#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AASDH	132949	genome.wustl.edu	37	4	57215467	57215467	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:57215467G>A	ENST00000205214.6	-	11	2630	c.2450C>T	c.(2449-2451)tCa>tTa	p.S817L	AASDH_ENST00000602986.1_Missense_Mutation_p.S664L|AASDH_ENST00000513376.1_Missense_Mutation_p.S717L|AASDH_ENST00000451613.1_Missense_Mutation_p.S817L|AASDH_ENST00000502617.1_Missense_Mutation_p.S817L|AASDH_ENST00000434343.2_Missense_Mutation_p.S332L	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	817					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				TACACATGCTGAGGATTCAAT	0.363																																																	0													83.0	83.0	83.0					4																	57215467		2203	4300	6503	SO:0001583	missense	0			AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.2450C>T	4.37:g.57215467G>A	ENSP00000205214:p.Ser817Leu		A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_Acyl_carrier_prot-like,superfamily_Quinonprotein_ADH-like_supfam,superfamily_Acyl_carrier_prot-like,smart_PQQ_beta_propeller_repeat,pfscan_Acyl_carrier_prot-like	p.S817L	ENST00000205214.6	37	c.2450	CCDS3504.1	4	.	.	.	.	.	.	.	.	.	.	G	33	5.277516	0.95459	.	.	ENSG00000157426	ENST00000205214;ENST00000513376;ENST00000434343;ENST00000451613;ENST00000503808;ENST00000502617	T;T;T;T;T	0.54866	0.89;0.55;0.89;0.55;0.55	5.9	5.9	0.94986	Quinonprotein alcohol dehydrogenase-like (2);	0.000000	0.85682	D	0.000000	T	0.81851	0.4910	H	0.94306	3.52	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.85943	0.1459	10	0.87932	D	0	-18.2685	20.2789	0.98501	0.0:0.0:1.0:0.0	.	664;817;817;817	E9PH98;Q4L235-4;Q4L235-3;Q4L235	.;.;.;ACSF4_HUMAN	L	817;717;332;817;664;817	ENSP00000205214:S817L;ENSP00000423760:S717L;ENSP00000392158:S332L;ENSP00000409656:S817L;ENSP00000421171:S817L	ENSP00000205214:S817L	S	-	2	0	AASDH	56910224	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.168000	0.94781	2.788000	0.95919	0.650000	0.86243	TCA	AASDH	-	superfamily_Quinonprotein_ADH-like_supfam	ENSG00000157426		0.363	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AASDH	HGNC	protein_coding	OTTHUMT00000250780.1	-	0.00	34	0	G	NM_181806		57215467	-1	tier1	-	no_errors	ENST00000205214	ensembl	human	known	74_37	missense	15.38	21	4	SNP	1.000	A
ABCA13	154664	genome.wustl.edu	37	7	48520703	48520703	+	Nonsense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:48520703C>G	ENST00000435803.1	+	46	13070	c.13046C>G	c.(13045-13047)tCa>tGa	p.S4349*	ABCA13_ENST00000544596.1_Nonsense_Mutation_p.S79*	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4349					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTGAATCTCTCAGGCTTCAAT	0.408																																																	0													91.0	88.0	89.0					7																	48520703		1863	4121	5984	SO:0001587	stop_gained	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.13046C>G	7.37:g.48520703C>G	ENSP00000411096:p.Ser4349*		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S4349*	ENST00000435803.1	37	c.13046	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	C	54	22.228524	0.99946	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	.	.	.	5.35	5.35	0.76521	.	0.000000	0.40640	N	0.001057	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.1462	0.81575	0.0:1.0:0.0:0.0	.	.	.	.	X	4349;122;79	.	ENSP00000391042:S122X	S	+	2	0	ABCA13	48491249	0.789000	0.28775	0.399000	0.26333	0.418000	0.31294	3.978000	0.56881	2.667000	0.90743	0.585000	0.79938	TCA	ABCA13	-	NULL	ENSG00000179869		0.408	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	-	0.00	64	0	C	NM_152701		48520703	+1	tier1	-	no_errors	ENST00000435803	ensembl	human	known	74_37	nonsense	26.32	70	25	SNP	0.701	G
ABCC12	94160	genome.wustl.edu	37	16	48117642	48117642	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr16:48117642G>T	ENST00000311303.3	-	29	4409	c.4064C>A	c.(4063-4065)gCa>gAa	p.A1355E	ABCC12_ENST00000416054.1_3'UTR|ABCC12_ENST00000448542.1_3'UTR|ABCC12_ENST00000532355.1_5'Flank	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	1355						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				TCTGACTTCTGCTGCTAGTAA	0.488																																																	0													184.0	195.0	191.0					16																	48117642		2201	4300	6501	SO:0001583	missense	0			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.4064C>A	16.37:g.48117642G>T	ENSP00000311030:p.Ala1355Glu		Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.A1355E	ENST00000311303.3	37	c.4064	CCDS10730.1	16	.	.	.	.	.	.	.	.	.	.	G	17.47	3.396670	0.62177	.	.	ENSG00000140798	ENST00000311303	D	0.92048	-2.96	5.5	5.5	0.81552	.	0.062959	0.64402	D	0.000007	D	0.91348	0.7271	L	0.42245	1.32	0.80722	D	1	D	0.61080	0.989	P	0.52031	0.688	D	0.91641	0.5327	10	0.72032	D	0.01	.	11.64	0.51227	0.0824:0.0:0.9176:0.0	.	1355	Q96J65	MRP9_HUMAN	E	1355	ENSP00000311030:A1355E	ENSP00000311030:A1355E	A	-	2	0	ABCC12	46675143	1.000000	0.71417	1.000000	0.80357	0.202000	0.24057	6.070000	0.71220	2.555000	0.86185	0.655000	0.94253	GCA	ABCC12	-	NULL	ENSG00000140798		0.488	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC12	HGNC	protein_coding	OTTHUMT00000256837.1	-	0.00	56	0	G	NM_033226		48117642	-1	tier1	-	no_errors	ENST00000311303	ensembl	human	known	74_37	missense	27.12	43	16	SNP	1.000	T
ACACB	32	genome.wustl.edu	37	12	109673410	109673410	+	Splice_Site	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:109673410G>A	ENST00000338432.7	+	33	4523		c.e33-1		ACACB_ENST00000543201.1_Splice_Site|ACACB_ENST00000377848.3_Splice_Site|ACACB_ENST00000377854.5_Splice_Site			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta						acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	TCTTTTTGCAGAAAGAATTTC	0.323																																																	0													141.0	127.0	132.0					12																	109673410		2203	4300	6503	SO:0001630	splice_region_variant	0			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.4405-1G>A	12.37:g.109673410G>A			A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Splice_Site	SNP	-	e32-1	ENST00000338432.7	37	c.4405-1	CCDS31898.1	12	.	.	.	.	.	.	.	.	.	.	G	20.9	4.072932	0.76415	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027;ENST00000543201	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8809	0.92356	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACACB	108157793	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.772000	0.98984	2.546000	0.85860	0.609000	0.83330	.	ACACB	-	-	ENSG00000076555		0.323	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	HGNC	protein_coding	OTTHUMT00000403077.1	-	0.00	88	0	G	NM_001093	Intron	109673410	+1	tier1	-	no_errors	ENST00000338432	ensembl	human	known	74_37	splice_site	8.89	82	8	SNP	1.000	A
ACTRT1	139741	genome.wustl.edu	37	X	127185305	127185305	+	Missense_Mutation	SNP	A	A	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chrX:127185305A>C	ENST00000371124.3	-	1	1077	c.881T>G	c.(880-882)cTt>cGt	p.L294R		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	294						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						GTCTGCATAAAGTTTATTCTG	0.522																																																	0													98.0	91.0	93.0					X																	127185305		2203	4300	6503	SO:0001583	missense	0			AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.881T>G	X.37:g.127185305A>C	ENSP00000360165:p.Leu294Arg		Q6X7C1|Q96L10	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.L294R	ENST00000371124.3	37	c.881	CCDS14611.1	X	.	.	.	.	.	.	.	.	.	.	A	12.17	1.858304	0.32791	.	.	ENSG00000123165	ENST00000371124	D	0.98060	-4.69	3.58	3.58	0.41010	.	0.000000	0.52532	D	0.000072	D	0.99190	0.9719	H	0.99261	4.49	0.44515	D	0.997463	D	0.89917	1.0	D	0.87578	0.998	D	0.98262	1.0499	10	0.87932	D	0	.	9.6661	0.39986	1.0:0.0:0.0:0.0	.	294	Q8TDG2	ACTT1_HUMAN	R	294	ENSP00000360165:L294R	ENSP00000360165:L294R	L	-	2	0	ACTRT1	127012986	0.987000	0.35691	0.016000	0.15963	0.041000	0.13682	4.141000	0.58038	1.637000	0.50538	0.486000	0.48141	CTT	ACTRT1	-	pfam_Actin-related,smart_Actin-related	ENSG00000123165		0.522	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTRT1	HGNC	protein_coding	OTTHUMT00000058192.1	-	0.00	26	0	A	NM_138289		127185305	-1	tier1	-	no_errors	ENST00000371124	ensembl	human	known	74_37	missense	45.16	17	14	SNP	1.000	C
ADAM2	2515	genome.wustl.edu	37	8	39607208	39607208	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:39607208G>T	ENST00000265708.4	-	17	1956	c.1853C>A	c.(1852-1854)aCt>aAt	p.T618N	ADAM2_ENST00000347580.4_Missense_Mutation_p.T599N|ADAM2_ENST00000521880.1_Missense_Mutation_p.T555N|ADAM2_ENST00000379853.2_Missense_Mutation_p.T462N	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	618	EGF-like.				adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		GCATTTGTCAGTAGTACAATC	0.358																																																	0													156.0	143.0	147.0					8																	39607208		2203	4300	6503	SO:0001583	missense	0			U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.1853C>A	8.37:g.39607208G>T	ENSP00000265708:p.Thr618Asn		P78326|Q9UQQ8	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.T618N	ENST00000265708.4	37	c.1853	CCDS34884.1	8	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.568870	0.00895	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55	4.21	-2.65	0.06095	.	.	.	.	.	T	0.75766	0.3894	N	0.16368	0.405	0.09310	N	1	B;B;B;B	0.15473	0.01;0.005;0.013;0.007	B;B;B;B	0.23018	0.043;0.011;0.026;0.011	T	0.59936	-0.7360	9	0.25751	T	0.34	.	4.8921	0.13731	0.1831:0.0:0.2462:0.5707	.	555;462;599;618	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	N	599;462;618;555	ENSP00000343854:T599N;ENSP00000369182:T462N;ENSP00000265708:T618N;ENSP00000429352:T555N	ENSP00000265708:T618N	T	-	2	0	ADAM2	39726365	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.069000	0.11542	-0.452000	0.07087	-0.953000	0.02652	ACT	ADAM2	-	NULL	ENSG00000104755		0.358	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM2	HGNC	protein_coding	OTTHUMT00000376926.1		0.00	22	0	G	NM_001464		39607208	-1			no_errors	ENST00000265708	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.000	T
ADAM21	8747	genome.wustl.edu	37	14	70925471	70925471	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr14:70925471C>G	ENST00000603540.1	+	2	1513	c.1255C>G	c.(1255-1257)Cag>Gag	p.Q419E	ADAM21_ENST00000267499.3_Missense_Mutation_p.Q419E|RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	419	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		AAGAGAAGAGCAGTGTGACTG	0.498																																																	0													70.0	68.0	68.0					14																	70925471		2203	4300	6503	SO:0001583	missense	0			AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.1255C>G	14.37:g.70925471C>G	ENSP00000474385:p.Gln419Glu		O43507|Q2VPC6|Q32MR0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.Q419E	ENST00000603540.1	37	c.1255	CCDS9804.1	14	.	.	.	.	.	.	.	.	.	.	C	0	-2.617198	0.00118	.	.	ENSG00000139985	ENST00000267499	T	0.09073	3.02	4.48	1.19	0.21007	Blood coagulation inhibitor, Disintegrin (4);	0.312344	0.21860	N	0.068042	T	0.02193	0.0068	N	0.01250	-0.93	0.24595	N	0.993805	B	0.10296	0.003	B	0.20184	0.028	T	0.47749	-0.9093	10	0.02654	T	1	.	9.0036	0.36097	0.1033:0.3999:0.4968:0.0	.	419	Q9UKJ8	ADA21_HUMAN	E	419	ENSP00000267499:Q419E	ENSP00000267499:Q419E	Q	+	1	0	ADAM21	69995224	0.008000	0.16893	0.968000	0.41197	0.175000	0.22909	-1.222000	0.02965	0.534000	0.28695	-0.357000	0.07601	CAG	ADAM21	-	pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin	ENSG00000139985		0.498	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM21	HGNC	protein_coding	OTTHUMT00000413008.3	-	0.00	108	0	C			70925471	+1	tier1	-	no_errors	ENST00000267499	ensembl	human	known	74_37	missense	13.00	87	13	SNP	0.986	G
ADAM20	8748	genome.wustl.edu	37	14	70991384	70991384	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr14:70991384C>A	ENST00000256389.3	-	2	485	c.241G>T	c.(241-243)Gcc>Tcc	p.A81S	RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003814.4	NP_003805.3	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20	31					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(2)	27			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		GAGGGCCTGGCCTGAGAGTGG	0.537																																																	0													73.0	66.0	68.0					14																	70991384		2203	4300	6503	SO:0001583	missense	0			AF029899	CCDS32111.1	14q24.2	2012-04-30	2005-08-18		ENSG00000134007	ENSG00000134007		"""ADAM metallopeptidase domain containing"""	199	protein-coding gene	gene with protein product		603712	"""a disintegrin and metalloproteinase domain 20"""			9469942	Standard	NM_003814		Approved		uc001xme.3	O43506	OTTHUMG00000167548	ENST00000256389.3:c.241G>T	14.37:g.70991384C>A	ENSP00000256389:p.Ala81Ser		Q6GTZ1|Q9UKJ9	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.A81S	ENST00000256389.3	37	c.241	CCDS32111.1	14	.	.	.	.	.	.	.	.	.	.	C	9.064	0.995185	0.19043	.	.	ENSG00000134007	ENST00000256389	T	0.00912	5.55	4.04	0.00712	0.14070	.	.	.	.	.	T	0.00875	0.0029	L	0.46157	1.445	0.09310	N	1	B	0.20780	0.048	B	0.19946	0.027	T	0.48328	-0.9045	9	0.09084	T	0.74	.	3.9885	0.09527	0.1638:0.4657:0.0:0.3705	.	31	O43506	ADA20_HUMAN	S	81	ENSP00000256389:A81S	ENSP00000256389:A81S	A	-	1	0	ADAM20	70061137	0.000000	0.05858	0.443000	0.26883	0.136000	0.21042	-0.322000	0.08007	0.099000	0.17552	0.650000	0.86243	GCC	ADAM20	-	pfam_Peptidase_M12B_N	ENSG00000134007		0.537	ADAM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM20	HGNC	protein_coding	OTTHUMT00000395004.2		0.00	31	0	C			70991384	-1			no_errors	ENST00000256389	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.006	A
ADAMTS12	81792	genome.wustl.edu	37	5	33549455	33549455	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:33549455G>T	ENST00000504830.1	-	21	4494	c.4159C>A	c.(4159-4161)Cgc>Agc	p.R1387S	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.R1302S	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1387	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R1387C(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TGAATCTCGCGTATCTTGAAG	0.557										HNSCC(64;0.19)																																							1	Substitution - Missense(1)	large_intestine(1)											85.0	95.0	92.0					5																	33549455		2203	4300	6503	SO:0001583	missense	0			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4159C>A	5.37:g.33549455G>T	ENSP00000422554:p.Arg1387Ser		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R1387S	ENST00000504830.1	37	c.4159	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	G	20.8	4.055417	0.75960	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.78364	-1.17;-1.17	5.16	4.27	0.50696	.	0.000000	0.85682	D	0.000000	D	0.91071	0.7190	H	0.96333	3.805	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.87578	0.998;0.991	D	0.92765	0.6227	10	0.87932	D	0	.	12.2147	0.54400	0.0:0.0:0.8289:0.1711	.	1302;1387	P58397-3;P58397	.;ATS12_HUMAN	S	1387;1302	ENSP00000422554:R1387S;ENSP00000344847:R1302S	ENSP00000344847:R1302S	R	-	1	0	ADAMTS12	33585212	1.000000	0.71417	0.993000	0.49108	0.986000	0.74619	4.136000	0.58004	1.140000	0.42260	0.650000	0.86243	CGC	ADAMTS12	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt	ENSG00000151388		0.557	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	HGNC	protein_coding	OTTHUMT00000367164.2		0.00	54	0	G	NM_030955		33549455	-1			no_errors	ENST00000504830	ensembl	human	known	74_37	missense	6.12	46	3	SNP	0.996	T
ADH7	131	genome.wustl.edu	37	4	100334317	100334317	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:100334317G>T	ENST00000209665.4	-	9	1389	c.1149C>A	c.(1147-1149)gtC>gtA	p.V383V	ADH7_ENST00000482593.1_Silent_p.V314V|ADH7_ENST00000476959.1_Silent_p.V391V|ADH7_ENST00000437033.2_Silent_p.V371V	NM_000673.4	NP_000664.2	P40394	ADH7_HUMAN	alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide	383					ethanol catabolic process (GO:0006068)|ethanol oxidation (GO:0006069)|extracellular negative regulation of signal transduction (GO:1900116)|fatty acid omega-oxidation (GO:0010430)|oxidation-reduction process (GO:0055114)|response to bacterium (GO:0009617)|response to ethanol (GO:0045471)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular region (GO:0005576)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|aldehyde oxidase activity (GO:0004031)|ethanol binding (GO:0035276)|receptor antagonist activity (GO:0048019)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)	19				OV - Ovarian serous cystadenocarcinoma(123;1.75e-08)		AAAACGTCAGGACCGTTCGAA	0.378																																																	0													145.0	135.0	138.0					4																	100334317		2203	4300	6503	SO:0001819	synonymous_variant	0			X76342	CCDS34034.1, CCDS54781.1	4q23-q24	2008-02-05			ENSG00000196344	ENSG00000196344	1.1.1.1	"""Alcohol dehydrogenases"""	256	protein-coding gene	gene with protein product		600086				8195208	Standard	NM_000673		Approved	ADH-4	uc021xqj.1	P40394	OTTHUMG00000159318	ENST00000209665.4:c.1149C>A	4.37:g.100334317G>T			A2RRB6|A8MVN9|B2R760|B4DWV6|Q13713	Silent	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like	p.V383	ENST00000209665.4	37	c.1149	CCDS34034.1	4																																																																																			ADH7	-	superfamily_GroES-like	ENSG00000196344		0.378	ADH7-201	KNOWN	basic|CCDS	protein_coding	ADH7	HGNC	protein_coding		-	0.00	38	0	G	NM_000673		100334317	-1	tier1	-	no_errors	ENST00000209665	ensembl	human	known	74_37	silent	8.16	45	4	SNP	0.992	T
ADPRHL1	113622	genome.wustl.edu	37	13	114098801	114098801	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr13:114098801G>T	ENST00000375418.3	-	2	404	c.318C>A	c.(316-318)ggC>ggA	p.G106G	ADPRHL1_ENST00000356501.4_Silent_p.G24G	NM_138430.3	NP_612439.2	Q8NDY3	ARHL1_HUMAN	ADP-ribosylhydrolase like 1	106					protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)			endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	11	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.0195)|GBM - Glioblastoma multiforme(44;0.116)			GCTGAGCACAGCCTTCAATGG	0.532																																																	0													234.0	214.0	221.0					13																	114098801		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ313429	CCDS9535.1, CCDS9536.1	13q34	2003-06-19			ENSG00000153531	ENSG00000153531			21303	protein-coding gene	gene with protein product		610620				12070318	Standard	NM_138430		Approved	ARH2	uc001vtq.1	Q8NDY3	OTTHUMG00000017386	ENST00000375418.3:c.318C>A	13.37:g.114098801G>T			Q5JUG2|Q96GD1	Silent	SNP	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1,pirsf_ADP-ribosylarg_hydro	p.G106	ENST00000375418.3	37	c.318	CCDS9535.1	13																																																																																			ADPRHL1	-	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1,pirsf_ADP-ribosylarg_hydro	ENSG00000153531		0.532	ADPRHL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPRHL1	HGNC	protein_coding	OTTHUMT00000045915.2	-	0.00	55	0	G	NM_138430		114098801	-1	tier1	-	no_errors	ENST00000375418	ensembl	human	known	74_37	silent	7.02	53	4	SNP	1.000	T
AGBL2	79841	genome.wustl.edu	37	11	47688578	47688578	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:47688578G>T	ENST00000525123.1	-	17	2663	c.2378C>A	c.(2377-2379)cCa>cAa	p.P793Q	AGBL2_ENST00000528244.1_Missense_Mutation_p.P755Q|AGBL2_ENST00000357610.3_Missense_Mutation_p.P795Q|AGBL2_ENST00000529712.1_5'Flank|AGBL2_ENST00000298861.4_Missense_Mutation_p.P793Q	NM_024783.3	NP_079059.2	Q5U5Z8	CBPC2_HUMAN	ATP/GTP binding protein-like 2	793						cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)	34						GAAAAAGGTTGGCTGCTTTTG	0.333																																																	0													58.0	59.0	59.0					11																	47688578		2201	4298	6499	SO:0001583	missense	0				CCDS7944.1	11p11.2	2014-06-23			ENSG00000165923	ENSG00000165923			26296	protein-coding gene	gene with protein product	"""cytoplasmic carboxypeptidase 2"""					12738998, 21303978	Standard	NM_024783		Approved	FLJ23598, CCP2	uc001ngg.3	Q5U5Z8	OTTHUMG00000165368	ENST00000525123.1:c.2378C>A	11.37:g.47688578G>T	ENSP00000435582:p.Pro793Gln		A8MPX2|Q53FV5|Q8IV57|Q9H5C0	Missense_Mutation	SNP	pfam_Peptidase_M14	p.P795Q	ENST00000525123.1	37	c.2384	CCDS7944.1	11	.	.	.	.	.	.	.	.	.	.	G	10.23	1.293641	0.23564	.	.	ENSG00000165923	ENST00000528609;ENST00000525123;ENST00000357610;ENST00000298861;ENST00000528244	T;T;T;T	0.09817	3.01;3.01;3.01;2.94	5.3	0.957	0.19613	.	1.124620	0.06768	N	0.782959	T	0.11196	0.0273	L	0.57536	1.79	0.09310	N	1	P;B	0.45474	0.859;0.144	B;B	0.40009	0.316;0.016	T	0.28235	-1.0050	10	0.45353	T	0.12	-0.9689	3.0386	0.06130	0.0877:0.156:0.435:0.3213	.	755;793	F6U0I4;Q5U5Z8	.;CBPC2_HUMAN	Q	176;793;795;793;755	ENSP00000435582:P793Q;ENSP00000350228:P795Q;ENSP00000298861:P793Q;ENSP00000436630:P755Q	ENSP00000298861:P793Q	P	-	2	0	AGBL2	47645154	0.005000	0.15991	0.010000	0.14722	0.070000	0.16714	0.224000	0.17738	0.296000	0.22592	0.591000	0.81541	CCA	AGBL2	-	NULL	ENSG00000165923		0.333	AGBL2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	AGBL2	HGNC	protein_coding	OTTHUMT00000383726.2		0.00	23	0	G	NM_024783		47688578	-1			no_errors	ENST00000357610	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.001	T
AGBL5	60509	genome.wustl.edu	37	2	27276293	27276293	+	Missense_Mutation	SNP	G	G	A	rs373073782		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:27276293G>A	ENST00000360131.4	+	3	398	c.239G>A	c.(238-240)cGg>cAg	p.R80Q	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Missense_Mutation_p.R80Q	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	80					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCAGCGTCCGGGGAGGAATG	0.527													G|||	1	0.000199681	0.0	0.0	5008	,	,		20425	0.0		0.0	False		,,,				2504	0.001																0								G	GLN/ARG,GLN/ARG	0,4406		0,0,2203	110.0	102.0	104.0		239,239	5.5	1.0	2		104	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	AGBL5	NM_001035507.2,NM_021831.5	43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	80/718,80/887	27276293	1,13005	2203	4300	6503	SO:0001583	missense	0			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.239G>A	2.37:g.27276293G>A	ENSP00000353249:p.Arg80Gln		A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	pfam_Peptidase_M14	p.R80Q	ENST00000360131.4	37	c.239	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	G	20.7	4.029841	0.75504	0.0	1.16E-4	ENSG00000084693	ENST00000453161;ENST00000323064;ENST00000360131	T;T	0.15017	2.48;2.46	5.52	5.52	0.82312	.	0.226270	0.42964	N	0.000634	T	0.32436	0.0829	L	0.42008	1.315	0.43647	D	0.996056	D;D;D	0.89917	1.0;0.999;1.0	P;P;D	0.65684	0.866;0.888;0.937	T	0.01096	-1.1453	10	0.20519	T	0.43	-8.1358	18.2118	0.89872	0.0:0.0:1.0:0.0	.	80;80;80	Q8NDL9;Q8NDL9-3;Q8NDL9-2	CBPC5_HUMAN;.;.	Q	80	ENSP00000323681:R80Q;ENSP00000353249:R80Q	ENSP00000323681:R80Q	R	+	2	0	AGBL5	27129797	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	3.818000	0.55678	2.586000	0.87340	0.561000	0.74099	CGG	AGBL5	-	NULL	ENSG00000084693		0.527	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	-	0.00	10	0	G	NM_021831		27276293	+1	tier1	-	no_errors	ENST00000360131	ensembl	human	known	74_37	missense	25.00	15	5	SNP	1.000	A
AGTPBP1	23287	genome.wustl.edu	37	9	88292466	88292466	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr9:88292466G>T	ENST00000357081.3	-	6	465	c.321C>A	c.(319-321)acC>acA	p.T107T	AGTPBP1_ENST00000376109.3_Silent_p.T159T|AGTPBP1_ENST00000376080.1_Silent_p.T49T|AGTPBP1_ENST00000376083.3_Silent_p.T107T|AGTPBP1_ENST00000376081.4_Silent_p.T107T|AGTPBP1_ENST00000337006.4_Silent_p.T49T|AGTPBP1_ENST00000491784.1_5'UTR|AGTPBP1_ENST00000432218.1_5'UTR			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	107					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						AACCACCTTTGGTGACTAAGA	0.299																																																	0													115.0	112.0	113.0					9																	88292466		2203	4300	6503	SO:0001819	synonymous_variant	0			AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.321C>A	9.37:g.88292466G>T			B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Silent	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.T159	ENST00000357081.3	37	c.477		9																																																																																			AGTPBP1	-	superfamily_ARM-type_fold	ENSG00000135049		0.299	AGTPBP1-004	KNOWN	basic	protein_coding	AGTPBP1	HGNC	protein_coding	OTTHUMT00000052893.1		0.00	21	0	G	NM_015239		88292466	-1			no_errors	ENST00000376109	ensembl	human	known	74_37	silent	12.50	28	4	SNP	0.998	T
AK9	221264	genome.wustl.edu	37	6	109935625	109935625	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:109935625G>T	ENST00000424296.2	-	14	1534	c.1458C>A	c.(1456-1458)ttC>ttA	p.F486L	AK9_ENST00000368948.2_Missense_Mutation_p.F486L|AK9_ENST00000341338.6_5'UTR	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	486					ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										CCTCCATTGGGAATACTCCAA	0.343																																																	0													139.0	116.0	123.0					6																	109935625		692	1591	2283	SO:0001583	missense	0			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.1458C>A	6.37:g.109935625G>T	ENSP00000410186:p.Phe486Leu		A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_YHS_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.F486L	ENST00000424296.2	37	c.1458	CCDS55048.1	6	.	.	.	.	.	.	.	.	.	.	G	2.748	-0.260714	0.05791	.	.	ENSG00000155085	ENST00000424296;ENST00000368948	T;T	0.64803	-0.02;-0.12	2.32	1.4	0.22301	.	1.607090	0.03997	N	0.295795	T	0.21550	0.0519	N	0.17082	0.46	0.18873	N	0.999985	B	0.06786	0.001	B	0.04013	0.001	T	0.08576	-1.0715	9	.	.	.	-0.642	6.1057	0.20071	0.0:0.0:0.6968:0.3032	.	486	Q5TCS8	AKD1_HUMAN	L	486	ENSP00000410186:F486L;ENSP00000357944:F486L	.	F	-	3	2	AKD1	110042318	0.001000	0.12720	0.013000	0.15412	0.002000	0.02628	0.624000	0.24462	0.509000	0.28195	-0.293000	0.09583	TTC	AK9	-	superfamily_P-loop_NTPase	ENSG00000155085		0.343	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AK9	HGNC	protein_coding		-	0.00	32	0	G	NM_001145128		109935625	-1	tier1	-	no_errors	ENST00000424296	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.015	T
ALMS1P	200420	genome.wustl.edu	37	2	73899496	73899496	+	RNA	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:73899496G>C	ENST00000450720.1	+	0	368					NR_003683.2		Q96L16	ALM1L_HUMAN	Alstrom syndrome 1 pseudogene						endosomal transport (GO:0016197)|regulation of stress fiber assembly (GO:0051492)												AAGTTCCAGCGAGGCTAAATT	0.453																																																	0																																												0			BC014492		2p13.2	2008-01-31	2008-01-31	2008-01-31	ENSG00000163016	ENSG00000163016			29586	pseudogene	pseudogene			"""Alstrom syndrome 1-like"""	ALMS1L		12477932	Standard	NR_003683		Approved		uc010yrl.2	Q96L16	OTTHUMG00000152773		2.37:g.73899496G>C				RNA	SNP	-	NULL	ENST00000450720.1	37	NULL		2																																																																																			ALMS1P	-	-	ENSG00000163016		0.453	ALMS1P-002	KNOWN	basic	processed_transcript	ALMS1P	HGNC	pseudogene	OTTHUMT00000339824.1	-	0.00	26	0	G	NR_003683		73899496	+1	tier1	-	no_errors	ENST00000450720	ensembl	human	known	74_37	rna	11.11	32	4	SNP	0.978	C
ALPK2	115701	genome.wustl.edu	37	18	56246602	56246602	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr18:56246602G>T	ENST00000361673.3	-	4	1619	c.1406C>A	c.(1405-1407)aCc>aAc	p.T469N	ALPK2_ENST00000587399.1_5'Flank	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	469						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						GCTGTCTCTGGTTTCTCCTTG	0.478											OREG0025011	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													150.0	151.0	151.0					18																	56246602		2203	4300	6503	SO:0001583	missense	0			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.1406C>A	18.37:g.56246602G>T	ENSP00000354991:p.Thr469Asn	1014	Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like_dom	p.T469N	ENST00000361673.3	37	c.1406	CCDS11966.2	18	.	.	.	.	.	.	.	.	.	.	G	16.07	3.018323	0.54576	.	.	ENSG00000198796	ENST00000361673	T	0.49720	0.77	5.21	2.16	0.27623	.	.	.	.	.	T	0.33265	0.0857	L	0.44542	1.39	0.25607	N	0.986537	B	0.32071	0.355	B	0.24974	0.057	T	0.11867	-1.0570	9	0.20046	T	0.44	-5.6669	7.956	0.30042	0.0:0.119:0.351:0.53	.	469	Q86TB3	ALPK2_HUMAN	N	469	ENSP00000354991:T469N	ENSP00000354991:T469N	T	-	2	0	ALPK2	54397582	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.489000	0.35562	1.180000	0.42898	-0.314000	0.08810	ACC	ALPK2	-	NULL	ENSG00000198796		0.478	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK2	HGNC	protein_coding	OTTHUMT00000256126.1	-	0.00	67	0	G	NM_052947		56246602	-1	tier1	-	no_errors	ENST00000361673	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.993	T
AMY2B	280	genome.wustl.edu	37	1	104113141	104113141	+	Intron	SNP	A	A	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:104113141A>G	ENST00000361355.4	+	3	570				AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)						carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		ACCTAGCACCATGAAGATCAA	0.557																																																	0																																										SO:0001627	intron_variant	0			M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.-46-1038A>G	1.37:g.104113141A>G			B3KTI1|B3KXB7|D3DT76|Q9UBH3	RNA	SNP	-	NULL	ENST00000361355.4	37	NULL	CCDS782.1	1																																																																																			AMY2B	-	-	ENSG00000240038		0.557	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1	-	0.00	127	0	A	NM_020978		104113141	+1	tier1	-	no_errors	ENST00000491397	ensembl	human	known	74_37	rna	6.74	83	6	SNP	1.000	G
ANKRD18B	441459	genome.wustl.edu	37	9	33541216	33541216	+	Missense_Mutation	SNP	G	G	C	rs111814125		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr9:33541216G>C	ENST00000290943.6	+	7	976	c.880G>C	c.(880-882)Ggt>Cgt	p.G294R		NM_001244752.1	NP_001231681.1	A2A2Z9	AN18B_HUMAN	ankyrin repeat domain 18B	294								p.G294R(1)		NS(1)|breast(1)|endometrium(2)|lung(1)|prostate(1)|stomach(1)	7						aagaaaagaaGGTGCAAAAGG	0.343																																																	1	Substitution - Missense(1)	prostate(1)																																								SO:0001583	missense	0					9p13.3	2013-01-10			ENSG00000230453	ENSG00000230453		"""Ankyrin repeat domain containing"""	23644	protein-coding gene	gene with protein product							Standard	NM_001244752		Approved	bA255A11.3	uc010mjw.2	A2A2Z9	OTTHUMG00000019776	ENST00000290943.6:c.880G>C	9.37:g.33541216G>C	ENSP00000290943:p.Gly294Arg			Missense_Mutation	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G294R	ENST00000290943.6	37	c.880		9	.	.	.	.	.	.	.	.	.	.	g	0.030	-1.339649	0.01277	.	.	ENSG00000230453	ENST00000290943	T	0.26660	1.72	0.225	0.225	0.15325	.	.	.	.	.	T	0.18087	0.0434	.	.	.	0.23076	N	0.998333	.	.	.	.	.	.	T	0.34625	-0.9821	4	0.19147	T	0.46	.	.	.	.	.	.	.	.	R	294	ENSP00000290943:G294R	ENSP00000290943:G294R	G	+	1	0	ANKRD18B	33531216	0.013000	0.17824	0.008000	0.14137	0.008000	0.06430	0.337000	0.19841	0.300000	0.22699	0.305000	0.20034	GGT	ANKRD18B	-	NULL	ENSG00000230453		0.343	ANKRD18B-002	KNOWN	basic|appris_principal	protein_coding	ANKRD18B	HGNC	protein_coding	OTTHUMT00000313729.2	-	0.00	30	0	G	XM_001718334		33541216	+1	tier1	rs111814125	no_errors	ENST00000290943	ensembl	human	known	74_37	missense	15.79	32	6	SNP	0.009	C
ANLN	54443	genome.wustl.edu	37	7	36447401	36447401	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:36447401G>T	ENST00000265748.2	+	5	1153	c.932G>T	c.(931-933)gGa>gTa	p.G311V	ANLN_ENST00000396068.2_Missense_Mutation_p.G311V|ANLN_ENST00000495714.1_3'UTR	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	311	Interaction with F-actin.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						AGTTGTGAGGGACAAAATCCT	0.388																																																	0													82.0	88.0	86.0					7																	36447401		2203	4300	6503	SO:0001583	missense	0			AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.932G>T	7.37:g.36447401G>T	ENSP00000265748:p.Gly311Val		Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.G311V	ENST00000265748.2	37	c.932	CCDS5447.1	7	.	.	.	.	.	.	.	.	.	.	G	3.383	-0.125925	0.06795	.	.	ENSG00000011426	ENST00000265748;ENST00000396068	T;T	0.10668	2.88;2.85	4.46	-6.53	0.01866	.	1.536870	0.03584	N	0.230603	T	0.03564	0.0102	N	0.01800	-0.715	0.24703	N	0.99325	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.0	T	0.40701	-0.9549	10	0.21014	T	0.42	0.3057	7.6101	0.28124	0.0:0.2059:0.4693:0.3248	.	188;311;311;311	B4DSL6;A8K5D9;Q9NQW6-2;Q9NQW6	.;.;.;ANLN_HUMAN	V	311	ENSP00000265748:G311V;ENSP00000379380:G311V	ENSP00000265748:G311V	G	+	2	0	ANLN	36413926	0.246000	0.23909	0.016000	0.15963	0.194000	0.23727	-0.170000	0.09897	-1.248000	0.02503	-0.505000	0.04504	GGA	ANLN	-	NULL	ENSG00000011426		0.388	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANLN	HGNC	protein_coding	OTTHUMT00000218582.3	-	0.00	45	0	G	NM_018685		36447401	+1	tier1	-	no_errors	ENST00000265748	ensembl	human	known	74_37	missense	6.33	74	5	SNP	0.198	T
ANXA10	11199	genome.wustl.edu	37	4	169105799	169105799	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:169105799G>T	ENST00000359299.3	+	11	1059	c.873G>T	c.(871-873)gaG>gaT	p.E291D		NM_007193.4	NP_009124.2	Q9UJ72	ANX10_HUMAN	annexin A10	291						mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)			endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(2)	16		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0325)		GATACAAAGAGCGATATGGAA	0.353																																																	0													160.0	167.0	165.0					4																	169105799		2203	4300	6503	SO:0001583	missense	0			AJ238979	CCDS34096.1	4q32.3	2008-02-05			ENSG00000109511	ENSG00000109511		"""Annexins"""	534	protein-coding gene	gene with protein product		608008				10458909	Standard	NM_007193		Approved	ANX14	uc003irm.3	Q9UJ72	OTTHUMG00000161275	ENST00000359299.3:c.873G>T	4.37:g.169105799G>T	ENSP00000352248:p.Glu291Asp		Q96IQ5|Q9UJV4	Missense_Mutation	SNP	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinX	p.E291D	ENST00000359299.3	37	c.873	CCDS34096.1	4	.	.	.	.	.	.	.	.	.	.	G	14.47	2.544357	0.45280	.	.	ENSG00000109511	ENST00000359299;ENST00000393751	T	0.03524	3.9	5.84	2.78	0.32641	.	0.000000	0.64402	D	0.000005	T	0.10895	0.0266	L	0.46567	1.45	0.37156	D	0.902374	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.947	T	0.05616	-1.0874	10	0.56958	D	0.05	.	10.2151	0.43164	0.296:0.0:0.704:0.0	.	163;291	Q6ITU8;Q9UJ72	.;ANX10_HUMAN	D	291	ENSP00000352248:E291D	ENSP00000352248:E291D	E	+	3	2	ANXA10	169342374	1.000000	0.71417	0.999000	0.59377	0.293000	0.27360	0.588000	0.23924	0.821000	0.34540	0.655000	0.94253	GAG	ANXA10	-	pfam_Annexin_repeat,smart_Annexin_repeat	ENSG00000109511		0.353	ANXA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA10	HGNC	protein_coding	OTTHUMT00000364348.2	-	0.00	70	0	G	NM_007193		169105799	+1	tier1	-	no_errors	ENST00000359299	ensembl	human	known	74_37	missense	8.70	63	6	SNP	1.000	T
APBA2	321	genome.wustl.edu	37	15	29346341	29346341	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:29346341A>T	ENST00000558402.1	+	5	853	c.254A>T	c.(253-255)gAc>gTc	p.D85V	APBA2_ENST00000411764.1_Missense_Mutation_p.D85V|APBA2_ENST00000558330.1_Missense_Mutation_p.D85V|APBA2_ENST00000561069.1_Missense_Mutation_p.D85V|APBA2_ENST00000558259.1_Missense_Mutation_p.D85V			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	85					in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		GAGGAGGAGGACTATGACGAG	0.622																																																	0													134.0	129.0	131.0					15																	29346341		2203	4300	6503	SO:0001583	missense	0			AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.254A>T	15.37:g.29346341A>T	ENSP00000453293:p.Asp85Val		E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	pfam_PTB/PI_dom,pfam_PDZ,superfamily_PDZ,smart_PTB/PI_dom,smart_PDZ,pfscan_PDZ,pfscan_PTB/PI_dom	p.D85V	ENST00000558402.1	37	c.254	CCDS10022.1	15	.	.	.	.	.	.	.	.	.	.	A	19.92	3.916832	0.73098	.	.	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.48522	0.81	5.25	4.13	0.48395	.	0.191712	0.43416	D	0.000561	T	0.62950	0.2470	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.997;0.997	T	0.62248	-0.6894	10	0.54805	T	0.06	.	8.7931	0.34863	0.9144:0.0:0.0856:0.0	.	85;85;85	Q5XKC0;E9PGI4;Q99767	.;.;APBA2_HUMAN	V	85	ENSP00000409312:D85V	ENSP00000219865:D85V	D	+	2	0	APBA2	27133633	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	7.919000	0.87513	0.832000	0.34804	0.528000	0.53228	GAC	APBA2	-	NULL	ENSG00000034053		0.622	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA2	HGNC	protein_coding	OTTHUMT00000251362.3		0.00	54	0	A	NM_005503		29346341	+1			no_errors	ENST00000558259	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
APCDD1	147495	genome.wustl.edu	37	18	10488020	10488020	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr18:10488020G>A	ENST00000355285.5	+	5	1884	c.1530G>A	c.(1528-1530)tgG>tgA	p.W510*		NM_153000.4	NP_694545.1			adenomatosis polyposis coli down-regulated 1											NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		TGCTGCATTGGAACATCCGCA	0.478																																																	0													37.0	44.0	42.0					18																	10488020		2203	4300	6503	SO:0001587	stop_gained	0			AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000355285.5:c.1530G>A	18.37:g.10488020G>A	ENSP00000347433:p.Trp510*			Nonsense_Mutation	SNP	NULL	p.W510*	ENST00000355285.5	37	c.1530	CCDS11849.1	18	.	.	.	.	.	.	.	.	.	.	G	38	7.154492	0.98099	.	.	ENSG00000154856	ENST00000355285;ENST00000423585	.	.	.	5.55	4.67	0.58626	.	0.315943	0.31612	N	0.007359	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.7619	15.9816	0.80114	0.0:0.1462:0.8538:0.0	.	.	.	.	X	510;561	.	ENSP00000347433:W510X	W	+	3	0	APCDD1	10478020	1.000000	0.71417	0.039000	0.18376	0.207000	0.24258	4.601000	0.61090	1.313000	0.45069	0.655000	0.94253	TGG	APCDD1	-	NULL	ENSG00000154856		0.478	APCDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APCDD1	HGNC	protein_coding	OTTHUMT00000254529.2		0.00	31	0	G	NM_153000		10488020	+1			no_errors	ENST00000355285	ensembl	human	known	74_37	nonsense	12.00	22	3	SNP	0.738	A
APOB	338	genome.wustl.edu	37	2	21238336	21238336	+	Silent	SNP	G	G	A	rs140456702		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:21238336G>A	ENST00000233242.1	-	22	3541	c.3414C>T	c.(3412-3414)ctC>ctT	p.L1138L		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1138					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACCAGTGGGCGAGGATCTCAC	0.463																																																	0								G		1,4405	2.1+/-5.4	0,1,2202	144.0	131.0	135.0		3414	-3.4	0.0	2	dbSNP_134	135	0,8600		0,0,4300	no	coding-synonymous	APOB	NM_000384.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		1138/4564	21238336	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3414C>T	2.37:g.21238336G>A			O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.L1138	ENST00000233242.1	37	c.3414	CCDS1703.1	2																																																																																			APOB	-	NULL	ENSG00000084674		0.463	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	-	0.00	55	0	G			21238336	-1	tier1	rs140456702	no_errors	ENST00000233242	ensembl	human	known	74_37	silent	17.95	64	14	SNP	0.000	A
APOB	338	genome.wustl.edu	37	2	21251398	21251398	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:21251398G>T	ENST00000233242.1	-	13	1757	c.1630C>A	c.(1630-1632)Ctt>Att	p.L544I	APOB_ENST00000399256.4_Missense_Mutation_p.L544I	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	544	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.L544I(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCTGAAGAAGAACCTCCTGG	0.468																																																	1	Substitution - Missense(1)	lung(1)											96.0	84.0	88.0					2																	21251398		2203	4300	6503	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1630C>A	2.37:g.21251398G>T	ENSP00000233242:p.Leu544Ile		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.L544I	ENST00000233242.1	37	c.1630	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	G	31	5.101036	0.94245	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	T;T	0.78707	-1.2;-1.2	5.69	5.69	0.88448	Lipid transport protein, N-terminal (3);Vitellinogen, superhelical (2);	0.000000	0.64402	D	0.000002	D	0.89332	0.6685	M	0.80183	2.485	0.53005	D	0.999965	D	0.89917	1.0	D	0.97110	1.0	D	0.89487	0.3754	10	0.72032	D	0.01	.	20.2084	0.98285	0.0:0.0:1.0:0.0	.	544	P04114	APOB_HUMAN	I	544	ENSP00000233242:L544I;ENSP00000382200:L544I	ENSP00000233242:L544I	L	-	1	0	APOB	21104903	1.000000	0.71417	0.988000	0.46212	0.845000	0.48019	5.526000	0.67116	2.865000	0.98341	0.655000	0.94253	CTT	APOB	-	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	ENSG00000084674		0.468	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1		0.00	39	0	G			21251398	-1			no_errors	ENST00000233242	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
ARFGAP1	55738	genome.wustl.edu	37	20	61915761	61915761	+	Intron	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr20:61915761G>A	ENST00000370283.4	+	10	857				MIR4326_ENST00000582203.1_RNA|ARFGAP1_ENST00000547204.1_Intron|ARFGAP1_ENST00000353546.3_Intron|ARFGAP1_ENST00000519604.1_Intron|ARFGAP1_ENST00000519273.2_Intron|ARFGAP1_ENST00000370275.4_Intron|ARFGAP1_ENST00000518794.2_3'UTR	NM_018209.2	NP_060679.1	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating protein 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|COPI coating of Golgi vesicle (GO:0048205)|endoplasmic reticulum unfolded protein response (GO:0030968)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cytosol (GO:0005829)|Golgi-associated vesicle membrane (GO:0030660)|synapse (GO:0045202)	ARF GTPase activator activity (GO:0008060)|GTPase activator activity (GO:0005096)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)	13	all_cancers(38;1.59e-09)					AGGAGAGGCTGAGCTCCTTTC	0.652																																																	0																																										SO:0001627	intron_variant	0			AK001629	CCDS13515.1, CCDS13516.1, CCDS63326.1, CCDS63327.1, CCDS63328.1	20q13.33	2009-11-30	2002-08-20	2002-08-23	ENSG00000101199	ENSG00000101199		"""ADP-ribosylation factor GTPase activating proteins"""	15852	protein-coding gene	gene with protein product		608377	"""ADP-ribosylation factor 1 GTPase activating protein"""	ARF1GAP		11210549	Standard	NM_018209		Approved	FLJ10767, bA261N11.3	uc002yel.3	Q8N6T3	OTTHUMG00000032965	ENST00000370283.4:c.718-457G>A	20.37:g.61915761G>A			B7Z3U0|B7Z8H8|B7ZBI3|E1P5I9|E7EV62|Q6PK71|Q96KC4|Q96T02|Q9NSU3|Q9NVF6|Q9UIL0	RNA	SNP	-	NULL	ENST00000370283.4	37	NULL	CCDS13515.1	20																																																																																			ARFGAP1	-	-	ENSG00000101199		0.652	ARFGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGAP1	HGNC	protein_coding	OTTHUMT00000080134.3	-	0.00	49	0	G	NM_018209		61915761	+1	tier1	-	no_errors	ENST00000468975	ensembl	human	known	74_37	rna	20.00	36	9	SNP	0.000	A
ARHGEF38	54848	genome.wustl.edu	37	4	106588313	106588313	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:106588313C>T	ENST00000420470.2	+	12	1861	c.1717C>T	c.(1717-1719)Cat>Tat	p.H573Y	ARHGEF38_ENST00000508036.2_3'UTR	NM_001242729.1	NP_001229658.1	Q9NXL2	ARH38_HUMAN	Rho guanine nucleotide exchange factor (GEF) 38	573						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(3)	11						AACTGACATTCATCGCTCCAA	0.383																																																	0																																										SO:0001583	missense	0			AK000191	CCDS3670.1, CCDS56338.1	4q24	2012-07-24			ENSG00000236699	ENSG00000236699		"""Rho guanine nucleotide exchange factors"""	25968	protein-coding gene	gene with protein product							Standard	NM_001242729		Approved	FLJ20184	uc003hxv.2	Q9NXL2	OTTHUMG00000154752	ENST00000420470.2:c.1717C>T	4.37:g.106588313C>T	ENSP00000416125:p.His573Tyr		C9JIB4	Missense_Mutation	SNP	pfam_DH-domain,pfam_BAR_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.H573Y	ENST00000420470.2	37	c.1717	CCDS56338.1	4	.	.	.	.	.	.	.	.	.	.	C	13.33	2.206444	0.39003	.	.	ENSG00000236699	ENST00000420470	T	0.68025	-0.3	5.6	5.6	0.85130	.	.	.	.	.	T	0.67896	0.2942	M	0.78637	2.42	0.54753	D	0.99998	B	0.33549	0.417	B	0.28553	0.091	T	0.67003	-0.5780	9	0.28530	T	0.3	-6.029	19.6223	0.95663	0.0:1.0:0.0:0.0	.	573	C9JIB4	.	Y	573	ENSP00000416125:H573Y	ENSP00000416125:H573Y	H	+	1	0	ARHGEF38	106807762	0.997000	0.39634	0.965000	0.40720	0.670000	0.39368	3.535000	0.53575	2.616000	0.88540	0.655000	0.94253	CAT	ARHGEF38	-	superfamily_SH3_domain	ENSG00000236699		0.383	ARHGEF38-001	PUTATIVE	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	ARHGEF38	HGNC	protein_coding	OTTHUMT00000336934.3	-	0.00	37	0	C	NM_017700		106588313	+1	tier1	-	no_errors	ENST00000420470	ensembl	human	putative	74_37	missense	19.51	33	8	SNP	1.000	T
ARL6IP6	151188	genome.wustl.edu	37	2	153575184	153575184	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:153575184G>A	ENST00000326446.5	+	1	757	c.46G>A	c.(46-48)Ggt>Agt	p.G16S	PRPF40A_ENST00000486100.1_5'Flank|PRPF40A_ENST00000410080.1_5'Flank	NM_152522.5	NP_689735.1	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation factor-like 6 interacting protein 6	16						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	5						GCGGCGCCGCGGTCCCGGCAC	0.682																																																	0													23.0	31.0	28.0					2																	153575184		2091	4181	6272	SO:0001583	missense	0			AK023109	CCDS2197.1	2q23	2014-05-12	2014-05-12		ENSG00000177917	ENSG00000177917			24048	protein-coding gene	gene with protein product							Standard	NM_152522		Approved	MGC33864	uc002tyn.3	Q8N6S5	OTTHUMG00000131901	ENST00000326446.5:c.46G>A	2.37:g.153575184G>A	ENSP00000315357:p.Gly16Ser		B2RDS6|Q7Z4G7	Missense_Mutation	SNP	NULL	p.G16S	ENST00000326446.5	37	c.46	CCDS2197.1	2	.	.	.	.	.	.	.	.	.	.	G	13.63	2.295421	0.40594	.	.	ENSG00000177917	ENST00000326446	.	.	.	4.41	0.441	0.16577	.	1.077880	0.07135	N	0.846285	T	0.19685	0.0473	N	0.08118	0	0.09310	N	1	B	0.26935	0.164	B	0.17433	0.018	T	0.23368	-1.0190	9	0.44086	T	0.13	0.0164	9.997	0.41905	0.1452:0.4294:0.4254:0.0	.	16	Q8N6S5	AR6P6_HUMAN	S	16	.	ENSP00000315357:G16S	G	+	1	0	ARL6IP6	153283430	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.062000	0.14389	-0.028000	0.13850	-1.109000	0.02080	GGT	ARL6IP6	-	NULL	ENSG00000177917		0.682	ARL6IP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL6IP6	HGNC	protein_coding	OTTHUMT00000254852.3	-	0.00	62	0	G	NM_152522		153575184	+1	tier1	-	no_errors	ENST00000326446	ensembl	human	known	74_37	missense	18.00	41	9	SNP	0.002	A
ARMC4	55130	genome.wustl.edu	37	10	28270509	28270509	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:28270509G>T	ENST00000305242.5	-	7	914	c.822C>A	c.(820-822)ggC>ggA	p.G274G	ARMC4_ENST00000537576.1_5'UTR|ARMC4_ENST00000480504.1_5'UTR|ARMC4_ENST00000545014.1_5'UTR|ARMC4_ENST00000239715.3_Silent_p.G131G	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	274					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						CATCTGTTTTGCCCTTTGGGA	0.308																																																	0													95.0	101.0	99.0					10																	28270509		2202	4294	6496	SO:0001819	synonymous_variant	0			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.822C>A	10.37:g.28270509G>T			A8K906|B7Z7I1|Q9H0C0	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_GSKIP_dom,smart_Armadillo,pfscan_Armadillo	p.G274	ENST00000305242.5	37	c.822	CCDS7157.1	10																																																																																			ARMC4	-	superfamily_GSKIP_dom	ENSG00000169126		0.308	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC4	HGNC	protein_coding	OTTHUMT00000047339.1		0.00	25	0	G	NM_018076		28270509	-1			no_errors	ENST00000305242	ensembl	human	known	74_37	silent	8.33	33	3	SNP	0.288	T
