#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCB6	10058	genome.wustl.edu	37	2	220083133	220083133	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr2:220083133A>T	ENST00000265316.3	-	1	579	c.263T>A	c.(262-264)cTg>cAg	p.L88Q	ABCB6_ENST00000439002.2_Missense_Mutation_p.L88Q	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	88					brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGGCCGGCCAGGGGCAGCGC	0.716																																																	0													10.0	16.0	14.0					2																	220083133		2161	4218	6379	SO:0001583	missense	0			AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.263T>A	2.37:g.220083133A>T	ENSP00000265316:p.Leu88Gln		O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.L88Q	ENST00000265316.3	37	c.263	CCDS2436.1	2	.	.	.	.	.	.	.	.	.	.	A	14.50	2.554996	0.45487	.	.	ENSG00000115657	ENST00000265316;ENST00000439002	D;D	0.82984	-1.67;-1.67	5.05	3.89	0.44902	.	0.686407	0.13909	N	0.354351	D	0.83866	0.5347	L	0.32530	0.975	0.27938	N	0.937627	D;D	0.59357	0.985;0.983	P;P	0.59825	0.864;0.762	T	0.75712	-0.3222	10	0.66056	D	0.02	-0.78	10.8673	0.46862	0.9257:0.0:0.0743:0.0	.	88;88	Q9NP58-4;Q9NP58	.;ABCB6_HUMAN	Q	88	ENSP00000265316:L88Q;ENSP00000394333:L88Q	ENSP00000265316:L88Q	L	-	2	0	ABCB6	219791377	0.998000	0.40836	0.936000	0.37596	0.172000	0.22775	3.106000	0.50322	1.049000	0.40321	0.482000	0.46254	CTG	ABCB6	-	NULL	ENSG00000115657		0.716	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB6	HGNC	protein_coding	OTTHUMT00000256820.2	-	0.00	62	0	A	NM_005689		220083133	-1	tier1	-	no_errors	ENST00000265316	ensembl	human	known	74_37	missense	12.70	55	8	SNP	0.219	T
ACADSB	36	genome.wustl.edu	37	10	124806738	124806738	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr10:124806738C>T	ENST00000358776.4	+	8	928	c.914C>T	c.(913-915)gCg>gTg	p.A305V	ACADSB_ENST00000496730.2_3'UTR|ACADSB_ENST00000368869.4_Missense_Mutation_p.A203V	NM_001609.3	NP_001600.1	P45954	ACDSB_HUMAN	acyl-CoA dehydrogenase, short/branched chain	305					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)|Valproic Acid(DB00313)	CTGGGACTGGCGCAAGGATGT	0.289																																																	0													82.0	86.0	85.0					10																	124806738		2203	4300	6503	SO:0001583	missense	0			U12778	CCDS7634.1	10q25-q26	2014-09-17	2010-04-30		ENSG00000196177	ENSG00000196177	1.3.99.-		91	protein-coding gene	gene with protein product		600301	"""acyl-Coenzyme A dehydrogenase, short/branched chain"""			7698750, 7759115	Standard	NM_001609		Approved	SBCAD, ACAD7	uc001lhb.3	P45954	OTTHUMG00000019200	ENST00000358776.4:c.914C>T	10.37:g.124806738C>T	ENSP00000357873:p.Ala305Val		B4DQ51|Q5SQN6|Q96CX7	Missense_Mutation	SNP	pfam_AcylCo_DH/oxidase_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_DH_2_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_AcylCo_DH/oxidase_C	p.A305V	ENST00000358776.4	37	c.914	CCDS7634.1	10	.	.	.	.	.	.	.	.	.	.	C	28.5	4.925427	0.92319	.	.	ENSG00000196177	ENST00000368869;ENST00000358776	D;D	0.97186	-4.28;-4.28	5.5	5.5	0.81552	Acyl-CoA dehydrogenase/oxidase C-terminal (2);Acyl-CoA oxidase/dehydrogenase, type 1 (1);	0.000000	0.85682	D	0.000000	D	0.99140	0.9703	H	0.97265	3.97	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99047	1.0826	10	0.87932	D	0	.	19.3976	0.94612	0.0:1.0:0.0:0.0	.	305	P45954	ACDSB_HUMAN	V	203;305	ENSP00000357862:A203V;ENSP00000357873:A305V	ENSP00000357873:A305V	A	+	2	0	ACADSB	124796728	1.000000	0.71417	0.999000	0.59377	0.780000	0.44128	7.317000	0.79018	2.575000	0.86900	0.650000	0.86243	GCG	ACADSB	-	pfam_AcylCo_DH/oxidase_C,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCo_DH/oxidase_C	ENSG00000196177		0.289	ACADSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACADSB	HGNC	protein_coding	OTTHUMT00000050843.1	-	0.00	47	0	C	NM_001609		124806738	+1	tier1	-	no_errors	ENST00000358776	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
ACADVL	37	genome.wustl.edu	37	17	7127680	7127680	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr17:7127680G>A	ENST00000356839.5	+	16	1752	c.1573G>A	c.(1573-1575)Gtc>Atc	p.V525I	MIR324_ENST00000362183.1_RNA|ACADVL_ENST00000350303.5_Missense_Mutation_p.V503I|ACADVL_ENST00000543245.2_Missense_Mutation_p.V548I	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain	525					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						CAGCGGACTTGTCCACCCGGA	0.657																																																	0													54.0	54.0	54.0					17																	7127680		2203	4300	6503	SO:0001583	missense	0			BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	ENST00000356839.5:c.1573G>A	17.37:g.7127680G>A	ENSP00000349297:p.Val525Ile		B4DEB6|F5H2A9|O76056|Q8WUL0	Missense_Mutation	SNP	pfam_AcylCo_DH/oxidase_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_AcylCo_DH/oxidase_C	p.V525I	ENST00000356839.5	37	c.1573	CCDS11090.1	17	.	.	.	.	.	.	.	.	.	.	G	12.89	2.072058	0.36566	.	.	ENSG00000072778	ENST00000543245;ENST00000356839;ENST00000350303;ENST00000322910;ENST00000542255	D;D	0.87412	-2.25;-2.25	5.42	-0.433	0.12287	.	0.257811	0.37955	N	0.001870	D	0.82701	0.5094	M	0.65320	2	0.54753	D	0.999983	B;B;B	0.19706	0.038;0.038;0.007	B;B;B	0.26969	0.075;0.075;0.006	T	0.72381	-0.4311	10	0.40728	T	0.16	.	9.0302	0.36254	0.2818:0.0:0.7182:0.0	.	548;503;525	F5H2A9;P49748-2;P49748	.;.;ACADV_HUMAN	I	548;571;503;525;571	ENSP00000438689:V548I;ENSP00000344152:V503I	ENSP00000325395:V525I	V	+	1	0	ACADVL	7068404	0.003000	0.15002	0.073000	0.20177	0.009000	0.06853	-0.128000	0.10531	-0.082000	0.12640	0.655000	0.94253	GTC	ACADVL	-	NULL	ENSG00000072778		0.657	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ACADVL	HGNC	protein_coding	OTTHUMT00000220001.5	-	0.00	56	0	G	NM_000018		7127680	+1	tier1	-	no_errors	ENST00000356839	ensembl	human	known	74_37	missense	11.84	67	9	SNP	0.760	A
ADRA1A	148	genome.wustl.edu	37	8	26721737	26721737	+	Silent	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr8:26721737G>A	ENST00000519229.1	-	1	756	c.750C>T	c.(748-750)agC>agT	p.S250S	ADRA1A_ENST00000380581.2_Silent_p.S250S|ADRA1A_ENST00000380587.1_Silent_p.S250S|ADRA1A_ENST00000380586.1_Silent_p.S250S|ADRA1A_ENST00000380582.3_Silent_p.S250S|ADRA1A_ENST00000380572.3_Silent_p.S250S|ADRA1A_ENST00000358857.5_Silent_p.S250S|ADRA1A_ENST00000380573.3_Silent_p.S250S|ADRA1A_ENST00000354550.4_Silent_p.S250S|ADRA1A_ENST00000276393.4_Silent_p.S250S			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	323					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	TGGTCTTGGCGCTGGCCATCC	0.617																																																	0													53.0	49.0	50.0					8																	26721737		2203	4300	6503	SO:0001819	synonymous_variant	0			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000519229.1:c.750C>T	8.37:g.26721737G>A			Q9NPY0	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_ADRA1A_rcpt,prints_GPCR_Rhodpsn,prints_ADR_fam	p.S250	ENST00000519229.1	37	c.750		8																																																																																			ADRA1A	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_ADRA1A_rcpt	ENSG00000120907		0.617	ADRA1A-009	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	ADRA1A	HGNC	protein_coding	OTTHUMT00000376207.1	-	0.00	60	0	G	NM_033303		26721737	-1	tier1	-	no_errors	ENST00000380586	ensembl	human	known	74_37	silent	11.39	70	9	SNP	0.386	A
AMOT	154796	genome.wustl.edu	37	X	112058876	112058876	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chrX:112058876G>A	ENST00000524145.1	-	3	1176	c.1102C>T	c.(1102-1104)Cgt>Tgt	p.R368C	AMOT_ENST00000371958.1_Missense_Mutation_p.R136C|AMOT_ENST00000371962.1_Missense_Mutation_p.R136C|AMOT_ENST00000371959.3_Missense_Mutation_p.R368C|AMOT_ENST00000304758.1_5'UTR			Q4VCS5	AMOT_HUMAN	angiomotin	368					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						TGGGAGAGACGGTAATGATCC	0.587																																																	0													68.0	62.0	64.0					X																	112058876		692	1591	2283	SO:0001583	missense	0			AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1102C>T	X.37:g.112058876G>A	ENSP00000429013:p.Arg368Cys		Q504X5|Q9HD27|Q9UPT1	Missense_Mutation	SNP	pfam_Angiomotin_C,superfamily_Prefoldin,prints_Angiomotin	p.R368C	ENST00000524145.1	37	c.1102	CCDS48154.1	X	.	.	.	.	.	.	.	.	.	.	G	15.32	2.797333	0.50208	.	.	ENSG00000126016	ENST00000371959;ENST00000371962;ENST00000524145;ENST00000371958	T;T;T;T	0.14391	2.51;2.51;2.51;2.51	5.31	5.31	0.75309	.	0.162865	0.40728	N	0.001031	T	0.15003	0.0362	L	0.36672	1.1	0.58432	D	0.999996	D	0.67145	0.996	B	0.43623	0.425	T	0.01062	-1.1464	10	0.56958	D	0.05	-4.9457	16.9735	0.86306	0.0:0.0:1.0:0.0	.	368	Q4VCS5	AMOT_HUMAN	C	368;136;368;136	ENSP00000361027:R368C;ENSP00000361030:R136C;ENSP00000429013:R368C;ENSP00000361026:R136C	ENSP00000361026:R136C	R	-	1	0	AMOT	111945532	1.000000	0.71417	0.937000	0.37676	0.239000	0.25481	4.204000	0.58460	2.475000	0.83589	0.529000	0.55759	CGT	AMOT	-	NULL	ENSG00000126016		0.587	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMOT	HGNC	protein_coding	OTTHUMT00000378570.1	-	0.00	44	0	G	NM_133265		112058876	-1	tier1	-	no_errors	ENST00000371959	ensembl	human	known	74_37	missense	32.20	40	19	SNP	1.000	A
ANKRD20A5P	440482	genome.wustl.edu	37	18	14225685	14225685	+	IGR	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr18:14225685G>T								RNU6-316P (34880 upstream) : RP11-757O6.1 (18938 downstream)																							CGTAAGACAAGAGATACTCTC	0.348																																																	0																																										SO:0001628	intergenic_variant	0																															18.37:g.14225685G>T				RNA	SNP	-	NULL		37	NULL		18																																																																																			ANKRD20A5P	-	-	ENSG00000186481	0	0.348					ANKRD20A5P	HGNC			-	0.00	153	0	G			14225685	+1	tier1	-	no_errors	ENST00000577614	ensembl	human	known	74_37	rna	10.05	179	20	SNP	0.252	T
ANO1	55107	genome.wustl.edu	37	11	70009403	70009403	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr11:70009403C>T	ENST00000355303.5	+	19	2212	c.1907C>T	c.(1906-1908)cCg>cTg	p.P636L	ANO1_ENST00000531349.1_Missense_Mutation_p.P345L|ANO1_ENST00000530676.1_Missense_Mutation_p.P490L|ANO1_ENST00000398543.2_Missense_Mutation_p.P490L|ANO1_ENST00000316296.5_Missense_Mutation_p.P578L|ANO1_ENST00000538023.1_Missense_Mutation_p.P636L	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	636					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	GTTGGACGCCCGGGCGACTAC	0.532																																																	0													60.0	63.0	62.0					11																	70009403		1943	4123	6066	SO:0001583	missense	0			BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.1907C>T	11.37:g.70009403C>T	ENSP00000347454:p.Pro636Leu		A8KAM3|Q8IYY8|Q8N7V3	Missense_Mutation	SNP	pfam_Anoctamin	p.P636L	ENST00000355303.5	37	c.1907	CCDS44663.1	11	.	.	.	.	.	.	.	.	.	.	C	19.13	3.768117	0.69878	.	.	ENSG00000131620	ENST00000355303;ENST00000538023;ENST00000398543;ENST00000546327;ENST00000316296;ENST00000530676;ENST00000531349	T;T;T;T;T;T	0.73681	-0.34;-0.43;-0.77;-0.35;-0.77;-0.44	5.08	5.08	0.68730	.	0.056642	0.64402	D	0.000001	D	0.90707	0.7084	H	0.95187	3.635	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;0.999	D	0.93376	0.6739	9	.	.	.	.	18.8833	0.92365	0.0:1.0:0.0:0.0	.	345;578;636	E9PNA7;Q5XXA6-3;Q5XXA6	.;.;ANO1_HUMAN	L	636;636;490;394;578;490;345	ENSP00000347454:P636L;ENSP00000444689:P636L;ENSP00000381551:P490L;ENSP00000319477:P578L;ENSP00000435797:P490L;ENSP00000432843:P345L	.	P	+	2	0	ANO1	69687051	1.000000	0.71417	0.952000	0.39060	0.200000	0.23975	6.972000	0.76110	2.535000	0.85469	0.655000	0.94253	CCG	ANO1	-	pfam_Anoctamin	ENSG00000131620		0.532	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANO1	HGNC	protein_coding	OTTHUMT00000393685.1	-	0.00	44	0	C	NM_018043		70009403	+1	tier1	-	no_errors	ENST00000355303	ensembl	human	known	74_37	missense	15.31	83	15	SNP	1.000	T
AP1B1	162	genome.wustl.edu	37	22	29815242	29815242	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr22:29815242G>C	ENST00000415447.1	-	2	62	c.45C>G	c.(43-45)atC>atG	p.I15M				Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	15					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						TCAGCTCGAAGATCTCCCCTA	0.517																																																	0																																										SO:0001583	missense	0			L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000415447.1:c.45C>G	22.37:g.29815242G>C	ENSP00000387612:p.Ile15Met		C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_B-adaptin_app_sub_C,pfam_HEAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Armadillo,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP_complex_bsu_1_2_4	p.I15M	ENST00000415447.1	37	c.45		22	.	.	.	.	.	.	.	.	.	.	G	13.54	2.267175	0.40095	.	.	ENSG00000100280	ENST00000415447	T	0.13657	2.57	2.36	2.36	0.29203	.	.	.	.	.	T	0.20981	0.0505	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.01781	-1.1275	6	0.59425	D	0.04	.	7.0581	0.25111	0.1488:0.0:0.8512:0.0	.	.	.	.	M	15	ENSP00000387612:I15M	ENSP00000387612:I15M	I	-	3	3	AP1B1	28145242	1.000000	0.71417	1.000000	0.80357	0.460000	0.32559	1.887000	0.39698	1.318000	0.45170	0.196000	0.17591	ATC	AP1B1	-	superfamily_ARM-type_fold,pirsf_AP_complex_bsu_1_2_4	ENSG00000100280		0.517	AP1B1-203	KNOWN	basic|appris_principal	protein_coding	AP1B1	HGNC	protein_coding		-	0.00	72	0	G	NM_001127		29815242	-1	tier1	-	no_errors	ENST00000415447	ensembl	human	known	74_37	missense	12.66	69	10	SNP	1.000	C
AVIL	10677	genome.wustl.edu	37	12	58204170	58204170	+	Silent	SNP	G	G	T	rs547034263		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr12:58204170G>T	ENST00000257861.3	-	6	1153	c.723C>A	c.(721-723)atC>atA	p.I241I	AVIL_ENST00000537081.1_Silent_p.I234I	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	241	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)	p.I241M(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					TCTGATCTATGATCTCATCAG	0.522													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20665	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	prostate(1)											120.0	109.0	113.0					12																	58204170		2203	4300	6503	SO:0001819	synonymous_variant	0			AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.723C>A	12.37:g.58204170G>T			B2RAU7|Q2NKM9	Silent	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.I241	ENST00000257861.3	37	c.723	CCDS8959.1	12																																																																																			AVIL	-	NULL	ENSG00000135407		0.522	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVIL	HGNC	protein_coding	OTTHUMT00000409276.1	-	0.00	64	0	G	NM_006576		58204170	-1	tier1	-	no_errors	ENST00000257861	ensembl	human	known	74_37	silent	19.67	49	12	SNP	0.002	T
BAI2	576	genome.wustl.edu	37	1	32196688	32196688	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr1:32196688C>T	ENST00000373658.3	-	29	4434	c.4093G>A	c.(4093-4095)Ggt>Agt	p.G1365S	BAI2_ENST00000398547.1_Missense_Mutation_p.G1298S|BAI2_ENST00000527361.1_Missense_Mutation_p.G1332S|BAI2_ENST00000465256.1_5'UTR|BAI2_ENST00000398556.3_Missense_Mutation_p.G1280S|BAI2_ENST00000257070.4_Missense_Mutation_p.G1332S|BAI2_ENST00000398538.1_Missense_Mutation_p.G1353S|BAI2_ENST00000440175.2_Missense_Mutation_p.G974S|BAI2_ENST00000373655.2_Missense_Mutation_p.G1365S|BAI2_ENST00000398542.1_Missense_Mutation_p.G1265S	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1365	Poly-Gly.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		CCACCCCCACCGCCAGGCTGC	0.701																																																	0													8.0	9.0	9.0					1																	32196688		2148	4227	6375	SO:0001583	missense	0			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.4093G>A	1.37:g.32196688C>T	ENSP00000362762:p.Gly1365Ser		B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.G1365S	ENST00000373658.3	37	c.4093	CCDS346.2	1	.	.	.	.	.	.	.	.	.	.	c	2.855	-0.237343	0.05944	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538	T;T;T;T;T;T;T;T;T	0.41758	1.67;1.87;1.05;1.05;2.03;0.99;0.99;1.68;1.07	5.34	-6.76	0.01732	.	0.690561	0.12662	N	0.449516	T	0.24736	0.0600	L	0.40543	1.245	0.09310	N	1	B;B;B;B;B;B;B	0.13145	0.0;0.0;0.007;0.0;0.003;0.0;0.004	B;B;B;B;B;B;B	0.14023	0.001;0.001;0.002;0.001;0.01;0.0;0.001	T	0.36625	-0.9740	10	0.09590	T	0.72	.	10.4467	0.44499	0.0:0.3594:0.0879:0.5528	.	1332;1353;974;1280;1365;1365;1353	O60241-4;O60241-3;B4DKC3;A2A3C6;O60241-2;O60241;A2A3C2	.;.;.;.;.;BAI2_HUMAN;.	S	1280;1298;1365;1365;1265;1332;1332;974;1353	ENSP00000381564:G1280S;ENSP00000381555:G1298S;ENSP00000362762:G1365S;ENSP00000362759:G1365S;ENSP00000381550:G1265S;ENSP00000257070:G1332S;ENSP00000435397:G1332S;ENSP00000391071:G974S;ENSP00000381548:G1353S	ENSP00000257070:G1332S	G	-	1	0	BAI2	31969275	0.000000	0.05858	0.000000	0.03702	0.594000	0.36715	-0.446000	0.06837	-1.792000	0.01259	-1.982000	0.00454	GGT	BAI2	-	NULL	ENSG00000121753		0.701	BAI2-015	KNOWN	basic|CCDS	protein_coding	BAI2	HGNC	protein_coding	OTTHUMT00000381838.1	-	0.00	39	0	C	NM_001703		32196688	-1	tier1	-	no_errors	ENST00000373658	ensembl	human	known	74_37	missense	30.77	45	20	SNP	0.000	T
BRWD3	254065	genome.wustl.edu	37	X	79940990	79940990	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chrX:79940990C>G	ENST00000373275.4	-	36	4267	c.4051G>C	c.(4051-4053)Gaa>Caa	p.E1351Q	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1351	Bromo 2. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TGTTGTCTTTCTGGAACAACA	0.378																																																	0													101.0	75.0	84.0					X																	79940990		2203	4300	6503	SO:0001583	missense	0				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.4051G>C	X.37:g.79940990C>G	ENSP00000362372:p.Glu1351Gln		C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quino_amine_DH_bsu,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.E1351Q	ENST00000373275.4	37	c.4051	CCDS14447.1	X	.	.	.	.	.	.	.	.	.	.	C	8.586	0.883498	0.17467	.	.	ENSG00000165288	ENST00000373275	T	0.56275	0.47	4.73	3.86	0.44501	Bromodomain (4);	0.658997	0.15346	N	0.267228	T	0.25827	0.0629	N	0.03209	-0.39	0.20764	N	0.999851	B	0.30542	0.284	B	0.32090	0.14	T	0.11108	-1.0601	9	.	.	.	-8.3853	6.9363	0.24468	0.0:0.877:0.0:0.123	.	1351	Q6RI45	BRWD3_HUMAN	Q	1351	ENSP00000362372:E1351Q	.	E	-	1	0	BRWD3	79827646	1.000000	0.71417	0.919000	0.36401	0.968000	0.65278	3.018000	0.49625	2.313000	0.78055	0.538000	0.68166	GAA	BRWD3	-	superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain	ENSG00000165288		0.378	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	HGNC	protein_coding	OTTHUMT00000057344.1	-	0.00	49	0	C	NM_153252		79940990	-1	tier1	-	no_errors	ENST00000373275	ensembl	human	known	74_37	missense	14.04	49	8	SNP	0.688	G
C10orf76	79591	genome.wustl.edu	37	10	103771512	103771512	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr10:103771512G>T	ENST00000370033.4	-	11	918	c.799C>A	c.(799-801)Caa>Aaa	p.Q267K		NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	267						integral component of membrane (GO:0016021)		p.Q267K(1)		autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		AAACCACTTTGGTGTTCTTCT	0.343																																																	1	Substitution - Missense(1)	endometrium(1)											125.0	124.0	124.0					10																	103771512		1823	4079	5902	SO:0001583	missense	0			AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.799C>A	10.37:g.103771512G>T	ENSP00000359050:p.Gln267Lys		Q2TB87|Q9H8Z9	Missense_Mutation	SNP	pfam_DUF1741,superfamily_ARM-type_fold	p.Q267K	ENST00000370033.4	37	c.799	CCDS41563.1	10	.	.	.	.	.	.	.	.	.	.	G	16.93	3.258640	0.59321	.	.	ENSG00000120029	ENST00000370033	T	0.65364	-0.15	6.17	6.17	0.99709	.	0.051755	0.85682	D	0.000000	T	0.56202	0.1969	L	0.46157	1.445	0.80722	D	1	B	0.26258	0.145	B	0.24974	0.057	T	0.54456	-0.8291	10	0.06494	T	0.89	-12.8406	20.8794	0.99867	0.0:0.0:1.0:0.0	.	267	Q5T2E6	CJ076_HUMAN	K	267	ENSP00000359050:Q267K	ENSP00000359050:Q267K	Q	-	1	0	C10orf76	103761502	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.097000	0.89539	2.941000	0.99782	0.655000	0.94253	CAA	C10orf76	-	superfamily_ARM-type_fold	ENSG00000120029		0.343	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf76	HGNC	protein_coding	OTTHUMT00000050007.1	-	0.00	28	0	G	NM_024541		103771512	-1	tier1	-	no_errors	ENST00000370033	ensembl	human	known	74_37	missense	17.78	37	8	SNP	1.000	T
CASP12	100506742	genome.wustl.edu	37	11	104762081	104762081	+	Silent	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr11:104762081G>T	ENST00000422698.2	-	4	501	c.483C>A	c.(481-483)tcC>tcA	p.S161S	CASP12_ENST00000433738.1_Intron|CASP12_ENST00000375726.2_Silent_p.S161S|CASP12_ENST00000508062.1_Silent_p.S77S|CASP12_ENST00000447913.1_Intron|CASP12_ENST00000441710.1_Silent_p.S161S|CASP12_ENST00000494737.1_Intron|CASP12_ENST00000448103.1_Intron|CASP12_ENST00000446862.1_Silent_p.S161S	NM_001191016.1	NP_001177945.1	Q6UXS9	CASPC_HUMAN	caspase 12 (gene/pseudogene)	161					endoplasmic reticulum unfolded protein response (GO:0030968)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)			breast(1)	1						TGCTGTCTGAGGACTGGTGCT	0.483																																																	0																																										SO:0001819	synonymous_variant	0			AF464191		11q22.3	2011-02-14	2007-12-17	2006-02-17	ENSG00000204403	ENSG00000204403		"""Caspases"""	19004	protein-coding gene	gene with protein product		608633	"""caspase 12 pseudogene 1"", ""caspase 12"""	CASP12P1		12054529, 9038361, 16917906, 16532395	Standard	NM_001191016		Approved		uc031qdo.1	Q6UXS9	OTTHUMG00000154965	ENST00000422698.2:c.483C>A	11.37:g.104762081G>T			D6RBN7	Silent	SNP	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.S161	ENST00000422698.2	37	c.483	CCDS55785.1	11																																																																																			CASP12	-	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_Pept_C14_ICE_p20	ENSG00000204403		0.483	CASP12-008	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	CASP12	HGNC	protein_coding	OTTHUMT00000337832.2	-	0.00	66	0	G	NM_001191016		104762081	-1	tier1	-	no_errors	ENST00000375726	ensembl	human	known	74_37	silent	14.94	74	13	SNP	0.071	T
CDK5R1	8851	genome.wustl.edu	37	17	30815527	30815527	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr17:30815527G>T	ENST00000313401.3	+	2	1578	c.889G>T	c.(889-891)Gac>Tac	p.D297Y		NM_003885.2	NP_003876.1	Q15078	CD5R1_HUMAN	cyclin-dependent kinase 5, regulatory subunit 1 (p35)	297					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|brain development (GO:0007420)|cell proliferation (GO:0008283)|cerebellum development (GO:0021549)|embryo development (GO:0009790)|ephrin receptor signaling pathway (GO:0048013)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|hippocampus development (GO:0021766)|ionotropic glutamate receptor signaling pathway (GO:0035235)|layer formation in cerebral cortex (GO:0021819)|negative regulation of axon extension (GO:0030517)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein targeting to membrane (GO:0090314)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of neuron differentiation (GO:0045664)|rhythmic process (GO:0048511)|serine phosphorylation of STAT3 protein (GO:0033136)|superior olivary nucleus maturation (GO:0021722)	axon (GO:0030424)|contractile fiber (GO:0043292)|cyclin-dependent protein kinase 5 holoenzyme complex (GO:0016533)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|cyclin-dependent protein kinase 5 activator activity (GO:0016534)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)			cervix(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.0938)			CGGCCAGGAGGACAAGAAGCG	0.483																																																	0													56.0	60.0	58.0					17																	30815527		2203	4300	6503	SO:0001583	missense	0			X80343	CCDS11273.1	17q12	2006-03-28			ENSG00000176749	ENSG00000176749			1775	protein-coding gene	gene with protein product		603460				8090221	Standard	NM_003885		Approved	p35nck5a, Nck5a	uc002hhn.3	Q15078	OTTHUMG00000132814	ENST00000313401.3:c.889G>T	17.37:g.30815527G>T	ENSP00000318486:p.Asp297Tyr		E1P664|Q5U0G3	Missense_Mutation	SNP	pfam_CDK5_activator,superfamily_Cyclin-like,pirsf_CDK5_activator	p.D297Y	ENST00000313401.3	37	c.889	CCDS11273.1	17	.	.	.	.	.	.	.	.	.	.	G	17.39	3.376658	0.61735	.	.	ENSG00000176749	ENST00000313401	T	0.79141	-1.24	5.55	5.55	0.83447	Cyclin-like (1);	0.057360	0.64402	D	0.000002	D	0.82499	0.5050	L	0.34521	1.04	0.58432	D	0.999997	D;P	0.89917	1.0;0.742	D;B	0.68192	0.956;0.367	D	0.84338	0.0525	10	0.87932	D	0	-8.9213	16.9953	0.86366	0.0:0.0:1.0:0.0	.	297;297	Q8N619;Q15078	.;CD5R1_HUMAN	Y	297	ENSP00000318486:D297Y	ENSP00000318486:D297Y	D	+	1	0	CDK5R1	27839640	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.804000	0.99143	2.609000	0.88269	0.557000	0.71058	GAC	CDK5R1	-	pirsf_CDK5_activator	ENSG00000176749		0.483	CDK5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK5R1	HGNC	protein_coding	OTTHUMT00000256264.1	-	0.00	50	0	G	NM_003885		30815527	+1	tier1	-	no_errors	ENST00000313401	ensembl	human	known	74_37	missense	16.36	46	9	SNP	1.000	T
CDK5R1	8851	genome.wustl.edu	37	17	30815538	30815538	+	Silent	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr17:30815538G>T	ENST00000313401.3	+	2	1589	c.900G>T	c.(898-900)cgG>cgT	p.R300R		NM_003885.2	NP_003876.1	Q15078	CD5R1_HUMAN	cyclin-dependent kinase 5, regulatory subunit 1 (p35)	300					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|brain development (GO:0007420)|cell proliferation (GO:0008283)|cerebellum development (GO:0021549)|embryo development (GO:0009790)|ephrin receptor signaling pathway (GO:0048013)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|hippocampus development (GO:0021766)|ionotropic glutamate receptor signaling pathway (GO:0035235)|layer formation in cerebral cortex (GO:0021819)|negative regulation of axon extension (GO:0030517)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein targeting to membrane (GO:0090314)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of neuron differentiation (GO:0045664)|rhythmic process (GO:0048511)|serine phosphorylation of STAT3 protein (GO:0033136)|superior olivary nucleus maturation (GO:0021722)	axon (GO:0030424)|contractile fiber (GO:0043292)|cyclin-dependent protein kinase 5 holoenzyme complex (GO:0016533)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|cyclin-dependent protein kinase 5 activator activity (GO:0016534)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)			cervix(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.0938)			ACAAGAAGCGGCTCCTCCTAG	0.478																																																	0													52.0	55.0	54.0					17																	30815538		2203	4300	6503	SO:0001819	synonymous_variant	0			X80343	CCDS11273.1	17q12	2006-03-28			ENSG00000176749	ENSG00000176749			1775	protein-coding gene	gene with protein product		603460				8090221	Standard	NM_003885		Approved	p35nck5a, Nck5a	uc002hhn.3	Q15078	OTTHUMG00000132814	ENST00000313401.3:c.900G>T	17.37:g.30815538G>T			E1P664|Q5U0G3	Silent	SNP	pfam_CDK5_activator,superfamily_Cyclin-like,pirsf_CDK5_activator	p.R300	ENST00000313401.3	37	c.900	CCDS11273.1	17																																																																																			CDK5R1	-	pirsf_CDK5_activator	ENSG00000176749		0.478	CDK5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK5R1	HGNC	protein_coding	OTTHUMT00000256264.1		0.00	55	0	G	NM_003885		30815538	+1			no_errors	ENST00000313401	ensembl	human	known	74_37	silent	5.56	51	3	SNP	1.000	T
CCDC57	284001	genome.wustl.edu	37	17	80115510	80115510	+	Intron	SNP	C	C	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr17:80115510C>T	ENST00000389641.4	-	14	2278				CCDC57_ENST00000392347.1_Intron|RP11-1376P16.1_ENST00000582774.1_RNA|CCDC57_ENST00000327026.3_5'UTR|RP11-1376P16.2_ENST00000579979.1_RNA|CCDC57_ENST00000392343.3_3'UTR			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			CTGCAGCCCTCGTCCCACCTG	0.652																																																	0																																										SO:0001627	intron_variant	0			BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.2241+113G>A	17.37:g.80115510C>T			A6NP51|A8MQC7|Q8IWG2|Q8TER3	RNA	SNP	-	NULL	ENST00000389641.4	37	NULL		17																																																																																			CCDC57	-	-	ENSG00000176155		0.652	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	CCDC57	HGNC	protein_coding	OTTHUMT00000277182.3	-	0.00	91	0	C	NM_198082		80115510	-1	tier1	-	no_errors	ENST00000327026	ensembl	human	known	74_37	rna	11.22	87	11	SNP	0.009	T
CHD4	1108	genome.wustl.edu	37	12	6707388	6707388	+	Splice_Site	SNP	C	C	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr12:6707388C>T	ENST00000357008.2	-	11	1849	c.1686G>A	c.(1684-1686)caG>caA	p.Q562Q	CHD4_ENST00000544040.1_Splice_Site_p.Q555Q|CHD4_ENST00000544484.1_Splice_Site_p.Q559Q|CHD4_ENST00000309577.6_Splice_Site_p.Q562Q	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	562	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						CTAAACTTACCTGCAGTTCAG	0.522																																					Colon(32;586 792 4568 16848 45314)												0													110.0	114.0	113.0					12																	6707388		2203	4300	6503	SO:0001630	splice_region_variant	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.1686+1G>A	12.37:g.6707388C>T			Q8IXZ5	Silent	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.Q562	ENST00000357008.2	37	c.1686	CCDS8552.1	12																																																																																			CHD4	-	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	ENSG00000111642		0.522	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		-	0.00	96	0	C	NM_001273	Silent	6707388	-1	tier1	-	no_errors	ENST00000309577	ensembl	human	known	74_37	silent	13.16	99	15	SNP	1.000	T
CNTNAP5	129684	genome.wustl.edu	37	2	125232348	125232348	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr2:125232348A>T	ENST00000431078.1	+	7	1315	c.951A>T	c.(949-951)aaA>aaT	p.K317N		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	317	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TACCAGGAAAACCTGGGACCT	0.368																																																	0													40.0	37.0	38.0					2																	125232348		1799	4067	5866	SO:0001583	missense	0			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.951A>T	2.37:g.125232348A>T	ENSP00000399013:p.Lys317Asn		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.K317N	ENST00000431078.1	37	c.951	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	A	19.97	3.925679	0.73213	.	.	ENSG00000155052	ENST00000431078	T	0.79554	-1.28	5.67	4.51	0.55191	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.53938	D	0.000058	D	0.88440	0.6437	M	0.81112	2.525	0.54753	D	0.999983	D	0.89917	1.0	D	0.91635	0.999	D	0.87829	0.2643	10	0.51188	T	0.08	.	9.881	0.41233	0.8568:0.0:0.1432:0.0	.	317	Q8WYK1	CNTP5_HUMAN	N	317	ENSP00000399013:K317N	ENSP00000399013:K317N	K	+	3	2	CNTNAP5	124948818	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	0.761000	0.26489	1.074000	0.40909	0.482000	0.46254	AAA	CNTNAP5	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000155052		0.368	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	HGNC	protein_coding	OTTHUMT00000330864.3	-	0.00	47	0	A			125232348	+1	tier1	-	no_errors	ENST00000431078	ensembl	human	known	74_37	missense	11.76	45	6	SNP	1.000	T
