9134	20.062	0.97678	0.0:0.0:1.0:0.0	.	319;295;330	B7Z4N8;A6NJA2;P54578	.;.;UBP14_HUMAN	L	330;295;319	ENSP00000261601:R330L;ENSP00000383125:R319L	ENSP00000261601:R330L	R	+	2	0	USP14	193144	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.389000	0.79806	2.730000	0.93505	0.563000	0.77884	CGA	USP14	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000101557		0.343	USP14-003	KNOWN	basic|appris_principal|CCDS	protein_coding	USP14	HGNC	protein_coding	OTTHUMT00000440305.3		0.00	66	0	G	NM_005151		203144	+1			no_errors	ENST00000261601	ensembl	human	known	74_37	missense	8.00	23	2	SNP	1.000	T
VSIG10	54621	genome.wustl.edu	37	12	118517313	118517313	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr12:118517313C>T	ENST00000359236.5	-	4	1039	c.763G>A	c.(763-765)Gac>Aac	p.D255N	VSIG10_ENST00000536905.1_5'Flank	NM_019086.5	NP_061959.2	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10	255	Ig-like C2-type 3.					integral component of membrane (GO:0016021)				endometrium(5)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|urinary_tract(1)	17						CACAGGAAGTCAGGGTCAGGG	0.567																																																	0													112.0	116.0	114.0					12																	118517313		2023	4200	6223	SO:0001583	missense	0				CCDS44992.1	12q24.23	2013-01-29			ENSG00000176834	ENSG00000176834		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26078	protein-coding gene	gene with protein product						12477932	Standard	NM_019086		Approved		uc001tws.3	Q8N0Z9		ENST00000359236.5:c.763G>A	12.37:g.118517313C>T	ENSP00000352172:p.Asp255Asn		Q9NWQ7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.D255N	ENST00000359236.5	37	c.763	CCDS44992.1	12	.	.	.	.	.	.	.	.	.	.	C	9.892	1.204402	0.22205	.	.	ENSG00000176834	ENST00000359236;ENST00000538357	T;T	0.14516	2.5;2.5	6.14	-6.9	0.01655	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.035180	0.02082	N	0.052454	T	0.08537	0.0212	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.26916	-1.0089	10	0.18276	T	0.48	-2.9229	9.4634	0.38798	0.084:0.1:0.084:0.7321	.	255	Q8N0Z9	VSI10_HUMAN	N	255;154	ENSP00000352172:D255N;ENSP00000442861:D154N	ENSP00000352172:D255N	D	-	1	0	VSIG10	117001696	0.000000	0.05858	0.000000	0.03702	0.693000	0.40251	-0.172000	0.09868	-1.200000	0.02662	-0.898000	0.02899	GAC	VSIG10	-	pfscan_Ig-like_dom	ENSG00000176834		0.567	VSIG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSIG10	HGNC	protein_coding	OTTHUMT00000401273.2	-	0.00	46	0	C	NM_019086		118517313	-1	tier1	-	no_errors	ENST00000359236	ensembl	human	known	74_37	missense	36.11	23	13	SNP	0.000	T
VSIG10	54621	genome.wustl.edu	37	12	118517327	118517327	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr12:118517327C>T	ENST00000359236.5	-	4	1025	c.749G>A	c.(748-750)gGa>gAa	p.G250E	VSIG10_ENST00000536905.1_5'Flank	NM_019086.5	NP_061959.2	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10	250	Ig-like C2-type 3.					integral component of membrane (GO:0016021)				endometrium(5)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|urinary_tract(1)	17						GTCAGGGTATCCCCCATCCCA	0.572																																																	0													117.0	121.0	119.0					12																	118517327		2042	4195	6237	SO:0001583	missense	0				CCDS44992.1	12q24.23	2013-01-29			ENSG00000176834	ENSG00000176834		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26078	protein-coding gene	gene with protein product						12477932	Standard	NM_019086		Approved		uc001tws.3	Q8N0Z9		ENST00000359236.5:c.749G>A	12.37:g.118517327C>T	ENSP00000352172:p.Gly250Glu		Q9NWQ7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.G250E	ENST00000359236.5	37	c.749	CCDS44992.1	12	.	.	.	.	.	.	.	.	.	.	C	32	5.108087	0.94292	.	.	ENSG00000176834	ENST00000359236;ENST00000538357	T;T	0.17370	2.28;2.28	6.14	6.14	0.99180	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.45606	D	0.000358	T	0.48960	0.1529	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.43523	-0.9386	10	0.87932	D	0	-24.7291	20.8597	0.99761	0.0:1.0:0.0:0.0	.	250	Q8N0Z9	VSI10_HUMAN	E	250;149	ENSP00000352172:G250E;ENSP00000442861:G149E	ENSP00000352172:G250E	G	-	2	0	VSIG10	117001710	0.994000	0.37717	0.999000	0.59377	0.993000	0.82548	5.275000	0.65575	2.937000	0.99478	0.650000	0.86243	GGA	VSIG10	-	pfscan_Ig-like_dom	ENSG00000176834		0.572	VSIG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSIG10	HGNC	protein_coding	OTTHUMT00000401273.2	-	0.00	51	0	C	NM_019086		118517327	-1	tier1	-	no_errors	ENST00000359236	ensembl	human	known	74_37	missense	39.53	26	17	SNP	0.999	T