ASAP1	50807	genome.wustl.edu	37	8	131370359	131370359	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:131370359G>T	ENST00000518721.1	-	3	317	c.90C>A	c.(88-90)ttC>ttA	p.F30L	ASAP1_ENST00000357668.1_Missense_Mutation_p.F30L|ASAP1_ENST00000520625.1_5'Flank	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	30					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						TCTCGGCGATGAACTCCGAGA	0.682																																																	0													102.0	76.0	85.0					8																	131370359		2203	4300	6503	SO:0001583	missense	0			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.90C>A	8.37:g.131370359G>T	ENSP00000429900:p.Phe30Leu		B2RNV3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP,prints_p67phox	p.F30L	ENST00000518721.1	37	c.90	CCDS6362.1	8	.	.	.	.	.	.	.	.	.	.	G	23.3	4.405411	0.83230	.	.	ENSG00000153317	ENST00000343135;ENST00000357668;ENST00000518721;ENST00000521426	T;T	0.25749	1.78;1.78	4.34	2.5	0.30297	.	0.214976	0.39615	N	0.001312	T	0.50171	0.1600	M	0.87381	2.88	0.51482	D	0.999923	D;D	0.69078	0.997;0.997	D;D	0.70716	0.97;0.97	T	0.49504	-0.8933	10	0.87932	D	0	.	8.093	0.30811	0.2434:0.0:0.7566:0.0	.	30;30	B2RNV3;Q9ULH1	.;ASAP1_HUMAN	L	30;30;30;23	ENSP00000350297:F30L;ENSP00000429900:F30L	ENSP00000344591:F30L	F	-	3	2	ASAP1	131439541	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.877000	0.39598	0.275000	0.22094	0.313000	0.20887	TTC	ASAP1	-	NULL	ENSG00000153317		0.682	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP1	HGNC	protein_coding	OTTHUMT00000380170.1		0.00	56	0	G	NM_018482		131370359	-1			no_errors	ENST00000357668	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
ASPM	259266	genome.wustl.edu	37	1	197071323	197071323	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:197071323C>T	ENST00000367409.4	-	18	7314	c.7058G>A	c.(7057-7059)aGa>aAa	p.R2353K	ASPM_ENST00000367408.1_Intron|ASPM_ENST00000294732.7_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2353	IQ 23. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						AGCCTGATATCTCATATGTAA	0.433																																																	0													135.0	129.0	131.0					1																	197071323		2203	4300	6503	SO:0001583	missense	0			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.7058G>A	1.37:g.197071323C>T	ENSP00000356379:p.Arg2353Lys		Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.R2353K	ENST00000367409.4	37	c.7058	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	c	3.726	-0.056481	0.07362	.	.	ENSG00000066279	ENST00000367409;ENST00000367406	T	0.72282	-0.64	4.39	0.382	0.16234	.	0.337744	0.24128	N	0.041281	T	0.68421	0.2999	L	0.42529	1.33	0.09310	N	1	P;P	0.50617	0.694;0.937	P;P	0.62298	0.874;0.9	T	0.57774	-0.7753	10	0.16896	T	0.51	.	5.0271	0.14391	0.0:0.4121:0.2766:0.3113	.	339;2353	E7EQ84;Q8IZT6	.;ASPM_HUMAN	K	2353;339	ENSP00000356379:R2353K	ENSP00000356376:R339K	R	-	2	0	ASPM	195337946	0.000000	0.05858	0.001000	0.08648	0.223000	0.24884	-2.452000	0.01005	0.211000	0.20683	0.558000	0.71614	AGA	ASPM	-	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000066279		0.433	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1	-	0.00	49	0	C	NM_018136		197071323	-1	tier1	-	no_errors	ENST00000367409	ensembl	human	known	74_37	missense	35.48	40	22	SNP	0.000	T
ATP2B1	490	genome.wustl.edu	37	12	90010583	90010583	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:90010583G>T	ENST00000428670.3	-	12	2519	c.2063C>A	c.(2062-2064)cCt>cAt	p.P688H	ATP2B1_ENST00000348959.3_Missense_Mutation_p.P688H|ATP2B1_ENST00000393164.2_Missense_Mutation_p.P431H|ATP2B1_ENST00000261173.2_Missense_Mutation_p.P688H|ATP2B1_ENST00000359142.3_Missense_Mutation_p.P688H			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	688					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						CACCACCTCAGGTCTCACAGG	0.428																																																	0													106.0	101.0	102.0					12																	90010583		2203	4300	6503	SO:0001583	missense	0			J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.2063C>A	12.37:g.90010583G>T	ENSP00000392043:p.Pro688His		Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.P688H	ENST00000428670.3	37	c.2063	CCDS9035.1	12	.	.	.	.	.	.	.	.	.	.	G	28.6	4.930771	0.92389	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670;ENST00000393164	D;D;D;D;D	0.97480	-4.4;-4.4;-4.4;-4.4;-4.4	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.99260	0.9742	H	0.98769	4.325	0.80722	D	1	D;P;P	0.89917	1.0;0.809;0.796	D;P;B	0.91635	0.999;0.515;0.434	D	0.98609	1.0662	10	0.87932	D	0	-28.8317	19.8788	0.96888	0.0:0.0:1.0:0.0	.	688;688;688	P20020-3;P20020-2;P20020-6	.;.;.	H	688;688;688;688;431	ENSP00000261173:P688H;ENSP00000343599:P688H;ENSP00000352054:P688H;ENSP00000392043:P688H;ENSP00000376869:P431H	ENSP00000261173:P688H	P	-	2	0	ATP2B1	88534714	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.004000	0.88535	2.708000	0.92522	0.650000	0.86243	CCT	ATP2B1	-	pfam_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma	ENSG00000070961		0.428	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP2B1	HGNC	protein_coding	OTTHUMT00000406653.1		0.00	31	0	G	NM_001682		90010583	-1			no_errors	ENST00000261173	ensembl	human	known	74_37	missense	6.25	45	3	SNP	1.000	T
ATP5A1	498	genome.wustl.edu	37	18	43675034	43675034	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr18:43675034G>T	ENST00000398752.6	-	2	245	c.124C>A	c.(124-126)Cat>Aat	p.H42N	ATP5A1_ENST00000590665.1_Missense_Mutation_p.H42N|ATP5A1_ENST00000591267.1_5'UTR|ATP5A1_ENST00000282050.2_Missense_Mutation_p.H42N|ATP5A1_ENST00000593152.2_5'UTR	NM_001001935.2|NM_004046.5	NP_001001935.1|NP_004037.1	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle	42					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|embryo development (GO:0009790)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of endothelial cell proliferation (GO:0001937)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting ATP synthase complex, catalytic core F(1) (GO:0045261)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|skin(1)|urinary_tract(1)	22						TTTTGAAGATGAGTGTTAGAG	0.348																																																	0													88.0	88.0	88.0					18																	43675034		2203	4300	6503	SO:0001583	missense	0			D14710	CCDS11927.1, CCDS58620.1, CCDS59315.1	18q21	2012-10-12	2006-01-13		ENSG00000152234	ENSG00000152234	3.6.1.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	823	protein-coding gene	gene with protein product		164360	"""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 2, non-cardiac muscle-like 2"", ""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1, cardiac muscle"""	ATP5AL2, ATPM		1830491	Standard	NM_001257334		Approved	ATP5A, hATP1, OMR, ORM	uc002lbr.2	P25705	OTTHUMG00000132637	ENST00000398752.6:c.124C>A	18.37:g.43675034G>T	ENSP00000381736:p.His42Asn		A8K092|B4DY56|K7ENP3|Q53XX6|Q8IXV2|Q96FB4|Q96HW2|Q96IR6|Q9BTV8	Missense_Mutation	SNP	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,pfam_ATPase_F1/V1/A1-cplx_a/bsu_C,pfam_ATPase_F1_a/bsu_N,superfamily_P-loop_NTPase,superfamily_ATPase_F1/V1/A1-cplx_a/bsu_C,superfamily_ATPase_F1_a/bsu_N,tigrfam_ATPase_F1-cplx_asu	p.H42N	ENST00000398752.6	37	c.124	CCDS11927.1	18	.	.	.	.	.	.	.	.	.	.	G	7.004	0.555536	0.13436	.	.	ENSG00000152234	ENST00000282050;ENST00000398752	T;T	0.28895	1.59;1.59	5.0	2.09	0.27110	.	0.436901	0.28572	N	0.014874	T	0.11623	0.0283	N	0.08118	0	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.16512	-1.0400	10	0.27785	T	0.31	0.9169	1.7661	0.03002	0.261:0.1344:0.4673:0.1373	.	42	P25705	ATPA_HUMAN	N	42	ENSP00000282050:H42N;ENSP00000381736:H42N	ENSP00000282050:H42N	H	-	1	0	ATP5A1	41929032	0.000000	0.05858	0.026000	0.17262	0.994000	0.84299	-0.260000	0.08708	0.192000	0.20272	0.644000	0.83932	CAT	ATP5A1	-	NULL	ENSG00000152234		0.348	ATP5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5A1	HGNC	protein_coding	OTTHUMT00000255884.1	-	0.00	40	0	G	NM_004046		43675034	-1	tier1	-	no_errors	ENST00000282050	ensembl	human	known	74_37	missense	20.83	57	15	SNP	0.000	T
ATP8A1	10396	genome.wustl.edu	37	4	42505477	42505477	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:42505477C>A	ENST00000381668.5	-	24	2372	c.2141G>T	c.(2140-2142)gGc>gTc	p.G714V	ATP8A1_ENST00000264449.10_Missense_Mutation_p.G699V	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	714					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	ATCAAGAGAGCCTTCATTTAT	0.274																																																	0													61.0	65.0	63.0					4																	42505477		2202	4295	6497	SO:0001583	missense	0			AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.2141G>T	4.37:g.42505477C>A	ENSP00000371084:p.Gly714Val		Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.G714V	ENST00000381668.5	37	c.2141	CCDS3466.1	4	.	.	.	.	.	.	.	.	.	.	C	15.04	2.714027	0.48622	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	T;T	0.79141	-1.24;-1.24	5.53	4.7	0.59300	HAD-like domain (2);	0.187573	0.47093	D	0.000249	T	0.64416	0.2596	N	0.05351	-0.065	0.80722	D	1	B;B	0.32071	0.355;0.336	B;B	0.40602	0.334;0.158	T	0.65804	-0.6079	10	0.49607	T	0.09	.	10.5614	0.45148	0.0:0.8531:0.0:0.1469	.	699;714	Q32M35;Q9Y2Q0	.;AT8A1_HUMAN	V	714;699	ENSP00000371084:G714V;ENSP00000264449:G699V	ENSP00000264449:G699V	G	-	2	0	ATP8A1	42200234	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.586000	0.46119	1.365000	0.46057	0.591000	0.81541	GGC	ATP8A1	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000124406		0.274	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP8A1	HGNC	protein_coding	OTTHUMT00000216861.2	-	0.00	52	0	C	NM_006095		42505477	-1	tier1	-	no_errors	ENST00000381668	ensembl	human	known	74_37	missense	11.67	53	7	SNP	1.000	A
B4GALT4	8702	genome.wustl.edu	37	3	118948751	118948751	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:118948751C>T	ENST00000483209.1	-	3	837	c.196G>A	c.(196-198)Gaa>Aaa	p.E66K	B4GALT4_ENST00000393765.2_Missense_Mutation_p.E66K|B4GALT4_ENST00000359213.3_Missense_Mutation_p.E66K|B4GALT4_ENST00000471675.1_Missense_Mutation_p.E19K|B4GALT4_ENST00000467604.1_Missense_Mutation_p.E66K|B4GALT4_ENST00000460321.1_Intron|B4GALT4-AS1_ENST00000470790.1_RNA			O60513	B4GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4	66					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|membrane lipid metabolic process (GO:0006643)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)			breast(2)|endometrium(1)|large_intestine(1)|lung(6)|skin(2)|stomach(2)	14				GBM - Glioblastoma multiforme(114;0.222)	N-Acetyl-D-glucosamine(DB00141)	GTGGATGCTTCATTAGTCAGA	0.413																																																	0													141.0	131.0	134.0					3																	118948751		2203	4300	6503	SO:0001583	missense	0			AF022367	CCDS2986.1	3q13.3	2013-02-19			ENSG00000121578	ENSG00000121578		"""Beta 4-glycosyltransferases"""	927	protein-coding gene	gene with protein product		604015				9597550	Standard	NM_003778		Approved	beta4Gal-T4	uc003eci.3	O60513	OTTHUMG00000159358	ENST00000483209.1:c.196G>A	3.37:g.118948751C>T	ENSP00000420161:p.Glu66Lys		Q68D68|Q9BSW3|Q9C078	Missense_Mutation	SNP	pfam_Galactosyl_T_C,prints_Galactosyl_T	p.E66K	ENST00000483209.1	37	c.196	CCDS2986.1	3	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641861	0.29157	.	.	ENSG00000121578	ENST00000483209;ENST00000467604;ENST00000471675;ENST00000359213;ENST00000393765;ENST00000475803;ENST00000479150	T;T;T;T;T;T	0.57907	0.76;0.37;0.76;0.76;1.56;0.99	5.16	0.703	0.18116	.	1.365360	0.04178	N	0.325956	T	0.44953	0.1318	L	0.59436	1.845	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22347	-1.0219	10	0.06757	T	0.87	-2.0729	7.0954	0.25307	0.0:0.5875:0.2825:0.1299	.	66	O60513	B4GT4_HUMAN	K	66;66;19;66;66;66;66	ENSP00000420161:E66K;ENSP00000417226:E66K;ENSP00000352144:E66K;ENSP00000377360:E66K;ENSP00000417188:E66K;ENSP00000417958:E66K	ENSP00000352144:E66K	E	-	1	0	B4GALT4	120431441	0.002000	0.14202	0.000000	0.03702	0.105000	0.19272	0.298000	0.19120	0.223000	0.20920	0.491000	0.48974	GAA	B4GALT4	-	NULL	ENSG00000121578		0.413	B4GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT4	HGNC	protein_coding	OTTHUMT00000354925.2	-	0.00	73	0	C	NM_003778		118948751	-1	tier1	-	no_errors	ENST00000359213	ensembl	human	known	74_37	missense	11.36	78	10	SNP	0.000	T
BAIAP3	8938	genome.wustl.edu	37	16	1393012	1393012	+	Silent	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr16:1393012C>G	ENST00000324385.5	+	14	1523	c.1365C>G	c.(1363-1365)gcC>gcG	p.A455A	BAIAP3_ENST00000562208.1_Silent_p.A397A|BAIAP3_ENST00000426824.3_Silent_p.A420A|BAIAP3_ENST00000397488.2_Silent_p.A437A|BAIAP3_ENST00000397489.1_Silent_p.A437A|BAIAP3_ENST00000421665.2_Silent_p.A384A|BAIAP3_ENST00000568887.1_Silent_p.A392A	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	455					G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				TGCAGCTGGCCGTGCTGTGAG	0.677																																																	0													30.0	25.0	26.0					16																	1393012		2192	4295	6487	SO:0001819	synonymous_variant	0			AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.1365C>G	16.37:g.1393012C>G			A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Silent	SNP	pfam_C2_dom,pfam_Munc13_subgr_dom-2,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.A455	ENST00000324385.5	37	c.1365	CCDS10434.1	16																																																																																			BAIAP3	-	NULL	ENSG00000007516		0.677	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	BAIAP3	HGNC	protein_coding	OTTHUMT00000109056.3	-	0.00	56	0	C			1393012	+1	tier1	-	no_errors	ENST00000324385	ensembl	human	known	74_37	silent	25.71	26	9	SNP	0.007	G
BCL9	607	genome.wustl.edu	37	1	147086253	147086253	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:147086253C>T	ENST00000234739.3	+	6	1138	c.398C>T	c.(397-399)tCc>tTc	p.S133F	BCL9_ENST00000473292.1_3'UTR	NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	133					canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					CACATAAAGTCCCAGGATTCC	0.458			T	"""IGH@, IGL@"""	B-ALL																																			Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	0													108.0	110.0	110.0					1																	147086253		2203	4300	6503	SO:0001583	missense	0			Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.398C>T	1.37:g.147086253C>T	ENSP00000234739:p.Ser133Phe		Q5T489	Missense_Mutation	SNP	pfam_BCL9_beta-catenin-bd_dom	p.S133F	ENST00000234739.3	37	c.398	CCDS30833.1	1	.	.	.	.	.	.	.	.	.	.	C	18.90	3.721946	0.68959	.	.	ENSG00000116128	ENST00000234739	T	0.57907	0.37	5.55	5.55	0.83447	.	0.414560	0.29293	N	0.012569	T	0.37972	0.1023	L	0.34521	1.04	0.45837	D	0.998706	B;B	0.22480	0.07;0.07	B;B	0.31016	0.123;0.123	T	0.26292	-1.0107	10	0.59425	D	0.04	-3.0457	19.6982	0.96039	0.0:1.0:0.0:0.0	.	133;133	Q1JQ81;O00512	.;BCL9_HUMAN	F	133	ENSP00000234739:S133F	ENSP00000234739:S133F	S	+	2	0	BCL9	145552877	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.027000	0.57239	2.894000	0.99253	0.655000	0.94253	TCC	BCL9	-	NULL	ENSG00000116128		0.458	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9	HGNC	protein_coding	OTTHUMT00000039468.1	-	0.00	59	0	C	NM_004326		147086253	+1	tier1	-	no_errors	ENST00000234739	ensembl	human	known	74_37	missense	14.58	41	7	SNP	1.000	T
BDNF	627	genome.wustl.edu	37	11	27679710	27679710	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:27679710G>T	ENST00000525528.1	-	1	1495	c.402C>A	c.(400-402)cgC>cgA	p.R134R	BDNF_ENST00000314915.6_Silent_p.R142R|BDNF_ENST00000532997.1_Silent_p.R134R|BDNF_ENST00000395981.3_Silent_p.R134R|BDNF_ENST00000420794.1_Silent_p.R134R|BDNF_ENST00000356660.4_Silent_p.R134R|BDNF_ENST00000438929.1_Silent_p.R216R|BDNF_ENST00000533131.1_Silent_p.R134R|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000395980.2_Silent_p.R134R|BDNF_ENST00000533246.1_Silent_p.R134R|BDNF_ENST00000395986.2_Silent_p.R149R|BDNF_ENST00000530861.1_Silent_p.R134R|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000439476.2_Silent_p.R134R|BDNF_ENST00000395978.3_Silent_p.R134R|BDNF_ENST00000418212.1_Silent_p.R134R|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000525950.1_Silent_p.R134R|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000395983.3_Silent_p.R134R|BDNF-AS_ENST00000501176.2_RNA|BDNF-AS_ENST00000499568.2_RNA|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000584049.1_5'UTR|BDNF-AS_ENST00000499008.3_RNA	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor	134					axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						GCTCCCCTCGGCGGGCAGGGT	0.552																																																	0													95.0	93.0	94.0					11																	27679710		2202	4299	6501	SO:0001819	synonymous_variant	0			AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.402C>A	11.37:g.27679710G>T			A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	Silent	SNP	pfam_Nerve_growth_factor-rel,smart_Nerve_growth_factor-rel,pfscan_Nerve_growth_factor-rel,prints_Brain-der_neurotrophic_factor,prints_Nerve_growth_factor-rel	p.R216	ENST00000525528.1	37	c.648	CCDS7866.1	11																																																																																			BDNF	-	pfam_Nerve_growth_factor-rel,smart_Nerve_growth_factor-rel,pfscan_Nerve_growth_factor-rel	ENSG00000176697		0.552	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BDNF	HGNC	protein_coding	OTTHUMT00000388135.1		0.00	47	0	G	NM_170735		27679710	-1			no_errors	ENST00000438929	ensembl	human	known	74_37	silent	5.56	34	2	SNP	1.000	T
BCO2	83875	genome.wustl.edu	37	11	112064319	112064319	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:112064319G>A	ENST00000357685.5	+	3	551	c.416G>A	c.(415-417)cGa>cAa	p.R139Q	AP002884.3_ENST00000532612.1_Missense_Mutation_p.R110Q|BCO2_ENST00000531169.1_Missense_Mutation_p.R105Q|SDHD_ENST00000525468.1_3'UTR|BCO2_ENST00000438022.1_Missense_Mutation_p.R105Q|BCO2_ENST00000361053.4_Missense_Mutation_p.R139Q|BCO2_ENST00000526088.1_Missense_Mutation_p.R105Q|BCO2_ENST00000393032.2_Missense_Mutation_p.R105Q|BCO2_ENST00000532593.1_Missense_Mutation_p.R34Q			Q9BYV7	BCDO2_HUMAN	beta-carotene oxygenase 2	139					carotene catabolic process (GO:0016121)|carotene metabolic process (GO:0016119)|carotenoid metabolic process (GO:0016116)|oxidation-reduction process (GO:0055114)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			NS(1)|breast(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)	16						GCTAAAAACCGAATTGTGATC	0.463																																					GBM(177;1916 2099 21049 29541 39946)												0													132.0	111.0	119.0					11																	112064319		2201	4297	6498	SO:0001583	missense	0			AJ290393	CCDS8358.2, CCDS41716.1, CCDS58181.1, CCDS58182.1, CCDS58183.1	11q23.1	2014-05-12	2008-04-15	2008-04-15	ENSG00000197580	ENSG00000197580	1.13.11.71		18503	protein-coding gene	gene with protein product	"""beta-carotene 9',10' oxygenase"", ""carotenoid-9',10'-cleaving dioxygenase"""	611740	"""beta-carotene dioxygenase 2"""	BCDO2		11278918, 15983114, 15949678	Standard	NM_031938		Approved	FLJ34464, B-DIOX-II	uc001pnf.3	Q9BYV7	OTTHUMG00000167155	ENST00000357685.5:c.416G>A	11.37:g.112064319G>A	ENSP00000350314:p.Arg139Gln		B0YIX5|B4DNC3|E9PBI8|E9PJJ1|Q8IUS0|Q96JC8|Q96JY5	Missense_Mutation	SNP	pfam_Carotenoid_Oase	p.R139Q	ENST00000357685.5	37	c.416	CCDS8358.2	11	.	.	.	.	.	.	.	.	.	.	G	31	5.068707	0.93950	.	.	ENSG00000197580	ENST00000357685;ENST00000393032;ENST00000361053;ENST00000438022;ENST00000526088;ENST00000532593;ENST00000531169	D;D;D;D;D;D;D	0.95137	-3.62;-3.62;-3.62;-3.62;-3.62;-3.62;-3.62	5.58	4.66	0.58398	.	0.057288	0.64402	N	0.000001	D	0.97583	0.9208	M	0.90369	3.11	0.80722	D	1	D;P;D	0.89917	1.0;0.944;1.0	D;P;D	0.91635	0.999;0.488;0.999	D	0.98202	1.0468	9	.	.	.	-1.3105	14.8123	0.70006	0.0697:0.0:0.9303:0.0	.	116;139;139	C9JEZ9;E9PBI8;Q9BYV7	.;.;BCDO2_HUMAN	Q	139;105;139;105;105;34;105	ENSP00000350314:R139Q;ENSP00000376752:R105Q;ENSP00000354338:R139Q;ENSP00000414843:R105Q;ENSP00000436615:R105Q;ENSP00000431802:R34Q;ENSP00000437053:R105Q	.	R	+	2	0	BCO2	111569529	1.000000	0.71417	0.876000	0.34364	0.938000	0.57974	7.266000	0.78452	1.346000	0.45694	0.655000	0.94253	CGA	BCO2	-	pfam_Carotenoid_Oase	ENSG00000197580		0.463	BCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCO2	HGNC	protein_coding	OTTHUMT00000256570.3		0.00	50	0	G	NM_001037290		112064319	+1			no_errors	ENST00000357685	ensembl	human	known	74_37	missense	8.82	31	3	SNP	1.000	A
BDP1	55814	genome.wustl.edu	37	5	70782376	70782376	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:70782376G>C	ENST00000358731.4	+	9	1398	c.1135G>C	c.(1135-1137)Gag>Cag	p.E379Q	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	379	Required for phosphorylation by CSNK2A1.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TGCTGAAGAAGAGAAAAGAAA	0.318																																																	0													60.0	58.0	59.0					5																	70782376		1795	4064	5859	SO:0001583	missense	0			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.1135G>C	5.37:g.70782376G>C	ENSP00000351575:p.Glu379Gln		Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.E379Q	ENST00000358731.4	37	c.1135	CCDS43328.1	5	.	.	.	.	.	.	.	.	.	.	G	18.71	3.681729	0.68042	.	.	ENSG00000145734	ENST00000358731;ENST00000437938;ENST00000444711	T	0.04706	3.57	5.82	4.94	0.65067	.	0.172516	0.50627	N	0.000116	T	0.15305	0.0369	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	0.991;1.0;0.998	D;D;D	0.85130	0.918;0.997;0.952	T	0.01771	-1.1277	10	0.35671	T	0.21	.	8.2256	0.31566	0.0824:0.1597:0.7579:0.0	.	379;379;379	A6H8Y1;A6H8Y1-2;A6H8Y1-4	BDP1_HUMAN;.;.	Q	379	ENSP00000351575:E379Q	ENSP00000351575:E379Q	E	+	1	0	BDP1	70818132	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.215000	0.42862	1.426000	0.47256	0.591000	0.81541	GAG	BDP1	-	NULL	ENSG00000145734		0.318	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BDP1	HGNC	protein_coding	OTTHUMT00000374681.2	-	0.00	38	0	G	NM_018429		70782376	+1	tier1	-	no_errors	ENST00000358731	ensembl	human	known	74_37	missense	21.05	45	12	SNP	1.000	C
BEND5	79656	genome.wustl.edu	37	1	49193621	49193621	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:49193621G>C	ENST00000371833.3	-	6	1289	c.1203C>G	c.(1201-1203)atC>atG	p.I401M	BEND5_ENST00000476096.1_5'UTR|AGBL4_ENST00000371839.1_Intron|AGBL4_ENST00000371838.1_Intron	NM_024603.2	NP_078879.2	Q7L4P6	BEND5_HUMAN	BEN domain containing 5	401	BEN. {ECO:0000255|PROSITE- ProRule:PRU00784}.					Golgi apparatus (GO:0005794)				large_intestine(5)|lung(2)|skin(1)	8						TGATATCCATGATTTTTTCAC	0.338																																																	0													178.0	170.0	173.0					1																	49193621		2203	4300	6503	SO:0001583	missense	0			BC007932	CCDS552.2	1p33	2012-11-22	2008-10-03	2008-10-03	ENSG00000162373	ENSG00000162373		"""BEN domain containing"""	25668	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 165"""	C1orf165		12477932	Standard	NM_024603		Approved	FLJ11588	uc001crx.4	Q7L4P6	OTTHUMG00000008153	ENST00000371833.3:c.1203C>G	1.37:g.49193621G>C	ENSP00000360899:p.Ile401Met		D3DQ27|Q96A62|Q9HAI3	Missense_Mutation	SNP	pfam_BEN_domain	p.I401M	ENST00000371833.3	37	c.1203	CCDS552.2	1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.586881	0.66105	.	.	ENSG00000162373	ENST00000371833;ENST00000294347	.	.	.	5.84	5.84	0.93424	BEN domain (1);	0.000000	0.85682	D	0.000000	T	0.63581	0.2523	L	0.27053	0.805	0.49389	D	0.999782	D	0.69078	0.997	D	0.83275	0.996	T	0.60078	-0.7333	8	.	.	.	-12.8229	14.0253	0.64582	0.0:0.0:0.8492:0.1508	.	401	Q7L4P6	BEND5_HUMAN	M	401;113	.	.	I	-	3	3	BEND5	48966208	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.427000	0.34881	2.779000	0.95612	0.591000	0.81541	ATC	BEND5	-	NULL	ENSG00000162373		0.338	BEND5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND5	HGNC	protein_coding	OTTHUMT00000022323.1	-	0.00	71	0	G	NM_024603		49193621	-1	tier1	-	no_errors	ENST00000371833	ensembl	human	known	74_37	missense	15.52	49	9	SNP	1.000	C
BEST3	144453	genome.wustl.edu	37	12	70048704	70048704	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:70048704C>G	ENST00000330891.5	-	10	2216	c.1990G>C	c.(1990-1992)Gag>Cag	p.E664Q	BEST3_ENST00000488961.1_Missense_Mutation_p.E451Q|BEST3_ENST00000331471.4_Intron|BEST3_ENST00000553096.1_Missense_Mutation_p.E558Q	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	664					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			GGTGATTCCTCAGTTTCCTTG	0.453																																																	0													136.0	129.0	131.0					12																	70048704		1924	4137	6061	SO:0001583	missense	0			AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.1990G>C	12.37:g.70048704C>G	ENSP00000332413:p.Glu664Gln		B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Missense_Mutation	SNP	pfam_Bestrophin/UPF0187	p.E664Q	ENST00000330891.5	37	c.1990	CCDS8992.2	12	.	.	.	.	.	.	.	.	.	.	C	12.95	2.092536	0.36952	.	.	ENSG00000127325	ENST00000488961;ENST00000330891;ENST00000553096	D;D;D	0.97941	-4.28;-4.62;-4.58	5.67	4.78	0.61160	.	1.262320	0.06448	U	0.727264	D	0.94608	0.8262	L	0.34521	1.04	0.18873	N	0.999985	P;P	0.44877	0.8;0.845	B;B	0.39299	0.296;0.169	D	0.87648	0.2526	10	0.16896	T	0.51	-4.0108	8.93	0.35663	0.0:0.8304:0.0:0.1696	.	664;451	Q8N1M1;B5MDI8	BEST3_HUMAN;.	Q	451;664;558	ENSP00000433213:E451Q;ENSP00000332413:E664Q;ENSP00000449548:E558Q	ENSP00000332413:E664Q	E	-	1	0	BEST3	68334971	0.002000	0.14202	0.005000	0.12908	0.069000	0.16628	0.694000	0.25512	1.401000	0.46761	0.563000	0.77884	GAG	BEST3	-	NULL	ENSG00000127325		0.453	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEST3	HGNC	protein_coding	OTTHUMT00000313908.2	-	0.00	56	0	C	NM_152439		70048704	-1	tier1	-	no_errors	ENST00000330891	ensembl	human	known	74_37	missense	8.62	53	5	SNP	0.011	G
BPTF	2186	genome.wustl.edu	37	17	65960430	65960430	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:65960430G>T	ENST00000321892.4	+	27	8803	c.8742G>T	c.(8740-8742)caG>caT	p.Q2914H	BPTF_ENST00000335221.5_Missense_Mutation_p.Q2771H|BPTF_ENST00000424123.3_Missense_Mutation_p.Q2632H|BPTF_ENST00000306378.6_Missense_Mutation_p.Q2788H			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2914					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TCTGTCCACAGTGCCAGTCAA	0.512																																																	0													118.0	106.0	110.0					17																	65960430		2203	4300	6503	SO:0001583	missense	0			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.8742G>T	17.37:g.65960430G>T	ENSP00000315454:p.Gln2914His		Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.Q2914H	ENST00000321892.4	37	c.8742		17	.	.	.	.	.	.	.	.	.	.	G	10.73	1.433569	0.25813	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892;ENST00000342579	D;D;D	0.84944	-1.92;-1.92;-1.92	5.91	4.87	0.63330	.	.	.	.	.	D	0.86247	0.5887	L	0.31845	0.965	0.53688	D	0.999973	P;D;D;D	0.76494	0.873;0.977;0.999;0.999	P;P;D;D	0.69307	0.538;0.905;0.963;0.963	D	0.85562	0.1228	9	0.59425	D	0.04	-7.7087	9.494	0.38978	0.2185:0.0:0.7815:0.0	.	119;592;2788;2771	E9PE19;B4DJV8;Q12830-2;Q12830-4	.;.;.;.	H	2788;2771;2914;119	ENSP00000307208:Q2788H;ENSP00000334351:Q2771H;ENSP00000315454:Q2914H	ENSP00000307208:Q2788H	Q	+	3	2	BPTF	63390892	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.875000	0.39578	2.809000	0.96659	0.555000	0.69702	CAG	BPTF	-	pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000171634		0.512	BPTF-201	KNOWN	basic	protein_coding	BPTF	HGNC	protein_coding		-	0.00	77	0	G	NM_182641, NM_004459		65960430	+1	tier1	-	no_errors	ENST00000321892	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
BRD9	65980	genome.wustl.edu	37	5	889786	889786	+	Intron	SNP	T	T	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:889786T>A	ENST00000467963.1	-	4	567				TRIP13_ENST00000166345.3_5'Flank|BRD9_ENST00000494422.1_5'Flank|BRD9_ENST00000388890.4_Missense_Mutation_p.N10I|BRD9_ENST00000483173.1_Intron|BRD9_ENST00000435709.2_Missense_Mutation_p.N10I|BRD9_ENST00000323510.4_Missense_Mutation_p.N10I	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9						chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			GAAAAAAAAATTGAATACAAG	0.448																																																	0													88.0	89.0	88.0					5																	889786		2203	4300	6503	SO:0001627	intron_variant	0			AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.401-24A>T	5.37:g.889786T>A			A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Missense_Mutation	SNP	pfam_DUF3512,pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.N10I	ENST00000467963.1	37	c.29	CCDS34127.2	5	.	.	.	.	.	.	.	.	.	.	T	11.79	1.744156	0.30865	.	.	ENSG00000028310	ENST00000323510;ENST00000388890;ENST00000435709;ENST00000489093	T;T;T;T	0.35605	1.53;1.53;1.3;1.33	4.32	-8.65	0.00870	.	1.608980	0.03781	N	0.261414	T	0.21550	0.0519	.	.	.	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18209	-1.0344	9	0.87932	D	0	.	1.3174	0.02110	0.3499:0.2089:0.2817:0.1595	.	10;10	Q9H8M2-1;Q9H8M2-3	.;.	I	10	ENSP00000323557:N10I;ENSP00000373542:N10I;ENSP00000402984:N10I;ENSP00000420722:N10I	ENSP00000323557:N10I	N	-	2	0	BRD9	942786	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-2.385000	0.01062	-3.868000	0.00097	-0.490000	0.04691	AAT	BRD9	-	NULL	ENSG00000028310		0.448	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD9	HGNC	protein_coding	OTTHUMT00000354113.1	-	0.00	48	0	T	NM_023924		889786	-1	tier1	-	no_errors	ENST00000323510	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.000	A
BZW1	9689	genome.wustl.edu	37	2	201682946	201682946	+	Splice_Site	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:201682946G>C	ENST00000409600.1	+	8	1104	c.649G>C	c.(649-651)Gaa>Caa	p.E217Q	BZW1_ENST00000409226.1_Splice_Site_p.E221Q|BZW1_ENST00000452790.2_Splice_Site_p.E249Q	NM_001207067.1|NM_014670.3	NP_001193996.1|NP_055485.2	Q7L1Q6	BZW1_HUMAN	basic leucine zipper and W2 domains 1	217					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(1)|kidney(2)|large_intestine(1)|lung(2)	6						CTTCTTTTAGGAACTCTTTCC	0.313																																																	0													23.0	21.0	22.0					2																	201682946		1789	4055	5844	SO:0001630	splice_region_variant	0			D13630	CCDS56154.1, CCDS56155.1, CCDS56156.1	2q33	2010-04-09			ENSG00000082153	ENSG00000082153			18380	protein-coding gene	gene with protein product						10964520, 11524015	Standard	NM_001207067		Approved	BZAP45, KIAA0005	uc021vus.1	Q7L1Q6	OTTHUMG00000154560	ENST00000409600.1:c.649-1G>C	2.37:g.201682946G>C			B4DLZ8|B4DWF7|Q14281|Q15394|Q9BUY0	Missense_Mutation	SNP	pfam_W2_domain,superfamily_ARM-type_fold,smart_W2_domain	p.E217Q	ENST00000409600.1	37	c.649	CCDS56156.1	2	.	.	.	.	.	.	.	.	.	.	G	20.7	4.030358	0.75504	.	.	ENSG00000082153	ENST00000410110;ENST00000409600;ENST00000431249;ENST00000409226;ENST00000452790	T;T;T;T	0.79141	0.77;-1.22;-1.22;-1.24	5.76	5.76	0.90799	.	0.151934	0.64402	D	0.000019	D	0.89146	0.6632	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.999	D;P;D	0.68621	0.959;0.889;0.925	D	0.88376	0.2998	9	.	.	.	-7.915	20.3273	0.98706	0.0:0.0:1.0:0.0	.	221;249;217	B4DWF7;B4DLZ8;Q7L1Q6	.;.;BZW1_HUMAN	Q	217;217;133;221;249	ENSP00000387086:E217Q;ENSP00000386474:E217Q;ENSP00000386837:E221Q;ENSP00000394316:E249Q	.	E	+	1	0	BZW1	201391191	1.000000	0.71417	1.000000	0.80357	0.691000	0.40173	9.703000	0.98714	2.881000	0.98747	0.643000	0.83706	GAA	BZW1	-	NULL	ENSG00000082153		0.313	BZW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BZW1	HGNC	protein_coding	OTTHUMT00000335975.1	-	0.00	34	0	G	NM_014670	Missense_Mutation	201682946	+1	tier1	-	no_errors	ENST00000409600	ensembl	human	known	74_37	missense	30.00	35	15	SNP	1.000	C
CCDC7	79741	genome.wustl.edu	37	10	33140807	33140807	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:33140807G>C	ENST00000375030.2	+	21	2192	c.1574G>C	c.(1573-1575)gGt>gCt	p.G525A	C10orf68_ENST00000375028.3_Missense_Mutation_p.G570A|C10orf68_ENST00000375025.4_Missense_Mutation_p.G630A			Q9H943	CJ068_HUMAN		566										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						TATAGGGCTGGTCCAAGCTTT	0.338																																																	0													143.0	156.0	152.0					10																	33140807		2203	4298	6501	SO:0001583	missense	0																														ENST00000375030.2:c.1574G>C	10.37:g.33140807G>C	ENSP00000364170:p.Gly525Ala		B0QZ71|Q08AN7|Q8N7T7	Missense_Mutation	SNP	NULL	p.G630A	ENST00000375030.2	37	c.1889		10	.	.	.	.	.	.	.	.	.	.	.	2.487	-0.318396	0.05386	.	.	ENSG00000150076	ENST00000302316;ENST00000375030;ENST00000375028;ENST00000375025;ENST00000375037	T;T;T;T	0.36157	1.31;1.28;1.27;1.27	2.94	-5.88	0.02290	.	.	.	.	.	T	0.22205	0.0535	L	0.40543	1.245	0.09310	N	1	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.09377	0.002;0.002;0.001;0.004	T	0.15809	-1.0424	9	0.56958	D	0.05	.	2.7958	0.05401	0.5188:0.2303:0.135:0.1159	.	547;566;570;525	B4DX58;Q9H943;A2A3B4;A2A3D6	.;CJ068_HUMAN;.;.	A	566;525;570;630;542	ENSP00000303710:G566A;ENSP00000364170:G525A;ENSP00000364168:G570A;ENSP00000364165:G630A	ENSP00000303710:G566A	G	+	2	0	C10orf68	33180813	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.727000	0.01860	-2.734000	0.00382	-0.802000	0.03209	GGT	C10orf68	-	NULL	ENSG00000150076		0.338	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	C10orf68	HGNC	protein_coding	OTTHUMT00000313999.2	-	0.00	20	0	G			33140807	+1	tier1	-	no_errors	ENST00000375025	ensembl	human	known	74_37	missense	28.12	23	9	SNP	0.000	C
C14orf159	80017	genome.wustl.edu	37	14	91681831	91681831	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr14:91681831G>T	ENST00000523771.1	+	13	2235	c.1632G>T	c.(1630-1632)agG>agT	p.R544S	C14orf159_ENST00000523816.1_Missense_Mutation_p.R544S|C14orf159_ENST00000412671.2_Missense_Mutation_p.R549S|C14orf159_ENST00000521077.2_Missense_Mutation_p.R509S|C14orf159_ENST00000518868.1_Missense_Mutation_p.R549S|C14orf159_ENST00000522322.1_Missense_Mutation_p.R544S|C14orf159_ENST00000428926.2_Missense_Mutation_p.R544S|C14orf159_ENST00000256324.10_Missense_Mutation_p.R549S|C14orf159_ENST00000520328.1_Missense_Mutation_p.R492S|C14orf159_ENST00000525393.2_Missense_Mutation_p.R420S			Q7Z3D6	CN159_HUMAN	chromosome 14 open reading frame 159	544						mitochondrion (GO:0005739)		p.R544R(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		AGTACCTGAGGAAAGCAGTCG	0.577																																																	1	Substitution - coding silent(1)	skin(1)											102.0	91.0	95.0					14																	91681831		2203	4300	6503	SO:0001583	missense	0			AK097294	CCDS32141.1, CCDS41979.1, CCDS45150.1, CCDS66693.1, CCDS73677.1	14q32.11	2012-09-26			ENSG00000133943	ENSG00000133943			20498	protein-coding gene	gene with protein product							Standard	NM_001102367		Approved	FLJ39975	uc001xze.2	Q7Z3D6	OTTHUMG00000164980	ENST00000523771.1:c.1632G>T	14.37:g.91681831G>T	ENSP00000429655:p.Arg544Ser		B3KUI7|Q86SW3|Q86SX8|Q86SX9|Q86T08|Q86TV5|Q96GW5|Q9H7G0|Q9H8Y9|Q9H9W6	Missense_Mutation	SNP	pfam_DUF1445,pirsf_UPF0317_mt	p.R549S	ENST00000523771.1	37	c.1647	CCDS32141.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.982|7.982	0.751417|0.751417	0.15778|0.15778	.|.	.|.	ENSG00000133943|ENSG00000133943	ENST00000522816|ENST00000520328;ENST00000256324;ENST00000521077;ENST00000518868;ENST00000523816;ENST00000525393;ENST00000428926;ENST00000522322;ENST00000523771;ENST00000412671	.|T;T;T;T;T;T;T;T;T;T	.|0.23348	.|1.94;2.52;1.91;2.52;2.52;2.31;2.52;2.52;2.52;2.52	5.34|5.34	2.53|2.53	0.30540|0.30540	.|.	.|0.586711	.|0.17891	.|N	.|0.158524	T|T	0.26048|0.26048	0.0635|0.0635	L|L	0.55743|0.55743	1.74|1.74	0.35775|0.35775	D|D	0.821197|0.821197	.|P;P;P;P;P	.|0.48089	.|0.905;0.72;0.884;0.902;0.884	.|B;P;B;B;B	.|0.44673	.|0.422;0.457;0.426;0.163;0.426	T|T	0.22068|0.22068	-1.0227|-1.0227	5|10	.|0.44086	.|T	.|0.13	.|.	8.191|8.191	0.31368|0.31368	0.2556:0.0:0.7443:0.0|0.2556:0.0:0.7443:0.0	.|.	.|544;420;492;549;509	.|Q7Z3D6;Q8NB88;Q7Z3D6-5;Q7Z3D6-2;Q7Z3D6-3	.|CN159_HUMAN;.;.;.;.	V|S	145|492;549;509;549;544;420;544;544;544;549	.|ENSP00000429453:R492S;ENSP00000256324:R549S;ENSP00000430137:R509S;ENSP00000428263:R549S;ENSP00000428974:R544S;ENSP00000435459:R420S;ENSP00000404343:R544S;ENSP00000427953:R544S;ENSP00000429655:R544S;ENSP00000404196:R549S	.|ENSP00000256324:R549S	G|R	+|+	2|3	0|2	C14orf159|C14orf159	90751584|90751584	1.000000|1.000000	0.71417|0.71417	0.479000|0.479000	0.27329|0.27329	0.026000|0.026000	0.11368|0.11368	2.266000|2.266000	0.43320|0.43320	0.252000|0.252000	0.21531|0.21531	0.655000|0.655000	0.94253|0.94253	GGA|AGG	C14orf159	-	pirsf_UPF0317_mt	ENSG00000133943		0.577	C14orf159-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C14orf159	HGNC	protein_coding	OTTHUMT00000381273.1		0.00	72	0	G	NM_024952		91681831	+1			no_errors	ENST00000256324	ensembl	human	known	74_37	missense	6.12	46	3	SNP	0.970	T
C19orf18	147685	genome.wustl.edu	37	19	58472903	58472903	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:58472903C>G	ENST00000314391.3	-	5	489	c.388G>C	c.(388-390)Gag>Cag	p.E130Q		NM_152474.4	NP_689687.1	Q8NEA5	CS018_HUMAN	chromosome 19 open reading frame 18	130						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	8		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)		TGTCTTTCCTCAGCCTGTGCC	0.433																																																	0													126.0	115.0	119.0					19																	58472903		2203	4300	6503	SO:0001583	missense	0			BC033933	CCDS12967.1	19q13.43	2013-03-11			ENSG00000177025	ENSG00000177025			28642	protein-coding gene	gene with protein product						12477932	Standard	NM_152474		Approved	MGC41906	uc002qqv.3	Q8NEA5	OTTHUMG00000183450	ENST00000314391.3:c.388G>C	19.37:g.58472903C>G	ENSP00000321519:p.Glu130Gln			Missense_Mutation	SNP	NULL	p.E130Q	ENST00000314391.3	37	c.388	CCDS12967.1	19	.	.	.	.	.	.	.	.	.	.	C	13.45	2.239393	0.39598	.	.	ENSG00000177025	ENST00000314391	T	0.59906	0.23	4.14	4.14	0.48551	.	0.000000	0.46145	D	0.000313	T	0.64483	0.2602	L	0.34521	1.04	0.28703	N	0.903985	D	0.89917	1.0	D	0.91635	0.999	T	0.59451	-0.7452	10	0.87932	D	0	-44.2751	12.212	0.54386	0.0:1.0:0.0:0.0	.	130	Q8NEA5	CS018_HUMAN	Q	130	ENSP00000321519:E130Q	ENSP00000321519:E130Q	E	-	1	0	C19orf18	63164715	0.966000	0.33281	0.913000	0.36048	0.173000	0.22820	2.704000	0.47118	2.596000	0.87737	0.462000	0.41574	GAG	C19orf18	-	NULL	ENSG00000177025		0.433	C19orf18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf18	HGNC	protein_coding	OTTHUMT00000466704.1		0.00	32	0	C	NM_152474		58472903	-1			no_errors	ENST00000314391	ensembl	human	known	74_37	missense	13.04	19	3	SNP	0.923	G
ERICH3	127254	genome.wustl.edu	37	1	75112384	75112384	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:75112384G>T	ENST00000326665.5	-	3	428	c.210C>A	c.(208-210)gcC>gcA	p.A70A		NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		70										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						AAATTGCCTGGGCTAAGCATT	0.299																																																	0													34.0	31.0	32.0					1																	75112384		2036	3904	5940	SO:0001819	synonymous_variant	0																														ENST00000326665.5:c.210C>A	1.37:g.75112384G>T			Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Silent	SNP	NULL	p.A70	ENST00000326665.5	37	c.210	CCDS30755.1	1																																																																																			C1orf173	-	NULL	ENSG00000178965		0.299	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1		0.00	32	0	G			75112384	-1			no_errors	ENST00000326665	ensembl	human	known	74_37	silent	5.77	49	3	SNP	0.907	T
C22orf23	84645	genome.wustl.edu	37	22	38343465	38343465	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr22:38343465C>G	ENST00000249079.2	-	4	428	c.172G>C	c.(172-174)Gat>Cat	p.D58H	C22orf23_ENST00000403305.1_Missense_Mutation_p.D58H|C22orf23_ENST00000403026.1_Missense_Mutation_p.D58H			Q9BZE7	EVG1_HUMAN	chromosome 22 open reading frame 23	58										endometrium(3)|kidney(2)|large_intestine(7)	12	Melanoma(58;0.045)					GGCAAAGCATCTCCTCCTGGG	0.512																																																	0													117.0	100.0	106.0					22																	38343465		2203	4300	6503	SO:0001583	missense	0			AF324466	CCDS13962.1, CCDS74860.1	22q13.1	2013-10-11			ENSG00000128346	ENSG00000128346			18589	protein-coding gene	gene with protein product						11237012	Standard	NM_032561		Approved	FLJ32787, EVG1, LOC84645	uc003auj.2	Q9BZE7	OTTHUMG00000150672	ENST00000249079.2:c.172G>C	22.37:g.38343465C>G	ENSP00000249079:p.Asp58His		Q5JYU9|Q96M68	Missense_Mutation	SNP	pfam_UPF0193	p.D58H	ENST00000249079.2	37	c.172	CCDS13962.1	22	.	.	.	.	.	.	.	.	.	.	C	15.14	2.744501	0.49151	.	.	ENSG00000128346	ENST00000403305;ENST00000249079;ENST00000403026;ENST00000418863;ENST00000422191	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	5.38	2.2	0.27929	.	0.590794	0.17643	N	0.166969	T	0.50548	0.1622	L	0.59436	1.845	0.21105	N	0.999782	D	0.58970	0.984	P	0.57620	0.824	T	0.37641	-0.9697	10	0.56958	D	0.05	-1.3546	8.5833	0.33642	0.0:0.7609:0.0:0.2391	.	58	Q9BZE7	EVG1_HUMAN	H	58	ENSP00000384667:D58H;ENSP00000249079:D58H;ENSP00000384618:D58H;ENSP00000395077:D58H;ENSP00000407707:D58H	ENSP00000249079:D58H	D	-	1	0	C22orf23	36673411	0.271000	0.24162	0.325000	0.25375	0.626000	0.37791	0.549000	0.23329	0.265000	0.21872	0.555000	0.69702	GAT	C22orf23	-	pfam_UPF0193	ENSG00000128346		0.512	C22orf23-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C22orf23	HGNC	protein_coding	OTTHUMT00000319564.1		0.00	62	0	C	NM_032561		38343465	-1			no_errors	ENST00000249079	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.310	G
CA1	759	genome.wustl.edu	37	8	86240905	86240905	+	Splice_Site	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:86240905G>T	ENST00000523953.1	-	9	1716	c.670C>A	c.(670-672)Ctg>Atg	p.L224M	CA1_ENST00000542576.1_Splice_Site_p.L224M|CA1_ENST00000523022.1_Splice_Site_p.L224M|CA1_ENST00000432364.2_Splice_Site_p.L224M|CA1_ENST00000522389.1_Splice_Site_p.L90M|CA1_ENST00000256119.5_Splice_Site_p.L224M|CA1_ENST00000431316.1_Splice_Site_p.L224M			P00915	CAH1_HUMAN	carbonic anhydrase I	224					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	13		all_lung(136;4.89e-06)			Acetazolamide(DB00819)|Amlodipine(DB00381)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Ethinamate(DB01031)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methocarbamol(DB00423)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	AATTGTGCCAGCTAGAAGGat	0.378																																																	0													79.0	76.0	77.0					8																	86240905		2203	4300	6503	SO:0001630	splice_region_variant	0			M33987	CCDS6237.1	8q21.2	2006-03-10				ENSG00000133742	4.2.1.1	"""Carbonic anhydrases"""	1368	protein-coding gene	gene with protein product		114800				1916821	Standard	NM_001164830		Approved	Car1	uc003ydi.3	P00915		ENST00000523953.1:c.670-1C>A	8.37:g.86240905G>T				Missense_Mutation	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.L224M	ENST00000523953.1	37	c.670	CCDS6237.1	8	.	.	.	.	.	.	.	.	.	.	G	7.680	0.688849	0.14973	.	.	ENSG00000133742	ENST00000523953;ENST00000256119;ENST00000431316;ENST00000542576;ENST00000432364;ENST00000523022;ENST00000522389;ENST00000524324;ENST00000517618;ENST00000519991	T;T;T;T;T;T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49	4.97	4.09	0.47781	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.249082	0.38548	N	0.001654	T	0.75398	0.3844	M	0.66939	2.045	0.43381	D	0.995482	D	0.89917	1.0	D	0.83275	0.996	T	0.75587	-0.3266	10	0.05620	T	0.96	-1.9923	6.3559	0.21400	0.0947:0.0:0.7241:0.1812	.	224	P00915	CAH1_HUMAN	M	224;224;224;224;224;224;90;158;224;111	ENSP00000430656:L224M;ENSP00000256119:L224M;ENSP00000392338:L224M;ENSP00000443517:L224M;ENSP00000401551:L224M;ENSP00000429798:L224M;ENSP00000427773:L90M;ENSP00000428923:L158M;ENSP00000430861:L224M;ENSP00000430543:L111M	ENSP00000256119:L224M	L	-	1	2	CA1	86428157	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	3.734000	0.55037	1.073000	0.40885	0.650000	0.86243	CTG	CA1	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000133742		0.378	CA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA1	HGNC	protein_coding	OTTHUMT00000381067.1		0.00	25	0	G	NM_001738	Missense_Mutation	86240905	-1			no_errors	ENST00000256119	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
C8orf76	84933	genome.wustl.edu	37	8	124250109	124250109	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:124250109G>T	ENST00000276704.4	-	3	337	c.286C>A	c.(286-288)Cag>Aag	p.Q96K	C8orf76_ENST00000521310.1_5'UTR|ZHX1-C8ORF76_ENST00000357082.4_Missense_Mutation_p.Q64K	NM_032847.2	NP_116236.1	Q96K31	CH076_HUMAN	chromosome 8 open reading frame 76	96										NS(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(4)	17	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			TGACCTTCCTGGACATCCCTT	0.418																																																	0													76.0	69.0	71.0					8																	124250109		2203	4300	6503	SO:0001583	missense	0			AK027731	CCDS6341.1	8q24.13	2012-06-27			ENSG00000189376	ENSG00000189376			25924	protein-coding gene	gene with protein product							Standard	NM_032847		Approved	FLJ14825	uc003yqc.2	Q96K31	OTTHUMG00000172562	ENST00000276704.4:c.286C>A	8.37:g.124250109G>T	ENSP00000276704:p.Gln96Lys		Q53HC1	Missense_Mutation	SNP	NULL	p.Q96K	ENST00000276704.4	37	c.286	CCDS6341.1	8	.	.	.	.	.	.	.	.	.	.	G	14.15	2.448648	0.43531	.	.	ENSG00000189376	ENST00000276704;ENST00000357082	T;T	0.76316	-1.01;-1.01	5.86	4.99	0.66335	Tetratricopeptide-like helical (1);	0.234727	0.45126	D	0.000394	T	0.77987	0.4213	M	0.71581	2.175	0.35225	D	0.776386	P;P	0.48294	0.908;0.908	P;P	0.45753	0.492;0.492	T	0.82325	-0.0513	10	0.30854	T	0.27	-12.6664	11.9317	0.52849	0.1392:0.0:0.8608:0.0	.	64;96	Q96EF9;Q96K31	.;CH076_HUMAN	K	96;64	ENSP00000276704:Q96K;ENSP00000349593:Q64K	ENSP00000276704:Q96K	Q	-	1	0	C8orf76	124319290	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	2.438000	0.44837	1.479000	0.48272	0.655000	0.94253	CAG	C8orf76	-	NULL	ENSG00000189376		0.418	C8orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8orf76	HGNC	protein_coding	OTTHUMT00000381748.1	-	0.00	69	0	G	NM_032847		124250109	-1	tier1	-	no_errors	ENST00000276704	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
CA10	56934	genome.wustl.edu	37	17	49710983	49710983	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:49710983T>G	ENST00000285273.4	-	9	1929	c.818A>C	c.(817-819)aAc>aCc	p.N273T	CA10_ENST00000442502.2_Missense_Mutation_p.N273T|CA10_ENST00000451037.2_Missense_Mutation_p.N273T|CA10_ENST00000571918.1_5'Flank|CA10_ENST00000570565.1_Missense_Mutation_p.N198T|CA10_ENST00000340813.6_Missense_Mutation_p.N279T	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	273					brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	AGATGGCTGGTTCTGGCTGAG	0.498																																																	0													99.0	85.0	90.0					17																	49710983		2203	4300	6503	SO:0001583	missense	0			AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.818A>C	17.37:g.49710983T>G	ENSP00000285273:p.Asn273Thr		B2R7J0|B4DGL6	Missense_Mutation	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.N279T	ENST00000285273.4	37	c.836	CCDS32684.1	17	.	.	.	.	.	.	.	.	.	.	T	19.43	3.825496	0.71143	.	.	ENSG00000154975	ENST00000442502;ENST00000285273;ENST00000451037;ENST00000340813	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.44	4.36	0.52297	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.046280	0.85682	D	0.000000	T	0.68146	0.2969	L	0.33293	1	0.58432	D	0.999991	D;D;B	0.89917	1.0;1.0;0.379	D;D;B	0.97110	1.0;1.0;0.124	T	0.62671	-0.6805	10	0.09338	T	0.73	.	10.4229	0.44361	0.0:0.0767:0.0:0.9233	.	273;279;198	Q9NS85;Q68D28;B4DGL6	CAH10_HUMAN;.;.	T	273;273;273;279	ENSP00000390666:N273T;ENSP00000285273:N273T;ENSP00000405388:N273T;ENSP00000340363:N279T	ENSP00000285273:N273T	N	-	2	0	CA10	47065982	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	7.884000	0.87274	0.903000	0.36546	0.533000	0.62120	AAC	CA10	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000154975		0.498	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CA10	HGNC	protein_coding	OTTHUMT00000437480.1	-	0.00	49	0	T	NM_020178		49710983	-1	tier1	-	no_errors	ENST00000340813	ensembl	human	known	74_37	missense	28.57	25	10	SNP	1.000	G