COX16	51241	genome.wustl.edu	37	14	70826373	70826373	+	5'UTR	SNP	A	A	G			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr14:70826373A>G	ENST00000389912.6	-	0	75				SYNJ2BP-COX16_ENST00000555276.1_RNA|COX16_ENST00000557612.1_5'UTR|RNU2-51P_ENST00000410708.1_RNA	NM_016468.6	NP_057552.1	Q9P0S2	COX16_HUMAN	COX16 cytochrome c oxidase assembly homolog (S. cerevisiae)							integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)				large_intestine(1)|lung(2)	3						TCAGCAGCTCACGCTCTCACC	0.522																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF151037	CCDS9802.1	14q24.2	2013-05-10	2008-08-14	2008-06-23	ENSG00000133983	ENSG00000133983			20213	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 112"""	C14orf112		11042152, 15596615	Standard	NM_016468		Approved	HSPC203		Q9P0S2	OTTHUMG00000171238	ENST00000389912.6:c.-69T>C	14.37:g.70826373A>G			A6NDT5|A8K3X8	RNA	SNP	-	NULL	ENST00000389912.6	37	NULL	CCDS9802.1	14																																																																																			COX16	-	-	ENSG00000133983		0.522	COX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX16	HGNC	protein_coding	OTTHUMT00000412470.2	-	0.00	16	0	A	NM_016468		70826373	-1	tier1	-	no_errors	ENST00000557612	ensembl	human	known	74_37	rna	20.00	24	6	SNP	0.000	G
CSTL1	128817	genome.wustl.edu	37	20	23425499	23425499	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr20:23425499G>T	ENST00000246020.2	+	3	442	c.422G>T	c.(421-423)gGc>gTc	p.G141V	CSTL1_ENST00000347397.1_Missense_Mutation_p.G141V			Q9H114	CST1L_HUMAN	cystatin-like 1	141						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(2)|endometrium(2)|large_intestine(3)|lung(4)|skin(2)|stomach(1)	14	Colorectal(13;0.0993)|Lung NSC(19;0.235)					GAGCATGTGGGCAGAAACCTC	0.443																																																	0													77.0	73.0	75.0					20																	23425499		2203	4300	6503	SO:0001583	missense	0			AL096677	CCDS13153.1	20p11.21	2012-08-14			ENSG00000125823	ENSG00000125823			15958	protein-coding gene	gene with protein product						20565543	Standard	NM_138283		Approved	dJ322G13.4, CTES1	uc002wte.3	Q9H114	OTTHUMG00000032068	ENST00000246020.2:c.422G>T	20.37:g.23425499G>T	ENSP00000246020:p.Gly141Val		Q17RA8|Q64FF7	Missense_Mutation	SNP	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.G141V	ENST00000246020.2	37	c.422	CCDS13153.1	20	.	.	.	.	.	.	.	.	.	.	G	9.068	0.996105	0.19043	.	.	ENSG00000125823	ENST00000347397;ENST00000246020	T;T	0.10192	2.9;2.9	3.78	2.81	0.32909	.	1.495720	0.04527	N	0.385739	T	0.07052	0.0179	N	0.08118	0	0.09310	N	1	B	0.22604	0.072	B	0.14578	0.011	T	0.26155	-1.0111	10	0.62326	D	0.03	.	7.6576	0.28383	0.1172:0.0:0.8828:0.0	.	141	Q9H114	CST1L_HUMAN	V	141	ENSP00000344907:G141V;ENSP00000246020:G141V	ENSP00000246020:G141V	G	+	2	0	CSTL1	23373499	0.007000	0.16637	0.001000	0.08648	0.003000	0.03518	1.822000	0.39052	1.149000	0.42402	0.561000	0.74099	GGC	CSTL1	-	NULL	ENSG00000125823		0.443	CSTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSTL1	HGNC	protein_coding	OTTHUMT00000078328.1	-	0.00	36	0	G			23425499	+1	tier1	-	no_errors	ENST00000246020	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.002	T
DENND4A	10260	genome.wustl.edu	37	15	66031173	66031173	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr15:66031173G>C	ENST00000431932.2	-	6	880	c.672C>G	c.(670-672)ttC>ttG	p.F224L	DENND4A_ENST00000443035.3_Missense_Mutation_p.F224L	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	224	UDENN.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						CCGGTAGTGAGAATGACTCAT	0.338																																																	0													76.0	75.0	75.0					15																	66031173		1827	4076	5903	SO:0001583	missense	0			AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.672C>G	15.37:g.66031173G>C	ENSP00000396830:p.Phe224Leu		E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,tigrfam_Pentatricopeptide_repeat	p.F224L	ENST00000431932.2	37	c.672	CCDS45285.1	15	.	.	.	.	.	.	.	.	.	.	G	20.3	3.967903	0.74131	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	T;T	0.43688	0.94;0.94	5.34	3.45	0.39498	uDENN (3);	0.000000	0.85682	D	0.000000	T	0.65026	0.2652	M	0.86805	2.84	0.80722	D	1	D;D;D	0.76494	0.971;0.999;0.999	D;D;D	0.83275	0.949;0.996;0.994	T	0.66428	-0.5926	10	0.87932	D	0	.	8.4921	0.33106	0.2986:0.0:0.7014:0.0	.	224;224;224	B7Z5Y3;E7EPL3;Q7Z401	.;.;MYCPP_HUMAN	L	224	ENSP00000391167:F224L;ENSP00000396830:F224L	ENSP00000396830:F224L	F	-	3	2	DENND4A	63818227	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.906000	0.39887	0.623000	0.30267	0.484000	0.47621	TTC	DENND4A	-	pfam_uDENN_dom,smart_uDENN_dom,pfscan_uDENN_dom	ENSG00000174485		0.338	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4A	HGNC	protein_coding	OTTHUMT00000419611.1		0.00	24	0	G	NM_005848		66031173	-1			no_errors	ENST00000443035	ensembl	human	known	74_37	missense	7.89	35	3	SNP	1.000	C
DIP2A	23181	genome.wustl.edu	37	21	47957436	47957436	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr21:47957436A>T	ENST00000417564.2	+	15	1806	c.1785A>T	c.(1783-1785)aaA>aaT	p.K595N	DIP2A_ENST00000427143.2_Missense_Mutation_p.K531N|DIP2A_ENST00000466639.1_Missense_Mutation_p.K552N|Metazoa_SRP_ENST00000607098.1_RNA|DIP2A_ENST00000435722.3_Missense_Mutation_p.K595N|DIP2A_ENST00000400274.1_Missense_Mutation_p.K591N|DIP2A_ENST00000318711.7_Missense_Mutation_p.K596N|DIP2A_ENST00000457905.3_Missense_Mutation_p.K595N			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	595					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GGATCCAGAAAGTGTGCTTCT	0.493																																																	0													92.0	96.0	95.0					21																	47957436		2197	4300	6497	SO:0001583	missense	0			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.1785A>T	21.37:g.47957436A>T	ENSP00000392066:p.Lys595Asn		A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.K596N	ENST00000417564.2	37	c.1788	CCDS46655.1	21	.	.	.	.	.	.	.	.	.	.	A	19.24	3.788876	0.70337	.	.	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000358985;ENST00000457905;ENST00000466639;ENST00000435722;ENST00000417564	T;T;T;T;T;T;T	0.10382	2.88;2.88;2.88;2.88;2.88;2.88;2.88	5.44	3.0	0.34707	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.23289	0.0563	M	0.61703	1.905	0.58432	D	0.999999	P;B;D;D;B;B	0.89917	0.741;0.261;1.0;0.958;0.393;0.244	P;B;D;D;B;B	0.87578	0.568;0.243;0.998;0.924;0.406;0.264	T	0.02736	-1.1117	10	0.25751	T	0.34	-6.7106	6.9842	0.24719	0.7943:0.0:0.0738:0.1319	.	596;531;552;595;595;595	E9PER1;E7EMA5;Q14689-3;Q14689;Q14689-4;Q14689-2	.;.;.;DIP2A_HUMAN;.;.	N	591;531;596;552;595;552;595;595	ENSP00000383133:K591N;ENSP00000400528:K531N;ENSP00000323633:K596N;ENSP00000393434:K595N;ENSP00000430249:K552N;ENSP00000415089:K595N;ENSP00000392066:K595N	ENSP00000323633:K596N	K	+	3	2	DIP2A	46781864	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.303000	0.33470	0.878000	0.35920	0.482000	0.46254	AAA	DIP2A	-	pfam_AMP-dep_Synth/Lig	ENSG00000160305		0.493	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	HGNC	protein_coding	OTTHUMT00000376736.1	-	0.00	58	0	A	NM_015151		47957436	+1	tier1	-	no_errors	ENST00000318711	ensembl	human	known	74_37	missense	7.46	62	5	SNP	1.000	T
DMRTB1	63948	genome.wustl.edu	37	1	53930386	53930386	+	Missense_Mutation	SNP	C	C	A	rs150466113		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr1:53930386C>A	ENST00000371445.3	+	3	882	c.827C>A	c.(826-828)cCg>cAg	p.P276Q		NM_033067.1	NP_149056.1	Q96MA1	DMRTB_HUMAN	DMRT-like family B with proline-rich C-terminal, 1	276	Pro-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(3)|lung(5)|ovary(1)|skin(1)	10						ccCCTTCCACCGCTTCCACCG	0.667																																																	0													45.0	49.0	48.0					1																	53930386		2203	4300	6503	SO:0001583	missense	0			AJ291671	CCDS581.1	1p32	2008-08-29			ENSG00000143006	ENSG00000143006			13913	protein-coding gene	gene with protein product		614805					Standard	NM_033067		Approved		uc001cvq.1	Q96MA1	OTTHUMG00000008080	ENST00000371445.3:c.827C>A	1.37:g.53930386C>A	ENSP00000360500:p.Pro276Gln		Q96SD2	Missense_Mutation	SNP	pfam_DM_DNA-bd,superfamily_DM_DNA-bd,smart_DM_DNA-bd,pfscan_DM_DNA-bd	p.P276Q	ENST00000371445.3	37	c.827	CCDS581.1	1	.	.	.	.	.	.	.	.	.	.	C	11.68	1.711403	0.30322	.	.	ENSG00000143006	ENST00000371445;ENST00000431335	T	0.49139	0.79	2.08	-0.397	0.12423	.	.	.	.	.	T	0.39279	0.1072	L	0.29908	0.895	0.09310	N	1	D	0.54047	0.964	P	0.52514	0.701	T	0.22452	-1.0216	9	0.54805	T	0.06	2.7883	2.0845	0.03642	0.2896:0.4783:0.0:0.2321	.	276	Q96MA1	DMRTB_HUMAN	Q	276;123	ENSP00000360500:P276Q	ENSP00000360500:P276Q	P	+	2	0	DMRTB1	53702974	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	-0.168000	0.09925	-0.061000	0.13110	0.455000	0.32223	CCG	DMRTB1	-	NULL	ENSG00000143006		0.667	DMRTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRTB1	HGNC	protein_coding	OTTHUMT00000022110.1	-	0.00	123	0	C			53930386	+1	tier1	-	no_errors	ENST00000371445	ensembl	human	known	74_37	missense	7.88	152	13	SNP	0.001	A
DOK3	79930	genome.wustl.edu	37	5	176930258	176930258	+	IGR	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr5:176930258G>T	ENST00000357198.4	-	0	1729				DOK3_ENST00000312943.6_Missense_Mutation_p.Q261K|DOK3_ENST00000377112.4_Missense_Mutation_p.Q159K|RP11-1334A24.6_ENST00000506025.1_RNA	NM_024872.2	NP_079148.2	Q7L591	DOK3_HUMAN	docking protein 3						Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|lung(7)	13	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			aggctgtcctgaacacggctg	0.567																																																	0													76.0	75.0	75.0					5																	176930258		692	1591	2283	SO:0001628	intergenic_variant	0			AK026223	CCDS4426.1, CCDS47349.1, CCDS47350.1	5q35	2008-02-05			ENSG00000146094	ENSG00000146094			24583	protein-coding gene	gene with protein product		611435				10733577, 12595900	Standard	NM_024872		Approved	FLJ22570	uc003mhk.3	Q7L591	OTTHUMG00000130850		5.37:g.176930258G>T			E9PAT0|H7BXS0|Q8N864|Q9BQB3|Q9H666	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,pfscan_Insln_rcpt_S1	p.Q261K	ENST00000357198.4	37	c.781	CCDS4426.1	5	.	.	.	.	.	.	.	.	.	.	G	9.851	1.193754	0.22037	.	.	ENSG00000146094	ENST00000312943;ENST00000377112	T;T	0.49720	0.82;0.77	2.1	0.253	0.15551	.	.	.	.	.	T	0.17916	0.0430	N	0.08118	0	0.09310	N	0.999997	B;B;B	0.27625	0.115;0.072;0.183	B;B;B	0.19666	0.012;0.011;0.026	T	0.24835	-1.0149	9	0.02654	T	1	.	4.1571	0.10266	0.3767:0.0:0.6232:0.0	.	159;261;147	E9PAT0;Q7L591-3;Q7L591-2	.;.;.	K	261;159	ENSP00000325174:Q261K;ENSP00000366316:Q159K	ENSP00000325174:Q261K	Q	-	1	0	DOK3	176862864	0.002000	0.14202	0.001000	0.08648	0.067000	0.16453	-0.147000	0.10234	0.040000	0.15660	0.313000	0.20887	CAG	DOK3	-	pfscan_Insln_rcpt_S1	ENSG00000146094		0.567	DOK3-001	KNOWN	basic|CCDS	protein_coding	DOK3	HGNC	protein_coding	OTTHUMT00000253420.4	-	0.00	35	0	G	NM_024872		176930258	-1	tier1	-	no_errors	ENST00000312943	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.001	T
EGFL6	25975	genome.wustl.edu	37	X	13621508	13621508	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chrX:13621508G>T	ENST00000361306.1	+	5	730	c.473G>T	c.(472-474)tGt>tTt	p.C158F	EGFL6_ENST00000380602.3_Missense_Mutation_p.C158F	NM_001167890.1|NM_015507.3	NP_001161362.1|NP_056322.2	Q8IUX8	EGFL6_HUMAN	EGF-like-domain, multiple 6	158	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)|skin(3)	23						CAGTGCCTGTGTCCATCCTCA	0.502																																																	0													141.0	115.0	124.0					X																	13621508		2203	4300	6503	SO:0001583	missense	0			AF186084	CCDS14155.1, CCDS55370.1	Xp22	2008-02-05	2002-10-09		ENSG00000198759	ENSG00000198759			3235	protein-coding gene	gene with protein product		300239	"""MAM and EGF domain containing"""	MAEG		10610727	Standard	NM_015507		Approved		uc004cvj.3	Q8IUX8	OTTHUMG00000021155	ENST00000361306.1:c.473G>T	X.37:g.13621508G>T	ENSP00000355126:p.Cys158Phe		B2RCB1|Q6UXJ1|Q8NBV0|Q8WYG3|Q9NY67|Q9NZL7|Q9UFK6	Missense_Mutation	SNP	pfam_MAM_dom,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_MAM_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.C158F	ENST00000361306.1	37	c.473	CCDS14155.1	X	.	.	.	.	.	.	.	.	.	.	G	17.18	3.323838	0.60634	.	.	ENSG00000198759	ENST00000361306;ENST00000380602	D;D	0.97791	-4.54;-4.54	5.06	5.06	0.68205	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.99061	0.9678	M	0.93375	3.41	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.971	D	0.99525	1.0959	10	0.87932	D	0	.	17.2613	0.87070	0.0:0.0:1.0:0.0	.	158;158	Q8IUX8-2;Q8IUX8	.;EGFL6_HUMAN	F	158	ENSP00000355126:C158F;ENSP00000369976:C158F	ENSP00000355126:C158F	C	+	2	0	EGFL6	13531429	1.000000	0.71417	0.817000	0.32601	0.375000	0.29983	9.012000	0.93624	2.100000	0.63781	0.583000	0.79449	TGT	EGFL6	-	smart_EG-like_dom	ENSG00000198759		0.502	EGFL6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	EGFL6	HGNC	protein_coding	OTTHUMT00000055800.1	-	0.00	42	0	G	NM_015507		13621508	+1	tier1	-	no_errors	ENST00000380602	ensembl	human	known	74_37	missense	12.20	36	5	SNP	1.000	T
SCN11A	11280	genome.wustl.edu	37	3	38948856	38948856	+	Intron	SNP	C	C	T	rs370348256|rs76050581|rs377500548		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr3:38948856C>T	ENST00000302328.3	-	10	1672				SCN11A_ENST00000450244.1_Intron|SCN11A_ENST00000444237.2_Intron|SCN11A_ENST00000456224.3_Intron|AC116038.1_ENST00000401122.1_RNA	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit						cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TATacacacacacacacacac	0.383																																																	0																																										SO:0001627	intron_variant	0			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.1473+583G>A	3.37:g.38948856C>T			A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	RNA	SNP	-	NULL	ENST00000302328.3	37	NULL	CCDS33737.1	3																																																																																			AC116038.1	-	-	ENSG00000215941		0.383	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215941	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000109746.4	-	0.00	14	0	C	NM_014139		38948856	+1	tier1	rs76050581	no_errors	ENST00000401122	ensembl	human	novel	74_37	rna	23.53	13	4	SNP	0.000	T
LINC00937	389634	genome.wustl.edu	37	12	8476956	8476956	+	lincRNA	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr12:8476956G>A	ENST00000544461.1	-	0	1081				RP11-113C12.4_ENST00000537764.1_RNA|AC092745.1_ENST00000408380.1_RNA|RP11-90D4.3_ENST00000535746.1_lincRNA					long intergenic non-protein coding RNA 937																		tttctcgctcgggcctccaAA	0.537																																																	0																																												0			BC073935		12p13.31	2013-05-30			ENSG00000226091	ENSG00000226091		"""Long non-coding RNAs"""	48629	non-coding RNA	RNA, long non-coding							Standard	NR_024420		Approved				OTTHUMG00000168663		12.37:g.8476956G>A				RNA	SNP	-	NULL	ENST00000544461.1	37	NULL		12																																																																																			AC092745.1	-	-	ENSG00000221307		0.537	LINC00937-001	KNOWN	basic	lincRNA	ENSG00000221307	Clone_based_ensembl_gene	lincRNA	OTTHUMT00000400511.1	-	0.00	85	0	G			8476956	+1	tier1	-	no_errors	ENST00000408380	ensembl	human	novel	74_37	rna	11.65	91	12	SNP	0.279	A
FAHD2CP	729234	genome.wustl.edu	37	2	96676301	96676301	+	RNA	SNP	C	C	A	rs369749400		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr2:96676301C>A	ENST00000607780.1	+	0	0									fumarylacetoacetate hydrolase domain containing 2C, pseudogene																		GTGACGTCACCGGACGCGCCC	0.711																																																	0																																												0					2q11.1	2012-06-29			ENSG00000231584	ENSG00000231584			44135	pseudogene	pseudogene							Standard	NR_003698		Approved		uc010fht.3		OTTHUMG00000155210		2.37:g.96676301C>A				RNA	SNP	-	NULL	ENST00000607780.1	37	NULL		2																																																																																			FAHD2CP	-	-	ENSG00000231584		0.711	FAHD2CP-005	KNOWN	non_canonical_TEC|basic	processed_transcript	FAHD2CP	HGNC	pseudogene	OTTHUMT00000470200.1	-	0.00	12	0	C	NR_003698		96676301	+1	tier1	-	no_errors	ENST00000467292	ensembl	human	known	74_37	rna	43.75	9	7	SNP	0.018	A
FAM149A	25854	genome.wustl.edu	37	4	187079298	187079298	+	Intron	SNP	C	C	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr4:187079298C>T	ENST00000356371.5	+	8	1602				FAM149A_ENST00000503432.1_Intron|FAM149A_ENST00000389354.5_Intron|FAM149A_ENST00000514829.1_3'UTR|FAM149A_ENST00000227065.4_Intron|FAM149A_ENST00000514153.1_Intron|FAM149A_ENST00000502970.1_Intron			A5PLN7	F149A_HUMAN	family with sequence similarity 149, member A											breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(2)	25		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		GAACACTGGCCGGCAGGCTGT	0.607																																																	0																																										SO:0001627	intron_variant	0			AK057166	CCDS34117.1	4q35.1	2012-04-19			ENSG00000109794	ENSG00000109794			24527	protein-coding gene	gene with protein product							Standard	NM_015398		Approved	DKFZP564J102, MST119, MSTP119	uc010isl.3	A5PLN7	OTTHUMG00000160565	ENST00000356371.5:c.1602+425C>T	4.37:g.187079298C>T			B5MDB8|Q2TAN6|Q7Z2S5|Q9Y4T9	RNA	SNP	-	NULL	ENST00000356371.5	37	NULL		4																																																																																			FAM149A	-	-	ENSG00000109794		0.607	FAM149A-201	KNOWN	basic	protein_coding	FAM149A	HGNC	protein_coding		-	0.00	24	0	C	NM_001006655		187079298	+1	tier1	-	no_errors	ENST00000513030	ensembl	human	known	74_37	rna	38.24	21	13	SNP	0.983	T
FAM45A	404636	genome.wustl.edu	37	10	120882997	120882997	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr10:120882997G>T	ENST00000361432.2	+	6	636	c.610G>T	c.(610-612)Gtg>Ttg	p.V204L	FAM45A_ENST00000489988.1_3'UTR|FAM45A_ENST00000535029.1_Missense_Mutation_p.W166C|FAM45A_ENST00000544016.1_Missense_Mutation_p.V53L	NM_207009.2	NP_996892.1	Q8TCE6	FA45A_HUMAN	family with sequence similarity 45, member A	204										breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	14		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		GCCTGCCCTGGTGTGGCACCG	0.562																																																	0													95.0	71.0	79.0					10																	120882997		2203	4300	6503	SO:0001583	missense	0			AF168713	CCDS7609.1	10q25	2008-09-04			ENSG00000119979	ENSG00000119979			31793	protein-coding gene	gene with protein product							Standard	NM_207009		Approved			Q8TCE6	OTTHUMG00000019143	ENST00000361432.2:c.610G>T	10.37:g.120882997G>T	ENSP00000354688:p.Val204Leu		B1AMV6|B4DDC3|D3DRC8|Q9NXW4	Missense_Mutation	SNP	pfam_ABL9/DENND6_dom	p.V204L	ENST00000361432.2	37	c.610	CCDS7609.1	10	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	17.32|17.32|17.32	3.359109|3.359109|3.359109	0.61403|0.61403|0.61403	.|.|.	.|.|.	ENSG00000119979|ENSG00000119979|ENSG00000119979	ENST00000546291|ENST00000361432;ENST00000544016|ENST00000535029	.|.|.	.|.|.	.|.|.	5.65|5.65|5.65	5.65|5.65|5.65	0.86999|0.86999|0.86999	.|.|.	.|0.333417|.	.|0.33438|.	.|N|.	.|0.004915|.	T|T|T	0.75598|0.75598|0.75598	0.3871|0.3871|0.3871	M|M|M	0.68593|0.68593|0.68593	2.085|2.085|2.085	0.45378|0.45378|0.45378	D|D|D	0.998368|0.998368|0.998368	.|B;B;B;B|.	.|0.23442|.	.|0.041;0.032;0.033;0.085|.	.|B;B;B;B|.	.|0.26310|.	.|0.068;0.068;0.025;0.059|.	T|T|T	0.77531|0.77531|0.77531	-0.2553|-0.2553|-0.2553	6|9|6	0.72032|0.41790|0.87932	D|T|D	0.01|0.15|0	.|.|.	17.8954|17.8954|17.8954	0.88886|0.88886|0.88886	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|131;53;196;204|.	.|B4DNL9;B4DMU4;Q8TCE6-2;Q8TCE6|.	.|.;.;.;FA45A_HUMAN|.	V|L|C	203|204;53|166	.|.|.	ENSP00000442471:G203V|ENSP00000354688:V204L|ENSP00000444309:W166C	G|V|W	+|+|+	2|1|3	0|0|0	FAM45A|FAM45A|FAM45A	120872987|120872987|120872987	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	4.156000|4.156000|4.156000	0.58138|0.58138|0.58138	2.663000|2.663000|2.663000	0.90544|0.90544|0.90544	0.543000|0.543000|0.543000	0.68304|0.68304|0.68304	GGT|GTG|TGG	FAM45A	-	NULL	ENSG00000119979		0.562	FAM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM45A	HGNC	protein_coding	OTTHUMT00000050623.1		0.00	85	0	G	NM_207009		120882997	+1			no_errors	ENST00000361432	ensembl	human	known	74_37	missense	6.76	69	5	SNP	1.000	T
FAM47C	442444	genome.wustl.edu	37	X	37027957	37027957	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chrX:37027957G>A	ENST00000358047.3	+	1	1526	c.1474G>A	c.(1474-1476)Gac>Aac	p.D492N		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	492										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						AGAGCCTCCCGACACTGGAGT	0.622																																																	0													73.0	71.0	72.0					X																	37027957		2202	4300	6502	SO:0001583	missense	0			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1474G>A	X.37:g.37027957G>A	ENSP00000367913:p.Asp492Asn		Q6ZU46	Missense_Mutation	SNP	NULL	p.D492N	ENST00000358047.3	37	c.1474	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	a	11.58	1.682033	0.29872	.	.	ENSG00000198173	ENST00000358047	T	0.14022	2.54	0.974	-1.95	0.07548	.	.	.	.	.	T	0.07324	0.0185	L	0.38175	1.15	0.09310	N	1	B	0.31655	0.334	B	0.22152	0.038	T	0.36720	-0.9736	9	0.20519	T	0.43	.	3.4805	0.07601	0.2206:0.2606:0.5188:0.0	.	492	Q5HY64	FA47C_HUMAN	N	492	ENSP00000367913:D492N	ENSP00000367913:D492N	D	+	1	0	FAM47C	36937878	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.995000	0.01472	-0.791000	0.04486	0.407000	0.27541	GAC	FAM47C	-	NULL	ENSG00000198173		0.622	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	-	0.00	82	0	G	NM_001013736		37027957	+1	tier1	-	no_errors	ENST00000358047	ensembl	human	known	74_37	missense	24.00	57	18	SNP	0.001	A
FAT4	79633	genome.wustl.edu	37	4	126371928	126371928	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr4:126371928C>T	ENST00000394329.3	+	9	9770	c.9757C>T	c.(9757-9759)Caa>Taa	p.Q3253*	FAT4_ENST00000335110.5_Nonsense_Mutation_p.Q1551*	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3253	Cadherin 31. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q3253E(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CATAACCACTCAAGGCTTCTT	0.438																																																	2	Substitution - Missense(2)	endometrium(2)											61.0	60.0	60.0					4																	126371928		2203	4300	6503	SO:0001587	stop_gained	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.9757C>T	4.37:g.126371928C>T	ENSP00000377862:p.Gln3253*		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.Q3253*	ENST00000394329.3	37	c.9757	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	C	51	18.161898	0.99900	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	.	.	.	5.63	5.63	0.86233	.	0.000000	0.33670	U	0.004675	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	.	19.7096	0.96089	0.0:1.0:0.0:0.0	.	.	.	.	X	3253;1551	.	ENSP00000335169:Q1551X	Q	+	1	0	FAT4	126591378	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	7.662000	0.83803	2.652000	0.90054	0.655000	0.94253	CAA	FAT4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196159		0.438	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	-	0.00	40	0	C	NM_024582		126371928	+1	tier1	-	no_errors	ENST00000394329	ensembl	human	known	74_37	nonsense	13.04	40	6	SNP	1.000	T
FBN1	2200	genome.wustl.edu	37	15	48808454	48808454	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr15:48808454C>A	ENST00000316623.5	-	11	1708	c.1253G>T	c.(1252-1254)gGc>gTc	p.G418V		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	418	Pro-rich.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		AGGAGGAAAGCCAGGAGGAAC	0.502																																																	0													115.0	121.0	119.0					15																	48808454		2197	4296	6493	SO:0001583	missense	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.1253G>T	15.37:g.48808454C>A	ENSP00000325527:p.Gly418Val		B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.G418V	ENST00000316623.5	37	c.1253	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	C	11.36	1.615055	0.28712	.	.	ENSG00000166147	ENST00000316623	D	0.81739	-1.53	5.54	3.55	0.40652	.	0.547984	0.21330	N	0.076307	T	0.71151	0.3306	L	0.43923	1.385	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.64202	-0.6463	10	0.15499	T	0.54	.	12.1625	0.54110	0.3085:0.6915:0.0:0.0	.	418	P35555	FBN1_HUMAN	V	418	ENSP00000325527:G418V	ENSP00000325527:G418V	G	-	2	0	FBN1	46595746	0.996000	0.38824	1.000000	0.80357	0.999000	0.98932	0.634000	0.24614	1.534000	0.49203	0.655000	0.94253	GGC	FBN1	-	pirsf_FBN	ENSG00000166147		0.502	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	-	0.00	37	0	C			48808454	-1	tier1	-	no_errors	ENST00000316623	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	A
FBXO9	26268	genome.wustl.edu	37	6	52957602	52957602	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr6:52957602G>T	ENST00000244426.6	+	8	1045	c.873G>T	c.(871-873)tgG>tgT	p.W291C	RN7SL244P_ENST00000493405.2_RNA|FBXO9_ENST00000323557.7_Missense_Mutation_p.W281C|FBXO9_ENST00000370939.3_Missense_Mutation_p.W247C	NM_012347.4	NP_036479.1	Q9UK97	FBX9_HUMAN	F-box protein 9	291					fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|protein ubiquitination (GO:0016567)|regulation of TOR signaling (GO:0032006)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|large_intestine(4)|lung(1)|pancreas(2)|skin(1)	9	Lung NSC(77;0.103)					ATAGAGCCTGGCACCAAGTGG	0.353																																																	0													60.0	57.0	58.0					6																	52957602		1843	4096	5939	SO:0001583	missense	0			AF155114	CCDS55022.1, CCDS55023.1, CCDS55024.1	6p12.3-p11.2	2004-06-15	2004-06-15		ENSG00000112146	ENSG00000112146		"""F-boxes /  ""other"""""	13588	protein-coding gene	gene with protein product		609091	"""F-box only protein 9"""			10531035, 10531037	Standard	NM_012347		Approved	FBX9, NY-REN-57	uc021zao.1	Q9UK97	OTTHUMG00000014869	ENST00000244426.6:c.873G>T	6.37:g.52957602G>T	ENSP00000244426:p.Trp291Cys		A6NFW3|B3KMM6|O75986|Q59EH8|Q6PKH7|Q9NT57|Q9Y593	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom,pfscan_F-box_dom	p.W291C	ENST00000244426.6	37	c.873	CCDS55023.1	6	.	.	.	.	.	.	.	.	.	.	G	17.32	3.359482	0.61403	.	.	ENSG00000112146	ENST00000370939;ENST00000323557;ENST00000244426	T;T;T	0.78246	-1.15;-1.15;-1.16	5.53	4.66	0.58398	F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	T	0.78966	0.4367	L	0.55103	1.725	0.80722	D	1	P;P;D	0.71674	0.865;0.673;0.998	B;B;P	0.61328	0.442;0.248;0.887	T	0.80661	-0.1283	10	0.49607	T	0.09	-22.9532	14.6531	0.68811	0.0702:0.0:0.9298:0.0	.	281;398;291	Q9UK97-2;Q59EH8;Q9UK97	.;.;FBX9_HUMAN	C	247;281;291	ENSP00000359977:W247C;ENSP00000326968:W281C;ENSP00000244426:W291C	ENSP00000244426:W291C	W	+	3	0	FBXO9	53065561	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	9.420000	0.97426	1.477000	0.48234	-0.251000	0.11542	TGG	FBXO9	-	superfamily_F-box_dom	ENSG00000112146		0.353	FBXO9-002	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	FBXO9	HGNC	protein_coding	OTTHUMT00000040950.3	-	0.00	58	0	G			52957602	+1	tier1	-	no_errors	ENST00000244426	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
FLG	2312	genome.wustl.edu	37	1	152282420	152282420	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr1:152282420C>G	ENST00000368799.1	-	3	4977	c.4942G>C	c.(4942-4944)Gag>Cag	p.E1648Q	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1648	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGGAGCTCTCTGCAGAGTGC	0.537									Ichthyosis																																								0													231.0	236.0	234.0					1																	152282420		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4942G>C	1.37:g.152282420C>G	ENSP00000357789:p.Glu1648Gln		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.E1648Q	ENST00000368799.1	37	c.4942	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	6.520	0.464110	0.12402	.	.	ENSG00000143631	ENST00000368799	T	0.00882	5.58	3.03	0.818	0.18778	.	.	.	.	.	T	0.00300	0.0009	L	0.41236	1.265	0.09310	N	1	B	0.24618	0.107	B	0.18871	0.023	T	0.32851	-0.9891	9	0.14656	T	0.56	.	7.6128	0.28139	0.4548:0.5451:0.0:0.0	.	1648	P20930	FILA_HUMAN	Q	1648	ENSP00000357789:E1648Q	ENSP00000357789:E1648Q	E	-	1	0	FLG	150549044	0.010000	0.17322	0.000000	0.03702	0.012000	0.07955	0.821000	0.27338	0.057000	0.16193	0.306000	0.20318	GAG	FLG	-	NULL	ENSG00000143631		0.537	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	202	0	C	NM_002016		152282420	-1	tier1	-	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	11.79	171	23	SNP	0.000	G
FLOT2	2319	genome.wustl.edu	37	17	27209414	27209414	+	Missense_Mutation	SNP	C	C	T	rs376860005		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr17:27209414C>T	ENST00000394908.4	-	6	624	c.520G>A	c.(520-522)Gtg>Atg	p.V174M	FLOT2_ENST00000585169.1_Missense_Mutation_p.V174M|FLOT2_ENST00000394906.2_Missense_Mutation_p.V229M|FLOT2_ENST00000577789.1_5'UTR	NM_004475.2	NP_004466.2	Q14254	FLOT2_HUMAN	flotillin 2	174					cell adhesion (GO:0007155)|epidermis development (GO:0008544)|establishment of protein localization to plasma membrane (GO:0090002)|negative regulation of amyloid precursor protein catabolic process (GO:1902992)|negative regulation of gene expression (GO:0010629)|protein stabilization (GO:0050821)	acrosomal membrane (GO:0002080)|caveola (GO:0005901)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|flotillin complex (GO:0016600)|focal adhesion (GO:0005925)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				endometrium(3)|lung(6)|prostate(1)|urinary_tract(1)	11	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;3.26e-06)|all cancers(11;1.76e-05)|BRCA - Breast invasive adenocarcinoma(11;0.00015)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			CTCTGCACCACGGCAGTCTGC	0.602																																																	0													51.0	54.0	53.0					17																	27209414		2202	4294	6496	SO:0001583	missense	0			M60922	CCDS11245.2	17q11-q12	2008-07-18			ENSG00000132589	ENSG00000132589			3758	protein-coding gene	gene with protein product	"""Flotillin 2 (epidermal surface antigen 1)"", ""membrane component, chromosome 17, surface marker 1 (35kD protein identified by monoclonal antibody ECS-1)"""	131560		M17S1		1769667	Standard	XM_005257950		Approved	ESA, ESA1, ECS-1, ECS1	uc002hdc.3	Q14254	OTTHUMG00000132674	ENST00000394908.4:c.520G>A	17.37:g.27209414C>T	ENSP00000378368:p.Val174Met			Missense_Mutation	SNP	pfam_Band_7,smart_Band_7	p.V174M	ENST00000394908.4	37	c.520	CCDS11245.2	17	.	.	.	.	.	.	.	.	.	.	C	15.28	2.788191	0.49997	.	.	ENSG00000132589	ENST00000394906;ENST00000394908	D;D	0.93076	-3.16;-3.16	5.44	4.41	0.53225	.	0.166809	0.52532	D	0.000069	D	0.88179	0.6367	N	0.19112	0.55	0.33158	D	0.546633	B	0.23854	0.092	B	0.22880	0.042	D	0.88549	0.3115	10	0.49607	T	0.09	-22.3657	16.9695	0.86295	0.0:0.8615:0.1385:0.0	.	174	Q14254	FLOT2_HUMAN	M	229;174	ENSP00000378366:V229M;ENSP00000378368:V174M	ENSP00000378366:V229M	V	-	1	0	FLOT2	24233540	0.999000	0.42202	0.965000	0.40720	0.359000	0.29487	3.998000	0.57024	2.578000	0.87016	0.313000	0.20887	GTG	FLOT2	-	pfam_Band_7,smart_Band_7	ENSG00000132589		0.602	FLOT2-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	FLOT2	HGNC	protein_coding	OTTHUMT00000255935.3	-	0.00	92	0	C	NM_004475		27209414	-1	tier1	-	no_errors	ENST00000394908	ensembl	human	known	74_37	missense	10.00	72	8	SNP	0.894	T