VTI1A	143187	genome.wustl.edu	37	10	114224339	114224339	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr10:114224339C>T	ENST00000393077.2	+	3	303	c.187C>T	c.(187-189)Cca>Tca	p.P63S	VTI1A_ENST00000432306.1_Missense_Mutation_p.P63S	NM_145206.2	NP_660207.2	Q96AJ9	VTI1A_HUMAN	vesicle transport through interaction with t-SNAREs 1A	63					intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	SNAP receptor activity (GO:0005484)		VTI1A/TCF7L2(8)	breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)		CCGAGAGATACCACCCCAAAG	0.383			T	TCF7L2	colorectal																																			Dom	yes		10	10q25.2	143187	vesicle transport through interaction with t-SNAREs homolog 1A		E	0													118.0	108.0	111.0					10																	114224339		2203	4300	6503	SO:0001583	missense	0			BC017052	CCDS7575.2	10q25.2	2012-12-10	2012-12-10		ENSG00000151532	ENSG00000151532			17792	protein-coding gene	gene with protein product		614316	"""vesicle transport through interaction with t-SNAREs homolog 1A (yeast)"""			9446565	Standard	NM_145206		Approved	MVti1, Vti1a, Vti1-rp2	uc001kzz.3	Q96AJ9	OTTHUMG00000019063	ENST00000393077.2:c.187C>T	10.37:g.114224339C>T	ENSP00000376792:p.Pro63Ser		A2A307|B4E137|Q5W0D7	Missense_Mutation	SNP	pfam_Vesicle_trsprt_v-SNARE_N,superfamily_t-SNARE,smart_T_SNARE_dom	p.P63S	ENST00000393077.2	37	c.187	CCDS7575.2	10	.	.	.	.	.	.	.	.	.	.	C	20.2	3.956178	0.73902	.	.	ENSG00000151532	ENST00000393077;ENST00000432306	.	.	.	5.62	5.62	0.85841	t-SNARE (1);Vesicle transport v-SNARE, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.69815	0.3153	L	0.55103	1.725	0.58432	D	0.999991	B;P	0.38677	0.256;0.642	B;P	0.47528	0.288;0.549	T	0.69439	-0.5145	9	0.52906	T	0.07	-30.1432	19.6486	0.95791	0.0:1.0:0.0:0.0	.	63;63	Q5W0D7;Q96AJ9	.;VTI1A_HUMAN	S	63	.	ENSP00000376792:P63S	P	+	1	0	VTI1A	114214329	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.141000	0.77330	2.646000	0.89796	0.591000	0.81541	CCA	VTI1A	-	pfam_Vesicle_trsprt_v-SNARE_N,superfamily_t-SNARE	ENSG00000151532		0.383	VTI1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VTI1A	HGNC	protein_coding	OTTHUMT00000050397.2		0.00	56	0	C			114224339	+1			no_errors	ENST00000393077	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
XPO6	23214	genome.wustl.edu	37	16	28133018	28133018	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr16:28133018G>T	ENST00000304658.5	-	14	2332	c.1832C>A	c.(1831-1833)tCa>tAa	p.S611*	XPO6_ENST00000565698.1_Nonsense_Mutation_p.S597*	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	611					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						TTTCAATACTGATGGCACAGC	0.393																																																	0													184.0	176.0	178.0					16																	28133018		1894	4122	6016	SO:0001587	stop_gained	0			AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.1832C>A	16.37:g.28133018G>T	ENSP00000302790:p.Ser611*		A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Nonsense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.S611*	ENST00000304658.5	37	c.1832	CCDS42135.1	16	.	.	.	.	.	.	.	.	.	.	G	44	11.018439	0.99503	.	.	ENSG00000169180	ENST00000304658	.	.	.	5.76	5.76	0.90799	.	0.061993	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-7.6274	17.4796	0.87669	0.0:0.0:1.0:0.0	.	.	.	.	X	611	.	ENSP00000302790:S611X	S	-	2	0	XPO6	28040519	1.000000	0.71417	0.991000	0.47740	0.988000	0.76386	7.745000	0.85046	2.706000	0.92434	0.655000	0.94253	TCA	XPO6	-	superfamily_ARM-type_fold	ENSG00000169180		0.393	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO6	HGNC	protein_coding	OTTHUMT00000433732.1		0.00	60	0	G	XM_055195		28133018	-1			no_errors	ENST00000304658	ensembl	human	known	74_37	nonsense	5.26	36	2	SNP	1.000	T