CACNA1C	775	genome.wustl.edu	37	12	2743482	2743482	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:2743482G>T	ENST00000347598.4	+	32	3992	c.3992G>T	c.(3991-3993)tGg>tTg	p.W1331L	CACNA1C_ENST00000399655.1_Missense_Mutation_p.W1283L|CACNA1C_ENST00000399644.1_Intron|CACNA1C_ENST00000327702.7_Missense_Mutation_p.W1283L|CACNA1C_ENST00000399649.1_Missense_Mutation_p.W1283L|CACNA1C_ENST00000399641.1_Missense_Mutation_p.W1283L|CACNA1C_ENST00000399637.1_Missense_Mutation_p.W1283L|CACNA1C_ENST00000399629.1_Missense_Mutation_p.W1311L|CACNA1C_ENST00000399591.1_Missense_Mutation_p.W1283L|CACNA1C_ENST00000399597.1_Intron|CACNA1C_ENST00000399617.1_Intron|CACNA1C_ENST00000335762.5_Missense_Mutation_p.W1308L|CACNA1C_ENST00000399621.1_Missense_Mutation_p.W1283L|CACNA1C_ENST00000406454.3_Intron|CACNA1C_ENST00000399595.1_Missense_Mutation_p.W1283L|CACNA1C_ENST00000402845.3_Intron|CACNA1C_ENST00000399603.1_Intron|CACNA1C_ENST00000399601.1_Missense_Mutation_p.W1283L|CACNA1C_ENST00000399634.1_Missense_Mutation_p.W1283L|CACNA1C_ENST00000399638.1_Missense_Mutation_p.W1311L|CACNA1C_ENST00000399606.1_Missense_Mutation_p.W1303L|CACNA1C_ENST00000344100.3_Missense_Mutation_p.W1283L	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1331					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TGTGATGCATGGAATACATTT	0.468																																																	0													79.0	71.0	74.0					12																	2743482		1961	4152	6113	SO:0001583	missense	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.3992G>T	12.37:g.2743482G>T	ENSP00000266376:p.Trp1331Leu		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.W1283L	ENST00000347598.4	37	c.3848	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	G	16.72	3.202592	0.58234	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399638;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000399634;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.99121	-5.45;-5.45;-5.45;-5.45;-5.45;-5.45;-5.45;-5.45;-5.45;-5.45;-5.45;-5.45;-5.45;-5.45;-5.45;-5.45	5.31	5.31	0.75309	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99708	0.9888	H	0.99705	4.715	0.80722	D	1	P;P;B;D;D;B;D;D;D;B;B;B;B;B;B;B;B	0.89917	0.515;0.643;0.374;0.996;0.996;0.161;0.999;1.0;0.996;0.414;0.261;0.002;0.385;0.261;0.261;0.385;0.227	B;P;B;D;D;B;D;D;D;B;B;B;B;B;B;B;B	0.85130	0.1;0.876;0.1;0.991;0.991;0.189;0.997;0.991;0.991;0.348;0.189;0.047;0.189;0.189;0.189;0.189;0.1	D	0.96933	0.9682	10	0.87932	D	0	.	18.9677	0.92702	0.0:0.0:1.0:0.0	.	1283;1331;1283;1311;1311;1303;1283;1254;1331;1283;1283;1283;1283;1283;1283;1283;1283	Q13936-14;Q13936;Q13936-33;Q13936-32;Q13936-31;Q13936-30;Q13936-23;Q13936-28;Q13936-11;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	L	1308;1283;1311;1283;1283;1283;1283;1331;1303;1283;1283;1311;1283;1283;1283;1283;1124	ENSP00000336982:W1308L;ENSP00000382563:W1283L;ENSP00000382547:W1311L;ENSP00000382530:W1283L;ENSP00000382546:W1283L;ENSP00000382500:W1283L;ENSP00000382549:W1283L;ENSP00000266376:W1331L;ENSP00000382515:W1303L;ENSP00000382510:W1283L;ENSP00000341092:W1283L;ENSP00000382537:W1311L;ENSP00000329877:W1283L;ENSP00000382557:W1283L;ENSP00000382542:W1283L;ENSP00000382504:W1283L	ENSP00000323129:W1124L	W	+	2	0	CACNA1C	2613743	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.677000	0.98645	2.477000	0.83638	0.655000	0.94253	TGG	CACNA1C	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000151067		0.468	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1	-	0.00	47	0	G	NM_000719		2743482	+1	tier1	-	no_errors	ENST00000399634	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
CALR	811	genome.wustl.edu	37	19	13054423	13054423	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:13054423G>A	ENST00000316448.5	+	8	1106	c.1033G>A	c.(1033-1035)Gag>Aag	p.E345K	RAD23A_ENST00000592268.1_5'Flank|CTC-425F1.4_ENST00000589120.1_RNA|RAD23A_ENST00000316856.3_5'Flank|RAD23A_ENST00000586534.1_5'Flank|RAD23A_ENST00000541222.1_5'Flank	NM_004343.3	NP_004334.1	P27797	CALR_HUMAN	calreticulin	345	C-domain.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|cellular response to lithium ion (GO:0071285)|cellular senescence (GO:0090398)|chaperone-mediated protein folding (GO:0061077)|cortical actin cytoskeleton organization (GO:0030866)|endoplasmic reticulum unfolded protein response (GO:0030968)|glucocorticoid receptor signaling pathway (GO:0042921)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|peptide antigen assembly with MHC class I protein complex (GO:0002502)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of phagocytosis (GO:0050766)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|post-translational protein modification (GO:0043687)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein localization to nucleus (GO:0034504)|protein maturation by protein folding (GO:0022417)|protein N-linked glycosylation via asparagine (GO:0018279)|protein stabilization (GO:0050821)|regulation of apoptotic process (GO:0042981)|regulation of meiosis (GO:0040020)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to testosterone (GO:0033574)|sequestering of calcium ion (GO:0051208)|spermatogenesis (GO:0007283)	acrosomal vesicle (GO:0001669)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|intracellular (GO:0005622)|membrane (GO:0016020)|MHC class I peptide loading complex (GO:0042824)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasmic reticulum (GO:0016529)	androgen receptor binding (GO:0050681)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|chaperone binding (GO:0051087)|complement component C1q binding (GO:0001849)|DNA binding (GO:0003677)|glycoprotein binding (GO:0001948)|hormone binding (GO:0042562)|integrin binding (GO:0005178)|iron ion binding (GO:0005506)|mRNA binding (GO:0003729)|peptide binding (GO:0042277)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)	10					Antihemophilic Factor(DB00025)|Melatonin(DB01065)|Tenecteplase(DB00031)	GTTTGGCAACGAGACGTGGGG	0.597																																																	0													152.0	121.0	131.0					19																	13054423		2203	4300	6503	SO:0001583	missense	0			M84739	CCDS12288.1	19p13.3-p13.2	2014-09-17				ENSG00000179218			1455	protein-coding gene	gene with protein product	"""Sicca syndrome antigen A (autoantigen Ro; calreticulin)"", ""autoantigen Ro"""	109091				2365822	Standard	NM_004343		Approved	RO, SSA, cC1qR, CRT, FLJ26680	uc002mvu.2	P27797		ENST00000316448.5:c.1033G>A	19.37:g.13054423G>A	ENSP00000320866:p.Glu345Lys		Q6IAT4|Q9UDG2	Missense_Mutation	SNP	pirsf_Calreticulin,pfam_Calret/calnex,superfamily_ConA-like_lec_gl_sf,prints_Calret/calnex	p.E345K	ENST00000316448.5	37	c.1033	CCDS12288.1	19	.	.	.	.	.	.	.	.	.	.	G	19.40	3.820857	0.71028	.	.	ENSG00000179218	ENST00000316448;ENST00000539083	T	0.51574	0.7	5.6	5.6	0.85130	Concanavalin A-like lectin/glucanase (1);	0.112806	0.64402	D	0.000011	T	0.40546	0.1121	L	0.37897	1.145	0.80722	D	1	B	0.27559	0.181	B	0.15870	0.014	T	0.17561	-1.0365	10	0.42905	T	0.14	-42.1271	18.3626	0.90380	0.0:0.0:1.0:0.0	.	345	P27797	CALR_HUMAN	K	345;224	ENSP00000320866:E345K	ENSP00000320866:E345K	E	+	1	0	CALR	12915423	1.000000	0.71417	0.815000	0.32552	0.631000	0.37964	9.630000	0.98420	2.633000	0.89246	0.561000	0.74099	GAG	CALR	-	pirsf_Calreticulin,superfamily_ConA-like_lec_gl_sf	ENSG00000179218		0.597	CALR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALR	HGNC	protein_coding	OTTHUMT00000451952.1	-	0.00	43	0	G	NM_004343		13054423	+1	tier1	-	no_errors	ENST00000316448	ensembl	human	known	74_37	missense	22.22	28	8	SNP	1.000	A
CARD18	59082	genome.wustl.edu	37	11	105009559	105009559	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:105009559G>A	ENST00000530950.1	-	2	253	c.254C>T	c.(253-255)tCa>tTa	p.S85L	CARD18_ENST00000526823.1_Missense_Mutation_p.S46L|CARD18_ENST00000532895.1_Missense_Mutation_p.S46L	NM_021571.3	NP_067546.1	P57730	CAR18_HUMAN	caspase recruitment domain family, member 18	85	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				inflammatory response (GO:0006954)|regulation of apoptotic process (GO:0042981)		cysteine-type endopeptidase inhibitor activity (GO:0004869)			central_nervous_system(1)|ovary(1)	2						ACCCATCTTTGAGGCAAGTTG	0.408																																																	0													241.0	222.0	228.0					11																	105009559		1897	4113	6010	SO:0001583	missense	0			AY358231	CCDS53705.1	11q22.3	2008-09-02				ENSG00000255501			28861	protein-coding gene	gene with protein product		605354				11051551	Standard	NM_021571		Approved	UNQ5804, ICEBERG, pseudo-ICE	uc021qpy.1	P57730		ENST00000530950.1:c.254C>T	11.37:g.105009559G>A	ENSP00000436691:p.Ser85Leu		A2RRF8	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like_dom,pfscan_CARD	p.S85L	ENST00000530950.1	37	c.254	CCDS53705.1	11	.	.	.	.	.	.	.	.	.	.	.	6.097	0.386122	0.11524	.	.	ENSG00000255501	ENST00000530950;ENST00000526823;ENST00000532895	T;T;T	0.22945	1.93;1.93;1.93	2.58	-5.16	0.02857	DEATH-like (2);Caspase Recruitment (3);	0.900232	0.09540	U	0.788437	T	0.20618	0.0496	.	.	.	0.09310	N	1	B	0.27380	0.177	B	0.41723	0.365	T	0.44345	-0.9334	9	0.30854	T	0.27	.	3.1882	0.06608	0.1367:0.507:0.1492:0.2071	.	85	P57730	CAR18_HUMAN	L	85;46;46	ENSP00000436691:S85L;ENSP00000437035:S46L;ENSP00000437187:S46L	ENSP00000437035:S46L	S	-	2	0	CARD18	104514769	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.296000	0.00522	-2.414000	0.00569	-0.354000	0.07668	TCA	CARD18	-	pfam_CARD,superfamily_DEATH-like_dom,pfscan_CARD	ENSG00000255501		0.408	CARD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD18	HGNC	protein_coding	OTTHUMT00000388183.2		0.00	71	0	G	NM_021571		105009559	-1			no_errors	ENST00000530950	ensembl	human	known	74_37	missense	8.93	51	5	SNP	0.000	A
CASP8AP2	9994	genome.wustl.edu	37	6	90575968	90575968	+	RNA	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:90575968C>G	ENST00000551025.1	+	0	4396									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		TAGGAAAACACATGTAAGAAT	0.378																																					Colon(187;1656 2025 17045 31481 39901)												0													46.0	42.0	43.0					6																	90575968		1862	4106	5968			0			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90575968C>G				RNA	SNP	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			CASP8AP2	-	-	ENSG00000118412		0.378	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	HGNC	processed_transcript		-	0.00	20	0	C	NM_001137667		90575968	+1	tier1	-	no_errors	ENST00000237177	ensembl	human	known	74_37	rna	42.86	12	9	SNP	0.007	G
CASP8AP2	9994	genome.wustl.edu	37	6	90577632	90577632	+	RNA	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:90577632C>G	ENST00000551025.1	+	0	6060									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		ATGATCATTTCATTGTGAAAA	0.438																																					Colon(187;1656 2025 17045 31481 39901)												0													127.0	114.0	118.0					6																	90577632		1934	4140	6074			0			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90577632C>G				RNA	SNP	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			CASP8AP2	-	-	ENSG00000118412		0.438	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	HGNC	processed_transcript		-	0.00	44	0	C	NM_001137667		90577632	+1	tier1	-	no_errors	ENST00000237177	ensembl	human	known	74_37	rna	29.79	33	14	SNP	1.000	G
CASP8AP2	9994	genome.wustl.edu	37	6	90578545	90578545	+	RNA	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:90578545C>G	ENST00000551025.1	+	0	6973									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		AAATCATCCTCATAAAAAACA	0.358																																					Colon(187;1656 2025 17045 31481 39901)												0													43.0	40.0	41.0					6																	90578545		1815	4079	5894			0			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90578545C>G				RNA	SNP	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			CASP8AP2	-	-	ENSG00000118412		0.358	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	HGNC	processed_transcript		-	0.00	15	0	C	NM_001137667		90578545	+1	tier1	-	no_errors	ENST00000237177	ensembl	human	known	74_37	rna	30.00	14	6	SNP	0.930	G
CASZ1	54897	genome.wustl.edu	37	1	10715781	10715781	+	Silent	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:10715781G>A	ENST00000377022.3	-	9	1907	c.1590C>T	c.(1588-1590)agC>agT	p.S530S	RP4-734G22.3_ENST00000606802.1_RNA|CASZ1_ENST00000344008.5_Silent_p.S530S	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	530					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		CGTCCAGCGGGCTGAAACGCA	0.607																																																	0													212.0	153.0	173.0					1																	10715781		2203	4300	6503	SO:0001819	synonymous_variant	0			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.1590C>T	1.37:g.10715781G>A			Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S530	ENST00000377022.3	37	c.1590	CCDS41246.1	1																																																																																			CASZ1	-	NULL	ENSG00000130940		0.607	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	-	0.00	53	0	G	NM_017766		10715781	-1	tier1	-	no_errors	ENST00000377022	ensembl	human	known	74_37	silent	8.16	43	4	SNP	1.000	A
CCDC141	285025	genome.wustl.edu	37	2	179730512	179730512	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:179730512C>G	ENST00000420890.2	-	17	2823	c.2706G>C	c.(2704-2706)atG>atC	p.M902I	CCDC141_ENST00000295723.5_Missense_Mutation_p.M327I	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	902										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TCTCGTCTCTCATGGCGCAGT	0.522																																																	0													364.0	327.0	339.0					2																	179730512		2203	4300	6503	SO:0001583	missense	0			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.2706G>C	2.37:g.179730512C>G	ENSP00000395995:p.Met902Ile		H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Spectrin_repeat,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.M902I	ENST00000420890.2	37	c.2706		2	.	.	.	.	.	.	.	.	.	.	C	6.570	0.473540	0.12521	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723;ENST00000443758	T;T;T;T	0.39592	1.07;1.39;1.39;1.62	6.07	-12.1	0.00011	.	1.564530	0.03402	N	0.203481	T	0.15262	0.0368	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.05733	-1.0867	10	0.22706	T	0.39	3.4315	3.7058	0.08400	0.1131:0.3873:0.2599:0.2397	.	327	Q6ZP82	CC141_HUMAN	I	902;346;327;902	ENSP00000395995:M902I;ENSP00000344627:M346I;ENSP00000295723:M327I;ENSP00000390190:M902I	ENSP00000295723:M327I	M	-	3	0	CCDC141	179438757	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.689000	0.05144	-2.082000	0.00868	-1.835000	0.00590	ATG	CCDC141	-	NULL	ENSG00000163492		0.522	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	CCDC141	HGNC	protein_coding		-	0.00	111	0	C	NM_173648		179730512	-1	tier1	-	no_errors	ENST00000420890	ensembl	human	known	74_37	missense	17.78	74	16	SNP	0.000	G
CCDC158	339965	genome.wustl.edu	37	4	77305497	77305497	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:77305497G>T	ENST00000388914.3	-	5	622	c.470C>A	c.(469-471)gCc>gAc	p.A157D	CCDC158_ENST00000434846.2_Missense_Mutation_p.A157D	NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	157										breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						AAGGCATTTGGCAGCTTCAAG	0.388																																																	0													120.0	110.0	113.0					4																	77305497		1898	4130	6028	SO:0001583	missense	0			BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.470C>A	4.37:g.77305497G>T	ENSP00000373566:p.Ala157Asp		Q8IYQ1|Q8N7D4|Q8N7E3	Missense_Mutation	SNP	superfamily_Prefoldin	p.A157D	ENST00000388914.3	37	c.470	CCDS43242.1	4	.	.	.	.	.	.	.	.	.	.	G	18.37	3.609305	0.66558	.	.	ENSG00000163749	ENST00000388914;ENST00000318586;ENST00000434846	T;T	0.35421	1.35;1.31	5.72	5.72	0.89469	.	0.000000	0.56097	D	0.000039	T	0.44561	0.1299	N	0.24115	0.695	0.34301	D	0.684311	P;D	0.89917	0.944;1.0	P;D	0.87578	0.714;0.998	T	0.40627	-0.9553	10	0.13470	T	0.59	.	16.792	0.85591	0.0:0.0:1.0:0.0	.	157;157	Q5M9N0-3;Q5M9N0	.;CD158_HUMAN	D	157	ENSP00000373566:A157D;ENSP00000401742:A157D	ENSP00000316815:A157D	A	-	2	0	CCDC158	77524521	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	4.480000	0.60243	2.711000	0.92665	0.655000	0.94253	GCC	CCDC158	-	NULL	ENSG00000163749		0.388	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC158	HGNC	protein_coding	OTTHUMT00000362694.2		0.00	24	0	G	NM_001042784		77305497	-1			no_errors	ENST00000388914	ensembl	human	known	74_37	missense	9.09	30	3	SNP	1.000	T
MMACHC	25974	genome.wustl.edu	37	1	45963037	45963037	+	5'Flank	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:45963037G>T	ENST00000401061.4	+	0	0				CCDC163P_ENST00000490551.3_Missense_Mutation_p.P66T|CCDC163P_ENST00000502793.2_5'UTR|CCDC163P_ENST00000488405.2_Missense_Mutation_p.P66T|CCDC163P_ENST00000432082.1_Missense_Mutation_p.P66T	NM_015506.2	NP_056321.2	Q9Y4U1	MMAC_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria						cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	8	Acute lymphoblastic leukemia(166;0.155)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGCACTGCAGGAGTGACAGCA	0.453																																																	0													87.0	87.0	87.0					1																	45963037		2120	4249	6369	SO:0001631	upstream_gene_variant	0				CCDS41324.1	1p34.1	2011-05-12			ENSG00000132763	ENSG00000132763			24525	protein-coding gene	gene with protein product		609831				16311595	Standard	NM_015506		Approved	DKFZP564I122, cblC	uc009vxv.3	Q9Y4U1	OTTHUMG00000007742		1.37:g.45963037G>T	Exception_encountered		Q5T157|Q9BRQ7	Missense_Mutation	SNP	NULL	p.P66T	ENST00000401061.4	37	c.196	CCDS41324.1	1	.	.	.	.	.	.	.	.	.	.	G	12.52	1.961305	0.34565	.	.	ENSG00000236624	ENST00000490551;ENST00000432082;ENST00000488405	.	.	.	3.96	-2.24	0.06909	.	.	.	.	.	T	0.28134	0.0694	.	.	.	0.09310	N	1	B;B	0.28636	0.218;0.218	B;B	0.31101	0.058;0.124	T	0.25537	-1.0129	7	0.35671	T	0.21	.	8.5415	0.33395	0.6747:0.0:0.3253:0.0	.	66;66	E9PLD6;F2Z3K3	.;.	T	66	.	ENSP00000431736:P66T	P	-	1	0	CCDC163P	45735624	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.653000	0.05360	-0.440000	0.07211	-0.478000	0.04885	CCT	CCDC163P	-	NULL	ENSG00000236624		0.453	MMACHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC163P	HGNC	protein_coding	OTTHUMT00000020864.2	-	0.00	33	0	G	NM_015506		45963037	-1	tier1	-	no_errors	ENST00000415578	ensembl	human	known	74_37	missense	18.75	13	3	SNP	0.000	T
SOHLH2	54937	genome.wustl.edu	37	13	36744698	36744698	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr13:36744698G>T	ENST00000379881.3	-	10	1315	c.1227C>A	c.(1225-1227)ggC>ggA	p.G409G	CCDC169-SOHLH2_ENST00000511166.1_Silent_p.G486G|SOHLH2_ENST00000554962.1_Silent_p.G486G	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	409					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		TGCACGTCTGGCCCAACCCAG	0.517																																																	0													77.0	64.0	68.0					13																	36744698		2203	4300	6503	SO:0001819	synonymous_variant	0			AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.1227C>A	13.37:g.36744698G>T			B4DX90|Q5EGC3|Q8TC74|Q96QX4	Silent	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.G486	ENST00000379881.3	37	c.1458	CCDS9355.1	13																																																																																			CCDC169-SOHLH2	-	NULL	ENSG00000250709		0.517	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC169-SOHLH2	HGNC	protein_coding	OTTHUMT00000044477.2	-	0.00	34	0	G	NM_017826		36744698	-1	tier1	-	no_errors	ENST00000511166	ensembl	human	known	74_37	silent	16.67	15	3	SNP	0.569	T
CCSAP	126731	genome.wustl.edu	37	1	229460176	229460177	+	3'UTR	INS	-	-	A	rs201639580|rs370670446	byFrequency	TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:229460176_229460177insA	ENST00000366687.1	-	0	1669_1670				RP4-803J11.2_ENST00000418348.1_RNA|CCSAP_ENST00000284617.2_3'UTR|CCSAP_ENST00000366686.1_3'UTR|CCSAP_ENST00000483092.1_5'UTR			Q6IQ19	CCSAP_HUMAN	centriole, cilia and spindle-associated protein						multicellular organismal development (GO:0007275)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of embryonic development (GO:0045995)	axon (GO:0030424)|axoneme (GO:0005930)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cilium (GO:0005929)|spindle (GO:0005819)											ATGTATTCTTTAAAAAAAAAAA	0.366													|||unknown(LONG_INSERTION)	1654	0.330272	0.2216	0.4582	5008	,	,		17071	0.3413		0.3986	False		,,,				2504	0.3047																0																																										SO:0001624	3_prime_UTR_variant	0			BC071609	CCDS1577.1	1q42.13	2012-06-19	2012-06-19	2012-06-19	ENSG00000154429	ENSG00000154429			29578	protein-coding gene	gene with protein product	"""centriole and spindle-associated protein"""		"""chromosome 1 open reading frame 96"""	C1orf96		22493317	Standard	NM_145257		Approved	FLJ41471, CSAP	uc001htl.4	Q6IQ19	OTTHUMG00000037663	ENST00000366687.1:c.*806->T	1.37:g.229460187_229460187dupA			A8K5X2|Q6P9G2|Q6ZW85|Q8IXU1|Q96BM2	RNA	INS	-	NULL	ENST00000366687.1	37	NULL	CCDS1577.1	1																																																																																			CCSAP	-	-	ENSG00000154429		0.366	CCSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCSAP	HGNC	protein_coding	OTTHUMT00000091839.1		0.00	10	0	-	NM_145257		229460177	-1	tier1		no_errors	ENST00000483092	ensembl	human	known	74_37	rna	47.06	18	16	INS	0.001:0.004	A
CCT8L2	150160	genome.wustl.edu	37	22	17072414	17072414	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr22:17072414T>A	ENST00000359963.3	-	1	1286	c.1027A>T	c.(1027-1029)Agg>Tgg	p.R343W		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	343					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				TTGCCTGGCCTCTGGGGAGGG	0.547																																																	0													104.0	103.0	103.0					22																	17072414		2203	4300	6503	SO:0001583	missense	0			AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.1027A>T	22.37:g.17072414T>A	ENSP00000353048:p.Arg343Trp		A4QPH3|Q9UJS3	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1	p.R343W	ENST00000359963.3	37	c.1027	CCDS13738.1	22	.	.	.	.	.	.	.	.	.	.	t	4.974	0.180926	0.09443	.	.	ENSG00000198445	ENST00000359963	T	0.78595	-1.19	1.98	-1.38	0.09027	.	1.610060	0.03911	U	0.281869	T	0.55369	0.1916	N	0.08118	0	0.09310	N	1	P	0.44090	0.826	B	0.35813	0.211	T	0.54207	-0.8328	10	0.87932	D	0	-1.3139	5.4805	0.16721	0.0:0.5797:0.0:0.4203	.	343	Q96SF2	TCPQM_HUMAN	W	343	ENSP00000353048:R343W	ENSP00000353048:R343W	R	-	1	2	CCT8L2	15452414	0.000000	0.05858	0.498000	0.27564	0.110000	0.19582	-0.296000	0.08287	-0.327000	0.08551	0.312000	0.20444	AGG	CCT8L2	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom	ENSG00000198445		0.547	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT8L2	HGNC	protein_coding	OTTHUMT00000280580.1	-	0.00	63	0	T			17072414	-1	tier1	-	no_errors	ENST00000359963	ensembl	human	known	74_37	missense	22.00	39	11	SNP	0.406	A
CD46	4179	genome.wustl.edu	37	1	207943509	207943509	+	Intron	SNP	T	T	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:207943509T>C	ENST00000358170.2	+	9	1102				CD46_ENST00000441839.2_Intron|CD46_ENST00000360212.2_Intron|CD46_ENST00000357714.1_Intron|CD46_ENST00000367042.1_Intron|CD46_ENST00000322918.5_Intron|CD46_ENST00000367041.1_Intron|CD46_ENST00000361067.1_Intron|CD46_ENST00000367047.1_Intron|CD46_ENST00000322875.4_Intron|CD46_ENST00000480003.1_Intron|CD46_ENST00000469535.1_3'UTR|CD46_ENST00000354848.1_Intron	NM_002389.4	NP_002380.3	P15529	MCP_HUMAN	CD46 molecule, complement regulatory protein						adaptive immune response (GO:0002250)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|interleukin-10 production (GO:0032613)|negative regulation of complement activation (GO:0045916)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transforming growth factor beta production (GO:0071636)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)|regulation of Notch signaling pathway (GO:0008593)|sequestering of extracellular ligand from receptor (GO:0035581)|single fertilization (GO:0007338)|T cell mediated immunity (GO:0002456)|viral process (GO:0016032)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|inner acrosomal membrane (GO:0002079)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cadherin binding (GO:0045296)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	19						cttgtgcaaatatatatgtag	0.279																																																	0																																										SO:0001627	intron_variant	0			BC030594	CCDS1479.1, CCDS1480.1, CCDS1481.1, CCDS1482.1, CCDS1484.1, CCDS1485.1, CCDS31008.1, CCDS31009.1	1q32	2014-09-17	2006-03-28	2006-02-09	ENSG00000117335	ENSG00000117335		"""CD molecules"", ""Complement system"""	6953	protein-coding gene	gene with protein product		120920	"""antigen identified by monoclonal antibody TRA-2-10"", ""membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)"", ""CD46 antigen, complement regulatory protein"""	MIC10, MCP		7929741	Standard	NM_002389		Approved	TRA2.10, MGC26544, TLX	uc001hgj.3	P15529	OTTHUMG00000036397	ENST00000358170.2:c.947-157T>C	1.37:g.207943509T>C			A0T1T0|A0T1T1|A0T1T2|Q15429|Q53GV9|Q5HY94|Q5VWS6|Q5VWS7|Q5VWS8|Q5VWS9|Q5VWT0|Q5VWT1|Q5VWT2|Q6N0A1|Q7Z3R5|Q9NNW2|Q9NNW3|Q9NNW4|Q9UCJ4	RNA	SNP	-	NULL	ENST00000358170.2	37	NULL	CCDS1485.1	1																																																																																			CD46	-	-	ENSG00000117335		0.279	CD46-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD46	HGNC	protein_coding	OTTHUMT00000088588.3	-	0.00	36	0	T	NM_172361		207943509	+1	tier1	-	no_errors	ENST00000469535	ensembl	human	known	74_37	rna	55.17	26	32	SNP	0.002	C
CD74	972	genome.wustl.edu	37	5	149792285	149792285	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:149792285G>C	ENST00000009530.7	-	1	29	c.28C>G	c.(28-30)Cgg>Ggg	p.R10G	CD74_ENST00000524315.1_Missense_Mutation_p.R10G|CD74_ENST00000377795.3_Missense_Mutation_p.R10G|CD74_ENST00000353334.6_Missense_Mutation_p.R10G			P04233	HG2A_HUMAN	CD74 molecule, major histocompatibility complex, class II invariant chain	10					activation of MAPK activity (GO:0000187)|antigen processing and presentation of endogenous antigen (GO:0019883)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|chaperone mediated protein folding requiring cofactor (GO:0051085)|defense response (GO:0006952)|immunoglobulin mediated immune response (GO:0016064)|intracellular protein transport (GO:0006886)|macrophage migration inhibitory factor signaling pathway (GO:0035691)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of mature B cell apoptotic process (GO:0002906)|negative regulation of peptide secretion (GO:0002792)|negative regulation of T cell differentiation (GO:0045581)|negative thymic T cell selection (GO:0045060)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of type 2 immune response (GO:0002830)|positive thymic T cell selection (GO:0045059)|prostaglandin biosynthetic process (GO:0001516)|protein complex assembly (GO:0006461)|regulation of macrophage activation (GO:0043030)|signal transduction (GO:0007165)|T cell selection (GO:0045058)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|macrophage migration inhibitory factor receptor complex (GO:0035692)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)|NOS2-CD74 complex (GO:0035693)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)|vacuole (GO:0005773)	beta-amyloid binding (GO:0001540)|cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|identical protein binding (GO:0042802)|macrophage migration inhibitory factor binding (GO:0035718)|MHC class II protein binding (GO:0042289)|MHC class II protein binding, via antigen binding groove (GO:0042658)|MHC class II protein complex binding (GO:0023026)|protein binding involved in protein folding (GO:0044183)	p.R10W(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)	5		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGATCTTCCCGACAGCTCCTG	0.612			T	ROS1	NSCLC																																			Dom	yes		5	5q32	972	"""CD74 molecule, major histocompatibility complex, class II invariant chain"""		E	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											152.0	153.0	153.0					5																	149792285		2203	4300	6503	SO:0001583	missense	0				CCDS34276.1, CCDS47308.1, CCDS47309.1	5q32	2012-09-20	2006-03-28		ENSG00000019582	ENSG00000019582		"""CD molecules"""	1697	protein-coding gene	gene with protein product	"""HLA-DR-gamma"", ""Ia-associated invariant chain"", ""gamma chain of class II antigens"", ""MHC HLA-DR gamma chain"""	142790	"""CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)"""	DHLAG		6324166, 3001652	Standard	NM_004355		Approved		uc003lsc.3	P04233	OTTHUMG00000163559	ENST00000009530.7:c.28C>G	5.37:g.149792285G>C	ENSP00000009530:p.Arg10Gly		A8K7R1|B4DNE8|D3DQG3|D3DQG4|Q14597|Q29832|Q5U0J8|Q8SNA0|Q8WLP6	Missense_Mutation	SNP	pfam_MHC_II-assoc_invar/CLIP_MHC-bd,pfam_MHC_II-assoc_invariant_trimer,pfam_Thyroglobulin_1,superfamily_MHC_II-assoc_invariant_trimer,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_MHC_II-assoc_invar_chain,pfscan_Thyroglobulin_1,prints_MHC_II-assoc_invar_chain	p.R10G	ENST00000009530.7	37	c.28	CCDS47309.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.147|2.147	-0.395465|-0.395465	0.04899|0.04899	.|.	.|.	ENSG00000019582|ENSG00000019582	ENST00000377795;ENST00000353334;ENST00000524315;ENST00000009530|ENST00000518797	T|.	0.58797|.	0.31|.	5.09|5.09	-0.158|-0.158	0.13383|0.13383	.|.	1.523410|.	0.04231|.	N|.	0.335207|.	T|T	0.07369|0.07369	0.0186|0.0186	N|N	0.00926|0.00926	-1.1|-1.1	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0|.	B;B;B;B|.	0.01281|.	0.0;0.0;0.0;0.0|.	T|T	0.31308|0.31308	-0.9948|-0.9948	10|5	0.33940|.	T|.	0.23|.	1.0452|1.0452	0.8313|0.8313	0.01131|0.01131	0.3006:0.3515:0.1527:0.1953|0.3006:0.3515:0.1527:0.1953	.|.	10;10;10;10|.	A9YLN4;P04233-3;P04233-2;P04233|.	.;.;.;HG2A_HUMAN|.	G|W	10|4	ENSP00000009530:R10G|.	ENSP00000009530:R10G|.	R|S	-|-	1|2	2|0	CD74|CD74	149772478|149772478	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-0.474000|-0.474000	0.06607|0.06607	-0.356000|-0.356000	0.08187|0.08187	-2.070000|-2.070000	0.00385|0.00385	CGG|TCG	CD74	-	NULL	ENSG00000019582		0.612	CD74-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CD74	HGNC	protein_coding	OTTHUMT00000374178.1	-	0.00	44	0	G	NM_004355		149792285	-1	tier1	-	no_errors	ENST00000009530	ensembl	human	known	74_37	missense	20.00	24	6	SNP	0.000	C
CDC25A	993	genome.wustl.edu	37	3	48222299	48222299	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:48222299G>T	ENST00000302506.3	-	6	869	c.461C>A	c.(460-462)cCt>cAt	p.P154H	CDC25A_ENST00000351231.3_Intron|RNU7-128P_ENST00000517247.1_RNA	NM_001789.2	NP_001780.2	P30304	MPIP1_HUMAN	cell division cycle 25A	154					cell proliferation (GO:0008283)|cellular response to UV (GO:0034644)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to radiation (GO:0009314)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.000685)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		ACGAGATACAGGTCTTACTGG	0.507																																																	0													132.0	124.0	127.0					3																	48222299		2203	4300	6503	SO:0001583	missense	0			M81933	CCDS2760.1, CCDS2761.1	3p21	2013-01-17	2013-01-17		ENSG00000164045	ENSG00000164045		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1725	protein-coding gene	gene with protein product		116947	"""cell division cycle 25A"", ""cell division cycle 25 homolog A (S. cerevisiae)"", ""cell division cycle 25 homolog A (S. pombe)"""			1836978	Standard	NM_001789		Approved		uc003csh.1	P30304	OTTHUMG00000133535	ENST00000302506.3:c.461C>A	3.37:g.48222299G>T	ENSP00000303706:p.Pro154His		Q8IZH5|Q96IL3|Q9H2F2	Missense_Mutation	SNP	pfam_MPI_Phosphatase,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom,prints_MPI_Phosphatase	p.P154H	ENST00000302506.3	37	c.461	CCDS2760.1	3	.	.	.	.	.	.	.	.	.	.	G	16.89	3.246317	0.59103	.	.	ENSG00000164045	ENST00000302506;ENST00000443342	T;T	0.29655	1.56;1.56	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.44350	0.1289	M	0.81497	2.545	0.80722	D	1	B	0.28470	0.213	B	0.35688	0.208	T	0.43048	-0.9415	10	0.87932	D	0	.	15.854	0.78960	0.0:0.0:1.0:0.0	.	154	P30304	MPIP1_HUMAN	H	154;153	ENSP00000303706:P154H;ENSP00000416483:P153H	ENSP00000303706:P154H	P	-	2	0	CDC25A	48197303	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	5.318000	0.65829	2.826000	0.97356	0.655000	0.94253	CCT	CDC25A	-	pfam_MPI_Phosphatase	ENSG00000164045		0.507	CDC25A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC25A	HGNC	protein_coding	OTTHUMT00000257512.2	-	0.00	32	0	G	NM_001789		48222299	-1	tier1	-	no_errors	ENST00000302506	ensembl	human	known	74_37	missense	16.67	15	3	SNP	1.000	T
CDC27	996	genome.wustl.edu	37	17	45219311	45219311	+	Missense_Mutation	SNP	T	T	C	rs140737545		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:45219311T>C	ENST00000066544.3	-	12	1552	c.1459A>G	c.(1459-1461)Att>Gtt	p.I487V	CDC27_ENST00000531206.1_Missense_Mutation_p.I493V|CDC27_ENST00000446365.2_Missense_Mutation_p.I426V|CDC27_ENST00000527547.1_Missense_Mutation_p.I486V	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	487					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TGGCTCAAAATATTTATAGCT	0.383																																																	0													112.0	118.0	116.0					17																	45219311		2203	4299	6502	SO:0001583	missense	0			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1459A>G	17.37:g.45219311T>C	ENSP00000066544:p.Ile487Val		G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.I493V	ENST00000066544.3	37	c.1477	CCDS11509.1	17	.	.	.	.	.	.	.	.	.	.	T	4.731	0.135890	0.09032	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77	5.92	3.6	0.41247	.	0.089833	0.85682	D	0.000000	T	0.53384	0.1793	L	0.31476	0.935	0.49798	D	0.999821	B;B;B;B	0.23316	0.05;0.083;0.083;0.024	B;B;B;B	0.17098	0.008;0.017;0.017;0.005	T	0.44590	-0.9318	10	0.02654	T	1	-23.2923	6.9274	0.24422	0.0:0.0792:0.1504:0.7704	.	426;486;493;487	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	V	487;493;426;486	ENSP00000066544:I487V;ENSP00000434614:I493V;ENSP00000392802:I426V;ENSP00000437339:I486V	ENSP00000066544:I487V	I	-	1	0	CDC27	42574310	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	4.907000	0.63300	1.072000	0.40860	0.528000	0.53228	ATT	CDC27	-	NULL	ENSG00000004897		0.383	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	HGNC	protein_coding	OTTHUMT00000389742.2	-	0.00	27	0	T			45219311	-1	tier1	rs140737545	no_errors	ENST00000531206	ensembl	human	known	74_37	missense	15.69	43	8	SNP	1.000	C
CDC40	51362	genome.wustl.edu	37	6	110534290	110534290	+	Splice_Site	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:110534290G>T	ENST00000368932.1	+	9	970	c.869G>T	c.(868-870)gGc>gTc	p.G290V	CDC40_ENST00000368930.1_Splice_Site_p.G290V|CDC40_ENST00000307731.1_Splice_Site_p.G290V			O60508	PRP17_HUMAN	cell division cycle 40	290					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		TTTTTATAGGGCGTCAGTGCA	0.378																																																	0													197.0	173.0	181.0					6																	110534290		2203	4300	6503	SO:0001630	splice_region_variant	0			AF015044	CCDS5081.1	6q22.1	2013-01-17	2013-01-17		ENSG00000168438	ENSG00000168438		"""WD repeat domain containing"""	17350	protein-coding gene	gene with protein product		605585	"""cell division cycle 40 homolog (yeast)"", ""cell division cycle 40 homolog (S. cerevisiae)"""			9769104, 9830021	Standard	NM_015891		Approved	PRP17, EHB3, PRPF17, FLJ10564	uc003pua.3	O60508	OTTHUMG00000015358	ENST00000368932.1:c.868-1G>T	6.37:g.110534290G>T			B2RBC5|O75471|Q5SRN0|Q9UPG1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G290V	ENST00000368932.1	37	c.869	CCDS5081.1	6	.	.	.	.	.	.	.	.	.	.	G	22.1	4.241744	0.79912	.	.	ENSG00000168438	ENST00000368932;ENST00000368933;ENST00000368930;ENST00000307731	T;T;T;T	0.60797	0.16;0.16;0.16;0.16	5.8	4.91	0.64330	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.047815	0.85682	D	0.000000	T	0.64461	0.2600	L	0.51914	1.62	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.69957	-0.5004	10	0.66056	D	0.02	-15.0156	16.6781	0.85284	0.0:0.1298:0.8702:0.0	.	290	O60508	PRP17_HUMAN	V	290	ENSP00000357928:G290V;ENSP00000357929:G290V;ENSP00000357926:G290V;ENSP00000304370:G290V	ENSP00000304370:G290V	G	+	2	0	CDC40	110640983	1.000000	0.71417	0.852000	0.33557	0.952000	0.60782	9.042000	0.93793	1.410000	0.46936	0.563000	0.77884	GGC	CDC40	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000168438		0.378	CDC40-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC40	HGNC	protein_coding	OTTHUMT00000041791.1		0.00	67	0	G	NM_015891	Missense_Mutation	110534290	+1			no_errors	ENST00000307731	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.998	T
CDC42BPA	8476	genome.wustl.edu	37	1	227288919	227288919	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:227288919G>T	ENST00000366769.3	-	15	3314	c.2023C>A	c.(2023-2025)Cca>Aca	p.P675T	CDC42BPA_ENST00000366767.3_Missense_Mutation_p.P594T|CDC42BPA_ENST00000366766.2_Missense_Mutation_p.P675T|CDC42BPA_ENST00000366764.2_Missense_Mutation_p.P675T|CDC42BPA_ENST00000366765.3_Missense_Mutation_p.P675T|CDC42BPA_ENST00000334218.5_Missense_Mutation_p.P675T|CDC42BPA_ENST00000535525.1_Missense_Mutation_p.P675T	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)									p.P675T(2)|p.P594T(1)		NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				CATACTCCTGGTGAGTAACTA	0.259																																																	3	Substitution - Missense(3)	endometrium(3)											66.0	67.0	66.0					1																	227288919		2199	4293	6492	SO:0001583	missense	0			U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.2023C>A	1.37:g.227288919G>T	ENSP00000355731:p.Pro675Thr			Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Pkinase_C,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,superfamily_WD40_repeat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_CRIB_dom,pfscan_CRIB_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.P675T	ENST00000366769.3	37	c.2023	CCDS1558.1	1	.	.	.	.	.	.	.	.	.	.	g	10.09	1.254280	0.22965	.	.	ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000535525;ENST00000366765	T;T;T;T;T;T;T	0.64803	-0.1;-0.1;-0.1;-0.11;-0.12;-0.09;-0.08	5.57	5.57	0.84162	.	0.211271	0.49916	D	0.000132	T	0.59321	0.2185	L	0.55481	1.735	0.42055	D	0.991132	B;B;B;B	0.15473	0.01;0.001;0.004;0.013	B;B;B;B	0.15484	0.007;0.003;0.013;0.008	T	0.55464	-0.8137	10	0.16896	T	0.51	.	19.5667	0.95397	0.0:0.0:1.0:0.0	.	675;675;594;675	F5H5N0;Q5VT25-4;Q5VT25-3;Q5VT25-5	.;.;.;.	T	675;594;675;675;675;675;675	ENSP00000355731:P675T;ENSP00000355729:P594T;ENSP00000335341:P675T;ENSP00000355728:P675T;ENSP00000355726:P675T;ENSP00000443275:P675T;ENSP00000355727:P675T	ENSP00000335341:P675T	P	-	1	0	CDC42BPA	225355542	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.439000	0.44846	2.604000	0.88044	0.645000	0.84053	CCA	CDC42BPA	-	NULL	ENSG00000143776		0.259	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPA	HGNC	protein_coding	OTTHUMT00000091696.1	-	0.00	43	0	G	NM_014826		227288919	-1	tier1	-	no_errors	ENST00000334218	ensembl	human	known	74_37	missense	9.76	74	8	SNP	1.000	T
CENPW	387103	genome.wustl.edu	37	6	126667418	126667418	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:126667418G>T	ENST00000368328.4	+	2	294	c.194G>T	c.(193-195)aGt>aTt	p.S65I	CENPW_ENST00000368325.1_Missense_Mutation_p.S80I|CENPW_ENST00000368326.1_Missense_Mutation_p.V52L			Q5EE01	CENPW_HUMAN	centromere protein W	65					CENP-A containing nucleosome assembly (GO:0034080)|chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|kinetochore (GO:0000776)|nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(2)|large_intestine(1)|lung(3)	6						GCTTGTGCGAGTAAATGTAGA	0.373																																																	0													116.0	111.0	112.0					6																	126667418		2203	4300	6503	SO:0001583	missense	0			BC039556	CCDS34529.1, CCDS69196.1, CCDS75516.1	6q22.32	2013-11-05	2010-04-16	2010-04-16	ENSG00000203760	ENSG00000203760			21488	protein-coding gene	gene with protein product	"""cancer-upregulated gene 2"""	611264	"""chromosome 6 open reading frame 173"""	C6orf173		17610844, 19070575	Standard	NM_001286524		Approved	CUG2	uc003qao.3	Q5EE01	OTTHUMG00000015518	ENST00000368328.4:c.194G>T	6.37:g.126667418G>T	ENSP00000357311:p.Ser65Ile		A6NIR0|A6NJC2	Missense_Mutation	SNP	NULL	p.S80I	ENST00000368328.4	37	c.239	CCDS34529.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.22|13.22	2.171383|2.171383	0.38315|0.38315	.|.	.|.	ENSG00000203760|ENSG00000203760	ENST00000368325;ENST00000368328|ENST00000368326	T|.	0.24538|.	1.85|.	5.61|5.61	-2.0|-2.0	0.07433|0.07433	Histone-fold (1);|.	0.660498|.	0.13340|.	N|.	0.395230|.	T|T	0.30230|0.30230	0.0758|0.0758	.|.	.|.	.|.	0.27958|0.27958	N|N	0.936893|0.936893	P|.	0.35656|.	0.514|.	B|.	0.38056|.	0.264|.	T|T	0.43180|0.43180	-0.9407|-0.9407	9|5	0.72032|0.87932	D|D	0.01|0	-13.5418|-13.5418	9.9205|9.9205	0.41462|0.41462	0.5359:0.0:0.4641:0.0|0.5359:0.0:0.4641:0.0	.|.	65|.	Q5EE01|.	CENPW_HUMAN|.	I|L	80;65|52	ENSP00000357311:S65I|.	ENSP00000357308:S80I|ENSP00000357309:V52L	S|V	+|+	2|1	0|0	CENPW|CENPW	126709111|126709111	0.856000|0.856000	0.29760|0.29760	0.919000|0.919000	0.36401|0.36401	0.529000|0.529000	0.34654|0.34654	-0.185000|-0.185000	0.09684|0.09684	-0.197000|-0.197000	0.10350|0.10350	-0.440000|-0.440000	0.05779|0.05779	AGT|GTA	CENPW	-	NULL	ENSG00000203760		0.373	CENPW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPW	HGNC	protein_coding	OTTHUMT00000042104.1		0.00	20	0	G			126667418	+1			no_errors	ENST00000368325	ensembl	human	known	74_37	missense	8.11	34	3	SNP	0.954	T
CEP112	201134	genome.wustl.edu	37	17	64026024	64026024	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:64026024G>T	ENST00000392769.2	-	13	1554	c.1336C>A	c.(1336-1338)Cag>Aag	p.Q446K	CEP112_ENST00000535342.2_Missense_Mutation_p.Q446K|CEP112_ENST00000537949.1_Missense_Mutation_p.Q404K|CEP112_ENST00000541355.1_Missense_Mutation_p.Q81K	NM_145036.3	NP_659473.2	Q8N8E3	CE112_HUMAN	centrosomal protein 112kDa	446					receptor localization to synapse (GO:0097120)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(11)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	28						CACGTTATCTGGTAACATCTT	0.378																																																	0													182.0	166.0	171.0					17																	64026024		2203	4300	6503	SO:0001583	missense	0			AF458591	CCDS32710.1, CCDS32711.1	17q24.2	2014-02-20	2011-05-06	2011-05-06	ENSG00000154240	ENSG00000154240			28514	protein-coding gene	gene with protein product			"""coiled-coil domain containing 46"""	CCDC46		21399614	Standard	NM_145036		Approved	MGC33887	uc002jfl.3	Q8N8E3		ENST00000392769.2:c.1336C>A	17.37:g.64026024G>T	ENSP00000376522:p.Gln446Lys		Q6PIB5|Q8NCR4|Q8NFR4	Missense_Mutation	SNP	superfamily_t-SNARE	p.Q446K	ENST00000392769.2	37	c.1336	CCDS32710.1	17	.	.	.	.	.	.	.	.	.	.	G	18.65	3.670316	0.67814	.	.	ENSG00000154240	ENST00000535342;ENST00000392769;ENST00000541355;ENST00000537949	T;T;T;T	0.16597	2.33;2.33;2.33;2.33	5.77	5.77	0.91146	.	0.121669	0.56097	D	0.000025	T	0.40694	0.1127	L	0.60455	1.87	0.42680	D	0.993548	D;D;D	0.67145	0.996;0.996;0.996	D;D;D	0.72982	0.979;0.979;0.979	T	0.01235	-1.1410	10	0.37606	T	0.19	-17.5304	20.3626	0.98863	0.0:0.0:1.0:0.0	.	404;404;446	F5GYE8;A2RRR7;Q8N8E3	.;.;CE112_HUMAN	K	446;446;81;404	ENSP00000442784:Q446K;ENSP00000376522:Q446K;ENSP00000443711:Q81K;ENSP00000440775:Q404K	ENSP00000376522:Q446K	Q	-	1	0	CEP112	61456486	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.691000	0.74573	2.885000	0.99019	0.655000	0.94253	CAG	CEP112	-	NULL	ENSG00000154240		0.378	CEP112-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP112	HGNC	protein_coding	OTTHUMT00000446582.1		0.00	40	0	G	NM_145036		64026024	-1			no_errors	ENST00000392769	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
CEP290	80184	genome.wustl.edu	37	12	88524980	88524980	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:88524980C>T	ENST00000552810.1	-	7	800	c.457G>A	c.(457-459)Gag>Aag	p.E153K	CEP290_ENST00000309041.7_Missense_Mutation_p.E153K|CEP290_ENST00000397838.3_5'Flank	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	153					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TCTGCCTCCTCATTTCGAAGA	0.274																																																	0													96.0	84.0	88.0					12																	88524980		1770	4029	5799	SO:0001583	missense	0			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.457G>A	12.37:g.88524980C>T	ENSP00000448012:p.Glu153Lys		Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	NULL	p.E153K	ENST00000552810.1	37	c.457	CCDS55858.1	12	.	.	.	.	.	.	.	.	.	.	C	24.8	4.567565	0.86439	.	.	ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998;ENST00000545139	T;T	0.66638	-0.22;-0.22	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.74084	0.3670	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.68318	-0.5440	10	0.20046	T	0.44	.	19.3369	0.94322	0.0:1.0:0.0:0.0	.	153	O15078	CE290_HUMAN	K	153;153;153;55	ENSP00000448012:E153K;ENSP00000308021:E153K	ENSP00000308021:E153K	E	-	1	0	CEP290	87049111	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.123000	0.71614	2.575000	0.86900	0.563000	0.77884	GAG	CEP290	-	NULL	ENSG00000198707		0.274	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP290	HGNC	protein_coding	OTTHUMT00000406344.1	-	0.00	43	0	C	NM_025114		88524980	-1	tier1	-	no_errors	ENST00000309041	ensembl	human	known	74_37	missense	26.67	55	20	SNP	1.000	T
CHD6	84181	genome.wustl.edu	37	20	40045236	40045236	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr20:40045236T>C	ENST00000373233.3	-	33	6655	c.6478A>G	c.(6478-6480)Atc>Gtc	p.I2160V	CHD6_ENST00000480022.1_5'Flank	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2160					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				ACCTTGTGGATCTGGGCCGCC	0.532																																																	0													94.0	83.0	87.0					20																	40045236		2203	4300	6503	SO:0001583	missense	0			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.6478A>G	20.37:g.40045236T>C	ENSP00000362330:p.Ile2160Val		Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_BRK_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.I2160V	ENST00000373233.3	37	c.6478	CCDS13317.1	20	.	.	.	.	.	.	.	.	.	.	T	2.897	-0.228428	0.06022	.	.	ENSG00000124177	ENST00000373233	D	0.85088	-1.94	5.46	0.495	0.16890	.	0.208545	0.34507	N	0.003906	T	0.69287	0.3094	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.51513	-0.8696	10	0.29301	T	0.29	-2.0655	6.224	0.20698	0.0:0.4243:0.1468:0.4289	.	2160	Q8TD26	CHD6_HUMAN	V	2160	ENSP00000362330:I2160V	ENSP00000362330:I2160V	I	-	1	0	CHD6	39478650	0.998000	0.40836	0.983000	0.44433	0.086000	0.17979	0.594000	0.24014	-0.114000	0.11936	0.533000	0.62120	ATC	CHD6	-	NULL	ENSG00000124177		0.532	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	HGNC	protein_coding	OTTHUMT00000079270.1	-	0.00	33	0	T			40045236	-1	tier1	-	no_errors	ENST00000373233	ensembl	human	known	74_37	missense	17.02	39	8	SNP	0.940	C
CHST1	8534	genome.wustl.edu	37	11	45671711	45671711	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:45671711G>T	ENST00000308064.2	-	4	1433	c.763C>A	c.(763-765)Cgg>Agg	p.R255R	CHST1_ENST00000533673.1_5'Flank|RP11-495O11.1_ENST00000525563.1_RNA	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	255					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		TACCAGAGCCGCCAGAGCCGG	0.637																																																	0													68.0	60.0	63.0					11																	45671711		2203	4299	6502	SO:0001819	synonymous_variant	0			U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.763C>A	11.37:g.45671711G>T			D3DQP2	Silent	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	p.R255	ENST00000308064.2	37	c.763	CCDS7913.1	11																																																																																			CHST1	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	ENSG00000175264		0.637	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST1	HGNC	protein_coding	OTTHUMT00000390127.1		0.00	46	0	G	NM_003654		45671711	-1			no_errors	ENST00000308064	ensembl	human	known	74_37	silent	6.06	31	2	SNP	1.000	T
CHUK	1147	genome.wustl.edu	37	10	101967073	101967073	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:101967073T>C	ENST00000370397.7	-	11	1231	c.1145A>G	c.(1144-1146)tAt>tGt	p.Y382C		NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	382					anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	ATAAACCATATAGCTATCACA	0.328																																					Ovarian(159;52 1904 10536 35305 37148)												0													48.0	49.0	49.0					10																	101967073		2202	4293	6495	SO:0001583	missense	0			AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.1145A>G	10.37:g.101967073T>C	ENSP00000359424:p.Tyr382Cys		O14666|Q13132|Q5W0I4|Q92467	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IKKbetaNEMObind,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Y382C	ENST00000370397.7	37	c.1145	CCDS7488.1	10	.	.	.	.	.	.	.	.	.	.	T	12.91	2.079499	0.36662	.	.	ENSG00000213341	ENST00000370397	T	0.58358	0.34	5.68	4.56	0.56223	.	0.000000	0.85682	D	0.000000	T	0.46927	0.1418	L	0.57536	1.79	0.58432	D	0.999997	B	0.19583	0.037	B	0.12837	0.008	T	0.38200	-0.9672	10	0.39692	T	0.17	-13.7367	9.7859	0.40675	0.0:0.0812:0.0:0.9188	.	382	O15111	IKKA_HUMAN	C	382	ENSP00000359424:Y382C	ENSP00000359424:Y382C	Y	-	2	0	CHUK	101957063	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.042000	0.64202	0.992000	0.38840	0.528000	0.53228	TAT	CHUK	-	NULL	ENSG00000213341		0.328	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHUK	HGNC	protein_coding	OTTHUMT00000049836.1		0.00	13	0	T	NM_001278		101967073	-1			no_errors	ENST00000370397	ensembl	human	known	74_37	missense	29.17	17	7	SNP	1.000	C