FRMPD2	143162	genome.wustl.edu	37	10	49440312	49440312	+	Nonsense_Mutation	SNP	A	A	C			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr10:49440312A>C	ENST00000374201.3	-	10	1316	c.1014T>G	c.(1012-1014)taT>taG	p.Y338*	FRMPD2_ENST00000305531.3_Nonsense_Mutation_p.Y314*|FRMPD2_ENST00000407470.4_Nonsense_Mutation_p.Y307*	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	338					tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		TGAGAGCCAAATAGGATTTCC	0.433																																																	0													74.0	70.0	72.0					10																	49440312		2203	4300	6503	SO:0001587	stop_gained	0			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.1014T>G	10.37:g.49440312A>C	ENSP00000363317:p.Tyr338*		B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Nonsense_Mutation	SNP	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.Y338*	ENST00000374201.3	37	c.1014	CCDS31195.1	10	.	.	.	.	.	.	.	.	.	.	A	39	7.486594	0.98316	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	.	.	.	5.44	-4.18	0.03846	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.0268	0.58819	0.4251:0.0:0.5749:0.0	.	.	.	.	X	338;314;307	.	ENSP00000307079:Y314X	Y	-	3	2	FRMPD2	49110318	0.000000	0.05858	0.462000	0.27118	0.995000	0.86356	-0.202000	0.09451	-0.833000	0.04245	0.533000	0.62120	TAT	FRMPD2	-	NULL	ENSG00000170324		0.433	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3	-	0.00	27	0	A	NM_152428		49440312	-1	tier1	-	no_errors	ENST00000374201	ensembl	human	known	74_37	nonsense	21.05	30	8	SNP	0.000	C
GALR2	8811	genome.wustl.edu	37	17	74071023	74071023	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr17:74071023G>A	ENST00000329003.3	+	1	149	c.59G>A	c.(58-60)gGc>gAc	p.G20D	SRP68_ENST00000539137.1_5'Flank|SRP68_ENST00000307877.2_5'Flank|SRP68_ENST00000355113.5_5'Flank	NM_003857.2	NP_003848.1	O43603	GALR2_HUMAN	galanin receptor 2	20					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell surface receptor signaling pathway (GO:0007166)|digestion (GO:0007586)|feeding behavior (GO:0007631)|learning or memory (GO:0007611)|multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|negative regulation of adenylate cyclase activity (GO:0007194)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of large conductance calcium-activated potassium channel activity (GO:1902608)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|peptide hormone binding (GO:0017046)			cervix(1)|lung(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	8						GGCGGGGGAGGCTGGCACCCC	0.746																																																	0													18.0	14.0	15.0					17																	74071023		2182	4252	6434	SO:0001583	missense	0			AF040630	CCDS11739.1	17q25.3	2012-08-08			ENSG00000182687	ENSG00000182687		"""GPCR / Class A : Galanin receptors"""	4133	protein-coding gene	gene with protein product		603691				9685625, 9832121	Standard	NM_003857		Approved	GALNR2	uc002jqm.1	O43603	OTTHUMG00000167479	ENST00000329003.3:c.59G>A	17.37:g.74071023G>A	ENSP00000329684:p.Gly20Asp		A5JUU4|Q32MN8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Galanin_rcpt,prints_GAL2_rcpt	p.G20D	ENST00000329003.3	37	c.59	CCDS11739.1	17	.	.	.	.	.	.	.	.	.	.	G	14.50	2.555070	0.45487	.	.	ENSG00000182687	ENST00000329003	T	0.69685	-0.42	4.0	3.0	0.34707	.	1.403810	0.05102	N	0.487312	T	0.49253	0.1546	N	0.14661	0.345	0.31632	N	0.648925	P	0.47106	0.89	B	0.38378	0.272	T	0.43376	-0.9395	10	0.11182	T	0.66	.	13.4198	0.60989	0.0:0.1595:0.8405:0.0	.	20	O43603	GALR2_HUMAN	D	20	ENSP00000329684:G20D	ENSP00000329684:G20D	G	+	2	0	GALR2	71582618	1.000000	0.71417	0.551000	0.28230	0.527000	0.34593	2.849000	0.48286	1.000000	0.39049	0.313000	0.20887	GGC	GALR2	-	NULL	ENSG00000182687		0.746	GALR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALR2	HGNC	protein_coding	OTTHUMT00000394760.1	-	0.00	39	0	G			74071023	+1	tier1	-	no_errors	ENST00000329003	ensembl	human	known	74_37	missense	18.42	31	7	SNP	0.996	A
GCN1L1	10985	genome.wustl.edu	37	12	120580662	120580662	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr12:120580662T>A	ENST00000300648.6	-	43	5591	c.5579A>T	c.(5578-5580)gAg>gTg	p.E1860V		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1860					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTTATCATCCTCAGAGGCAGT	0.547																																																	0													155.0	155.0	155.0					12																	120580662		2046	4200	6246	SO:0001583	missense	0			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.5579A>T	12.37:g.120580662T>A	ENSP00000300648:p.Glu1860Val		A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	pfam_DUF3554,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.E1860V	ENST00000300648.6	37	c.5579	CCDS41847.1	12	.	.	.	.	.	.	.	.	.	.	T	23.9	4.471630	0.84533	.	.	ENSG00000089154	ENST00000300648	T	0.56611	0.45	5.97	5.97	0.96955	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73814	0.3635	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.77262	-0.2653	10	0.87932	D	0	-21.2584	16.4473	0.83942	0.0:0.0:0.0:1.0	.	1860	Q92616	GCN1L_HUMAN	V	1860	ENSP00000300648:E1860V	ENSP00000300648:E1860V	E	-	2	0	GCN1L1	119065045	1.000000	0.71417	0.844000	0.33320	0.784000	0.44337	7.484000	0.81180	2.281000	0.76405	0.533000	0.62120	GAG	GCN1L1	-	superfamily_ARM-type_fold	ENSG00000089154		0.547	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCN1L1	HGNC	protein_coding	OTTHUMT00000403592.1		0.00	47	0	T			120580662	-1			no_errors	ENST00000300648	ensembl	human	known	74_37	missense	6.82	41	3	SNP	1.000	A
GLA	2717	genome.wustl.edu	37	X	100656624	100656624	+	Silent	SNP	T	T	C			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chrX:100656624T>C	ENST00000218516.3	-	3	564	c.543A>G	c.(541-543)gcA>gcG	p.A181A	RPL36A-HNRNPH2_ENST00000409170.3_Intron|GLA_ENST00000479445.1_5'UTR	NM_000169.2	NP_000160.1	P06280	AGAL_HUMAN	galactosidase, alpha	181					glycoside catabolic process (GO:0016139)|glycosphingolipid catabolic process (GO:0046479)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|oligosaccharide metabolic process (GO:0009311)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-galactosidase activity (GO:0004557)|catalytic activity (GO:0003824)|galactoside binding (GO:0016936)|hydrolase activity (GO:0016787)|protein homodimerization activity (GO:0042803)|raffinose alpha-galactosidase activity (GO:0052692)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						CATTACCATCTGCCAAATTTT	0.403																																					Colon(193;776 2816 31189 44474)												0													119.0	105.0	110.0					X																	100656624		2203	4300	6503	SO:0001819	synonymous_variant	0			X16889	CCDS14484.1	Xq21.3-q22	2014-09-17			ENSG00000102393	ENSG00000102393	3.2.1.22		4296	protein-coding gene	gene with protein product		300644					Standard	NM_000169		Approved	GALA	uc004ehl.1	P06280	OTTHUMG00000022026	ENST00000218516.3:c.543A>G	X.37:g.100656624T>C			Q6LER7	Silent	SNP	pfam_Glyco_hydro_GHD,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_27	p.A181	ENST00000218516.3	37	c.543	CCDS14484.1	X																																																																																			GLA	-	superfamily_Glycoside_hydrolase_SF	ENSG00000102393		0.403	GLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLA	HGNC	protein_coding	OTTHUMT00000057540.1	-	0.00	55	0	T			100656624	-1	tier1	-	no_errors	ENST00000218516	ensembl	human	known	74_37	silent	7.35	63	5	SNP	0.290	C
GUSBP6	653435	genome.wustl.edu	37	7	63580894	63580894	+	RNA	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr7:63580894G>A	ENST00000434932.1	+	0	86									glucuronidase, beta pseudogene 6																		GAGCTTATCGGGAATTCTGCC	0.478																																																	0																																												0					7q11.21	2011-06-09			ENSG00000224458	ENSG00000224458			42320	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000156481		7.37:g.63580894G>A				RNA	SNP	-	NULL	ENST00000434932.1	37	NULL		7																																																																																			GUSBP6	-	-	ENSG00000224458		0.478	GUSBP6-002	KNOWN	basic|exp_conf	processed_transcript	GUSBP6	HGNC	pseudogene	OTTHUMT00000344314.1	-	0.00	119	0	G			63580894	+1	tier1	-	no_errors	ENST00000434932	ensembl	human	known	74_37	rna	37.40	82	49	SNP	1.000	A
GRM8	2918	genome.wustl.edu	37	7	126173452	126173452	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr7:126173452T>G	ENST00000339582.2	-	9	2792	c.1984A>C	c.(1984-1986)Agc>Cgc	p.S662R	GRM8_ENST00000480995.1_5'UTR|GRM8_ENST00000444921.2_Missense_Mutation_p.S662R|GRM8_ENST00000358373.3_Missense_Mutation_p.S662R			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	662					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				GCTGCATAGCTGAAACACATG	0.443										HNSCC(24;0.065)																																							0													93.0	88.0	90.0					7																	126173452		2203	4300	6503	SO:0001583	missense	0				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1984A>C	7.37:g.126173452T>G	ENSP00000344173:p.Ser662Arg		A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_8,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4,pfscan_GPCR_3_C	p.S662R	ENST00000339582.2	37	c.1984	CCDS5794.1	7	.	.	.	.	.	.	.	.	.	.	T	21.7	4.189593	0.78789	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373	D;D;D	0.88586	-2.4;-2.4;-2.4	5.75	5.75	0.90469	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.94394	0.8197	M	0.81341	2.54	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.80764	0.994;0.968	D	0.95010	0.8151	10	0.87932	D	0	.	15.2424	0.73480	0.0:0.0:0.0:1.0	.	662;662	O00222-2;O00222	.;GRM8_HUMAN	R	662	ENSP00000344173:S662R;ENSP00000409790:S662R;ENSP00000351142:S662R	ENSP00000344173:S662R	S	-	1	0	GRM8	125960688	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.206000	0.71126	0.533000	0.62120	AGC	GRM8	-	pfam_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt,pfscan_GPCR_3_C	ENSG00000179603		0.443	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	HGNC	protein_coding	OTTHUMT00000059209.4	-	0.00	64	0	T			126173452	-1	tier1	-	no_errors	ENST00000339582	ensembl	human	known	74_37	missense	10.71	50	6	SNP	1.000	G
HDAC4	9759	genome.wustl.edu	37	2	240016733	240016733	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr2:240016733G>T	ENST00000345617.3	-	17	3029	c.2238C>A	c.(2236-2238)ttC>ttA	p.F746L	HDAC4_ENST00000541256.1_Missense_Mutation_p.F720L|HDAC4_ENST00000543185.1_Missense_Mutation_p.F330L	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	746	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		GGAGCCGGACGAACACGGAGG	0.612																																																	0													77.0	85.0	82.0					2																	240016733		2203	4300	6503	SO:0001583	missense	0			AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.2238C>A	2.37:g.240016733G>T	ENSP00000264606:p.Phe746Leu		Q9UND6	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pfam_Arb2_domain,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.F746L	ENST00000345617.3	37	c.2238	CCDS2529.1	2	.	.	.	.	.	.	.	.	.	.	G	8.926	0.962203	0.18583	.	.	ENSG00000068024	ENST00000345617;ENST00000456922;ENST00000543185;ENST00000541256;ENST00000393621	T;T;T	0.65364	0.22;-0.15;0.73	4.46	-8.93	0.00771	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	T	0.65207	0.2669	L	0.48935	1.535	0.40990	D	0.984848	D;B;B;B;B;B	0.54601	0.967;0.222;0.013;0.014;0.016;0.2	P;B;B;B;B;B	0.58577	0.841;0.094;0.016;0.005;0.037;0.146	T	0.79305	-0.1858	10	0.56958	D	0.05	.	20.7024	0.99706	0.2754:0.0:0.7246:0.0	.	746;629;720;720;714;746	B7Z8G5;F5H0Q9;F5H5W4;B7Z8I2;Q53SM2;P56524	.;.;.;.;.;HDAC4_HUMAN	L	746;634;330;720;629	ENSP00000264606:F746L;ENSP00000440481:F330L;ENSP00000443057:F720L	ENSP00000264606:F746L	F	-	3	2	HDAC4	239681670	0.411000	0.25384	0.125000	0.21846	0.040000	0.13550	-0.171000	0.09883	-2.355000	0.00614	-0.768000	0.03414	TTC	HDAC4	-	pfam_His_deacetylse_dom,pirsf_Histone_deAcase_II_euk	ENSG00000068024		0.612	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC4	HGNC	protein_coding	OTTHUMT00000257174.2	-	0.00	78	0	G	NM_006037		240016733	-1	tier1	-	no_errors	ENST00000345617	ensembl	human	known	74_37	missense	9.09	60	6	SNP	0.191	T
HEATR1	55127	genome.wustl.edu	37	1	236760260	236760260	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr1:236760260G>T	ENST00000366582.3	-	6	734	c.620C>A	c.(619-621)cCg>cAg	p.P207Q	HEATR1_ENST00000366581.2_Missense_Mutation_p.P207Q|HEATR1_ENST00000483073.1_5'UTR	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	207					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TGAGCTGCCCGGGTACTCAGC	0.493																																																	0													90.0	91.0	91.0					1																	236760260		2203	4300	6503	SO:0001583	missense	0			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.620C>A	1.37:g.236760260G>T	ENSP00000355541:p.Pro207Gln		Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	pfam_BP28_C_dom,pfam_U3snoRNP10,superfamily_ARM-type_fold	p.P207Q	ENST00000366582.3	37	c.620	CCDS31066.1	1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.064368	0.55432	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.41758	0.99;0.99	5.53	4.61	0.57282	.	0.364796	0.30611	N	0.009260	T	0.45518	0.1346	L	0.57536	1.79	0.47009	D	0.999285	D	0.58268	0.982	P	0.46339	0.513	T	0.41538	-0.9503	10	0.33940	T	0.23	.	15.5893	0.76512	0.0:0.0:0.8609:0.1391	.	207	Q9H583	HEAT1_HUMAN	Q	207	ENSP00000355541:P207Q;ENSP00000355540:P207Q	ENSP00000355540:P207Q	P	-	2	0	HEATR1	234826883	0.998000	0.40836	0.060000	0.19600	0.748000	0.42578	3.481000	0.53179	1.299000	0.44798	0.655000	0.94253	CCG	HEATR1	-	NULL	ENSG00000119285		0.493	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	HGNC	protein_coding	OTTHUMT00000096635.1		0.00	41	0	G	XM_375853		236760260	-1			no_errors	ENST00000366582	ensembl	human	known	74_37	missense	5.08	56	3	SNP	0.214	T
HMGN5	79366	genome.wustl.edu	37	X	80371790	80371790	+	Silent	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chrX:80371790G>T	ENST00000358130.2	-	6	508	c.180C>A	c.(178-180)gcC>gcA	p.A60A	HMGN5_ENST00000491275.1_5'UTR	NM_030763.2	NP_110390.1	P82970	HMGN5_HUMAN	high mobility group nucleosome binding domain 5	60					chromatin modification (GO:0016568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.A60A(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	10						CAACTGCTTGGGCACTTGTAT	0.328																																																	2	Substitution - coding silent(2)	endometrium(2)											148.0	113.0	125.0					X																	80371790		2203	4297	6500	SO:0001819	synonymous_variant	0			AF250329	CCDS14448.1	Xq13.3	2011-07-01	2011-04-05	2009-09-15	ENSG00000198157	ENSG00000198157		"""High-mobility group / Canonical"""	8013	protein-coding gene	gene with protein product		300385	"""nucleosomal binding protein 1"", ""high-mobility group nucleosome binding domain 5"""	NSBP1		11161810, 19748358	Standard	NM_030763		Approved		uc004eee.1	P82970	OTTHUMG00000021911	ENST00000358130.2:c.180C>A	X.37:g.80371790G>T			Q5JSL1	Silent	SNP	pfam_HMGN_fam,smart_HMGN_fam,prints_HMGN_fam	p.A60	ENST00000358130.2	37	c.180	CCDS14448.1	X																																																																																			HMGN5	-	pfam_HMGN_fam,smart_HMGN_fam	ENSG00000198157		0.328	HMGN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGN5	HGNC	protein_coding	OTTHUMT00000057354.1		0.00	43	0	G	NM_030763		80371790	-1			no_errors	ENST00000358130	ensembl	human	known	74_37	silent	9.38	29	3	SNP	0.020	T
HOXA9	3205	genome.wustl.edu	37	7	27202906	27202906	+	3'UTR	SNP	A	A	G			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr7:27202906A>G	ENST00000343483.6	-	0	1207				RP1-170O19.20_ENST00000465941.1_5'Flank|HOXA9_ENST00000497089.1_5'UTR	NM_152739.3	NP_689952.1	P31269	HXA9_HUMAN	homeobox A9						endothelial cell activation (GO:0042118)|multicellular organismal development (GO:0007275)|negative regulation of myeloid cell differentiation (GO:0045638)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|endometrium(1)|lung(5)|prostate(1)	8						TTAAGTCAGGAACAGGTAGAT	0.323			T	"""NUP98, MSI2"""	AML*																																			Dom	yes		7	7p15-p14.2	3205	homeo box A9		L	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS5409.1	7p15.2	2011-06-20	2005-12-22		ENSG00000078399	ENSG00000078399		"""Homeoboxes / ANTP class : HOXL subclass"""	5109	protein-coding gene	gene with protein product		142956	"""homeo box A9"""	HOX1G, HOX1		1973146, 1358459	Standard	NM_152739		Approved		uc003syt.3	P31269	OTTHUMG00000023220	ENST00000343483.6:c.*316T>C	7.37:g.27202906A>G			O43369|O43429|Q99820	RNA	SNP	-	NULL	ENST00000343483.6	37	NULL	CCDS5409.1	7																																																																																			HOXA9	-	-	ENSG00000078399		0.323	HOXA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA9	HGNC	protein_coding	OTTHUMT00000358706.2		0.00	22	0	A			27202906	-1			no_errors	ENST00000497089	ensembl	human	known	74_37	rna	11.43	31	4	SNP	1.000	G
IGSF3	3321	genome.wustl.edu	37	1	117142808	117142808	+	Nonsense_Mutation	SNP	A	A	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr1:117142808A>T	ENST00000369486.3	-	7	2549	c.1784T>A	c.(1783-1785)tTg>tAg	p.L595*	IGSF3_ENST00000318837.6_Nonsense_Mutation_p.L615*|IGSF3_ENST00000369483.1_Nonsense_Mutation_p.L615*	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	595	Ig-like C2-type 5.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		GAAGGTCACCAAGTCATGGAA	0.612																																																	0													25.0	26.0	26.0					1																	117142808		2203	4297	6500	SO:0001587	stop_gained	0			AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.1784T>A	1.37:g.117142808A>T	ENSP00000358498:p.Leu595*		A6NJZ6|A6NMC7	Nonsense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.L615*	ENST00000369486.3	37	c.1844	CCDS30813.1	1	.	.	.	.	.	.	.	.	.	.	A	39	7.818438	0.98507	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	.	.	.	4.57	4.57	0.56435	.	0.000000	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.5993	11.9372	0.52880	1.0:0.0:0.0:0.0	.	.	.	.	X	595;615;615	.	ENSP00000321184:L615X	L	-	2	0	IGSF3	116944331	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	8.502000	0.90505	1.907000	0.55213	0.374000	0.22700	TTG	IGSF3	-	smart_Ig_sub	ENSG00000143061		0.612	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF3	HGNC	protein_coding	OTTHUMT00000059040.1	-	0.00	67	0	A	NM_001542		117142808	-1	tier1	-	no_errors	ENST00000318837	ensembl	human	known	74_37	nonsense	15.48	71	13	SNP	1.000	T
HRNR	388697	genome.wustl.edu	37	1	152195673	152195673	+	Silent	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr1:152195673G>T	ENST00000368801.2	-	2	132	c.57C>A	c.(55-57)gcC>gcA	p.A19A	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	19	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.|S-100-like.				establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGCTGGGTGGCATATTGGT	0.418																																																	0													171.0	156.0	161.0					1																	152195673		2203	4300	6503	SO:0001819	synonymous_variant	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.57C>A	1.37:g.152195673G>T			Q5DT20|Q5U1F4	Silent	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.A19	ENST00000368801.2	37	c.57	CCDS30859.1	1																																																																																			HRNR	-	pfam_S100_Ca-bd_sub	ENSG00000197915		0.418	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	-	0.00	85	0	G	XM_373868		152195673	-1	tier1	-	no_errors	ENST00000368801	ensembl	human	known	74_37	silent	9.59	65	7	SNP	0.327	T
IL7R	3575	genome.wustl.edu	37	5	35873661	35873661	+	Missense_Mutation	SNP	G	G	T	rs193922644|rs193922643		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr5:35873661G>T	ENST00000303115.3	+	5	746	c.617G>T	c.(616-618)cGa>cTa	p.R206L	IL7R_ENST00000506850.1_Missense_Mutation_p.R206L|IL7R_ENST00000343305.4_Missense_Mutation_p.R206L	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	206	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			ATTAAAGTTCGATCCATCCCT	0.423			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																																	Dom	yes		5	5p13	146661	interleukin 7 receptor	yes	L	0													86.0	82.0	83.0					5																	35873661		2203	4300	6503	SO:0001583	missense	0			M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.617G>T	5.37:g.35873661G>T	ENSP00000306157:p.Arg206Leu		B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3	p.R206L	ENST00000303115.3	37	c.617	CCDS3911.1	5	.	.	.	.	.	.	.	.	.	.	G	23.0	4.365471	0.82463	.	.	ENSG00000168685	ENST00000303115;ENST00000343305;ENST00000506850;ENST00000505093	D;T;T;T	0.97480	-4.4;-0.65;-0.65;-1.33	5.97	5.97	0.96955	Short hematopoietin receptor, family 1, conserved site (1);Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	D	0.98074	0.9365	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.98539	1.0631	10	0.87932	D	0	-2.0552	15.9215	0.79580	0.0:0.0:1.0:0.0	.	206;206	D6RGV2;P16871	.;IL7RA_HUMAN	L	206;206;206;9	ENSP00000306157:R206L;ENSP00000345819:R206L;ENSP00000421207:R206L;ENSP00000426069:R9L	ENSP00000306157:R206L	R	+	2	0	IL7R	35909418	0.995000	0.38212	1.000000	0.80357	0.758000	0.43043	5.259000	0.65485	2.820000	0.97059	0.655000	0.94253	CGA	IL7R	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3	ENSG00000168685		0.423	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL7R	HGNC	protein_coding	OTTHUMT00000207577.2		0.00	21	0	G			35873661	+1			no_errors	ENST00000303115	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.998	T
INTS2	57508	genome.wustl.edu	37	17	59958373	59958373	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr17:59958373T>C	ENST00000444766.3	-	17	2348	c.2273A>G	c.(2272-2274)cAa>cGa	p.Q758R	INTS2_ENST00000251334.6_Missense_Mutation_p.Q750R	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	758					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						TATACCTTCTTGGAGTTGTTT	0.378																																																	0													91.0	86.0	88.0					17																	59958373		1844	4085	5929	SO:0001583	missense	0			AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.2273A>G	17.37:g.59958373T>C	ENSP00000414237:p.Gln758Arg		Q9ULD3	Missense_Mutation	SNP	NULL	p.Q758R	ENST00000444766.3	37	c.2273	CCDS45750.1	17	.	.	.	.	.	.	.	.	.	.	T	11.23	1.577559	0.28180	.	.	ENSG00000108506	ENST00000444766;ENST00000251334	T	0.42513	0.97	5.63	5.63	0.86233	.	0.100814	0.64402	D	0.000001	T	0.24122	0.0584	N	0.08118	0	0.48511	D	0.999665	B	0.06786	0.001	B	0.09377	0.004	T	0.10154	-1.0642	9	.	.	.	-9.7706	15.0037	0.71495	0.0:0.0:0.0:1.0	.	758	Q9H0H0	INT2_HUMAN	R	758;757	ENSP00000414237:Q758R	.	Q	-	2	0	INTS2	57313155	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	5.416000	0.66417	2.129000	0.65627	0.455000	0.32223	CAA	INTS2	-	NULL	ENSG00000108506		0.378	INTS2-001	KNOWN	basic|CCDS	protein_coding	INTS2	HGNC	protein_coding	OTTHUMT00000445368.1		0.00	39	0	T	NM_020748		59958373	-1			no_errors	ENST00000444766	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	C
KCND2	3751	genome.wustl.edu	37	7	119914701	119914701	+	Silent	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr7:119914701G>A	ENST00000331113.4	+	1	980	c.15G>A	c.(13-15)gtG>gtA	p.V5V		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	5	Interaction with KCNIP2.				action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	CGGCGGGGGTGGCAGCGTGGC	0.622																																																	0													71.0	84.0	80.0					7																	119914701		2177	4298	6475	SO:0001819	synonymous_variant	0			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.15G>A	7.37:g.119914701G>A			O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Silent	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Shal-type,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.2,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.V5	ENST00000331113.4	37	c.15	CCDS5776.1	7																																																																																			KCND2	-	pfam_Shal-type	ENSG00000184408		0.622	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCND2	HGNC	protein_coding	OTTHUMT00000346996.1	-	0.00	91	0	G	NM_012281		119914701	+1	tier1	-	no_errors	ENST00000331113	ensembl	human	known	74_37	silent	11.54	92	12	SNP	0.012	A
KIAA0430	9665	genome.wustl.edu	37	16	15733071	15733071	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr16:15733071G>T	ENST00000396368.3	-	2	226	c.20C>A	c.(19-21)aCt>aAt	p.T7N	KIAA0430_ENST00000602337.1_Missense_Mutation_p.T7N|KIAA0430_ENST00000344181.3_De_novo_Start_OutOfFrame|KIAA0430_ENST00000551742.1_Missense_Mutation_p.T7N|KIAA0430_ENST00000540441.2_Missense_Mutation_p.T7N|KIAA0430_ENST00000548025.1_Missense_Mutation_p.T7N	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	7					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						GGAGTTCTCAGTTCCGTTTCC	0.408																																																	0													243.0	227.0	232.0					16																	15733071		1969	4167	6136	SO:0001583	missense	0			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.20C>A	16.37:g.15733071G>T	ENSP00000379654:p.Thr7Asn		A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Missense_Mutation	SNP	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.T7N	ENST00000396368.3	37	c.20	CCDS10562.2	16	.	.	.	.	.	.	.	.	.	.	G	13.84	2.356028	0.41700	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000548025;ENST00000551742;ENST00000551298;ENST00000549219	.	.	.	5.62	4.66	0.58398	.	0.176845	0.47455	D	0.000229	T	0.50803	0.1637	L	0.32530	0.975	0.80722	D	1	B;B;B;B;B	0.33694	0.015;0.421;0.421;0.421;0.297	B;B;B;B;B	0.36289	0.014;0.221;0.221;0.221;0.11	T	0.55315	-0.8160	9	0.72032	D	0.01	.	15.6833	0.77391	0.0:0.2591:0.7409:0.0	.	6;6;7;6;6	Q9Y4F3-6;Q9Y4F3-5;F8VV09;Q9Y4F3-4;Q9Y4F3	.;.;.;.;LKAP_HUMAN	N	7;7;6;7;7;7;7	.	ENSP00000315718:T6N	T	-	2	0	KIAA0430	15640572	0.997000	0.39634	1.000000	0.80357	0.569000	0.35902	1.577000	0.36515	1.354000	0.45846	0.655000	0.94253	ACT	KIAA0430	-	NULL	ENSG00000166783		0.408	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	HGNC	protein_coding	OTTHUMT00000252131.2	-	0.00	83	0	G	NM_014647		15733071	-1	tier1	-	no_errors	ENST00000396368	ensembl	human	known	74_37	missense	15.62	54	10	SNP	1.000	T
KIAA1324L	222223	genome.wustl.edu	37	7	86567530	86567530	+	Splice_Site	SNP	T	T	C			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr7:86567530T>C	ENST00000450689.2	-	8	1186	c.1001A>G	c.(1000-1002)gAg>gGg	p.E334G	KIAA1324L_ENST00000297222.6_Splice_Site_p.E94G|KIAA1324L_ENST00000444627.1_Splice_Site_p.E334G|KIAA1324L_ENST00000416314.1_Splice_Site_p.E167G	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	334						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					GGATCCTTCCTCTGCAACATA	0.393																																																	0													106.0	95.0	99.0					7																	86567530		2168	4231	6399	SO:0001630	splice_region_variant	0			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.1001-1A>G	7.37:g.86567530T>C			A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Growth_fac_rcpt_N_dom	p.E334G	ENST00000450689.2	37	c.1001	CCDS47632.1	7	.	.	.	.	.	.	.	.	.	.	T	12.96	2.093898	0.36952	.	.	ENSG00000164659	ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314	T;T;T;T	0.62232	0.04;0.83;0.04;1.59	5.49	5.49	0.81192	Growth factor, receptor (1);	0.244526	0.42548	D	0.000688	T	0.46112	0.1376	N	0.16790	0.44	0.80722	D	1	B;B;B	0.12013	0.005;0.0;0.0	B;B;B	0.12156	0.007;0.0;0.0	T	0.36648	-0.9739	10	0.21014	T	0.42	.	14.7544	0.69552	0.0:0.0:0.0:1.0	.	334;94;167	A8MWY0;A8MWY0-2;B4DJV3	K132L_HUMAN;.;.	G	334;94;334;167	ENSP00000413445:E334G;ENSP00000297222:E94G;ENSP00000397377:E334G;ENSP00000402390:E167G	ENSP00000297222:E94G	E	-	2	0	KIAA1324L	86405466	1.000000	0.71417	0.997000	0.53966	0.865000	0.49528	3.673000	0.54591	2.073000	0.62155	0.460000	0.39030	GAG	KIAA1324L	-	superfamily_Growth_fac_rcpt_N_dom	ENSG00000164659		0.393	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1324L	HGNC	protein_coding	OTTHUMT00000333372.3	-	0.00	97	0	T	NM_152748	Missense_Mutation	86567530	-1	tier1	-	no_errors	ENST00000450689	ensembl	human	known	74_37	missense	28.77	52	21	SNP	0.933	C
KIAA1671	85379	genome.wustl.edu	37	22	25577733	25577733	+	Silent	SNP	T	T	C	rs9612887	byFrequency	TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr22:25577733T>C	ENST00000406486.4	+	11	5529	c.5142T>C	c.(5140-5142)ccT>ccC	p.P1714P	KIAA1671_ENST00000401395.1_Silent_p.P221P|KIAA1671_ENST00000358431.3_Silent_p.P1714P			Q9BY89	K1671_HUMAN	KIAA1671	1714								p.P1714P(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|lung(2)|prostate(1)|stomach(2)	9						AGAGGACCCCTGTCAGCCATC	0.547													C|||	2662	0.53155	0.416	0.6412	5008	,	,		18343	0.7659		0.4801	False		,,,				2504	0.4213																1	Substitution - coding silent(1)	stomach(1)						C		593,791		121,351,220	63.0	69.0	67.0		5142	-9.1	0.0	22	dbSNP_119	67	1430,1752		328,774,489	no	coding-synonymous	KIAA1671	NM_001145206.1		449,1125,709	CC,CT,TT		44.9403,42.8468,44.3057		1714/1807	25577733	2023,2543	692	1591	2283	SO:0001819	synonymous_variant	0				CCDS46676.1	22q11.23	2009-07-09			ENSG00000197077	ENSG00000197077			29345	protein-coding gene	gene with protein product						15289310	Standard	NM_001145206		Approved		uc003abn.3	Q9BY89	OTTHUMG00000150841	ENST00000406486.4:c.5142T>C	22.37:g.25577733T>C			B0QYF2|B7ZW08|Q5THZ5	Silent	SNP	NULL	p.P1714	ENST00000406486.4	37	c.5142	CCDS46676.1	22																																																																																			KIAA1671	-	NULL	ENSG00000197077		0.547	KIAA1671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1671	HGNC	protein_coding	OTTHUMT00000320306.6		0.00	26	0	T	NM_001145206		25577733	+1			no_errors	ENST00000358431	ensembl	human	known	74_37	silent	9.09	30	3	SNP	0.000	C