ZDHHC16	84287	genome.wustl.edu	37	10	99211446	99211446	+	Missense_Mutation	SNP	G	G	T	rs141510622		TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr10:99211446G>T	ENST00000370854.3	+	2	203	c.14G>T	c.(13-15)cGg>cTg	p.R5L	ZDHHC16_ENST00000352634.4_Missense_Mutation_p.R5L|ZDHHC16_ENST00000353979.3_Missense_Mutation_p.R5L|ZDHHC16_ENST00000370846.4_Missense_Mutation_p.R5L|ZDHHC16_ENST00000370842.2_Missense_Mutation_p.R5L|ZDHHC16_ENST00000393760.1_Missense_Mutation_p.R5L|ZDHHC16_ENST00000345745.5_Missense_Mutation_p.R5L	NM_032327.2	NP_115703.2	Q969W1	ZDH16_HUMAN	zinc finger, DHHC-type containing 16	5					apoptotic process (GO:0006915)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.R5Q(1)		kidney(4)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	14		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)		CGAGGCCAGCGGAGCCTGCTG	0.642																																																	1	Substitution - Missense(1)	skin(1)											27.0	31.0	30.0					10																	99211446		2203	4299	6502	SO:0001583	missense	0			AF258563	CCDS7460.1, CCDS7461.1, CCDS7462.1, CCDS7463.1, CCDS73176.1	10q24.1	2008-05-02			ENSG00000171307	ENSG00000171307		"""Zinc fingers, DHHC-type"""	20714	protein-coding gene	gene with protein product						12021275	Standard	NM_198043		Approved	APH2	uc001knk.3	Q969W1	OTTHUMG00000018847	ENST00000370854.3:c.14G>T	10.37:g.99211446G>T	ENSP00000359891:p.Arg5Leu		D3DR52|D3DR53|D3DR54|Q5JTG7|Q5JTH0|Q8N4Z6|Q8WY84|Q9BSV3	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.R5L	ENST00000370854.3	37	c.14	CCDS7460.1	10	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921101	0.73213	.	.	ENSG00000171307	ENST00000370854;ENST00000393760;ENST00000414567;ENST00000370846;ENST00000352634;ENST00000353979;ENST00000370842;ENST00000345745;ENST00000433086	T;T;T;T;T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0;2.0;2.0;2.0;2.0	5.59	5.59	0.84812	.	0.198090	0.39407	N	0.001363	T	0.32285	0.0824	L	0.29908	0.895	0.39776	D	0.972231	D;D;B;D;D;D;D	0.76494	0.987;0.998;0.029;0.992;0.999;0.992;0.987	D;D;B;D;D;D;D	0.79784	0.931;0.985;0.027;0.969;0.993;0.969;0.953	T	0.07481	-1.0770	10	0.72032	D	0.01	0.0065	10.6764	0.45789	0.1171:0.0:0.8829:0.0	.	5;5;5;5;5;5;5	B4DNL2;E9PCL9;B1AMU0;Q969W1-3;Q969W1-4;Q969W1-2;Q969W1	.;.;.;.;.;.;ZDH16_HUMAN	L	5	ENSP00000359891:R5L;ENSP00000377357:R5L;ENSP00000400719:R5L;ENSP00000359883:R5L;ENSP00000345383:R5L;ENSP00000323360:R5L;ENSP00000359879:R5L;ENSP00000304487:R5L;ENSP00000398532:R5L	ENSP00000304487:R5L	R	+	2	0	ZDHHC16	99201436	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.057000	0.57455	2.641000	0.89580	0.561000	0.74099	CGG	ZDHHC16	-	NULL	ENSG00000171307		0.642	ZDHHC16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZDHHC16	HGNC	protein_coding	OTTHUMT00000049658.2		0.00	30	0	G	NM_032327		99211446	+1			no_errors	ENST00000370854	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
ZMYM6	9204	genome.wustl.edu	37	1	35452920	35452920	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:35452920G>C	ENST00000357182.4	-	16	3990	c.3763C>G	c.(3763-3765)Cag>Gag	p.Q1255E	RP11-244H3.1_ENST00000417456.1_RNA|ZMYM6_ENST00000493328.1_5'UTR|ZMYM6_ENST00000487874.1_Intron|ZMYM6_ENST00000373340.2_Intron|ZMYM6NB_ENST00000373337.3_5'Flank	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	1255					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				ATCCAAAACTGAGTTACAGAC	0.343																																																	0													77.0	74.0	75.0					1																	35452920		1831	4092	5923	SO:0001583	missense	0			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.3763C>G	1.37:g.35452920G>C	ENSP00000349708:p.Gln1255Glu		B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	pfam_Znf_MYM,superfamily_RNaseH-like_dom,smart_TRASH_dom	p.Q1255E	ENST00000357182.4	37	c.3763	CCDS387.2	1	.	