CLASP2	23122	genome.wustl.edu	37	3	33592770	33592770	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:33592770C>G	ENST00000468888.2	-	30	3197	c.3151G>C	c.(3151-3153)Gaa>Caa	p.E1051Q	CLASP2_ENST00000399362.4_Missense_Mutation_p.E1050Q|CLASP2_ENST00000480013.1_Missense_Mutation_p.E830Q|CLASP2_ENST00000359576.5_Missense_Mutation_p.E1042Q|CLASP2_ENST00000307312.7_Missense_Mutation_p.E532Q|CLASP2_ENST00000539981.1_Missense_Mutation_p.E820Q|CLASP2_ENST00000461133.3_Missense_Mutation_p.E810Q			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	831	Interaction with RSN and localization to the Golgi and kinetochores.|Required for cortical localization.				axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						CTTTTGGGTTCTGTTGTCCAA	0.388																																																	0													101.0	97.0	98.0					3																	33592770		1826	4076	5902	SO:0001583	missense	0			AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.3151G>C	3.37:g.33592770C>G	ENSP00000419974:p.Glu1051Gln		Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Missense_Mutation	SNP	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.E1050Q	ENST00000468888.2	37	c.3148		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.57|18.57	3.652001|3.652001	0.67472|0.67472	.|.	.|.	ENSG00000163539|ENSG00000163539	ENST00000468888;ENST00000399362;ENST00000359576;ENST00000307312;ENST00000539981;ENST00000480013;ENST00000461133|ENST00000480385	T;T;T;T;T;T;T|.	0.66638|.	-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22|.	5.27|5.27	5.27|5.27	0.74061|0.74061	Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73837|0.73837	0.3638|0.3638	M|M	0.68952|0.68952	2.095|2.095	0.80722|0.80722	D|D	1|1	B;D;B|.	0.67145|.	0.004;0.996;0.279|.	B;D;B|.	0.78314|.	0.015;0.991;0.128|.	T|T	0.72646|0.72646	-0.4230|-0.4230	10|5	0.72032|.	D|.	0.01|.	-25.0587|-25.0587	17.4201|17.4201	0.87512|0.87512	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	831;1042;1050|.	O75122;F5H604;E7ERI8|.	CLAP2_HUMAN;.;.|.	Q|T	1051;1050;1042;532;820;830;810|106	ENSP00000419974:E1051Q;ENSP00000382297:E1050Q;ENSP00000352581:E1042Q;ENSP00000304743:E532Q;ENSP00000439039:E820Q;ENSP00000417518:E830Q;ENSP00000419305:E810Q|.	ENSP00000304743:E532Q|.	E|R	-|-	1|2	0|0	CLASP2|CLASP2	33567774|33567774	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.770000|7.770000	0.85390|0.85390	2.606000|2.606000	0.88127|0.88127	0.591000|0.591000	0.81541|0.81541	GAA|AGA	CLASP2	-	superfamily_ARM-type_fold	ENSG00000163539		0.388	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	CLASP2	HGNC	protein_coding	OTTHUMT00000344320.4	-	0.00	25	0	C	NM_001207044		33592770	-1	tier1	-	no_errors	ENST00000399362	ensembl	human	known	74_37	missense	13.33	39	6	SNP	1.000	G
CLEC11A	6320	genome.wustl.edu	37	19	51226822	51226822	+	Missense_Mutation	SNP	C	C	A	rs370035526		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:51226822C>A	ENST00000250340.4	+	1	237	c.40C>A	c.(40-42)Cag>Aag	p.Q14K	CLEC11A_ENST00000599973.1_Missense_Mutation_p.Q14K	NM_002975.2	NP_002966.1	Q9Y240	CLC11_HUMAN	C-type lectin domain family 11, member A	14					positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|growth factor activity (GO:0008083)			kidney(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	7		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		GGTGGTCCCCCAGCTCTTGGG	0.647																																																	0													61.0	64.0	63.0					19																	51226822		2203	4300	6503	SO:0001583	missense	0			AF087658	CCDS12800.1	19q13.3	2010-04-27	2005-02-09	2005-02-11		ENSG00000105472		"""C-type lectin domain containing"""	10576	protein-coding gene	gene with protein product		604713	"""stem cell growth factor; lymphocyte secreted C-type lectin"""	SCGF		9207134, 9442024	Standard	NM_002975		Approved	P47, LSLCL, CLECSF3	uc002psy.3	Q9Y240		ENST00000250340.4:c.40C>A	19.37:g.51226822C>A	ENSP00000250340:p.Gln14Lys		B2RAD4	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.Q14K	ENST00000250340.4	37	c.40	CCDS12800.1	19	.	.	.	.	.	.	.	.	.	.	C	15.54	2.865186	0.51482	.	.	ENSG00000105472	ENST00000250340;ENST00000445858	T	0.39997	1.05	3.24	3.24	0.37175	.	0.271244	0.19782	N	0.106188	T	0.29256	0.0728	L	0.27053	0.805	0.25126	N	0.990602	B	0.23316	0.083	B	0.19391	0.025	T	0.28744	-1.0034	10	0.72032	D	0.01	-8.8472	10.16	0.42847	0.0:1.0:0.0:0.0	.	14	Q9Y240	CLC11_HUMAN	K	14	ENSP00000250340:Q14K	ENSP00000250340:Q14K	Q	+	1	0	CLEC11A	55918634	1.000000	0.71417	0.992000	0.48379	0.979000	0.70002	1.942000	0.40243	1.830000	0.53286	0.462000	0.41574	CAG	CLEC11A	-	NULL	ENSG00000105472		0.647	CLEC11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC11A	HGNC	protein_coding	OTTHUMT00000464062.1	-	0.00	39	0	C	NM_002975		51226822	+1	tier1	-	no_errors	ENST00000250340	ensembl	human	known	74_37	missense	31.03	20	9	SNP	0.901	A
CLTCL1	8218	genome.wustl.edu	37	22	19263189	19263189	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr22:19263189C>G	ENST00000263200.10	-	2	279	c.207G>C	c.(205-207)gaG>gaC	p.E69D	CLTCL1_ENST00000353891.5_Missense_Mutation_p.E69D|CLTCL1_ENST00000427926.1_Missense_Mutation_p.E69D	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	69	Globular terminal domain.|WD40-like repeat 2.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					TGATGGCACTCTCTGCAGAGA	0.463			T	?	ALCL																																			Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	0													47.0	47.0	47.0					22																	19263189		1926	4149	6075	SO:0001583	missense	0				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.207G>C	22.37:g.19263189C>G	ENSP00000445677:p.Glu69Asp		B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,pfam_Clathrin_H-chain_propeller_rpt,pfam_Clathrin_H-chain_linker_core,superfamily_Clathrin_H-chain_propeller_N,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	p.E69D	ENST00000263200.10	37	c.207	CCDS46662.1	22	.	.	.	.	.	.	.	.	.	.	C	3.490	-0.104112	0.06967	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926;ENST00000449918	T;T;T;T	0.14266	2.52;2.52;2.52;2.52	4.2	-4.79	0.03200	Clathrin, heavy chain, propeller, N-terminal (1);Clathrin, heavy chain, linker/propeller domain (1);	0.273575	0.35040	N	0.003492	T	0.02342	0.0072	N	0.00985	-1.075	0.37204	D	0.904495	B;B	0.02656	0.0;0.0	B;B	0.12156	0.007;0.002	T	0.42899	-0.9424	10	0.02654	T	1	-10.5426	5.8085	0.18454	0.0:0.2779:0.4146:0.3075	.	69;69	P53675-2;P53675	.;CLH2_HUMAN	D	69	ENSP00000439662:E69D;ENSP00000445677:E69D;ENSP00000441158:E69D;ENSP00000443264:E69D	ENSP00000445677:E69D	E	-	3	2	CLTCL1	17643189	1.000000	0.71417	0.322000	0.25334	0.839000	0.47603	0.512000	0.22755	-1.254000	0.02485	0.650000	0.86243	GAG	CLTCL1	-	superfamily_Clathrin_H-chain_propeller_N,pirsf_Clathrin_heavy_chain	ENSG00000070371		0.463	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	CLTCL1	HGNC	protein_coding	OTTHUMT00000316397.5	-	0.00	40	0	C	NM_007098		19263189	-1	tier1	-	no_errors	ENST00000263200	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.986	G
CMYA5	202333	genome.wustl.edu	37	5	79095325	79095325	+	Silent	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:79095325C>T	ENST00000446378.2	+	13	12127	c.12096C>T	c.(12094-12096)ttC>ttT	p.F4032F	CTC-431G16.2_ENST00000421252.2_RNA	NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	4032	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AGTTGCTCTTCATCATCAGGC	0.522																																																	0													142.0	137.0	138.0					5																	79095325		2008	4184	6192	SO:0001819	synonymous_variant	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.12096C>T	5.37:g.79095325C>T			A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.F4032	ENST00000446378.2	37	c.12096	CCDS47238.1	5																																																																																			CMYA5	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY	ENSG00000164309		0.522	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	-	0.00	42	0	C	NM_153610		79095325	+1	tier1	-	no_errors	ENST00000446378	ensembl	human	known	74_37	silent	28.79	47	19	SNP	0.995	T
CNGB3	54714	genome.wustl.edu	37	8	87638285	87638285	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:87638285G>T	ENST00000320005.5	-	13	1551	c.1504C>A	c.(1504-1506)Cta>Ata	p.L502I		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	502					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						GTAGTTGGTAGGGTCTTAAGC	0.378																																																	0													116.0	105.0	109.0					8																	87638285		2203	4300	6503	SO:0001583	missense	0			AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.1504C>A	8.37:g.87638285G>T	ENSP00000316605:p.Leu502Ile		C9JA51|Q9NRE9	Missense_Mutation	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.L502I	ENST00000320005.5	37	c.1504	CCDS6244.1	8	.	.	.	.	.	.	.	.	.	.	G	11.66	1.705738	0.30232	.	.	ENSG00000170289	ENST00000320005	D	0.97906	-4.6	5.37	3.57	0.40892	Cyclic nucleotide-binding-like (1);	0.233737	0.33670	N	0.004665	D	0.97804	0.9279	M	0.80616	2.505	0.41751	D	0.989663	P;P	0.48694	0.914;0.861	P;P	0.57846	0.828;0.677	D	0.96881	0.9646	10	0.72032	D	0.01	.	5.463	0.16627	0.1651:0.0:0.5711:0.2638	.	502;502	Q9NQW8-2;Q9NQW8	.;CNGB3_HUMAN	I	502	ENSP00000316605:L502I	ENSP00000316605:L502I	L	-	1	2	CNGB3	87707401	1.000000	0.71417	0.343000	0.25615	0.040000	0.13550	3.158000	0.50723	0.650000	0.30769	0.650000	0.86243	CTA	CNGB3	-	superfamily_cNMP-bd-like	ENSG00000170289		0.378	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGB3	HGNC	protein_coding	OTTHUMT00000375107.1	-	0.00	50	0	G	NM_019098		87638285	-1	tier1	-	no_errors	ENST00000320005	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.886	T
CNR1	1268	genome.wustl.edu	37	6	88853810	88853810	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:88853810A>T	ENST00000537554.1	-	2	4746	c.1184T>A	c.(1183-1185)aTc>aAc	p.I395N	CNR1_ENST00000362094.5_3'UTR|CNR1_ENST00000549716.1_Missense_Mutation_p.I334N|CNR1_ENST00000369501.2_Missense_Mutation_p.I395N|CNR1_ENST00000535130.1_Missense_Mutation_p.I395N|CNR1_ENST00000428600.2_Missense_Mutation_p.I395N|CNR1_ENST00000369499.2_Missense_Mutation_p.I395N|CNR1_ENST00000468898.1_Missense_Mutation_p.I362N|CNR1_ENST00000549890.1_Missense_Mutation_p.I395N	NM_001160226.1|NM_001160258.1	NP_001153698.1|NP_001153730.1	P21554	CNR1_HUMAN	cannabinoid receptor 1 (brain)	395					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|positive regulation of acute inflammatory response to antigenic stimulus (GO:0002866)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood pressure (GO:0045777)|positive regulation of fever generation (GO:0031622)|positive regulation of neuron projection development (GO:0010976)|regulation of feeding behavior (GO:0060259)|regulation of insulin secretion (GO:0050796)|regulation of penile erection (GO:0060405)|regulation of synaptic transmission, GABAergic (GO:0032228)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|drug binding (GO:0008144)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(10)|urinary_tract(1)	37		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Dronabinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	AGCATAGATGATGGGGTTCAC	0.512																																																	0													125.0	114.0	118.0					6																	88853810		2203	4300	6503	SO:0001583	missense	0			AF107262	CCDS5015.1, CCDS5016.1, CCDS5016.2	6q14-q15	2012-08-08			ENSG00000118432	ENSG00000118432		"""GPCR / Class A : Cannabinoid receptors"""	2159	protein-coding gene	gene with protein product		114610		CNR			Standard	NM_016083		Approved	CB1K5, CB-R, CB1, CANN6, CB1A	uc003pmq.4	P21554	OTTHUMG00000015184	ENST00000537554.1:c.1184T>A	6.37:g.88853810A>T	ENSP00000441046:p.Ile395Asn		B2R9T4|E1P512|Q13949|Q495Z0|Q4PLI4|Q4VBM6|Q5JVL5|Q5UB37|Q9UNN0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pirsf_Canbinoid_rcpt_1,pfscan_GPCR_Rhodpsn_7TM,prints_Canbinoid_rcpt_1,prints_Cnbnoid_rcpt,prints_GPCR_Rhodpsn	p.I395N	ENST00000537554.1	37	c.1184	CCDS5015.1	6	.	.	.	.	.	.	.	.	.	.	A	18.23	3.579038	0.65878	.	.	ENSG00000118432	ENST00000369501;ENST00000535130;ENST00000537554;ENST00000369499;ENST00000549890;ENST00000468898;ENST00000428600;ENST00000549716	T;T;T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81	5.94	5.94	0.96194	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.66771	0.2823	M	0.84683	2.71	0.80722	D	1	D;D	0.69078	0.994;0.997	P;D	0.69824	0.9;0.966	T	0.73613	-0.3927	10	0.87932	D	0	.	16.3932	0.83546	1.0:0.0:0.0:0.0	.	362;395	P21554-3;P21554	.;CNR1_HUMAN	N	395;395;395;395;395;362;395;334	ENSP00000358513:I395N;ENSP00000442689:I395N;ENSP00000441046:I395N;ENSP00000358511:I395N;ENSP00000446819:I395N;ENSP00000420188:I362N;ENSP00000412192:I395N;ENSP00000449549:I334N	ENSP00000358511:I395N	I	-	2	0	CNR1	88910529	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	9.309000	0.96252	2.267000	0.75376	0.533000	0.62120	ATC	CNR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pirsf_Canbinoid_rcpt_1,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000118432		0.512	CNR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CNR1	HGNC	protein_coding	OTTHUMT00000354204.2	-	0.00	24	0	A			88853810	-1	tier1	-	no_errors	ENST00000369499	ensembl	human	known	74_37	missense	18.52	22	5	SNP	1.000	T
COG1	9382	genome.wustl.edu	37	17	71197644	71197644	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:71197644T>C	ENST00000299886.4	+	7	1758	c.1678T>C	c.(1678-1680)Tac>Cac	p.Y560H		NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	560					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			CTTTGACAGATACGCAGATGC	0.557																																																	0													99.0	89.0	93.0					17																	71197644		2203	4300	6503	SO:0001583	missense	0				CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.1678T>C	17.37:g.71197644T>C	ENSP00000299886:p.Tyr560His		Q9NPV9|Q9P2G6	Missense_Mutation	SNP	NULL	p.Y560H	ENST00000299886.4	37	c.1678	CCDS11692.1	17	.	.	.	.	.	.	.	.	.	.	T	4.751	0.139575	0.09083	.	.	ENSG00000166685	ENST00000438720;ENST00000299886	T;T	0.24151	1.87;1.87	5.29	4.21	0.49690	.	0.250785	0.41712	D	0.000828	T	0.39937	0.1097	M	0.63843	1.955	0.09310	N	0.999997	D;D;D	0.63046	0.986;0.992;0.986	P;P;P	0.60682	0.794;0.878;0.794	T	0.22626	-1.0211	10	0.21014	T	0.42	-8.8889	10.9846	0.47514	0.0:0.0731:0.0:0.9269	.	560;560;560	E9PBL8;Q8WTW3;Q4G0L8	.;COG1_HUMAN;.	H	560	ENSP00000400111:Y560H;ENSP00000299886:Y560H	ENSP00000299886:Y560H	Y	+	1	0	COG1	68709239	0.549000	0.26481	0.002000	0.10522	0.034000	0.12701	3.856000	0.55964	0.864000	0.35578	0.533000	0.62120	TAC	COG1	-	NULL	ENSG00000166685		0.557	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG1	HGNC	protein_coding	OTTHUMT00000441638.1	-	0.00	33	0	T			71197644	+1	tier1	-	no_errors	ENST00000299886	ensembl	human	known	74_37	missense	45.95	20	17	SNP	0.027	C
COG4	25839	genome.wustl.edu	37	16	70551560	70551560	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr16:70551560G>T	ENST00000323786.5	-	3	359	c.338C>A	c.(337-339)tCc>tAc	p.S113Y	COG4_ENST00000564653.1_Missense_Mutation_p.S113Y|COG4_ENST00000393612.4_Missense_Mutation_p.S109Y	NM_001195139.1|NM_015386.2	NP_001182068.1|NP_056201.2	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	109	Interacts with STX5.				Golgi organization (GO:0007030)|Golgi vesicle prefusion complex stabilization (GO:0048213)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|pancreas(1)|prostate(2)	33		Ovarian(137;0.0694)				AACTTTGCTGGACACATTCTC	0.438																																																	0													149.0	132.0	138.0					16																	70551560		2198	4300	6498	SO:0001583	missense	0			AL050101	CCDS10892.2, CCDS73909.1	16q22.1	2013-09-20			ENSG00000103051	ENSG00000103051		"""Components of oligomeric golgi complex"""	18620	protein-coding gene	gene with protein product		606976				11980916	Standard	NM_015386		Approved	COD1, DKFZP586E1519	uc002ezc.3	Q9H9E3	OTTHUMG00000128515	ENST00000323786.5:c.338C>A	16.37:g.70551560G>T	ENSP00000315775:p.Ser113Tyr		B4DMN8|C9JS23|Q96D40|Q9BRF0|Q9BVZ2|Q9H5Y4|Q9Y3W3	Missense_Mutation	SNP	pfam_COG_su4,smart_COG_su4	p.S113Y	ENST00000323786.5	37	c.338	CCDS10892.2	16	.	.	.	.	.	.	.	.	.	.	g	25.7	4.662698	0.88251	.	.	ENSG00000103051	ENST00000323786;ENST00000338984;ENST00000393612;ENST00000534772	T;T;T	0.47528	0.84;0.84;0.84	5.31	5.31	0.75309	.	0.085834	0.85682	D	0.000000	T	0.70325	0.3211	M	0.83603	2.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.74902	-0.3506	10	0.87932	D	0	-10.6541	13.6887	0.62533	0.0:0.2822:0.7177:0.0	.	108;109	Q6PIW8;Q9H9E3	.;COG4_HUMAN	Y	113;109;109;36	ENSP00000315775:S113Y;ENSP00000377236:S109Y;ENSP00000461912:S36Y	ENSP00000315775:S113Y	S	-	2	0	COG4	69109061	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	6.611000	0.74183	2.496000	0.84212	0.450000	0.29827	TCC	COG4	-	NULL	ENSG00000103051		0.438	COG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG4	HGNC	protein_coding	OTTHUMT00000250326.3		0.00	16	0	G			70551560	-1			no_errors	ENST00000323786	ensembl	human	known	74_37	missense	11.11	24	3	SNP	1.000	T
COL24A1	255631	genome.wustl.edu	37	1	86497581	86497581	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:86497581G>T	ENST00000370571.2	-	14	2395	c.2029C>A	c.(2029-2031)Ccg>Acg	p.P677T	COL24A1_ENST00000436319.1_Missense_Mutation_p.P677T	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	677	Collagen-like 3.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.P677T(1)|p.P676fs*5(1)		NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		GGAAACCCCGGAGGACCAGTG	0.328																																																	2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|lung(1)											85.0	88.0	87.0					1																	86497581		1830	4068	5898	SO:0001583	missense	0			AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.2029C>A	1.37:g.86497581G>T	ENSP00000359603:p.Pro677Thr		C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Fib_collagen_C	p.P677T	ENST00000370571.2	37	c.2029	CCDS41353.1	1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.486655	0.26686	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	D;D	0.94046	-3.34;-3.34	5.87	5.87	0.94306	.	0.000000	0.38058	N	0.001833	D	0.85999	0.5828	L	0.45352	1.415	0.38745	D	0.953975	B	0.10296	0.003	B	0.18263	0.021	T	0.80171	-0.1493	10	0.31617	T	0.26	.	13.4103	0.60938	0.0723:0.0:0.9277:0.0	.	677	Q17RW2	COOA1_HUMAN	T	677	ENSP00000359603:P677T;ENSP00000392531:P677T	ENSP00000359603:P677T	P	-	1	0	COL24A1	86270169	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	3.264000	0.51553	2.941000	0.99782	0.655000	0.94253	CCG	COL24A1	-	NULL	ENSG00000171502		0.328	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL24A1	HGNC	protein_coding	OTTHUMT00000029335.4	-	0.00	56	0	G	NM_152890		86497581	-1	tier1	-	no_errors	ENST00000370571	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
COL4A2	1284	genome.wustl.edu	37	13	111102088	111102088	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr13:111102088G>T	ENST00000360467.5	+	19	1447	c.1141G>T	c.(1141-1143)Gga>Tga	p.G381*		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	381	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GGGTGAGCCAGGAGACCCGGG	0.607																																																	0													16.0	18.0	18.0					13																	111102088		1460	3180	4640	SO:0001587	stop_gained	0			AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.1141G>T	13.37:g.111102088G>T	ENSP00000353654:p.Gly381*		Q14052|Q548C3|Q5VZA9|Q66K23	Nonsense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G381*	ENST00000360467.5	37	c.1141	CCDS41907.1	13	.	.	.	.	.	.	.	.	.	.	G	39	7.821244	0.98507	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	.	.	.	5.13	5.13	0.70059	.	0.000000	0.52532	D	0.000063	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.1003	0.65051	0.0:0.0:1.0:0.0	.	.	.	.	X	381	.	ENSP00000257309:G381X	G	+	1	0	COL4A2	109900089	1.000000	0.71417	0.996000	0.52242	0.887000	0.51463	5.109000	0.64615	2.387000	0.81309	0.563000	0.77884	GGA	COL4A2	-	NULL	ENSG00000134871		0.607	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A2	HGNC	protein_coding	OTTHUMT00000045761.2	-	0.00	28	0	G	NM_001846		111102088	+1	tier1	-	no_errors	ENST00000360467	ensembl	human	known	74_37	nonsense	10.81	33	4	SNP	1.000	T
COL6A3	1293	genome.wustl.edu	37	2	238253225	238253225	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:238253225G>T	ENST00000295550.4	-	36	7888	c.7436C>A	c.(7435-7437)gCt>gAt	p.A2479D	COL6A3_ENST00000347401.3_Missense_Mutation_p.A2278D|COL6A3_ENST00000409809.1_Missense_Mutation_p.A2273D|COL6A3_ENST00000353578.4_Missense_Mutation_p.A2273D|COL6A3_ENST00000346358.4_Missense_Mutation_p.A2279D|COL6A3_ENST00000472056.1_Missense_Mutation_p.A1872D	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2479	Nonhelical region.|VWFA 11. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GGATGTCAGAGCCACCTGAAG	0.517																																																	0													80.0	73.0	75.0					2																	238253225		2203	4300	6503	SO:0001583	missense	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.7436C>A	2.37:g.238253225G>T	ENSP00000295550:p.Ala2479Asp		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.A2479D	ENST00000295550.4	37	c.7436	CCDS33412.1	2	.	.	.	.	.	.	.	.	.	.	G	8.746	0.920195	0.17982	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.14640	2.49;2.49;2.49;2.49;2.49;2.49	4.77	4.77	0.60923	von Willebrand factor, type A (3);	0.956269	0.08596	N	0.922236	T	0.21841	0.0526	N	0.22421	0.69	0.09310	N	1	B;B;B;D	0.65815	0.029;0.351;0.023;0.995	B;B;B;D	0.65010	0.11;0.172;0.045;0.931	T	0.22487	-1.0215	10	0.14656	T	0.56	.	13.1951	0.59734	0.0:0.0:0.8407:0.1593	.	1872;1872;2273;2479	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	D	2479;2278;2273;1872;2273;2279	ENSP00000295550:A2479D;ENSP00000315609:A2278D;ENSP00000315873:A2273D;ENSP00000418285:A1872D;ENSP00000386844:A2273D;ENSP00000295546:A2279D	ENSP00000295550:A2479D	A	-	2	0	COL6A3	237917964	0.004000	0.15560	0.004000	0.12327	0.852000	0.48524	1.656000	0.37355	2.339000	0.79563	0.655000	0.94253	GCT	COL6A3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000163359		0.517	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	-	0.00	33	0	G	NM_004369		238253225	-1	tier1	-	no_errors	ENST00000295550	ensembl	human	known	74_37	missense	15.38	22	4	SNP	0.004	T
COL6A5	256076	genome.wustl.edu	37	3	130110053	130110053	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:130110053G>T	ENST00000432398.2	+	7	2942	c.2448G>T	c.(2446-2448)gtG>gtT	p.V816V	COL6A5_ENST00000265379.6_Silent_p.V816V	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	816	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TAGACGTTGTGTTTGTGCTGG	0.403																																																	0													74.0	59.0	64.0					3																	130110053		692	1591	2283	SO:0001819	synonymous_variant	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.2448G>T	3.37:g.130110053G>T			A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Silent	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.V816	ENST00000432398.2	37	c.2448		3																																																																																			COL6A5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000172752		0.403	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		-	0.00	34	0	G	NM_153264		130110053	+1	tier1	-	no_errors	ENST00000265379	ensembl	human	known	74_37	silent	5.06	75	4	SNP	1.000	T
CRY1	1407	genome.wustl.edu	37	12	107391315	107391315	+	Silent	SNP	G	G	T	rs368170196		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:107391315G>T	ENST00000008527.5	-	9	2310	c.1443C>A	c.(1441-1443)atC>atA	p.I481I		NM_004075.4	NP_004066.1	Q16526	CRY1_HUMAN	cryptochrome circadian clock 1	481	Interaction with TIMELESS. {ECO:0000250}.				blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|lipid storage (GO:0019915)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of glucocorticoid secretion (GO:2000850)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of DNA damage checkpoint (GO:2000001)|response to glucagon (GO:0033762)|response to insulin (GO:0032868)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|double-stranded DNA binding (GO:0003690)|nuclear hormone receptor binding (GO:0035257)|nucleotide binding (GO:0000166)|phosphatase binding (GO:0019902)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin binding (GO:0043130)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|skin(1)	29						TCATCCTTTCGATATTCAAAC	0.393																																																	0													120.0	114.0	116.0					12																	107391315		2203	4300	6503	SO:0001819	synonymous_variant	0			BC030519	CCDS9112.1	12q23-q24.1	2014-01-17	2014-01-17		ENSG00000008405	ENSG00000008405			2384	protein-coding gene	gene with protein product		601933	"""cryptochrome 1 (photolyase-like)"""	PHLL1		8921389	Standard	NM_004075		Approved		uc001tmi.4	Q16526	OTTHUMG00000170005	ENST00000008527.5:c.1443C>A	12.37:g.107391315G>T				Silent	SNP	pfam_Photolyase_FAD-bd/Cryptochr_C,pfam_DNA_photolyase_N,superfamily_Photolyase_FAD-bd/Cryptochr_C,superfamily_DNA_photolyase_N	p.I481	ENST00000008527.5	37	c.1443	CCDS9112.1	12																																																																																			CRY1	-	pfam_Photolyase_FAD-bd/Cryptochr_C,superfamily_Photolyase_FAD-bd/Cryptochr_C	ENSG00000008405		0.393	CRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRY1	HGNC	protein_coding	OTTHUMT00000406827.1		0.00	47	0	G	NM_004075		107391315	-1			no_errors	ENST00000008527	ensembl	human	known	74_37	silent	5.56	34	2	SNP	0.997	T
CSH1	1442	genome.wustl.edu	37	17	61972411	61972411	+	Missense_Mutation	SNP	G	G	T	rs61764004		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:61972411G>T	ENST00000316193.8	-	5	766	c.625C>A	c.(625-627)Cgc>Agc	p.R209S	CSH1_ENST00000329882.8_3'UTR|CSH1_ENST00000453363.3_Missense_Mutation_p.R114S	NM_001317.5	NP_001308.1	P0DML2	CSH1_HUMAN	chorionic somatomammotropin hormone 1 (placental lactogen)	209						extracellular region (GO:0005576)	metal ion binding (GO:0046872)	p.R209C(1)		central_nervous_system(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	8						TCCACAGAGCGGCACTGCACC	0.607									Russell-Silver syndrome																																								1	Substitution - Missense(1)	central_nervous_system(1)											105.0	94.0	98.0					17																	61972411		2198	4299	6497	SO:0001583	missense	0	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism	J00118	CCDS11649.1	17q22-q24	2008-07-18				ENSG00000136488			2440	protein-coding gene	gene with protein product	"""chorionic somatomammotropin A"", ""placental lactogen"", ""choriomammotropin"""	150200				6208192	Standard	NM_001317		Approved	hCS-A, CSA, PL, CSMT, FLJ75407	uc002jcs.2	P0DML2		ENST00000316193.8:c.625C>A	17.37:g.61972411G>T	ENSP00000316416:p.Arg209Ser		P01243|Q0VDB1|Q14407	Missense_Mutation	SNP	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core,prints_Somatotropin	p.R209S	ENST00000316193.8	37	c.625	CCDS11649.1	17	.	.	.	.	.	.	.	.	.	.	g	10.94	1.491692	0.26774	.	.	ENSG00000136488	ENST00000316193;ENST00000453363	D;D	0.92911	-3.13;-3.13	2.56	1.57	0.23409	.	.	.	.	.	D	0.95319	0.8481	M	0.86651	2.83	0.43114	D	0.994825	D;D	0.71674	0.989;0.998	D;D	0.71414	0.973;0.955	D	0.93904	0.7191	9	0.72032	D	0.01	.	8.4239	0.32718	0.1261:0.0:0.8739:0.0	rs61764004	114;209	B1A4H2;Q6PF11	.;.	S	209;114	ENSP00000316416:R209S;ENSP00000402517:R114S	ENSP00000316416:R209S	R	-	1	0	CSH1	59326143	1.000000	0.71417	0.996000	0.52242	0.012000	0.07955	6.449000	0.73473	0.405000	0.25532	-0.671000	0.03813	CGC	CSH1	-	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core,prints_Somatotropin	ENSG00000136488		0.607	CSH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSH1	HGNC	protein_coding	OTTHUMT00000416040.1		0.00	136	0	G	NM_001317		61972411	-1			no_errors	ENST00000316193	ensembl	human	known	74_37	missense	5.56	102	6	SNP	1.000	T
CSMD3	114788	genome.wustl.edu	37	8	113256737	113256737	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:113256737G>A	ENST00000297405.5	-	65	10532	c.10288C>T	c.(10288-10290)Cat>Tat	p.H3430Y	CSMD3_ENST00000343508.3_Missense_Mutation_p.H3390Y|CSMD3_ENST00000455883.2_Missense_Mutation_p.H3261Y|CSMD3_ENST00000352409.3_Missense_Mutation_p.H3360Y	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3430	Sushi 28. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTATACCCATGAGATGGAAGG	0.423										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													131.0	115.0	120.0					8																	113256737		2203	4300	6503	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10288C>T	8.37:g.113256737G>A	ENSP00000297405:p.His3430Tyr		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.H3430Y	ENST00000297405.5	37	c.10288	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	9.611	1.131245	0.21041	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.62232	0.04;0.04;0.04;0.04;0.04	5.37	5.37	0.77165	Complement control module (2);Sushi/SCR/CCP (3);	0.382887	0.25055	N	0.033489	T	0.24470	0.0593	N	0.00116	-2.08	0.30743	N	0.745955	B;B;B	0.15473	0.0;0.0;0.013	B;B;B	0.22386	0.001;0.0;0.039	T	0.15694	-1.0428	10	0.02654	T	1	.	19.3052	0.94158	0.0:0.0:1.0:0.0	.	3261;3430;3390	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	Y	3390;3430;2700;3261;3360	ENSP00000345799:H3390Y;ENSP00000297405:H3430Y;ENSP00000341558:H2700Y;ENSP00000412263:H3261Y;ENSP00000343124:H3360Y	ENSP00000297405:H3430Y	H	-	1	0	CSMD3	113325913	1.000000	0.71417	0.996000	0.52242	0.143000	0.21401	5.874000	0.69652	2.793000	0.96121	0.591000	0.81541	CAT	CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.423	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	45	0	G	NM_052900		113256737	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	24.00	38	12	SNP	0.997	A
CSMD3	114788	genome.wustl.edu	37	8	113504786	113504786	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:113504786G>T	ENST00000297405.5	-	31	5454	c.5210C>A	c.(5209-5211)tCa>tAa	p.S1737*	CSMD3_ENST00000343508.3_Nonsense_Mutation_p.S1697*|CSMD3_ENST00000455883.2_Nonsense_Mutation_p.S1633*|CSMD3_ENST00000352409.3_Nonsense_Mutation_p.S1737*	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1737	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S1697L(1)|p.S1737L(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GGTGAGTGTTGAATAACCTTG	0.398										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							2	Substitution - Missense(2)	lung(2)											173.0	151.0	158.0					8																	113504786		2203	4300	6503	SO:0001587	stop_gained	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5210C>A	8.37:g.113504786G>T	ENSP00000297405:p.Ser1737*		Q96PZ3	Nonsense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.S1737*	ENST00000297405.5	37	c.5210	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	47	13.181419	0.99725	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	.	.	.	4.9	4.9	0.64082	.	0.178557	0.37304	N	0.002151	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.0045	0.64453	0.0755:0.0:0.9245:0.0	.	.	.	.	X	1697;1737;1077;1633;1737	.	ENSP00000297405:S1737X	S	-	2	0	CSMD3	113573962	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	9.427000	0.97472	2.704000	0.92352	0.585000	0.79938	TCA	CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.398	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1		0.00	33	0	G	NM_052900		113504786	-1			no_errors	ENST00000297405	ensembl	human	known	74_37	nonsense	5.41	35	2	SNP	1.000	T
CTAGE9	643854	genome.wustl.edu	37	6	132031038	132031038	+	Missense_Mutation	SNP	C	C	G	rs556536036		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:132031038C>G	ENST00000314099.8	-	1	1168	c.1120G>C	c.(1120-1122)Gaa>Caa	p.E374Q	ENPP3_ENST00000357639.3_Intron|ENPP3_ENST00000358229.5_Intron|ENPP3_ENST00000414305.1_Intron	NM_001145659.1|NM_001278507.1	NP_001139131.1|NP_001265436.1	A4FU28	CTGE9_HUMAN	CTAGE family, member 9	374						integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						TTCTCACTTTCAAAATATATG	0.313													c|||	1	0.000199681	0.0	0.0	5008	,	,		22859	0.0		0.0	False		,,,				2504	0.001																0													2.0	2.0	2.0					6																	132031038		546	1224	1770	SO:0001583	missense	0				CCDS47475.1	6q23.2	2010-06-23			ENSG00000236761	ENSG00000236761			37275	protein-coding gene	gene with protein product							Standard	NM_001145659		Approved		uc011ece.2	A4FU28	OTTHUMG00000047966	ENST00000314099.8:c.1120G>C	6.37:g.132031038C>G	ENSP00000395587:p.Glu374Gln			Missense_Mutation	SNP	NULL	p.E374Q	ENST00000314099.8	37	c.1120	CCDS47475.1	6	.	.	.	.	.	.	.	.	.	.	-	8.997	0.979109	0.18812	.	.	ENSG00000236761	ENST00000314099	T	0.38722	1.12	.	.	.	.	.	.	.	.	T	0.52338	0.1728	M	0.91406	3.205	0.23381	N	0.997796	D	0.76494	0.999	D	0.79784	0.993	T	0.36672	-0.9738	8	0.87932	D	0	.	5.8178	0.18506	0.0:0.999:0.0:0.001	.	374	A4FU28	CTGE9_HUMAN	Q	374	ENSP00000395587:E374Q	ENSP00000395587:E374Q	E	-	1	0	CTAGE9	132072731	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	1.221000	0.32503	-0.000000	0.14550	0.000000	0.15137	GAA	CTAGE9	-	NULL	ENSG00000236761		0.313	CTAGE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTAGE9	HGNC	protein_coding	OTTHUMT00000109220.1	-	0.00	54	0	C	NM_001145659		132031038	-1	tier1	-	no_errors	ENST00000314099	ensembl	human	known	74_37	missense	25.42	44	15	SNP	0.684	G
CTSL	1514	genome.wustl.edu	37	9	90344621	90344621	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr9:90344621G>T	ENST00000343150.5	+	6	1645	c.755G>T	c.(754-756)gGt>gTt	p.G252V	CTSL_ENST00000495822.1_3'UTR|CTSL_ENST00000340342.6_Missense_Mutation_p.G252V			P07711	CATL1_HUMAN	cathepsin L	252					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage apoptotic process (GO:0071888)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|nucleus (GO:0005634)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|histone binding (GO:0042393)|proteoglycan binding (GO:0043394)										ATTGATGCAGGTCATGAGTCC	0.433																																																	0													151.0	144.0	146.0					9																	90344621		2203	4300	6503	SO:0001583	missense	0			X12451	CCDS6675.1	9q21.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000135047	ENSG00000135047	3.4.22.15	"""Cathepsins"""	2537	protein-coding gene	gene with protein product		116880	"""cathepsin L1"""	CTSL1		8419312, 2835398	Standard	NM_145918		Approved	FLJ31037	uc004apk.4	P07711	OTTHUMG00000020149	ENST00000343150.5:c.755G>T	9.37:g.90344621G>T	ENSP00000345344:p.Gly252Val		Q6IAV1|Q96QJ0	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,pfam_Prot_inhib_I29,smart_Prot_inhib_I29,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.G252V	ENST00000343150.5	37	c.755	CCDS6675.1	9	.	.	.	.	.	.	.	.	.	.	G	14.23	2.474563	0.43942	.	.	ENSG00000135047	ENST00000343150;ENST00000340342	T;T	0.21932	1.98;1.98	4.19	0.129	0.14739	Peptidase C1A, papain C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.31136	0.0787	L	0.52206	1.635	0.21290	N	0.999731	B	0.25007	0.116	P	0.47705	0.555	T	0.49808	-0.8900	10	0.72032	D	0.01	.	8.9606	0.35845	0.3163:0.0:0.6837:0.0	.	252	P07711	CATL1_HUMAN	V	252	ENSP00000345344:G252V;ENSP00000365061:G252V	ENSP00000365061:G252V	G	+	2	0	CTSL1	89534441	0.257000	0.24022	0.000000	0.03702	0.062000	0.15995	3.104000	0.50306	-0.177000	0.10690	0.655000	0.94253	GGT	CTSL	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C	ENSG00000135047		0.433	CTSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSL	HGNC	protein_coding	OTTHUMT00000052936.1	-	0.00	34	0	G	NM_001912		90344621	+1	tier1	-	no_errors	ENST00000340342	ensembl	human	known	74_37	missense	55.88	15	19	SNP	0.011	T
CYBB	1536	genome.wustl.edu	37	X	37655246	37655246	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chrX:37655246G>T	ENST00000378588.4	+	6	593	c.526G>T	c.(526-528)Ggc>Tgc	p.G176C	TM4SF2_ENST00000465127.1_Intron|CYBB_ENST00000536160.1_Intron|CYBB_ENST00000545017.1_Missense_Mutation_p.G144C	NM_000397.3	NP_000388.2	P04839	CY24B_HUMAN	cytochrome b-245, beta polypeptide	176	Ferric oxidoreductase.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|rough endoplasmic reticulum (GO:0005791)	flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|prostate(2)|skin(2)	32					Dextromethorphan(DB00514)	CCTGTTGGCAGGCATCACTGG	0.468																																																	0													137.0	105.0	116.0					X																	37655246		2202	4300	6502	SO:0001583	missense	0			X04011	CCDS14242.1	Xp21.1	2014-09-17	2008-07-29		ENSG00000165168	ENSG00000165168		"""Cytochrome b genes"""	2578	protein-coding gene	gene with protein product		300481	"""chronic granulomatous disease"""	CGD			Standard	NM_000397		Approved	GP91-PHOX, NOX2	uc004ddr.2	P04839	OTTHUMG00000033175	ENST00000378588.4:c.526G>T	X.37:g.37655246G>T	ENSP00000367851:p.Gly176Cys		A8K138|Q2PP16	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.G176C	ENST00000378588.4	37	c.526	CCDS14242.1	X	.	.	.	.	.	.	.	.	.	.	G	17.39	3.377150	0.61735	.	.	ENSG00000165168	ENST00000378588;ENST00000545017	D;D	0.96856	-4.13;-4.15	5.4	5.4	0.78164	Flavoprotein transmembrane component (1);	0.000000	0.85682	D	0.000000	D	0.98826	0.9604	H	0.95950	3.745	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99705	1.1005	10	0.87932	D	0	.	18.3094	0.90194	0.0:0.0:1.0:0.0	.	144;176	F5GWD2;P04839	.;CY24B_HUMAN	C	176;144	ENSP00000367851:G176C;ENSP00000441896:G144C	ENSP00000367851:G176C	G	+	1	0	CYBB	37540186	1.000000	0.71417	0.996000	0.52242	0.210000	0.24377	9.476000	0.97823	2.263000	0.75096	0.538000	0.68166	GGC	CYBB	-	pfam_Fe3_Rdtase_TM_dom	ENSG00000165168		0.468	CYBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYBB	HGNC	protein_coding	OTTHUMT00000080881.1	-	0.00	39	0	G			37655246	+1	tier1	-	no_errors	ENST00000378588	ensembl	human	known	74_37	missense	12.90	27	4	SNP	1.000	T
DAG1	1605	genome.wustl.edu	37	3	49569266	49569268	+	In_Frame_Del	DEL	CCA	CCA	-			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	CCA	CCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:49569266_49569268delCCA	ENST00000539901.1	+	3	1880_1882	c.1322_1324delCCA	c.(1321-1326)tccacc>tcc	p.T446del	DAG1_ENST00000308775.2_In_Frame_Del_p.T446del|DAG1_ENST00000545947.1_In_Frame_Del_p.T446del|DAG1_ENST00000538711.1_In_Frame_Del_p.T446del|DAG1_ENST00000515359.2_In_Frame_Del_p.T446del|DAG1_ENST00000541308.1_In_Frame_Del_p.T446del	NM_001177644.2	NP_001171115	Q14118	DAG1_HUMAN	dystroglycan 1 (dystrophin-associated glycoprotein 1)	446	Mucin-like domain.|Thr-rich.				basement membrane organization (GO:0071711)|branching involved in salivary gland morphogenesis (GO:0060445)|calcium-dependent cell-matrix adhesion (GO:0016340)|commissural neuron axon guidance (GO:0071679)|cytoskeletal anchoring at plasma membrane (GO:0007016)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|microtubule anchoring (GO:0034453)|modulation by virus of host morphology or physiology (GO:0019048)|morphogenesis of an epithelial sheet (GO:0002011)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell migration (GO:0030336)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase B signaling (GO:0051898)|nerve maturation (GO:0021682)|NLS-bearing protein import into nucleus (GO:0006607)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell outer membrane (GO:0009279)|cell-cell adherens junction (GO:0005913)|contractile ring (GO:0070938)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystroglycan complex (GO:0016011)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|node of Ranvier (GO:0033268)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|alpha-actinin binding (GO:0051393)|calcium ion binding (GO:0005509)|laminin-1 binding (GO:0043237)|SH2 domain binding (GO:0042169)|structural constituent of muscle (GO:0008307)|tubulin binding (GO:0015631)|vinculin binding (GO:0017166)|virus receptor activity (GO:0001618)			NS(1)|autonomic_ganglia(2)|breast(2)|endometrium(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TCAACTGACTCCACCACCACCAC	0.581																																																	0									,,,,,,,,,,,,	4,4262		1,2,2130					,,,,,,,,,,,,	5.4	1.0			182	4,8250		2,0,4125	no	coding,coding,coding,coding,coding,coding,coding,coding,coding,coding,coding,coding,coding	DAG1	NM_004393.4,NM_001177644.1,NM_001177643.1,NM_001177642.1,NM_001177641.1,NM_001177640.1,NM_001177639.1,NM_001177638.1,NM_001177637.1,NM_001177636.1,NM_001177635.1,NM_001177634.1,NM_001165928.2	,,,,,,,,,,,,	3,2,6255	A1A1,A1R,RR		0.0485,0.0938,0.0639	,,,,,,,,,,,,	,,,,,,,,,,,,		8,12512				SO:0001651	inframe_deletion	0			L19711	CCDS2799.1	3p21	2014-09-17			ENSG00000173402	ENSG00000173402			2666	protein-coding gene	gene with protein product	"""alpha-dystroglycan"", ""dystrophin-associated glycoprotein-1"", ""beta-dystroglycan"""	128239				7774920, 1741056	Standard	NM_001177643		Approved	A3a, 156DAG, AGRNR, DAG	uc021wyd.1	Q14118	OTTHUMG00000156869	ENST00000539901.1:c.1322_1324delCCA	3.37:g.49569275_49569277delCCA	ENSP00000439334:p.Thr446del		A8K6M7|Q969J9	In_Frame_Del	DEL	pfam_DAG1,superfamily_Alpha-dystroglycan_domain_2,superfamily_Cadherin-like,smart_Cadg	p.T445in_frame_del	ENST00000539901.1	37	c.1322_1324	CCDS2799.1	3																																																																																			DAG1	-	NULL	ENSG00000173402		0.581	DAG1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	DAG1	HGNC	protein_coding	OTTHUMT00000346326.1		0.00	53	0	CCA			49569268	+1	tier1		no_errors	ENST00000308775	ensembl	human	known	74_37	in_frame_del	9.68	28	3	DEL	0.969:0.477:0.479	-
DCAF11	80344	genome.wustl.edu	37	14	24584027	24584027	+	5'UTR	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr14:24584027C>T	ENST00000446197.3	+	0	39				DCAF11_ENST00000396941.4_5'Flank|DCAF11_ENST00000559115.1_5'UTR|DCAF11_ENST00000396936.1_5'Flank|NRL_ENST00000561028.1_5'UTR	NM_025230.4	NP_079506.3	Q8TEB1	DCA11_HUMAN	DDB1 and CUL4 associated factor 11						protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)											CCGCGAGATGCGTGACGAGCG	0.682																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF130070	CCDS9610.1, CCDS41929.1	14q11.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000100897	ENSG00000100897		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20258	protein-coding gene	gene with protein product		613317	"""WD repeat domain 23"""	WDR23			Standard	NM_025230		Approved	PRO2389, GL014	uc001wlv.3	Q8TEB1	OTTHUMG00000028793	ENST00000446197.3:c.-689C>T	14.37:g.24584027C>T			B3KQ83|D3DS56|Q5D039|Q86U00|Q86U39|Q8NDN2|Q9H2J0|Q9H3A3|Q9H5C9	RNA	SNP	-	NULL	ENST00000446197.3	37	NULL	CCDS9610.1	14																																																																																			DCAF11	-	-	ENSG00000100897		0.682	DCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF11	HGNC	protein_coding	OTTHUMT00000071907.4	-	0.00	39	0	C			24584027	+1	tier1	-	no_errors	ENST00000557809	ensembl	human	known	74_37	rna	28.21	27	11	SNP	0.618	T
DCLK2	166614	genome.wustl.edu	37	4	151153530	151153530	+	Silent	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:151153530G>A	ENST00000296550.7	+	9	2095	c.1341G>A	c.(1339-1341)gtG>gtA	p.V447V	DCLK2_ENST00000506325.1_Silent_p.V446V|DCLK2_ENST00000302176.8_Silent_p.V464V	NM_001040260.3	NP_001035350.2	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2	447	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					TGCGCCGAGTGAAACATCCCA	0.438																																					GBM(195;186 2215 13375 16801 37459)												0													218.0	202.0	208.0					4																	151153530		2203	4300	6503	SO:0001819	synonymous_variant	0			BC032726	CCDS34076.1, CCDS47142.1, CCDS47142.2	4q31.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000170390	ENSG00000170390			19002	protein-coding gene	gene with protein product		613166	"""doublecortin and CaM kinase-like 2"""	DCAMKL2		12477932	Standard	NM_001040260		Approved	MGC45428, DCDC3, DCDC3B, DCK2	uc003ilo.4	Q8N568	OTTHUMG00000161444	ENST00000296550.7:c.1341G>A	4.37:g.151153530G>A			C9J5Q9|Q59GC8|Q8N399	Silent	SNP	pfam_Prot_kinase_dom,pfam_Doublecortin_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Doublecortin_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Doublecortin_dom,pfscan_Prot_kinase_dom	p.V464	ENST00000296550.7	37	c.1392	CCDS34076.1	4																																																																																			DCLK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000170390		0.438	DCLK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCLK2	HGNC	protein_coding	OTTHUMT00000364952.1	-	0.00	52	0	G	NM_001040260		151153530	+1	tier1	-	no_errors	ENST00000302176	ensembl	human	known	74_37	silent	19.44	28	7	SNP	1.000	A
DCTN4	51164	genome.wustl.edu	37	5	150095155	150095155	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:150095155C>T	ENST00000447998.2	-	12	1256	c.1141G>A	c.(1141-1143)Gaa>Aaa	p.E381K	DCTN4_ENST00000424236.1_Missense_Mutation_p.E324K|DCTN4_ENST00000446090.2_Missense_Mutation_p.E388K	NM_016221.3	NP_057305.1	Q9UJW0	DCTN4_HUMAN	dynactin 4 (p62)	381					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	10		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCTTGAGGTTCTGCCAACTCA	0.488																																																	0													152.0	124.0	134.0					5																	150095155		2203	4300	6503	SO:0001583	missense	0			AF195120	CCDS4310.1, CCDS47310.1, CCDS47311.1	5q31-q32	2008-05-23			ENSG00000132912	ENSG00000132912			15518	protein-coding gene	gene with protein product		614758				10843801, 16554302	Standard	NM_016221		Approved		uc010jhi.3	Q9UJW0	OTTHUMG00000130079	ENST00000447998.2:c.1141G>A	5.37:g.150095155C>T	ENSP00000416968:p.Glu381Lys		B3KWW0|D3DQH0|E5RGT5|Q8TAN8	Missense_Mutation	SNP	pfam_Dynactin_p62	p.E388K	ENST00000447998.2	37	c.1162	CCDS4310.1	5	.	.	.	.	.	.	.	.	.	.	C	16.60	3.169017	0.57584	.	.	ENSG00000132912	ENST00000447998;ENST00000424236;ENST00000446090	T;T;T	0.22134	1.97;1.97;1.97	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.22205	0.0535	L	0.34521	1.04	0.80722	D	1	P;P	0.42078	0.728;0.77	B;B	0.42738	0.275;0.396	T	0.01162	-1.1432	10	0.16896	T	0.51	-4.8852	20.5632	0.99335	0.0:1.0:0.0:0.0	.	388;381	Q9UJW0-3;Q9UJW0	.;DCTN4_HUMAN	K	381;324;388	ENSP00000416968:E381K;ENSP00000411251:E324K;ENSP00000414906:E388K	ENSP00000411251:E324K	E	-	1	0	DCTN4	150075348	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	7.309000	0.78937	2.937000	0.99478	0.650000	0.86243	GAA	DCTN4	-	pfam_Dynactin_p62	ENSG00000132912		0.488	DCTN4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCTN4	HGNC	protein_coding	OTTHUMT00000252372.1	-	0.00	68	0	C			150095155	-1	tier1	-	no_errors	ENST00000446090	ensembl	human	known	74_37	missense	12.07	51	7	SNP	1.000	T
DDX39A	10212	genome.wustl.edu	37	19	14522366	14522366	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:14522366C>G	ENST00000242776.4	-	4	482	c.381G>C	c.(379-381)caG>caC	p.Q127H	DDX39A_ENST00000454233.2_Missense_Mutation_p.Q127H|CTC-548K16.5_ENST00000590626.1_RNA|DDX39A_ENST00000592927.1_5'UTR	NM_005804.3	NP_005795.2	O00148	DX39A_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A	127	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|kidney(1)|lung(2)|ovary(1)|pancreas(1)	11						CCTTGCTGATCTGGAAGGCCA	0.567																																																	0													155.0	130.0	138.0					19																	14522366		2203	4300	6503	SO:0001583	missense	0			U90426	CCDS12308.1	19p13.12	2011-02-08	2011-02-08	2011-02-08	ENSG00000123136	ENSG00000123136		"""DEAD-boxes"""	17821	protein-coding gene	gene with protein product	"""UAP56-related helicase, 49 kDa"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 39"""	DDX39		7601445	Standard	NM_005804		Approved	DDXL, BAT1L, URH49	uc002myo.3	O00148		ENST00000242776.4:c.381G>C	19.37:g.14522366C>G	ENSP00000242776:p.Gln127His		Q8N5M0|Q9BVP6|Q9H5W0	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.Q127H	ENST00000242776.4	37	c.381	CCDS12308.1	19	.	.	.	.	.	.	.	.	.	.	c	18.54	3.646740	0.67358	.	.	ENSG00000123136	ENST00000451994;ENST00000242776;ENST00000324340;ENST00000454233	T;T;T	0.58506	2.81;0.33;0.33	4.13	1.93	0.25924	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81413	0.4817	H	0.99074	4.42	0.80722	D	1	D;P	0.54397	0.966;0.936	P;P	0.59546	0.859;0.594	D	0.84208	0.0454	10	0.87932	D	0	-20.1532	8.8432	0.35155	0.0:0.7928:0.0:0.2072	.	127;127	B1Q2N1;O00148	.;DX39A_HUMAN	H	170;127;127;127	ENSP00000242776:Q127H;ENSP00000322749:Q127H;ENSP00000392929:Q127H	ENSP00000242776:Q127H	Q	-	3	2	DDX39A	14383366	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.697000	0.47060	0.871000	0.35750	0.651000	0.88453	CAG	DDX39A	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000123136		0.567	DDX39A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX39A	HGNC	protein_coding	OTTHUMT00000459880.1	-	0.00	75	0	C	NM_138998		14522366	-1	tier1	-	no_errors	ENST00000242776	ensembl	human	known	74_37	missense	22.03	46	13	SNP	1.000	G