KIF17	57576	genome.wustl.edu	37	1	20998480	20998480	+	Silent	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr1:20998480G>A	ENST00000247986.2	-	12	2983	c.2673C>T	c.(2671-2673)ggC>ggT	p.G891G	KIF17_ENST00000375044.1_Silent_p.G791G|KIF17_ENST00000490034.1_5'UTR|KIF17_ENST00000400463.3_Silent_p.G891G			Q9P2E2	KIF17_HUMAN	kinesin family member 17	891					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TCTTCCAGAAGCCGTTATCTT	0.582																																																	0													131.0	119.0	123.0					1																	20998480		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.2673C>T	1.37:g.20998480G>A			A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G891	ENST00000247986.2	37	c.2673	CCDS213.1	1																																																																																			KIF17	-	NULL	ENSG00000117245		0.582	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF17	HGNC	protein_coding	OTTHUMT00000276995.1	-	0.00	91	0	G	NM_020816		20998480	-1	tier1	-	no_errors	ENST00000247986	ensembl	human	known	74_37	silent	12.75	130	19	SNP	1.000	A
KIFC1	3833	genome.wustl.edu	37	6	33374195	33374195	+	Missense_Mutation	SNP	C	C	T	rs112635529		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr6:33374195C>T	ENST00000428849.2	+	8	2209	c.1759C>T	c.(1759-1761)Cgg>Tgg	p.R587W		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	587	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						GGAACGCCTTCGGGAAACACA	0.652																																																	0													41.0	48.0	45.0					6																	33374195		2203	4300	6503	SO:0001583	missense	0			D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.1759C>T	6.37:g.33374195C>T	ENSP00000393963:p.Arg587Trp		O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R587W	ENST00000428849.2	37	c.1759	CCDS34430.1	6	.	.	.	.	.	.	.	.	.	.	c	24.1	4.494156	0.85069	.	.	ENSG00000237649	ENST00000428849	T	0.76186	-1.0	5.22	4.28	0.50868	Kinesin, motor domain (4);	0.060433	0.64402	D	0.000005	T	0.81351	0.4804	M	0.78285	2.405	0.47476	D	0.999434	D;D	0.89917	1.0;1.0	D;D	0.73708	0.981;0.981	T	0.82762	-0.0297	10	0.87932	D	0	-22.1125	10.3201	0.43760	0.2856:0.7144:0.0:0.0	.	579;587	B4E063;Q9BW19	.;KIFC1_HUMAN	W	587	ENSP00000393963:R587W	ENSP00000393963:R587W	R	+	1	2	KIFC1	33482173	0.984000	0.35163	0.998000	0.56505	0.977000	0.68977	2.238000	0.43070	2.710000	0.92621	0.558000	0.71614	CGG	KIFC1	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000237649		0.652	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIFC1	HGNC	protein_coding	OTTHUMT00000076417.1	-	0.00	54	0	C	NM_002263		33374195	+1	tier1	rs112635529	no_errors	ENST00000428849	ensembl	human	known	74_37	missense	19.18	58	14	SNP	0.999	T
KLKP1	606293	genome.wustl.edu	37	19	51391278	51391278	+	RNA	SNP	C	C	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr19:51391278C>A	ENST00000600104.1	-	0	639							Q107X0	KRIP1_HUMAN	kallikrein pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)											AGATTCTGGACCATTCCTTGG	0.602																																																	0																																												0			AY302756		19q13.33	2014-03-18			ENSG00000197588	ENSG00000197588		"""Kallikreins"""	21260	pseudogene	pseudogene	"""kallikrein 31 pseudogene"""					15498522, 16541416, 18196551	Standard	NR_002948		Approved	YKLK1, PsiKLK1, KLK31P	uc002ptw.3	Q107X0	OTTHUMG00000183118		19.37:g.51391278C>A				RNA	SNP	-	NULL	ENST00000600104.1	37	NULL		19																																																																																			KLKP1	-	-	ENSG00000197588		0.602	KLKP1-002	KNOWN	basic	processed_transcript	KLKP1	HGNC	pseudogene	OTTHUMT00000465166.1	-	0.00	223	0	C	NG_005220		51391278	-1	tier1	-	no_errors	ENST00000600104	ensembl	human	known	74_37	rna	16.53	207	41	SNP	0.000	A
KRT86	3892	genome.wustl.edu	37	12	52649170	52649170	+	Intron	SNP	C	C	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr12:52649170C>T	ENST00000544024.1	+	1	129				KRT121P_ENST00000529785.1_RNA			O43790	KRT86_HUMAN	keratin 86							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		CAGCAGTGGCCCTTAGTGCCA	0.502																																																	0																																										SO:0001627	intron_variant	0			X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000544024.1:c.-5+5958C>T	12.37:g.52649170C>T			P78387	RNA	SNP	-	NULL	ENST00000544024.1	37	NULL	CCDS41785.1	12																																																																																			KRT121P	-	-	ENSG00000135477		0.502	KRT86-202	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT121P	HGNC	protein_coding		-	0.00	46	0	C	NM_002284		52649170	-1	tier1	-	no_errors	ENST00000529785	ensembl	human	known	74_37	rna	10.42	43	5	SNP	0.544	T
KRT25	147183	genome.wustl.edu	37	17	38910113	38910113	+	Splice_Site	SNP	T	T	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr17:38910113T>A	ENST00000312150.4	-	3	728	c.668A>T	c.(667-669)gAg>gTg	p.E223V		NM_181534.3	NP_853512.1			keratin 25											endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(4)	16		Breast(137;0.00526)				AGCTCTTACCTCTTTATGGTT	0.428																																																	0													165.0	163.0	163.0					17																	38910113		2203	4300	6503	SO:0001630	splice_region_variant	0			AK129503	CCDS11373.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000204897	ENSG00000204897		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30839	protein-coding gene	gene with protein product			"""keratin 25A"""	KRT25A		16831889	Standard	NM_181534		Approved		uc002hve.3	Q7Z3Z0	OTTHUMG00000133373	ENST00000312150.4:c.669+1A>T	17.37:g.38910113T>A				Missense_Mutation	SNP	pfam_IF,prints_Keratin_I	p.E223V	ENST00000312150.4	37	c.668	CCDS11373.1	17	.	.	.	.	.	.	.	.	.	.	T	27.9	4.876033	0.91664	.	.	ENSG00000204897	ENST00000394042;ENST00000312150	D	0.91124	-2.79	5.92	5.92	0.95590	Filament (1);	0.000000	0.64402	D	0.000003	D	0.97383	0.9144	H	0.98333	4.205	0.58432	D	0.999998	D	0.76494	0.999	D	0.78314	0.991	D	0.98968	1.0800	10	0.87932	D	0	.	16.3495	0.83197	0.0:0.0:0.0:1.0	.	223	Q7Z3Z0	K1C25_HUMAN	V	223	ENSP00000310573:E223V	ENSP00000310573:E223V	E	-	2	0	KRT25	36163639	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.843000	0.62838	2.261000	0.74972	0.482000	0.46254	GAG	KRT25	-	pfam_IF	ENSG00000204897		0.428	KRT25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT25	HGNC	protein_coding	OTTHUMT00000257218.1	-	0.00	74	0	T	NM_181534	Missense_Mutation	38910113	-1	tier1	-	no_errors	ENST00000312150	ensembl	human	known	74_37	missense	13.98	80	13	SNP	1.000	A
KRT34	3885	genome.wustl.edu	37	17	39538436	39538436	+	Silent	SNP	G	G	A	rs374587752		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr17:39538436G>A	ENST00000394001.1	-	1	219	c.189C>T	c.(187-189)tgC>tgT	p.C63C		NM_021013.3	NP_066293.2	O76011	KRT34_HUMAN	keratin 34	63	Head.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Breast(137;0.000496)				TGGGGGGCACGCAGGGCCGGG	0.617																																																	0								G		0,4406		0,0,2203	50.0	49.0	50.0		189	-3.1	0.3	17		50	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KRT34	NM_021013.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		63/437	39538436	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			Y16790	CCDS11390.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131737	ENSG00000131737		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6452	protein-coding gene	gene with protein product	"""hard keratin type I 4"""	602763	"""keratin, hair, acidic, 4"""	KRTHA4		2431943, 9756910, 16831889	Standard	NM_021013		Approved	Ha-4	uc002hwm.3	O76011	OTTHUMG00000133436	ENST00000394001.1:c.189C>T	17.37:g.39538436G>A			Q8IUT8|Q8N4W2	Silent	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.C63	ENST00000394001.1	37	c.189	CCDS11390.1	17																																																																																			KRT34	-	NULL	ENSG00000131737		0.617	KRT34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT34	HGNC	protein_coding	OTTHUMT00000257304.3	-	0.00	121	0	G	NM_021013		39538436	-1	tier1	-	no_errors	ENST00000394001	ensembl	human	known	74_37	silent	10.60	134	16	SNP	0.241	A
LAMA4	3910	genome.wustl.edu	37	6	112508790	112508790	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr6:112508790G>T	ENST00000230538.7	-	8	1225	c.828C>A	c.(826-828)tgC>tgA	p.C276*	LAMA4_ENST00000389463.4_Nonsense_Mutation_p.C269*|LAMA4_ENST00000522006.1_Nonsense_Mutation_p.C269*|LAMA4_ENST00000424408.2_Nonsense_Mutation_p.C269*	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	276	Domain II and I.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		GGTCCCAGACGCACTTATCAC	0.517																																																	0													59.0	50.0	53.0					6																	112508790		2203	4300	6503	SO:0001587	stop_gained	0				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.828C>A	6.37:g.112508790G>T	ENSP00000230538:p.Cys276*		Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Nonsense_Mutation	SNP	pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_II,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Focal_adhesion_kin_target_dom,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Laminin_G	p.C276*	ENST00000230538.7	37	c.828	CCDS43491.1	6	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	g|g|g	40|40|40	8.006980|8.006980|8.006980	0.98607|0.98607|0.98607	.|.|.	.|.|.	ENSG00000112769|ENSG00000112769|ENSG00000112769	ENST00000368640|ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408;ENST00000454881;ENST00000521398;ENST00000542588|ENST00000521732	.|.|.	.|.|.	.|.|.	5.9|5.9|5.9	1.07|1.07|1.07	0.20283|0.20283|0.20283	.|.|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	T|.|T	0.44664|.|0.44664	0.1304|.|0.1304	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|.|T	0.39440|.|0.39440	-0.9614|.|-0.9614	4|.|4	.|0.02654|.	.|T|.	.|1|.	.|.|.	9.8495|9.8495|9.8495	0.41048|0.41048|0.41048	0.4623:0.0:0.5377:0.0|0.4623:0.0:0.5377:0.0|0.4623:0.0:0.5377:0.0	.|.|.	.|.|.	.|.|.	.|.|.	E|X|S	80|276;269;269;269;276;276;269|89	.|.|.	.|ENSP00000230538:C276X|.	A|C|R	-|-|-	2|3|1	0|2|0	LAMA4|LAMA4|LAMA4	112615483|112615483|112615483	0.998000|0.998000|0.998000	0.40836|0.40836|0.40836	0.999000|0.999000|0.999000	0.59377|0.59377|0.59377	0.824000|0.824000|0.824000	0.46624|0.46624|0.46624	0.323000|0.323000|0.323000	0.19593|0.19593|0.19593	0.408000|0.408000|0.408000	0.25621|0.25621|0.25621	-0.119000|-0.119000|-0.119000	0.15052|0.15052|0.15052	GCG|TGC|CGT	LAMA4	-	NULL	ENSG00000112769		0.517	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAMA4	HGNC	protein_coding	OTTHUMT00000041876.2	-	0.00	53	0	G	NM_001105206		112508790	-1	tier1	-	no_errors	ENST00000230538	ensembl	human	known	74_37	nonsense	6.25	60	4	SNP	0.999	T
ZEB1	6935	genome.wustl.edu	37	10	31652896	31652896	+	Intron	SNP	C	C	T	rs567460090	byFrequency	TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr10:31652896C>T	ENST00000320985.10	+	1	168				ZEB1_ENST00000542815.3_Intron|ZEB1_ENST00000559858.1_Intron|RP11-192P3.5_ENST00000359888.2_RNA|ZEB1_ENST00000560721.2_Intron|RP11-192P3.5_ENST00000607134.1_RNA|ZEB1_ENST00000446923.2_Intron|ZEB1_ENST00000361642.5_Intron			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1						cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				GAAGGCCTCACGGACAAGACG	0.607													c|||	2	0.000399361	0.0008	0.0	5008	,	,		17998	0.0		0.0	False		,,,				2504	0.001				Ovarian(40;423 959 14296 36701 49589)												0																																										SO:0001627	intron_variant	0			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.58+44675C>T	10.37:g.31652896C>T			B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	RNA	SNP	-	NULL	ENST00000320985.10	37	NULL	CCDS7169.1	10																																																																																			RP11-192P3.5	-	-	ENSG00000196960		0.607	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC100505502	Clone_based_vega_gene	protein_coding	OTTHUMT00000419083.2	-	0.00	50	0	C	NM_030751		31652896	-1	tier1	-	no_errors	ENST00000359888	ensembl	human	known	74_37	rna	8.16	45	4	SNP	0.247	T
LRIT3	345193	genome.wustl.edu	37	4	110789009	110789009	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr4:110789009G>T	ENST00000594814.1	+	3	802	c.802G>T	c.(802-804)Ggc>Tgc	p.G268C	LRIT3_ENST00000409621.2_Missense_Mutation_p.G85C|LRIT3_ENST00000327908.3_Missense_Mutation_p.G85C|LRIT3_ENST00000379920.3_Missense_Mutation_p.G223C	NM_198506.3	NP_940908.3	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 3	268	Ig-like.				regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	16				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		GTCTGCTCTGGGCAGTAATGT	0.493																																																	0													116.0	106.0	109.0					4																	110789009		2203	4300	6503	SO:0001583	missense	0			AK126648	CCDS3688.2, CCDS3688.3	4q25	2014-01-28	2007-06-19		ENSG00000183423	ENSG00000183423		"""Immunoglobulin superfamily / I-set domain containing"""	24783	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 4"""	615004					Standard	NM_198506		Approved	FLJ44691, FIGLER4, CSNB1F	uc031sgv.1	Q3SXY7	OTTHUMG00000132043	ENST00000594814.1:c.802G>T	4.37:g.110789009G>T	ENSP00000469759:p.Gly268Cys		C9J1C2|Q6ZTG1	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G268C	ENST00000594814.1	37	c.802	CCDS3688.3	4	.	.	.	.	.	.	.	.	.	.	G	28.2	4.903105	0.92035	.	.	ENSG00000183423	ENST00000327908;ENST00000379920;ENST00000409621	D;D;D	0.81499	-1.5;-1.5;-1.5	5.88	5.88	0.94601	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94873	0.8343	H	0.99074	4.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96522	0.9386	10	0.87932	D	0	.	20.2228	0.98330	0.0:0.0:1.0:0.0	.	223;85	Q3SXY7;Q3SXY7-2	LRIT3_HUMAN;.	C	85;223;85	ENSP00000328222:G85C;ENSP00000369252:G223C;ENSP00000386734:G85C	ENSP00000328222:G85C	G	+	1	0	LRIT3	111008458	1.000000	0.71417	0.977000	0.42913	0.953000	0.61014	9.476000	0.97823	2.789000	0.95967	0.655000	0.94253	GGC	LRIT3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000183423		0.493	LRIT3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIT3	HGNC	protein_coding	OTTHUMT00000335270.2		0.00	56	0	G	NM_198506		110789009	+1			no_errors	ENST00000594814	ensembl	human	known	74_37	missense	8.33	33	3	SNP	1.000	T
LSM7	51690	genome.wustl.edu	37	19	2328428	2328429	+	Nonsense_Mutation	DNP	TG	TG	AT			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	T|G	T|G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr19:2328428_2328429TG>AT	ENST00000252622.10	-	2	107_108	c.54_55CA>AT	c.(52-57)taCAtc>taATtc	p.18_19YI>*F	SPPL2B_ENST00000452401.2_RNA|AC004410.3_ENST00000586111.2_RNA	NM_016199.2	NP_057283.1	Q9UK45	LSM7_HUMAN	LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)	18					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|spliceosomal complex (GO:0005681)	U6 snRNA binding (GO:0017070)			kidney(1)|urinary_tract(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCTTGTCGATGTACTTGGACA	0.55																																																	0																																										SO:0001587	stop_gained	0			AF182293	CCDS45907.1	19p13.3	2008-05-02			ENSG00000130332	ENSG00000130332			20470	protein-coding gene	gene with protein product		607287				10523320, 12515382	Standard	NM_016199		Approved	YNL147W	uc002lvp.4	Q9UK45		ENST00000252622.10:c.54_55delinsAT	19.37:g.2328428_2328429delinsAT	ENSP00000252622:p.Y18_I19delins*F			Missense_Mutation|Nonsense_Mutation	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc,pirsf_U6_snRNA_Lsm7	p.I19F|p.Y18*	ENST00000252622.10	37	c.55|c.54	CCDS45907.1	19																																																																																			LSM7	-	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc,pirsf_U6_snRNA_Lsm7	ENSG00000130332		0.550	LSM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM7	HGNC	protein_coding	OTTHUMT00000451375.2	-	0.00	61|62	0	T|G			2328428|2328429	-1	tier1	-	no_errors	ENST00000252622	ensembl	human	known	74_37	missense|nonsense	16.00	42	8	SNP	1.000	A|T
LYG2	254773	genome.wustl.edu	37	2	99858901	99858901	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr2:99858901G>T	ENST00000409238.1	-	5	585	c.565C>A	c.(565-567)Cca>Aca	p.P189T	LYG2_ENST00000423800.1_3'UTR|LYG2_ENST00000333017.2_Missense_Mutation_p.P189T			Q86SG7	LYG2_HUMAN	lysozyme G-like 2	189					cell wall macromolecule catabolic process (GO:0016998)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)	p.P189S(1)		large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)|stomach(1)	12						ATGTCCGATGGGGTGGCAATC	0.413																																																	1	Substitution - Missense(1)	prostate(1)											149.0	143.0	145.0					2																	99858901		2203	4300	6503	SO:0001583	missense	0			AF323919	CCDS2042.1	2q11.2	2008-02-05			ENSG00000185674	ENSG00000185674			29615	protein-coding gene	gene with protein product						8889548, 12574869	Standard	NM_175735		Approved	LYGH	uc002szw.1	Q86SG7	OTTHUMG00000130643	ENST00000409238.1:c.565C>A	2.37:g.99858901G>T	ENSP00000386939:p.Pro189Thr		Q496G2|Q53RW0	Missense_Mutation	SNP	pfam_TGlycosylase-like_SLT,superfamily_Lysozyme-like_dom,pirsf_Glyco_hydro_23,prints_Glyco_hydro_23	p.P189T	ENST00000409238.1	37	c.565	CCDS2042.1	2	.	.	.	.	.	.	.	.	.	.	G	3.574	-0.086921	0.07097	.	.	ENSG00000185674	ENST00000409238;ENST00000333017	.	.	.	5.22	4.34	0.51931	Lysozyme-like domain (1);	0.337581	0.25938	N	0.027326	T	0.44201	0.1282	L	0.51422	1.61	0.09310	N	1	P	0.45283	0.855	P	0.49012	0.598	T	0.28870	-1.0030	8	.	.	.	-9.3349	9.6242	0.39741	0.0938:0.0:0.9062:0.0	.	189	Q86SG7	LYG2_HUMAN	T	189	.	.	P	-	1	0	LYG2	99225333	0.175000	0.23083	0.007000	0.13788	0.024000	0.10985	2.240000	0.43088	1.442000	0.47568	0.563000	0.77884	CCA	LYG2	-	superfamily_Lysozyme-like_dom,pirsf_Glyco_hydro_23,prints_Glyco_hydro_23	ENSG00000185674		0.413	LYG2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LYG2	HGNC	protein_coding	OTTHUMT00000330307.1		0.00	51	0	G	NM_175735		99858901	-1			no_errors	ENST00000333017	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.017	T
LZTS3	9762	genome.wustl.edu	37	20	3146868	3146868	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr20:3146868G>T	ENST00000329152.3	-	2	1995	c.598C>A	c.(598-600)Ctg>Atg	p.L200M	LZTS3_ENST00000360342.3_Missense_Mutation_p.L200M|LZTS3_ENST00000337576.5_Missense_Mutation_p.L200M			O60299	LZTS3_HUMAN		200						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)											GACTTGTCCAGTCCGCCTTTG	0.617																																																	0													54.0	48.0	50.0					20																	3146868		2203	4300	6503	SO:0001583	missense	0																														ENST00000329152.3:c.598C>A	20.37:g.3146868G>T	ENSP00000332123:p.Leu200Met		A2A2Q7|D3DVX6|Q8IXX8	Missense_Mutation	SNP	NULL	p.L200M	ENST00000329152.3	37	c.598	CCDS13049.1	20	.	.	.	.	.	.	.	.	.	.	G	19.66	3.869307	0.72065	.	.	ENSG00000088899	ENST00000329152;ENST00000360342;ENST00000337576	T;T;T	0.36157	1.27;1.3;1.3	5.26	5.26	0.73747	.	0.440915	0.23224	N	0.050527	T	0.48995	0.1531	L	0.43152	1.355	0.44918	D	0.997931	D;D	0.64830	0.994;0.989	P;P	0.56865	0.808;0.648	T	0.42378	-0.9455	10	0.46703	T	0.11	-11.6956	18.8648	0.92287	0.0:0.0:1.0:0.0	.	200;200	O60299-2;O60299	.;PRIP1_HUMAN	M	200	ENSP00000332123:L200M;ENSP00000353496:L200M;ENSP00000338166:L200M	ENSP00000332123:L200M	L	-	1	2	RP5-1187M17.10	3094868	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	4.350000	0.59392	2.450000	0.82876	0.561000	0.74099	CTG	LZTS3	-	NULL	ENSG00000088899		0.617	LZTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTS3	Uniprot_gn	protein_coding	OTTHUMT00000077715.2	-	0.00	91	0	G			3146868	-1	tier1	-	no_errors	ENST00000329152	ensembl	human	known	74_37	missense	21.21	78	21	SNP	1.000	T
MASTL	84930	genome.wustl.edu	37	10	27459382	27459382	+	Silent	SNP	T	T	C			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr10:27459382T>C	ENST00000375940.4	+	8	1551	c.1494T>C	c.(1492-1494)agT>agC	p.S498S	MASTL_ENST00000477034.1_3'UTR|MASTL_ENST00000375946.4_Silent_p.S498S|MASTL_ENST00000342386.6_Silent_p.S498S			Q96GX5	GWL_HUMAN	microtubule associated serine/threonine kinase-like	498	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of protein phosphatase type 2A activity (GO:0034048)|regulation of cell cycle (GO:0051726)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein phosphatase 2A binding (GO:0051721)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGCACAAAAGTCAACAAAATG	0.328																																																	0													57.0	57.0	57.0					10																	27459382		2203	4300	6503	SO:0001819	synonymous_variant	0			BC009107	CCDS7153.1, CCDS53502.1, CCDS53503.1	10p12.1	2005-11-03			ENSG00000120539	ENSG00000120539			19042	protein-coding gene	gene with protein product		608221					Standard	NM_001172303		Approved	FLJ14813, THC2	uc001itm.3	Q96GX5	OTTHUMG00000017855	ENST00000375940.4:c.1494T>C	10.37:g.27459382T>C			Q5T8D5|Q5T8D7|Q8NCD6|Q96SJ5	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S498	ENST00000375940.4	37	c.1494	CCDS53502.1	10																																																																																			MASTL	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000120539		0.328	MASTL-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MASTL	HGNC	protein_coding	OTTHUMT00000047320.1	-	0.00	48	0	T	NM_032844		27459382	+1	tier1	-	no_errors	ENST00000375940	ensembl	human	known	74_37	silent	12.12	29	4	SNP	0.002	C
MBD5	55777	genome.wustl.edu	37	2	149243434	149243434	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr2:149243434A>G	ENST00000407073.1	+	11	3966	c.2969A>G	c.(2968-2970)cAg>cGg	p.Q990R	MBD5_ENST00000404807.1_Missense_Mutation_p.Q1223R	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	990					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		CAGGGGTACCAGAATCTCCAG	0.463																																																	0													110.0	112.0	111.0					2																	149243434		2203	4300	6503	SO:0001583	missense	0			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.2969A>G	2.37:g.149243434A>G	ENSP00000386049:p.Gln990Arg		A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	superfamily_DNA-bd_dom,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd,pfscan_PWWP_dom	p.Q990R	ENST00000407073.1	37	c.2969	CCDS33302.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.06|19.06	3.754256|3.754256	0.69648|0.69648	.|.	.|.	ENSG00000204406|ENSG00000204406	ENST00000407073;ENST00000404807|ENST00000416015	T;T|.	0.21734|.	1.99;1.99|.	5.47|5.47	2.91|2.91	0.33838|0.33838	.|.	0.105866|.	0.42548|.	D|.	0.000694|.	T|T	0.43166|0.43166	0.1235|0.1235	N|N	0.24115|0.24115	0.695|0.695	0.35762|0.35762	D|D	0.820221|0.820221	P;B|.	0.41910|.	0.764;0.118|.	B;B|.	0.36504|.	0.226;0.064|.	T|T	0.48547|0.48547	-0.9026|-0.9026	10|5	0.44086|.	T|.	0.13|.	-0.4726|-0.4726	11.9709|11.9709	0.53063|0.53063	0.7257:0.2743:0.0:0.0|0.7257:0.2743:0.0:0.0	.|.	1223;990|.	E9PHH0;Q9P267|.	.;MBD5_HUMAN|.	R|G	990;1223|963	ENSP00000386049:Q990R;ENSP00000384672:Q1223R|.	ENSP00000384672:Q1223R|.	Q|R	+|+	2|1	0|2	MBD5|MBD5	148959904|148959904	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.823000|3.823000	0.55715|0.55715	0.888000|0.888000	0.36160|0.36160	0.482000|0.482000	0.46254|0.46254	CAG|AGA	MBD5	-	NULL	ENSG00000204406		0.463	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD5	HGNC	protein_coding	OTTHUMT00000318111.2	-	0.00	52	0	A			149243434	+1	tier1	-	no_errors	ENST00000407073	ensembl	human	known	74_37	missense	13.75	69	11	SNP	1.000	G
MCTP2	55784	genome.wustl.edu	37	15	94942290	94942290	+	Splice_Site	SNP	C	C	T	rs528835766		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr15:94942290C>T	ENST00000357742.4	+	14	1889	c.1889C>T	c.(1888-1890)cCg>cTg	p.P630L	MCTP2_ENST00000331706.4_Splice_Site_p.P218L|MCTP2_ENST00000557742.1_Splice_Site_p.P218L|MCTP2_ENST00000451018.3_Splice_Site_p.P630L	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	630					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			ATATATAATCCGGTAAGTCTA	0.363													C|||	1	0.000199681	0.0	0.0	5008	,	,		18080	0.0		0.001	False		,,,				2504	0.0																0													63.0	65.0	64.0					15																	94942290		2197	4298	6495	SO:0001630	splice_region_variant	0			AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.1890+1C>T	15.37:g.94942290C>T			A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	pfam_C2_dom,pfam_PRibTrfase_C,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.P630L	ENST00000357742.4	37	c.1889	CCDS32338.1	15	.	.	.	.	.	.	.	.	.	.	C	15.75	2.927029	0.52759	.	.	ENSG00000140563	ENST00000451018;ENST00000331706;ENST00000357742	T;T;T	0.70164	-0.46;0.08;-0.29	5.28	5.28	0.74379	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.80149	0.4570	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	0.972;1.0;1.0	P;D;D	0.77557	0.742;0.984;0.99	T	0.81482	-0.0913	10	0.66056	D	0.02	.	18.9233	0.92534	0.0:1.0:0.0:0.0	.	630;218;630	Q6DN12-2;Q6DN12-4;Q6DN12	.;.;MCTP2_HUMAN	L	630;218;630	ENSP00000395109:P630L;ENSP00000329646:P218L;ENSP00000350377:P630L	ENSP00000329646:P218L	P	+	2	0	MCTP2	92743294	1.000000	0.71417	1.000000	0.80357	0.054000	0.15201	5.504000	0.66968	2.470000	0.83445	0.655000	0.94253	CCG	MCTP2	-	superfamily_C2_dom	ENSG00000140563		0.363	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCTP2	HGNC	protein_coding	OTTHUMT00000415060.3	-	0.00	29	0	C	NM_018349	Missense_Mutation	94942290	+1	tier1	-	no_errors	ENST00000357742	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
MGAT4C	25834	genome.wustl.edu	37	12	86373140	86373140	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr12:86373140C>A	ENST00000604798.1	-	8	2568	c.1364G>T	c.(1363-1365)tGt>tTt	p.C455F	MGAT4C_ENST00000552808.2_Missense_Mutation_p.C455F|MGAT4C_ENST00000393205.2_Missense_Mutation_p.C484F|MGAT4C_ENST00000548651.1_Missense_Mutation_p.C455F|MGAT4C_ENST00000332156.1_Missense_Mutation_p.C455F|MGAT4C_ENST00000549405.2_Missense_Mutation_p.C455F			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	455					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)	p.C455Y(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						TATCCTCATACAATGTATATC	0.308																																																	1	Substitution - Missense(1)	kidney(1)											78.0	78.0	78.0					12																	86373140		2203	4300	6503	SO:0001583	missense	0				CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.1364G>T	12.37:g.86373140C>A	ENSP00000474896:p.Cys455Phe		B4DRH2|Q4G199|Q9UIU5	Missense_Mutation	SNP	pfam_Glyco_transf_54,superfamily_LSM_dom	p.C484F	ENST00000604798.1	37	c.1451	CCDS9030.1	12	.	.	.	.	.	.	.	.	.	.	C	18.80	3.700331	0.68501	.	.	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651	T;T;T;T;T	0.36340	1.3;1.26;1.3;1.3;1.3	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.66396	0.2785	M	0.83603	2.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.69495	-0.5130	10	0.72032	D	0.01	-10.3016	19.9607	0.97248	0.0:1.0:0.0:0.0	.	484;455	B4DRH2;Q9UBM8	.;MGT4C_HUMAN	F	455;484;455;455;455;455	ENSP00000331664:C455F;ENSP00000376900:C484F;ENSP00000449022:C455F;ENSP00000446647:C455F;ENSP00000447253:C455F	ENSP00000331664:C455F	C	-	2	0	MGAT4C	84897271	1.000000	0.71417	0.993000	0.49108	0.932000	0.56968	7.814000	0.86154	2.713000	0.92767	0.585000	0.79938	TGT	MGAT4C	-	NULL	ENSG00000182050		0.308	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MGAT4C	HGNC	protein_coding	OTTHUMT00000406212.2	-	0.00	64	0	C	NM_013244		86373140	-1	tier1	-	no_errors	ENST00000393205	ensembl	human	known	74_37	missense	12.90	81	12	SNP	1.000	A
MIR380	494329	genome.wustl.edu	37	14	101491915	101491915	+	RNA	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr14:101491915G>A	ENST00000362112.2	-	0	0				MIR323A_ENST00000362199.1_RNA|MIR329-2_ENST00000385029.1_RNA|MIR299_ENST00000385016.2_RNA|MIR329-1_ENST00000385028.1_RNA|MIR1197_ENST00000408818.1_RNA|MIR758_ENST00000390227.1_RNA|MIR411_ENST00000362239.2_RNA	NR_029872.1				microRNA 380																		CCTGGTATTTGAAGATGCGGT	0.502																																																	0													207.0	188.0	194.0					14																	101491915		1568	3582	5150			0					14q32.31	2013-02-12		2008-12-18		ENSG00000198982		"""ncRNAs / Micro RNAs"""	31873	non-coding RNA	RNA, micro		613654		MIRN380			Standard	NR_029872		Approved	hsa-mir-380	uc010awb.1				14.37:g.101491915G>A				RNA	SNP	-	NULL	ENST00000362112.2	37	NULL		14																																																																																			MIR1197	-	-	ENSG00000221745		0.502	MIR380-201	KNOWN	basic	miRNA	MIR1197	HGNC	miRNA		-	0.00	162	0	G	NR_029872		101491915	+1	tier1	-	no_errors	ENST00000408818	ensembl	human	known	74_37	rna	8.12	181	16	SNP	0.984	A
MIR518D	574489	genome.wustl.edu	37	19	54238132	54238132	+	RNA	SNP	C	C	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr19:54238132C>A	ENST00000385014.1	+	0	2				MIR516B1_ENST00000385211.1_RNA|RNU6-980P_ENST00000516925.1_RNA	NR_030211.1				microRNA 518d																		GTGAGAAGATCCCATGCTGTG	0.418																																																	0													103.0	97.0	99.0					19																	54238132		1568	3582	5150			0					19q13.42	2011-09-12		2008-12-18	ENSG00000207747	ENSG00000207747		"""ncRNAs / Micro RNAs"""	32121	non-coding RNA	RNA, micro				MIRN518D			Standard	NR_030211		Approved	hsa-mir-518d	uc021vao.1				19.37:g.54238132C>A				RNA	SNP	-	NULL	ENST00000385014.1	37	NULL		19																																																																																			MIR518D	-	-	ENSG00000207747		0.418	MIR518D-201	KNOWN	basic	miRNA	MIR518D	HGNC	miRNA		-	0.00	80	0	C	NR_030211		54238132	+1	tier1	-	no_errors	ENST00000385014	ensembl	human	known	74_37	rna	10.00	81	9	SNP	0.005	A
STRN3	29966	genome.wustl.edu	37	14	31483858	31483858	+	Intron	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr14:31483858G>T	ENST00000357479.5	-	1	479				MIR624_ENST00000385217.1_RNA|STRN3_ENST00000355683.5_Intron	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3						negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		AAACCACTTAGGTGTAATGCT	0.313																																																	0													47.0	42.0	43.0					14																	31483858		1502	3414	4916	SO:0001627	intron_variant	0				CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.282+11251C>A	14.37:g.31483858G>T			A2RTX7|A6NHZ7|Q9NRA5	RNA	SNP	-	NULL	ENST00000357479.5	37	NULL	CCDS41938.1	14																																																																																			MIR624	-	-	ENSG00000207952		0.313	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MIR624	HGNC	protein_coding	OTTHUMT00000409713.1	-	0.00	76	0	G	NM_014574		31483858	-1	tier1	-	no_errors	ENST00000385217	ensembl	human	known	74_37	rna	10.31	87	10	SNP	0.001	T