.	.	.	.	.	.	.	.	.	G	13.14	2.149399	0.37923	.	.	ENSG00000163867	ENST00000357182	T	0.17854	2.25	4.56	4.56	0.56223	Ribonuclease H-like (1);	0.059469	0.64402	D	0.000002	T	0.10852	0.0265	N	0.22421	0.69	0.80722	D	1	B	0.29862	0.259	B	0.30179	0.112	T	0.09509	-1.0671	10	0.09084	T	0.74	-7.0294	13.1425	0.59442	0.0:0.0:1.0:0.0	.	1255	O95789	ZMYM6_HUMAN	E	1255	ENSP00000349708:Q1255E	ENSP00000349708:Q1255E	Q	-	1	0	ZMYM6	35225507	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	1.073000	0.30691	2.820000	0.97059	0.650000	0.86243	CAG	ZMYM6	-	superfamily_RNaseH-like_dom	ENSG00000163867		0.343	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM6	HGNC	protein_coding	OTTHUMT00000011999.1	-	0.00	63	0	G	NM_007167		35452920	-1	tier1	-	no_errors	ENST00000357182	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	C
ZNF326	284695	genome.wustl.edu	37	1	90486372	90486372	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:90486372T>C	ENST00000340281.4	+	10	1339	c.1196T>C	c.(1195-1197)aTg>aCg	p.M399T	ZNF326_ENST00000455342.2_Missense_Mutation_p.M193T|ZNF326_ENST00000370447.3_Missense_Mutation_p.M310T	NM_182976.2	NP_892021.1	Q5BKZ1	ZN326_HUMAN	zinc finger protein 326	399					mRNA processing (GO:0006397)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, elongation (GO:0032784)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	DBIRD complex (GO:0044609)|nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(7)|ovary(1)	25		all_lung(203;0.0116)|Lung NSC(277;0.0417)		all cancers(265;0.00728)|Epithelial(280;0.0265)		GATGATCACATGATGAAGGTA	0.333																																																	0													150.0	148.0	149.0					1																	90486372		2203	4300	6503	SO:0001583	missense	0			BC013102	CCDS727.1, CCDS728.1	1p22	2012-04-19			ENSG00000162664	ENSG00000162664		"""Zinc fingers, C2H2-type"""	14104	protein-coding gene	gene with protein product	"""ZNF-protein interacting with nuclear mRNPs and DBC1"""	614601				22446626	Standard	NM_182976		Approved	Zfp326, ZAN75, FLJ20403, ZIRD	uc001dnq.2	Q5BKZ1	OTTHUMG00000010675	ENST00000340281.4:c.1196T>C	1.37:g.90486372T>C	ENSP00000340796:p.Met399Thr		A8MYX1|B4DLN0|B4E179|Q5VW93|Q5VW94|Q5VW96|Q5VW97|Q6NSA2|Q7Z638|Q7Z6C2	Missense_Mutation	SNP	pfam_AKAP95	p.M399T	ENST00000340281.4	37	c.1196	CCDS727.1	1	.	.	.	.	.	.	.	.	.	.	T	18.97	3.735407	0.69189	.	.	ENSG00000162664	ENST00000394590;ENST00000340281;ENST00000370447;ENST00000455342	T;T;T	0.51817	0.69;0.69;0.69	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.60183	0.2249	M	0.66939	2.045	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.75020	0.985;0.985	T	0.65315	-0.6198	10	0.72032	D	0.01	-7.541	15.7684	0.78146	0.0:0.0:0.0:1.0	.	399;399	A8MYX1;Q5BKZ1	.;ZN326_HUMAN	T	399;399;310;193	ENSP00000340796:M399T;ENSP00000359476:M310T;ENSP00000403470:M193T	ENSP00000340796:M399T	M	+	2	0	ZNF326	90258960	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.364000	0.73086	2.138000	0.66242	0.460000	0.39030	ATG	ZNF326	-	pfam_AKAP95	ENSG00000162664		0.333	ZNF326-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF326	HGNC	protein_coding	OTTHUMT00000029428.2	-	0.00	56	0	T	NM_181781		90486372	+1	tier1	-	no_errors	ENST00000340281	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	C
ZNF528	84436	genome.wustl.edu	37	19	52919153	52919153	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:52919153G>T	ENST00000360465.3	+	7	1474	c.1048G>T	c.(1048-1050)Gag>Tag	p.E350*	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	350					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		TCATACTGGTGAGAAACCTTA	0.388																																																	0													66.0	65.0	66.0					19																	52919153		2203	4300	6503	SO:0001587	stop_gained	0			AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.1048G>T	19.37:g.52919153G>T	ENSP00000353652:p.Glu350*		B3KPN4|Q86T88|Q96JK0	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E350*	ENST00000360465.3	37	c.1048	CCDS33091.1	19	.	