DDX51	317781	genome.wustl.edu	37	12	132625429	132625429	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:132625429C>T	ENST00000397333.3	-	9	1425	c.1387G>A	c.(1387-1389)Gat>Aat	p.D463N		NM_175066.3	NP_778236.2	Q8N8A6	DDX51_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 51	463					rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(1)|lung(5)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.59e-08)|Epithelial(86;3.62e-07)|all cancers(50;2.13e-05)		CCATCTGTATCTTCCAGGCCC	0.607																																																	0													97.0	105.0	102.0					12																	132625429		1910	4117	6027	SO:0001583	missense	0			BC040185	CCDS41865.1	12q24.33	2005-10-12				ENSG00000185163		"""DEAD-boxes"""	20082	protein-coding gene	gene with protein product							Standard	NM_175066		Approved		uc001ujy.4	Q8N8A6		ENST00000397333.3:c.1387G>A	12.37:g.132625429C>T	ENSP00000380495:p.Asp463Asn		A8MPT9|Q5CZ71|Q8IXK5|Q96ED1	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D463N	ENST00000397333.3	37	c.1387	CCDS41865.1	12	.	.	.	.	.	.	.	.	.	.	C	11.15	1.554077	0.27739	.	.	ENSG00000185163	ENST00000397333	T	0.02085	4.46	4.83	2.97	0.34412	DEAD-like helicase (1);	1.342410	0.04618	N	0.401490	T	0.04634	0.0126	M	0.73962	2.25	0.09310	N	1	B	0.15141	0.012	B	0.12837	0.008	T	0.48625	-0.9019	10	0.33141	T	0.24	-11.2003	5.2034	0.15277	0.0:0.6453:0.1705:0.1843	.	463	Q8N8A6	DDX51_HUMAN	N	463	ENSP00000380495:D463N	ENSP00000380495:D463N	D	-	1	0	DDX51	131191382	0.004000	0.15560	0.002000	0.10522	0.033000	0.12548	1.499000	0.35671	0.455000	0.26910	-0.698000	0.03680	GAT	DDX51	-	superfamily_P-loop_NTPase,smart_Helicase_ATP-bd	ENSG00000185163		0.607	DDX51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX51	HGNC	protein_coding	OTTHUMT00000398978.1	-	0.00	39	0	C	NM_175066		132625429	-1	tier1	-	no_errors	ENST00000397333	ensembl	human	known	74_37	missense	32.56	29	14	SNP	0.004	T
DDX52	11056	genome.wustl.edu	37	17	36002238	36002238	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:36002238G>T	ENST00000349699.2	-	2	230	c.187C>A	c.(187-189)Caa>Aaa	p.Q63K	DDX52_ENST00000394367.3_5'UTR|RP11-697E22.2_ENST00000586950.1_RNA|RP11-697E22.2_ENST00000586163.1_RNA	NM_007010.3	NP_008941.2	Q9Y2R4	DDX52_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 52	63						membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|ovary(1)|skin(3)	17		Breast(25;0.00637)|Ovarian(249;0.15)				TGATGTGTTTGTGATGCTCCA	0.438																																																	0													140.0	138.0	139.0					17																	36002238		2203	4300	6503	SO:0001583	missense	0			AF077033	CCDS11323.1	17q21.1	2014-05-06			ENSG00000141141	ENSG00000278053		"""DEAD-boxes"""	20038	protein-coding gene	gene with protein product		612500				11124703	Standard	XM_006721650		Approved	ROK1	uc002hoi.2	Q9Y2R4	OTTHUMG00000188475	ENST00000349699.2:c.187C>A	17.37:g.36002238G>T	ENSP00000268854:p.Gln63Lys		Q86YG1|Q8N213|Q9NVE0|Q9Y482	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.Q63K	ENST00000349699.2	37	c.187	CCDS11323.1	17	.	.	.	.	.	.	.	.	.	.	G	6.875	0.530834	0.13127	.	.	ENSG00000141141	ENST00000349699	T	0.12984	2.63	5.17	-2.01	0.07410	.	4.808940	0.00357	N	0.000020	T	0.10637	0.0260	L	0.40543	1.245	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.36578	-0.9742	10	0.02654	T	1	.	8.5953	0.33712	0.0:0.5382:0.2157:0.2461	.	63	Q9Y2R4	DDX52_HUMAN	K	63	ENSP00000268854:Q63K	ENSP00000268854:Q63K	Q	-	1	0	DDX52	33076351	0.000000	0.05858	0.000000	0.03702	0.792000	0.44763	-0.500000	0.06405	-0.291000	0.09012	0.491000	0.48974	CAA	DDX52	-	NULL	ENSG00000141141		0.438	DDX52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX52	HGNC	protein_coding	OTTHUMT00000256795.1	-	0.00	58	0	G	NM_152300		36002238	-1	tier1	-	no_errors	ENST00000349699	ensembl	human	known	74_37	missense	6.33	74	5	SNP	0.000	T
DDX56	54606	genome.wustl.edu	37	7	44613437	44613437	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:44613437G>C	ENST00000258772.5	-	1	164	c.58C>G	c.(58-60)Cag>Gag	p.Q20E	DDX56_ENST00000485367.1_5'Flank|DDX56_ENST00000431640.1_Missense_Mutation_p.Q20E	NM_001257189.1|NM_019082.3	NP_001244118.1|NP_061955.1	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 56	20					ATP catabolic process (GO:0006200)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)	16						GCGTGTACCTGAAGGAGCCGG	0.647																																																	0													35.0	37.0	36.0					7																	44613437		2203	4300	6503	SO:0001583	missense	0			AJ131712	CCDS5492.1, CCDS59053.1	7p13	2012-02-23	2012-02-23		ENSG00000136271	ENSG00000136271		"""DEAD-boxes"""	18193	protein-coding gene	gene with protein product	"""nucleolar helicase of 61 kDa"""	608023	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 56"""			10749921	Standard	NM_019082		Approved	NOH61	uc003tlg.4	Q9NY93	OTTHUMG00000129211	ENST00000258772.5:c.58C>G	7.37:g.44613437G>C	ENSP00000258772:p.Gln20Glu		A4D2K9|C9JV95|Q6IAE2|Q9H9I8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.Q20E	ENST00000258772.5	37	c.58	CCDS5492.1	7	.	.	.	.	.	.	.	.	.	.	G	16.00	2.999025	0.54147	.	.	ENSG00000136271	ENST00000258772;ENST00000431640	T;T	0.39056	1.1;1.1	5.22	5.22	0.72569	RNA helicase, DEAD-box type, Q motif (1);	0.055176	0.64402	D	0.000001	T	0.35038	0.0918	L	0.44542	1.39	0.40824	D	0.983534	B;B	0.33964	0.434;0.155	B;B	0.27380	0.079;0.041	T	0.34725	-0.9817	10	0.66056	D	0.02	-28.6618	14.2753	0.66175	0.0:0.0:1.0:0.0	.	20;20	C9JV95;Q9NY93	.;DDX56_HUMAN	E	20	ENSP00000258772:Q20E;ENSP00000393488:Q20E	ENSP00000258772:Q20E	Q	-	1	0	DDX56	44579962	1.000000	0.71417	1.000000	0.80357	0.380000	0.30137	4.681000	0.61663	2.441000	0.82636	0.655000	0.94253	CAG	DDX56	-	superfamily_P-loop_NTPase,pfscan_RNA_helicase_DEAD_Q_motif	ENSG00000136271		0.647	DDX56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX56	HGNC	protein_coding	OTTHUMT00000251291.1	-	0.00	29	0	G	NM_019082		44613437	-1	tier1	-	no_errors	ENST00000258772	ensembl	human	known	74_37	missense	18.52	22	5	SNP	1.000	C
DDX60L	91351	genome.wustl.edu	37	4	169377190	169377190	+	Splice_Site	SNP	T	T	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:169377190T>A	ENST00000511577.1	-	7	1084	c.837A>T	c.(835-837)ttA>ttT	p.L279F	DDX60L_ENST00000505890.1_Splice_Site_p.L279F|DDX60L_ENST00000260184.7_Splice_Site_p.L279F			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	279							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TTTTACTTACTAAGACACGAT	0.453																																																	0													53.0	49.0	50.0					4																	169377190		1946	4152	6098	SO:0001630	splice_region_variant	0			AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.837+1A>T	4.37:g.169377190T>A			Q96ND6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L279F	ENST00000511577.1	37	c.837		4	.	.	.	.	.	.	.	.	.	.	T	13.64	2.296686	0.40594	.	.	ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890;ENST00000505863	T;T;T;T	0.22336	1.96;1.96;1.97;2.7	3.48	2.27	0.28462	.	0.740857	0.10182	U	0.705781	T	0.37679	0.1012	L	0.58810	1.83	0.09310	N	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.72075	0.949;0.976;0.949	T	0.12578	-1.0542	9	.	.	.	.	6.0129	0.19586	0.0:0.2343:0.0:0.7657	.	279;279;279	E9PAP8;D6R906;Q5H9U9	.;.;DDX6L_HUMAN	F	279;279;279;7	ENSP00000260184:L279F;ENSP00000422423:L279F;ENSP00000422202:L279F;ENSP00000421026:L7F	.	L	-	3	2	DDX60L	169613765	0.760000	0.28428	0.002000	0.10522	0.003000	0.03518	0.845000	0.27668	0.234000	0.21139	0.377000	0.23210	TTA	DDX60L	-	NULL	ENSG00000181381		0.453	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	DDX60L	HGNC	protein_coding	OTTHUMT00000364839.1	-	0.00	26	0	T	NM_001012967	Missense_Mutation	169377190	-1	tier1	-	no_errors	ENST00000260184	ensembl	human	known	74_37	missense	37.93	18	11	SNP	0.006	A
DGCR2	9993	genome.wustl.edu	37	22	19028769	19028769	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr22:19028769C>G	ENST00000263196.7	-	9	1445	c.1198G>C	c.(1198-1200)Gat>Cat	p.D400H	DGCR2_ENST00000545799.1_3'UTR|DGCR2_ENST00000537045.1_Missense_Mutation_p.D359H	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	P98153	IDD_HUMAN	DiGeorge syndrome critical region gene 2	400					cell adhesion (GO:0007155)|cognition (GO:0050890)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)	18	Colorectal(54;0.0993)					GGGCCGTAATCAAAGCCAGGG	0.607																																																	0													83.0	77.0	79.0					22																	19028769		2203	4300	6503	SO:0001583	missense	0			D79985	CCDS33598.1, CCDS54496.1	22q11.21	2008-06-12			ENSG00000070413	ENSG00000070413			2845	protein-coding gene	gene with protein product	"""integral membrane protein DGCR2"""	600594				7655455, 8630060	Standard	NM_005137		Approved	KIAA0163, LAN, IDD, DGS-C, SEZ-12	uc002zoq.1	P98153	OTTHUMG00000150141	ENST00000263196.7:c.1198G>C	22.37:g.19028769C>G	ENSP00000263196:p.Asp400His		A6NIB5|A8K6K5|B5TY34|B7Z935	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,superfamily_C-type_lectin_fold,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_C-type_lectin,smart_VWF_C,pfscan_LDrepeatLR_classA_rpt,pfscan_C-type_lectin	p.D400H	ENST00000263196.7	37	c.1198	CCDS33598.1	22	.	.	.	.	.	.	.	.	.	.	C	33	5.276457	0.95459	.	.	ENSG00000070413	ENST00000537045;ENST00000263196	T;D	0.97710	0.62;-4.5	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	D	0.98620	0.9538	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99449	1.0940	10	0.72032	D	0.01	.	20.0384	0.97572	0.0:1.0:0.0:0.0	.	356;400	B7Z3T5;P98153	.;IDD_HUMAN	H	359;400	ENSP00000440062:D359H;ENSP00000263196:D400H	ENSP00000263196:D400H	D	-	1	0	DGCR2	17408769	1.000000	0.71417	0.998000	0.56505	0.900000	0.52787	5.979000	0.70508	2.837000	0.97791	0.655000	0.94253	GAT	DGCR2	-	NULL	ENSG00000070413		0.607	DGCR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	DGCR2	HGNC	protein_coding	OTTHUMT00000316504.1	-	0.00	37	0	C	NM_005137		19028769	-1	tier1	-	no_errors	ENST00000263196	ensembl	human	known	74_37	missense	22.86	27	8	SNP	1.000	G
DGKA	1606	genome.wustl.edu	37	12	56347520	56347520	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:56347520C>T	ENST00000331886.5	+	24	2630	c.2176C>T	c.(2176-2178)Cgc>Tgc	p.R726C	DGKA_ENST00000394147.1_Missense_Mutation_p.R726C|DGKA_ENST00000549079.2_3'UTR|DGKA_ENST00000551156.1_Missense_Mutation_p.R726C	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	726					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	CCCACCCCCCCGCTCCACCAA	0.587																																																	0													94.0	90.0	91.0					12																	56347520		2203	4300	6503	SO:0001583	missense	0			AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.2176C>T	12.37:g.56347520C>T	ENSP00000328405:p.Arg726Cys		O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_EF_hand_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.R726C	ENST00000331886.5	37	c.2176	CCDS8896.1	12	.	.	.	.	.	.	.	.	.	.	C	18.43	3.622758	0.66787	.	.	ENSG00000065357	ENST00000331886;ENST00000394147;ENST00000551156	D;D;D	0.86366	-2.11;-2.11;-2.11	4.88	3.96	0.45880	.	0.796636	0.11607	N	0.547214	D	0.85754	0.5770	L	0.38175	1.15	0.44807	D	0.997815	D	0.64830	0.994	P	0.48677	0.586	D	0.83950	0.0316	10	0.87932	D	0	.	13.2848	0.60237	0.1654:0.8346:0.0:0.0	.	726	P23743	DGKA_HUMAN	C	726	ENSP00000328405:R726C;ENSP00000377703:R726C;ENSP00000450359:R726C	ENSP00000328405:R726C	R	+	1	0	DGKA	54633787	0.779000	0.28652	0.508000	0.27688	0.893000	0.52053	2.339000	0.43965	1.094000	0.41399	0.561000	0.74099	CGC	DGKA	-	NULL	ENSG00000065357		0.587	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKA	HGNC	protein_coding	OTTHUMT00000407291.1	-	0.00	35	0	C			56347520	+1	tier1	-	no_errors	ENST00000331886	ensembl	human	known	74_37	missense	22.86	27	8	SNP	0.975	T
DHX32	55760	genome.wustl.edu	37	10	127542725	127542725	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:127542725G>T	ENST00000284690.3	-	4	1387	c.897C>A	c.(895-897)aaC>aaA	p.N299K	DHX32_ENST00000284688.6_Intron|DHX32_ENST00000368721.1_5'UTR	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32	299						mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				CAAGATCTGGGTTTAGGTTAG	0.343																																																	0													84.0	86.0	85.0					10																	127542725		2203	4299	6502	SO:0001583	missense	0				CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.897C>A	10.37:g.127542725G>T	ENSP00000284690:p.Asn299Lys		A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,superfamily_P-loop_NTPase,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd	p.N299K	ENST00000284690.3	37	c.897	CCDS7652.1	10	.	.	.	.	.	.	.	.	.	.	G	10.08	1.253580	0.22965	.	.	ENSG00000089876	ENST00000284690	T	0.13089	2.62	5.9	3.01	0.34805	.	0.433801	0.27442	N	0.019349	T	0.09992	0.0245	L	0.38953	1.18	0.29801	N	0.832467	B	0.20671	0.047	B	0.14023	0.01	T	0.09335	-1.0679	10	0.44086	T	0.13	-16.6329	6.6869	0.23150	0.2588:0.1225:0.6186:0.0	.	299	Q7L7V1	DHX32_HUMAN	K	299	ENSP00000284690:N299K	ENSP00000284690:N299K	N	-	3	2	DHX32	127532715	0.906000	0.30813	0.015000	0.15790	0.590000	0.36582	0.615000	0.24329	0.827000	0.34685	-0.143000	0.13931	AAC	DHX32	-	superfamily_P-loop_NTPase	ENSG00000089876		0.343	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX32	HGNC	protein_coding	OTTHUMT00000050945.2		0.00	43	0	G	NM_018180		127542725	-1			no_errors	ENST00000284690	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.263	T
DICER1	23405	genome.wustl.edu	37	14	95570212	95570212	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr14:95570212G>T	ENST00000526495.1	-	23	3812	c.3521C>A	c.(3520-3522)gCa>gAa	p.A1174E	DICER1_ENST00000556045.1_Missense_Mutation_p.A72E|DICER1_ENST00000527414.1_Missense_Mutation_p.A1174E|DICER1_ENST00000541352.1_Missense_Mutation_p.A1174E|DICER1_ENST00000393063.1_Missense_Mutation_p.A1174E|DICER1_ENST00000343455.3_Missense_Mutation_p.A1174E			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1174					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		ACCATTAATTGCTGTAAGATC	0.413			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																														yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	0													91.0	90.0	90.0					14																	95570212		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.3521C>A	14.37:g.95570212G>T	ENSP00000437256:p.Ala1174Glu		A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	pfam_RNase_III_dom,pfam_PAZ_dom,pfam_Dicer_dimerisation_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,superfamily_RNase_III_dom,superfamily_P-loop_NTPase,superfamily_PAZ_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_PAZ_dom,smart_RNase_III_dom,smart_dsRNA-bd_dom,pfscan_PAZ_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_dsRNA-bd_dom,pfscan_RNase_III_dom	p.A1174E	ENST00000526495.1	37	c.3521	CCDS9931.1	14	.	.	.	.	.	.	.	.	.	.	G	16.68	3.190002	0.58017	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000556045;ENST00000541352	T;T;T;T;D;T	0.86769	0.46;0.46;0.46;0.46;-2.17;0.76	5.24	5.24	0.73138	.	0.087644	0.49916	D	0.000135	T	0.81235	0.4780	L	0.29908	0.895	0.46849	D	0.999226	P;B;B	0.46706	0.883;0.094;0.09	B;B;B	0.44224	0.444;0.023;0.051	T	0.79070	-0.1954	10	0.02654	T	1	-10.5635	18.8506	0.92227	0.0:0.0:1.0:0.0	.	72;1174;1174	B3KRG4;E0AD28;Q9UPY3	.;.;DICER_HUMAN	E	1174;1174;1174;1174;72;1174	ENSP00000343745:A1174E;ENSP00000437256:A1174E;ENSP00000376783:A1174E;ENSP00000435681:A1174E;ENSP00000451041:A72E;ENSP00000444719:A1174E	ENSP00000343745:A1174E	A	-	2	0	DICER1	94639965	1.000000	0.71417	0.821000	0.32701	0.998000	0.95712	2.887000	0.48586	2.450000	0.82876	0.561000	0.74099	GCA	DICER1	-	NULL	ENSG00000100697		0.413	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	DICER1	HGNC	protein_coding	OTTHUMT00000387997.1	-	0.00	30	0	G			95570212	-1	tier1	-	no_errors	ENST00000343455	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
DIP2B	57609	genome.wustl.edu	37	12	51135289	51135289	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:51135289C>T	ENST00000301180.5	+	37	4479	c.4445C>T	c.(4444-4446)tCg>tTg	p.S1482L	Y_RNA_ENST00000363558.1_RNA	NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	1482						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						ATTGAGACCTCGGTGTCCCGG	0.463																																																	0													154.0	127.0	136.0					12																	51135289		2203	4300	6503	SO:0001583	missense	0			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.4445C>T	12.37:g.51135289C>T	ENSP00000301180:p.Ser1482Leu		Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.S1482L	ENST00000301180.5	37	c.4445	CCDS31799.1	12	.	.	.	.	.	.	.	.	.	.	C	31	5.091012	0.94149	.	.	ENSG00000066084	ENST00000301180	T	0.09445	2.98	5.06	5.06	0.68205	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.31670	0.0804	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00931	-1.1510	10	0.72032	D	0.01	-11.1985	18.5847	0.91185	0.0:1.0:0.0:0.0	.	1482	Q9P265	DIP2B_HUMAN	L	1482	ENSP00000301180:S1482L	ENSP00000301180:S1482L	S	+	2	0	DIP2B	49421556	1.000000	0.71417	0.956000	0.39512	0.732000	0.41865	5.805000	0.69143	2.783000	0.95769	0.655000	0.94253	TCG	DIP2B	-	pfam_AMP-dep_Synth/Lig	ENSG00000066084		0.463	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2B	HGNC	protein_coding	OTTHUMT00000404243.1	-	0.00	51	0	C	NM_173602		51135289	+1	tier1	-	no_errors	ENST00000301180	ensembl	human	known	74_37	missense	16.18	57	11	SNP	1.000	T
DIS3	22894	genome.wustl.edu	37	13	73335787	73335787	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr13:73335787G>T	ENST00000377767.4	-	18	2608	c.2508C>A	c.(2506-2508)acC>acA	p.T836T	DIS3_ENST00000377780.4_Silent_p.T806T|DIS3_ENST00000545453.1_Silent_p.T674T	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	836					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		CAAATACCTGGGTATGAAAAG	0.303										Multiple Myeloma(4;0.011)																																							0													123.0	115.0	118.0					13																	73335787		2203	4300	6503	SO:0001819	synonymous_variant	0			AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.2508C>A	13.37:g.73335787G>T			A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Silent	SNP	smart_PIN_dom	p.T836	ENST00000377767.4	37	c.2508	CCDS9447.1	13																																																																																			DIS3	-	NULL	ENSG00000083520		0.303	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIS3	HGNC	protein_coding	OTTHUMT00000045250.2	-	0.00	60	0	G	NM_014953		73335787	-1	tier1	-	no_errors	ENST00000377767	ensembl	human	known	74_37	silent	6.35	59	4	SNP	0.674	T
DNAH10	196385	genome.wustl.edu	37	12	124298415	124298415	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:124298415G>T	ENST00000409039.3	+	20	3407	c.3382G>T	c.(3382-3384)Gac>Tac	p.D1128Y		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1128	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CAGATATAGGGACGTCCAGGA	0.393																																																	0													77.0	74.0	75.0					12																	124298415		1979	4187	6166	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.3382G>T	12.37:g.124298415G>T	ENSP00000386770:p.Asp1128Tyr		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.D1128Y	ENST00000409039.3	37	c.3382	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	20.2	3.945009	0.73672	.	.	ENSG00000197653	ENST00000409039	T	0.22539	1.95	5.72	5.72	0.89469	.	.	.	.	.	T	0.50411	0.1614	M	0.83483	2.645	0.80722	D	1	D	0.67145	0.996	P	0.61940	0.896	T	0.54214	-0.8327	9	0.72032	D	0.01	.	19.8751	0.96867	0.0:0.0:1.0:0.0	.	1128	Q8IVF4	DYH10_HUMAN	Y	1128	ENSP00000386770:D1128Y	ENSP00000386770:D1128Y	D	+	1	0	DNAH10	122864368	1.000000	0.71417	0.980000	0.43619	0.320000	0.28249	9.609000	0.98334	2.695000	0.91970	0.655000	0.94253	GAC	DNAH10	-	NULL	ENSG00000197653		0.393	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	-	0.00	56	0	G			124298415	+1	tier1	-	no_errors	ENST00000409039	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
DNAH3	55567	genome.wustl.edu	37	16	20966359	20966359	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr16:20966359G>A	ENST00000261383.3	-	55	10846	c.10847C>T	c.(10846-10848)cCa>cTa	p.P3616L	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3616	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CTTCTCTGATGGATAGCTGGT	0.438																																																	0													96.0	94.0	95.0					16																	20966359		2201	4300	6501	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.10847C>T	16.37:g.20966359G>A	ENSP00000261383:p.Pro3616Leu		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.P3616L	ENST00000261383.3	37	c.10847	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	G	22.0	4.232720	0.79688	.	.	ENSG00000158486	ENST00000261383	T	0.09073	3.02	5.43	5.43	0.79202	Dynein heavy chain (1);	0.131543	0.50627	D	0.000120	T	0.48040	0.1478	H	0.99507	4.6	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68462	-0.5402	10	0.87932	D	0	.	12.5657	0.56308	0.0758:0.0:0.9242:0.0	.	3616	Q8TD57	DYH3_HUMAN	L	3616	ENSP00000261383:P3616L	ENSP00000261383:P3616L	P	-	2	0	DNAH3	20873860	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.280000	0.95786	2.543000	0.85770	0.655000	0.94253	CCA	DNAH3	-	pfam_Dynein_heavy_dom	ENSG00000158486		0.438	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	-	0.00	23	0	G	NM_017539		20966359	-1	tier1	-	no_errors	ENST00000261383	ensembl	human	known	74_37	missense	33.33	12	6	SNP	1.000	A
DNAH6	1768	genome.wustl.edu	37	2	84864352	84864352	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:84864352G>C	ENST00000237449.6	+	30	4680	c.4672G>C	c.(4672-4674)Gag>Cag	p.E1558Q	DNAH6_ENST00000389394.3_Missense_Mutation_p.E1558Q|DNAH6_ENST00000398278.2_Missense_Mutation_p.E1558Q			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1558	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						ATTCATGTTTGAGGGGCGGGA	0.383																																																	0													84.0	73.0	76.0					2																	84864352		692	1591	2283	SO:0001583	missense	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.4672G>C	2.37:g.84864352G>C	ENSP00000237449:p.Glu1558Gln		A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.E1558Q	ENST00000237449.6	37	c.4672	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	G	27.3	4.815034	0.90790	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.09255	3.0;3.0;3.0	5.89	5.89	0.94794	ATPase, AAA+ type, core (1);	.	.	.	.	T	0.34513	0.0900	M	0.76574	2.34	0.50039	D	0.999846	D	0.59767	0.986	D	0.64877	0.93	T	0.01356	-1.1376	9	0.72032	D	0.01	.	19.0281	0.92941	0.0:0.0:1.0:0.0	.	1558	Q9C0G6	DYH6_HUMAN	Q	1558	ENSP00000374045:E1558Q;ENSP00000381326:E1558Q;ENSP00000237449:E1558Q	ENSP00000237449:E1558Q	E	+	1	0	DNAH6	84717863	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.729000	0.91490	2.793000	0.96121	0.561000	0.74099	GAG	DNAH6	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000115423		0.383	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	-	0.00	22	0	G	NM_001370		84864352	+1	tier1	-	no_errors	ENST00000237449	ensembl	human	known	74_37	missense	36.00	16	9	SNP	1.000	C
DNAH8	1769	genome.wustl.edu	37	6	38919237	38919237	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:38919237T>G	ENST00000359357.3	+	80	11995	c.11741T>G	c.(11740-11742)cTg>cGg	p.L3914R	DNAH8_ENST00000441566.1_Missense_Mutation_p.L3878R|RP1-207H1.3_ENST00000416948.1_RNA|DNAH8_ENST00000449981.2_Missense_Mutation_p.L4131R			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	3914	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						ATATGCTTCCTGTCCATGGGA	0.418																																																	0													209.0	219.0	215.0					6																	38919237		2203	4300	6503	SO:0001583	missense	0			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.11741T>G	6.37:g.38919237T>G	ENSP00000352312:p.Leu3914Arg		O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L3914R	ENST00000359357.3	37	c.11741		6	.	.	.	.	.	.	.	.	.	.	T	26.0	4.690938	0.88735	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.14144	2.53;2.53;2.53	5.69	5.69	0.88448	Dynein heavy chain (1);	0.000000	0.64402	D	0.000001	T	0.52108	0.1714	H	0.99211	4.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.74680	-0.3584	10	0.87932	D	0	.	16.2433	0.82426	0.0:0.0:0.0:1.0	.	3878;3914	Q96JB1-2;Q96JB1	.;DYH8_HUMAN	R	4119;4119;3914;3878	ENSP00000333363:L4119R;ENSP00000352312:L3914R;ENSP00000402294:L3878R	ENSP00000333363:L4119R	L	+	2	0	DNAH8	39027215	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.905000	0.87416	2.296000	0.77279	0.533000	0.62120	CTG	DNAH8	-	pfam_Dynein_heavy_dom	ENSG00000124721		0.418	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	HGNC	protein_coding	OTTHUMT00000043574.1	-	0.00	25	0	T	NM_001206927		38919237	+1	tier1	-	no_errors	ENST00000359357	ensembl	human	known	74_37	missense	25.00	24	8	SNP	1.000	G
DNAH9	1770	genome.wustl.edu	37	17	11809063	11809063	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:11809063G>T	ENST00000262442.4	+	61	11754	c.11686G>T	c.(11686-11688)Gcc>Tcc	p.A3896S	DNAH9_ENST00000396001.2_3'UTR|DNAH9_ENST00000454412.2_Missense_Mutation_p.A3896S|DNAH9_ENST00000608377.1_Missense_Mutation_p.A208S	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3896	AAA 6. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.A3896T(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		ATCGGGACCAGCCACTCCTAT	0.473																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											69.0	69.0	69.0					17																	11809063		2203	4300	6503	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.11686G>T	17.37:g.11809063G>T	ENSP00000262442:p.Ala3896Ser		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A3896S	ENST00000262442.4	37	c.11686	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	G	10.79	1.450231	0.26074	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703;ENST00000396001;ENST00000361801	T;T;T	0.07567	3.18;3.18;3.18	4.81	3.78	0.43462	Dynein heavy chain (1);	0.053373	0.85682	N	0.000000	T	0.04272	0.0118	N	0.11154	0.105	0.52099	D	0.999947	B;B	0.16396	0.016;0.017	B;B	0.28305	0.088;0.088	T	0.31280	-0.9949	10	0.07482	T	0.82	.	8.4451	0.32836	0.0788:0.0:0.7336:0.1876	.	249;3896	B7Z7H0;Q9NYC9	.;DYH9_HUMAN	S	3896;3896;2478;208;249	ENSP00000262442:A3896S;ENSP00000414874:A3896S;ENSP00000379323:A208S	ENSP00000262442:A3896S	A	+	1	0	DNAH9	11749788	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.194000	0.51005	1.214000	0.43395	0.655000	0.94253	GCC	DNAH9	-	pfam_Dynein_heavy_dom	ENSG00000007174		0.473	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2		0.00	55	0	G	NM_001372		11809063	+1			no_errors	ENST00000262442	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
DNAJC11	55735	genome.wustl.edu	37	1	6704700	6704700	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:6704700C>A	ENST00000377577.5	-	10	1138	c.1015G>T	c.(1015-1017)Gct>Tct	p.A339S	DNAJC11_ENST00000349363.6_Intron|DNAJC11_ENST00000542246.1_Missense_Mutation_p.A301S|DNAJC11_ENST00000377573.5_Missense_Mutation_p.A249S|DNAJC11_ENST00000465508.1_5'UTR|DNAJC11_ENST00000294401.7_Missense_Mutation_p.A339S	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	339						extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		TTCCTCTCAGCTCCGTACTCC	0.547																																																	0													87.0	83.0	84.0					1																	6704700		2203	4300	6503	SO:0001583	missense	0			AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443	ENST00000377577.5:c.1015G>T	1.37:g.6704700C>A	ENSP00000366800:p.Ala339Ser		Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	Missense_Mutation	SNP	pfam_DnaJ-like_C11_C,pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.A339S	ENST00000377577.5	37	c.1015	CCDS87.1	1	.	.	.	.	.	.	.	.	.	.	C	15.31	2.795260	0.50208	.	.	ENSG00000007923	ENST00000377577;ENST00000294401;ENST00000542246;ENST00000377573	T;T;T;T	0.27557	2.26;2.45;2.03;1.66	5.58	5.58	0.84498	.	0.107271	0.64402	D	0.000005	T	0.50257	0.1605	M	0.72894	2.215	0.80722	D	1	P;P;P	0.46277	0.501;0.875;0.862	B;P;P	0.53549	0.058;0.729;0.451	T	0.46762	-0.9168	10	0.51188	T	0.08	-10.6364	18.5658	0.91116	0.0:1.0:0.0:0.0	.	249;339;339	B4DGD5;Q9NVH1-3;Q9NVH1	.;.;DJC11_HUMAN	S	339;339;301;249	ENSP00000366800:A339S;ENSP00000294401:A339S;ENSP00000444020:A301S;ENSP00000366796:A249S	ENSP00000294401:A339S	A	-	1	0	DNAJC11	6627287	1.000000	0.71417	0.241000	0.24154	0.122000	0.20287	7.249000	0.78278	2.624000	0.88883	0.585000	0.79938	GCT	DNAJC11	-	NULL	ENSG00000007923		0.547	DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC11	HGNC	protein_coding	OTTHUMT00000004216.3	-	0.00	22	0	C	NM_018198		6704700	-1	tier1	-	no_errors	ENST00000377577	ensembl	human	known	74_37	missense	24.00	19	6	SNP	1.000	A
DNAJB4	11080	genome.wustl.edu	37	1	78470892	78470892	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:78470892C>A	ENST00000370763.5	+	1	355	c.98C>A	c.(97-99)cCg>cAg	p.P33Q	RP11-386I14.4_ENST00000608684.1_RNA|DNAJB4_ENST00000487931.1_Intron|GIPC2_ENST00000476882.1_Intron	NM_007034.3	NP_008965.2	Q9UDY4	DNJB4_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 4	33	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				protein folding (GO:0006457)|response to heat (GO:0009408)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|unfolded protein binding (GO:0051082)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10						AAATTTCATCCGGACAAGAAC	0.368																																																	0													70.0	78.0	75.0					1																	78470892		2202	4300	6502	SO:0001583	missense	0			U40992	CCDS684.1	1p31.1	2011-09-02			ENSG00000162616	ENSG00000162616		"""Heat shock proteins / DNAJ (HSP40)"""	14886	protein-coding gene	gene with protein product		611327				9546042, 11147971	Standard	NM_007034		Approved	HLJ1	uc001dij.3	Q9UDY4	OTTHUMG00000040905	ENST00000370763.5:c.98C>A	1.37:g.78470892C>A	ENSP00000359799:p.Pro33Gln		B2R824|Q13431	Missense_Mutation	SNP	pfam_DnaJ_C,pfam_DnaJ_domain,superfamily_DnaJ_domain,superfamily_HSP40/DnaJ_pept-bd,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.P33Q	ENST00000370763.5	37	c.98	CCDS684.1	1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.464242	0.63513	.	.	ENSG00000162616	ENST00000426517;ENST00000370763	D;D	0.89875	-2.58;-2.58	5.83	3.98	0.46160	Heat shock protein DnaJ, N-terminal (5);	0.050056	0.85682	D	0.000000	D	0.96414	0.8830	H	0.99590	4.645	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96875	0.9642	10	0.87932	D	0	.	12.5148	0.56026	0.0:0.8648:0.0:0.1352	.	33	Q9UDY4	DNJB4_HUMAN	Q	33	ENSP00000399494:P33Q;ENSP00000359799:P33Q	ENSP00000359799:P33Q	P	+	2	0	DNAJB4	78243480	1.000000	0.71417	0.994000	0.49952	0.974000	0.67602	7.487000	0.81328	0.811000	0.34303	-0.145000	0.13849	CCG	DNAJB4	-	pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	ENSG00000162616		0.368	DNAJB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB4	HGNC	protein_coding	OTTHUMT00000098248.3		0.00	40	0	C			78470892	+1			no_errors	ENST00000370763	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.997	A
DNAJC24	120526	genome.wustl.edu	37	11	31447855	31447855	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:31447855G>T	ENST00000465995.1	+	4	378	c.272G>T	c.(271-273)gGa>gTa	p.G91V	DNAJC24_ENST00000536040.1_3'UTR	NM_181706.4	NP_859057.4	Q6P3W2	DJC24_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 24	90					chaperone-mediated protein folding (GO:0061077)|oxidation-reduction process (GO:0055114)|peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)|positive regulation of ATPase activity (GO:0032781)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATPase activator activity (GO:0001671)|ferrous iron binding (GO:0008198)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|skin(1)|upper_aerodigestive_tract(2)	11						AGAAATGTAGGACCAGTAGAT	0.284																																																	0													114.0	110.0	111.0					11																	31447855		1828	4078	5906	SO:0001583	missense	0			AL833128	CCDS7873.2	11p14.1	2011-09-02	2008-07-03	2008-07-03	ENSG00000170946	ENSG00000170946		"""Heat shock proteins / DNAJ (HSP40)"""	26979	protein-coding gene	gene with protein product		611072	"""zinc finger, CSL-type containing 3"", ""DPH4 homolog (JJJ3, S. cerevisiae)"", ""DPH4, JJJ3 homolog (S. cerevisiae)"""	ZCSL3, DPH4		15485916	Standard	NM_181706		Approved	JJJ3	uc001msx.3	Q6P3W2	OTTHUMG00000133712	ENST00000465995.1:c.272G>T	11.37:g.31447855G>T	ENSP00000417548:p.Gly91Val		A8K0V0|B1ALC1|I6L9B4	Missense_Mutation	SNP	pfam_DnaJ_domain,pfam_Znf_DHP,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_Znf_DHP,pfscan_DnaJ_domain,prints_DnaJ_domain	p.G91V	ENST00000465995.1	37	c.272	CCDS7873.2	11	.	.	.	.	.	.	.	.	.	.	G	17.11	3.306168	0.60305	.	.	ENSG00000170946	ENST00000465995	T	0.33654	1.4	5.52	5.52	0.82312	.	0.052588	0.85682	D	0.000000	T	0.48223	0.1488	M	0.66939	2.045	0.80722	D	1	D	0.71674	0.998	P	0.52267	0.694	T	0.31586	-0.9938	10	0.17369	T	0.5	.	17.9764	0.89129	0.0:0.0:1.0:0.0	.	90	Q6P3W2	DJC24_HUMAN	V	91	ENSP00000417548:G91V	ENSP00000417548:G91V	G	+	2	0	DNAJC24	31404431	1.000000	0.71417	0.992000	0.48379	0.804000	0.45430	7.181000	0.77682	2.744000	0.94065	0.650000	0.86243	GGA	DNAJC24	-	NULL	ENSG00000170946		0.284	DNAJC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC24	HGNC	protein_coding	OTTHUMT00000258011.3	-	0.00	26	0	G	NM_181706		31447855	+1	tier1	-	no_errors	ENST00000465995	ensembl	human	known	74_37	missense	38.71	19	12	SNP	1.000	T
DNAJC6	9829	genome.wustl.edu	37	1	65878634	65878634	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:65878634G>T	ENST00000395325.3	+	19	2825	c.2668G>T	c.(2668-2670)Gca>Tca	p.A890S	RNU2-15P_ENST00000410692.1_RNA|DNAJC6_ENST00000371069.4_Missense_Mutation_p.A947S|DNAJC6_ENST00000263441.7_Missense_Mutation_p.A877S	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	890	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						TGAACAATACGCAAAGATGAT	0.368																																																	0													167.0	171.0	170.0					1																	65878634		2203	4300	6503	SO:0001583	missense	0			AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.2668G>T	1.37:g.65878634G>T	ENSP00000378735:p.Ala890Ser		B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_DnaJ_domain,superfamily_DnaJ_domain,superfamily_C2_dom,smart_DnaJ_domain,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom,pfscan_DnaJ_domain	p.A947S	ENST00000395325.3	37	c.2839	CCDS30739.1	1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475318	0.84640	.	.	ENSG00000116675	ENST00000263441;ENST00000395325;ENST00000371069	T;T;T	0.34472	1.36;1.36;1.36	5.76	5.76	0.90799	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.85682	D	0.000000	T	0.60483	0.2272	M	0.81682	2.555	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.63088	-0.6715	10	0.87932	D	0	.	20.3316	0.98722	0.0:0.0:1.0:0.0	.	947;890	O75061-2;O75061	.;AUXI_HUMAN	S	877;890;947	ENSP00000263441:A877S;ENSP00000378735:A890S;ENSP00000360108:A947S	ENSP00000263441:A877S	A	+	1	0	DNAJC6	65651222	1.000000	0.71417	0.987000	0.45799	0.359000	0.29487	9.416000	0.97383	2.871000	0.98454	0.655000	0.94253	GCA	DNAJC6	-	pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain	ENSG00000116675		0.368	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	DNAJC6	HGNC	protein_coding	OTTHUMT00000025134.1	-	0.00	60	0	G			65878634	+1	tier1	-	no_errors	ENST00000371069	ensembl	human	known	74_37	missense	7.58	60	5	SNP	1.000	T
DOPEY2	9980	genome.wustl.edu	37	21	37597889	37597889	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr21:37597889G>T	ENST00000399151.3	+	12	1482	c.1397G>T	c.(1396-1398)aGg>aTg	p.R466M		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	466					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TACAGCGTGAGGAACAGCGTC	0.522																																																	0																																										SO:0001583	missense	0			AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.1397G>T	21.37:g.37597889G>T	ENSP00000382104:p.Arg466Met		D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	pfam_Dopey_N	p.R466M	ENST00000399151.3	37	c.1397	CCDS13643.1	21	.	.	.	.	.	.	.	.	.	.	G	10.21	1.287298	0.23478	.	.	ENSG00000142197	ENST00000399151	T	0.12672	2.66	5.11	2.09	0.27110	.	1.249050	0.05278	N	0.518785	T	0.07234	0.0183	N	0.08118	0	0.09310	N	1	B;B	0.24963	0.115;0.07	B;B	0.17098	0.017;0.007	T	0.30995	-0.9959	10	0.45353	T	0.12	-8.9507	4.1399	0.10188	0.2776:0.1728:0.5496:0.0	.	466;466	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	M	466	ENSP00000382104:R466M	ENSP00000382104:R466M	R	+	2	0	DOPEY2	36519759	0.006000	0.16342	0.002000	0.10522	0.002000	0.02628	1.252000	0.32874	0.814000	0.34374	0.655000	0.94253	AGG	DOPEY2	-	NULL	ENSG00000142197		0.522	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY2	HGNC	protein_coding	OTTHUMT00000194636.1	-	0.00	68	0	G	NM_005128		37597889	+1	tier1	-	no_errors	ENST00000399151	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.002	T
DPP10	57628	genome.wustl.edu	37	2	116535403	116535403	+	Missense_Mutation	SNP	C	C	A	rs370987489		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:116535403C>A	ENST00000410059.1	+	15	1834	c.1354C>A	c.(1354-1356)Ctg>Atg	p.L452M	DPP10_ENST00000409163.1_Missense_Mutation_p.L402M|DPP10_ENST00000393147.2_Missense_Mutation_p.L456M|DPP10_ENST00000310323.8_Missense_Mutation_p.L445M	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	452						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						AGGAAGGCAGCTGTACAGGTA	0.403																																																	0													152.0	135.0	141.0					2																	116535403		2203	4300	6503	SO:0001583	missense	0			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1354C>A	2.37:g.116535403C>A	ENSP00000386565:p.Leu452Met		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.L456M	ENST00000410059.1	37	c.1366	CCDS46400.1	2	.	.	.	.	.	.	.	.	.	.	C	18.31	3.594966	0.66219	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.34	3.54	0.40534	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.000000	0.64402	D	0.000002	T	0.68155	0.2970	M	0.91459	3.21	0.52099	D	0.99994	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;D;D	0.97110	0.992;1.0;0.995;0.995	T	0.71407	-0.4602	10	0.87932	D	0	-31.3092	9.5784	0.39472	0.0:0.8275:0.0:0.1725	.	445;456;448;452	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	M	452;402;456;445;402	ENSP00000386565:L452M;ENSP00000387038:L402M;ENSP00000376855:L456M;ENSP00000309066:L445M	ENSP00000309066:L445M	L	+	1	2	DPP10	116251873	0.994000	0.37717	1.000000	0.80357	0.988000	0.76386	1.345000	0.33953	0.629000	0.30376	0.579000	0.79373	CTG	DPP10	-	pfam_Peptidase_S9B	ENSG00000175497		0.403	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	HGNC	protein_coding	OTTHUMT00000330580.4		0.00	40	0	C	NM_020868		116535403	+1			no_errors	ENST00000393147	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
DPYS	1807	genome.wustl.edu	37	8	105456626	105456626	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:105456626C>T	ENST00000351513.2	-	4	775	c.643G>A	c.(643-645)Gag>Aag	p.E215K		NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	215					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TCGTGGCCCTCAGGGCCTGTT	0.522																																																	0													60.0	57.0	58.0					8																	105456626		2203	4300	6503	SO:0001583	missense	0			D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.643G>A	8.37:g.105456626C>T	ENSP00000276651:p.Glu215Lys			Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.E215K	ENST00000351513.2	37	c.643	CCDS6302.1	8	.	.	.	.	.	.	.	.	.	.	C	36	5.932012	0.97116	.	.	ENSG00000147647	ENST00000351513	D	0.90676	-2.71	5.67	5.67	0.87782	Amidohydrolase 1 (1);	0.000000	0.85682	D	0.000000	D	0.94525	0.8237	M	0.63169	1.94	0.80722	D	1	D	0.64830	0.994	D	0.66602	0.945	D	0.94611	0.7804	10	0.87932	D	0	-39.4355	19.7714	0.96367	0.0:1.0:0.0:0.0	.	215	Q14117	DPYS_HUMAN	K	215	ENSP00000276651:E215K	ENSP00000276651:E215K	E	-	1	0	DPYS	105525802	1.000000	0.71417	0.961000	0.40146	0.979000	0.70002	7.337000	0.79256	2.666000	0.90696	0.655000	0.94253	GAG	DPYS	-	pfam_Amidohydro_1,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000147647		0.522	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYS	HGNC	protein_coding	OTTHUMT00000380814.1	-	0.00	42	0	C	NM_001385		105456626	-1	tier1	-	no_errors	ENST00000351513	ensembl	human	known	74_37	missense	31.58	13	6	SNP	1.000	T
DSN1	79980	genome.wustl.edu	37	20	35381135	35381135	+	3'UTR	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr20:35381135G>T	ENST00000426836.1	-	0	1499				DSN1_ENST00000373750.4_3'UTR|DSN1_ENST00000373745.3_3'UTR|DSN1_ENST00000373734.4_3'UTR|DSN1_ENST00000373740.3_3'UTR|DSN1_ENST00000473615.1_5'UTR|DSN1_ENST00000448110.2_3'UTR	NM_001145316.1	NP_001138788.1	Q9H410	DSN1_HUMAN	DSN1, MIS12 kinetochore complex component						chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	16		Myeloproliferative disorder(115;0.00874)				CACGTGCTGGGGCACTCTTCC	0.473																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK023408	CCDS13286.1, CCDS46596.1, CCDS46597.1	20q11.23	2013-07-03	2013-07-03	2006-11-07	ENSG00000149636	ENSG00000149636			16165	protein-coding gene	gene with protein product	"""kinetochore null 3 homolog (C. elegans)"""	609175	"""chromosome 20 open reading frame 172"", ""DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C20orf172		16585270, 20819937	Standard	NM_001145315		Approved	dJ469A13.2, MIS13, KNL3, hKNL-3	uc002xfz.3	Q9H410	OTTHUMG00000032396	ENST00000426836.1:c.*56C>A	20.37:g.35381135G>T			B4DWT2|E1P5U9|Q5JW55|Q5JW56|Q9H8P4	RNA	SNP	-	NULL	ENST00000426836.1	37	NULL	CCDS13286.1	20																																																																																			DSN1	-	-	ENSG00000149636		0.473	DSN1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSN1	HGNC	protein_coding	OTTHUMT00000079043.2	-	0.00	32	0	G	NM_024918		35381135	-1	tier1	-	no_errors	ENST00000473615	ensembl	human	putative	74_37	rna	15.38	22	4	SNP	0.000	T
DST	667	genome.wustl.edu	37	6	56329512	56329512	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:56329512G>C	ENST00000361203.3	-	95	21777	c.21770C>G	c.(21769-21771)tCt>tGt	p.S7257C	DST_ENST00000446842.2_Missense_Mutation_p.S7042C|DST_ENST00000312431.6_Intron|DST_ENST00000370788.2_Missense_Mutation_p.S5171C|DST_ENST00000370769.4_Missense_Mutation_p.S7368C|DST_ENST00000370754.5_Missense_Mutation_p.S7546C|DST_ENST00000244364.6_Intron|DST_ENST00000421834.2_Missense_Mutation_p.S5253C			Q03001	DYST_HUMAN	dystonin	7366	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AGTAATTGAAGAGTTTGATTC	0.383																																																	0													22.0	21.0	22.0					6																	56329512		876	1991	2867	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.21770C>G	6.37:g.56329512G>C	ENSP00000354508:p.Ser7257Cys		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.S7546C	ENST00000361203.3	37	c.22637		6	.	.	.	.	.	.	.	.	.	.	G	17.49	3.402823	0.62288	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T	0.66099	-0.18;-0.19;-0.08;0.76;-0.07;-0.12	6.07	6.07	0.98685	.	0.000000	0.53938	D	0.000060	T	0.77239	0.4101	.	.	.	0.34437	D	0.699141	.	.	.	.	.	.	T	0.78069	-0.2348	6	0.87932	D	0	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	.	.	.	C	7546;7368;5253;7042;5171;7257	ENSP00000359790:S7546C;ENSP00000359805:S7368C;ENSP00000400883:S5253C;ENSP00000393645:S7042C;ENSP00000359824:S5171C;ENSP00000354508:S7257C	ENSP00000354508:S7257C	S	-	2	0	DST	56437471	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	TCT	DST	-	superfamily_ABC1_TM_dom	ENSG00000151914		0.383	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	43	0	G	NM_001723		56329512	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	missense	19.61	41	10	SNP	1.000	C
DTX3L	151636	genome.wustl.edu	37	3	122284880	122284880	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:122284880G>T	ENST00000296161.4	+	2	551	c.362G>T	c.(361-363)gGa>gTa	p.G121V	PARP9_ENST00000492382.1_5'Flank|PARP9_ENST00000471785.1_5'Flank|PARP9_ENST00000477522.2_5'Flank|PARP9_ENST00000360356.2_5'Flank|DTX3L_ENST00000383661.3_Missense_Mutation_p.G121V|PARP9_ENST00000462315.1_5'Flank	NM_138287.3	NP_612144.1	Q8TDB6	DTX3L_HUMAN	deltex 3 like, E3 ubiquitin ligase	121					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone monoubiquitination (GO:0010390)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0459)		CAACATGAAGGACATATTCCT	0.453																																																	0													96.0	83.0	88.0					3																	122284880		2203	4300	6503	SO:0001583	missense	0				CCDS3015.1	3q21.1	2014-01-28	2014-01-28		ENSG00000163840	ENSG00000163840		"""RING-type (C3HC4) zinc fingers"""	30323	protein-coding gene	gene with protein product	"""rhysin 2"""	613143	"""deltex 3-like (Drosophila)"""			12670957, 22411408	Standard	NM_138287		Approved	BBAP	uc003efk.3	Q8TDB6	OTTHUMG00000159524	ENST00000296161.4:c.362G>T	3.37:g.122284880G>T	ENSP00000296161:p.Gly121Val		B3KWH6|Q53ZZ3|Q5MJP7	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.G121V	ENST00000296161.4	37	c.362	CCDS3015.1	3	.	.	.	.	.	.	.	.	.	.	G	12.64	1.998747	0.35226	.	.	ENSG00000163840	ENST00000296161;ENST00000383661	T;T	0.32272	1.46;2.08	4.9	2.83	0.33086	.	0.729351	0.11778	N	0.530433	T	0.27967	0.0689	L	0.38175	1.15	0.19945	N	0.999945	P;P	0.50272	0.899;0.933	P;P	0.48227	0.571;0.564	T	0.12451	-1.0547	10	0.56958	D	0.05	-23.2411	4.1532	0.10247	0.4679:0.0:0.5321:0.0	.	121;121	Q8TDB6-2;Q8TDB6	.;DTX3L_HUMAN	V	121	ENSP00000296161:G121V;ENSP00000373157:G121V	ENSP00000296161:G121V	G	+	2	0	DTX3L	123767570	0.001000	0.12720	0.000000	0.03702	0.008000	0.06430	0.468000	0.22051	0.472000	0.27344	0.643000	0.83706	GGA	DTX3L	-	NULL	ENSG00000163840		0.453	DTX3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX3L	HGNC	protein_coding	OTTHUMT00000355966.1		0.00	25	0	G	NM_138287		122284880	+1			no_errors	ENST00000296161	ensembl	human	known	74_37	missense	8.47	54	5	SNP	0.001	T
DYRK4	8798	genome.wustl.edu	37	12	4714126	4714126	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:4714126C>G	ENST00000540757.2	+	9	988	c.828C>G	c.(826-828)atC>atG	p.I276M	DYRK4_ENST00000010132.5_Missense_Mutation_p.I276M|DYRK4_ENST00000545342.1_5'Flank|DYRK4_ENST00000543431.1_Missense_Mutation_p.I276M|RP11-500M8.7_ENST00000536588.1_Missense_Mutation_p.S6C	NM_001282285.1|NM_001282286.1|NM_003845.1	NP_001269214.1|NP_001269215.1|NP_003836.1	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4	276	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27			Colorectal(7;0.103)			CAGAAGTGATCCTGGGCCACC	0.572											OREG0021598	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													66.0	62.0	63.0					12																	4714126		2203	4300	6503	SO:0001583	missense	0			Y09305	CCDS8530.1	12p13.32	2014-09-11			ENSG00000010219	ENSG00000010219			3095	protein-coding gene	gene with protein product		609181				9748265	Standard	NM_003845		Approved		uc001qmx.3	Q9NR20	OTTHUMG00000168204	ENST00000540757.2:c.828C>G	12.37:g.4714126C>G	ENSP00000441755:p.Ile276Met	620	A8K8F7|Q8NEF2|Q92631	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.I276M	ENST00000540757.2	37	c.828	CCDS8530.1	12	.	.	.	.	.	.	.	.	.	.	C	18.46	3.629310	0.67015	.	.	ENSG00000010219	ENST00000542744;ENST00000540757;ENST00000010132;ENST00000543431	T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39	5.6	-1.1	0.09872	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75265	0.3826	M	0.69185	2.1	0.80722	D	1	D;D;P	0.89917	1.0;0.957;0.929	D;P;P	0.79108	0.992;0.842;0.902	T	0.74093	-0.3776	10	0.87932	D	0	.	10.1204	0.42616	0.0:0.3744:0.0:0.6256	.	391;276;276	F5H6L9;Q9NR20-2;Q9NR20	.;.;DYRK4_HUMAN	M	391;276;276;276	ENSP00000437534:I391M;ENSP00000441755:I276M;ENSP00000010132:I276M;ENSP00000439697:I276M	ENSP00000010132:I276M	I	+	3	3	DYRK4	4584387	0.996000	0.38824	0.996000	0.52242	0.995000	0.86356	0.398000	0.20899	-0.199000	0.10317	0.555000	0.69702	ATC	DYRK4	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000010219		0.572	DYRK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYRK4	HGNC	protein_coding	OTTHUMT00000398780.2	-	0.00	41	0	C			4714126	+1	tier1	-	no_errors	ENST00000010132	ensembl	human	known	74_37	missense	28.57	35	14	SNP	0.991	G