MLLT3	4300	genome.wustl.edu	37	9	20363485	20363485	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr9:20363485G>T	ENST00000380338.4	-	7	1606	c.1320C>A	c.(1318-1320)agC>agA	p.S440R	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000380321.1_Missense_Mutation_p.S34R|MLLT3_ENST00000429426.2_Missense_Mutation_p.S437R|MLLT3_ENST00000355930.6_Missense_Mutation_p.S34R	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	440					anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		TGCGACTTCGGCTGCCTCCTC	0.468			T	MLL	ALL																																			Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	0													155.0	134.0	141.0					9																	20363485		2203	4300	6503	SO:0001583	missense	0			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.1320C>A	9.37:g.20363485G>T	ENSP00000369695:p.Ser440Arg		B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.S440R	ENST00000380338.4	37	c.1320	CCDS6494.1	9	.	.	.	.	.	.	.	.	.	.	G	7.177	0.588835	0.13812	.	.	ENSG00000171843	ENST00000380338;ENST00000355930;ENST00000380323;ENST00000429426;ENST00000540751;ENST00000380321	.	.	.	5.49	1.37	0.22104	.	0.174595	0.64402	D	0.000008	T	0.22085	0.0532	N	0.14661	0.345	0.44492	D	0.997432	P;B	0.41041	0.736;0.148	B;B	0.30029	0.11;0.034	T	0.03728	-1.1009	9	0.26408	T	0.33	-10.1161	9.9591	0.41686	0.3066:0.0:0.6934:0.0	.	437;440	B7Z755;P42568	.;AF9_HUMAN	R	440;34;34;437;479;34	.	ENSP00000348196:S34R	S	-	3	2	MLLT3	20353485	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.425000	0.21346	0.319000	0.23209	-0.152000	0.13540	AGC	MLLT3	-	NULL	ENSG00000171843		0.468	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT3	HGNC	protein_coding	OTTHUMT00000051872.1		0.00	53	0	G	NM_004529		20363485	-1			no_errors	ENST00000380338	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
MMP14	4323	genome.wustl.edu	37	14	23310779	23310779	+	Missense_Mutation	SNP	C	C	T	rs554056813		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr14:23310779C>T	ENST00000311852.6	+	2	449	c.188C>T	c.(187-189)gCg>gTg	p.A63V	MMP14_ENST00000548162.1_3'UTR	NM_004995.2	NP_004986.1	P50281	MMP14_HUMAN	matrix metallopeptidase 14 (membrane-inserted)	63					angiogenesis (GO:0001525)|astrocyte cell migration (GO:0043615)|branching morphogenesis of an epithelial tube (GO:0048754)|chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|endodermal cell differentiation (GO:0035987)|endothelial cell proliferation (GO:0001935)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|male gonad development (GO:0008584)|negative regulation of focal adhesion assembly (GO:0051895)|ovarian follicle development (GO:0001541)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|tissue remodeling (GO:0048771)|zymogen activation (GO:0031638)	extracellular matrix (GO:0031012)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|peptidase activator activity (GO:0016504)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)	Marimastat(DB00786)	TCACTCTCAGCGGCCATCGCT	0.572																																																	0													114.0	87.0	96.0					14																	23310779		2203	4300	6503	SO:0001583	missense	0				CCDS9577.1	14q11-q12	2011-06-29	2005-08-08		ENSG00000157227	ENSG00000157227			7160	protein-coding gene	gene with protein product	"""membrane type 1 metalloprotease"""	600754	"""matrix metalloproteinase 14 (membrane-inserted)"""			8015608	Standard	NM_004995		Approved	MT1-MMP	uc001whc.3	P50281	OTTHUMG00000028704	ENST00000311852.6:c.188C>T	14.37:g.23310779C>T	ENSP00000308208:p.Ala63Val		A8K5L0|Q6GSF3|Q92678	Missense_Mutation	SNP	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.A63V	ENST00000311852.6	37	c.188	CCDS9577.1	14	.	.	.	.	.	.	.	.	.	.	C	22.3	4.266555	0.80358	.	.	ENSG00000157227	ENST00000311852;ENST00000548761	T;T	0.38240	1.15;1.15	5.64	4.75	0.60458	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	0.105283	0.64402	D	0.000004	T	0.38026	0.1025	M	0.62723	1.935	0.43137	D	0.994881	B	0.31485	0.325	B	0.29862	0.108	T	0.32798	-0.9893	10	0.56958	D	0.05	.	14.9842	0.71332	0.144:0.856:0.0:0.0	.	63	P50281	MMP14_HUMAN	V	63;69	ENSP00000308208:A63V;ENSP00000446989:A69V	ENSP00000308208:A63V	A	+	2	0	MMP14	22380619	0.905000	0.30787	1.000000	0.80357	0.988000	0.76386	3.947000	0.56652	1.378000	0.46305	-0.158000	0.13435	GCG	MMP14	-	pirsf_Pept_M10A_Metazoans,pfam_Peptidoglycan-bd-like,superfamily_Peptidoglycan-bd-like	ENSG00000157227		0.572	MMP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP14	HGNC	protein_coding	OTTHUMT00000071660.3	-	0.00	75	0	C	NM_004995		23310779	+1	tier1	-	no_errors	ENST00000311852	ensembl	human	known	74_37	missense	17.78	74	16	SNP	1.000	T
MRGPRG-AS1	283303	genome.wustl.edu	37	11	3243194	3243194	+	RNA	SNP	T	T	C	rs11026003	byFrequency	TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr11:3243194T>C	ENST00000420873.2	+	0	656				MRGPRG-AS1_ENST00000434798.1_RNA|MRGPRG-AS1_ENST00000541883.1_RNA			Q2M3A8	MRAS1_HUMAN	MRGPRG antisense RNA 1																		CGTCCAGGCCTGTTTCAACTA	0.607													T|||	185	0.0369409	0.0113	0.0043	5008	,	,		17713	0.1429		0.0189	False		,,,				2504	0.0041																0																																												0			AK097749		11p15.4	2012-10-12	2012-08-15	2012-08-10	ENSG00000236301	ENSG00000236301		"""Long non-coding RNAs"""	26691	non-coding RNA	RNA, long non-coding			"""chromosome 11 open reading frame 36"", ""MRGPRG antisense RNA 1 (non-protein coding)"""	C11orf36			Standard	NR_027138		Approved	FLJ36102, HSD-40	uc001lxo.2	Q2M3A8	OTTHUMG00000011707		11.37:g.3243194T>C			Q6TF48|Q8N7R8|Q8N9X7	RNA	SNP	-	NULL	ENST00000420873.2	37	NULL		11																																																																																			MRGPRG-AS1	-	-	ENSG00000236301		0.607	MRGPRG-AS1-002	KNOWN	alternative_5_UTR|basic	antisense	MRGPRG-AS1	HGNC	antisense	OTTHUMT00000032345.2		0.00	34	0	T	NR_027138		3243194	+1			no_errors	ENST00000420873	ensembl	human	known	74_37	rna	6.98	40	3	SNP	0.030	C
MS4A7	58475	genome.wustl.edu	37	11	60160258	60160258	+	Splice_Site	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr11:60160258G>T	ENST00000300184.3	+	6	843	c.647G>T	c.(646-648)gGg>gTg	p.G216V	MS4A7_ENST00000534016.1_Splice_Site_p.G171V|MS4A14_ENST00000531787.1_Intron|MS4A7_ENST00000358246.1_Splice_Site_p.G171V|MS4A7_ENST00000530234.2_Intron	NM_021201.4|NM_206939.1	NP_067024.1|NP_996822.1	Q9GZW8	MS4A7_HUMAN	membrane-spanning 4-domains, subfamily A, member 7	216						integral component of membrane (GO:0016021)		p.N213_G216del(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(8)|ovary(1)|skin(1)	20						AACAACCCTGGGGTGAGTATG	0.458																																																	1	Deletion - In frame(1)	central_nervous_system(1)											211.0	177.0	189.0					11																	60160258		2203	4300	6503	SO:0001630	splice_region_variant	0			AB026043	CCDS7985.1, CCDS7986.1	11q12	2008-03-25				ENSG00000166927			13378	protein-coding gene	gene with protein product		606502				11245982, 11401424	Standard	NM_021201		Approved	CD20L4, CFFM4, MS4A8	uc001npf.3	Q9GZW8		ENST00000300184.3:c.648+1G>T	11.37:g.60160258G>T			A6NP53|Q6IAG8	Missense_Mutation	SNP	pfam_CD20-like	p.G216V	ENST00000300184.3	37	c.647	CCDS7985.1	11	.	.	.	.	.	.	.	.	.	.	G	21.3	4.121807	0.77436	.	.	ENSG00000166927	ENST00000300184;ENST00000358246;ENST00000534016;ENST00000530027	T;T;T;T	0.52057	2.69;1.99;1.99;0.68	3.45	1.56	0.23342	.	3.823050	0.00649	N	0.000555	T	0.48429	0.1499	N	0.08118	0	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.52200	-0.8607	10	0.41790	T	0.15	-59.3109	5.482	0.16729	0.2586:0.0:0.7414:0.0	.	171;216	Q9GZW8-2;Q9GZW8	.;MS4A7_HUMAN	V	216;171;171;152	ENSP00000300184:G216V;ENSP00000350983:G171V;ENSP00000434637:G171V;ENSP00000434819:G152V	ENSP00000300184:G216V	G	+	2	0	MS4A7	59916834	0.987000	0.35691	0.875000	0.34327	0.908000	0.53690	1.408000	0.34668	0.460000	0.27045	0.467000	0.42956	GGG	MS4A7	-	NULL	ENSG00000166927		0.458	MS4A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A7	HGNC	protein_coding	OTTHUMT00000394299.1	-	0.00	66	0	G		Missense_Mutation	60160258	+1	tier1	-	no_errors	ENST00000300184	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.882	T
MT-CO2	4513	genome.wustl.edu	37	M	7642	7642	+	Silent	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chrM:7642G>A	ENST00000361739.1	+	1	57	c.57G>A	c.(55-57)gaG>gaA	p.E19E	MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	19					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						ATCATAGAAGAGCTTATCACC	0.378																																																	0																																										SO:0001819	synonymous_variant	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.57G>A	M.37:g.7642G>A			Q37526	Silent	SNP	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.E19	ENST00000361739.1	37	c.57		MT																																																																																			MT-CO2	-	pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,tigrfam_Cyt_c_oxidase_su2	ENSG00000198712		0.378	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	HGNC	protein_coding		-	0.00	573	0	G	YP_003024029		7642	+1	tier1	-	no_errors	ENST00000361739	ensembl	human	known	74_37	silent	52.61	580	646	SNP	NULL	A
MT1DP	326343	genome.wustl.edu	37	16	56678679	56678679	+	RNA	SNP	A	A	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr16:56678679A>T	ENST00000463480.2	+	0	172							A1L3X4	MT1DP_HUMAN	metallothionein 1D, pseudogene								metal ion binding (GO:0046872)										TGCACCTGAAAAGGGGCATTG	0.542																																																	0																																												0			AF348999		16q13	2011-04-15	2011-04-15		ENSG00000205361	ENSG00000205361		"""Metallothioneins"""	7396	pseudogene	pseudogene						6089206, 6327055, 3785191	Standard	NR_027781		Approved	MTM	uc010vhf.2	A1L3X4	OTTHUMG00000158354		16.37:g.56678679A>T			Q86YX1	RNA	SNP	-	NULL	ENST00000463480.2	37	NULL		16																																																																																			MT1DP	-	-	ENSG00000205361		0.542	MT1DP-002	KNOWN	basic	processed_transcript	MT1DP	HGNC	pseudogene	OTTHUMT00000350774.2	-	0.00	95	0	A			56678679	+1	tier1	-	no_errors	ENST00000463480	ensembl	human	known	74_37	rna	15.38	88	16	SNP	0.991	T
MYH13	8735	genome.wustl.edu	37	17	10206736	10206736	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr17:10206736C>T	ENST00000418404.3	-	37	5709	c.5546G>A	c.(5545-5547)cGc>cAc	p.R1849H	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Missense_Mutation_p.R1849H			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1849					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CTTGACTTTGCGTTCGTACTT	0.522																																																	0													154.0	154.0	154.0					17																	10206736		1941	4161	6102	SO:0001583	missense	0			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.5546G>A	17.37:g.10206736C>T	ENSP00000404570:p.Arg1849His		O95252|Q9P0U8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1849H	ENST00000418404.3	37	c.5546	CCDS45613.1	17	.	.	.	.	.	.	.	.	.	.	C	26.8	4.774774	0.90108	.	.	ENSG00000006788	ENST00000252172	D	0.83673	-1.75	3.92	3.92	0.45320	Myosin tail (1);	.	.	.	.	D	0.93132	0.7813	M	0.93150	3.385	0.40362	D	0.979255	D	0.89917	1.0	D	0.97110	1.0	D	0.95476	0.8556	9	0.87932	D	0	.	16.4927	0.84206	0.0:1.0:0.0:0.0	.	1849	Q9UKX3	MYH13_HUMAN	H	1849	ENSP00000252172:R1849H	ENSP00000252172:R1849H	R	-	2	0	MYH13	10147461	0.755000	0.28372	0.651000	0.29564	0.960000	0.62799	4.733000	0.62036	2.168000	0.68352	0.561000	0.74099	CGC	MYH13	-	pfam_Myosin_tail	ENSG00000006788		0.522	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1	-	0.00	81	0	C	NM_003802		10206736	-1	tier1	-	no_errors	ENST00000252172	ensembl	human	known	74_37	missense	11.11	96	12	SNP	0.999	T
MYH7	4625	genome.wustl.edu	37	14	23886458	23886458	+	Missense_Mutation	SNP	G	G	A	rs139646545		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr14:23886458G>A	ENST00000355349.3	-	32	4585	c.4423C>T	c.(4423-4425)Cgc>Tgc	p.R1475C	CTD-2201G16.1_ENST00000557368.1_RNA|MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1475			R -> C. {ECO:0000269|PubMed:15483641}.		adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CTGAGGGAGCGAGCCTCCTTC	0.577																																																	0			GRCh37	CM050711	MYH7	M	rs139646545	G	CYS/ARG	0,4406		0,0,2203	96.0	98.0	97.0		4423	5.3	1.0	14	dbSNP_134	97	1,8599	1.2+/-3.3	0,1,4299	no	missense	MYH7	NM_000257.2	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1475/1936	23886458	1,13005	2203	4300	6503	SO:0001583	missense	0			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4423C>T	14.37:g.23886458G>A	ENSP00000347507:p.Arg1475Cys		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1475C	ENST00000355349.3	37	c.4423	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	G	19.88	3.909150	0.72868	0.0	1.16E-4	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.83914	-1.78	5.27	5.27	0.74061	Myosin tail (1);	.	.	.	.	D	0.94479	0.8223	H	0.98027	4.13	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95906	0.8919	9	0.72032	D	0.01	.	15.4652	0.75394	0.0:0.0:0.8611:0.1389	.	1475	P12883	MYH7_HUMAN	C	1475;1480	ENSP00000347507:R1475C	ENSP00000347507:R1475C	R	-	1	0	MYH7	22956298	0.989000	0.36119	0.994000	0.49952	0.986000	0.74619	1.988000	0.40697	2.746000	0.94184	0.591000	0.81541	CGC	MYH7	-	pfam_Myosin_tail,superfamily_Prefoldin	ENSG00000092054		0.577	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	-	0.00	39	0	G	NM_000257		23886458	-1	tier1	rs139646545	no_errors	ENST00000355349	ensembl	human	known	74_37	missense	23.19	53	16	SNP	0.967	A
NEUROD6	63974	genome.wustl.edu	37	7	31378309	31378309	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr7:31378309G>T	ENST00000297142.3	-	2	896	c.574C>A	c.(574-576)Cag>Aag	p.Q192K		NM_022728.2	NP_073565.2	Q96NK8	NDF6_HUMAN	neuronal differentiation 6	192					cell differentiation (GO:0030154)|dentate gyrus development (GO:0021542)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	32						TCCCCACCCTGACCCATCAGG	0.567																																																	0													111.0	84.0	93.0					7																	31378309		2203	4300	6503	SO:0001583	missense	0			AF248954	CCDS5434.1	7p15.1	2013-05-21	2012-02-22		ENSG00000164600	ENSG00000164600		"""Basic helix-loop-helix proteins"""	13804	protein-coding gene	gene with protein product		611513	"""neurogenic differentiation 6"""			12357074	Standard	NM_022728		Approved	Atoh2, NEX1M, Math-2, bHLHa2, Nex1	uc003tch.4	Q96NK8	OTTHUMG00000022865	ENST00000297142.3:c.574C>A	7.37:g.31378309G>T	ENSP00000297142:p.Gln192Lys		Q548T9|Q9H3H6	Missense_Mutation	SNP	pfam_Neurogenic_DUF,pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pirsf_TF_bHLH_NeuroD,pfscan_bHLH_dom	p.Q192K	ENST00000297142.3	37	c.574	CCDS5434.1	7	.	.	.	.	.	.	.	.	.	.	G	16.35	3.099618	0.56183	.	.	ENSG00000164600	ENST00000297142	T	0.65364	-0.15	5.02	5.02	0.67125	Neurogenic differentiation factor, domain of unknown function (1);	0.053511	0.85682	D	0.000000	T	0.56804	0.2010	L	0.37630	1.12	0.58432	D	0.999999	B	0.34372	0.451	B	0.38156	0.266	T	0.52609	-0.8553	10	0.21540	T	0.41	-17.5021	18.7079	0.91645	0.0:0.0:1.0:0.0	.	192	Q96NK8	NDF6_HUMAN	K	192	ENSP00000297142:Q192K	ENSP00000297142:Q192K	Q	-	1	0	NEUROD6	31344834	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.769000	0.85360	2.481000	0.83766	0.650000	0.86243	CAG	NEUROD6	-	pfam_Neurogenic_DUF,pirsf_TF_bHLH_NeuroD	ENSG00000164600		0.567	NEUROD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROD6	HGNC	protein_coding	OTTHUMT00000215050.1	-	0.00	28	0	G	NM_022728		31378309	-1	tier1	-	no_errors	ENST00000297142	ensembl	human	known	74_37	missense	8.06	57	5	SNP	1.000	T
NKTR	4820	genome.wustl.edu	37	3	42679486	42679486	+	Frame_Shift_Del	DEL	A	A	-	rs150528581	byFrequency	TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr3:42679486delA	ENST00000232978.8	+	13	2478	c.2290delA	c.(2290-2292)aaafs	p.K765fs	RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000434363.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	765	Arg/Ser-rich.				protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		ATCCAGTGGGAAAAAAAATAG	0.378																																																	0													86.0	86.0	86.0					3																	42679486		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.2290delA	3.37:g.42679486delA	ENSP00000232978:p.Lys765fs			Frame_Shift_Del	DEL	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.N766fs	ENST00000232978.8	37	c.2290	CCDS2702.1	3																																																																																			NKTR	-	NULL	ENSG00000114857		0.378	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKTR	HGNC	protein_coding	OTTHUMT00000256642.2		0.00	32	0	A	NM_005385		42679486	+1	tier1		no_errors	ENST00000232978	ensembl	human	known	74_37	frame_shift_del	18.18	18	4	DEL	0.001	-
NOS1	4842	genome.wustl.edu	37	12	117703277	117703277	+	Silent	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr12:117703277G>A	ENST00000338101.4	-	11	1984	c.1980C>T	c.(1978-1980)acC>acT	p.T660T	NOS1_ENST00000317775.6_Silent_p.T660T|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		TGAAGGACTCGGTGGCGGAGT	0.597																																					Esophageal Squamous(162;1748 2599 51982 52956)												0													51.0	50.0	50.0					12																	117703277		2069	4249	6318	SO:0001819	synonymous_variant	0				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.1980C>T	12.37:g.117703277G>A				Silent	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,pfam_PDZ,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,superfamily_PDZ,smart_PDZ,pirsf_NOS_euk,pfscan_PDZ,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.T660	ENST00000338101.4	37	c.1980	CCDS55890.1	12																																																																																			NOS1	-	pfam_NO_synthase_oxygenase_dom,superfamily_NO_synthase_oxygenase_dom,pirsf_NOS_euk	ENSG00000089250		0.597	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	HGNC	protein_coding	OTTHUMT00000268053.1	-	0.00	98	0	G			117703277	-1	tier1	-	no_errors	ENST00000317775	ensembl	human	known	74_37	silent	7.44	112	9	SNP	0.750	A
NPSR1	387129	genome.wustl.edu	37	7	34768375	34768375	+	Intron	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr7:34768375G>T	ENST00000360581.1	+	2	408				NPSR1_ENST00000381539.3_Intron|NPSR1-AS1_ENST00000419766.1_RNA|NPSR1_ENST00000531252.1_Intron|NPSR1_ENST00000381542.1_Intron|NPSR1_ENST00000359791.1_Intron|NPSR1_ENST00000381553.3_Intron	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	agaaactgatgggcatgaaga	0.408																																																	0																																										SO:0001627	intron_variant	0			AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.280+44079G>T	7.37:g.34768375G>T			A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	RNA	SNP	-	NULL	ENST00000360581.1	37	NULL	CCDS5444.1	7																																																																																			NPSR1-AS1	-	-	ENSG00000197085		0.408	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPSR1-AS1	HGNC	protein_coding	OTTHUMT00000216837.1	-	0.00	76	0	G	NM_207173		34768375	-1	tier1	-	no_errors	ENST00000358772	ensembl	human	known	74_37	rna	31.58	65	30	SNP	0.000	T
NRXN3	9369	genome.wustl.edu	37	14	80327777	80327777	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr14:80327777G>A	ENST00000557594.1	+	6	2337	c.1384G>A	c.(1384-1386)Gaa>Aaa	p.E462K	NRXN3_ENST00000554719.1_Intron|NRXN3_ENST00000556003.1_Intron|NRXN3_ENST00000428277.2_Intron|NRXN3_ENST00000335750.5_Intron|NRXN3_ENST00000281127.7_Intron	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	462					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CAAAGTCTCCGAAACTAGTAG	0.483																																																	0																																										SO:0001583	missense	0			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.1384G>A	14.37:g.80327777G>A	ENSP00000451672:p.Glu462Lys		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Neurexin-like,pfscan_Laminin_G	p.E462K	ENST00000557594.1	37	c.1384		14	.	.	.	.	.	.	.	.	.	.	G	16.22	3.060356	0.55432	.	.	ENSG00000021645	ENST00000330071;ENST00000557594	T	0.33216	1.42	6.16	6.16	0.99307	.	.	.	.	.	T	0.23572	0.0570	.	.	.	0.80722	D	1	P	0.48640	0.913	B	0.30855	0.121	T	0.03221	-1.1059	7	.	.	.	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	462	Q9HDB5	NRX3B_HUMAN	K	1468;462	ENSP00000451672:E462K	.	E	+	1	0	NRXN3	79397530	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.010000	0.88615	2.937000	0.99478	0.650000	0.86243	GAA	NRXN3	-	NULL	ENSG00000021645		0.483	NRXN3-004	NOVEL	basic	protein_coding	NRXN3	HGNC	protein_coding	OTTHUMT00000413790.1	-	0.00	83	0	G	NM_001105250		80327777	+1	tier1	-	no_errors	ENST00000557594	ensembl	human	novel	74_37	missense	26.88	68	25	SNP	1.000	A
NT5C1B	93034	genome.wustl.edu	37	2	18765855	18765855	+	Silent	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr2:18765855G>A	ENST00000359846.2	-	5	905	c.828C>T	c.(826-828)gaC>gaT	p.D276D	NT5C1B-RDH14_ENST00000532967.1_Silent_p.D276D|NT5C1B_ENST00000600945.1_Silent_p.D276D|RNU6-1215P_ENST00000384441.1_RNA|NT5C1B_ENST00000460052.1_5'Flank|NT5C1B_ENST00000304081.4_Silent_p.D216D	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	276					nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				CCTCGTAGTCGTCCTCGTCCT	0.682																																																	0													17.0	19.0	18.0					2																	18765855		2202	4300	6502	SO:0001819	synonymous_variant	0			AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.828C>T	2.37:g.18765855G>A			B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Missense_Mutation	SNP	NULL	p.T194M	ENST00000359846.2	37	c.581	CCDS33150.1	2																																																																																			NT5C1B	-	NULL	ENSG00000185013		0.682	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NT5C1B	HGNC	protein_coding	OTTHUMT00000323822.1		0.00	53	0	G			18765855	-1			no_errors	ENST00000406971	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.000	A
OLFM3	118427	genome.wustl.edu	37	1	102270448	102270448	+	Silent	SNP	A	A	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr1:102270448A>T	ENST00000338858.5	-	6	782	c.783T>A	c.(781-783)acT>acA	p.T261T	OLFM3_ENST00000536598.1_3'UTR|OLFM3_ENST00000370103.4_Silent_p.T241T|OLFM3_ENST00000462354.1_5'UTR			Q96PB7	NOE3_HUMAN	olfactomedin 3	261	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		TTTTATTGTTAGTATAACTGT	0.378																																																	0													52.0	50.0	51.0					1																	102270448		2203	4297	6500	SO:0001819	synonymous_variant	0			AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.783T>A	1.37:g.102270448A>T			Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Silent	SNP	pfam_Olfac-like,pfam_Noelin-1,superfamily_Quino_amine_DH_bsu,smart_Olfac-like,pfscan_Olfac-like	p.T261	ENST00000338858.5	37	c.783		1																																																																																			OLFM3	-	pfam_Olfac-like,superfamily_Quino_amine_DH_bsu,smart_Olfac-like,pfscan_Olfac-like	ENSG00000118733		0.378	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	OLFM3	HGNC	protein_coding	OTTHUMT00000030142.1	-	0.00	43	0	A			102270448	-1	tier1	-	no_errors	ENST00000338858	ensembl	human	known	74_37	silent	20.41	39	10	SNP	0.994	T
OR10Q1	219960	genome.wustl.edu	37	11	57995724	57995724	+	Silent	SNP	G	G	A	rs142217876		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr11:57995724G>A	ENST00000316770.2	-	1	666	c.624C>T	c.(622-624)agC>agT	p.S208S		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				GCACGAGGATGCTCACGACAT	0.627																																																	0													81.0	69.0	73.0					11																	57995724		2201	4295	6496	SO:0001819	synonymous_variant	0			AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.624C>T	11.37:g.57995724G>A			Q6IFG4	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S208	ENST00000316770.2	37	c.624	CCDS31547.1	11																																																																																			OR10Q1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000180475		0.627	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Q1	HGNC	protein_coding	OTTHUMT00000394706.1	-	0.00	45	0	G	NM_001004471		57995724	-1	tier1	-	no_errors	ENST00000316770	ensembl	human	known	74_37	silent	8.86	72	7	SNP	0.304	A
OR2T2	401992	genome.wustl.edu	37	1	248616580	248616580	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr1:248616580C>T	ENST00000342927.3	+	1	504	c.482C>T	c.(481-483)aCt>aTt	p.T161I		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTCATGCTGACTCCTGTCACT	0.517																																																	0													23.0	29.0	27.0					1																	248616580		2178	4268	6446	SO:0001583	missense	0			BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.482C>T	1.37:g.248616580C>T	ENSP00000343062:p.Thr161Ile		B2RNM1|B9EH01	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T161I	ENST00000342927.3	37	c.482	CCDS31116.1	1	.	.	.	.	.	.	.	.	.	.	c	8.035	0.762661	0.15914	.	.	ENSG00000196240	ENST00000342927	T	0.00245	8.45	3.72	-0.647	0.11468	GPCR, rhodopsin-like superfamily (1);	0.133396	0.34200	N	0.004167	T	0.00300	0.0009	M	0.69463	2.115	0.09310	N	1	D	0.62365	0.991	D	0.65573	0.936	T	0.53739	-0.8396	10	0.62326	D	0.03	.	1.4313	0.02334	0.1479:0.4461:0.145:0.261	.	161	Q6IF00	OR2T2_HUMAN	I	161	ENSP00000343062:T161I	ENSP00000343062:T161I	T	+	2	0	OR2T2	246683203	0.000000	0.05858	0.002000	0.10522	0.145000	0.21501	-0.061000	0.11693	-0.332000	0.08489	0.449000	0.29647	ACT	OR2T2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196240		0.517	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T2	HGNC	protein_coding	OTTHUMT00000097421.1	-	0.00	57	0	C	NM_001004136		248616580	+1	tier1	-	no_errors	ENST00000342927	ensembl	human	known	74_37	missense	21.43	55	15	SNP	0.000	T
OR5H15	403274	genome.wustl.edu	37	3	97888227	97888227	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr3:97888227G>T	ENST00000356526.2	+	1	684	c.684G>T	c.(682-684)aaG>aaT	p.K228N		NM_001005515.1	NP_001005515.1	A6NDH6	O5H15_HUMAN	olfactory receptor, family 5, subfamily H, member 15	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(2)|stomach(1)	35						TCTTAGAAAAGAAATCTGATA	0.378																																																	0													71.0	76.0	74.0					3																	97888227		2203	4300	6503	SO:0001583	missense	0				CCDS33799.1	3q11.2	2013-09-23			ENSG00000233412	ENSG00000233412		"""GPCR / Class A : Olfactory receptors"""	31287	protein-coding gene	gene with protein product							Standard	NM_001005515		Approved		uc011bgu.2	A6NDH6	OTTHUMG00000160076	ENST00000356526.2:c.684G>T	3.37:g.97888227G>T	ENSP00000373195:p.Lys228Asn			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K228N	ENST00000356526.2	37	c.684	CCDS33799.1	3	.	.	.	.	.	.	.	.	.	.	-	2.722	-0.266383	0.05754	.	.	ENSG00000233412	ENST00000356526;ENST00000454529	T	0.00115	8.71	2.48	-4.88	0.03113	GPCR, rhodopsin-like superfamily (1);	0.732533	0.12129	N	0.496963	T	0.00073	0.0002	L	0.31420	0.93	0.09310	N	1	B	0.12630	0.006	B	0.15052	0.012	T	0.39502	-0.9611	10	0.87932	D	0	.	1.3604	0.02190	0.4521:0.148:0.2501:0.1498	.	228	A6NDH6	O5H15_HUMAN	N	228	ENSP00000373195:K228N	ENSP00000373195:K228N	K	+	3	2	OR5H15	99370917	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.241000	0.02911	-0.961000	0.03609	-2.968000	0.00081	AAG	OR5H15	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000233412		0.378	OR5H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H15	HGNC	protein_coding	OTTHUMT00000359109.1	-	0.00	88	0	G			97888227	+1	tier1	-	no_errors	ENST00000356526	ensembl	human	known	74_37	missense	5.22	109	6	SNP	0.000	T
PADI1	29943	genome.wustl.edu	37	1	17555281	17555281	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr1:17555281G>T	ENST00000375471.4	+	7	906	c.814G>T	c.(814-816)Gtg>Ttg	p.V272L		NM_013358.2	NP_037490.2	Q9ULC6	PADI1_HUMAN	peptidyl arginine deiminase, type I	272					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	28		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	TGTCAGCCTGGTGGACCCGGG	0.652																																					Esophageal Squamous(80;414 1257 4580 27746 50832)												0													78.0	80.0	79.0					1																	17555281		2203	4300	6503	SO:0001583	missense	0			AB033768	CCDS178.1	1p36.13	2008-07-18			ENSG00000142623	ENSG00000142623	3.5.3.15	"""Peptidyl arginine deiminases"""	18367	protein-coding gene	gene with protein product	"""peptidylarginine deiminase type I"", ""protein-arginine deiminase type-1"", ""hPAD-colony 10"""	607934				12416996	Standard	NM_013358		Approved	HPAD10, PDI1, PDI, PAD1	uc001bah.1	Q9ULC6	OTTHUMG00000002294	ENST00000375471.4:c.814G>T	1.37:g.17555281G>T	ENSP00000364620:p.Val272Leu		A1L4K6|Q70SX6	Missense_Mutation	SNP	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.V272L	ENST00000375471.4	37	c.814	CCDS178.1	1	.	.	.	.	.	.	.	.	.	.	G	2.828	-0.243321	0.05906	.	.	ENSG00000142623	ENST00000375471	T	0.13778	2.56	4.97	-0.822	0.10819	Protein-arginine deiminase (PAD), central domain (2);	0.342924	0.27961	N	0.017142	T	0.04318	0.0119	N	0.11651	0.15	0.80722	D	1	B	0.12630	0.006	B	0.18263	0.021	T	0.41787	-0.9489	10	0.02654	T	1	-11.9408	4.5133	0.11923	0.0899:0.476:0.2358:0.1984	.	272	Q9ULC6	PADI1_HUMAN	L	272	ENSP00000364620:V272L	ENSP00000364620:V272L	V	+	1	0	PADI1	17427868	0.766000	0.28496	0.998000	0.56505	0.788000	0.44548	0.034000	0.13776	0.423000	0.26033	0.561000	0.74099	GTG	PADI1	-	pfam_Prot_Arg_deaminase_cen_dom,superfamily_Prot_Arg_deaminase_cen_dom,pirsf_Protein-arginine_deiminase_sub	ENSG00000142623		0.652	PADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI1	HGNC	protein_coding	OTTHUMT00000006621.1	-	0.00	55	0	G	NM_013358		17555281	+1	tier1	-	no_errors	ENST00000375471	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.999	T
OTUD7B	56957	genome.wustl.edu	37	1	149916658	149916658	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr1:149916658C>T	ENST00000369135.4	-	12	1924	c.1630G>A	c.(1630-1632)Ggc>Agc	p.G544S		NM_020205.2	NP_064590.2	Q6GQQ9	OTU7B_HUMAN	OTU deubiquitinase 7B	544					mucosal immune response (GO:0002385)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|DNA binding (GO:0003677)|Lys48-specific deubiquitinase activity (GO:1990380)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			GTCTCAGTGCCGCTGCTTCCT	0.582																																																	0													105.0	109.0	108.0					1																	149916658		2005	4190	6195	SO:0001583	missense	0			AJ293573	CCDS72903.1	1q21.2	2014-02-24	2014-02-24	2006-07-07	ENSG00000163113	ENSG00000264522		"""OTU domain containing"""	16683	protein-coding gene	gene with protein product		611748	"""zinc finger, A20 domain containing 1"", ""OTU domain containing 7B"""	ZA20D1		11463333, 23827681	Standard	NM_020205		Approved	CEZANNE	uc001etn.3	Q6GQQ9	OTTHUMG00000012291	ENST00000369135.4:c.1630G>A	1.37:g.149916658C>T	ENSP00000358131:p.Gly544Ser		B7Z643|D3DUZ8|Q5SZ60|Q8WWA7|Q9NQ53|Q9UFF4	Missense_Mutation	SNP	pfam_OTU,superfamily_UBA-like,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.G544S	ENST00000369135.4	37	c.1630	CCDS41389.1	1	.	.	.	.	.	.	.	.	.	.	C	10.87	1.471493	0.26423	.	.	ENSG00000163113	ENST00000369135;ENST00000543330	T	0.35789	1.29	4.86	3.93	0.45458	.	0.809562	0.11271	N	0.581514	T	0.11067	0.0270	N	0.22421	0.69	0.44030	D	0.996758	B	0.31837	0.342	B	0.22753	0.041	T	0.08889	-1.0700	9	.	.	.	-11.2761	13.5571	0.61765	0.1566:0.8434:0.0:0.0	.	544	Q6GQQ9	OTU7B_HUMAN	S	544	ENSP00000358131:G544S	.	G	-	1	0	OTUD7B	148183282	0.970000	0.33590	0.966000	0.40874	0.499000	0.33736	3.576000	0.53878	1.233000	0.43693	0.455000	0.32223	GGC	OTUD7B	-	NULL	ENSG00000163113		0.582	OTUD7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD7B	HGNC	protein_coding	OTTHUMT00000034146.3	-	0.00	44	0	C	NM_020205		149916658	-1	tier1	-	no_errors	ENST00000369135	ensembl	human	known	74_37	missense	15.91	37	7	SNP	1.000	T