.	.	.	.	.	.	.	.	.	G	36	5.870921	0.97049	.	.	ENSG00000167555	ENST00000360465	.	.	.	2.08	2.08	0.27032	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	11.173	0.48582	0.0:0.0:1.0:0.0	.	.	.	.	X	350	.	ENSP00000353652:E350X	E	+	1	0	ZNF528	57610965	0.998000	0.40836	0.940000	0.37924	0.140000	0.21249	2.745000	0.47459	1.134000	0.42165	0.655000	0.94253	GAG	ZNF528	-	pfscan_Znf_C2H2	ENSG00000167555		0.388	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF528	HGNC	protein_coding	OTTHUMT00000344336.1	-	0.00	42	0	G	NM_032423		52919153	+1	tier1	-	no_errors	ENST00000360465	ensembl	human	known	74_37	nonsense	21.43	33	9	SNP	1.000	T
ZNF525	170958	genome.wustl.edu	37	19	53885037	53885037	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:53885037G>A	ENST00000355326.3	+	1	359	c.359G>A	c.(358-360)cGt>cAt	p.R120H	ZNF525_ENST00000475179.1_Intron|ZNF525_ENST00000467003.1_Missense_Mutation_p.R366H|ZNF525_ENST00000474037.1_Missense_Mutation_p.R402H|ZNF525_ENST00000593918.1_Intron			Q8N782	ZN525_HUMAN	zinc finger protein 525	120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)|lung(3)	9						ACATGCCATCGTAGACTTCAT	0.383																																																	0																																										SO:0001583	missense	0			AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277	ENST00000355326.3:c.359G>A	19.37:g.53885037G>A	ENSP00000408929:p.Arg120His		Q8TF23	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R120H	ENST00000355326.3	37	c.359		19	.	.	.	.	.	.	.	.	.	.	G	6.326	0.428182	0.11987	.	.	ENSG00000203326	ENST00000474037;ENST00000467003;ENST00000355326	T;T;T	0.37584	2.21;2.21;1.19	1.64	-2.74	0.05932	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24160	0.0585	.	.	.	0.09310	N	1	B	0.23316	0.083	B	0.19666	0.026	T	0.22871	-1.0204	8	0.56958	D	0.05	.	7.7338	0.28802	0.8576:0.0:0.1424:0.0	.	120	Q8N782	ZN525_HUMAN	H	402;366;120	ENSP00000417696:R402H;ENSP00000419136:R366H;ENSP00000408929:R120H	ENSP00000408929:R120H	R	+	2	0	ZNF525	58576849	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-1.560000	0.02160	-0.668000	0.05296	-1.809000	0.00614	CGT	ZNF525	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000203326		0.383	ZNF525-201	KNOWN	basic	protein_coding	ZNF525	HGNC	protein_coding			0.00	75	0	G	NR_003699		53885037	+1			no_errors	ENST00000355326	ensembl	human	known	74_37	missense	6.02	78	5	SNP	0.178	A
ZNF568	374900	genome.wustl.edu	37	19	37440440	37440440	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:37440440A>T	ENST00000333987.7	+	7	891	c.385A>T	c.(385-387)Aag>Tag	p.K129*	ZNF568_ENST00000415168.1_Nonsense_Mutation_p.K65*|ZNF568_ENST00000455427.2_Intron|ZNF568_ENST00000427117.1_Intron	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	129					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGAACAGATCAAGAAGCAACA	0.318																																																	0													56.0	50.0	52.0					19																	37440440		1823	4086	5909	SO:0001587	stop_gained	0			BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.385A>T	19.37:g.37440440A>T	ENSP00000334685:p.Lys129*		B4DS92|E7ER33|Q6N060|Q8NA64	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K129*	ENST00000333987.7	37	c.385	CCDS42558.1	19	.	.	.	.	.	.	.	.	.	.	A	36	5.839672	0.97009	.	.	ENSG00000198453	ENST00000333987;ENST00000415168	.	.	.	4.31	2.22	0.28083	.	0.405249	0.18206	N	0.148333	.	.	.	.	.	.	0.38089	D	0.93691	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	6.8169	0.23835	0.7998:0.0:0.2002:0.0	.	.	.	.	X	129;65	.	ENSP00000334685:K129X	K	+	1	0	ZNF568	42132280	0.000000	0.05858	0.978000	0.43139	0.998000	0.95712	0.080000	0.14802	0.306000	0.22856	0.533000	0.62120	AAG	ZNF568	-	NULL	ENSG00000198453		0.318	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF568	HGNC	protein_coding	OTTHUMT00000109572.2	-	0.00	42	0	A	NM_198539		37440440	+1	tier1	-	no_errors	ENST00000333987	ensembl	human	known	74_37	nonsense	8.77	52	5	SNP	0.706	T