EBF1	1879	genome.wustl.edu	37	5	158158109	158158109	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:158158109G>C	ENST00000313708.6	-	11	1375	c.1093C>G	c.(1093-1095)Cgg>Ggg	p.R365G	EBF1_ENST00000517373.1_Missense_Mutation_p.R357G|EBF1_ENST00000380654.4_Missense_Mutation_p.R334G|EBF1_ENST00000518836.1_5'UTR	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	365					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCAGGGTGCCGAGGAATGACC	0.438			T	HMGA2	lipoma																																			Dom	yes		5	5q34	1879	early B-cell factor 1		M	0													69.0	69.0	69.0					5																	158158109		2203	4300	6503	SO:0001583	missense	0			AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.1093C>G	5.37:g.158158109G>C	ENSP00000322898:p.Arg365Gly		Q8IW11	Missense_Mutation	SNP	pfam_IPT,superfamily_Ig_E-set,superfamily_bHLH_dom,smart_IPT	p.R365G	ENST00000313708.6	37	c.1093	CCDS4343.1	5	.	.	.	.	.	.	.	.	.	.	G	18.72	3.683352	0.68157	.	.	ENSG00000164330	ENST00000318060;ENST00000313708;ENST00000380654;ENST00000517373	T;T;T	0.45668	0.89;0.89;0.89	5.51	2.48	0.30137	Helix-loop-helix DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.64800	0.2631	M	0.85197	2.74	0.47153	D	0.999337	B;D;P;P	0.64830	0.228;0.994;0.521;0.653	B;D;B;P	0.66602	0.081;0.945;0.198;0.511	T	0.70568	-0.4836	10	0.48119	T	0.1	-5.5481	14.6933	0.69101	0.0:0.0:0.4173:0.5827	.	365;352;365;334	A8K0Z7;B4E2U8;Q9UH73;Q9UH73-2	.;.;COE1_HUMAN;.	G	365;365;334;357	ENSP00000322898:R365G;ENSP00000370029:R334G;ENSP00000428020:R357G	ENSP00000322898:R365G	R	-	1	2	EBF1	158090687	0.922000	0.31269	0.996000	0.52242	0.996000	0.88848	1.401000	0.34589	0.750000	0.32877	0.655000	0.94253	CGG	EBF1	-	superfamily_bHLH_dom	ENSG00000164330		0.438	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	EBF1	HGNC	protein_coding	OTTHUMT00000252649.1	-	0.00	25	0	G	NM_024007		158158109	-1	tier1	-	no_errors	ENST00000313708	ensembl	human	known	74_37	missense	36.36	21	12	SNP	0.962	C
ECM2	1842	genome.wustl.edu	37	9	95263118	95263118	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr9:95263118G>T	ENST00000344604.5	-	9	1971	c.1822C>A	c.(1822-1824)Cat>Aat	p.H608N	CENPP_ENST00000375587.3_Intron|ECM2_ENST00000444490.2_Missense_Mutation_p.H586N	NM_001197295.1|NM_001393.3	NP_001184224.1|NP_001384.1	O94769	ECM2_HUMAN	extracellular matrix protein 2, female organ and adipocyte specific	608					cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27						CTCAGAGAATGATATGCCCCA	0.413																																																	0													124.0	118.0	120.0					9																	95263118		2203	4300	6503	SO:0001583	missense	0			AB011792	CCDS6698.1, CCDS56578.1	9q22.3	2008-07-21			ENSG00000106823	ENSG00000106823			3154	protein-coding gene	gene with protein product	"""matrix glycoprotein SC1/ECM2"""	603479				9790758	Standard	NM_001393		Approved		uc011lty.2	O94769	OTTHUMG00000020226	ENST00000344604.5:c.1822C>A	9.37:g.95263118G>T	ENSP00000344758:p.His608Asn		B2R730|E2PU11|Q5T9F2|Q7Z3D0	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_VWF_C,smart_VWF_C,smart_Leu-rich_rpt_typical-subtyp,pfscan_VWF_C	p.H608N	ENST00000344604.5	37	c.1822	CCDS6698.1	9	.	.	.	.	.	.	.	.	.	.	G	11.37	1.618565	0.28801	.	.	ENSG00000106823	ENST00000444490;ENST00000344604	T;T	0.56941	0.43;0.43	5.12	4.21	0.49690	.	0.477728	0.24233	N	0.040335	T	0.32615	0.0835	N	0.05487	-0.04	0.39456	D	0.967482	B;B;B	0.23990	0.008;0.095;0.022	B;B;B	0.27170	0.026;0.077;0.022	T	0.12066	-1.0562	10	0.11485	T	0.65	.	15.4861	0.75569	0.0:0.1511:0.8489:0.0	.	608;586;586	O94769;B4DK93;O94769-2	ECM2_HUMAN;.;.	N	586;608	ENSP00000393971:H586N;ENSP00000344758:H608N	ENSP00000344758:H608N	H	-	1	0	ECM2	94302939	1.000000	0.71417	0.993000	0.49108	0.952000	0.60782	4.174000	0.58256	1.256000	0.44068	0.591000	0.81541	CAT	ECM2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000106823		0.413	ECM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECM2	HGNC	protein_coding	OTTHUMT00000053091.1	-	0.00	51	0	G	NM_001393		95263118	-1	tier1	-	no_errors	ENST00000344604	ensembl	human	known	74_37	missense	7.94	58	5	SNP	0.997	T
EFCAB3	146779	genome.wustl.edu	37	17	60493371	60493371	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:60493371G>T	ENST00000305286.3	+	10	1076	c.998G>T	c.(997-999)aGa>aTa	p.R333I	EFCAB3_ENST00000450662.2_Missense_Mutation_p.R385I	NM_173503.3	NP_775774.1	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3	333							calcium ion binding (GO:0005509)			cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)	17			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			CAGGTGAAGAGAGCTACTGAT	0.428																																																	0													68.0	69.0	68.0					17																	60493371		2203	4300	6503	SO:0001583	missense	0			AK098684	CCDS11632.1, CCDS45751.1	17q23.3	2013-01-10			ENSG00000172421	ENSG00000172421		"""EF-hand domain containing"""	26379	protein-coding gene	gene with protein product						12477932	Standard	NM_173503		Approved	FLJ25818	uc010wpc.2	Q8N7B9	OTTHUMG00000179175	ENST00000305286.3:c.998G>T	17.37:g.60493371G>T	ENSP00000302649:p.Arg333Ile		J3KQM8	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.R385I	ENST00000305286.3	37	c.1154	CCDS11632.1	17	.	.	.	.	.	.	.	.	.	.	G	17.75	3.466457	0.63625	.	.	ENSG00000172421	ENST00000450662;ENST00000305286	T;T	0.60920	0.15;0.18	4.48	1.23	0.21249	.	0.295577	0.29444	N	0.012134	T	0.56156	0.1966	L	0.60455	1.87	0.41678	D	0.989279	D	0.54964	0.969	P	0.51806	0.68	T	0.56426	-0.7981	10	0.72032	D	0.01	.	4.3796	0.11288	0.2091:0.1881:0.6028:0.0	.	333	Q8N7B9	EFCB3_HUMAN	I	385;333	ENSP00000403932:R385I;ENSP00000302649:R333I	ENSP00000302649:R333I	R	+	2	0	EFCAB3	57847103	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	0.426000	0.21363	0.572000	0.29383	0.555000	0.69702	AGA	EFCAB3	-	NULL	ENSG00000172421		0.428	EFCAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB3	HGNC	protein_coding	OTTHUMT00000379114.1		0.00	39	0	G	NM_173503		60493371	+1			no_errors	ENST00000450662	ensembl	human	known	74_37	missense	5.88	48	3	SNP	1.000	T
EMC1	23065	genome.wustl.edu	37	1	19559457	19559457	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:19559457C>G	ENST00000477853.1	-	14	1647	c.1605G>C	c.(1603-1605)atG>atC	p.M535I	EMC1_ENST00000375199.3_Missense_Mutation_p.M534I|RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375208.3_Missense_Mutation_p.M513I	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	535						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											CCATCACCATCATCTTCTGGA	0.453																																																	0													274.0	285.0	281.0					1																	19559457		2203	4300	6503	SO:0001583	missense	0				CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.1605G>C	1.37:g.19559457C>G	ENSP00000420608:p.Met535Ile		A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Missense_Mutation	SNP	pfam_DUF1620,superfamily_Quinonprotein_ADH-like_supfam	p.M535I	ENST00000477853.1	37	c.1605	CCDS190.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.87|15.87	2.961998|2.961998	0.53400|0.53400	.|.	.|.	ENSG00000127463|ENSG00000127463	ENST00000375197|ENST00000477853;ENST00000375199;ENST00000375208	.|T;T;T	.|0.21361	.|2.02;2.02;2.01	5.27|5.27	4.35|4.35	0.52113|0.52113	.|.	.|0.068741	.|0.85682	.|N	.|0.000000	T|T	0.19248|0.19248	0.0462|0.0462	L|L	0.45228|0.45228	1.405|1.405	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.33171	.|0.02;0.043;0.4;0.278	.|B;B;B;B	.|0.32465	.|0.036;0.053;0.146;0.07	T|T	0.03306|0.03306	-1.1050|-1.1050	5|10	.|0.28530	.|T	.|0.3	-38.8483|-38.8483	14.1041|14.1041	0.65078|0.65078	0.1515:0.8485:0.0:0.0|0.1515:0.8485:0.0:0.0	.|.	.|513;534;534;535	.|Q8N766-4;Q8N766-2;Q8N766-3;Q8N766	.|.;.;.;K0090_HUMAN	H|I	269|535;534;513	.|ENSP00000420608:M535I;ENSP00000364345:M534I;ENSP00000364354:M513I	.|ENSP00000364345:M534I	D|M	-|-	1|3	0|0	KIAA0090|KIAA0090	19432044|19432044	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	7.313000|7.313000	0.78978|0.78978	1.430000|1.430000	0.47334|0.47334	-0.182000|-0.182000	0.12963|0.12963	GAT|ATG	EMC1	-	NULL	ENSG00000127463		0.453	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EMC1	HGNC	protein_coding	OTTHUMT00000007076.2	-	0.00	106	0	C	NM_015047		19559457	-1	tier1	-	no_errors	ENST00000477853	ensembl	human	known	74_37	missense	20.21	75	19	SNP	1.000	G
EML6	400954	genome.wustl.edu	37	2	55122100	55122100	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:55122100A>G	ENST00000356458.6	+	19	3311	c.2791A>G	c.(2791-2793)Atg>Gtg	p.M931V		NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	931						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						CTGGGATGATATGTTTGAAAG	0.403																																																	0													225.0	196.0	204.0					2																	55122100		692	1591	2283	SO:0001583	missense	0				CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.2791A>G	2.37:g.55122100A>G	ENSP00000348842:p.Met931Val		A8MUB5|B6ZDG7	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M931V	ENST00000356458.6	37	c.2791	CCDS46286.1	2	.	.	.	.	.	.	.	.	.	.	A	13.89	2.372476	0.42003	.	.	ENSG00000214595	ENST00000356458	T	0.01258	5.09	5.74	4.6	0.57074	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.179454	0.26507	U	0.023995	T	0.01387	0.0045	N	0.22421	0.69	0.40982	D	0.98478	B	0.02656	0.0	B	0.06405	0.002	T	0.60047	-0.7339	10	0.31617	T	0.26	.	11.4423	0.50105	0.9301:0.0:0.0699:0.0	.	931	Q6ZMW3	EMAL6_HUMAN	V	931	ENSP00000348842:M931V	ENSP00000348842:M931V	M	+	1	0	EML6	54975604	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.173000	0.77612	1.018000	0.39521	0.533000	0.62120	ATG	EML6	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000214595		0.403	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EML6	HGNC	protein_coding	OTTHUMT00000324997.3	-	0.00	51	0	A	XM_001725002		55122100	+1	tier1	-	no_errors	ENST00000356458	ensembl	human	novel	74_37	missense	47.31	49	44	SNP	1.000	G
Unknown	0	genome.wustl.edu	37	GL000212.1	65454	65454	+	IGR	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chrGL000212.1:65454G>A								None (None upstream) : None (None downstream)																							CGCTGACGAGGACCCCGTCCA	0.657																																																	0																																										SO:0001628	intergenic_variant	0																															GL000212.1.37:g.65454G>A				Silent	SNP	NULL	p.R401		37	c.1203		GL000212.1																																																																																			AL356585.1	-	NULL	ENSG00000212857	0	0.657					ENSG00000212857	Clone_based_ensembl_gene			-	0.00	48	0	G			65454	+1	tier1	-	no_errors	ENST00000391545	ensembl	human	known	74_37	silent	17.39	38	8	SNP	NULL	A
CGGBP1	8545	genome.wustl.edu	37	3	88135509	88135509	+	Intron	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:88135509G>T	ENST00000462901.1	-	3	284				RP11-159G9.5_ENST00000473136.1_Missense_Mutation_p.D97Y			Q9UFW8	CGBP1_HUMAN	CGG triplet repeat binding protein 1						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			kidney(1)|large_intestine(2)|lung(2)	5		Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00359)|Lung(72;0.00677)		ATCATTCCCAGATGAATGTGA	0.388																																																	0																																										SO:0001627	intron_variant	0			AJ000258	CCDS43111.1	3p12-p11.1	2008-07-18			ENSG00000163320	ENSG00000163320			1888	protein-coding gene	gene with protein product	"""p20-CGG binding protein"""	603363				9201980, 14667814	Standard	NM_001195308		Approved	p20-CGGBP, CGGBP	uc003dqt.3	Q9UFW8	OTTHUMG00000159009	ENST00000462901.1:c.228-28136C>A	3.37:g.88135509G>T			D3DU38|O15183	Missense_Mutation	SNP	NULL	p.D97Y	ENST00000462901.1	37	c.289	CCDS43111.1	3	.	.	.	.	.	.	.	.	.	.	G	15.21	2.767391	0.49574	.	.	ENSG00000229729	ENST00000473136	T	0.78126	-1.15	5.73	4.84	0.62591	.	.	.	.	.	D	0.84813	0.5555	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.85874	0.1418	6	0.72032	D	0.01	.	14.7704	0.69671	0.0727:0.0:0.9273:0.0	.	.	.	.	Y	97	ENSP00000419057:D97Y	ENSP00000419057:D97Y	D	+	1	0	RP11-159G9.5	88218199	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.659000	0.61504	2.861000	0.98227	0.655000	0.94253	GAT	RP11-159G9.5	-	NULL	ENSG00000229729		0.388	CGGBP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000229729	Clone_based_vega_gene	protein_coding	OTTHUMT00000353159.1	-	0.00	50	0	G	NM_001008390		88135509	+1	tier1	-	no_errors	ENST00000473136	ensembl	human	putative	74_37	missense	7.69	48	4	SNP	1.000	T
ANKRD45	339416	genome.wustl.edu	37	1	173604925	173604925	+	Intron	SNP	G	G	A	rs532208235		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:173604925G>A	ENST00000333279.2	-	4	557				RP11-360D2.1_ENST00000417563.1_RNA	NM_198493.2	NP_940895.1	Q5TZF3	ANR45_HUMAN	ankyrin repeat domain 45											NS(2)|endometrium(2)|large_intestine(4)|lung(3)|skin(1)	12						TGTCTTCTTCGTCTTATTTGT	0.328																																																	0																																										SO:0001627	intron_variant	0				CCDS1309.1	1q25.1	2013-01-10			ENSG00000183831	ENSG00000183831		"""Ankyrin repeat domain containing"""	24786	protein-coding gene	gene with protein product	"""cancer/testis antigen 117"""						Standard	NM_198493		Approved	FLJ45235, CT117	uc001gja.1	Q5TZF3	OTTHUMG00000040546	ENST00000333279.2:c.497-8627C>T	1.37:g.173604925G>A			A1A4G2|Q6ZST1	RNA	SNP	-	NULL	ENST00000333279.2	37	NULL	CCDS1309.1	1																																																																																			RP11-360D2.1	-	-	ENSG00000232113		0.328	ANKRD45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232113	Clone_based_vega_gene	protein_coding	OTTHUMT00000097580.2	-	0.00	53	0	G	NM_198493		173604925	+1	tier1	-	no_errors	ENST00000417563	ensembl	human	known	74_37	rna	44.83	48	39	SNP	0.976	A
FMNL1	752	genome.wustl.edu	37	17	43316271	43316271	+	Intron	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:43316271G>C	ENST00000331495.3	+	11	1305				CTD-2020K17.3_ENST00000393507.2_RNA|FMNL1_ENST00000587489.1_5'Flank|FMNL1_ENST00000328118.3_Intron|FMNL1_ENST00000592006.1_Intron|CTD-2020K17.3_ENST00000587534.1_RNA	NM_005892.3	NP_005883	O95466	FMNL_HUMAN	formin-like 1						actin filament severing (GO:0051014)|cortical actin cytoskeleton organization (GO:0030866)|regulation of cell shape (GO:0008360)|substrate-dependent cell migration (GO:0006929)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|GTPase activating protein binding (GO:0032794)|Rac GTPase binding (GO:0048365)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(12)|pancreas(1)|skin(1)|urinary_tract(2)	33						GGAAGGCATTGAGCAACCCCA	0.542																																					GBM(164;1247 1997 8702 11086 51972)												0													100.0	76.0	84.0					17																	43316271		2203	4300	6503	SO:0001627	intron_variant	0			AJ008112	CCDS11497.1	17q21.31	2008-05-14	2003-12-02	2003-12-03		ENSG00000184922			1212	protein-coding gene	gene with protein product		604656	"""formin-like"""	C17orf1B, FMNL		9799091	Standard	NM_005892		Approved	C17orf1	uc002iin.3	O95466		ENST00000331495.3:c.970-51G>C	17.37:g.43316271G>C			D2DGW2|Q6DKG5|Q6IBP3|Q86UH1|Q8N671|Q8TDH1|Q96H10	RNA	SNP	-	NULL	ENST00000331495.3	37	NULL	CCDS11497.1	17																																																																																			CTD-2020K17.3	-	-	ENSG00000233175		0.542	FMNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000233175	Clone_based_vega_gene	protein_coding	OTTHUMT00000450198.1	-	0.00	51	0	G	NM_005892		43316271	-1	tier1	-	no_errors	ENST00000587534	ensembl	human	known	74_37	rna	33.33	30	15	SNP	0.000	C
ATP6V1F	9296	genome.wustl.edu	37	7	128502673	128502673	+	5'Flank	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:128502673G>C	ENST00000249289.4	+	0	0				RP11-309L24.2_ENST00000469965.1_RNA|ATP6V1F_ENST00000492758.1_5'Flank	NM_004231.3	NP_004222.2	Q16864	VATF_HUMAN	ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F						ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATPase activity, uncoupled (GO:0042624)|hydrogen ion transmembrane transporter activity (GO:0015078)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			lung(1)|ovary(1)|prostate(1)	3						AGCGCTTGTtgaacgaatgaa	0.552																																																	0																																										SO:0001631	upstream_gene_variant	0			D49400	CCDS5807.1, CCDS56511.1	7q32.1	2010-04-21	2002-08-29		ENSG00000128524	ENSG00000128524	3.6.3.14	"""ATPases / V-type"""	16832	protein-coding gene	gene with protein product		607160				8581736, 8621738	Standard	NM_004231		Approved	ATP6S14, VATF, Vma7	uc022all.1	Q16864	OTTHUMG00000158365		7.37:g.128502673G>C	Exception_encountered		C9J2K4|Q6IBA8	RNA	SNP	-	NULL	ENST00000249289.4	37	NULL	CCDS5807.1	7																																																																																			RP11-309L24.2	-	-	ENSG00000242902		0.552	ATP6V1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000242902	Clone_based_vega_gene	protein_coding	OTTHUMT00000350800.1		0.00	9	0	G	NM_004231		128502673	-1			no_errors	ENST00000469965	ensembl	human	known	74_37	rna	37.50	5	3	SNP	0.000	C
PRKCH	5583	genome.wustl.edu	37	14	61789324	61789324	+	Intron	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr14:61789324C>G	ENST00000332981.5	+	1	748				RP11-902B17.1_ENST00000500036.2_RNA|PRKCH_ENST00000555082.1_5'Flank	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta						blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		TCCACGTGGCCGCGGCACTGG	0.622																																					Melanoma(135;863 1779 8064 14443 26348)												0																																										SO:0001627	intron_variant	0			M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.363+142C>G	14.37:g.61789324C>G			B4DJN5|Q16246|Q8NE03	RNA	SNP	-	NULL	ENST00000332981.5	37	NULL	CCDS9752.1	14																																																																																			RP11-902B17.1	-	-	ENSG00000247287		0.622	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000247287	Clone_based_vega_gene	protein_coding	OTTHUMT00000276974.2	-	0.00	83	0	C	NM_006255		61789324	-1	tier1	-	no_errors	ENST00000500036	ensembl	human	known	74_37	rna	8.16	45	4	SNP	0.736	G
EPHB1	2047	genome.wustl.edu	37	3	134880869	134880869	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:134880869G>C	ENST00000398015.3	+	7	1802	c.1432G>C	c.(1432-1434)Gag>Cag	p.E478Q	EPHB1_ENST00000493838.1_Missense_Mutation_p.E39Q	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	478	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						GGAACACAATGAGTTCAACTC	0.542																																																	0													89.0	94.0	92.0					3																	134880869		2065	4207	6272	SO:0001583	missense	0			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.1432G>C	3.37:g.134880869G>C	ENSP00000381097:p.Glu478Gln		A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.E478Q	ENST00000398015.3	37	c.1432	CCDS46921.1	3	.	.	.	.	.	.	.	.	.	.	G	19.03	3.748316	0.69533	.	.	ENSG00000154928	ENST00000398015;ENST00000493838	T;T	0.58358	0.34;0.34	5.54	5.54	0.83059	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.121832	0.52532	D	0.000068	T	0.60366	0.2263	M	0.82630	2.6	0.80722	D	1	B	0.21225	0.053	B	0.19148	0.024	T	0.58651	-0.7599	10	0.42905	T	0.14	.	19.6787	0.95950	0.0:0.0:1.0:0.0	.	478	P54762	EPHB1_HUMAN	Q	478;39	ENSP00000381097:E478Q;ENSP00000419574:E39Q	ENSP00000381097:E478Q	E	+	1	0	EPHB1	136363559	1.000000	0.71417	0.997000	0.53966	0.947000	0.59692	9.293000	0.96082	2.884000	0.98904	0.655000	0.94253	GAG	EPHB1	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000154928		0.542	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB1	HGNC	protein_coding	OTTHUMT00000357671.1	-	0.00	48	0	G	NM_004441		134880869	+1	tier1	-	no_errors	ENST00000398015	ensembl	human	known	74_37	missense	13.10	73	11	SNP	1.000	C
EPS15L1	58513	genome.wustl.edu	37	19	16552786	16552786	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:16552786G>T	ENST00000248070.6	-	3	221	c.82C>A	c.(82-84)Ccg>Acg	p.P28T	EPS15L1_ENST00000535753.2_Missense_Mutation_p.P28T|EPS15L1_ENST00000455140.2_Missense_Mutation_p.P28T|EPS15L1_ENST00000594975.1_Missense_Mutation_p.P28T|EPS15L1_ENST00000597937.1_Missense_Mutation_p.P28T|CTD-2013N17.4_ENST00000587343.1_RNA	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	28	EH 1. {ECO:0000255|PROSITE- ProRule:PRU00077}.|Interaction with DAB2. {ECO:0000250}.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						GTGTATGCCGGATCGACCTGA	0.507											OREG0025335	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													83.0	86.0	85.0					19																	16552786		2203	4300	6503	SO:0001583	missense	0			AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.82C>A	19.37:g.16552786G>T	ENSP00000248070:p.Pro28Thr	711	A2RRF3|A5PL29|B4DKA3	Missense_Mutation	SNP	superfamily_Prefoldin,smart_EPS15_homology,smart_EF_hand_dom,smart_Ubiquitin-int_motif,pfscan_EF_hand_dom,pfscan_EPS15_homology,pfscan_Ubiquitin-int_motif	p.P28T	ENST00000248070.6	37	c.82	CCDS32944.1	19	.	.	.	.	.	.	.	.	.	.	G	10.63	1.403694	0.25291	.	.	ENSG00000127527	ENST00000455140;ENST00000248070;ENST00000535753	T;T;T	0.32023	1.9;1.89;1.47	5.33	4.29	0.51040	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.43612	0.1255	L	0.51914	1.62	0.80722	D	1	D;P;D;D;D	0.76494	0.999;0.89;0.998;0.996;0.961	D;P;D;D;P	0.75484	0.986;0.596;0.953;0.968;0.835	T	0.32640	-0.9899	10	0.07644	T	0.81	.	13.0458	0.58925	0.0776:0.0:0.9224:0.0	.	28;28;28;28;28	A8K5P4;A5PL29;A2RRF3;Q9UBC2;G3V0H2	.;.;.;EP15R_HUMAN;.	T	28	ENSP00000393313:P28T;ENSP00000248070:P28T;ENSP00000440103:P28T	ENSP00000248070:P28T	P	-	1	0	EPS15L1	16413786	1.000000	0.71417	0.843000	0.33291	0.004000	0.04260	7.276000	0.78559	1.265000	0.44215	0.655000	0.94253	CCG	EPS15L1	-	smart_EPS15_homology,pfscan_EPS15_homology	ENSG00000127527		0.507	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	EPS15L1	HGNC	protein_coding	OTTHUMT00000461040.1	-	0.00	31	0	G	NM_021235		16552786	-1	tier1	-	no_errors	ENST00000455140	ensembl	human	known	74_37	missense	13.16	33	5	SNP	1.000	T
EPS8L2	64787	genome.wustl.edu	37	11	721938	721938	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:721938G>T	ENST00000533256.1	+	12	1306	c.931G>T	c.(931-933)Gag>Tag	p.E311*	EPS8L2_ENST00000526198.1_Nonsense_Mutation_p.E327*|AP006621.9_ENST00000527021.2_RNA|EPS8L2_ENST00000318562.8_Nonsense_Mutation_p.E311*|EPS8L2_ENST00000530636.1_Nonsense_Mutation_p.E311*			Q9H6S3	ES8L2_HUMAN	EPS8-like 2	311					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCCCCCCTCTGAGGGCGAGTT	0.667																																																	0													30.0	28.0	29.0					11																	721938		2196	4294	6490	SO:0001587	stop_gained	0			AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.931G>T	11.37:g.721938G>T	ENSP00000435585:p.Glu311*		B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Nonsense_Mutation	SNP	pfam_PTB,pfam_SH3_domain,pfam_PTB/PI_dom,pfam_SH3_2,superfamily_SH3_domain,superfamily_SAM/pointed,smart_PTB/PI_dom,smart_SH3_domain,pfscan_PTB/PI_dom,pfscan_SH3_domain	p.E311*	ENST00000533256.1	37	c.931	CCDS31328.1	11	.	.	.	.	.	.	.	.	.	.	g	38	7.074577	0.98044	.	.	ENSG00000177106	ENST00000318562;ENST00000533256;ENST00000530636;ENST00000526198	.	.	.	3.43	3.43	0.39272	.	0.341281	0.25151	N	0.032742	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-22.9287	14.1421	0.65327	0.0:0.0:1.0:0.0	.	.	.	.	X	311;311;311;327	.	ENSP00000320828:E311X	E	+	1	0	EPS8L2	711938	1.000000	0.71417	0.262000	0.24481	0.442000	0.32017	6.832000	0.75329	1.934000	0.56057	0.586000	0.80456	GAG	EPS8L2	-	NULL	ENSG00000177106		0.667	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	EPS8L2	HGNC	protein_coding	OTTHUMT00000382344.1	-	0.00	46	0	G	NM_022772		721938	+1	tier1	-	no_errors	ENST00000318562	ensembl	human	known	74_37	nonsense	12.82	34	5	SNP	0.996	T
ERCC6L2	375748	genome.wustl.edu	37	9	98729010	98729010	+	3'UTR	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr9:98729010C>T	ENST00000288985.7	+	0	2452				ERCC6L2_ENST00000437817.1_3'UTR|ERCC6L2_ENST00000466840.1_3'UTR	NM_001010895.2	NP_001010895.1	Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2						DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)										TGAACTTCTTCTCTGACCTTT	0.368																																																	0													71.0	68.0	69.0					9																	98729010		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000288985.7:c.*8C>T	9.37:g.98729010C>T			A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	RNA	SNP	-	NULL	ENST00000288985.7	37	NULL	CCDS35072.1	9																																																																																			ERCC6L2	-	-	ENSG00000182150		0.368	ERCC6L2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ERCC6L2	HGNC	protein_coding	OTTHUMT00000053247.2	-	0.00	77	0	C	NM_001010895		98729010	+1	tier1	-	no_errors	ENST00000466840	ensembl	human	known	74_37	rna	31.25	33	15	SNP	0.000	T
ERVMER34-1	100288413	genome.wustl.edu	37	4	53610238	53610238	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:53610238C>T	ENST00000443173.1	-	3	2310	c.1450G>A	c.(1450-1452)Gga>Aga	p.G484R	ERVMER34-1_ENST00000454756.2_Intron|ERVMER34-1_ENST00000440542.1_Missense_Mutation_p.G484R|ERVMER34-1_ENST00000540758.1_Missense_Mutation_p.G484R	NM_001242690.1	NP_001229619.1	Q9H9K5	MER34_HUMAN	endogenous retrovirus group MER34, member 1	484						integral component of membrane (GO:0016021)|viral envelope (GO:0019031)				endometrium(3)|kidney(1)	4						aaccagtctcccacttttgca	0.398																																																	0													124.0	109.0	113.0					4																	53610238		692	1591	2283	SO:0001583	missense	0					4q12	2011-10-20			ENSG00000226887	ENSG00000226887			42970	other	endogenous retrovirus							Standard	NM_024534		Approved		uc003gzs.3	Q9H9K5	OTTHUMG00000150366	ENST00000443173.1:c.1450G>A	4.37:g.53610238C>T	ENSP00000460602:p.Gly484Arg		B3KTB4|Q0P5R3|Q6NWN0	Missense_Mutation	SNP	pfam_TLV/ENV_coat_polyprotein	p.G484R	ENST00000443173.1	37	c.1450		4																																																																																			ERVMER34-1	-	pfam_TLV/ENV_coat_polyprotein	ENSG00000226887		0.398	ERVMER34-1-002	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	ERVMER34-1	HGNC	protein_coding	OTTHUMT00000317860.2		0.00	34	0	C	NM_024534		53610238	-1			no_errors	ENST00000440542	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.000	T
ESR1	2099	genome.wustl.edu	37	6	152415668	152415668	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:152415668G>T	ENST00000206249.3	+	7	1880	c.1518G>T	c.(1516-1518)caG>caT	p.Q506H	ESR1_ENST00000456483.2_Missense_Mutation_p.Q394H|ESR1_ENST00000406599.1_Missense_Mutation_p.Q245H|ESR1_ENST00000440973.1_Missense_Mutation_p.Q506H|ESR1_ENST00000427531.2_Intron|ESR1_ENST00000443427.1_Missense_Mutation_p.Q506H|ESR1_ENST00000338799.5_Missense_Mutation_p.Q506H	NM_000125.3	NP_000116.2	P03372	ESR1_HUMAN	estrogen receptor 1	506	Interaction with AKAP13.|Self-association.|Steroid-binding.|Transactivation AF-2.				androgen metabolic process (GO:0008209)|antral ovarian follicle growth (GO:0001547)|cellular response to estradiol stimulus (GO:0071392)|chromatin remodeling (GO:0006338)|epithelial cell development (GO:0002064)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|gene expression (GO:0010467)|intracellular estrogen receptor signaling pathway (GO:0030520)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|male gonad development (GO:0008584)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of gene expression (GO:0010629)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcriptionally active chromatin (GO:0035327)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|estrogen-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0038052)|identical protein binding (GO:0042802)|nitric-oxide synthase regulator activity (GO:0030235)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Allylestrenol(DB01431)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Estropipate(DB04574)|Ethinyl Estradiol(DB00977)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Ospemifene(DB04938)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)|Trilostane(DB01108)	GGCTGGCCCAGCTCCTCCTCA	0.562																																																	0													50.0	47.0	48.0					6																	152415668		2203	4300	6503	SO:0001583	missense	0			X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831		"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR		3754034	Standard	NM_000125		Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.1518G>T	6.37:g.152415668G>T	ENSP00000206249:p.Gln506His		Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	Missense_Mutation	SNP	pfam_Oestr_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Oestr_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.Q506H	ENST00000206249.3	37	c.1518	CCDS5234.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.11|14.11	2.438210|2.438210	0.43326|0.43326	.|.	.|.	ENSG00000091831|ENSG00000091831	ENST00000347491|ENST00000440973;ENST00000338799;ENST00000456483;ENST00000443427;ENST00000206249;ENST00000406599;ENST00000431590	.|D;D;D;D;D;D	.|0.96967	.|-4.19;-4.19;-4.19;-4.19;-4.19;-4.19	5.5|5.5	1.74|1.74	0.24563|0.24563	.|Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.95475	.|0.8530	L|L	0.46670|0.46670	1.46|1.46	0.80722|0.80722	D|D	1|1	.|D;B;P;D;B;P;D	.|0.71674	.|0.998;0.011;0.886;0.992;0.126;0.955;0.963	.|D;B;B;P;B;P;P	.|0.87578	.|0.998;0.01;0.279;0.755;0.181;0.815;0.884	.|D	.|0.94201	.|0.7450	.|10	.|0.52906	.|T	.|0.07	.|.	10.4745|10.4745	0.44657|0.44657	0.2634:0.0:0.7366:0.0|0.2634:0.0:0.7366:0.0	.|.	.|71;201;245;433;505;506;506	.|B5LY05;C8CJL6;Q9H2M1;B4E3R5;A8KAF4;G4XH65;P03372	.|.;.;.;.;.;.;ESR1_HUMAN	.|H	-1|506;506;394;506;506;245;434	.|ENSP00000405330:Q506H;ENSP00000342630:Q506H;ENSP00000415934:Q394H;ENSP00000387500:Q506H;ENSP00000206249:Q506H;ENSP00000384064:Q245H	.|ENSP00000206249:Q506H	.|Q	+|+	.|3	.|2	ESR1|ESR1	152457361|152457361	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.621000|2.621000	0.46418|0.46418	0.308000|0.308000	0.22923|0.22923	0.555000|0.555000	0.69702|0.69702	.|CAG	ESR1	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	ENSG00000091831		0.562	ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESR1	HGNC	protein_coding	OTTHUMT00000043308.1	-	0.00	60	0	G			152415668	+1	tier1	-	no_errors	ENST00000206249	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	T
ESRP1	54845	genome.wustl.edu	37	8	95718708	95718708	+	3'UTR	SNP	T	T	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:95718708T>G	ENST00000433389.2	+	0	2827				ESRP1_ENST00000423620.2_3'UTR|ESRP1_ENST00000523347.1_3'UTR|ESRP1_ENST00000454170.2_3'UTR|ESRP1_ENST00000358397.5_3'UTR	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1						mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						TAAAAACAAATTAAATTTTAA	0.289																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.*591T>G	8.37:g.95718708T>G			A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	RNA	SNP	-	NULL	ENST00000433389.2	37	NULL	CCDS47897.1	8																																																																																			ESRP1	-	-	ENSG00000104413		0.289	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ESRP1	HGNC	protein_coding	OTTHUMT00000379326.1	-	0.00	10	0	T	NM_017697		95718708	+1	tier1	-	no_errors	ENST00000523347	ensembl	human	known	74_37	rna	50.00	6	6	SNP	0.000	G
ETV1	2115	genome.wustl.edu	37	7	13950874	13950874	+	Silent	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:13950874G>A	ENST00000430479.1	-	10	1528	c.861C>T	c.(859-861)agC>agT	p.S287S	ETV1_ENST00000476720.2_5'UTR|ETV1_ENST00000403685.1_Silent_p.S269S|ETV1_ENST00000242066.5_Silent_p.S269S|ETV1_ENST00000405192.2_Intron|ETV1_ENST00000405218.2_Silent_p.S287S|ETV1_ENST00000399357.3_Silent_p.S184S|ETV1_ENST00000405358.4_Silent_p.S301S|ETV1_ENST00000403527.1_Silent_p.S247S|ETV1_ENST00000420159.2_Silent_p.S229S|ETV1_ENST00000343495.5_Silent_p.S269S	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	287					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						CTTCTGTTCTGCTGGGATGAG	0.398			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																			Dom	yes		7	7p22	2115	ets variant gene 1		"""M, E"""	0													81.0	80.0	80.0					7																	13950874		1902	4111	6013	SO:0001819	synonymous_variant	0				CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.861C>T	7.37:g.13950874G>A			A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Silent	SNP	pfam_ETS_PEA3_N,pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.S287	ENST00000430479.1	37	c.861	CCDS55088.1	7																																																																																			ETV1	-	pfam_ETS_PEA3_N	ENSG00000006468		0.398	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ETV1	HGNC	protein_coding	OTTHUMT00000326111.1	-	0.00	32	0	G	NM_004956		13950874	-1	tier1	-	no_errors	ENST00000405218	ensembl	human	known	74_37	silent	10.53	34	4	SNP	1.000	A
EWSR1	2130	genome.wustl.edu	37	22	29684675	29684675	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr22:29684675C>T	ENST00000397938.2	+	8	1193	c.874C>T	c.(874-876)Cgg>Tgg	p.R292W	EWSR1_ENST00000333395.6_Missense_Mutation_p.R292W|EWSR1_ENST00000332050.6_Intron|EWSR1_ENST00000406548.1_Missense_Mutation_p.R292W|EWSR1_ENST00000331029.7_Missense_Mutation_p.R292W|EWSR1_ENST00000332035.6_Missense_Mutation_p.R236W|EWSR1_ENST00000414183.2_Missense_Mutation_p.R298W	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	Q01844	EWS_HUMAN	EWS RNA-binding protein 1	292					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						AGGAGAGAACCGGAGCATGAG	0.592			T	"""FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1"""	"""Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma"""																																			Dom	yes		22	22q12	2130	Ewing sarcoma breakpoint region 1 (EWS)		"""L, M"""	0													58.0	53.0	55.0					22																	29684675		2203	4300	6503	SO:0001583	missense	0				CCDS13851.1, CCDS13852.1, CCDS13852.2, CCDS54512.1, CCDS54513.1, CCDS54514.1	22q12.2	2013-05-24	2013-05-24		ENSG00000182944	ENSG00000182944		"""RNA binding motif (RRM) containing"""	3508	protein-coding gene	gene with protein product		133450	"""Ewing sarcoma breakpoint region 1"""			1522903	Standard	NM_005243		Approved	EWS	uc003aev.3	Q01844	OTTHUMG00000151107	ENST00000397938.2:c.874C>T	22.37:g.29684675C>T	ENSP00000381031:p.Arg292Trp		B0QYK1|Q5THL0|Q92635|Q96FE8|Q96MN4|Q96MX4|Q9BWA2	Missense_Mutation	SNP	pfam_Znf_RanBP2,pfam_RRM_dom,smart_RRM_dom,smart_Znf_RanBP2,pfscan_Znf_RanBP2,pfscan_RRM_dom	p.R298W	ENST00000397938.2	37	c.892	CCDS13851.1	22	.	.	.	.	.	.	.	.	.	.	C	14.62	2.588766	0.46110	.	.	ENSG00000182944	ENST00000397938;ENST00000406548;ENST00000331029;ENST00000414183;ENST00000333395;ENST00000332035	T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49	5.94	4.87	0.63330	.	0.000000	0.64402	U	0.000001	T	0.31888	0.0811	L	0.31065	0.9	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999;0.976	P;P;P;P;P;P	0.50082	0.63;0.63;0.63;0.535;0.535;0.489	T	0.01371	-1.1372	10	0.37606	T	0.19	.	15.9667	0.79979	0.1354:0.8646:0.0:0.0	.	236;292;236;298;292;292	Q96MN4;Q96FE8;B0QYK1;Q96MX4;Q01844;Q9BWA2	.;.;.;.;EWS_HUMAN;.	W	292;292;292;298;292;236	ENSP00000381031:R292W;ENSP00000385726:R292W;ENSP00000330516:R292W;ENSP00000400142:R298W;ENSP00000327456:R292W;ENSP00000331699:R236W	ENSP00000330516:R292W	R	+	1	2	EWSR1	28014675	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.399000	0.44495	2.820000	0.97059	0.650000	0.86243	CGG	EWSR1	-	NULL	ENSG00000182944		0.592	EWSR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EWSR1	HGNC	protein_coding	OTTHUMT00000321345.1	-	0.00	80	0	C	NM_005243		29684675	+1	tier1	-	no_errors	ENST00000414183	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
EYS	346007	genome.wustl.edu	37	6	65300411	65300411	+	Missense_Mutation	SNP	A	A	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:65300411A>C	ENST00000370621.3	-	26	5875	c.5349T>G	c.(5347-5349)gaT>gaG	p.D1783E	EYS_ENST00000370616.2_Missense_Mutation_p.D1783E|EYS_ENST00000503581.1_Missense_Mutation_p.D1783E			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1783					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						CTTCTGAAAAATCAGGCACTG	0.373																																																	0													107.0	101.0	103.0					6																	65300411		692	1590	2282	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.5349T>G	6.37:g.65300411A>C	ENSP00000359655:p.Asp1783Glu		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.D1783E	ENST00000370621.3	37	c.5349		6	.	.	.	.	.	.	.	.	.	.	A	11.50	1.656809	0.29425	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.84298	-1.83;-1.8;-1.8	5.87	-2.75	0.05914	.	.	.	.	.	T	0.48677	0.1513	N	0.08118	0	0.09310	N	1	P;B	0.42518	0.782;0.132	B;B	0.39465	0.3;0.051	T	0.50423	-0.8830	9	0.87932	D	0	.	4.3913	0.11341	0.4421:0.0:0.2645:0.2934	.	1783;1783	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	E	1783	ENSP00000424243:D1783E;ENSP00000359655:D1783E;ENSP00000359650:D1783E	ENSP00000359650:D1783E	D	-	3	2	EYS	65357132	0.000000	0.05858	0.000000	0.03702	0.337000	0.28794	0.031000	0.13710	-0.095000	0.12351	0.482000	0.46254	GAT	EYS	-	NULL	ENSG00000188107		0.373	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	-	0.00	18	0	A	XM_294050		65300411	-1	tier1	-	no_errors	ENST00000370616	ensembl	human	known	74_37	missense	17.39	19	4	SNP	0.000	C
FABP3	2170	genome.wustl.edu	37	1	31842415	31842415	+	Intron	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:31842415G>T	ENST00000373713.2	-	2	135				FABP3_ENST00000497275.1_5'UTR	NM_004102.3	NP_004093.1	P05413	FABPH_HUMAN	fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)						cholesterol homeostasis (GO:0042632)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid import (GO:0044539)|negative regulation of cell proliferation (GO:0008285)|phospholipid homeostasis (GO:0055091)|positive regulation of phospholipid biosynthetic process (GO:0071073)|regulation of fatty acid oxidation (GO:0046320)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to insulin (GO:0032868)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasm (GO:0016528)	cytoskeletal protein binding (GO:0008092)|icosatetraenoic acid binding (GO:0050543)|long-chain fatty acid binding (GO:0036041)|long-chain fatty acid transporter activity (GO:0005324)|oleic acid binding (GO:0070538)			large_intestine(1)|lung(2)|ovary(2)	5		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0185)|READ - Rectum adenocarcinoma(331;0.149)		CTGAGGGTAGGGGGAAGGTTA	0.493																																																	0													130.0	114.0	120.0					1																	31842415		2202	4300	6502	SO:0001627	intron_variant	0			U57623	CCDS342.1	1p33-p32	2013-03-01	2003-09-10		ENSG00000121769	ENSG00000121769		"""Fatty acid binding protein family"""	3557	protein-coding gene	gene with protein product		134651	"""fatty acid binding protein 11"""	MDGI, FABP11		8661024	Standard	NM_004102		Approved	H-FABP, O-FABP	uc001bss.1	P05413	OTTHUMG00000003797	ENST00000373713.2:c.74-11C>A	1.37:g.31842415G>T			B2RAB6|Q5VV93|Q99957	RNA	SNP	-	NULL	ENST00000373713.2	37	NULL	CCDS342.1	1																																																																																			FABP3	-	-	ENSG00000121769		0.493	FABP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FABP3	HGNC	protein_coding	OTTHUMT00000010683.1	-	0.00	70	0	G	NM_004102		31842415	-1	tier1	-	no_errors	ENST00000497275	ensembl	human	known	74_37	rna	8.00	46	4	SNP	0.000	T
FAM133A	286499	genome.wustl.edu	37	X	92964880	92964880	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chrX:92964880G>T	ENST00000355813.5	+	4	988	c.462G>T	c.(460-462)aaG>aaT	p.K154N	FAM133A_ENST00000322139.4_Missense_Mutation_p.K154N|FAM133A_ENST00000332647.4_Missense_Mutation_p.K154N|FAM133A_ENST00000538690.1_Missense_Mutation_p.K154N	NM_001171109.1|NM_173698.2	NP_001164580.1|NP_775969.1	Q8N9E0	F133A_HUMAN	family with sequence similarity 133, member A	154	Lys-rich.|Ser-rich.									breast(2)|endometrium(2)|large_intestine(8)|lung(7)|upper_aerodigestive_tract(1)	20						CAGAGAGCAAGGAGTCTGTAA	0.358																																																	0													26.0	23.0	24.0					X																	92964880		2203	4293	6496	SO:0001583	missense	0			AK094978	CCDS14466.1	Xq21.32	2010-05-04			ENSG00000179083	ENSG00000179083			26748	protein-coding gene	gene with protein product	"""cancer/testis antigen 115"""						Standard	NM_173698		Approved	RP1-32F7.2, FLJ37659, CT115	uc022bzv.1	Q8N9E0	OTTHUMG00000021975	ENST00000355813.5:c.462G>T	X.37:g.92964880G>T	ENSP00000348067:p.Lys154Asn			Missense_Mutation	SNP	NULL	p.K154N	ENST00000355813.5	37	c.462	CCDS14466.1	X	.	.	.	.	.	.	.	.	.	.	g	9.879	1.201073	0.22121	.	.	ENSG00000179083	ENST00000538690;ENST00000355813;ENST00000322139;ENST00000332647	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	3.0	0.133	0.14766	.	0.054389	0.64402	U	0.000001	T	0.59445	0.2194	M	0.76002	2.32	0.09310	N	0.999994	D	0.76494	0.999	D	0.78314	0.991	T	0.48875	-0.8996	10	0.44086	T	0.13	-4.8187	5.3997	0.16288	0.4388:0.0:0.5612:0.0	.	154	Q8N9E0	F133A_HUMAN	N	154	ENSP00000441389:K154N;ENSP00000348067:K154N;ENSP00000318974:K154N;ENSP00000362169:K154N	ENSP00000318974:K154N	K	+	3	2	FAM133A	92851536	0.995000	0.38212	0.404000	0.26397	0.907000	0.53573	0.731000	0.26058	-0.095000	0.12351	0.597000	0.82753	AAG	FAM133A	-	NULL	ENSG00000179083		0.358	FAM133A-202	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM133A	HGNC	protein_coding	OTTHUMT00000057452.1	-	0.00	26	0	G	NM_173698		92964880	+1	tier1	-	no_errors	ENST00000322139	ensembl	human	known	74_37	missense	50.00	16	16	SNP	0.386	T
FAM149B1	317662	genome.wustl.edu	37	10	74968483	74968483	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:74968483G>T	ENST00000242505.6	+	6	823	c.649G>T	c.(649-651)Gac>Tac	p.D217Y		NM_173348.1	NP_775483.1	Q96BN6	F149B_HUMAN	family with sequence similarity 149, member B1	217										breast(2)|endometrium(1)|kidney(1)|stomach(3)	7						AGATGAGGAAGACTCTATAAT	0.358																																																	0													105.0	87.0	92.0					10																	74968483		692	1591	2283	SO:0001583	missense	0			AB023191	CCDS44435.1	10q22.2	2008-10-27	2007-11-14	2007-11-14	ENSG00000138286	ENSG00000138286			29162	protein-coding gene	gene with protein product			"""KIAA0974"""	KIAA0974		10231032	Standard	NM_173348		Approved		uc009xqz.3	Q96BN6	OTTHUMG00000067794	ENST00000242505.6:c.649G>T	10.37:g.74968483G>T	ENSP00000242505:p.Asp217Tyr		Q9Y2I0	Missense_Mutation	SNP	pfam_DUF3719	p.D217Y	ENST00000242505.6	37	c.649	CCDS44435.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.41|16.41	3.114685|3.114685	0.56505|0.56505	.|.	.|.	ENSG00000138286|ENSG00000138286	ENST00000242505;ENST00000429173;ENST00000445951|ENST00000372955	T;T|.	0.33216|.	2.57;1.42|.	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	0.481278|.	0.23762|.	N|.	0.044816|.	T|T	0.61540|0.61540	0.2355|0.2355	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	D;D;P;D|.	0.56746|.	0.976;0.977;0.933;0.96|.	P;P;P;P|.	0.56648|.	0.74;0.803;0.542;0.731|.	T|T	0.58775|0.58775	-0.7577|-0.7577	10|5	0.87932|.	D|.	0|.	-7.1619|-7.1619	14.0157|14.0157	0.64523|0.64523	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	195;7;217;217|.	B4E0M2;B3KN32;Q96BN6;Q96BN6-2|.	.;.;F149B_HUMAN;.|.	Y|N	217;7;12|157	ENSP00000242505:D217Y;ENSP00000402293:D12Y|.	ENSP00000242505:D217Y|.	D|K	+|+	1|3	0|2	FAM149B1|FAM149B1	74638489|74638489	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.420000|0.420000	0.31355|0.31355	5.790000|5.790000	0.69038|0.69038	2.359000|2.359000	0.80004|0.80004	0.585000|0.585000	0.79938|0.79938	GAC|AAG	FAM149B1	-	NULL	ENSG00000138286		0.358	FAM149B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM149B1	HGNC	protein_coding	OTTHUMT00000145438.1	-	0.00	64	0	G	NM_173348		74968483	+1	tier1	-	no_errors	ENST00000242505	ensembl	human	known	74_37	missense	5.00	75	4	SNP	1.000	T
FAM198B	51313	genome.wustl.edu	37	4	159092457	159092457	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:159092457C>A	ENST00000296530.8	-	2	692	c.71G>T	c.(70-72)cGt>cTt	p.R24L	RP11-597D13.9_ENST00000514381.1_RNA|FAM198B_ENST00000585682.1_Missense_Mutation_p.R24L|RP11-597D13.9_ENST00000503611.1_RNA|FAM198B_ENST00000589306.1_Intron|FAM198B_ENST00000393807.5_Missense_Mutation_p.R24L|RP11-597D13.9_ENST00000509463.1_RNA|FAM198B_ENST00000592057.1_Missense_Mutation_p.R24L|RP11-597D13.9_ENST00000505532.1_RNA	NM_016613.6	NP_057697.2	Q6UWH4	F198B_HUMAN	family with sequence similarity 198, member B	24						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(14)|skin(2)|urinary_tract(1)	26						CCAGAGCTTACGCACCCGCGG	0.612																																																	0													40.0	41.0	41.0					4																	159092457		2202	4298	6500	SO:0001583	missense	0				CCDS3798.1, CCDS34087.1	4q32.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000164125	ENSG00000164125			25312	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 18"""	C4orf18		12975309	Standard	NM_001031700		Approved	FLJ38155, DKFZp434L142	uc003ipr.4	Q6UWH4	OTTHUMG00000161537	ENST00000296530.8:c.71G>T	4.37:g.159092457C>A	ENSP00000296530:p.Arg24Leu		Q498Z3|Q6IAF9|Q6ZMF2|Q86XL0	Missense_Mutation	SNP	NULL	p.R24L	ENST00000296530.8	37	c.71	CCDS3798.1	4	.	.	.	.	.	.	.	.	.	.	C	9.123	1.009411	0.19277	.	.	ENSG00000164125	ENST00000337222;ENST00000296530;ENST00000393807;ENST00000417442	T;T	0.26660	1.72;1.72	5.31	3.43	0.39272	.	0.859428	0.10447	N	0.673587	T	0.10035	0.0246	N	0.03324	-0.35	0.09310	N	1	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.32877	-0.9890	10	0.15952	T	0.53	-1.2195	5.4491	0.16552	0.1827:0.6222:0.1142:0.081	.	24;24;24	Q6UWH4-3;Q6UWH4-2;Q6UWH4	.;.;F198B_HUMAN	L	24	ENSP00000296530:R24L;ENSP00000377396:R24L	ENSP00000296530:R24L	R	-	2	0	FAM198B	159311907	0.098000	0.21812	0.002000	0.10522	0.549000	0.35272	1.234000	0.32660	1.458000	0.47871	0.655000	0.94253	CGT	FAM198B	-	NULL	ENSG00000164125		0.612	FAM198B-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM198B	HGNC	protein_coding	OTTHUMT00000365230.1	-	0.00	20	0	C	NM_001031700, NM_016613		159092457	-1	tier1	-	no_errors	ENST00000393807	ensembl	human	known	74_37	missense	45.45	11	10	SNP	0.000	A
FAM92A1	137392	genome.wustl.edu	37	8	94738686	94738686	+	Nonsense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:94738686C>G	ENST00000518322.1	+	8	863	c.722C>G	c.(721-723)tCa>tGa	p.S241*	FAM92A1_ENST00000519679.1_Nonsense_Mutation_p.S86*|FAM92A1_ENST00000520363.1_3'UTR|FAM92A1_ENST00000423990.2_Nonsense_Mutation_p.S203*|FAM92A1_ENST00000517718.1_Nonsense_Mutation_p.S86*	NM_145269.3	NP_660312.2	A1XBS5	F92A1_HUMAN	family with sequence similarity 92, member A1	241										NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)	7	Breast(36;2.4e-06)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			AGAGCAAATTCAAAGTCACCT	0.373																																																	0													84.0	78.0	79.0					8																	94738686		1877	4111	5988	SO:0001587	stop_gained	0				CCDS47892.1, CCDS64933.1	8q22.1	2005-09-22			ENSG00000188343	ENSG00000188343			30452	protein-coding gene	gene with protein product						12477932	Standard	XM_005250783		Approved	FLJ38979	uc022ayd.1	A1XBS5	OTTHUMG00000164238	ENST00000518322.1:c.722C>G	8.37:g.94738686C>G	ENSP00000429367:p.Ser241*		A1XBS4|Q32ND3|Q6AHW7|Q8N8R1|Q96L09	Nonsense_Mutation	SNP	pfam_FAM92	p.S241*	ENST00000518322.1	37	c.722	CCDS47892.1	8	.	.	.	.	.	.	.	.	.	.	C	26.3	4.723947	0.89298	.	.	ENSG00000188343	ENST00000518322;ENST00000423990;ENST00000436526;ENST00000341186;ENST00000517718;ENST00000521641;ENST00000519679	.	.	.	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-14.5878	19.7622	0.96325	0.0:1.0:0.0:0.0	.	.	.	.	X	241;203;203;241;86;86;86	.	ENSP00000341363:S241X	S	+	2	0	FAM92A1	94807862	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.604000	0.61112	2.732000	0.93576	0.650000	0.86243	TCA	FAM92A1	-	NULL	ENSG00000188343		0.373	FAM92A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM92A1	HGNC	protein_coding	OTTHUMT00000377890.4	-	0.00	63	0	C	NM_145269		94738686	+1	tier1	-	no_errors	ENST00000518322	ensembl	human	known	74_37	nonsense	30.36	39	17	SNP	1.000	G
FAM95B1	100133036	genome.wustl.edu	37	9	42472104	42472104	+	Intron	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr9:42472104C>T	ENST00000421686.2	+	11	1457				FAM95B1_ENST00000592873.1_RNA																							GTGGTTCTGCCCATTGCTGGA	0.542																																																	0																																										SO:0001627	intron_variant	0																														ENST00000421686.2:c.224-1832C>T	9.37:g.42472104C>T				RNA	SNP	-	NULL	ENST00000421686.2	37	NULL		9																																																																																			FAM95B1	-	-	ENSG00000223839		0.542	RP11-146D12.2-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	FAM95B1	HGNC	protein_coding	OTTHUMT00000129789.5	-	0.00	127	0	C			42472104	+1	tier1	-	no_errors	ENST00000592873	ensembl	human	known	74_37	rna	7.78	82	7	SNP	0.012	T