PCSK5	5125	genome.wustl.edu	37	9	78923612	78923612	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr9:78923612G>T	ENST00000545128.1	+	28	4113	c.3575G>T	c.(3574-3576)gGa>gTa	p.G1192V		NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	1192	CRM (Cys-rich motif).				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						ACCTGCAATGGATCTGCAACT	0.433																																																	0													52.0	49.0	50.0					9																	78923612		876	1991	2867	SO:0001583	missense	0				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.3575G>T	9.37:g.78923612G>T	ENSP00000446280:p.Gly1192Val		F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt_N_dom,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EG-like_dom,prints_Peptidase_S8_subtilisin-rel	p.G1192V	ENST00000545128.1	37	c.3575	CCDS55320.1	9	.	.	.	.	.	.	.	.	.	.	G	14.62	2.588659	0.46110	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000424854	T;T	0.36340	1.35;1.26	5.89	1.89	0.25635	.	0.654458	0.15132	N	0.278770	T	0.60932	0.2307	M	0.93678	3.445	0.58432	D	0.999994	.	.	.	.	.	.	T	0.61978	-0.6951	8	0.59425	D	0.04	-3.9285	7.9218	0.29850	0.3506:0.0:0.6494:0.0	.	.	.	.	V	1192;922;892	ENSP00000446280:G1192V;ENSP00000411654:G892V	ENSP00000365945:G922V	G	+	2	0	PCSK5	78113432	0.984000	0.35163	0.968000	0.41197	0.964000	0.63967	0.595000	0.24029	0.365000	0.24400	0.561000	0.74099	GGA	PCSK5	-	superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_EG-like_dom	ENSG00000099139		0.433	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	HGNC	protein_coding			0.00	49	0	G			78923612	+1			no_errors	ENST00000545128	ensembl	human	known	74_37	missense	9.09	30	3	SNP	0.988	T
PDLIM2	64236	genome.wustl.edu	37	8	22442854	22442854	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr8:22442854C>A	ENST00000397760.4	+	6	882	c.482C>A	c.(481-483)tCc>tAc	p.S161Y	PDLIM2_ENST00000339162.7_Missense_Mutation_p.S161Y|PDLIM2_ENST00000308354.7_Missense_Mutation_p.S411Y|PDLIM2_ENST00000265810.4_Missense_Mutation_p.S161Y|PDLIM2_ENST00000409141.1_Missense_Mutation_p.S161Y|PDLIM2_ENST00000397761.2_Missense_Mutation_p.S161Y|PDLIM2_ENST00000409417.1_Missense_Mutation_p.S161Y|PDLIM2_ENST00000448520.1_3'UTR			Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 (mystique)	161	Ser-rich.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		CTGGCATGTTCCCCGGGCCTC	0.672																																																	0													46.0	35.0	39.0					8																	22442854		2203	4299	6502	SO:0001583	missense	0			AY007729	CCDS34860.1, CCDS6032.1, CCDS34861.1, CCDS6032.2	8p21.3	2012-06-27			ENSG00000120913	ENSG00000120913			13992	protein-coding gene	gene with protein product		609722					Standard	NM_021630		Approved		uc003xby.4	Q96JY6	OTTHUMG00000164270	ENST00000397760.4:c.482C>A	8.37:g.22442854C>A	ENSP00000380867:p.Ser161Tyr		D3DSR5|J3KNH4|Q7Z584|Q86WM8|Q8WZ29|Q9H4L9|Q9H7I2	Missense_Mutation	SNP	pfam_PDZ,pfam_Znf_LIM,superfamily_PDZ,smart_PDZ,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.S411Y	ENST00000397760.4	37	c.1232		8	.	.	.	.	.	.	.	.	.	.	C	14.00	2.403395	0.42613	.	.	ENSG00000120913	ENST00000456545;ENST00000308354;ENST00000452226;ENST00000397760;ENST00000339162;ENST00000397761;ENST00000426493;ENST00000429812;ENST00000409141;ENST00000265810;ENST00000409417	T;T;T;T;T;T;T;T;T;T;T	0.30182	1.75;3.33;2.4;2.37;2.4;2.37;1.54;1.65;2.4;2.48;2.37	5.31	2.5	0.30297	.	1.581180	0.03222	N	0.177707	T	0.43211	0.1237	M	0.67953	2.075	0.09310	N	1	D;P;B;P	0.54207	0.965;0.924;0.278;0.94	P;P;B;P	0.51135	0.66;0.66;0.181;0.459	T	0.08186	-1.0734	10	0.72032	D	0.01	-6.3013	3.9925	0.09543	0.167:0.5839:0.1612:0.088	.	161;161;161;161	Q96JY6-3;Q96JY6-4;Q96JY6;C9JS55	.;.;PDLI2_HUMAN;.	Y	161;411;161;161;161;161;161;161;161;161;161	ENSP00000401992:S161Y;ENSP00000312634:S411Y;ENSP00000394376:S161Y;ENSP00000380867:S161Y;ENSP00000342035:S161Y;ENSP00000380868:S161Y;ENSP00000392920:S161Y;ENSP00000407643:S161Y;ENSP00000386868:S161Y;ENSP00000265810:S161Y;ENSP00000387084:S161Y	ENSP00000265810:S161Y	S	+	2	0	PDLIM2	22498799	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.694000	0.25512	0.223000	0.20920	0.561000	0.74099	TCC	PDLIM2	-	NULL	ENSG00000120913		0.672	PDLIM2-202	KNOWN	basic|appris_principal	protein_coding	PDLIM2	HGNC	protein_coding	OTTHUMT00000334167.1		0.00	83	0	C			22442854	+1			no_errors	ENST00000308354	ensembl	human	known	74_37	missense	5.94	95	6	SNP	0.000	A
PIAS1	8554	genome.wustl.edu	37	15	68438931	68438931	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr15:68438931G>T	ENST00000249636.6	+	6	869	c.721G>T	c.(721-723)Gtg>Ttg	p.V241L	PIAS1_ENST00000545237.1_Missense_Mutation_p.V243L	NM_016166.1	NP_057250.1	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	241	PINIT. {ECO:0000255|PROSITE- ProRule:PRU00799}.				androgen receptor signaling pathway (GO:0030521)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|protein-DNA complex assembly (GO:0065004)|regulation of cell proliferation (GO:0042127)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.V241L(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)	24						AAAAAATGGCGTGGAACCAAA	0.368																																																	1	Substitution - Missense(1)	endometrium(1)											95.0	90.0	91.0					15																	68438931		1825	4074	5899	SO:0001583	missense	0			AF077951	CCDS45290.1	15q	2011-10-11	2002-04-19	2002-04-19		ENSG00000033800		"""Zinc fingers, MIZ-type"""	2752	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 3"""	603566	"""DEAD/H (Asp-Glu-Ala-Asp/His) box binding protein 1"""	DDXBP1		9724754, 9177271	Standard	XM_005254735		Approved	GBP, GU/RH-II, ZMIZ3	uc002aqz.3	O75925		ENST00000249636.6:c.721G>T	15.37:g.68438931G>T	ENSP00000249636:p.Val241Leu		B2RB67|B3KSY9|C5J4B4|Q147X4|Q99751|Q9UN02	Missense_Mutation	SNP	pfam_Znf_MIZ,smart_SAP_dom,pfscan_Znf_MIZ,pfscan_SAP_dom	p.V241L	ENST00000249636.6	37	c.721	CCDS45290.1	15	.	.	.	.	.	.	.	.	.	.	G	33	5.264597	0.95399	.	.	ENSG00000033800	ENST00000249636;ENST00000545237	T;T	0.43294	0.95;0.95	5.55	5.55	0.83447	PINIT domain (1);	0.000000	0.85682	D	0.000000	T	0.60418	0.2267	M	0.64567	1.98	0.80722	D	1	P;P	0.52316	0.952;0.893	P;P	0.58077	0.832;0.627	T	0.62077	-0.6930	10	0.72032	D	0.01	-9.8198	19.5037	0.95106	0.0:0.0:1.0:0.0	.	241;241	C5J4B4;O75925	.;PIAS1_HUMAN	L	241;243	ENSP00000249636:V241L;ENSP00000438574:V243L	ENSP00000249636:V241L	V	+	1	0	PIAS1	66225985	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.596000	0.87737	0.655000	0.94253	GTG	PIAS1	-	NULL	ENSG00000033800		0.368	PIAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS1	HGNC	protein_coding	OTTHUMT00000419642.2	-	0.00	52	0	G			68438931	+1	tier1	-	no_errors	ENST00000249636	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
PIAS1	8554	genome.wustl.edu	37	15	68438944	68438944	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr15:68438944G>T	ENST00000249636.6	+	6	882	c.734G>T	c.(733-735)cGa>cTa	p.R245L	PIAS1_ENST00000545237.1_Missense_Mutation_p.R247L	NM_016166.1	NP_057250.1	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	245	PINIT. {ECO:0000255|PROSITE- ProRule:PRU00799}.				androgen receptor signaling pathway (GO:0030521)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|protein-DNA complex assembly (GO:0065004)|regulation of cell proliferation (GO:0042127)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.R245L(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)	24						GAACCAAAGCGACCCAGCCGA	0.378																																																	1	Substitution - Missense(1)	endometrium(1)											114.0	108.0	110.0					15																	68438944		1832	4072	5904	SO:0001583	missense	0			AF077951	CCDS45290.1	15q	2011-10-11	2002-04-19	2002-04-19		ENSG00000033800		"""Zinc fingers, MIZ-type"""	2752	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 3"""	603566	"""DEAD/H (Asp-Glu-Ala-Asp/His) box binding protein 1"""	DDXBP1		9724754, 9177271	Standard	XM_005254735		Approved	GBP, GU/RH-II, ZMIZ3	uc002aqz.3	O75925		ENST00000249636.6:c.734G>T	15.37:g.68438944G>T	ENSP00000249636:p.Arg245Leu		B2RB67|B3KSY9|C5J4B4|Q147X4|Q99751|Q9UN02	Missense_Mutation	SNP	pfam_Znf_MIZ,smart_SAP_dom,pfscan_Znf_MIZ,pfscan_SAP_dom	p.R245L	ENST00000249636.6	37	c.734	CCDS45290.1	15	.	.	.	.	.	.	.	.	.	.	G	34	5.307116	0.95629	.	.	ENSG00000033800	ENST00000249636;ENST00000545237	T;T	0.39592	1.08;1.07	5.54	5.54	0.83059	PINIT domain (1);	0.061993	0.64402	D	0.000003	T	0.71358	0.3330	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	T	0.76418	-0.2966	10	0.87932	D	0	-8.5286	19.4841	0.95022	0.0:0.0:1.0:0.0	.	245;245	C5J4B4;O75925	.;PIAS1_HUMAN	L	245;247	ENSP00000249636:R245L;ENSP00000438574:R247L	ENSP00000249636:R245L	R	+	2	0	PIAS1	66225998	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.592000	0.87571	0.650000	0.86243	CGA	PIAS1	-	NULL	ENSG00000033800		0.378	PIAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS1	HGNC	protein_coding	OTTHUMT00000419642.2		0.00	55	0	G			68438944	+1			no_errors	ENST00000249636	ensembl	human	known	74_37	missense	6.67	42	3	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	-	0.00	64	0	G			178936091	+1	tier1	rs104886003	no_errors	ENST00000263967	ensembl	human	known	74_37	missense	37.08	56	33	SNP	1.000	A
PLK5	126520	genome.wustl.edu	37	19	1533972	1533972	+	Missense_Mutation	SNP	C	C	G	rs11084897	byFrequency	TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr19:1533972C>G	ENST00000334770.4	+	12	1646	c.757C>G	c.(757-759)Ctc>Gtc	p.L253V	PLK5_ENST00000454744.2_Missense_Mutation_p.L253V			Q496M5	PLK5_HUMAN	polo-like kinase 5	253					cellular response to growth factor stimulus (GO:0071363)|defense response to tumor cell (GO:0002357)|G2 DNA damage checkpoint (GO:0031572)|mitotic nuclear division (GO:0007067)|positive regulation of neuron projection development (GO:0010976)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|transformed cell apoptotic process (GO:0006927)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)										TGGACCCGGCCTCTGCCTCCT	0.697													C|||	2033	0.40595	0.3154	0.3732	5008	,	,		12609	0.625		0.2177	False		,,,				2504	0.5194																0																																										SO:0001583	missense	0			DQ424898	CCDS59328.1	19p13.3	2012-11-19	2011-07-14	2011-07-14	ENSG00000185988	ENSG00000185988			27001	protein-coding gene	gene with protein product			"""polo-like kinase 5 pseudogene"", ""polo-like kinase 5, pseudogene"""	PLK5P		21245385	Standard	NM_001243079		Approved	SgK384ps	uc002ltf.3	Q496M5	OTTHUMG00000180073	ENST00000334770.4:c.757C>G	19.37:g.1533972C>G	ENSP00000466248:p.Leu253Val		B3KNR4|Q1ZYM0	Missense_Mutation	SNP	superfamily_Kinase-like_dom,pfscan_Prot_kinase_dom	p.L253V	ENST00000334770.4	37	c.757	CCDS59328.1	19																																																																																			PLK5	-	NULL	ENSG00000185988		0.697	PLK5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLK5	HGNC	protein_coding	OTTHUMT00000449628.1		0.00	64	0	C	NR_026557		1533972	+1			no_errors	ENST00000334770	ensembl	human	known	74_37	missense	5.26	54	3	SNP	0.983	G
POTEH	23784	genome.wustl.edu	37	22	16277955	16277955	+	Intron	SNP	A	A	G	rs4819442		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr22:16277955A>G	ENST00000343518.6	-	5	1080				POTEH-AS1_ENST00000422014.1_RNA|RNU6-816P_ENST00000390914.1_RNA	NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H											NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						TTACCAATTTAACATCTTGCC	0.338																																																	0																																										SO:0001627	intron_variant	0			AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.1029-70T>C	22.37:g.16277955A>G			A2CEK4|A6NCI1|A9Z1W0	RNA	SNP	-	NULL	ENST00000343518.6	37	NULL	CCDS46658.1	22																																																																																			POTEH-AS1	-	-	ENSG00000236666		0.338	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEH-AS1	HGNC	protein_coding	OTTHUMT00000276918.4	-	0.00	28	0	A	NM_001136213		16277955	+1	tier1	-	no_errors	ENST00000422014	ensembl	human	known	74_37	rna	13.51	32	5	SNP	0.004	G
PRAM1	84106	genome.wustl.edu	37	19	8563824	8563824	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr19:8563824G>T	ENST00000423345.4	-	2	1388	c.868C>A	c.(868-870)Ctt>Att	p.L290I	PRAM1_ENST00000255612.3_Missense_Mutation_p.L290I			Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	338	Pro-rich.				integrin-mediated signaling pathway (GO:0007229)|regulation of neutrophil degranulation (GO:0043313)		lipid binding (GO:0008289)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)	19						AGGTCCCCAAGCTCAGGCTGC	0.647																																																	0													28.0	31.0	30.0					19																	8563824		2192	4297	6489	SO:0001583	missense	0			BC028012	CCDS45954.1, CCDS45954.2	19p13.2	2009-01-21				ENSG00000133246			30091	protein-coding gene	gene with protein product		606466				11301322, 15572693	Standard	NM_032152		Approved	PML-RAR	uc002mkd.3	Q96QH2		ENST00000423345.4:c.868C>A	19.37:g.8563824G>T	ENSP00000408342:p.Leu290Ile		Q8N6W7	Missense_Mutation	SNP	superfamily_SH3_domain	p.L290I	ENST00000423345.4	37	c.868	CCDS45954.2	19	.	.	.	.	.	.	.	.	.	.	G	7.309	0.614623	0.14129	.	.	ENSG00000133246	ENST00000255612;ENST00000423345	T;T	0.14391	2.51;2.51	4.12	-2.13	0.07144	.	1.312210	0.05361	N	0.533604	T	0.07324	0.0185	N	0.14661	0.345	0.09310	N	1	B;B	0.30236	0.228;0.274	B;B	0.30179	0.083;0.112	T	0.38520	-0.9657	10	0.20046	T	0.44	.	5.8605	0.18745	0.4483:0.147:0.4047:0.0	.	290;338	Q96QH2-2;Q96QH2	.;PRAM_HUMAN	I	290	ENSP00000255612:L290I;ENSP00000408342:L290I	ENSP00000255612:L290I	L	-	1	0	PRAM1	8469824	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.653000	0.05360	-0.501000	0.06605	-1.099000	0.02127	CTT	PRAM1	-	NULL	ENSG00000133246		0.647	PRAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRAM1	HGNC	protein_coding	OTTHUMT00000397040.3	-	0.00	39	0	G	NM_032152		8563824	-1	tier1	-	no_errors	ENST00000423345	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.000	T
PRSS12	8492	genome.wustl.edu	37	4	119252994	119252994	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr4:119252994G>T	ENST00000296498.3	-	4	1130	c.848C>A	c.(847-849)gCt>gAt	p.A283D		NM_003619.3	NP_003610.2	P56730	NETR_HUMAN	protease, serine, 12 (neurotrypsin, motopsin)	283	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				exocytosis (GO:0006887)|zymogen activation (GO:0031638)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)|terminal bouton (GO:0043195)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(3)|kidney(1)|large_intestine(9)|lung(11)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	29						GCTGCCTCCAGCAAGGCGAAT	0.473																																																	0													78.0	71.0	73.0					4																	119252994		2203	4300	6503	SO:0001583	missense	0			AJ001531	CCDS3709.1	4q25-q26	2010-05-07			ENSG00000164099	ENSG00000164099		"""Serine peptidases / Serine peptidases"""	9477	protein-coding gene	gene with protein product		606709				9540828, 9245503	Standard	NM_003619		Approved	BSSP-3, MRT1	uc003ica.2	P56730	OTTHUMG00000161166	ENST00000296498.3:c.848C>A	4.37:g.119252994G>T	ENSP00000296498:p.Ala283Asp		Q9UP16	Missense_Mutation	SNP	pfam_SRCR,pfam_Peptidase_S1,pfam_Kringle,superfamily_Trypsin-like_Pept_dom,superfamily_Srcr_rcpt-rel,superfamily_Kringle-like,smart_Kringle,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_Kringle,pfscan_SRCR,pfscan_Peptidase_S1,prints_SRCR,prints_Peptidase_S1A	p.A283D	ENST00000296498.3	37	c.848	CCDS3709.1	4	.	.	.	.	.	.	.	.	.	.	G	14.82	2.649359	0.47362	.	.	ENSG00000164099	ENST00000296498	T	0.29917	1.55	6.04	-7.84	0.01196	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.949521	0.08766	N	0.896946	T	0.38639	0.1048	M	0.75615	2.305	0.09310	N	1	B	0.29590	0.25	B	0.42462	0.388	T	0.58014	-0.7711	10	0.66056	D	0.02	.	11.2858	0.49220	0.6134:0.0:0.3034:0.0832	.	283	P56730	NETR_HUMAN	D	283	ENSP00000296498:A283D	ENSP00000296498:A283D	A	-	2	0	PRSS12	119472442	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.436000	0.21526	-1.490000	0.01842	-1.300000	0.01332	GCT	PRSS12	-	superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	ENSG00000164099		0.473	PRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS12	HGNC	protein_coding	OTTHUMT00000256516.2	-	0.00	32	0	G			119252994	-1	tier1	-	no_errors	ENST00000296498	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.000	T
PRSS22	64063	genome.wustl.edu	37	16	2905760	2905760	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr16:2905760C>G	ENST00000161006.3	-	4	439	c.374G>C	c.(373-375)tGg>tCg	p.W125S	LA16c-325D7.1_ENST00000577140.1_RNA|PRSS22_ENST00000571228.1_Intron|PRSS22_ENST00000574768.1_5'UTR	NM_022119.3	NP_071402.1	Q9GZN4	BSSP4_HUMAN	protease, serine, 22	125	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(2)|skin(2)	10						GGGCTCCACCCAGGCAACACC	0.612																																																	0													59.0	59.0	59.0					16																	2905760		2198	4300	6498	SO:0001583	missense	0			AF321182	CCDS10481.1	16p13.3	2010-05-07			ENSG00000005001	ENSG00000005001		"""Serine peptidases / Serine peptidases"""	14368	protein-coding gene	gene with protein product	"""brain-specific serine protease 4"""	609343				11602603, 15701722	Standard	XM_005255473		Approved	hBSSP-4, BSSP-4, SP001LA	uc002cry.1	Q9GZN4	OTTHUMG00000128961	ENST00000161006.3:c.374G>C	16.37:g.2905760C>G	ENSP00000161006:p.Trp125Ser		O43342|Q6UXE0	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1	p.W125S	ENST00000161006.3	37	c.374	CCDS10481.1	16	.	.	.	.	.	.	.	.	.	.	c	1.172	-0.640687	0.03557	.	.	ENSG00000005001	ENST00000161006	T	0.80123	-1.34	4.48	2.48	0.30137	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.628475	0.14319	N	0.327136	T	0.38612	0.1047	N	0.00125	-2.05	0.80722	D	1	B	0.17268	0.021	B	0.18871	0.023	T	0.37619	-0.9698	10	0.11182	T	0.66	.	5.6073	0.17387	0.0:0.6886:0.2035:0.1079	.	125	Q9GZN4	BSSP4_HUMAN	S	125	ENSP00000161006:W125S	ENSP00000161006:W125S	W	-	2	0	PRSS22	2845761	0.002000	0.14202	0.998000	0.56505	0.924000	0.55760	0.138000	0.16016	1.163000	0.42636	0.555000	0.69702	TGG	PRSS22	-	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000005001		0.612	PRSS22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS22	HGNC	protein_coding	OTTHUMT00000250943.1	-	0.00	22	0	C	NM_022119		2905760	-1	tier1	-	no_errors	ENST00000161006	ensembl	human	known	74_37	missense	15.15	28	5	SNP	0.996	G
PTPRK	5796	genome.wustl.edu	37	6	128294905	128294905	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr6:128294905G>T	ENST00000368215.3	-	28	4033	c.4034C>A	c.(4033-4035)cCt>cAt	p.P1345H	PTPRK_ENST00000368226.4_Missense_Mutation_p.P1346H|PTPRK_ENST00000368227.3_Missense_Mutation_p.P1363H|PTPRK_ENST00000368213.5_Missense_Mutation_p.P1352H|PTPRK_ENST00000368207.3_Missense_Mutation_p.P1378H|PTPRK_ENST00000368210.3_Missense_Mutation_p.P1364H|PTPRK_ENST00000532331.1_Missense_Mutation_p.P1368H			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	1345	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		TTTGGATCCAGGCACTTCTCG	0.478																																																	0													126.0	115.0	119.0					6																	128294905		2203	4300	6503	SO:0001583	missense	0			L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.4034C>A	6.37:g.128294905G>T	ENSP00000357198:p.Pro1345His		B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.P1363H	ENST00000368215.3	37	c.4088		6	.	.	.	.	.	.	.	.	.	.	G	29.5	5.008267	0.93346	.	.	ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207	T;T;T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59;1.59;1.59	5.82	5.82	0.92795	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	T	0.72622	0.3483	H	0.99261	4.49	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	D	0.84547	0.0642	10	0.87932	D	0	.	20.0789	0.97764	0.0:0.0:1.0:0.0	.	1368;1352;1345;1346	B7ZMG0;Q15262-3;Q15262;Q15262-2	.;.;PTPRK_HUMAN;.	H	1346;1363;1368;1352;1364;1345;1378	ENSP00000357209:P1346H;ENSP00000357210:P1363H;ENSP00000432973:P1368H;ENSP00000357196:P1352H;ENSP00000357193:P1364H;ENSP00000357198:P1345H;ENSP00000357190:P1378H	ENSP00000357190:P1378H	P	-	2	0	PTPRK	128336598	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.810000	0.99221	2.750000	0.94351	0.655000	0.94253	CCT	PTPRK	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000152894		0.478	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	PTPRK	HGNC	protein_coding	OTTHUMT00000042163.1		0.00	43	0	G			128294905	-1			no_errors	ENST00000368227	ensembl	human	known	74_37	missense	5.08	54	3	SNP	1.000	T
RASGRP2	10235	genome.wustl.edu	37	11	64497626	64497626	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr11:64497626G>T	ENST00000354024.3	-	13	1705	c.1453C>A	c.(1453-1455)Ctg>Atg	p.L485M	RASGRP2_ENST00000377494.1_Missense_Mutation_p.L485M|RASGRP2_ENST00000394432.3_Missense_Mutation_p.L485M|RASGRP2_ENST00000377497.3_Missense_Mutation_p.L485M	NM_153819.1	NP_722541.1	Q7LDG7	GRP2_HUMAN	RAS guanyl releasing protein 2 (calcium and DAG-regulated)	485	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				blood coagulation (GO:0007596)|cellular response to calcium ion (GO:0071277)|platelet activation (GO:0030168)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CTGGAGCGCAGGAAATAGGAA	0.647																																																	0													27.0	26.0	26.0					11																	64497626		2038	3990	6028	SO:0001583	missense	0			U78170	CCDS31598.1	11q13	2014-09-17			ENSG00000068831	ENSG00000068831		"""EF-hand domain containing"""	9879	protein-coding gene	gene with protein product		605577				9789079	Standard	NM_001098670		Approved	CALDAG-GEFI	uc009ypv.3	Q7LDG7	OTTHUMG00000045420	ENST00000354024.3:c.1453C>A	11.37:g.64497626G>T	ENSP00000338864:p.Leu485Met		A6NDC7|O00538|Q9UL65	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_EF_hand_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.L485M	ENST00000354024.3	37	c.1453	CCDS31598.1	11	.	.	.	.	.	.	.	.	.	.	G	10.35	1.326056	0.24080	.	.	ENSG00000068831	ENST00000377494;ENST00000394432;ENST00000377497;ENST00000354024	T;T;T;T	0.56444	0.46;0.46;0.46;0.46	4.46	1.51	0.23008	EF-hand-like domain (1);	0.133235	0.50627	N	0.000116	T	0.29588	0.0738	N	0.17800	0.525	0.80722	D	1	B;B	0.13594	0.008;0.008	B;B	0.13407	0.009;0.009	T	0.04178	-1.0971	10	0.18276	T	0.48	-22.3423	5.4453	0.16531	0.18:0.0:0.6593:0.1607	.	485;485	Q7LDG7;A6NDC7	GRP2_HUMAN;.	M	485	ENSP00000366714:L485M;ENSP00000377953:L485M;ENSP00000366717:L485M;ENSP00000338864:L485M	ENSP00000338864:L485M	L	-	1	2	RASGRP2	64254202	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.170000	0.42443	0.228000	0.21019	-0.291000	0.09656	CTG	RASGRP2	-	smart_EF_hand_dom	ENSG00000068831		0.647	RASGRP2-002	NOVEL	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	RASGRP2	HGNC	protein_coding	OTTHUMT00000142062.1		0.00	34	0	G	NM_153819		64497626	-1			no_errors	ENST00000377494	ensembl	human	known	74_37	missense	6.67	55	4	SNP	1.000	T
RBBP8	5932	genome.wustl.edu	37	18	20596862	20596862	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr18:20596862G>T	ENST00000399722.2	+	17	2780	c.2429G>T	c.(2428-2430)gGg>gTg	p.G810V	RBBP8_ENST00000327155.5_Missense_Mutation_p.G810V|RBBP8_ENST00000360790.5_Missense_Mutation_p.G815V|RBBP8_ENST00000581687.1_5'UTR|RBBP8_ENST00000399725.2_Intron	NM_203291.1	NP_976036.1	Q99708	COM1_HUMAN	retinoblastoma binding protein 8	810					blastocyst hatching (GO:0001835)|cell cycle checkpoint (GO:0000075)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|G2 DNA damage checkpoint (GO:0031572)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	damaged DNA binding (GO:0003684)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)	p.G810V(1)		central_nervous_system(1)|cervix(2)|endometrium(5)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	24	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			AAACTGCTTGGGCACACGTGT	0.318								Homologous recombination																																									1	Substitution - Missense(1)	endometrium(1)											107.0	109.0	108.0					18																	20596862		2203	4300	6503	SO:0001583	missense	0			AF043431	CCDS11874.1, CCDS11875.1	18q11.2	2012-11-05	2001-11-28		ENSG00000101773	ENSG00000101773			9891	protein-coding gene	gene with protein product	"""CTBP-interacting protein"""	604124	"""retinoblastoma-binding protein 8"", ""Seckel syndrome 2"""	SCKL2		9721205, 17965729, 21998596	Standard	NM_002894		Approved	CtIP, RIM, COM1	uc002ktw.3	Q99708	OTTHUMG00000131769	ENST00000399722.2:c.2429G>T	18.37:g.20596862G>T	ENSP00000382628:p.Gly810Val		A6NKN2|A8K8W6|E7ETY1|O75371|Q8NHQ3	Missense_Mutation	SNP	pfam_CtIP_N,pfam_DNA-repair_Sae2/CtIP	p.G810V	ENST00000399722.2	37	c.2429	CCDS11875.1	18	.	.	.	.	.	.	.	.	.	.	g	21.1	4.093801	0.76870	.	.	ENSG00000101773	ENST00000327155;ENST00000399722;ENST00000360790	T;T;T	0.63096	-0.02;-0.02;-0.01	5.33	4.46	0.54185	.	0.110694	0.64402	D	0.000008	T	0.80783	0.4689	M	0.86502	2.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84031	0.0359	10	0.87932	D	0	-7.3178	13.0342	0.58860	0.0777:0.0:0.9223:0.0	.	815;810	E7ETY1;Q99708	.;COM1_HUMAN	V	810;810;815	ENSP00000323050:G810V;ENSP00000382628:G810V;ENSP00000354024:G815V	ENSP00000323050:G810V	G	+	2	0	RBBP8	18850860	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.252000	0.78309	1.253000	0.44018	0.637000	0.83480	GGG	RBBP8	-	pfam_DNA-repair_Sae2/CtIP	ENSG00000101773		0.318	RBBP8-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RBBP8	HGNC	protein_coding	OTTHUMT00000446387.1	-	0.00	40	0	G	NM_203291		20596862	+1	tier1	-	no_errors	ENST00000327155	ensembl	human	known	74_37	missense	16.13	26	5	SNP	1.000	T
ROCK2	9475	genome.wustl.edu	37	2	11351835	11351835	+	Silent	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr2:11351835G>A	ENST00000315872.6	-	18	2623	c.2175C>T	c.(2173-2175)atC>atT	p.I725I	ROCK2_ENST00000401753.1_Silent_p.I482I	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	725	Interaction with PPP1R12A.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		TGGCTTCTTCGATGGACTCAT	0.388																																																	0													207.0	185.0	192.0					2																	11351835		1866	4104	5970	SO:0001819	synonymous_variant	0			D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.2175C>T	2.37:g.11351835G>A			Q53QZ0|Q53SJ7|Q9UQN5	Silent	SNP	pfam_Prot_kinase_dom,pfam_Rho-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_tRNA-bd_arm,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Rho-assoc_coiled-coil_kin,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.I725	ENST00000315872.6	37	c.2175	CCDS42654.1	2																																																																																			ROCK2	-	pirsf_Rho-assoc_coiled-coil_kin	ENSG00000134318		0.388	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROCK2	HGNC	protein_coding	OTTHUMT00000313886.3	-	0.00	89	0	G			11351835	-1	tier1	-	no_errors	ENST00000315872	ensembl	human	known	74_37	silent	14.58	81	14	SNP	0.995	A
RPF2	84154	genome.wustl.edu	37	6	111336995	111336995	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr6:111336995G>T	ENST00000441448.2	+	8	624	c.532G>T	c.(532-534)Gct>Tct	p.A178S		NM_032194.1	NP_115570.1	Q9H7B2	RPF2_HUMAN	ribosome production factor 2 homolog (S. cerevisiae)	178	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|ovary(2)	7						TATCCGCCTGGCTGGATTAGA	0.338																																																	0													91.0	93.0	93.0					6																	111336995		2203	4300	6503	SO:0001583	missense	0			AK024740	CCDS5088.1	6q21	2009-09-25	2009-09-25	2009-09-25	ENSG00000197498	ENSG00000197498			20870	protein-coding gene	gene with protein product	"""ribosomal processing factor 2 homolog (S. cerevisiae)"""		"""brix domain containing 1"""	BXDC1		12048200	Standard	NM_032194		Approved	FLJ21087, bA397G5.4	uc003pun.3	Q9H7B2	OTTHUMG00000015368	ENST00000441448.2:c.532G>T	6.37:g.111336995G>T	ENSP00000402338:p.Ala178Ser		Q5VXN1|Q8N4A1	Missense_Mutation	SNP	pfam_Brix,superfamily_Anticodon-bd,smart_Brix,pfscan_Brix	p.A178S	ENST00000441448.2	37	c.532	CCDS5088.1	6	.	.	.	.	.	.	.	.	.	.	g	12.95	2.090804	0.36855	.	.	ENSG00000197498	ENST00000441448;ENST00000368864;ENST00000425871	T;T;T	0.21191	2.02;2.02;2.02	5.71	5.71	0.89125	Brix domain (3);	0.000000	0.85682	D	0.000000	T	0.20861	0.0502	M	0.70842	2.15	0.80722	D	1	P;P	0.40681	0.727;0.727	B;B	0.41691	0.314;0.364	T	0.01604	-1.1314	10	0.33141	T	0.24	-15.4875	19.8493	0.96733	0.0:0.0:1.0:0.0	.	178;178	A8K800;Q9H7B2	.;RPF2_HUMAN	S	178;139;145	ENSP00000402338:A178S;ENSP00000357857:A139S;ENSP00000414026:A145S	ENSP00000357857:A139S	A	+	1	0	RPF2	111443688	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.348000	0.97062	2.701000	0.92244	0.563000	0.77884	GCT	RPF2	-	pfam_Brix,superfamily_Anticodon-bd,smart_Brix,pfscan_Brix	ENSG00000197498		0.338	RPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPF2	HGNC	protein_coding	OTTHUMT00000041813.2		0.00	39	0	G	NM_032194		111336995	+1			no_errors	ENST00000441448	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
SATL1	340562	genome.wustl.edu	37	X	84362459	84362459	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chrX:84362459G>C	ENST00000395409.3	-	1	1515	c.955C>G	c.(955-957)Ctg>Gtg	p.L319V	SATL1_ENST00000332921.5_Missense_Mutation_p.L319V|SATL1_ENST00000509231.1_Missense_Mutation_p.L506V			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	319	Gln-rich.						N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						GGTTGACTCAGGCCTGGTTGG	0.557																																																	0													130.0	108.0	116.0					X																	84362459		2203	4300	6503	SO:0001583	missense	0			BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.955C>G	X.37:g.84362459G>C	ENSP00000378804:p.Leu319Val		A0AVK7|E9PB72|Q5H8V9	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase	p.L506V	ENST00000395409.3	37	c.1516		X	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.710072	0.00712	.	.	ENSG00000184788	ENST00000395409;ENST00000332921;ENST00000509231	T;T;T	0.40476	1.03;1.03;1.03	3.29	-6.58	0.01836	.	.	.	.	.	T	0.21674	0.0522	L	0.50333	1.59	0.09310	N	1	P;B	0.35328	0.495;0.112	B;B	0.25987	0.065;0.019	T	0.28073	-1.0055	9	0.08381	T	0.77	4.4435	3.7044	0.08394	0.1134:0.1923:0.5095:0.1849	.	319;506	Q86VE3;E9PB72	SATL1_HUMAN;.	V	319;319;506	ENSP00000378804:L319V;ENSP00000329115:L319V;ENSP00000425421:L506V	ENSP00000329115:L319V	L	-	1	2	SATL1	84249115	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.879000	0.04188	-1.695000	0.01423	-0.191000	0.12829	CTG	SATL1	-	NULL	ENSG00000184788		0.557	SATL1-202	KNOWN	basic|appris_principal	protein_coding	SATL1	HGNC	protein_coding		-	0.00	81	0	G	XM_291339		84362459	-1	tier1	-	no_errors	ENST00000509231	ensembl	human	known	74_37	missense	33.33	66	33	SNP	0.000	C