ZNF583	147949	genome.wustl.edu	37	19	56935610	56935610	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:56935610C>G	ENST00000333201.9	+	5	1793	c.1583C>G	c.(1582-1584)tCt>tGt	p.S528C	ZNF583_ENST00000585612.1_Intron|ZNF583_ENST00000291598.7_Missense_Mutation_p.S528C	NM_001159861.1|NM_152478.2	NP_001153333.1|NP_689691.2	Q96ND8	ZN583_HUMAN	zinc finger protein 583	528					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S528F(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		TGCAGGAAATCTTTCAGGCAG	0.408																																																	1	Substitution - Missense(1)	kidney(1)											107.0	106.0	106.0					19																	56935610		2203	4300	6503	SO:0001583	missense	0			AK055592	CCDS12943.1	19q13.43	2013-09-20			ENSG00000198440	ENSG00000198440		"""Zinc fingers, C2H2-type"", ""-"""	26427	protein-coding gene	gene with protein product							Standard	NM_152478		Approved	FLJ31030	uc010ygl.1	Q96ND8	OTTHUMG00000168874	ENST00000333201.9:c.1583C>G	19.37:g.56935610C>G	ENSP00000388502:p.Ser528Cys		O14850|Q2NKK3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S528C	ENST00000333201.9	37	c.1583	CCDS12943.1	19	.	.	.	.	.	.	.	.	.	.	C	15.23	2.770739	0.49680	.	.	ENSG00000198440	ENST00000291598;ENST00000333201	T;T	0.08370	3.1;3.1	4.64	3.52	0.40303	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43579	D	0.000552	T	0.20577	0.0495	M	0.65320	2	0.09310	N	1	D	0.76494	0.999	P	0.62885	0.908	T	0.00948	-1.1504	9	.	.	.	.	11.4596	0.50202	0.0:0.6667:0.3333:0.0	.	528	Q96ND8	ZN583_HUMAN	C	528	ENSP00000291598:S528C;ENSP00000388502:S528C	.	S	+	2	0	ZNF583	61627422	0.001000	0.12720	0.005000	0.12908	0.995000	0.86356	1.112000	0.31172	2.574000	0.86865	0.650000	0.86243	TCT	ZNF583	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198440		0.408	ZNF583-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF583	HGNC	protein_coding	OTTHUMT00000401453.1		0.00	58	0	C	NM_152478		56935610	+1			no_errors	ENST00000291598	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.009	G
ZNF544	27300	genome.wustl.edu	37	19	58757716	58757716	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:58757716G>A	ENST00000596652.1	+	4	317	c.83G>A	c.(82-84)tGg>tAg	p.W28*	CTD-3138B18.4_ENST00000600029.1_Nonsense_Mutation_p.W28*|ZNF544_ENST00000596597.1_3'UTR|ZNF544_ENST00000599227.1_Nonsense_Mutation_p.W28*|ZNF544_ENST00000596825.1_Nonsense_Mutation_p.W28*|ZNF544_ENST00000599953.1_Intron|ZNF544_ENST00000596929.1_Nonsense_Mutation_p.W28*|ZNF544_ENST00000269829.4_Nonsense_Mutation_p.W28*|ZNF544_ENST00000594384.1_Nonsense_Mutation_p.W28*|ZNF544_ENST00000600220.1_Nonsense_Mutation_p.W28*|ZNF544_ENST00000595981.1_Nonsense_Mutation_p.W28*|ZNF544_ENST00000333581.5_Nonsense_Mutation_p.W28*|ZNF544_ENST00000415203.2_Nonsense_Mutation_p.W28*|ZNF544_ENST00000600044.1_Nonsense_Mutation_p.W28*			Q6NX49	ZN544_HUMAN	zinc finger protein 544	28	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		CAGGAGGAGTGGGAACAGCTG	0.567																																																	0													195.0	173.0	180.0					19																	58757716		2203	4300	6503	SO:0001587	stop_gained	0			AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.83G>A	19.37:g.58757716G>A	ENSP00000469635:p.Trp28*		A8K6J1|Q9UEX4	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.W28*	ENST00000596652.1	37	c.83	CCDS12973.1	19	.	.	.	.	.	.	.	.	.	.	G	37	5.988131	0.97179	.	.	ENSG00000198131	ENST00000269829;ENST00000333581;ENST00000415203	.	.	.	2.36	2.36	0.29203	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.3976	0.44209	0.0:0.0:1.0:0.0	.	.	.	.	X	28	.	ENSP00000269829:W28X	W	+	2	0	ZNF544	63449528	1.000000	0.71417	0.279000	0.24732	0.425000	0.31504	3.986000	0.56937	1.324000	0.45282	0.407000	0.27541	TGG	ZNF544	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000198131		0.567	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF544	HGNC	protein_coding	OTTHUMT00000466754.1	-	0.00	64	0	G	NM_014480		58757716	+1	tier1	-	no_errors	ENST00000269829	ensembl	human	known	74_37	nonsense	32.05	53	25	SNP	0.960	A