FANK1	92565	genome.wustl.edu	37	10	127693454	127693454	+	Splice_Site	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:127693454C>G	ENST00000368693.1	+	7	645	c.541C>G	c.(541-543)Cta>Gta	p.L181V	FANK1_ENST00000477963.1_3'UTR|FANK1_ENST00000368695.1_Splice_Site_p.L175V			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	181						cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				ATGTTGCAGTCTAATGCTGGC	0.483																																																	0													127.0	118.0	121.0					10																	127693454		2203	4300	6503	SO:0001630	splice_region_variant	0			BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.540-1C>G	10.37:g.127693454C>G			Q6UXY9|Q6X7T6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Fibronectin_type3,prints_Ankyrin_rpt	p.L181V	ENST00000368693.1	37	c.541	CCDS31309.1	10	.	.	.	.	.	.	.	.	.	.	C	16.97	3.269557	0.59540	.	.	ENSG00000203780	ENST00000368695;ENST00000368693;ENST00000368691;ENST00000368692	D;D;T	0.81739	-1.53;-1.53;-0.55	5.79	3.95	0.45737	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000018	D	0.89417	0.6709	M	0.86805	2.84	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.87578	0.993;0.99;0.998	D	0.89163	0.3531	10	0.87932	D	0	-16.0681	9.415	0.38517	0.0:0.7713:0.0:0.2287	.	207;181;181	Q8TC84-3;Q8TC84-2;Q8TC84	.;.;FANK1_HUMAN	V	175;181;159;207	ENSP00000357684:L175V;ENSP00000357682:L181V;ENSP00000357680:L159V	ENSP00000357680:L159V	L	+	1	2	FANK1	127683444	0.997000	0.39634	0.852000	0.33557	0.796000	0.44982	1.977000	0.40589	0.798000	0.33994	0.655000	0.94253	CTA	FANK1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000203780		0.483	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FANK1	HGNC	protein_coding		-	0.00	111	0	C	NM_145235	Missense_Mutation	127693454	+1	tier1	-	no_errors	ENST00000368693	ensembl	human	known	74_37	missense	25.60	93	32	SNP	0.992	G
FAT1	2195	genome.wustl.edu	37	4	187549722	187549722	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:187549722G>T	ENST00000441802.2	-	8	4728	c.4519C>A	c.(4519-4521)Ctt>Att	p.L1507I		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1507	Cadherin 13. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GCAGGATCAAGACGAAATTTC	0.463										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0													121.0	116.0	118.0					4																	187549722		1896	4105	6001	SO:0001583	missense	0			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.4519C>A	4.37:g.187549722G>T	ENSP00000406229:p.Leu1507Ile			Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.L1507I	ENST00000441802.2	37	c.4519	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	G	11.22	1.573096	0.28092	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.33865	1.39	5.45	5.45	0.79879	Cadherin (4);Cadherin-like (1);	0.126726	0.53938	D	0.000059	T	0.28665	0.0710	N	0.04994	-0.135	0.52099	D	0.999949	D	0.55385	0.971	P	0.58077	0.832	T	0.05666	-1.0871	10	0.05436	T	0.98	.	14.3996	0.67034	0.0:0.0:0.8526:0.1474	.	1507	Q14517	FAT1_HUMAN	I	1507	ENSP00000406229:L1507I	ENSP00000260147:L1507I	L	-	1	0	FAT1	187786716	1.000000	0.71417	0.986000	0.45419	0.774000	0.43823	4.487000	0.60293	2.861000	0.98227	0.650000	0.86243	CTT	FAT1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000083857		0.463	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3	-	0.00	44	0	G	NM_005245		187549722	-1	tier1	-	no_errors	ENST00000441802	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.989	T
FBXO18	84893	genome.wustl.edu	37	10	5965761	5965761	+	Intron	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:5965761G>T	ENST00000362091.4	+	16	2513				FBXO18_ENST00000379999.5_Intron|FBXO18_ENST00000397269.3_Intron	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18						DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						TTTCCCTCCAGAGAAGGGCGA	0.567																																																	0																																										SO:0001627	intron_variant	0			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.2398+102G>T	10.37:g.5965761G>T			Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	RNA	SNP	-	NULL	ENST00000362091.4	37	NULL	CCDS7072.1	10																																																																																			FBXO18	-	-	ENSG00000134452		0.567	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO18	HGNC	protein_coding	OTTHUMT00000046596.1	-	0.00	19	0	G	NM_032807		5965761	+1	tier1	-	no_errors	ENST00000475867	ensembl	human	known	74_37	rna	20.00	12	3	SNP	0.017	T
FBXO22	26263	genome.wustl.edu	37	15	76222260	76222260	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:76222260G>T	ENST00000308275.3	+	6	769	c.664G>T	c.(664-666)Gtc>Ttc	p.V222F	FBXO22_ENST00000453211.2_Missense_Mutation_p.V222F|FBXO22_ENST00000540507.1_Missense_Mutation_p.V118F	NM_147188.2	NP_671717.1	Q8NEZ5	FBX22_HUMAN	F-box protein 22	222					cellular protein modification process (GO:0006464)|cellular response to starvation (GO:0009267)|nucleocytoplasmic transport (GO:0006913)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein polyubiquitination (GO:0000209)|regulation of skeletal muscle fiber development (GO:0048742)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						TGTGGTCCTTGTCTTTGGTTA	0.403																																																	0													195.0	172.0	180.0					15																	76222260		2197	4294	6491	SO:0001583	missense	0			AF174602	CCDS10287.1, CCDS45310.1	15q23	2008-10-03	2004-06-15		ENSG00000167196	ENSG00000167196		"""F-boxes /  ""other"""""	13593	protein-coding gene	gene with protein product	"""FIST domain containing 1"""	609096	"""F-box only protein 22"""			10531035, 10531037, 17855421	Standard	NM_147188		Approved	FBX22, FISTC1	uc002bbk.3	Q8NEZ5	OTTHUMG00000142841	ENST00000308275.3:c.664G>T	15.37:g.76222260G>T	ENSP00000307833:p.Val222Phe		Q0D2P8|Q6PIL5|Q8IXW3|Q9H824|Q9UKC0	Missense_Mutation	SNP	pfam_FIST_C_domain,pfam_F-box_dom,superfamily_F-box_dom	p.V222F	ENST00000308275.3	37	c.664	CCDS10287.1	15	.	.	.	.	.	.	.	.	.	.	G	13.45	2.240062	0.39598	.	.	ENSG00000167196	ENST00000308275;ENST00000453211;ENST00000540507	.	.	.	4.97	1.89	0.25635	.	0.428628	0.24154	N	0.041055	T	0.30355	0.0762	N	0.19112	0.55	0.24607	N	0.993742	P;P	0.51351	0.868;0.944	B;P	0.53722	0.23;0.733	T	0.05666	-1.0871	9	0.62326	D	0.03	-24.0953	5.794	0.18377	0.2713:0.1574:0.5713:0.0	.	222;222	Q8NEZ5;Q8NEZ5-3	FBX22_HUMAN;.	F	222;222;118	.	ENSP00000307833:V222F	V	+	1	0	FBXO22	74009315	0.862000	0.29867	0.824000	0.32777	0.995000	0.86356	0.682000	0.25335	0.710000	0.31997	-0.145000	0.13849	GTC	FBXO22	-	NULL	ENSG00000167196		0.403	FBXO22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO22	HGNC	protein_coding	OTTHUMT00000286477.2	-	0.00	51	0	G	NM_147188		76222260	+1	tier1	-	no_errors	ENST00000308275	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.249	T
FBXW8	26259	genome.wustl.edu	37	12	117461965	117461965	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:117461965G>T	ENST00000309909.5	+	9	1463	c.1381G>T	c.(1381-1383)Gac>Tac	p.D461Y	FBXW8_ENST00000455858.2_Missense_Mutation_p.D395Y			Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8	461					cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|labyrinthine layer blood vessel development (GO:0060716)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|spongiotrophoblast layer development (GO:0060712)	Cul7-RING ubiquitin ligase complex (GO:0031467)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)				endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	22	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)		GAGGATCCACGACCTCCGCAG	0.577																																																	0													101.0	84.0	90.0					12																	117461965		2203	4300	6503	SO:0001583	missense	0			AF176707	CCDS9182.1, CCDS44988.1	12q24.23	2013-01-09	2007-02-08	2003-06-13				"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13597	protein-coding gene	gene with protein product		609073	"""F-box only protein 29"", ""F-box and WD-40 domain protein 8"""	FBXO29		10531035, 10531037	Standard	NM_012174		Approved	FBX29, FBW6, FBW8	uc001twg.1	Q8N3Y1	OTTHUMG00000169329	ENST00000309909.5:c.1381G>T	12.37:g.117461965G>T	ENSP00000310686:p.Asp461Tyr		Q9UK95	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom,superfamily_Quinonprotein_ADH-like_supfam,superfamily_F-box_dom,smart_F-box_dom,smart_WD40_repeat,pfscan_F-box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D461Y	ENST00000309909.5	37	c.1381	CCDS9182.1	12	.	.	.	.	.	.	.	.	.	.	G	18.05	3.536578	0.65085	.	.	ENSG00000174989	ENST00000309909;ENST00000455858;ENST00000505227	T;T	0.13538	2.58;2.58	5.61	5.61	0.85477	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.045370	0.85682	D	0.000000	T	0.42426	0.1202	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.995	T	0.26155	-1.0111	10	0.87932	D	0	-34.3959	19.5968	0.95544	0.0:0.0:1.0:0.0	.	461;395	Q8N3Y1;Q8N3Y1-2	FBXW8_HUMAN;.	Y	461;395;395	ENSP00000310686:D461Y;ENSP00000389144:D395Y	ENSP00000310686:D461Y	D	+	1	0	FBXW8	115946348	1.000000	0.71417	0.992000	0.48379	0.233000	0.25261	8.300000	0.89948	2.793000	0.96121	0.655000	0.94253	GAC	FBXW8	-	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000174989		0.577	FBXW8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW8	HGNC	protein_coding	OTTHUMT00000403561.1	-	0.00	98	0	G	NM_012174		117461965	+1	tier1	-	no_errors	ENST00000309909	ensembl	human	known	74_37	missense	5.00	95	5	SNP	1.000	T
FCRL3	115352	genome.wustl.edu	37	1	157660306	157660306	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:157660306C>T	ENST00000368184.3	-	9	1720	c.1429G>A	c.(1429-1431)Gtc>Atc	p.V477I	FCRL3_ENST00000473231.1_5'UTR|RP11-367J7.3_ENST00000453692.1_RNA|FCRL3_ENST00000368186.5_Missense_Mutation_p.V477I	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	477	Ig-like C2-type 6.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					AGGGTGAGGACGGGGCGAGAC	0.532																																																	0													39.0	43.0	41.0					1																	157660306		2203	4300	6503	SO:0001583	missense	0			AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.1429G>A	1.37:g.157660306C>T	ENSP00000357167:p.Val477Ile		A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.V483I	ENST00000368184.3	37	c.1447	CCDS1167.1	1	.	.	.	.	.	.	.	.	.	.	.	1.293	-0.607156	0.03717	.	.	ENSG00000160856	ENST00000368186;ENST00000368184;ENST00000292392	T;T	0.03496	3.91;3.91	4.47	-2.61	0.06171	Immunoglobulin-like (1);	0.419149	0.16957	N	0.192663	T	0.01421	0.0046	L	0.45285	1.41	0.09310	N	1	B;B;B	0.31125	0.309;0.029;0.263	B;B;B	0.41374	0.355;0.022;0.102	T	0.43798	-0.9369	10	0.27785	T	0.31	.	6.9603	0.24593	0.0:0.6024:0.2526:0.145	.	477;382;477	Q96P31;D3DVD1;Q96P31-6	FCRL3_HUMAN;.;.	I	477	ENSP00000357169:V477I;ENSP00000357167:V477I	ENSP00000292392:V477I	V	-	1	0	FCRL3	155926930	0.065000	0.20965	0.010000	0.14722	0.002000	0.02628	-0.713000	0.05007	-0.594000	0.05836	-2.048000	0.00412	GTC	FCRL3	-	pfscan_Ig-like_dom	ENSG00000160856		0.532	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	FCRL3	HGNC	protein_coding	OTTHUMT00000051419.2		0.00	29	0	C	NM_052939		157660306	-1			no_errors	ENST00000492769	ensembl	human	known	74_37	missense	8.57	32	3	SNP	0.004	T
FGF23	8074	genome.wustl.edu	37	12	4488592	4488592	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:4488592G>T	ENST00000237837.1	-	1	302	c.157C>A	c.(157-159)Ctg>Atg	p.L53M		NM_020638.2	NP_065689.1	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23	53					cell differentiation (GO:0030154)|cellular phosphate ion homeostasis (GO:0030643)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bone mineralization (GO:0030502)|negative regulation of hormone secretion (GO:0046888)|negative regulation of osteoblast differentiation (GO:0045668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphate ion homeostasis (GO:0055062)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of phosphate transport (GO:0010966)|vitamin D catabolic process (GO:0042369)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	22			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			TGGATCTGCAGGTGGTAGCTG	0.597																																																	0													185.0	139.0	155.0					12																	4488592		2203	4300	6503	SO:0001583	missense	0			AF263537	CCDS8526.1	12p13	2008-07-04			ENSG00000118972	ENSG00000118972			3680	protein-coding gene	gene with protein product		605380				11032749, 18310961	Standard	NM_020638		Approved		uc001qmq.1	Q9GZV9	OTTHUMG00000168241	ENST00000237837.1:c.157C>A	12.37:g.4488592G>T	ENSP00000237837:p.Leu53Met		Q4V758	Missense_Mutation	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	p.L53M	ENST00000237837.1	37	c.157	CCDS8526.1	12	.	.	.	.	.	.	.	.	.	.	G	19.70	3.876792	0.72180	.	.	ENSG00000118972	ENST00000237837	D	0.93426	-3.22	3.96	3.96	0.45880	.	0.000000	0.64402	D	0.000001	D	0.97081	0.9046	M	0.89478	3.035	0.54753	D	0.999987	D	0.89917	1.0	D	0.97110	1.0	D	0.97767	1.0224	10	0.72032	D	0.01	-8.8019	17.3281	0.87255	0.0:0.0:1.0:0.0	.	53	Q9GZV9	FGF23_HUMAN	M	53	ENSP00000237837:L53M	ENSP00000237837:L53M	L	-	1	2	FGF23	4358853	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.751000	0.62169	2.496000	0.84212	0.655000	0.94253	CTG	FGF23	-	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam	ENSG00000118972		0.597	FGF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF23	HGNC	protein_coding	OTTHUMT00000398936.1	-	0.00	38	0	G			4488592	-1	tier1	-	no_errors	ENST00000237837	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
FHL1	2273	genome.wustl.edu	37	X	135291420	135291420	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chrX:135291420G>A	ENST00000345434.3	+	6	788	c.707G>A	c.(706-708)aGa>aAa	p.R236K	FHL1_ENST00000370676.3_Intron|FHL1_ENST00000394153.2_Intron|FHL1_ENST00000543669.1_Intron|FHL1_ENST00000539015.1_Intron|FHL1_ENST00000370683.1_Intron|FHL1_ENST00000370690.3_Intron|FHL1_ENST00000394155.2_Missense_Mutation_p.R236K|FHL1_ENST00000535737.1_Intron			Q13642	FHL1_HUMAN	four and a half LIM domains 1	236					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|organ morphogenesis (GO:0009887)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane depolarization (GO:0003254)|regulation of potassium ion transmembrane transporter activity (GO:1901016)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel binding (GO:0044325)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(192;0.000127)					ACTGTGTCAAGAGTGAGCCAC	0.557											OREG0019943	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													52.0	47.0	48.0					X																	135291420		1568	3582	5150	SO:0001583	missense	0			U60115	CCDS14655.1, CCDS55505.1, CCDS55506.1, CCDS55507.1, CCDS76036.1	Xq26.3	2014-09-17			ENSG00000022267	ENSG00000022267			3702	protein-coding gene	gene with protein product	"""Four-and-a-half LIM domains 1"", ""LIM protein SLIMMER"""	300163				8753811, 9714789	Standard	NM_001449		Approved	SLIM1, KYO-T, bA535K18.1, FHL1B, XMPMA, FLH1A, MGC111107	uc004ezo.3	Q13642	OTTHUMG00000022504	ENST00000345434.3:c.707G>A	X.37:g.135291420G>A	ENSP00000071281:p.Arg236Lys	1617	B7Z5T4|B7Z793|O95212|Q13230|Q13645|Q5JXI7|Q5M7Y6|Q6IB30|Q9NZ40|Q9UKZ8|Q9Y630	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.R236K	ENST00000345434.3	37	c.707	CCDS55507.1	X	.	.	.	.	.	.	.	.	.	.	g	10.86	1.468610	0.26335	.	.	ENSG00000022267	ENST00000394155;ENST00000345434	T;T	0.63255	-0.03;-0.03	3.85	3.85	0.44370	.	0.336378	0.37761	N	0.001941	T	0.33990	0.0882	N	0.08118	0	0.24455	N	0.99447	B	0.02656	0.0	B	0.04013	0.001	T	0.16837	-1.0389	10	0.02654	T	1	.	10.3036	0.43667	0.0:0.0:1.0:0.0	.	236	Q13642	FHL1_HUMAN	K	236	ENSP00000377710:R236K;ENSP00000071281:R236K	ENSP00000071281:R236K	R	+	2	0	FHL1	135119086	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.800000	0.55537	2.187000	0.69744	0.421000	0.28195	AGA	FHL1	-	NULL	ENSG00000022267		0.557	FHL1-002	KNOWN	basic|CCDS	protein_coding	FHL1	HGNC	protein_coding	OTTHUMT00000058461.1	-	0.00	16	0	G	NM_001449		135291420	+1	tier1	-	no_errors	ENST00000345434	ensembl	human	known	74_37	missense	57.14	3	4	SNP	1.000	A
FIG4	9896	genome.wustl.edu	37	6	110112718	110112718	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:110112718C>T	ENST00000230124.3	+	20	2444	c.2320C>T	c.(2320-2322)Cag>Tag	p.Q774*	FIG4_ENST00000441478.2_Nonsense_Mutation_p.Q497*	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	774					cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		CTCTGTGTCTCAGCGCTCCAC	0.642																																																	0													57.0	58.0	58.0					6																	110112718		2203	4300	6503	SO:0001587	stop_gained	0			D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.2320C>T	6.37:g.110112718C>T	ENSP00000230124:p.Gln774*		Q53H49|Q5TCS6	Nonsense_Mutation	SNP	pfam_Syja_N,pfscan_Syja_N	p.Q774*	ENST00000230124.3	37	c.2320	CCDS5078.1	6	.	.	.	.	.	.	.	.	.	.	C	40	8.213125	0.98709	.	.	ENSG00000112367	ENST00000441478;ENST00000230124;ENST00000419951	.	.	.	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-18.3716	20.2187	0.98312	0.0:1.0:0.0:0.0	.	.	.	.	X	497;774;81	.	ENSP00000230124:Q774X	Q	+	1	0	FIG4	110219411	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.780000	0.95670	0.655000	0.94253	CAG	FIG4	-	NULL	ENSG00000112367		0.642	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIG4	HGNC	protein_coding	OTTHUMT00000041768.1	-	0.00	20	0	C	NM_014845		110112718	+1	tier1	-	no_errors	ENST00000230124	ensembl	human	known	74_37	nonsense	21.74	18	5	SNP	1.000	T
FMNL2	114793	genome.wustl.edu	37	2	153488536	153488536	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:153488536G>T	ENST00000475377.2	+	8	890	c.690G>T	c.(688-690)aaG>aaT	p.K230N	FMNL2_ENST00000288670.9_Missense_Mutation_p.K855N			Q96PY5	FMNL2_HUMAN	formin-like 2	855	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						TAGATACAAAGTCAACAGACA	0.408																																																	0													94.0	87.0	90.0					2																	153488536		1892	4120	6012	SO:0001583	missense	0			AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000475377.2:c.690G>T	2.37:g.153488536G>T	ENSP00000418959:p.Lys230Asn		B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin,prints_Wilms_tumour	p.K855N	ENST00000475377.2	37	c.2565		2	.	.	.	.	.	.	.	.	.	.	G	15.43	2.832521	0.50845	.	.	ENSG00000157827	ENST00000288670;ENST00000421344;ENST00000475377	T;T	0.44482	0.92;0.92	5.83	3.08	0.35506	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	T	0.71056	0.3295	H	0.95645	3.7	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.97110	0.997;1.0;0.999	T	0.75900	-0.3154	10	0.87932	D	0	.	9.5857	0.39514	0.2757:0.0:0.7243:0.0	.	855;336;855	Q96PY5;Q6ZN96;Q96PY5-3	FMNL2_HUMAN;.;.	N	855;336;230	ENSP00000288670:K855N;ENSP00000418959:K230N	ENSP00000288670:K855N	K	+	3	2	FMNL2	153196782	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.000000	0.57039	0.821000	0.34540	0.655000	0.94253	AAG	FMNL2	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000157827		0.408	FMNL2-002	NOVEL	basic|exp_conf	protein_coding	FMNL2	HGNC	protein_coding	OTTHUMT00000333583.3	-	0.00	57	0	G	NM_052905		153488536	+1	tier1	-	no_errors	ENST00000288670	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
FMO3	2328	genome.wustl.edu	37	1	171086431	171086431	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:171086431G>T	ENST00000367755.4	+	9	1559	c.1448G>T	c.(1447-1449)aGa>aTa	p.R483I	FMO3_ENST00000392085.2_Missense_Mutation_p.R483I|FMO3_ENST00000538429.1_Missense_Mutation_p.R420I|FMO3_ENST00000542847.1_Missense_Mutation_p.R463I	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	483					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)			endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	CCAGGAGCCAGAAATGCCATA	0.532																																																	0													99.0	91.0	94.0					1																	171086431		2203	4300	6503	SO:0001583	missense	0			BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.1448G>T	1.37:g.171086431G>T	ENSP00000356729:p.Arg483Ile		B2R816|Q14854|Q8N5N5	Missense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_3,prints_Flavin_mOase_1,prints_Flavin_mOase_2	p.R483I	ENST00000367755.4	37	c.1448	CCDS1292.1	1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.516917	0.85495	.	.	ENSG00000007933	ENST00000367755;ENST00000392085;ENST00000542847;ENST00000538429	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.36	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.80914	0.4715	H	0.94925	3.6	0.58432	D	0.999999	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.78314	0.964;0.991;0.991	D	0.86992	0.2111	10	0.87932	D	0	-9.8315	14.7305	0.69377	0.0:0.0:0.8538:0.1462	.	420;463;483	F5H261;F5GZZ8;P31513	.;.;FMO3_HUMAN	I	483;483;463;420	ENSP00000356729:R483I;ENSP00000375935:R483I;ENSP00000444073:R463I;ENSP00000439500:R420I	ENSP00000356729:R483I	R	+	2	0	FMO3	169353055	0.993000	0.37304	0.798000	0.32154	0.996000	0.88848	5.307000	0.65762	1.183000	0.42943	0.655000	0.94253	AGA	FMO3	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase	ENSG00000007933		0.532	FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO3	HGNC	protein_coding	OTTHUMT00000086219.1		0.00	49	0	G	NM_006894		171086431	+1			no_errors	ENST00000367755	ensembl	human	known	74_37	missense	5.88	48	3	SNP	0.974	T
FMO4	2329	genome.wustl.edu	37	1	171303853	171303853	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:171303853C>G	ENST00000367749.3	+	8	1461	c.1131C>G	c.(1129-1131)atC>atG	p.I377M		NM_002022.1	NP_002013.1	P31512	FMO4_HUMAN	flavin containing monooxygenase 4	377					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					AAGGATCCATCTTATCAGGCA	0.438																																					Pancreas(24;816 862 7754 7993 32832)												0													66.0	66.0	66.0					1																	171303853		2203	4300	6503	SO:0001583	missense	0			BC002780	CCDS1295.1	1q24.3	2011-08-04			ENSG00000076258	ENSG00000076258	1.14.13.8		3772	protein-coding gene	gene with protein product		136131		FMO2		8311461	Standard	NM_002022		Approved		uc001gho.3	P31512	OTTHUMG00000035506	ENST00000367749.3:c.1131C>G	1.37:g.171303853C>G	ENSP00000356723:p.Ile377Met		Q53XR0	Missense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_4,prints_Flavin_mOase_1,prints_Flavin_mOase_3	p.I377M	ENST00000367749.3	37	c.1131	CCDS1295.1	1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.827668	0.32329	.	.	ENSG00000076258	ENST00000367749	T	0.57752	0.38	5.53	3.68	0.42216	.	0.108661	0.64402	D	0.000010	T	0.56108	0.1963	M	0.82132	2.575	0.41159	D	0.986083	P	0.47604	0.898	P	0.61722	0.893	T	0.59888	-0.7369	10	0.52906	T	0.07	-16.0574	5.9123	0.19035	0.136:0.6428:0.0:0.2212	.	377	P31512	FMO4_HUMAN	M	377	ENSP00000356723:I377M	ENSP00000356723:I377M	I	+	3	3	FMO4	169570477	0.924000	0.31332	0.739000	0.30968	0.330000	0.28571	0.124000	0.15728	0.704000	0.31869	0.585000	0.79938	ATC	FMO4	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase	ENSG00000076258		0.438	FMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO4	HGNC	protein_coding	OTTHUMT00000086223.1	-	0.00	21	0	C	NM_002022		171303853	+1	tier1	-	no_errors	ENST00000367749	ensembl	human	known	74_37	missense	41.18	20	14	SNP	0.774	G
FRMD4A	55691	genome.wustl.edu	37	10	13699399	13699399	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:13699399G>C	ENST00000357447.2	-	22	2558	c.2190C>G	c.(2188-2190)ttC>ttG	p.F730L	FRMD4A_ENST00000358621.4_Missense_Mutation_p.F715L|FRMD4A_ENST00000378503.1_Missense_Mutation_p.F730L	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	730	Ser-rich.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						GCGGGGTGTAGAAGTCGGGGC	0.652																																																	0													37.0	35.0	36.0					10																	13699399		2203	4300	6503	SO:0001583	missense	0			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.2190C>G	10.37:g.13699399G>C	ENSP00000350032:p.Phe730Leu		A7E2Y3|Q5T377	Missense_Mutation	SNP	pfam_DUF3338,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.F730L	ENST00000357447.2	37	c.2190	CCDS7101.1	10	.	.	.	.	.	.	.	.	.	.	G	14.77	2.634401	0.47049	.	.	ENSG00000151474	ENST00000358621;ENST00000357447;ENST00000378503	D;D;D	0.85556	-1.99;-2.0;-2.0	5.11	4.2	0.49525	.	0.044806	0.85682	D	0.000000	T	0.81123	0.4757	L	0.49126	1.545	0.45227	D	0.99823	B	0.20887	0.049	B	0.22601	0.04	T	0.78585	-0.2147	10	0.44086	T	0.13	-21.5171	12.9763	0.58538	0.0784:0.0:0.9216:0.0	.	730	Q9P2Q2	FRM4A_HUMAN	L	715;730;730	ENSP00000351438:F715L;ENSP00000350032:F730L;ENSP00000367764:F730L	ENSP00000350032:F730L	F	-	3	2	FRMD4A	13739405	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.879000	0.48522	2.353000	0.79882	0.436000	0.28706	TTC	FRMD4A	-	NULL	ENSG00000151474		0.652	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD4A	HGNC	protein_coding	OTTHUMT00000046889.1	-	0.00	27	0	G	NM_018027		13699399	-1	tier1	-	no_errors	ENST00000357447	ensembl	human	known	74_37	missense	32.00	17	8	SNP	1.000	C
FZD6	8323	genome.wustl.edu	37	8	104337100	104337100	+	Missense_Mutation	SNP	G	G	T	rs201820118		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:104337100G>T	ENST00000358755.4	+	4	1083	c.766G>T	c.(766-768)Gat>Tat	p.D256Y	FZD6_ENST00000522566.1_Missense_Mutation_p.D256Y|FZD6_ENST00000523739.1_Missense_Mutation_p.D224Y|FZD6_ENST00000540287.1_Intron	NM_001164616.1|NM_003506.3	NP_001158088.1|NP_003497.2	O60353	FZD6_HUMAN	frizzled class receptor 6	256					angiogenesis (GO:0001525)|axonogenesis (GO:0007409)|cell proliferation in midbrain (GO:0033278)|embryonic nail plate morphogenesis (GO:0035880)|establishment of planar polarity (GO:0001736)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|platelet activation (GO:0030168)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(57;2.86e-05)|STAD - Stomach adenocarcinoma(118;0.197)			TTTGCTAGGCGATAGCACAGC	0.398																																																	0													123.0	106.0	112.0					8																	104337100		2203	4300	6503	SO:0001583	missense	0			AB012911	CCDS6298.1, CCDS55268.1	8q22.3-q23.1	2014-01-29	2014-01-29		ENSG00000164930	ENSG00000164930		"""GPCR / Class F : Frizzled receptors"""	4044	protein-coding gene	gene with protein product		603409	"""frizzled (Drosophila) homolog 6"", ""frizzled homolog 6 (Drosophila)"", ""frizzled 6, seven transmembrane spanning receptor"", ""frizzled family receptor 6"""			9480858, 14747478	Standard	NM_003506		Approved	Hfz6	uc003ylh.3	O60353	OTTHUMG00000164840	ENST00000358755.4:c.766G>T	8.37:g.104337100G>T	ENSP00000351605:p.Asp256Tyr		B4DRN0|Q6N0A5|Q6P9C3|Q8WXR9	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.D256Y	ENST00000358755.4	37	c.766	CCDS6298.1	8	.	.	.	.	.	.	.	.	.	.	G	14.17	2.454041	0.43634	.	.	ENSG00000164930	ENST00000522566;ENST00000358755;ENST00000523739;ENST00000539487	D;D;D	0.82984	-1.67;-1.67;-1.67	5.5	2.9	0.33743	GPCR, family 2-like (1);	0.196856	0.52532	D	0.000072	D	0.89619	0.6767	M	0.87971	2.92	0.80722	D	1	P;P;P	0.49253	0.921;0.902;0.921	P;P;P	0.59948	0.866;0.759;0.866	D	0.88389	0.3007	10	0.87932	D	0	.	9.0984	0.36653	0.8342:0.0:0.1658:0.0	.	201;256;256	B4E236;B2R9H9;O60353	.;.;FZD6_HUMAN	Y	256;256;224;201	ENSP00000429055:D256Y;ENSP00000351605:D256Y;ENSP00000429528:D224Y	ENSP00000351605:D256Y	D	+	1	0	FZD6	104406276	0.969000	0.33509	0.986000	0.45419	0.776000	0.43924	2.176000	0.42500	0.300000	0.22699	-0.218000	0.12543	GAT	FZD6	-	pfam_Frizzled,pfscan_GPCR_2-like	ENSG00000164930		0.398	FZD6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD6	HGNC	protein_coding	OTTHUMT00000380560.1		0.00	44	0	G	NM_003506		104337100	+1			no_errors	ENST00000358755	ensembl	human	known	74_37	missense	5.88	48	3	SNP	0.987	T
GABRA2	2555	genome.wustl.edu	37	4	46252361	46252361	+	Nonsense_Mutation	SNP	A	A	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:46252361A>C	ENST00000510861.1	-	10	1493	c.1320T>G	c.(1318-1320)taT>taG	p.Y440*	GABRA2_ENST00000540012.1_Nonsense_Mutation_p.Y445*|GABRA2_ENST00000514090.1_Nonsense_Mutation_p.Y440*|GABRA2_ENST00000356504.1_Nonsense_Mutation_p.Y440*|GABRA2_ENST00000507069.1_Nonsense_Mutation_p.Y500*|GABRA2_ENST00000381620.4_Nonsense_Mutation_p.Y440*			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	440					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	CTCTGTTTAAATATGTAGCCC	0.338																																																	0													83.0	89.0	87.0					4																	46252361		2202	4295	6497	SO:0001587	stop_gained	0				CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.1320T>G	4.37:g.46252361A>C	ENSP00000421828:p.Tyr440*		A8K0U7|B7Z1H8|Q59G14	Nonsense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa2_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.Y445*	ENST00000510861.1	37	c.1335	CCDS3471.1	4	.	.	.	.	.	.	.	.	.	.	A	40	8.104145	0.98657	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069	.	.	.	5.96	4.8	0.61643	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.51012	D	0.999903	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.09	0.30795	0.8515:0.0:0.1485:0.0	.	.	.	.	X	440;440;440;440;445;500	.	ENSP00000348897:Y440X	Y	-	3	2	GABRA2	45947118	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.193000	0.42658	2.280000	0.76307	0.533000	0.62120	TAT	GABRA2	-	superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,tigrfam_Neur_channel	ENSG00000151834		0.338	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	GABRA2	HGNC	protein_coding	OTTHUMT00000360848.2	-	0.00	30	0	A			46252361	-1	tier1	-	no_errors	ENST00000540012	ensembl	human	known	74_37	nonsense	37.21	27	16	SNP	1.000	C
GALNT2	2590	genome.wustl.edu	37	1	230391114	230391114	+	Intron	SNP	G	G	A	rs375373287		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:230391114G>A	ENST00000366672.4	+	11	1208				GALNT2_ENST00000485438.1_3'UTR|GALNT2_ENST00000543760.1_Intron|GALNT2_ENST00000541865.1_Intron	NM_004481.3	NP_004472.1	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2						cellular protein metabolic process (GO:0044267)|immunoglobulin biosynthetic process (GO:0002378)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(5)|skin(2)	32	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				GGCTGAGCGGGGTCCAAAACA	0.542																																																	0													83.0	65.0	71.0					1																	230391114		2203	4300	6503	SO:0001627	intron_variant	0			BC041120	CCDS1582.1	1q41-q42	2014-03-13	2014-03-13		ENSG00000143641	ENSG00000143641	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4124	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 2"""	602274	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)"""			9592121, 7592619	Standard	NM_004481		Approved	GalNAc-T2	uc010pwa.1	Q10471	OTTHUMG00000037771	ENST00000366672.4:c.1136+24G>A	1.37:g.230391114G>A			A8K1Y3|B7Z8V8|C5HU00|Q9NPY4	RNA	SNP	-	NULL	ENST00000366672.4	37	NULL	CCDS1582.1	1																																																																																			GALNT2	-	-	ENSG00000143641		0.542	GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT2	HGNC	protein_coding	OTTHUMT00000092158.1	-	0.00	80	0	G	NM_004481		230391114	+1	tier1	-	no_errors	ENST00000485438	ensembl	human	known	74_37	rna	37.93	54	33	SNP	0.003	A
GAPVD1	26130	genome.wustl.edu	37	9	128094322	128094322	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr9:128094322G>T	ENST00000495955.1	+	14	2581	c.2291G>T	c.(2290-2292)gGc>gTc	p.G764V	GAPVD1_ENST00000394105.2_Missense_Mutation_p.G764V|GAPVD1_ENST00000265956.4_Missense_Mutation_p.G764V|GAPVD1_ENST00000470056.1_Missense_Mutation_p.G764V|GAPVD1_ENST00000394083.2_Missense_Mutation_p.G743V|GAPVD1_ENST00000297933.6_Missense_Mutation_p.G764V|GAPVD1_ENST00000394104.2_Missense_Mutation_p.G764V|GAPVD1_ENST00000312123.9_Missense_Mutation_p.G743V			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	764					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.G764V(1)		central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						AGCACACCAGGCCTCAGTGTT	0.507																																																	1	Substitution - Missense(1)	lung(1)											104.0	81.0	89.0					9																	128094322		2203	4300	6503	SO:0001583	missense	0				CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.2291G>T	9.37:g.128094322G>T	ENSP00000419063:p.Gly764Val		A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Missense_Mutation	SNP	pfam_RasGAP,pfam_VPS9,superfamily_Rho_GTPase_activation_prot,smart_VPS9_subgr,pfscan_VPS9,pfscan_RasGAP	p.G764V	ENST00000495955.1	37	c.2291		9	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	29.3|29.3|29.3	4.990953|4.990953|4.990953	0.93106|0.93106|0.93106	.|.|.	.|.|.	ENSG00000165219|ENSG00000165219|ENSG00000165219	ENST00000431329|ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000467750;ENST00000297933;ENST00000312123|ENST00000436712	.|T;T;T;T;T;T;T;T;T|.	.|0.14516|.	.|2.5;2.5;2.5;2.5;2.5;2.5;2.5;2.5;2.5|.	6.01|6.01|6.01	6.01|6.01|6.01	0.97437|0.97437|0.97437	.|.|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	T|T|T	0.54967|0.54967|0.54967	0.1891|0.1891|0.1891	N|N|N	0.19112|0.19112|0.19112	0.55|0.55|0.55	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;D;D;D;D;D|.	.|0.89917|.	.|1.0;1.0;1.0;1.0;1.0;1.0|.	.|D;D;D;D;D;D|.	.|0.91635|.	.|0.998;0.996;0.998;0.998;0.998;0.999|.	T|T|T	0.46456|0.46456|0.46456	-0.9190|-0.9190|-0.9190	5|9|5	.|.|.	.|.|.	.|.|.	.|.|.	19.5023|19.5023|19.5023	0.95100|0.95100|0.95100	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|764;764;764;743;764;764|.	.|Q14C86-5;Q14C86;Q14C86-3;Q14C86-4;Q14C86-2;Q14C86-6|.	.|.;GAPD1_HUMAN;.;.;.;.|.	S|V|S	627|764;764;764;764;743;764;764;764;743|600	.|ENSP00000419767:G764V;ENSP00000377665:G764V;ENSP00000377664:G764V;ENSP00000265956:G764V;ENSP00000377645:G743V;ENSP00000419063:G764V;ENSP00000418747:G764V;ENSP00000297933:G764V;ENSP00000309582:G743V|.	.|.|.	A|G|R	+|+|+	1|2|3	0|0|2	GAPVD1|GAPVD1|GAPVD1	127134143|127134143|127134143	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.987000|0.987000|0.987000	0.75469|0.75469|0.75469	9.869000|9.869000|9.869000	0.99810|0.99810|0.99810	2.850000|2.850000|2.850000	0.98022|0.98022|0.98022	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GCC|GGC|AGG	GAPVD1	-	NULL	ENSG00000165219		0.507	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	GAPVD1	HGNC	protein_coding	OTTHUMT00000355644.1		0.00	25	0	G			128094322	+1			no_errors	ENST00000394105	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	T
GAS2L3	283431	genome.wustl.edu	37	12	100994180	100994180	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:100994180G>T	ENST00000539410.1	+	3	425	c.39G>T	c.(37-39)ctG>ctT	p.L13L	GAS2L3_ENST00000537247.1_5'UTR|GAS2L3_ENST00000547754.1_Silent_p.L13L|GAS2L3_ENST00000266754.5_Silent_p.L13L			Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	13					actin cytoskeleton organization (GO:0030036)|cell cycle arrest (GO:0007050)|microtubule cytoskeleton organization (GO:0000226)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	actin binding (GO:0003779)|microtubule binding (GO:0008017)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35						GAGAAGATCTGCCTCTAAGTC	0.398																																																	0													109.0	105.0	106.0					12																	100994180		2203	4300	6503	SO:0001819	synonymous_variant	0			AK095594	CCDS9079.1	12q23.1	2014-09-11			ENSG00000139354	ENSG00000139354			27475	protein-coding gene	gene with protein product							Standard	NM_174942		Approved		uc001thu.3	Q86XJ1	OTTHUMG00000170439	ENST00000539410.1:c.39G>T	12.37:g.100994180G>T			B2RCN2	Silent	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.L13	ENST00000539410.1	37	c.39	CCDS9079.1	12																																																																																			GAS2L3	-	NULL	ENSG00000139354		0.398	GAS2L3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2L3	HGNC	protein_coding	OTTHUMT00000409143.1		0.00	27	0	G	NM_174942		100994180	+1			no_errors	ENST00000266754	ensembl	human	known	74_37	silent	11.11	24	3	SNP	0.939	T
ARF5	381	genome.wustl.edu	37	7	127231635	127231636	+	3'UTR	INS	-	-	T	rs543667839|rs377612947		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:127231635_127231636insT	ENST00000000233.5	+	0	979_980				FSCN3_ENST00000478328.1_3'UTR|GCC1_ENST00000497650.1_Intron|FSCN3_ENST00000265825.5_5'Flank|FSCN3_ENST00000420086.2_5'Flank	NM_001662.3	NP_001653.1	P84085	ARF5_HUMAN	ADP-ribosylation factor 5						GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			cervix(2)|kidney(1)|lung(10)|ovary(1)	14						TCTGGGTTTCCTTTTTTTTTTC	0.564																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS34745.1	7q31.3	2008-07-18			ENSG00000004059	ENSG00000004059		"""ADP-ribosylation factors"""	658	protein-coding gene	gene with protein product		103188				1993656	Standard	NM_001662		Approved		uc003vmb.2	P84085	OTTHUMG00000023246	ENST00000000233.5:c.*283->T	7.37:g.127231645_127231645dupT			P26437	RNA	INS	-	NULL	ENST00000000233.5	37	NULL	CCDS34745.1	7																																																																																			GCC1	-	-	ENSG00000179562		0.564	ARF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC1	HGNC	protein_coding	OTTHUMT00000059567.2		0.00	24	0	-	NM_001662		127231636	-1	tier1		no_errors	ENST00000473728	ensembl	human	known	74_37	rna	10.34	26	3	INS	0.929:0.928	T
GGNBP1	449520	genome.wustl.edu	37	6	33556768	33556768	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:33556768G>T	ENST00000374458.1	+	6	925	c.295G>T	c.(295-297)Gag>Tag	p.E99*	LINC00336_ENST00000477984.1_RNA			Q5YKI7	GGNB1_HUMAN	gametogenetin binding protein 1 (pseudogene)	99	Interaction with GGN. {ECO:0000250}.				cell differentiation (GO:0030154)|mitochondrial fission (GO:0000266)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)											GCTTCTTGAGGAGAAAGGTGA	0.572																																																	0																																										SO:0001587	stop_gained	0					6p21	2012-04-19	2012-04-19		ENSG00000204188	ENSG00000204188			19427	pseudogene	pseudogene		609495	"""gametogenetin binding protein 1"""			15642376	Standard	NR_028361		Approved		uc021ywq.1	Q5YKI7		ENST00000374458.1:c.295G>T	6.37:g.33556768G>T	ENSP00000363582:p.Glu99*		Q5YKI8	Nonsense_Mutation	SNP	NULL	p.E99*	ENST00000374458.1	37	c.295		6	.	.	.	.	.	.	.	.	.	.	G	29.1	4.980075	0.92982	.	.	ENSG00000204188	ENST00000374458	.	.	.	4.23	4.23	0.50019	.	0.000000	0.45867	D	0.000332	.	.	.	.	.	.	0.34949	D	0.751028	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-9.6021	12.0608	0.53561	0.0:0.0:1.0:0.0	.	.	.	.	X	99	.	ENSP00000363582:E99X	E	+	1	0	GGNBP1	33664746	1.000000	0.71417	0.471000	0.27229	0.015000	0.08874	4.737000	0.62066	2.215000	0.71742	0.650000	0.86243	GAG	GGNBP1	-	NULL	ENSG00000204188		0.572	GGNBP1-201	KNOWN	basic|appris_principal	protein_coding	GGNBP1	HGNC	protein_coding		-	0.00	53	0	G			33556768	+1	tier1	-	no_errors	ENST00000374458	ensembl	human	known	74_37	nonsense	10.00	36	4	SNP	0.820	T
GH2	2689	genome.wustl.edu	37	17	61957710	61957710	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:61957710G>T	ENST00000423893.2	-	5	686	c.625C>A	c.(625-627)Cgc>Agc	p.R209S	GH2_ENST00000456543.2_Silent_p.A207A|GH2_ENST00000449787.2_Missense_Mutation_p.R194S|GH2_ENST00000332800.7_3'UTR			P01242	SOM2_HUMAN	growth hormone 2	209					JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			breast(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	24						TCCACAGAGCGGCACTGCACG	0.607																																																	0													99.0	84.0	89.0					17																	61957710		2202	4279	6481	SO:0001583	missense	0			J03756	CCDS11647.1, CCDS11648.1, CCDS45757.1, CCDS45758.1	17q22-q24	2014-01-30						"""Endogenous ligands"""	4262	protein-coding gene	gene with protein product	"""placental-specific growth hormone"", ""placenta-specific growth hormone"""	139240				6306568	Standard	NM_002059		Approved	GH-V, GHV, GHL, hGH-V	uc002jcl.2	P01242		ENST00000423893.2:c.625C>A	17.37:g.61957710G>T	ENSP00000409294:p.Arg209Ser		B1A4H5|B1A4H7|O14643|O14644|P09587	Missense_Mutation	SNP	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core,prints_Somatotropin	p.R209S	ENST00000423893.2	37	c.625	CCDS11647.1	17	.	.	.	.	.	.	.	.	.	.	g	13.15	2.150450	0.37923	.	.	ENSG00000136487	ENST00000423893;ENST00000449787	D;D	0.92911	-3.13;-3.13	2.74	2.74	0.32292	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	.	.	.	.	D	0.95446	0.8521	.	.	.	0.80722	D	1	D;D	0.89917	1.0;0.98	D;P	0.97110	1.0;0.589	D	0.95525	0.8598	8	0.72032	D	0.01	.	12.4782	0.55827	0.0:0.0:1.0:0.0	.	209;194	P01242;O14643	SOM2_HUMAN;.	S	209;194	ENSP00000409294:R209S;ENSP00000410618:R194S	ENSP00000409294:R209S	R	-	1	0	GH2	59311442	1.000000	0.71417	0.998000	0.56505	0.093000	0.18481	4.598000	0.61069	1.531000	0.49152	0.306000	0.20318	CGC	GH2	-	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core,prints_Somatotropin	ENSG00000136487		0.607	GH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GH2	HGNC	protein_coding	OTTHUMT00000417665.1	-	0.00	116	0	G	NM_002059		61957710	-1	tier1	-	no_errors	ENST00000423893	ensembl	human	known	74_37	missense	6.00	93	6	SNP	1.000	T
GLI1	2735	genome.wustl.edu	37	12	57864972	57864972	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:57864972G>T	ENST00000228682.2	+	12	2540	c.2449G>T	c.(2449-2451)Gaa>Taa	p.E817*	GLI1_ENST00000543426.1_Nonsense_Mutation_p.E689*|GLI1_ENST00000546141.1_Nonsense_Mutation_p.E776*	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	817			E -> Q (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)	p.E817Q(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			AGTCAAGCCAGAACAGGGGTG	0.602																																					Pancreas(157;841 1936 10503 41495 50368)												1	Substitution - Missense(1)	breast(1)											63.0	66.0	65.0					12																	57864972		2203	4300	6503	SO:0001587	stop_gained	0				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.2449G>T	12.37:g.57864972G>T	ENSP00000228682:p.Glu817*		D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E817*	ENST00000228682.2	37	c.2449	CCDS8940.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.357482	0.95854	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467	.	.	.	4.44	4.44	0.53790	.	0.000000	0.43579	D	0.000541	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	.	14.956	0.71113	0.0:0.0:1.0:0.0	.	.	.	.	X	689;817;776;776	.	ENSP00000228682:E817X	E	+	1	0	GLI1	56151239	0.998000	0.40836	0.950000	0.38849	0.526000	0.34562	3.005000	0.49521	2.464000	0.83262	0.484000	0.47621	GAA	GLI1	-	NULL	ENSG00000111087		0.602	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI1	HGNC	protein_coding	OTTHUMT00000394197.1		0.00	24	0	G	NM_005269		57864972	+1			no_errors	ENST00000228682	ensembl	human	known	74_37	nonsense	16.67	10	2	SNP	0.996	T
GMEB2	26205	genome.wustl.edu	37	20	62223484	62223484	+	Silent	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr20:62223484G>C	ENST00000266068.1	-	8	1321	c.843C>G	c.(841-843)ctC>ctG	p.L281L	GMEB2_ENST00000370069.1_Silent_p.L230L|GMEB2_ENST00000370077.1_Silent_p.L281L			Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding protein 2	281					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	18	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)			CGATGTTGTTGAGAAGTACAG	0.607																																																	0													109.0	82.0	91.0					20																	62223484		2203	4300	6503	SO:0001819	synonymous_variant	0			AF173867	CCDS13528.1	20q13.33	2008-07-02			ENSG00000101216	ENSG00000101216			4371	protein-coding gene	gene with protein product		607451				10523663, 11743720	Standard	NM_012384		Approved	P79PIF, KIAA1269, PIF79	uc002yfq.1	Q9UKD1	OTTHUMG00000032988	ENST00000266068.1:c.843C>G	20.37:g.62223484G>C			E1P5J3|Q5TDS0|Q9H431|Q9H4X7|Q9H4X8|Q9UF78|Q9ULF1	Silent	SNP	pfam_SAND_dom,superfamily_SAND_dom-like,superfamily_Sig_transdc_His_kin_Hpt_dom,smart_SAND_dom,pfscan_SAND_dom	p.L281	ENST00000266068.1	37	c.843	CCDS13528.1	20																																																																																			GMEB2	-	superfamily_Sig_transdc_His_kin_Hpt_dom	ENSG00000101216		0.607	GMEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMEB2	HGNC	protein_coding	OTTHUMT00000080166.1	-	0.00	26	0	G	NM_012384		62223484	-1	tier1	-	no_errors	ENST00000266068	ensembl	human	known	74_37	silent	42.31	15	11	SNP	1.000	C
GPD2	2820	genome.wustl.edu	37	2	157426011	157426011	+	Silent	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:157426011C>G	ENST00000310454.6	+	11	1809	c.1437C>G	c.(1435-1437)ctC>ctG	p.L479L	GPD2_ENST00000438166.2_Silent_p.L479L|GPD2_ENST00000540309.1_Intron|GPD2_ENST00000409125.4_Silent_p.L252L|GPD2_ENST00000409674.1_Silent_p.L479L	NM_001083112.2	NP_001076581.2	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2 (mitochondrial)	479					camera-type eye development (GO:0043010)|cellular lipid metabolic process (GO:0044255)|gluconeogenesis (GO:0006094)|glycerol catabolic process (GO:0019563)|glycerol-3-phosphate metabolic process (GO:0006072)|multicellular organism growth (GO:0035264)|small molecule metabolic process (GO:0044281)	glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (GO:0052591)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|stomach(1)	22						GCCCCACACTCTACATTAGGC	0.438																																																	0													97.0	94.0	95.0					2																	157426011		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS2202.1	2q24.1	2013-01-10			ENSG00000115159	ENSG00000115159	1.1.1.8	"""EF-hand domain containing"""	4456	protein-coding gene	gene with protein product		138430					Standard	NM_001083112		Approved		uc002tzd.4	P43304	OTTHUMG00000131951	ENST00000310454.6:c.1437C>G	2.37:g.157426011C>G			A8K4V0|B3KSA9|Q59FR1|Q9HAP9	Silent	SNP	pfam_FAD-dep_OxRdtase,pfam_FAD_bind_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_G3P_DH_FAD-dep	p.L479	ENST00000310454.6	37	c.1437	CCDS2202.1	2																																																																																			GPD2	-	NULL	ENSG00000115159		0.438	GPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPD2	HGNC	protein_coding	OTTHUMT00000254910.3	-	0.00	33	0	C			157426011	+1	tier1	-	no_errors	ENST00000310454	ensembl	human	known	74_37	silent	26.67	11	4	SNP	1.000	G
GPR112	139378	genome.wustl.edu	37	X	135429032	135429032	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chrX:135429032C>T	ENST00000394143.1	+	6	3458	c.3167C>T	c.(3166-3168)tCa>tTa	p.S1056L	GPR112_ENST00000412101.1_Missense_Mutation_p.S851L|GPR112_ENST00000287534.4_Missense_Mutation_p.S993L|GPR112_ENST00000394141.1_Missense_Mutation_p.S851L|GPR112_ENST00000370652.1_Missense_Mutation_p.S1056L	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1056					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					AATCTATCCTCAACTACAATG	0.473																																																	0													265.0	240.0	248.0					X																	135429032		2203	4300	6503	SO:0001583	missense	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.3167C>T	X.37:g.135429032C>T	ENSP00000377699:p.Ser1056Leu		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.S1056L	ENST00000394143.1	37	c.3167	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	C	13.25	2.179987	0.38511	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.34667	1.39;1.39;1.35;1.48;1.35	2.16	1.28	0.21552	.	.	.	.	.	T	0.39886	0.1095	L	0.27053	0.805	0.09310	N	1	D;P;P	0.61080	0.989;0.884;0.675	D;B;B	0.72625	0.978;0.258;0.067	T	0.14980	-1.0453	9	0.62326	D	0.03	.	4.3239	0.11031	0.0:0.7919:0.0:0.2081	.	993;851;1056	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	L	1056;1056;851;993;851	ENSP00000377699:S1056L;ENSP00000359686:S1056L;ENSP00000416526:S851L;ENSP00000287534:S993L;ENSP00000377697:S851L	ENSP00000287534:S993L	S	+	2	0	GPR112	135256698	0.179000	0.23135	0.002000	0.10522	0.049000	0.14656	0.404000	0.20999	0.357000	0.24183	0.436000	0.28706	TCA	GPR112	-	NULL	ENSG00000156920		0.473	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	-	0.00	25	0	C			135429032	+1	tier1	-	no_errors	ENST00000370652	ensembl	human	known	74_37	missense	63.64	12	21	SNP	0.002	T
GPR124	25960	genome.wustl.edu	37	8	37698775	37698775	+	Silent	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:37698775G>A	ENST00000412232.2	+	19	2932	c.2919G>A	c.(2917-2919)ctG>ctA	p.L973L	GPR124_ENST00000315215.7_Silent_p.L756L	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	973					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GGGAGGAGCTGAGGGGTTCCA	0.692																																																	0													27.0	32.0	30.0					8																	37698775		2202	4300	6502	SO:0001819	synonymous_variant	0			AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.2919G>A	8.37:g.37698775G>A			A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom	p.L973	ENST00000412232.2	37	c.2919	CCDS6097.2	8																																																																																			GPR124	-	NULL	ENSG00000020181		0.692	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR124	HGNC	protein_coding	OTTHUMT00000343331.2	-	0.00	51	0	G			37698775	+1	tier1	-	no_errors	ENST00000412232	ensembl	human	known	74_37	silent	9.78	83	9	SNP	0.000	A