SERPINB11	89778	genome.wustl.edu	37	18	61377507	61377507	+	RNA	SNP	A	A	C			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr18:61377507A>C	ENST00000382749.5	+	0	325				SERPINB11_ENST00000536691.1_RNA|SERPINB11_ENST00000538847.1_RNA|SERPINB11_ENST00000544088.1_RNA|SERPINB11_ENST00000489748.1_RNA			Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 11 (gene/pseudogene)						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|kidney(1)|lung(3)	6		Esophageal squamous(42;0.129)				ATAGGAGATAACATCTTCTTT	0.448																																					Ovarian(27;496 784 5942 8975 23930)												0													126.0	117.0	120.0					18																	61377507		1925	4151	6076			0					18q21.33	2014-02-18	2009-01-22		ENSG00000206072	ENSG00000206072		"""Serine (or cysteine) peptidase inhibitors"""	14221	protein-coding gene	gene with protein product		615682	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11"", ""serpin peptidase inhibitor, clade B (ovalbumin), member 11"""			17562709, 24172014	Standard	XM_006722569		Approved	EPIPIN	uc002ljk.4	Q96P15	OTTHUMG00000060404		18.37:g.61377507A>C			A8K9R0|Q5Q120|Q5Q121|Q5Q122|Q5Q123|Q6ISD3|Q96P13|Q96P14	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.N27T	ENST00000382749.5	37	c.80		18	.	.	.	.	.	.	.	.	.	.	A	16.14	3.039561	0.55003	.	.	ENSG00000206072	ENST00000544088;ENST00000538847	D;D	0.91894	-2.93;-2.93	5.14	5.14	0.70334	Serpin domain (3);	0.000000	0.53938	D	0.000043	D	0.97093	0.9050	H	0.95043	3.615	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.85130	0.991;0.997	D	0.98021	1.0371	10	0.87932	D	0	.	13.1919	0.59715	1.0:0.0:0.0:0.0	.	27;27	F5GY69;Q96P15	.;SPB11_HUMAN	T	27	ENSP00000441497:N27T;ENSP00000440795:N27T	ENSP00000421854:N27T	N	+	2	0	SERPINB11	59528487	0.999000	0.42202	0.943000	0.38184	0.362000	0.29581	6.068000	0.71201	2.051000	0.60960	0.533000	0.62120	AAC	SERPINB11	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000206072		0.448	SERPINB11-002	KNOWN	basic	polymorphic_pseudogene	SERPINB11	HGNC	polymorphic_pseudogene	OTTHUMT00000207392.3		0.00	51	0	A	NM_080475		61377507	+1			no_errors	ENST00000538847	ensembl	human	known	74_37	missense	5.36	53	3	SNP	0.975	C
SLTM	79811	genome.wustl.edu	37	15	59189346	59189346	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr15:59189346C>G	ENST00000380516.2	-	9	1282	c.1195G>C	c.(1195-1197)Gat>Cat	p.D399H	SLTM_ENST00000536328.1_5'UTR	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	399	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TTCTTCAAATCAGCAGCTTTG	0.348																																																	0													106.0	103.0	104.0					15																	59189346		2192	4291	6483	SO:0001583	missense	0			BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.1195G>C	15.37:g.59189346C>G	ENSP00000369887:p.Asp399His		A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SAP_dom,smart_SAP_dom,smart_RRM_dom,pfscan_SAP_dom,pfscan_RRM_dom	p.D399H	ENST00000380516.2	37	c.1195	CCDS10168.2	15	.	.	.	.	.	.	.	.	.	.	C	25.2	4.614528	0.87359	.	.	ENSG00000137776	ENST00000380516;ENST00000249736	T;T	0.77877	-1.13;-1.13	5.67	5.67	0.87782	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.56097	D	0.000033	D	0.89856	0.6836	M	0.87682	2.9	0.80722	D	1	D	0.89917	1.0	D	0.68943	0.961	D	0.90973	0.4821	10	0.87932	D	0	.	19.7775	0.96400	0.0:1.0:0.0:0.0	.	399	Q9NWH9	SLTM_HUMAN	H	399;381	ENSP00000369887:D399H;ENSP00000249736:D381H	ENSP00000249736:D381H	D	-	1	0	SLTM	56976638	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.680000	0.91292	0.655000	0.94253	GAT	SLTM	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000137776		0.348	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLTM	HGNC	protein_coding	OTTHUMT00000157124.1	-	0.00	47	0	C	NM_024755		59189346	-1	tier1	-	no_errors	ENST00000380516	ensembl	human	known	74_37	missense	9.86	64	7	SNP	1.000	G
SMARCA2	6595	genome.wustl.edu	37	9	2039777	2039779	+	In_Frame_Del	DEL	CAG	CAG	-	rs376509101|rs62639301	byFrequency	TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr9:2039777_2039779delCAG	ENST00000382203.1	+	4	876_878	c.667_669delCAG	c.(667-669)cagdel	p.Q238del	SMARCA2_ENST00000349721.2_In_Frame_Del_p.Q238del|SMARCA2_ENST00000382194.1_In_Frame_Del_p.Q238del|SMARCA2_ENST00000357248.2_In_Frame_Del_p.Q238del|SMARCA2_ENST00000491574.1_3'UTR|RP11-264I13.2_ENST00000426860.1_RNA			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	238	Poly-Gln.			Missing (in Ref. 1; CAA51407). {ECO:0000305}.	aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		gcagcagcaacagcagcagcagc	0.635																																																	0																																										SO:0001651	inframe_deletion	0			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.667_669delCAG	9.37:g.2039786_2039788delCAG	ENSP00000371638:p.Gln238del		B1ALG3|B1ALG4|D3DRH4|D3DRH5	In_Frame_Del	DEL	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_P-loop_NTPase,superfamily_Bromodomain,superfamily_RNaseH-like_dom,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain,prints_Bromodomain	p.Q226in_frame_del	ENST00000382203.1	37	c.667_669	CCDS34977.1	9																																																																																			SMARCA2	-	NULL	ENSG00000080503		0.635	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	SMARCA2	HGNC	protein_coding	OTTHUMT00000051505.1		0.00	54	0	CAG	NM_003070		2039779	+1	tier1		no_errors	ENST00000349721	ensembl	human	known	74_37	in_frame_del	11.59	61	8	DEL	0.310:0.494:0.625	-
SNRNP40	9410	genome.wustl.edu	37	1	31732603	31732603	+	3'UTR	DEL	A	A	-	rs59591825		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr1:31732603delA	ENST00000263694.4	-	0	1408				SNRNP40_ENST00000373720.3_3'UTR|SNRNP40_ENST00000489853.1_5'UTR	NM_004814.2	NP_004805.2	Q96DI7	SNR40_HUMAN	small nuclear ribonucleoprotein 40kDa (U5)						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	7						AGCCAGTTACAAAAAAAAAAA	0.299																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF090988	CCDS340.1	1p35.2	2013-01-09	2008-10-29	2008-10-29	ENSG00000060688	ENSG00000060688		"""WD repeat domain containing"""	30857	protein-coding gene	gene with protein product		607797	"""WD repeat domain 57 (U5 snRNP specific)"""	WDR57		9774689, 9731529, 10788320	Standard	NM_004814		Approved	PRP8BP, SPF38, PRPF8BP, HPRP8BP	uc009vtt.3	Q96DI7	OTTHUMG00000003790	ENST00000263694.4:c.*316T>-	1.37:g.31732603delA			B4DQJ1|O75938|O95320	RNA	DEL	-	NULL	ENST00000263694.4	37	NULL	CCDS340.1	1																																																																																			SNRNP40	-	-	ENSG00000060688		0.299	SNRNP40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP40	HGNC	protein_coding	OTTHUMT00000010657.1		0.00	19	0	A	NM_004814		31732603	-1	tier1		no_errors	ENST00000486941	ensembl	human	known	74_37	rna	25.00	15	5	DEL	0.000	-
SOWAHA	134548	genome.wustl.edu	37	5	132149509	132149509	+	Missense_Mutation	SNP	G	G	A	rs369609147		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr5:132149509G>A	ENST00000378693.2	+	1	477	c.196G>A	c.(196-198)Gcg>Acg	p.A66T		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	66																	CAACAACGTGGCGGTGGTGAA	0.726																																																	0								G	THR/ALA	0,3076		0,0,1538	19.0	29.0	26.0		196	4.5	1.0	5		26	2,6264		0,2,3131	no	missense	ANKRD43	NM_175873.4	58	0,2,4669	AA,AG,GG		0.0319,0.0,0.0214	possibly-damaging	66/550	132149509	2,9340	1538	3133	4671	SO:0001583	missense	0			AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.196G>A	5.37:g.132149509G>A	ENSP00000367965:p.Ala66Thr		Q8NAE7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A66T	ENST00000378693.2	37	c.196	CCDS43361.1	5	.	.	.	.	.	.	.	.	.	.	g	25.6	4.656449	0.88154	0.0	3.19E-4	ENSG00000198944	ENST00000378693	T	0.39787	1.06	4.53	4.53	0.55603	.	0.169921	0.35677	U	0.003052	T	0.63663	0.2530	M	0.70275	2.135	0.44789	D	0.997798	D	0.89917	1.0	D	0.77004	0.989	T	0.68812	-0.5310	10	0.72032	D	0.01	.	15.8636	0.79043	0.0:0.0:1.0:0.0	.	66	Q2M3V2	ANR43_HUMAN	T	66	ENSP00000367965:A66T	ENSP00000367965:A66T	A	+	1	0	ANKRD43	132177408	1.000000	0.71417	1.000000	0.80357	0.060000	0.15804	5.199000	0.65152	2.069000	0.61940	0.290000	0.19541	GCG	SOWAHA	-	NULL	ENSG00000198944		0.726	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOWAHA	HGNC	protein_coding	OTTHUMT00000133062.1	-	0.00	8	0	G	NM_175873		132149509	+1	tier1	-	no_errors	ENST00000378693	ensembl	human	known	74_37	missense	45.45	6	5	SNP	1.000	A
SUPT6H	6830	genome.wustl.edu	37	17	27002030	27002030	+	Missense_Mutation	SNP	G	G	T	rs376272646		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr17:27002030G>T	ENST00000314616.6	+	5	671	c.388G>T	c.(388-390)Gat>Tat	p.D130Y	SUPT6H_ENST00000347486.4_Missense_Mutation_p.D130Y|AC010761.13_ENST00000578819.1_RNA	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	130	Asp/Glu-rich.|Interaction with IWS1. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D130Y(1)		NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					TGACGAGGACGATGACGAGGA	0.498																																																	1	Substitution - Missense(1)	lung(1)											92.0	84.0	87.0					17																	27002030		2203	4300	6503	SO:0001583	missense	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.388G>T	17.37:g.27002030G>T	ENSP00000319104:p.Asp130Tyr		A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_SH2,superfamily_NA-bd_OB-fold,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,smart_SH2,pirsf_TF_Spt6,pfscan_SH2,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.D130Y	ENST00000314616.6	37	c.388	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	G	16.57	3.161209	0.57368	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	.	.	.	5.41	5.41	0.78517	.	0.046129	0.85682	D	0.000000	T	0.74809	0.3765	M	0.65975	2.015	0.80722	D	1	D	0.60575	0.988	P	0.56088	0.791	T	0.77446	-0.2585	9	0.87932	D	0	-24.5167	19.558	0.95361	0.0:0.0:1.0:0.0	.	130	Q7KZ85	SPT6H_HUMAN	Y	130	.	ENSP00000319104:D130Y	D	+	1	0	SUPT6H	24026157	1.000000	0.71417	0.961000	0.40146	0.628000	0.37860	7.049000	0.76613	2.697000	0.92050	0.655000	0.94253	GAT	SUPT6H	-	pirsf_TF_Spt6	ENSG00000109111		0.498	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SUPT6H	HGNC	protein_coding	OTTHUMT00000446422.2	-	0.00	37	0	G	NM_003170		27002030	+1	tier1	-	no_errors	ENST00000314616	ensembl	human	known	74_37	missense	15.38	55	10	SNP	1.000	T
TAF5L	27097	genome.wustl.edu	37	1	229730759	229730759	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr1:229730759G>A	ENST00000366676.1	-	4	1054	c.1055C>T	c.(1054-1056)gCg>gTg	p.A352V	TAF5L_ENST00000258281.2_Missense_Mutation_p.A352V			O75529	TAF5L_HUMAN	TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	352					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)	11	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)				TGAGCTGTCCGCGAGGAACCT	0.537																																																	0													112.0	99.0	103.0					1																	229730759		2203	4300	6503	SO:0001583	missense	0			AF069736	CCDS1581.1, CCDS31051.1	1q42.11-q42.3	2013-01-10	2002-08-29		ENSG00000135801	ENSG00000135801		"""WD repeat domain containing"""	17304	protein-coding gene	gene with protein product	"""PCAF associated factor 65 beta"""		"""TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425, 11124703	Standard	XM_005273100		Approved	PAF65B	uc001htq.3	O75529	OTTHUMG00000039463	ENST00000366676.1:c.1055C>T	1.37:g.229730759G>A	ENSP00000355636:p.Ala352Val		Q5TDI5|Q5TDI6|Q8IW31	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_TFIID-su_WD40-assoc_reg,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A352V	ENST00000366676.1	37	c.1055	CCDS1581.1	1	.	.	.	.	.	.	.	.	.	.	G	18.83	3.707888	0.68615	.	.	ENSG00000135801	ENST00000366676;ENST00000258281	T;T	0.60299	0.2;0.2	5.88	5.88	0.94601	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.353879	0.33235	N	0.005127	T	0.60689	0.2288	M	0.64997	1.995	0.49483	D	0.99979	B	0.22080	0.064	B	0.22386	0.039	T	0.57854	-0.7739	10	0.66056	D	0.02	-0.5473	20.2422	0.98381	0.0:0.0:1.0:0.0	.	352	O75529	TAF5L_HUMAN	V	352	ENSP00000355636:A352V;ENSP00000258281:A352V	ENSP00000258281:A352V	A	-	2	0	TAF5L	227797382	1.000000	0.71417	0.092000	0.20876	0.852000	0.48524	9.860000	0.99555	2.782000	0.95742	0.655000	0.94253	GCG	TAF5L	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000135801		0.537	TAF5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF5L	HGNC	protein_coding	OTTHUMT00000095229.1	-	0.00	45	0	G	NM_014409		229730759	-1	tier1	-	no_errors	ENST00000258281	ensembl	human	known	74_37	missense	14.29	48	8	SNP	0.924	A
TAS2R31	259290	genome.wustl.edu	37	12	11183296	11183296	+	Silent	SNP	A	A	G	rs370468039		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr12:11183296A>G	ENST00000390675.2	-	1	710	c.639T>C	c.(637-639)ggT>ggC	p.G213G	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	213					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|lung(6)	7						GAGATCCTTTACCATGGAGCT	0.423																																																	0													150.0	155.0	154.0					12																	11183296		2203	4300	6503	SO:0001819	synonymous_variant	0			AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538		ENST00000390675.2:c.639T>C	12.37:g.11183296A>G			P59547|Q17R84|Q645X5	Silent	SNP	pfam_TAS2_rcpt	p.G213	ENST00000390675.2	37	c.639	CCDS53747.1	12																																																																																			TAS2R31	-	pfam_TAS2_rcpt	ENSG00000256436		0.423	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R31	HGNC	protein_coding	OTTHUMT00000400233.1		0.00	71	0	A	NM_176885		11183296	-1			no_errors	ENST00000390675	ensembl	human	known	74_37	silent	5.21	91	5	SNP	0.000	G
TBC1D4	9882	genome.wustl.edu	37	13	75869023	75869023	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr13:75869023G>T	ENST00000377636.3	-	18	3629	c.3283C>A	c.(3283-3285)Cag>Aag	p.Q1095K	TBC1D4_ENST00000425511.1_Missense_Mutation_p.Q259K|TBC1D4_ENST00000377625.2_Missense_Mutation_p.Q1032K|TBC1D4_ENST00000431480.2_Missense_Mutation_p.Q1087K|TBC1D4_ENST00000478591.1_5'UTR	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	1095	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)	p.Q1095E(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		AATGAAAACTGAGAGGCAAAC	0.388																																																	1	Substitution - Missense(1)	cervix(1)											68.0	67.0	68.0					13																	75869023		1912	4164	6076	SO:0001583	missense	0			AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.3283C>A	13.37:g.75869023G>T	ENSP00000366863:p.Gln1095Lys		A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_DUF3350,pfam_PTB/PI_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTB/PI_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTB/PI_dom,pfscan_Rab-GTPase-TBC_dom	p.Q1095K	ENST00000377636.3	37	c.3283	CCDS41901.1	13	.	.	.	.	.	.	.	.	.	.	G	34	5.377005	0.95945	.	.	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625;ENST00000425511	T;T;T;T	0.21543	2.0;2.0;2.0;2.0	5.55	5.55	0.83447	Rab-GAP/TBC domain (4);	0.000000	0.64402	D	0.000003	T	0.37972	0.1023	L	0.35288	1.05	0.80722	D	1	D;D;P;D	0.76494	0.991;0.991;0.95;0.999	P;P;P;D	0.77004	0.757;0.89;0.522;0.989	T	0.03993	-1.0986	10	0.41790	T	0.15	-23.5218	19.5156	0.95162	0.0:0.0:1.0:0.0	.	259;1032;1087;1095	O60343-4;O60343-2;O60343-3;O60343	.;.;.;TBCD4_HUMAN	K	1095;1087;1032;259	ENSP00000366863:Q1095K;ENSP00000395986:Q1087K;ENSP00000366852:Q1032K;ENSP00000390654:Q259K	ENSP00000366852:Q1032K	Q	-	1	0	TBC1D4	74767024	1.000000	0.71417	0.996000	0.52242	0.947000	0.59692	9.338000	0.96553	2.605000	0.88082	0.563000	0.77884	CAG	TBC1D4	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000136111		0.388	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D4	HGNC	protein_coding	OTTHUMT00000045283.1		0.00	36	0	G	NM_014832		75869023	-1			no_errors	ENST00000377636	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
TEX101	83639	genome.wustl.edu	37	19	43920355	43920355	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr19:43920355G>T	ENST00000598265.1	+	3	335	c.169G>T	c.(169-171)Ggg>Tgg	p.G57W	TEX101_ENST00000602198.1_Missense_Mutation_p.G75W|TEX101_ENST00000253435.7_Missense_Mutation_p.G75W|TEX101_ENST00000601707.1_3'UTR	NM_001130011.1	NP_001123483.1	Q9BY14	TX101_HUMAN	testis expressed 101	57						acrosomal membrane (GO:0002080)|anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				large_intestine(1)|lung(12)|ovary(1)|skin(1)	15		Prostate(69;0.0199)				TTGTGACAAAGGGGCACTTTG	0.468																																																	0													86.0	81.0	82.0					19																	43920355		2203	4300	6503	SO:0001583	missense	0			AF241268	CCDS12619.1, CCDS59393.1	19q13.31	2013-06-06	2007-03-13			ENSG00000131126			30722	protein-coding gene	gene with protein product	"""cancer/testis antigen 131"", ""spermatogenesis associated 44"""	612665	"""testis expressed sequence 101"""			16388701, 16516155	Standard	NM_031451		Approved	MGC4766, SGRG, CT131, SPATA44	uc010xwo.2	Q9BY14		ENST00000598265.1:c.169G>T	19.37:g.43920355G>T	ENSP00000472769:p.Gly57Trp		Q7L5R2|Q9BPY7	Missense_Mutation	SNP	pfam_LY6_UPAR	p.G75W	ENST00000598265.1	37	c.223	CCDS59393.1	19	.	.	.	.	.	.	.	.	.	.	G	13.19	2.164036	0.38217	.	.	ENSG00000131126	ENST00000253435;ENST00000407156	T	0.72051	-0.62	4.12	2.01	0.26516	.	0.497505	0.19024	N	0.124722	T	0.80025	0.4548	M	0.77313	2.365	0.09310	N	1	D;D	0.65815	0.992;0.995	D;D	0.71870	0.945;0.975	T	0.67546	-0.5643	10	0.87932	D	0	-1.2608	6.3289	0.21259	0.2224:0.0:0.7776:0.0	.	57;75	Q9BY14;Q9BY14-2	TX101_HUMAN;.	W	75;70	ENSP00000253435:G75W	ENSP00000253435:G75W	G	+	1	0	TEX101	48612195	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	0.583000	0.23849	0.694000	0.31654	0.561000	0.74099	GGG	TEX101	-	NULL	ENSG00000131126		0.468	TEX101-004	KNOWN	non_canonical_other|basic|CCDS	protein_coding	TEX101	HGNC	protein_coding	OTTHUMT00000463176.1	-	0.00	50	0	G	NM_031451		43920355	+1	tier1	-	no_errors	ENST00000253435	ensembl	human	known	74_37	missense	7.81	59	5	SNP	0.001	T
TNPO3	23534	genome.wustl.edu	37	7	128641132	128641132	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr7:128641132C>T	ENST00000265388.5	-	6	996	c.853G>A	c.(853-855)Gca>Aca	p.A285T	TNPO3_ENST00000471166.1_Missense_Mutation_p.A285T|TNPO3_ENST00000482320.1_Missense_Mutation_p.A219T|TNPO3_ENST00000393245.1_Missense_Mutation_p.A285T|TNPO3_ENST00000471234.1_Missense_Mutation_p.A285T			Q9Y5L0	TNPO3_HUMAN	transportin 3	285					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						TCTTCACGTGCCACGGCCATA	0.428																																					Pancreas(147;583 2585 39696 52331)												0													159.0	137.0	145.0					7																	128641132		2203	4300	6503	SO:0001583	missense	0			AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.853G>A	7.37:g.128641132C>T	ENSP00000265388:p.Ala285Thr		A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold	p.A285T	ENST00000265388.5	37	c.853	CCDS5809.1	7	.	.	.	.	.	.	.	.	.	.	C	31	5.086851	0.94100	.	.	ENSG00000064419	ENST00000393245;ENST00000265388;ENST00000482320;ENST00000471234;ENST00000471166	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	5.77	5.77	0.91146	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.31857	0.0810	N	0.22421	0.69	0.80722	D	1	P;D;P	0.59357	0.765;0.985;0.879	B;P;P	0.51945	0.404;0.685;0.496	T	0.01301	-1.1391	10	0.16896	T	0.51	.	17.8363	0.88699	0.0:1.0:0.0:0.0	.	285;285;285	C9IZM0;C9J7E5;Q9Y5L0	.;.;TNPO3_HUMAN	T	285;285;219;285;285	ENSP00000376936:A285T;ENSP00000265388:A285T;ENSP00000420089:A219T;ENSP00000418646:A285T;ENSP00000418267:A285T	ENSP00000265388:A285T	A	-	1	0	TNPO3	128428368	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.717000	0.84732	2.890000	0.99128	0.650000	0.86243	GCA	TNPO3	-	superfamily_ARM-type_fold	ENSG00000064419		0.428	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNPO3	HGNC	protein_coding	OTTHUMT00000350929.1	-	0.00	39	0	C	NM_012470		128641132	-1	tier1	-	no_errors	ENST00000393245	ensembl	human	known	74_37	missense	12.07	51	7	SNP	1.000	T
TNXB	7148	genome.wustl.edu	37	6	32017091	32017091	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr6:32017091T>C	ENST00000375244.3	-	28	9914	c.9713A>G	c.(9712-9714)cAc>cGc	p.H3238R	TNXB_ENST00000375247.2_Missense_Mutation_p.H3236R			P22105	TENX_HUMAN	tenascin XB	3283	Fibronectin type-III 24. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CTGCCCCTCGTGGAGGCCGTA	0.687																																																	0													39.0	41.0	40.0					6																	32017091		1265	2544	3809	SO:0001583	missense	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.9713A>G	6.37:g.32017091T>C	ENSP00000364393:p.His3238Arg		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.H3236R	ENST00000375244.3	37	c.9707		6	.	.	.	.	.	.	.	.	.	.	T	0.460	-0.889746	0.02511	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.56103	0.48;0.48	4.28	3.01	0.34805	.	0.264855	0.26792	N	0.022468	T	0.13713	0.0332	L	0.27944	0.81	0.09310	N	1	B	0.16166	0.016	B	0.15484	0.013	T	0.07868	-1.0750	10	0.21014	T	0.42	.	3.1004	0.06324	0.2107:0.114:0.0:0.6753	.	3236	P22105-3	.	R	3238;3236	ENSP00000364393:H3238R;ENSP00000364396:H3236R	ENSP00000364393:H3238R	H	-	2	0	TNXB	32125069	0.000000	0.05858	0.009000	0.14445	0.017000	0.09413	-0.418000	0.07080	1.572000	0.49736	0.260000	0.18958	CAC	TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000168477		0.687	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	-	0.00	60	0	T	NM_019105		32017091	-1	tier1	-	no_errors	ENST00000375247	ensembl	human	known	74_37	missense	14.13	79	13	SNP	0.002	C
TOMM34	10953	genome.wustl.edu	37	20	43571821	43571821	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr20:43571821G>A	ENST00000372813.3	-	7	1011	c.859C>T	c.(859-861)Ctc>Ttc	p.L287F	PABPC1L_ENST00000490798.1_Intron|PABPC1L_ENST00000372819.1_Intron	NM_006809.4	NP_006800.2	Q15785	TOM34_HUMAN	translocase of outer mitochondrial membrane 34	287					protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	heat shock protein binding (GO:0031072)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	11		Myeloproliferative disorder(115;0.0122)				ATCTGTAGGAGGTTGCTGATG	0.522																																																	0													109.0	102.0	105.0					20																	43571821		2203	4300	6503	SO:0001583	missense	0			U58970	CCDS13340.1	20q12-q13.1	2013-01-10			ENSG00000025772	ENSG00000025772		"""Tetratricopeptide (TTC) repeat domain containing"""	15746	protein-coding gene	gene with protein product	"""outer mitochondrial membrane translocase (34kD)"""					9324309	Standard	NM_006809		Approved	TOM34, HTOM34P	uc002xmy.3	Q15785	OTTHUMG00000032552	ENST00000372813.3:c.859C>T	20.37:g.43571821G>A	ENSP00000361900:p.Leu287Phe		Q53GH9|Q6IBN7|Q9NTZ3	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L287F	ENST00000372813.3	37	c.859	CCDS13340.1	20	.	.	.	.	.	.	.	.	.	.	G	19.36	3.812419	0.70912	.	.	ENSG00000025772	ENST00000372813	T	0.74737	-0.87	5.34	5.34	0.76211	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.074328	0.53938	D	0.000059	D	0.86932	0.6052	M	0.88450	2.955	0.42689	D	0.993572	D	0.89917	1.0	D	0.80764	0.994	D	0.88204	0.2886	10	0.59425	D	0.04	-25.9804	11.6541	0.51306	0.0832:0.0:0.9168:0.0	.	287	Q15785	TOM34_HUMAN	F	287	ENSP00000361900:L287F	ENSP00000361900:L287F	L	-	1	0	TOMM34	43005235	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.202000	0.42743	2.761000	0.94854	0.655000	0.94253	CTC	TOMM34	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000025772		0.522	TOMM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOMM34	HGNC	protein_coding	OTTHUMT00000079390.3	-	0.00	59	0	G	NM_006809		43571821	-1	tier1	-	no_errors	ENST00000372813	ensembl	human	known	74_37	missense	8.06	57	5	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	35	0	C	NM_000546		7578406	-1	tier1	rs28934578	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	28.57	25	10	SNP	1.000	T
TRAF4	9618	genome.wustl.edu	37	17	27075971	27075971	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr17:27075971G>T	ENST00000262395.5	+	7	918	c.789G>T	c.(787-789)aaG>aaT	p.K263N	AC010761.10_ENST00000579468.1_RNA|AC010761.9_ENST00000577325.1_RNA|TRAF4_ENST00000444415.3_Missense_Mutation_p.K263N|TRAF4_ENST00000262396.6_Intron	NM_004295.3	NP_004286.2	Q9BUZ4	TRAF4_HUMAN	TNF receptor-associated factor 4	263					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein kinase activity (GO:0045860)|regulation of apoptotic process (GO:0042981)|respiratory gaseous exchange (GO:0007585)|respiratory tube development (GO:0030323)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	DNA binding (GO:0003677)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|WW domain binding (GO:0050699)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10	Lung NSC(42;0.01)		Epithelial(11;3.26e-05)|all cancers(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.235)			AGTGCCCTAAGCTGGCAATGG	0.617																																																	0													30.0	28.0	29.0					17																	27075971		2201	4300	6501	SO:0001583	missense	0			X80200	CCDS11243.1	17q11-q21.3	2013-01-09			ENSG00000076604	ENSG00000076604		"""RING-type (C3HC4) zinc fingers"""	12034	protein-coding gene	gene with protein product		602464				7592751, 7490069	Standard	NM_004295		Approved	CART1, MLN62, RNF83	uc002hcs.3	Q9BUZ4	OTTHUMG00000132677	ENST00000262395.5:c.789G>T	17.37:g.27075971G>T	ENSP00000262395:p.Lys263Asn		O75615|Q14848|Q2KJU4|Q2PJN8	Missense_Mutation	SNP	pfam_MATH,pfam_Znf_C3HC4_RING-type,superfamily_TRAF-like,smart_Znf_RING,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.K263N	ENST00000262395.5	37	c.789	CCDS11243.1	17	.	.	.	.	.	.	.	.	.	.	G	10.88	1.475367	0.26511	.	.	ENSG00000076604	ENST00000262395;ENST00000444415	T;T	0.31247	1.5;1.5	5.62	3.65	0.41850	Zinc finger, TRAF-type (1);TRAF-like (1);	0.098618	0.64402	D	0.000001	T	0.24624	0.0597	L	0.42632	1.34	0.80722	D	1	P	0.43231	0.801	B	0.37780	0.258	T	0.01961	-1.1239	10	0.42905	T	0.14	.	11.0391	0.47820	0.1482:0.0:0.8518:0.0	.	263	Q9BUZ4	TRAF4_HUMAN	N	263	ENSP00000262395:K263N;ENSP00000438154:K263N	ENSP00000262395:K263N	K	+	3	2	TRAF4	24100098	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.382000	0.52463	0.733000	0.32492	0.655000	0.94253	AAG	TRAF4	-	superfamily_TRAF-like,pirsf_TNF_rcpt--assoc_TRAF,pfscan_Znf_TRAF	ENSG00000076604		0.617	TRAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF4	HGNC	protein_coding	OTTHUMT00000255944.2	-	0.00	46	0	G	NM_145751		27075971	+1	tier1	-	no_errors	ENST00000262395	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
TRANK1	9881	genome.wustl.edu	37	3	36873577	36873577	+	Missense_Mutation	SNP	C	C	G	rs377104234		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr3:36873577C>G	ENST00000429976.2	-	21	7612	c.7365G>C	c.(7363-7365)gaG>gaC	p.E2455D	TRANK1_ENST00000428977.2_Missense_Mutation_p.E1905D|TRANK1_ENST00000301807.6_Missense_Mutation_p.E1905D	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2455							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						CATCCCCAAGCTCCTTGTCCT	0.512																																																	0													101.0	103.0	102.0					3																	36873577		1963	4160	6123	SO:0001583	missense	0			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.7365G>C	3.37:g.36873577C>G	ENSP00000416168:p.Glu2455Asp		Q8N8K0	Missense_Mutation	SNP	pfam_UvrD-like_ATP-bd,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom	p.E2455D	ENST00000429976.2	37	c.7365	CCDS46789.2	3	.	.	.	.	.	.	.	.	.	.	C	11.59	1.685434	0.29872	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.35048	1.33;1.79;1.33	5.16	2.33	0.28932	.	0.107097	0.40302	N	0.001134	T	0.23611	0.0571	L	0.32530	0.975	0.09310	N	0.999996	B	0.12630	0.006	B	0.09377	0.004	T	0.17776	-1.0358	10	0.56958	D	0.05	.	5.5078	0.16864	0.0:0.5883:0.147:0.2647	.	2455	O15050	TRNK1_HUMAN	D	1905;2455;1905	ENSP00000416826:E1905D;ENSP00000416168:E2455D;ENSP00000301807:E1905D	ENSP00000301807:E1905D	E	-	3	2	TRANK1	36848581	0.389000	0.25205	0.018000	0.16275	0.562000	0.35680	0.791000	0.26915	0.261000	0.21753	-0.305000	0.09177	GAG	TRANK1	-	NULL	ENSG00000168016		0.512	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TRANK1	HGNC	protein_coding		-	0.00	79	0	C	NM_014831		36873577	-1	tier1	-	no_errors	ENST00000429976	ensembl	human	known	74_37	missense	11.11	64	8	SNP	0.176	G
TRIM35	23087	genome.wustl.edu	37	8	27168552	27168552	+	Silent	SNP	G	G	C			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr8:27168552G>C	ENST00000305364.4	-	1	284	c.201C>G	c.(199-201)gcC>gcG	p.A67A	PTK2B_ENST00000544172.1_5'Flank|PTK2B_ENST00000338238.4_5'Flank|TRIM35_ENST00000521253.1_Silent_p.A67A|PTK2B_ENST00000397501.1_5'Flank	NM_171982.3	NP_741983.2	Q9UPQ4	TRI35_HUMAN	tripartite motif containing 35	67					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	14		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|Epithelial(17;9.34e-10)|Colorectal(74;0.141)		TGCGCAGGTCGGCGGGTGACG	0.692																																																	0													21.0	20.0	20.0					8																	27168552		2197	4292	6489	SO:0001819	synonymous_variant	0			AB029021	CCDS6056.2	8p21.2	2013-01-09	2011-01-25		ENSG00000104228	ENSG00000104228		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16285	protein-coding gene	gene with protein product			"""tripartite motif-containing 35"""			11331580, 14662771, 12692137	Standard	XM_005273451		Approved	KIAA1098, MAIR, HLS5	uc003xfl.1	Q9UPQ4	OTTHUMG00000102047	ENST00000305364.4:c.201C>G	8.37:g.27168552G>C			Q86XQ0|Q8WVA4	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.A67	ENST00000305364.4	37	c.201	CCDS6056.2	8																																																																																			TRIM35	-	NULL	ENSG00000104228		0.692	TRIM35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM35	HGNC	protein_coding	OTTHUMT00000219848.2	-	0.00	62	0	G	NM_171982		27168552	-1	tier1	-	no_errors	ENST00000305364	ensembl	human	known	74_37	silent	8.00	90	8	SNP	1.000	C
TRIM61	391712	genome.wustl.edu	37	4	165891024	165891024	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr4:165891024C>T	ENST00000329314.5	-	3	743	c.131G>A	c.(130-132)tGg>tAg	p.W44*		NM_001012414.2	NP_001012414.1	Q5EBN2	TRI61_HUMAN	tripartite motif containing 61	44						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|kidney(1)|liver(1)|skin(1)|upper_aerodigestive_tract(1)	5	all_hematologic(180;0.221)	Prostate(90;0.109)		GBM - Glioblastoma multiforme(119;0.155)		TAGATCCTTCCAGGACATAAT	0.473																																																	0													55.0	45.0	49.0					4																	165891024		2201	4298	6499	SO:0001587	stop_gained	0				CCDS34093.1	4q32.3	2013-01-09	2011-01-25			ENSG00000183439		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24339	protein-coding gene	gene with protein product			"""ring finger protein 35"", ""tripartite motif-containing 61"""	RNF35			Standard	NM_001012414		Approved		uc003iqw.3	Q5EBN2		ENST00000329314.5:c.131G>A	4.37:g.165891024C>T	ENSP00000332288:p.Trp44*			Nonsense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,smart_Znf_RING,pfscan_Znf_B-box,pfscan_Znf_RING	p.W44*	ENST00000329314.5	37	c.131	CCDS34093.1	4	.	.	.	.	.	.	.	.	.	.	C	41	8.769899	0.98948	.	.	ENSG00000183439	ENST00000329314	.	.	.	3.22	2.36	0.29203	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.1714	0.31258	0.0:0.8722:0.0:0.1278	.	.	.	.	X	44	.	ENSP00000332288:W44X	W	-	2	0	TRIM61	166110474	0.998000	0.40836	0.013000	0.15412	0.467000	0.32768	2.184000	0.42575	0.698000	0.31739	0.580000	0.79431	TGG	TRIM61	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000183439		0.473	TRIM61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM61	HGNC	protein_coding	OTTHUMT00000364331.1	-	0.00	148	0	C	XM_373038		165891024	-1	tier1	-	no_errors	ENST00000329314	ensembl	human	known	74_37	nonsense	6.22	181	12	SNP	0.997	T