ZNF644	84146	genome.wustl.edu	37	1	91406698	91406698	+	Silent	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:91406698C>T	ENST00000370440.1	-	3	430	c.213G>A	c.(211-213)acG>acA	p.T71T	ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000337393.5_Silent_p.T71T|ZNF644_ENST00000347275.5_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	71					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T71T(1)		breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		GCAGAGTCAACGTATTATTTT	0.383																																																	1	Substitution - coding silent(1)	large_intestine(1)											156.0	150.0	152.0					1																	91406698		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.213G>A	1.37:g.91406698C>T			A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T71	ENST00000370440.1	37	c.213	CCDS731.1	1																																																																																			ZNF644	-	NULL	ENSG00000122482		0.383	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF644	HGNC	protein_coding	OTTHUMT00000027846.2		0.00	55	0	C	NM_032186		91406698	-1			no_errors	ENST00000337393	ensembl	human	known	74_37	silent	5.88	32	2	SNP	0.473	T
ZNF695	57116	genome.wustl.edu	37	1	247109044	247109044	+	3'UTR	SNP	G	G	A			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr1:247109044G>A	ENST00000487338.2	-	0	758				ZNF695_ENST00000498046.2_5'UTR	NM_001204221.1	NP_001191150	Q8IW36	ZN695_HUMAN	zinc finger protein 695						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(1)|lung(9)|prostate(1)|urinary_tract(1)	13	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TTCGCCTCACGGAGCAGGGAG	0.507																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS44344.1, CCDS55694.1	1q44	2013-01-08			ENSG00000197472	ENSG00000197472		"""Zinc fingers, C2H2-type"", ""-"""	30954	protein-coding gene	gene with protein product						12477932	Standard	NM_020394		Approved	SBZF3	uc009xgu.3	Q8IW36	OTTHUMG00000040707	ENST00000487338.2:c.*55C>T	1.37:g.247109044G>A			Q5T0N9|Q5T0P1|Q5T0P3|Q7Z2W8|Q7Z648	RNA	SNP	-	NULL	ENST00000487338.2	37	NULL	CCDS55694.1	1																																																																																			ZNF695	-	-	ENSG00000197472		0.507	ZNF695-006	KNOWN	basic|CCDS	protein_coding	ZNF695	HGNC	protein_coding	OTTHUMT00000098003.4	-	0.00	34	0	G	NM_020394		247109044	-1	tier1	-	no_errors	ENST00000498046	ensembl	human	known	74_37	rna	17.24	24	5	SNP	0.000	A
ZNF844	284391	genome.wustl.edu	37	19	12187160	12187160	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:12187160A>G	ENST00000439326.3	+	4	1400	c.1225A>G	c.(1225-1227)Atc>Gtc	p.I409V	ZNF844_ENST00000441304.2_3'UTR	NM_001136501.1	NP_001129973.1	Q08AG5	ZN844_HUMAN	zinc finger protein 844	409					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(1)|prostate(1)	10						TCCTTTCACTATCATGAAAGG	0.418																																																	0													41.0	39.0	40.0					19																	12187160		692	1591	2283	SO:0001583	missense	0			AL832297	CCDS45985.1	19p13.2	2013-01-08			ENSG00000223547	ENSG00000223547		"""Zinc fingers, C2H2-type"", ""-"""	25932	protein-coding gene	gene with protein product							Standard	NM_001136501		Approved	FLJ14959	uc002mtb.2	Q08AG5	OTTHUMG00000156405	ENST00000439326.3:c.1225A>G	19.37:g.12187160A>G	ENSP00000392024:p.Ile409Val		Q5JPI8	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I409V	ENST00000439326.3	37	c.1225	CCDS45985.1	19	.	.	.	.	.	.	.	.	.	.	-	3.121	-0.180506	0.06380	.	.	ENSG00000223547	ENST00000439326;ENST00000541708	T	0.05025	3.51	2.73	-5.47	0.02600	.	.	.	.	.	T	0.02119	0.0066	N	0.11756	0.17	0.09310	N	1	B	0.18741	0.03	B	0.10450	0.005	T	0.44832	-0.9302	9	0.07644	T	0.81	.	0.2101	0.00155	0.338:0.2378:0.1965:0.2277	.	409	Q08AG5	ZN844_HUMAN	V	409	ENSP00000392024:I409V	ENSP00000392024:I409V	I	+	1	0	ZNF844	12048160	0.000000	0.05858	0.000000	0.03702	0.065000	0.16274	-7.088000	0.00044	-2.420000	0.00564	0.329000	0.21502	ATC	ZNF844	-	NULL	ENSG00000223547		0.418	ZNF844-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF844	HGNC	protein_coding	OTTHUMT00000344086.2	-	0.00	81	0	A			12187160	+1	tier1	-	no_errors	ENST00000439326	ensembl	human	known	74_37	missense	33.33	34	17	SNP	0.000	G
ZNF844	284391	genome.wustl.edu	37	19	12187502	12187502	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:12187502A>G	ENST00000439326.3	+	4	1742	c.1567A>G	c.(1567-1569)Aaa>Gaa	p.K523E	ZNF844_ENST00000441304.2_3'UTR	NM_001136501.1	NP_001129973.1	Q08AG5	ZN844_HUMAN	zinc finger protein 844	523					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K523E(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(1)|prostate(1)	10						CAAATGCATGAAAGGACTCAC	0.413																																																	1	Substitution - Missense(1)	endometrium(1)											94.0	85.0	88.0					19																	12187502		692	1591	2283	SO:0001583	missense	0			AL832297	CCDS45985.1	19p13.2	2013-01-08			ENSG00000223547	ENSG00000223547		"""Zinc fingers, C2H2-type"", ""-"""	25932	protein-coding gene	gene with protein product							Standard	NM_001136501		Approved	FLJ14959	uc002mtb.2	Q08AG5	OTTHUMG00000156405	ENST00000439326.3:c.1567A>G	19.37:g.12187502A>G	ENSP00000392024:p.Lys523Glu		Q5JPI8	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K523E	ENST00000439326.3	37	c.1567	CCDS45985.1	19	.	.	.	.	.	.	.	.	.	.	a	8.659	0.899999	0.17686	.	.	ENSG00000223547	ENST00000439326;ENST00000541708	T	0.05786	3.39	2.31	-0.0571	0.13803	.	.	.	.	.	T	0.04452	0.0122	L	0.53617	1.68	0.09310	N	1	B	0.26081	0.141	B	0.15052	0.012	T	0.46638	-0.9177	9	0.05833	T	0.94	.	2.4497	0.04515	0.525:0.0:0.2647:0.2102	.	523	Q08AG5	ZN844_HUMAN	E	523	ENSP00000392024:K523E	ENSP00000392024:K523E	K	+	1	0	ZNF844	12048502	0.000000	0.05858	0.000000	0.03702	0.438000	0.31896	-0.320000	0.08028	-0.243000	0.09653	0.166000	0.16787	AAA	ZNF844	-	NULL	ENSG00000223547		0.413	ZNF844-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF844	HGNC	protein_coding	OTTHUMT00000344086.2		0.00	80	0	A			12187502	+1			no_errors	ENST00000439326	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.004	G
ZNF835	90485	genome.wustl.edu	37	19	57174972	57174972	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GN-01A-11D-A37C-09	TCGA-2H-A9GN-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0ee65e5-b8ae-4ca2-9f7d-c1bf89dcd80d	fc594ce0-d420-4d5f-a048-884c5a935e71	g.chr19:57174972C>T	ENST00000537055.2	-	2	1826	c.1595G>A	c.(1594-1596)cGt>cAt	p.R532H		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	532					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R554H(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						TGCTGGTCCACGCGGGTTTCT	0.582																																																	1	Substitution - Missense(1)	large_intestine(1)											50.0	53.0	52.0					19																	57174972		2051	4208	6259	SO:0001583	missense	0			AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.1595G>A	19.37:g.57174972C>T	ENSP00000444747:p.Arg532His		B7Z5Y0|G3V1S0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R532H	ENST00000537055.2	37	c.1595	CCDS56105.1	19	.	.	.	.	.	.	.	.	.	.	C	1.834	-0.469165	0.04445	.	.	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.06933	3.24	1.83	-3.66	0.04489	.	.	.	.	.	T	0.03434	0.0099	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.40869	-0.9540	9	0.66056	D	0.02	.	7.2836	0.26324	0.0:0.1772:0.5802:0.2426	.	554	Q9Y2P0	ZN835_HUMAN	H	554;532	ENSP00000444747:R532H	ENSP00000341756:R554H	R	-	2	0	ZNF835	61866784	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.834000	0.04391	-2.824000	0.00342	-1.474000	0.01003	CGT	ZNF835	-	NULL	ENSG00000127903		0.582	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF835	HGNC	protein_coding	OTTHUMT00000459800.1	-	0.00	30	0	C	NM_001005850		57174972	-1	tier1	-	no_errors	ENST00000537055	ensembl	human	known	74_37	missense	50.00	23	23	SNP	0.000	T