TRPV6	55503	genome.wustl.edu	37	7	142569658	142569658	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr7:142569658G>T	ENST00000359396.3	-	15	2225	c.1980C>A	c.(1978-1980)gaC>gaA	p.D660E		NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	660					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					CTGAGTCTTTGTCCAAATCCT	0.592																																																	0													92.0	96.0	95.0					7																	142569658		2203	4300	6503	SO:0001583	missense	0			AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.1980C>A	7.37:g.142569658G>T	ENSP00000352358:p.Asp660Glu		A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV5/TRPV6,prints_TRPV6_channel,prints_Ankyrin_rpt,tigrfam_TRP_channel	p.D660E	ENST00000359396.3	37	c.1980	CCDS5874.1	7	.	.	.	.	.	.	.	.	.	.	G	0.049	-1.255641	0.01457	.	.	ENSG00000165125	ENST00000359396;ENST00000311470	T	0.49139	0.79	5.2	3.26	0.37387	.	1.190390	0.05842	N	0.619629	T	0.35653	0.0939	L	0.27053	0.805	0.24058	N	0.996026	B	0.02656	0.0	B	0.04013	0.001	T	0.25641	-1.0126	10	0.19147	T	0.46	-10.4049	9.0942	0.36629	0.0:0.155:0.6723:0.1727	.	660	Q9H1D0	TRPV6_HUMAN	E	660;492	ENSP00000352358:D660E	ENSP00000310825:D492E	D	-	3	2	TRPV6	142279780	0.999000	0.42202	0.916000	0.36221	0.232000	0.25224	0.357000	0.20199	0.500000	0.27991	0.561000	0.74099	GAC	TRPV6	-	prints_TRPV6_channel,tigrfam_TRP_channel	ENSG00000165125		0.592	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV6	HGNC	protein_coding	OTTHUMT00000347662.1	-	0.00	43	0	G	NM_014274		142569658	-1	tier1	-	no_errors	ENST00000359396	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
TSPYL4	23270	genome.wustl.edu	37	6	116574350	116574350	+	Silent	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr6:116574350G>A	ENST00000420283.1	-	1	911	c.822C>T	c.(820-822)gaC>gaT	p.D274D	DSE_ENST00000540275.1_5'Flank|RP3-486I3.7_ENST00000448740.2_lincRNA	NM_021648.4	NP_067680.3	Q9UJ04	TSYL4_HUMAN	TSPY-like 4	274					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				endometrium(2)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(2)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.045)|OV - Ovarian serous cystadenocarcinoma(136;0.0666)|GBM - Glioblastoma multiforme(226;0.095)|Epithelial(106;0.125)		ACCTCAGCATGTCTTCATCTT	0.483																																																	0													58.0	58.0	58.0					6																	116574350		1981	4192	6173	SO:0001819	synonymous_variant	0				CCDS5106.1	6q22.1	2010-05-12			ENSG00000187189	ENSG00000187189			21559	protein-coding gene	gene with protein product							Standard	NM_021648		Approved	dJ486I3.2, KIAA0721	uc003pwn.3	Q9UJ04	OTTHUMG00000015429	ENST00000420283.1:c.822C>T	6.37:g.116574350G>A			B4DYQ2|O94828|Q96GW8	Silent	SNP	pfam_NAP_family	p.D274	ENST00000420283.1	37	c.822	CCDS5106.1	6																																																																																			TSPYL4	-	pfam_NAP_family	ENSG00000187189		0.483	TSPYL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPYL4	HGNC	protein_coding	OTTHUMT00000041934.2	-	0.00	67	0	G			116574350	-1	tier1	-	no_errors	ENST00000420283	ensembl	human	known	74_37	silent	8.11	68	6	SNP	0.621	A
TSPYL5	85453	genome.wustl.edu	37	8	98289607	98289607	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr8:98289607C>A	ENST00000322128.3	-	1	569	c.466G>T	c.(466-468)Gcg>Tcg	p.A156S		NM_033512.2	NP_277047.2	Q86VY4	TSYL5_HUMAN	TSPY-like 5	156					cellular response to gamma radiation (GO:0071480)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|regulation of growth (GO:0040008)	nucleus (GO:0005634)				cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	20	Breast(36;2.56e-06)					CCCCTCCCCGCGGTGCTACAG	0.642																																																	0													47.0	57.0	53.0					8																	98289607		2201	4299	6500	SO:0001583	missense	0			AB051537	CCDS34927.1	8q22.1	2011-05-24			ENSG00000180543	ENSG00000180543			29367	protein-coding gene	gene with protein product		614721				11214970	Standard	NM_033512		Approved	KIAA1750	uc003yhy.3	Q86VY4	OTTHUMG00000164857	ENST00000322128.3:c.466G>T	8.37:g.98289607C>A	ENSP00000322802:p.Ala156Ser		B3KRF0|Q9C0B3	Missense_Mutation	SNP	pfam_NAP_family	p.A156S	ENST00000322128.3	37	c.466	CCDS34927.1	8	.	.	.	.	.	.	.	.	.	.	C	8.613	0.889632	0.17540	.	.	ENSG00000180543	ENST00000322128	T	0.15139	2.45	4.05	-0.0851	0.13687	.	1.216370	0.06412	N	0.720760	T	0.06462	0.0166	N	0.08118	0	0.09310	N	1	B	0.28636	0.218	B	0.23419	0.046	T	0.34800	-0.9814	10	0.12103	T	0.63	-1.6875	1.9358	0.03337	0.3595:0.3584:0.1755:0.1066	.	156	Q86VY4	TSYL5_HUMAN	S	156	ENSP00000322802:A156S	ENSP00000322802:A156S	A	-	1	0	TSPYL5	98358783	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.274000	0.08537	-0.032000	0.13758	0.650000	0.86243	GCG	TSPYL5	-	NULL	ENSG00000180543		0.642	TSPYL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPYL5	HGNC	protein_coding	OTTHUMT00000380611.1	-	0.00	40	0	C	NM_033512		98289607	-1	tier1	-	no_errors	ENST00000322128	ensembl	human	known	74_37	missense	13.56	51	8	SNP	0.002	A
TTLL7	79739	genome.wustl.edu	37	1	84414391	84414391	+	Intron	SNP	A	A	G			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr1:84414391A>G	ENST00000260505.8	-	5	657				TTLL7_ENST00000477524.1_Intron	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7						cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		GGAAAATAAAAAGGTAAATAT	0.299																																																	0													54.0	61.0	58.0					1																	84414391		2196	4295	6491	SO:0001627	intron_variant	0			AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.280-13T>C	1.37:g.84414391A>G			Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	RNA	SNP	-	NULL	ENST00000260505.8	37	NULL	CCDS690.2	1																																																																																			TTLL7	-	-	ENSG00000137941		0.299	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL7	HGNC	protein_coding	OTTHUMT00000027498.1	-	0.00	34	0	A	NM_024686		84414391	-1	tier1	-	no_errors	ENST00000472688	ensembl	human	known	74_37	rna	13.33	39	6	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179400859	179400859	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr2:179400859C>G	ENST00000591111.1	-	307	95916	c.95692G>C	c.(95692-95694)Gat>Cat	p.D31898H	TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D30971H|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D24599H|TTN_ENST00000460472.2_Missense_Mutation_p.D24474H|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.D24666H|TTN_ENST00000589042.1_Missense_Mutation_p.D33539H|TTN-AS1_ENST00000415561.1_RNA			Q8WZ42	TITIN_HUMAN	titin	31898	Ig-like 141.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTAATCCATCTGCAATGATT	0.413																																																	0													130.0	116.0	120.0					2																	179400859		1878	4108	5986	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.95692G>C	2.37:g.179400859C>G	ENSP00000465570:p.Asp31898His		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.D30971H	ENST00000591111.1	37	c.92911		2	.	.	.	.	.	.	.	.	.	.	C	16.78	3.218032	0.58560	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9	5.76	5.76	0.90799	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.85852	0.5793	M	0.67517	2.055	0.54753	D	0.999985	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.74023	0.967;0.967;0.967;0.982	D	0.86351	0.1711	9	0.87932	D	0	.	19.9595	0.97236	0.0:1.0:0.0:0.0	.	24474;24599;24666;31898	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	30971;24474;24666;24599;24471	ENSP00000343764:D30971H;ENSP00000434586:D24474H;ENSP00000340554:D24666H;ENSP00000352154:D24599H	ENSP00000340554:D24666H	D	-	1	0	TTN	179109105	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	6.089000	0.71384	2.706000	0.92434	0.563000	0.77884	GAT	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	68	0	C	NM_133378		179400859	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	7.35	63	5	SNP	1.000	G
TXNDC16	57544	genome.wustl.edu	37	14	52899183	52899183	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr14:52899183C>A	ENST00000281741.4	-	21	2688	c.2317G>T	c.(2317-2319)Gtg>Ttg	p.V773L		NM_001160047.1|NM_020784.2	NP_001153519.1|NP_065835.2	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16	773					cell redox homeostasis (GO:0045454)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(3)|skin(1)	21	Breast(41;0.0716)					TTCTCCTGCACATCTGTTTCT	0.388																																																	0													92.0	90.0	91.0					14																	52899183		2203	4300	6503	SO:0001583	missense	0			AB037765	CCDS32083.1	14q22.1	2007-08-16	2007-08-16	2007-08-16		ENSG00000087301			19965	protein-coding gene	gene with protein product			"""KIAA1344"""	KIAA1344			Standard	NM_020784		Approved		uc001wzs.3	Q9P2K2		ENST00000281741.4:c.2317G>T	14.37:g.52899183C>A	ENSP00000281741:p.Val773Leu		A5PKW9|A7E260|A7MD07|B9EH67|Q9H9W7	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.V773L	ENST00000281741.4	37	c.2317	CCDS32083.1	14	.	.	.	.	.	.	.	.	.	.	C	1.920	-0.448524	0.04572	.	.	ENSG00000087301	ENST00000281741	T	0.17213	2.29	5.42	-1.66	0.08265	.	0.670453	0.13834	N	0.359530	T	0.08403	0.0209	N	0.22421	0.69	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.40794	-0.9544	10	0.13470	T	0.59	-15.832	6.8601	0.24062	0.0:0.4225:0.1828:0.3947	.	768;773	B7ZME4;Q9P2K2	.;TXD16_HUMAN	L	773	ENSP00000281741:V773L	ENSP00000281741:V773L	V	-	1	0	TXNDC16	51968933	0.000000	0.05858	0.009000	0.14445	0.272000	0.26649	-0.510000	0.06328	-0.097000	0.12307	0.644000	0.83932	GTG	TXNDC16	-	NULL	ENSG00000087301		0.388	TXNDC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNDC16	HGNC	protein_coding	OTTHUMT00000411681.1	-	0.00	73	0	C	XM_051699		52899183	-1	tier1	-	no_errors	ENST00000281741	ensembl	human	known	74_37	missense	15.66	70	13	SNP	0.006	A
UNC93B1	81622	genome.wustl.edu	37	11	67759316	67759316	+	Missense_Mutation	SNP	C	C	T	rs4014596		TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr11:67759316C>T	ENST00000227471.2	-	12	1571	c.1492G>A	c.(1492-1494)Gtg>Atg	p.V498M	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	499					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.V498M(1)									ACCAGCAGCACCGCCAGCTTA	0.741																																																	1	Substitution - Missense(1)	skin(1)											2.0	2.0	2.0					11																	67759316		806	1754	2560	SO:0001583	missense	0			AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.1492G>A	11.37:g.67759316C>T	ENSP00000227471:p.Val498Met		O95764|Q569H6|Q710D4	Missense_Mutation	SNP	pfam_Ion_channel_UNC-93,superfamily_MFS_dom_general_subst_transpt	p.V498M	ENST00000227471.2	37	c.1492		11	.	.	.	.	.	.	.	.	.	.	.	19.11	3.764070	0.69878	.	.	ENSG00000110057	ENST00000227471	D	0.82344	-1.6	4.98	2.8	0.32819	.	0.313238	0.30437	N	0.009625	T	0.66147	0.2760	N	0.19112	0.55	0.29268	N	0.870868	P	0.41265	0.744	B	0.39068	0.289	T	0.65010	-0.6272	10	0.66056	D	0.02	-19.153	2.9617	0.05895	0.2401:0.5562:0.0:0.2037	rs4014596	499	Q9H1C4	UN93B_HUMAN	M	498	ENSP00000227471:V498M	ENSP00000227471:V498M	V	-	1	0	UNC93B1	67515892	0.992000	0.36948	1.000000	0.80357	0.856000	0.48823	1.973000	0.40550	2.318000	0.78349	0.491000	0.48974	GTG	UNC93B1	-	NULL	ENSG00000110057		0.741	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	UNC93B1	HGNC	protein_coding			0.00	37	0	C	NM_030930		67759316	-1			no_errors	ENST00000227471	ensembl	human	known	74_37	missense	8.97	71	7	SNP	0.997	T
VWA5A	4013	genome.wustl.edu	37	11	123989252	123989252	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr11:123989252A>G	ENST00000456829.2	+	6	733	c.482A>G	c.(481-483)gAc>gGc	p.D161G	VWA5A_ENST00000361352.5_Missense_Mutation_p.D161G|VWA5A_ENST00000449321.1_Missense_Mutation_p.D161G|VWA5A_ENST00000360334.4_Missense_Mutation_p.D161G|VWA5A_ENST00000392748.1_Missense_Mutation_p.D161G|VWA5A_ENST00000392744.4_Missense_Mutation_p.D177G	NM_001130142.1	NP_001123614.1	O00534	VMA5A_HUMAN	von Willebrand factor A domain containing 5A	161										autonomic_ganglia(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	47						TCGTCTAAGGACAGTTGCCTT	0.448																																																	0													158.0	155.0	156.0					11																	123989252		2201	4299	6500	SO:0001583	missense	0			AF002672	CCDS8444.1, CCDS8445.1	11q24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000110002	ENSG00000110002			6658	protein-coding gene	gene with protein product		602929	"""loss of heterozygosity, 11, chromosomal region 2, gene A"""	LOH11CR2A		9417908, 14504409	Standard	NM_001130142		Approved	BCSC-1	uc001pzt.3	O00534	OTTHUMG00000165971	ENST00000456829.2:c.482A>G	11.37:g.123989252A>G	ENSP00000407726:p.Asp161Gly		Q6UN19|Q6UN20|Q9BVF8	Missense_Mutation	SNP	pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.D161G	ENST00000456829.2	37	c.482	CCDS8444.1	11	.	.	.	.	.	.	.	.	.	.	A	6.796	0.515892	0.12944	.	.	ENSG00000110002	ENST00000456829;ENST00000360334;ENST00000392748;ENST00000524524;ENST00000530025;ENST00000361352;ENST00000449321;ENST00000392744	T;T;T;T;T;T	0.26067	3.61;1.76;3.61;2.12;2.12;2.11	5.41	0.2	0.15181	.	1.283070	0.04667	N	0.410012	T	0.24275	0.0588	L	0.54323	1.7	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.10450	0.005;0.003	T	0.26292	-1.0107	10	0.34782	T	0.22	-7.1257	5.0702	0.14602	0.4095:0.3976:0.1929:0.0	.	177;161	B4DHS6;O00534	.;VMA5A_HUMAN	G	161;161;161;161;161;161;161;177	ENSP00000407726:D161G;ENSP00000353485:D161G;ENSP00000376504:D161G;ENSP00000355070:D161G;ENSP00000404683:D161G;ENSP00000376501:D177G	ENSP00000353485:D161G	D	+	2	0	VWA5A	123494462	0.000000	0.05858	0.005000	0.12908	0.037000	0.13140	0.127000	0.15790	0.025000	0.15241	0.528000	0.53228	GAC	VWA5A	-	NULL	ENSG00000110002		0.448	VWA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA5A	HGNC	protein_coding	OTTHUMT00000387273.1	-	0.00	47	0	A	NM_014622		123989252	+1	tier1	-	no_errors	ENST00000392748	ensembl	human	known	74_37	missense	8.70	63	6	SNP	0.001	G
VWDE	221806	genome.wustl.edu	37	7	12391319	12391319	+	Nonsense_Mutation	SNP	G	G	A	rs6967385	byFrequency	TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr7:12391319G>A	ENST00000275358.3	-	19	3954	c.3766C>T	c.(3766-3768)Caa>Taa	p.Q1256*		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	1256			Q -> K (in dbSNP:rs6967385). {ECO:0000269|PubMed:14702039}.			extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						GTAGTAAATTGATTTACAAAC	0.328																																																	0													129.0	123.0	125.0					7																	12391319		692	1590	2282	SO:0001587	stop_gained	0				CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.3766C>T	7.37:g.12391319G>A	ENSP00000275358:p.Gln1256*		B7ZM77|Q96SQ3	Nonsense_Mutation	SNP	pfam_EGF_extracell,pfam_VWF_type-D,superfamily_Cadherin-like,smart_VWF_type-D,smart_EG-like_dom,pfscan_EG-like_dom	p.Q1256*	ENST00000275358.3	37	c.3766	CCDS47544.1	7	.	.	.	.	.	.	.	.	.	.	T	41	9.069166	0.99055	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	.	.	.	3.06	-1.11	0.09840	.	1.313100	0.05006	N	0.470136	.	.	.	.	.	.	0.09310	P	0.99999999877128	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	0.5757	0.00703	0.1747:0.3048:0.1715:0.3489	.	.	.	.	X	1256;710	.	ENSP00000275358:Q1256X	Q	-	1	0	VWDE	12357844	0.003000	0.15002	0.001000	0.08648	0.006000	0.05464	-0.133000	0.10451	-0.579000	0.05952	-1.202000	0.01658	CAA	VWDE	-	NULL	ENSG00000146530		0.328	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VWDE	HGNC	protein_coding	OTTHUMT00000325870.3	-	0.00	55	0	G	XM_371878		12391319	-1	tier1	-	no_errors	ENST00000275358	ensembl	human	novel	74_37	nonsense	10.00	44	5	SNP	0.002	A
WT1-AS	51352	genome.wustl.edu	37	11	32462201	32462201	+	RNA	SNP	A	A	G			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr11:32462201A>G	ENST00000395900.1	+	0	3079				WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000426618.2_RNA|WT1-AS_ENST00000442957.1_RNA|WT1-AS_ENST00000525436.1_RNA|WT1-AS_ENST00000478367.1_RNA	NR_023920.1		Q06250	WIT1_HUMAN	WT1 antisense RNA											endometrium(1)|large_intestine(2)|lung(2)|prostate(1)	6						GTATTAAGCCATAAAGTATCC	0.333																																																	0																																												0			BC002734		11p13	2012-10-19	2012-08-15	2012-01-25	ENSG00000183242	ENSG00000183242		"""Long non-coding RNAs"", ""-"""	18135	non-coding RNA	RNA, long non-coding	"""Wilms tumor associated protein"""	607899	"""Wilms tumor upstream neighbor 1"", ""WT1 antisense RNA (non-protein coding)"""	WIT1		2173145, 8406502, 17210670	Standard	NR_120546		Approved	WIT-1, WT1AS, WT1-AS1	uc010red.2	Q06250	OTTHUMG00000039557		11.37:g.32462201A>G			Q4KMY0|Q96A27	RNA	SNP	-	NULL	ENST00000395900.1	37	NULL		11																																																																																			WT1-AS	-	-	ENSG00000183242		0.333	WT1-AS-001	KNOWN	basic	antisense	WT1-AS	HGNC	antisense	OTTHUMT00000095437.1	-	0.00	46	0	A	NR_023920		32462201	+1	tier1	-	no_errors	ENST00000395900	ensembl	human	known	74_37	rna	20.00	39	10	SNP	1.000	G
XDH	7498	genome.wustl.edu	37	2	31605935	31605935	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr2:31605935T>G	ENST00000379416.3	-	11	1018	c.970A>C	c.(970-972)Aca>Cca	p.T324P	XDH_ENST00000491727.1_5'UTR	NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	324	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	AACACCTCTGTCTTTTGGGCA	0.572																																					Colon(66;682 1445 30109 40147)												0													87.0	79.0	82.0					2																	31605935		2203	4300	6503	SO:0001583	missense	0			D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.970A>C	2.37:g.31605935T>G	ENSP00000368727:p.Thr324Pro		Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	pfam_AldOxase/xan_DH_Mopterin-bd,pfam_Mopterin_DH_FAD-bd,pfam_Ald_Oxase/Xan_DH_a/b,pfam_2Fe-2S-bd,pfam_CO_DH_flav_C,pfam_2Fe-2S_ferredoxin-type,superfamily_AldOxase/xan_DH_Mopterin-bd,superfamily_FAD-bd_2,superfamily_Ald_Oxase/Xan_DH_a/b,superfamily_2Fe-2S-bd,superfamily_CO_DH_flav_C,superfamily_2Fe-2S_ferredoxin-type,pirsf_Ald_Oxase/xanthine_DH,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Xanthine_DH_ssu	p.T324P	ENST00000379416.3	37	c.970	CCDS1775.1	2	.	.	.	.	.	.	.	.	.	.	T	33	5.247391	0.95305	.	.	ENSG00000158125	ENST00000379416	T	0.23950	1.88	5.65	4.49	0.54785	FAD-binding, type 2 (2);CO dehydrogenase flavoprotein-like, FAD-binding, subdomain 2 (1);Xanthine dehydrogenase, small subunit (1);Molybdopterin dehydrogenase, FAD-binding (1);	0.000000	0.85682	D	0.000000	T	0.59390	0.2190	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67960	-0.5535	10	0.87932	D	0	.	11.2954	0.49276	0.0:0.0722:0.0:0.9278	.	324	P47989	XDH_HUMAN	P	324	ENSP00000368727:T324P	ENSP00000368727:T324P	T	-	1	0	XDH	31459439	1.000000	0.71417	0.195000	0.23364	0.654000	0.38779	5.088000	0.64486	0.980000	0.38523	0.368000	0.22195	ACA	XDH	-	pfam_Mopterin_DH_FAD-bd,superfamily_FAD-bd_2,pirsf_Ald_Oxase/xanthine_DH,tigrfam_Xanthine_DH_ssu	ENSG00000158125		0.572	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XDH	HGNC	protein_coding	OTTHUMT00000216840.1	-	0.00	88	0	T	NM_000379		31605935	-1	tier1	-	no_errors	ENST00000379416	ensembl	human	known	74_37	missense	8.97	71	7	SNP	0.992	G
ZFP14	57677	genome.wustl.edu	37	19	36832184	36832184	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr19:36832184T>C	ENST00000270001.7	-	5	659	c.544A>G	c.(544-546)Att>Gtt	p.I182V		NM_020917.2	NP_065968.1	Q9HCL3	ZFP14_HUMAN	ZFP14 zinc finger protein	182					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	26	Esophageal squamous(110;0.162)					GAGCGACGAATAAAGGTCTTC	0.403																																																	0													159.0	152.0	155.0					19																	36832184		2203	4300	6503	SO:0001583	missense	0			AB046779	CCDS33002.1	19q13.13	2013-01-08	2012-11-27			ENSG00000142065		"""Zinc fingers, C2H2-type"", ""-"""	29312	protein-coding gene	gene with protein product			"""zinc finger protein 14 homolog (mouse)"""			10997877	Standard	NM_020917		Approved	KIAA1559, ZNF531	uc010eex.2	Q9HCL3		ENST00000270001.7:c.544A>G	19.37:g.36832184T>C	ENSP00000270001:p.Ile182Val		A7MD23	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I182V	ENST00000270001.7	37	c.544	CCDS33002.1	19	.	.	.	.	.	.	.	.	.	.	t	8.999	0.979680	0.18812	.	.	ENSG00000142065	ENST00000270001;ENST00000392172	T	0.36699	1.24	3.85	3.85	0.44370	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.46145	D	0.000306	T	0.20251	0.0487	N	0.20530	0.585	0.80722	D	1	P;B	0.35894	0.526;0.237	B;B	0.34301	0.179;0.119	T	0.04294	-1.0962	10	0.30078	T	0.28	.	7.4912	0.27462	0.0:0.1059:0.0:0.8941	.	182;182	A8KAN8;Q9HCL3	.;ZFP14_HUMAN	V	182	ENSP00000270001:I182V	ENSP00000270001:I182V	I	-	1	0	ZFP14	41524024	0.963000	0.33076	1.000000	0.80357	0.958000	0.62258	1.740000	0.38228	1.737000	0.51674	0.448000	0.29417	ATT	ZFP14	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000142065		0.403	ZFP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP14	HGNC	protein_coding	OTTHUMT00000452528.1	-	0.00	43	0	T	NM_020917		36832184	-1	tier1	-	no_errors	ENST00000270001	ensembl	human	known	74_37	missense	24.62	49	16	SNP	0.888	C
ZNF212	7988	genome.wustl.edu	37	7	148951091	148951091	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr7:148951091G>A	ENST00000335870.2	+	5	1201	c.1073G>A	c.(1072-1074)cGg>cAg	p.R358Q		NM_012256.3	NP_036388.2	Q9UDV6	ZN212_HUMAN	zinc finger protein 212	358					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|ovary(1)|prostate(1)	9	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)			CCCAGGCCACGGCTGAAACCA	0.592																																																	0													50.0	42.0	44.0					7																	148951091		2203	4300	6503	SO:0001583	missense	0			U38864	CCDS5896.1	7q36.1	2013-01-08			ENSG00000170260	ENSG00000170260		"""Zinc fingers, C2H2-type"", ""-"""	13004	protein-coding gene	gene with protein product		602386				9169157	Standard	NM_012256		Approved	C2H2-150	uc003wfp.3	Q9UDV6	OTTHUMG00000158968	ENST00000335870.2:c.1073G>A	7.37:g.148951091G>A	ENSP00000338572:p.Arg358Gln		B2RCF4|Q13396|Q8N664	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_DUF3669_Znf,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R358Q	ENST00000335870.2	37	c.1073	CCDS5896.1	7	.	.	.	.	.	.	.	.	.	.	G	2.303	-0.359660	0.05138	.	.	ENSG00000170260	ENST00000335870	T	0.06933	3.24	4.99	-3.4	0.04853	.	1.081660	0.07119	N	0.843587	T	0.04048	0.0113	N	0.16790	0.44	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.46693	-0.9173	10	0.07644	T	0.81	-6.9203	6.7877	0.23682	0.4781:0.0:0.4098:0.112	.	358	Q9UDV6	ZN212_HUMAN	Q	358	ENSP00000338572:R358Q	ENSP00000338572:R358Q	R	+	2	0	ZNF212	148582024	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-1.021000	0.03615	-0.663000	0.05331	-0.367000	0.07326	CGG	ZNF212	-	NULL	ENSG00000170260		0.592	ZNF212-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF212	HGNC	protein_coding	OTTHUMT00000352710.1	-	0.00	34	0	G	NM_012256		148951091	+1	tier1	-	no_errors	ENST00000335870	ensembl	human	known	74_37	missense	9.43	48	5	SNP	0.001	A
ZNF222	7673	genome.wustl.edu	37	19	44537041	44537041	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr19:44537041G>C	ENST00000187879.8	+	4	1376	c.1214G>C	c.(1213-1215)aGg>aCg	p.R405T	ZNF222_ENST00000391960.3_Missense_Mutation_p.R445T|ZNF223_ENST00000591793.1_Intron	NM_013360.2	NP_037492.2	Q9UK12	ZN222_HUMAN	zinc finger protein 222	405					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20		Prostate(69;0.0435)				TGTGGAAAGAGGCTTGTATGC	0.448																																																	0													96.0	97.0	97.0					19																	44537041		2203	4300	6503	SO:0001583	missense	0			AF187988	CCDS33045.1, CCDS46098.1	19q13.2	2013-01-08				ENSG00000159885		"""Zinc fingers, C2H2-type"", ""-"""	13015	protein-coding gene	gene with protein product							Standard	NM_013360		Approved		uc002oye.3	Q9UK12		ENST00000187879.8:c.1214G>C	19.37:g.44537041G>C	ENSP00000187879:p.Arg405Thr		G5E9B9|Q8N6G7|Q9P1U5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R445T	ENST00000187879.8	37	c.1334	CCDS33045.1	19	.	.	.	.	.	.	.	.	.	.	G	0.799	-0.756204	0.03019	.	.	ENSG00000159885	ENST00000391960;ENST00000187879;ENST00000251272	T;T	0.07327	3.2;3.2	2.71	-5.41	0.02648	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02970	0.0088	N	0.02960	-0.455	0.09310	N	1	P;P	0.37548	0.58;0.599	B;B	0.42245	0.381;0.15	T	0.35649	-0.9780	9	0.25751	T	0.34	.	2.0669	0.03605	0.1987:0.2683:0.3974:0.1357	.	445;405	G5E9B9;Q9UK12	.;ZN222_HUMAN	T	445;405;351	ENSP00000375822:R445T;ENSP00000187879:R405T	ENSP00000187879:R405T	R	+	2	0	ZNF222	49228881	0.000000	0.05858	0.000000	0.03702	0.187000	0.23431	0.280000	0.18790	-0.834000	0.04239	0.205000	0.17691	AGG	ZNF222	-	pfscan_Znf_C2H2	ENSG00000159885		0.448	ZNF222-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF222	HGNC	protein_coding	OTTHUMT00000460465.2		0.00	30	0	G			44537041	+1			no_errors	ENST00000391960	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.000	C
ZNF300	91975	genome.wustl.edu	37	5	150275679	150275679	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr5:150275679T>C	ENST00000274599.5	-	6	1542	c.1122A>G	c.(1120-1122)atA>atG	p.I374M	ZNF300_ENST00000418587.2_Missense_Mutation_p.I338M|ZNF300_ENST00000446148.2_Missense_Mutation_p.I390M|ZNF300_ENST00000427179.1_3'UTR|ZNF300_ENST00000394226.2_Missense_Mutation_p.I374M	NM_052860.2	NP_443092.1	Q96RE9	ZN300_HUMAN	zinc finger protein 300	374					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)	27		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCCCAGTATGTATTCTCTGAT	0.443																																																	0													57.0	57.0	57.0					5																	150275679		2203	4298	6501	SO:0001583	missense	0			AF395541	CCDS4311.2, CCDS54939.1, CCDS54940.1	5q33.1	2013-01-08			ENSG00000145908	ENSG00000145908		"""Zinc fingers, C2H2-type"", ""-"""	13091	protein-coding gene	gene with protein product		612429				14746915	Standard	NM_052860		Approved		uc021yfx.1	Q96RE9	OTTHUMG00000130076	ENST00000274599.5:c.1122A>G	5.37:g.150275679T>C	ENSP00000274599:p.Ile374Met		A8MY91|B3KU35|B4DU78|F5GWS1|Q06DQ3|Q17RP3|Q5H9N5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I390M	ENST00000274599.5	37	c.1170	CCDS4311.2	5	.	.	.	.	.	.	.	.	.	.	T	15.14	2.744551	0.49151	.	.	ENSG00000145908	ENST00000446148;ENST00000274599;ENST00000418587;ENST00000394226	T;T;T;T	0.07800	3.16;3.16;3.16;3.16	3.87	-2.24	0.06909	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12987	0.0315	L	0.45470	1.425	0.22996	N	0.998459	D	0.61697	0.99	P	0.62491	0.903	T	0.16188	-1.0411	9	0.59425	D	0.04	.	1.0662	0.01611	0.415:0.1417:0.0996:0.3436	.	374	Q96RE9	ZN300_HUMAN	M	390;374;338;374	ENSP00000397178:I390M;ENSP00000274599:I374M;ENSP00000392593:I338M;ENSP00000377773:I374M	ENSP00000274599:I374M	I	-	3	3	ZNF300	150255872	0.040000	0.19996	0.988000	0.46212	0.998000	0.95712	-0.282000	0.08445	-0.485000	0.06754	0.482000	0.46254	ATA	ZNF300	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000145908		0.443	ZNF300-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF300	HGNC	protein_coding		-	0.00	76	0	T	NM_052860		150275679	-1	tier1	-	no_errors	ENST00000446148	ensembl	human	known	74_37	missense	7.78	83	7	SNP	0.989	C
ZNF536	9745	genome.wustl.edu	37	19	30936232	30936232	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr19:30936232T>C	ENST00000355537.3	+	2	1910	c.1763T>C	c.(1762-1764)gTg>gCg	p.V588A		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	588					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					AGCACTAAAGTGGGCAGCCAG	0.517																																																	0													79.0	83.0	82.0					19																	30936232		2203	4300	6503	SO:0001583	missense	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1763T>C	19.37:g.30936232T>C	ENSP00000347730:p.Val588Ala		A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V588A	ENST00000355537.3	37	c.1763	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	T	0	-2.604704	0.00123	.	.	ENSG00000198597	ENST00000355537	T	0.39997	1.05	5.53	2.29	0.28610	.	0.248135	0.41294	N	0.000920	T	0.21921	0.0528	N	0.08118	0	0.34321	D	0.686585	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.10474	-1.0628	10	0.54805	T	0.06	-20.2463	9.4449	0.38690	0.0:0.2048:0.0:0.7952	.	588;588	A7E228;O15090	.;ZN536_HUMAN	A	588	ENSP00000347730:V588A	ENSP00000347730:V588A	V	+	2	0	ZNF536	35628072	1.000000	0.71417	1.000000	0.80357	0.120000	0.20174	2.442000	0.44873	0.062000	0.16340	-0.256000	0.11100	GTG	ZNF536	-	NULL	ENSG00000198597		0.517	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	-	0.00	53	0	T	NM_014717		30936232	+1	tier1	-	no_errors	ENST00000355537	ensembl	human	known	74_37	missense	17.31	43	9	SNP	1.000	C
ZNF831	128611	genome.wustl.edu	37	20	57829715	57829715	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3YA-01A-11D-A247-09	TCGA-IG-A3YA-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	83152189-f14c-4816-b37f-1c7c9415b42c	279e35d6-308d-46ad-944d-0ef7e38237b1	g.chr20:57829715C>A	ENST00000371030.2	+	5	4951	c.4951C>A	c.(4951-4953)Ctg>Atg	p.L1651M		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1651							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GAAGAGGAGTCTGGAAGGAAT	0.438																																																	0													60.0	58.0	59.0					20																	57829715		1878	4112	5990	SO:0001583	missense	0			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.4951C>A	20.37:g.57829715C>A	ENSP00000360069:p.Leu1651Met		Q5TDR4|Q8TCP0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L1651M	ENST00000371030.2	37	c.4951	CCDS42894.1	20	.	.	.	.	.	.	.	.	.	.	C	17.88	3.496343	0.64186	.	.	ENSG00000124203	ENST00000371030	T	0.17528	2.27	5.66	-4.42	0.03579	.	0.000000	0.41097	D	0.000945	T	0.33411	0.0862	M	0.66939	2.045	0.24988	N	0.991554	D	0.89917	1.0	D	0.91635	0.999	T	0.17349	-1.0372	10	0.87932	D	0	-11.2611	13.4977	0.61436	0.0:0.6114:0.0:0.3886	.	1651	Q5JPB2	ZN831_HUMAN	M	1651	ENSP00000360069:L1651M	ENSP00000360069:L1651M	L	+	1	2	ZNF831	57263110	0.941000	0.31946	0.833000	0.33012	0.973000	0.67179	0.088000	0.14979	-0.805000	0.04404	-0.312000	0.09012	CTG	ZNF831	-	NULL	ENSG00000124203		0.438	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	HGNC	protein_coding	OTTHUMT00000079916.2	-	0.00	20	0	C	NM_178457		57829715	+1	tier1	-	no_errors	ENST00000371030	ensembl	human	novel	74_37	missense	30.00	7	3	SNP	0.554	A