GRAMD1C	54762	genome.wustl.edu	37	3	113619947	113619947	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:113619947G>C	ENST00000358160.4	+	7	1102	c.610G>C	c.(610-612)Gag>Cag	p.E204Q	GRAMD1C_ENST00000452134.2_5'UTR|GRAMD1C_ENST00000479212.1_3'UTR|GRAMD1C_ENST00000440446.2_5'UTR|GRAMD1C_ENST00000472026.1_Missense_Mutation_p.E37Q	NM_017577.4	NP_060047.3	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	204						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	26						TTTAAATGCTGAGGAGATGGA	0.393																																																	0													107.0	100.0	102.0					3																	113619947		2203	4300	6503	SO:0001583	missense	0				CCDS33826.1, CCDS54625.1	3q13.31	2005-11-02			ENSG00000178075	ENSG00000178075			25252	protein-coding gene	gene with protein product						12975309	Standard	NM_017577		Approved	DKFZp434C0328	uc003eaq.4	Q8IYS0	OTTHUMG00000159340	ENST00000358160.4:c.610G>C	3.37:g.113619947G>C	ENSP00000350881:p.Glu204Gln		A8K9Y1|A8KA99|Q6AW94|Q6UWN1|Q8N6S0|Q9UF46	Missense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.E204Q	ENST00000358160.4	37	c.610	CCDS33826.1	3	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829304	0.71258	.	.	ENSG00000178075	ENST00000358160;ENST00000472026	T;T	0.56776	1.19;0.44	5.97	4.16	0.48862	.	0.125094	0.51477	D	0.000090	T	0.62036	0.2395	M	0.68593	2.085	0.80722	D	1	D;P	0.63046	0.992;0.931	P;B	0.54544	0.755;0.274	T	0.65323	-0.6196	10	0.52906	T	0.07	.	12.0605	0.53561	0.1444:0.0:0.8556:0.0	.	37;204	E9PHT3;Q8IYS0	.;GRM1C_HUMAN	Q	204;37	ENSP00000350881:E204Q;ENSP00000419132:E37Q	ENSP00000350881:E204Q	E	+	1	0	GRAMD1C	115102637	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	4.035000	0.57297	1.523000	0.49018	0.650000	0.86243	GAG	GRAMD1C	-	NULL	ENSG00000178075		0.393	GRAMD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD1C	HGNC	protein_coding	OTTHUMT00000354733.1		0.00	24	0	G	NM_017577		113619947	+1			no_errors	ENST00000358160	ensembl	human	known	74_37	missense	13.95	37	6	SNP	1.000	C
GRASP	160622	genome.wustl.edu	37	12	52404909	52404909	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:52404909G>T	ENST00000293662.4	+	4	518	c.438G>T	c.(436-438)ctG>ctT	p.L146L	GRASP_ENST00000552963.1_3'UTR|GRASP_ENST00000552049.1_5'UTR|GRASP_ENST00000380039.2_5'Flank	NM_181711.2	NP_859062.1	Q7Z6J2	GRASP_HUMAN	GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein	146	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein localization (GO:0008104)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				central_nervous_system(1)|large_intestine(1)|lung(1)|skin(2)	5				BRCA - Breast invasive adenocarcinoma(357;0.0967)		CTGCCCAGCTGGCTGGGCTCA	0.582																																																	0													104.0	93.0	97.0					12																	52404909		2203	4300	6503	SO:0001819	synonymous_variant	0			AC019244	CCDS8817.1, CCDS61124.1	12q13.13	2011-09-02			ENSG00000161835	ENSG00000161835			18707	protein-coding gene	gene with protein product		612027				10828067	Standard	NM_001271856		Approved		uc001rzo.2	Q7Z6J2	OTTHUMG00000169595	ENST00000293662.4:c.438G>T	12.37:g.52404909G>T			Q6PIF8|Q7Z741	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L146	ENST00000293662.4	37	c.438	CCDS8817.1	12																																																																																			GRASP	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000161835		0.582	GRASP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRASP	HGNC	protein_coding	OTTHUMT00000404972.1	-	0.00	64	0	G			52404909	+1	tier1	-	no_errors	ENST00000293662	ensembl	human	known	74_37	silent	10.00	36	4	SNP	1.000	T
Unknown	0	genome.wustl.edu	37	3	6828336	6828336	+	IGR	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:6828336G>C								AC069277.2 (50520 upstream) : GRM7 (74465 downstream)																							AGACCATCTTGAGAGATTCTT	0.418																																																	0																																										SO:0001628	intergenic_variant	0																															3.37:g.6828336G>C				Missense_Mutation	SNP	NULL	p.E42Q		37	c.124		3																																																																																			GRM7	-	NULL	ENSG00000196277	0	0.418					GRM7	HGNC			-	0.00	41	0	G			6828336	+1	tier1	-	no_errors	ENST00000443259	ensembl	human	known	74_37	missense	30.77	36	16	SNP	0.001	C
GRK7	131890	genome.wustl.edu	37	3	141497256	141497256	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:141497256G>A	ENST00000264952.2	+	1	267	c.130G>A	c.(130-132)Ggc>Agc	p.G44S		NM_139209.2	NP_631948.1	Q8WTQ7	GRK7_HUMAN	G protein-coupled receptor kinase 7	44					protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26						CGGGCTGCAGGGCTGCGCGGA	0.682																																																	0													16.0	19.0	18.0					3																	141497256		2199	4290	6489	SO:0001583	missense	0				CCDS3120.1	3q24	2004-02-04	2004-02-04	2004-02-04	ENSG00000114124	ENSG00000114124			17031	protein-coding gene	gene with protein product		606987		GPRK7		11717351, 11754336	Standard	NM_139209		Approved		uc011bnd.2	Q8WTQ7	OTTHUMG00000159068	ENST00000264952.2:c.130G>A	3.37:g.141497256G>A	ENSP00000264952:p.Gly44Ser			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RGS_dom,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Regulat_G_prot_signal_superfam,pfscan_Prot_kinase_dom,prints_GPCR_kinase	p.G44S	ENST00000264952.2	37	c.130	CCDS3120.1	3	.	.	.	.	.	.	.	.	.	.	G	6.439	0.449160	0.12223	.	.	ENSG00000114124	ENST00000264952	T	0.02140	4.43	4.5	-5.68	0.02436	Regulator of G protein signalling superfamily (1);	1.180030	0.05806	N	0.613105	T	0.01387	0.0045	N	0.25647	0.755	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.49551	-0.8928	10	0.14656	T	0.56	-0.0532	1.4795	0.02433	0.2283:0.2031:0.3862:0.1824	.	44	Q8WTQ7	GRK7_HUMAN	S	44	ENSP00000264952:G44S	ENSP00000264952:G44S	G	+	1	0	GRK7	142979946	0.000000	0.05858	0.002000	0.10522	0.043000	0.13939	-1.622000	0.02042	-0.476000	0.06842	0.655000	0.94253	GGC	GRK7	-	superfamily_Regulat_G_prot_signal_superfam	ENSG00000114124		0.682	GRK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRK7	HGNC	protein_coding	OTTHUMT00000353168.1		0.00	36	0	G	NM_139209		141497256	+1			no_errors	ENST00000264952	ensembl	human	known	74_37	missense	12.24	43	6	SNP	0.000	A
GSDMC	56169	genome.wustl.edu	37	8	130789633	130789633	+	Silent	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:130789633C>T	ENST00000276708.4	-	2	1082	c.201G>A	c.(199-201)gaG>gaA	p.E67E		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	67						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						AAGAACTTGGCTCCAGGATGT	0.433																																																	0													95.0	85.0	89.0					8																	130789633		2203	4300	6503	SO:0001819	synonymous_variant	0			AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.201G>A	8.37:g.130789633C>T			Q5XKF3|Q6P494	Silent	SNP	pfam_Gasdermin	p.E67	ENST00000276708.4	37	c.201	CCDS6360.1	8																																																																																			GSDMC	-	pfam_Gasdermin	ENSG00000147697		0.433	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSDMC	HGNC	protein_coding	OTTHUMT00000380586.1	-	0.00	50	0	C			130789633	-1	tier1	-	no_errors	ENST00000276708	ensembl	human	known	74_37	silent	8.33	44	4	SNP	0.152	T
GSK3A	2931	genome.wustl.edu	37	19	42737477	42737478	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:42737477_42737478insGG	ENST00000222330.3	-	7	1089_1090	c.962_963insCC	c.(961-963)cctfs	p.P321fs	GSK3A_ENST00000398249.4_Frame_Shift_Ins_p.P239fs	NM_019884.2	NP_063937.2	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	321	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cardiac left ventricle morphogenesis (GO:0003214)|cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|cellular response to interleukin-3 (GO:0036016)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transferase activity (GO:0051348)|negative regulation of type B pancreatic cell development (GO:2000077)|negative regulation of UDP-glucose catabolic process (GO:0010905)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of heart contraction (GO:0045823)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein phosphorylation (GO:0006468)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of systemic arterial blood pressure (GO:0003073)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytosol (GO:0005829)	ATP binding (GO:0005524)|protein kinase A catalytic subunit binding (GO:0034236)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(3)|large_intestine(3)|lung(6)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	19		Prostate(69;0.00682)				CACTGTCCCCAGGGAAGATGGG	0.649																																																	0																																										SO:0001589	frameshift_variant	0				CCDS12599.1	19q13	2008-02-15			ENSG00000105723	ENSG00000105723			4616	protein-coding gene	gene with protein product		606784				9809441	Standard	NM_019884		Approved		uc002otb.1	P49840	OTTHUMG00000150722	ENST00000222330.3:c.961_962dupCC	19.37:g.42737478_42737479dupGG	ENSP00000222330:p.Pro321fs		O14959	Frame_Shift_Ins	INS	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G322fs	ENST00000222330.3	37	c.963_962	CCDS12599.1	19																																																																																			GSK3A	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000105723		0.649	GSK3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSK3A	HGNC	protein_coding	OTTHUMT00000319782.1		0.00	22	0	-			42737478	-1	tier1		no_errors	ENST00000222330	ensembl	human	known	74_37	frame_shift_ins	15.00	17	3	INS	0.956:1.000	GG
H2AFZ	3015	genome.wustl.edu	37	4	100870839	100870839	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:100870839G>A	ENST00000296417.5	-	2	279	c.62C>T	c.(61-63)tCg>tTg	p.S21L	RP11-15B17.1_ENST00000514624.1_RNA|RP11-15B17.1_ENST00000501976.2_RNA|RP11-15B17.1_ENST00000507494.1_RNA|DNAJB14_ENST00000442697.2_5'Flank|H2AFZ_ENST00000529158.1_5'UTR	NM_002106.3	NP_002097.1	P0C0S5	H2AZ_HUMAN	H2A histone family, member Z	21					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular vesicular exosome (GO:0070062)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|nucleosomal DNA binding (GO:0031492)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			breast(1)|endometrium(3)|lung(1)	5				OV - Ovarian serous cystadenocarcinoma(123;2.32e-08)		GGCTCTCTGCGAGCGGGAAAC	0.567																																																	0													78.0	87.0	84.0					4																	100870839		2203	4300	6503	SO:0001583	missense	0			X52317	CCDS3654.1	4q23	2011-01-27			ENSG00000164032	ENSG00000164032		"""Histones / Replication-independent"""	4741	protein-coding gene	gene with protein product		142763		H2AZ		1697587	Standard	XM_005262971		Approved	H2A.Z	uc003hvo.1	P0C0S5	OTTHUMG00000131048	ENST00000296417.5:c.62C>T	4.37:g.100870839G>A	ENSP00000296417:p.Ser21Leu		B2RD56|P17317|Q6I9U0	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.S21L	ENST00000296417.5	37	c.62	CCDS3654.1	4	.	.	.	.	.	.	.	.	.	.	G	19.22	3.784820	0.70222	.	.	ENSG00000164032	ENST00000296417	D	0.88277	-2.36	3.33	3.33	0.38152	Histone-fold (2);Histone core (1);Histone H2A (2);	0.257566	0.40385	N	0.001107	D	0.92838	0.7722	H	0.98370	4.215	0.80722	D	1	B	0.26775	0.159	B	0.16289	0.015	D	0.93652	0.6974	10	0.87932	D	0	-3.4773	14.8277	0.70125	0.0:0.0:1.0:0.0	.	21	P0C0S5	H2AZ_HUMAN	L	21	ENSP00000296417:S21L	ENSP00000296417:S21L	S	-	2	0	H2AFZ	101089862	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	6.585000	0.74062	1.697000	0.51169	0.455000	0.32223	TCG	H2AFZ	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000164032		0.567	H2AFZ-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	H2AFZ	HGNC	protein_coding	OTTHUMT00000253695.1	-	0.00	18	0	G	NM_002106		100870839	-1	tier1	-	no_errors	ENST00000296417	ensembl	human	known	74_37	missense	53.85	6	7	SNP	1.000	A
HCK	3055	genome.wustl.edu	37	20	30671780	30671780	+	Missense_Mutation	SNP	G	G	A	rs200896933		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr20:30671780G>A	ENST00000520553.1	+	7	799	c.553G>A	c.(553-555)Ggg>Agg	p.G185R	HCK_ENST00000538448.1_Missense_Mutation_p.G185R|HCK_ENST00000534862.1_Missense_Mutation_p.G186R|HCK_ENST00000375852.2_Missense_Mutation_p.G206R|HCK_ENST00000518730.1_Missense_Mutation_p.G184R|HCK_ENST00000375862.2_Missense_Mutation_p.G205R	NM_001172129.1|NM_001172130.1|NM_001172131.1|NM_002110.3	NP_001165600.1|NP_001165601.1|NP_001165602.1|NP_002101.2	P08631	HCK_HUMAN	HCK proto-oncogene, Src family tyrosine kinase	206	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|innate immune response-activating signal transduction (GO:0002758)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte degranulation (GO:0043299)|leukocyte migration involved in immune response (GO:0002522)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of defense response to virus by virus (GO:0050690)|regulation of inflammatory response (GO:0050727)|regulation of phagocytosis (GO:0050764)|regulation of podosome assembly (GO:0071801)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|respiratory burst after phagocytosis (GO:0045728)|viral process (GO:0016032)	caveola (GO:0005901)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(4)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		Bosutinib(DB06616)	CCTGGACAACGGGGGCTTCTA	0.567																																																	0													75.0	75.0	75.0					20																	30671780		2203	4300	6503	SO:0001583	missense	0			AK026432	CCDS33460.1, CCDS54453.1, CCDS54455.1, CCDS54456.1	20q11-q12	2014-06-25	2014-06-25		ENSG00000101336	ENSG00000101336		"""SH2 domain containing"""	4840	protein-coding gene	gene with protein product		142370	"""hemopoietic cell kinase"""			3496523	Standard	NM_002110		Approved	JTK9	uc002wxh.3	P08631	OTTHUMG00000032204	ENST00000520553.1:c.553G>A	20.37:g.30671780G>A	ENSP00000429848:p.Gly185Arg		A8K1I1|B4DQB6|E1P5M2|Q29RX1|Q2VPE2|Q504R5|Q5T7K1|Q5T7K2|Q96CC0|Q9H5Y5|Q9NUA4|Q9UMJ5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.G206R	ENST00000520553.1	37	c.616	CCDS54455.1	20	.	.	.	.	.	.	.	.	.	.	G	28.5	4.929030	0.92389	.	.	ENSG00000101336	ENST00000534862;ENST00000538448;ENST00000375862;ENST00000520553;ENST00000518730;ENST00000375852	T;T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4;1.4	5.0	5.0	0.66597	SH2 motif (4);	0.000000	0.85682	D	0.000000	T	0.70430	0.3223	M	0.93854	3.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79249	-0.1881	10	0.87932	D	0	.	17.4688	0.87640	0.0:0.0:1.0:0.0	.	184;206	P08631-3;P08631	.;HCK_HUMAN	R	186;185;205;185;184;206	ENSP00000444986:G186R;ENSP00000441169:G185R;ENSP00000365022:G205R;ENSP00000429848:G185R;ENSP00000427757:G184R;ENSP00000365012:G206R	ENSP00000365012:G206R	G	+	1	0	HCK	30135441	1.000000	0.71417	0.926000	0.36857	0.798000	0.45092	9.657000	0.98554	2.619000	0.88677	0.555000	0.69702	GGG	HCK	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000101336		0.567	HCK-006	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	HCK	HGNC	protein_coding	OTTHUMT00000375751.1		0.00	25	0	G			30671780	+1			no_errors	ENST00000375852	ensembl	human	known	74_37	missense	11.11	24	3	SNP	1.000	A
HCRTR2	3062	genome.wustl.edu	37	6	55039452	55039452	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:55039452G>A	ENST00000370862.3	+	1	403	c.67G>A	c.(67-69)Gaa>Aaa	p.E23K		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	23					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)			breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			GGAGCTGAATGAAACTCAAGA	0.542																																																	0													129.0	121.0	124.0					6																	55039452		2203	4300	6503	SO:0001583	missense	0			AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.67G>A	6.37:g.55039452G>A	ENSP00000359899:p.Glu23Lys		Q5VTM0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_Orexin_rcpt_2,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Orexin_rcpt,prints_GPCR_Rhodpsn,prints_Orexin_rcpt_2,prints_NPY_rcpt	p.E23K	ENST00000370862.3	37	c.67	CCDS4956.1	6	.	.	.	.	.	.	.	.	.	.	G	11.27	1.588696	0.28357	.	.	ENSG00000137252	ENST00000370862	T	0.60548	0.18	4.89	3.93	0.45458	.	0.541698	0.19651	N	0.109205	T	0.21062	0.0507	L	0.29908	0.895	0.24121	N	0.99581	B	0.15141	0.012	B	0.09377	0.004	T	0.08994	-1.0695	10	0.06236	T	0.91	.	13.7559	0.62937	0.0862:0.0:0.9138:0.0	.	23	O43614	OX2R_HUMAN	K	23	ENSP00000359899:E23K	ENSP00000359899:E23K	E	+	1	0	HCRTR2	55147411	0.995000	0.38212	0.967000	0.41034	0.990000	0.78478	4.710000	0.61873	2.541000	0.85698	0.563000	0.77884	GAA	HCRTR2	-	NULL	ENSG00000137252		0.542	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCRTR2	HGNC	protein_coding	OTTHUMT00000043392.1	-	0.00	47	0	G			55039452	+1	tier1	-	no_errors	ENST00000370862	ensembl	human	known	74_37	missense	38.30	29	18	SNP	0.555	A
HDAC4	9759	genome.wustl.edu	37	2	240016733	240016733	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:240016733G>T	ENST00000345617.3	-	17	3029	c.2238C>A	c.(2236-2238)ttC>ttA	p.F746L	HDAC4_ENST00000543185.1_Missense_Mutation_p.F330L|HDAC4_ENST00000541256.1_Missense_Mutation_p.F720L	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	746	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		GGAGCCGGACGAACACGGAGG	0.612																																																	0													77.0	85.0	82.0					2																	240016733		2203	4300	6503	SO:0001583	missense	0			AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.2238C>A	2.37:g.240016733G>T	ENSP00000264606:p.Phe746Leu		Q9UND6	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pfam_Arb2_domain,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.F746L	ENST00000345617.3	37	c.2238	CCDS2529.1	2	.	.	.	.	.	.	.	.	.	.	G	8.926	0.962203	0.18583	.	.	ENSG00000068024	ENST00000345617;ENST00000456922;ENST00000543185;ENST00000541256;ENST00000393621	T;T;T	0.65364	0.22;-0.15;0.73	4.46	-8.93	0.00771	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	T	0.65207	0.2669	L	0.48935	1.535	0.40990	D	0.984848	D;B;B;B;B;B	0.54601	0.967;0.222;0.013;0.014;0.016;0.2	P;B;B;B;B;B	0.58577	0.841;0.094;0.016;0.005;0.037;0.146	T	0.79305	-0.1858	10	0.56958	D	0.05	.	20.7024	0.99706	0.2754:0.0:0.7246:0.0	.	746;629;720;720;714;746	B7Z8G5;F5H0Q9;F5H5W4;B7Z8I2;Q53SM2;P56524	.;.;.;.;.;HDAC4_HUMAN	L	746;634;330;720;629	ENSP00000264606:F746L;ENSP00000440481:F330L;ENSP00000443057:F720L	ENSP00000264606:F746L	F	-	3	2	HDAC4	239681670	0.411000	0.25384	0.125000	0.21846	0.040000	0.13550	-0.171000	0.09883	-2.355000	0.00614	-0.768000	0.03414	TTC	HDAC4	-	pfam_His_deacetylse_dom,pirsf_Histone_deAcase_II_euk	ENSG00000068024		0.612	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC4	HGNC	protein_coding	OTTHUMT00000257174.2	-	0.00	63	0	G	NM_006037		240016733	-1	tier1	-	no_errors	ENST00000345617	ensembl	human	known	74_37	missense	9.62	47	5	SNP	0.191	T
HDAC9	9734	genome.wustl.edu	37	7	18706043	18706043	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:18706043G>A	ENST00000432645.2	+	11	1666	c.1666G>A	c.(1666-1668)Gaa>Aaa	p.E556K	HDAC9_ENST00000406451.4_Missense_Mutation_p.E556K|HDAC9_ENST00000428307.2_Missense_Mutation_p.E512K|HDAC9_ENST00000401921.1_Missense_Mutation_p.E515K|HDAC9_ENST00000456174.2_Missense_Mutation_p.E528K|HDAC9_ENST00000524023.1_Missense_Mutation_p.E479K|HDAC9_ENST00000406072.1_Missense_Mutation_p.E543K|HDAC9_ENST00000417496.2_Missense_Mutation_p.E554K|HDAC9_ENST00000441542.2_Missense_Mutation_p.E559K|HDAC9_ENST00000405010.3_Missense_Mutation_p.E556K	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	556					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	GGACAGTGATGAAGATGCTCA	0.478											OREG0017877	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													77.0	90.0	86.0					7																	18706043		2029	4177	6206	SO:0001583	missense	0			AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1666G>A	7.37:g.18706043G>A	ENSP00000410337:p.Glu556Lys	727	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.E559K	ENST00000432645.2	37	c.1675	CCDS47555.1	7	.	.	.	.	.	.	.	.	.	.	G	23.4	4.412578	0.83340	.	.	ENSG00000048052	ENST00000417496;ENST00000262069;ENST00000405010;ENST00000406451;ENST00000428307;ENST00000406072;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000456174;ENST00000524023	T;T;T;T;T;T;T;T;T;T	0.59502	0.48;0.58;0.27;0.5;0.49;0.26;0.27;0.27;0.57;0.49	5.58	5.58	0.84498	.	0.100699	0.43747	D	0.000524	T	0.61874	0.2382	M	0.69823	2.125	0.58432	D	0.99999	B;B;B;B;B;B;P;B;B;B;B;B;P	0.42871	0.18;0.084;0.275;0.293;0.18;0.189;0.792;0.417;0.094;0.084;0.417;0.287;0.688	B;B;B;B;B;B;B;B;B;B;B;B;B	0.40066	0.017;0.024;0.088;0.054;0.04;0.024;0.318;0.085;0.039;0.024;0.116;0.053;0.169	T	0.66803	-0.5831	10	0.54805	T	0.06	-12.3534	19.5563	0.95349	0.0:0.0:1.0:0.0	.	479;528;556;543;554;559;515;559;556;528;556;556;534	E7EX34;C9JS87;Q9UKV0-4;B5MCF1;B7Z917;Q68D71;Q9UKV0-6;Q9UKV0-7;Q9UKV0;B7Z928;Q9UKV0-5;Q9UKV0-3;Q8N879	.;.;.;.;.;.;.;.;HDAC9_HUMAN;.;.;.;.	K	554;557;556;556;512;543;515;556;559;528;479	ENSP00000401669:E554K;ENSP00000384382:E556K;ENSP00000384657:E556K;ENSP00000395655:E512K;ENSP00000384017:E543K;ENSP00000383912:E515K;ENSP00000410337:E556K;ENSP00000408617:E559K;ENSP00000388568:E528K;ENSP00000430036:E479K	ENSP00000262069:E557K	E	+	1	0	HDAC9	18672568	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.852000	0.92215	2.609000	0.88269	0.650000	0.86243	GAA	HDAC9	-	pirsf_Histone_deAcase_II_euk	ENSG00000048052		0.478	HDAC9-023	KNOWN	basic|CCDS	protein_coding	HDAC9	HGNC	protein_coding	OTTHUMT00000376176.1	-	0.00	31	0	G			18706043	+1	tier1	-	no_errors	ENST00000441542	ensembl	human	known	74_37	missense	20.69	23	6	SNP	1.000	A
HECW1	23072	genome.wustl.edu	37	7	43477632	43477632	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:43477632G>T	ENST00000395891.2	+	9	1437	c.832G>T	c.(832-834)Gtg>Ttg	p.V278L	HECW1_ENST00000453890.1_Missense_Mutation_p.V278L|HECW1_ENST00000471043.1_3'UTR	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	278	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						GCCCACTGACGTGCTGGAAAT	0.493																																																	0													132.0	137.0	136.0					7																	43477632		2035	4218	6253	SO:0001583	missense	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.832G>T	7.37:g.43477632G>T	ENSP00000379228:p.Val278Leu		A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_WW_dom,superfamily_C2_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.V278L	ENST00000395891.2	37	c.832	CCDS5469.2	7	.	.	.	.	.	.	.	.	.	.	G	33	5.255707	0.95336	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.69306	-0.39;-0.39	6.17	6.17	0.99709	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.108147	0.64402	D	0.000006	D	0.82756	0.5106	M	0.70595	2.14	0.80722	D	1	D;P;D	0.76494	0.992;0.953;0.999	P;P;D	0.87578	0.771;0.777;0.998	T	0.82244	-0.0553	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	278;310;278	B4DH42;B3KR18;Q76N89	.;.;HECW1_HUMAN	L	278;278;277	ENSP00000379228:V278L;ENSP00000407774:V278L	ENSP00000265522:V277L	V	+	1	0	HECW1	43444157	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	8.062000	0.89475	2.941000	0.99782	0.655000	0.94253	GTG	HECW1	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000002746		0.493	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2		0.00	48	0	G	NM_015052		43477632	+1			no_errors	ENST00000395891	ensembl	human	known	74_37	missense	6.38	44	3	SNP	1.000	T
HERC2P3	283755	genome.wustl.edu	37	15	20613737	20613737	+	RNA	SNP	C	C	T	rs369240504	byFrequency	TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:20613737C>T	ENST00000428453.1	-	0	4041							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						AACAGGTCCACGCATATTTGA	0.353													C|||	280	0.0559105	0.09	0.0202	5008	,	,		60019	0.0179		0.0209	False		,,,				2504	0.1104																0																																												0			AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20613737C>T				RNA	SNP	-	NULL	ENST00000428453.1	37	NULL		15																																																																																			HERC2P3	-	-	ENSG00000180229		0.353	HERC2P3-014	KNOWN	basic	processed_transcript	HERC2P3	HGNC	pseudogene	OTTHUMT00000347772.2	-	0.00	10	0	C	NG_008269		20613737	-1	tier1	-	no_errors	ENST00000430598	ensembl	human	known	74_37	rna	36.36	7	4	SNP	0.008	T
HERC2	8924	genome.wustl.edu	37	15	28437270	28437270	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:28437270G>A	ENST00000261609.7	-	53	8396	c.8288C>T	c.(8287-8289)tCt>tTt	p.S2763F		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CTGTTTTCCAGAACGGCCACA	0.498											OREG0022997	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													101.0	99.0	100.0					15																	28437270		2203	4300	6503	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.8288C>T	15.37:g.28437270G>A	ENSP00000261609:p.Ser2763Phe	801		Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.S2763F	ENST00000261609.7	37	c.8288	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	G	34	5.316426	0.95655	.	.	ENSG00000128731	ENST00000261609	T	0.64438	-0.1	5.67	5.67	0.87782	Anaphase-promoting complex, subunit 10/DOC domain (1);Galactose-binding domain-like (1);	0.119302	0.64402	D	0.000016	T	0.73473	0.3591	L	0.36672	1.1	0.80722	D	1	D;D	0.71674	0.998;0.99	D;D	0.78314	0.991;0.974	T	0.75048	-0.3455	10	0.72032	D	0.01	.	19.7646	0.96335	0.0:0.0:1.0:0.0	.	230;2763	A8KAQ8;O95714	.;HERC2_HUMAN	F	2763	ENSP00000261609:S2763F	ENSP00000261609:S2763F	S	-	2	0	HERC2	26110865	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.976000	0.88070	2.675000	0.91044	0.471000	0.43371	TCT	HERC2	-	superfamily_Galactose-bd-like	ENSG00000128731		0.498	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	-	0.00	32	0	G	NM_004667		28437270	-1	tier1	-	no_errors	ENST00000261609	ensembl	human	known	74_37	missense	16.67	15	3	SNP	1.000	A
HIVEP1	3096	genome.wustl.edu	37	6	12122460	12122460	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:12122460A>T	ENST00000379388.2	+	4	2764	c.2432A>T	c.(2431-2433)aAg>aTg	p.K811M		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	811					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				GATATACCGAAGTCACCTTTC	0.398																																																	0													147.0	137.0	140.0					6																	12122460		1894	4114	6008	SO:0001583	missense	0			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.2432A>T	6.37:g.12122460A>T	ENSP00000368698:p.Lys811Met		B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K811M	ENST00000379388.2	37	c.2432	CCDS43426.1	6	.	.	.	.	.	.	.	.	.	.	A	22.7	4.326954	0.81690	.	.	ENSG00000095951	ENST00000379388	T	0.10860	2.83	6.01	6.01	0.97437	.	0.000000	0.38111	N	0.001817	T	0.27832	0.0685	M	0.79805	2.47	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.02345	-1.1173	9	.	.	.	-30.6902	16.5285	0.84344	1.0:0.0:0.0:0.0	.	811	P15822	ZEP1_HUMAN	M	811	ENSP00000368698:K811M	.	K	+	2	0	HIVEP1	12230446	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.339000	0.96797	2.307000	0.77673	0.528000	0.53228	AAG	HIVEP1	-	NULL	ENSG00000095951		0.398	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	HGNC	protein_coding	OTTHUMT00000039870.2	-	0.00	23	0	A	NM_002114		12122460	+1	tier1	-	no_errors	ENST00000379388	ensembl	human	known	74_37	missense	25.00	21	7	SNP	1.000	T
HLCS	3141	genome.wustl.edu	37	21	38137350	38137350	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr21:38137350G>T	ENST00000399120.1	-	9	2873	c.1643C>A	c.(1642-1644)gCt>gAt	p.A548D	HLCS_ENST00000336648.4_Missense_Mutation_p.A548D	NM_001242784.1	NP_001229713.1	P50747	BPL1_HUMAN	holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	548	BPL/LPL catalytic. {ECO:0000255|PROSITE- ProRule:PRU01067}.				biotin metabolic process (GO:0006768)|cell proliferation (GO:0008283)|histone biotinylation (GO:0071110)|histone modification (GO:0016570)|protein biotinylation (GO:0009305)|response to biotin (GO:0070781)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin-[acetyl-CoA-carboxylase] ligase activity (GO:0004077)|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity (GO:0004078)|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity (GO:0004079)|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity (GO:0004080)|biotin-protein ligase activity (GO:0018271)|enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	TTCCACGACAGCCACGGACAT	0.522																																																	0													149.0	120.0	130.0					21																	38137350		2203	4300	6503	SO:0001583	missense	0				CCDS13647.1	21q22.1	2012-07-13	2010-04-30		ENSG00000159267	ENSG00000159267	6.3.4.9, 6.3.4.10, 6.3.4.11, 6.3.4.15		4976	protein-coding gene	gene with protein product		609018	"""holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)"", ""holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)"""			7842009	Standard	NM_000411		Approved	HCS	uc021wjb.1	P50747	OTTHUMG00000086636	ENST00000399120.1:c.1643C>A	21.37:g.38137350G>T	ENSP00000382071:p.Ala548Asp		B2RAH1|D3DSG6|Q99451	Missense_Mutation	SNP	pfam_BPL_LipA_LipB,pfam_BPL_C,tigrfam_Biotin_CoA_COase_ligase	p.A548D	ENST00000399120.1	37	c.1643	CCDS13647.1	21	.	.	.	.	.	.	.	.	.	.	G	26.9	4.780011	0.90195	.	.	ENSG00000159267	ENST00000399120;ENST00000336648	D;D	0.98105	-4.72;-4.72	5.68	5.68	0.88126	Biotin/lipoate A/B protein ligase (1);	0.000000	0.85682	D	0.000000	D	0.99384	0.9783	H	0.98786	4.33	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98344	1.0540	10	0.87932	D	0	.	19.4034	0.94640	0.0:0.0:1.0:0.0	.	548	P50747	BPL1_HUMAN	D	548	ENSP00000382071:A548D;ENSP00000338387:A548D	ENSP00000338387:A548D	A	-	2	0	HLCS	37059220	1.000000	0.71417	0.944000	0.38274	0.653000	0.38743	8.598000	0.90852	2.678000	0.91216	0.561000	0.74099	GCT	HLCS	-	pfam_BPL_LipA_LipB,tigrfam_Biotin_CoA_COase_ligase	ENSG00000159267		0.522	HLCS-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HLCS	HGNC	protein_coding	OTTHUMT00000194687.2	-	0.00	48	0	G			38137350	-1	tier1	-	no_errors	ENST00000336648	ensembl	human	known	74_37	missense	16.00	21	4	SNP	1.000	T
HMCN1	83872	genome.wustl.edu	37	1	186114952	186114952	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:186114952G>T	ENST00000271588.4	+	93	14734	c.14505G>T	c.(14503-14505)aaG>aaT	p.K4835N	HMCN1_ENST00000367492.2_Missense_Mutation_p.K4835N	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4835	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GAGGTGAAAAGACTCGGAAGC	0.542																																																	0													76.0	72.0	73.0					1																	186114952		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.14505G>T	1.37:g.186114952G>T	ENSP00000271588:p.Lys4835Asn		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.K4835N	ENST00000271588.4	37	c.14505	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.775202	0.49786	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.55413	0.52;0.52	5.59	2.29	0.28610	.	0.150496	0.64402	D	0.000014	T	0.48732	0.1516	M	0.73372	2.23	0.29355	N	0.865062	P	0.36354	0.549	B	0.34038	0.174	T	0.54016	-0.8356	10	0.72032	D	0.01	.	10.8422	0.46722	0.2687:0.0:0.7313:0.0	.	4835	Q96RW7	HMCN1_HUMAN	N	4835	ENSP00000271588:K4835N;ENSP00000356462:K4835N	ENSP00000271588:K4835N	K	+	3	2	HMCN1	184381575	1.000000	0.71417	0.991000	0.47740	0.546000	0.35178	4.534000	0.60622	0.703000	0.31848	0.655000	0.94253	AAG	HMCN1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000143341		0.542	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1		0.00	51	0	G	NM_031935		186114952	+1			no_errors	ENST00000271588	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
HNRNPUL1	11100	genome.wustl.edu	37	19	41798231	41798231	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:41798231G>C	ENST00000392006.3	+	8	1254	c.1081G>C	c.(1081-1083)Gaa>Caa	p.E361Q	HNRNPUL1_ENST00000352456.3_Missense_Mutation_p.E261Q|HNRNPUL1_ENST00000263367.3_Missense_Mutation_p.E272Q|HNRNPUL1_ENST00000378215.4_Missense_Mutation_p.E247Q|HNRNPUL1_ENST00000593587.1_Missense_Mutation_p.E261Q|HNRNPUL1_ENST00000602130.1_Missense_Mutation_p.E361Q|HNRNPUL1_ENST00000595018.1_Missense_Mutation_p.E261Q	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	361	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.|Necessary for interaction with TP53.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						AATCCAGAAGGAAGCCTTGGG	0.488																																																	0													149.0	149.0	149.0					19																	41798231		2203	4300	6503	SO:0001583	missense	0			AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.1081G>C	19.37:g.41798231G>C	ENSP00000375863:p.Glu361Gln		B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_SAP_dom,superfamily_ConA-like_lec_gl_sf,superfamily_P-loop_NTPase,smart_SAP_dom,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_SAP_dom	p.E361Q	ENST00000392006.3	37	c.1081	CCDS12576.1	19	.	.	.	.	.	.	.	.	.	.	G	32	5.164230	0.94727	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35	6.04	6.04	0.98038	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.090758	0.85682	D	0.000000	T	0.79021	0.4376	L	0.55213	1.73	0.53688	D	0.999976	D;P;D;D;P;P	0.65815	0.984;0.784;0.995;0.988;0.766;0.744	D;P;D;P;P;B	0.66979	0.944;0.643;0.948;0.844;0.593;0.406	T	0.76782	-0.2832	10	0.48119	T	0.1	-10.5998	19.3663	0.94464	0.0:0.0:1.0:0.0	.	272;261;361;247;361;261	B7Z4B8;A8K3W4;Q9BUJ2-2;Q9BUJ2-3;Q9BUJ2;Q9BUJ2-4	.;.;.;.;HNRL1_HUMAN;.	Q	261;361;247;272	ENSP00000340857:E261Q;ENSP00000375863:E361Q;ENSP00000367460:E247Q;ENSP00000263367:E272Q	ENSP00000263367:E272Q	E	+	1	0	HNRNPUL1	46490071	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.808000	0.99193	2.873000	0.98535	0.563000	0.77884	GAA	HNRNPUL1	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000105323		0.488	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPUL1	HGNC	protein_coding	OTTHUMT00000463406.1		0.00	42	0	G	NM_144732, NM_007040		41798231	+1			no_errors	ENST00000392006	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	C
HTT	3064	genome.wustl.edu	37	4	3189558	3189558	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:3189558G>T	ENST00000355072.5	+	39	5315	c.5170G>T	c.(5170-5172)Gaa>Taa	p.E1724*		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1724					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TTCAACGCTAGAAGAACACAG	0.383																																																	0													110.0	102.0	105.0					4																	3189558		1847	4104	5951	SO:0001587	stop_gained	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.5170G>T	4.37:g.3189558G>T	ENSP00000347184:p.Glu1724*		Q9UQB7	Nonsense_Mutation	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.E1724*	ENST00000355072.5	37	c.5170	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	G	47	13.304303	0.99733	.	.	ENSG00000197386	ENST00000355072	.	.	.	5.66	4.82	0.62117	.	0.457002	0.25509	N	0.030181	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	10.931	0.47217	0.0702:0.1302:0.7995:0.0	.	.	.	.	X	1724	.	ENSP00000347184:E1724X	E	+	1	0	HTT	3159356	0.963000	0.33076	0.064000	0.19789	0.833000	0.47200	2.939000	0.48995	1.388000	0.46506	0.655000	0.94253	GAA	HTT	-	NULL	ENSG00000197386		0.383	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2		0.00	36	0	G	NM_002111		3189558	+1			no_errors	ENST00000355072	ensembl	human	known	74_37	nonsense	9.68	28	3	SNP	0.903	T
IFIT1B	439996	genome.wustl.edu	37	10	91143758	91143758	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:91143758G>A	ENST00000371809.3	+	2	768	c.688G>A	c.(688-690)Gaa>Aaa	p.E230K	LIPA_ENST00000371837.1_Intron	NM_001010987.2	NP_001010987.1	Q5T764	IFT1B_HUMAN	interferon-induced protein with tetratricopeptide repeats 1B	230										endometrium(2)|large_intestine(3)|lung(8)	13						GCTTCAGGATGAAGGACAGGA	0.428																																																	0													184.0	196.0	192.0					10																	91143758		2203	4300	6503	SO:0001583	missense	0				CCDS31242.1	10q23.31	2014-05-22	2010-03-22	2010-03-22	ENSG00000204010	ENSG00000204010		"""Tetratricopeptide (TTC) repeat domain containing"""	23442	protein-coding gene	gene with protein product			"""interferon-induced protein with tetratricopeptide repeats 1-like"""	IFIT1L			Standard	NM_001010987		Approved	bA149I23.6	uc001kgh.3	Q5T764	OTTHUMG00000018709	ENST00000371809.3:c.688G>A	10.37:g.91143758G>A	ENSP00000360874:p.Glu230Lys		A7E245	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E230K	ENST00000371809.3	37	c.688	CCDS31242.1	10	.	.	.	.	.	.	.	.	.	.	G	3.197	-0.164626	0.06502	.	.	ENSG00000204010	ENST00000371809	T	0.36699	1.24	4.05	-6.42	0.01932	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	1.803390	0.02785	U	0.121373	T	0.12220	0.0297	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.19148	0.024	T	0.24368	-1.0162	10	0.05351	T	0.99	.	0.5187	0.00608	0.2448:0.199:0.1528:0.4035	.	230	Q5T764	IFT1B_HUMAN	K	230	ENSP00000360874:E230K	ENSP00000360874:E230K	E	+	1	0	IFIT1B	91133738	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-2.580000	0.00907	-1.086000	0.03084	-1.078000	0.02229	GAA	IFIT1B	-	pfscan_TPR-contain_dom	ENSG00000204010		0.428	IFIT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIT1B	HGNC	protein_coding	OTTHUMT00000049296.3		0.00	21	0	G	NM_001010987		91143758	+1			no_errors	ENST00000371809	ensembl	human	known	74_37	missense	9.09	30	3	SNP	0.000	A
IKZF1	10320	genome.wustl.edu	37	7	50459504	50459504	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:50459504G>T	ENST00000331340.3	+	7	948	c.793G>T	c.(793-795)Gac>Tac	p.D265Y	IKZF1_ENST00000438033.1_Missense_Mutation_p.D178Y|IKZF1_ENST00000343574.5_Missense_Mutation_p.D178Y|IKZF1_ENST00000440768.2_Missense_Mutation_p.G222V|IKZF1_ENST00000359197.5_Missense_Mutation_p.D223Y|IKZF1_ENST00000439701.1_Missense_Mutation_p.D223Y|IKZF1_ENST00000357364.4_Intron|IKZF1_ENST00000349824.4_Intron|IKZF1_ENST00000346667.4_Intron	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)	265					B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(131)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				TCTCGTGCTGGACAGACTAGC	0.403			"""D,T"""	BCL6	"""ALL, DLBCL"""																																			"""Rec,Dom"""	yes		7	7p12.2	10320	IKAROS family zinc finger 1		L	131	Unknown(131)	haematopoietic_and_lymphoid_tissue(131)											79.0	78.0	79.0					7																	50459504		1890	4123	6013	SO:0001583	missense	0			U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.793G>T	7.37:g.50459504G>T	ENSP00000331614:p.Asp265Tyr		A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D265Y	ENST00000331340.3	37	c.793		7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.4|22.4	4.282426|4.282426	0.80692|0.80692	.|.	.|.	ENSG00000185811|ENSG00000185811	ENST00000343574;ENST00000359197;ENST00000331340;ENST00000438033;ENST00000439701|ENST00000440768	T;T;T;T;T|T	0.08807|0.06068	3.05;3.11;3.14;3.05;3.11|3.35	5.23|5.23	5.23|5.23	0.72850|0.72850	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.22820|0.22820	0.0551|0.0551	.|.	.|.	.|.	0.53688|0.53688	D|D	0.999975|0.999975	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.83275|.	0.994;0.996;0.987|.	T|T	0.00269|0.00269	-1.1861|-1.1861	9|6	0.62326|0.62326	D|D	0.03|0.03	-25.6181|-25.6181	18.8054|18.8054	0.92035|0.92035	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	178;223;265|.	Q13422-2;Q13422-7;Q13422|.	.;.;IKZF1_HUMAN|.	Y|V	178;223;265;178;223|222	ENSP00000342750:D178Y;ENSP00000352123:D223Y;ENSP00000331614:D265Y;ENSP00000396554:D178Y;ENSP00000413025:D223Y|ENSP00000401507:G222V	ENSP00000331614:D265Y|ENSP00000401507:G222V	D|G	+|+	1|2	0|0	IKZF1|IKZF1	50426998|50426998	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.062000|8.062000	0.89475|0.89475	2.417000|2.417000	0.82017|0.82017	0.563000|0.563000	0.77884|0.77884	GAC|GGA	IKZF1	-	NULL	ENSG00000185811		0.403	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	IKZF1	HGNC	protein_coding	OTTHUMT00000342242.1	-	0.00	31	0	G	NM_006060		50459504	+1	tier1	-	no_errors	ENST00000331340	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
INPPL1	3636	genome.wustl.edu	37	11	71941179	71941179	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:71941179G>T	ENST00000298229.2	+	9	1158	c.954G>T	c.(952-954)gtG>gtT	p.V318V	INPPL1_ENST00000541756.1_Silent_p.V76V|INPPL1_ENST00000538751.1_Silent_p.V76V	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	318					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						AGCTAGATGTGACCCTGGGTG	0.617																																																	0													73.0	67.0	69.0					11																	71941179		2200	4293	6493	SO:0001819	synonymous_variant	0			Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.954G>T	11.37:g.71941179G>T			B2RTX5|Q13577|Q13578	Silent	SNP	pfam_Endo/exonuclease/phosphatase,pfam_SH2,pfam_SAM_2,pfam_SAM_type1,superfamily_Endo/exonuclease/phosphatase,superfamily_SAM/pointed,smart_SH2,smart_IPPc,smart_SAM,pfscan_SAM,pfscan_SH2,prints_SH2	p.V318	ENST00000298229.2	37	c.954	CCDS8213.1	11																																																																																			INPPL1	-	NULL	ENSG00000165458		0.617	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPPL1	HGNC	protein_coding	OTTHUMT00000396789.1	-	0.00	29	0	G	NM_001567		71941179	+1	tier1	-	no_errors	ENST00000298229	ensembl	human	known	74_37	silent	13.89	31	5	SNP	0.999	T
IL10RA	3587	genome.wustl.edu	37	11	117863957	117863957	+	Splice_Site	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:117863957G>T	ENST00000227752.3	+	4	489	c.369G>T	c.(367-369)gtG>gtT	p.V123V	IL10RA_ENST00000545409.1_5'UTR|IL10RA_ENST00000533700.1_3'UTR|IL10RA_ENST00000541785.1_Splice_Site_p.V103V	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	123					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		TCCATTTAGTGACTCTGACAG	0.542																																																	0													74.0	70.0	71.0					11																	117863957		2200	4296	6496	SO:0001630	splice_region_variant	0			U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.368-1G>T	11.37:g.117863957G>T			A8K6I0|B0YJ27	Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.D64Y	ENST00000227752.3	37	c.190	CCDS8388.1	11																																																																																			IL10RA	-	superfamily_Fibronectin_type3	ENSG00000110324		0.542	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL10RA	HGNC	protein_coding	OTTHUMT00000390167.1		0.00	44	0	G		Silent	117863957	+1			no_errors	ENST00000526544	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.996	T
IP6K2	51447	genome.wustl.edu	37	3	48726145	48726145	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:48726145G>T	ENST00000328631.5	-	6	1065	c.842C>A	c.(841-843)tCg>tAg	p.S281*	NCKIPSD_ENST00000416649.2_5'Flank|NCKIPSD_ENST00000341520.4_5'Flank|NCKIPSD_ENST00000294129.2_5'Flank	NM_001005909.2|NM_016291.3	NP_001005909.1|NP_057375.2	Q9UHH9	IP6K2_HUMAN	inositol hexakisphosphate kinase 2	281					cytokine-mediated signaling pathway (GO:0019221)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell growth (GO:0030308)|phosphate ion transport (GO:0006817)|phosphatidylinositol phosphorylation (GO:0046854)|positive regulation of apoptotic process (GO:0043065)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	15						GCCCTGCACCGATAGCTTCCG	0.572																																																	0													113.0	103.0	106.0					3																	48726145		2203	4300	6503	SO:0001587	stop_gained	0			AF177145	CCDS2777.1, CCDS33752.1, CCDS54579.1, CCDS54580.1, CCDS54581.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000068745	ENSG00000068745			17313	protein-coding gene	gene with protein product		606992	"""inositol hexaphosphate kinase 2"""	IHPK2		10574768	Standard	NM_016291		Approved		uc003cup.3	Q9UHH9	OTTHUMG00000133543	ENST00000328631.5:c.842C>A	3.37:g.48726145G>T	ENSP00000331103:p.Ser281*		A8K3B1|B4E3G6|G8JLL6|Q6P0N8|Q9BSZ6|Q9BUW3|Q9H4P7|Q9NT63|Q9UFU6	Nonsense_Mutation	SNP	pfam_IPK	p.S281*	ENST00000328631.5	37	c.842	CCDS2777.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.859145	0.97036	.	.	ENSG00000068745	ENST00000328631	.	.	.	5.75	4.88	0.63580	.	0.060518	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.5176	14.9703	0.71229	0.0684:0.0:0.9316:0.0	.	.	.	.	X	281	.	ENSP00000331103:S281X	S	-	2	0	IP6K2	48701149	1.000000	0.71417	0.756000	0.31282	0.903000	0.53119	9.869000	0.99810	1.442000	0.47568	0.655000	0.94253	TCG	IP6K2	-	pfam_IPK	ENSG00000068745		0.572	IP6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IP6K2	HGNC	protein_coding	OTTHUMT00000257521.2		0.00	61	0	G	NM_016291		48726145	-1			no_errors	ENST00000328631	ensembl	human	known	74_37	nonsense	5.13	37	2	SNP	0.997	T
IQGAP2	10788	genome.wustl.edu	37	5	75888710	75888710	+	Silent	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:75888710G>A	ENST00000274364.6	+	9	1164	c.867G>A	c.(865-867)ctG>ctA	p.L289L	IQGAP2_ENST00000379730.3_5'UTR	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	289					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AAGAACTGCTGACACAAGCAG	0.333																																																	0													145.0	152.0	149.0					5																	75888710		2203	4300	6503	SO:0001819	synonymous_variant	0			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.867G>A	5.37:g.75888710G>A			A8K4V1|B7Z8A4|J3KR91	Silent	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_dom,pfscan_RasGAP	p.L289	ENST00000274364.6	37	c.867	CCDS34188.1	5																																																																																			IQGAP2	-	NULL	ENSG00000145703		0.333	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP2	HGNC	protein_coding	OTTHUMT00000368877.1	-	0.00	50	0	G	NM_006633		75888710	+1	tier1	-	no_errors	ENST00000274364	ensembl	human	known	74_37	silent	11.67	53	7	SNP	1.000	A
ITGA8	8516	genome.wustl.edu	37	10	15726125	15726125	+	Splice_Site	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:15726125G>T	ENST00000378076.3	-	4	799	c.446C>A	c.(445-447)gCc>gAc	p.A149D		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	149					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						AGGAGCACAGGCCTAGGAAAC	0.373																																																	0													80.0	78.0	78.0					10																	15726125		2203	4300	6503	SO:0001630	splice_region_variant	0			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.445-1C>A	10.37:g.15726125G>T			B0YJ31|Q5VX94	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.A149D	ENST00000378076.3	37	c.446	CCDS31155.1	10	.	.	.	.	.	.	.	.	.	.	G	34	5.323890	0.95708	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.59772	0.24	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.83110	0.5183	M	0.92555	3.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.85511	0.1197	10	0.66056	D	0.02	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	149;149	F5H818;P53708	.;ITA8_HUMAN	D	149	ENSP00000367316:A149D	ENSP00000367316:A149D	A	-	2	0	ITGA8	15766131	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.861000	0.98227	0.655000	0.94253	GCC	ITGA8	-	NULL	ENSG00000077943		0.373	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA8	HGNC	protein_coding	OTTHUMT00000046987.1	-	0.00	33	0	G	NM_003638	Missense_Mutation	15726125	-1	tier1	-	no_errors	ENST00000378076	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
IZUMO1	284359	genome.wustl.edu	37	19	49248893	49248893	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:49248893A>G	ENST00000332955.2	-	2	771	c.224T>C	c.(223-225)aTg>aCg	p.M75T		NM_182575.2	NP_872381.2	Q8IYV9	IZUM1_HUMAN	izumo sperm-egg fusion 1	75					cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			endometrium(4)|kidney(3)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	17		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		AACGACCCCCATATAGGCATC	0.577																																																	0													126.0	107.0	113.0					19																	49248893		2203	4300	6503	SO:0001583	missense	0			BC034769	CCDS12732.1	19q13.33	2014-07-23			ENSG00000182264	ENSG00000182264		"""-"""	28539	protein-coding gene	gene with protein product	"""oocyte binding/fusion factor"""	609278				15759005, 18952059, 19658160, 22957301	Standard	NM_182575		Approved	IZUMO, MGC34799, OBF	uc002pkj.3	Q8IYV9	OTTHUMG00000183324	ENST00000332955.2:c.224T>C	19.37:g.49248893A>G	ENSP00000327786:p.Met75Thr		Q6Q8P6|Q6Q8P7	Missense_Mutation	SNP	NULL	p.M75T	ENST00000332955.2	37	c.224	CCDS12732.1	19	.	.	.	.	.	.	.	.	.	.	A	12.15	1.851486	0.32699	.	.	ENSG00000182264	ENST00000332955	T	0.22945	1.93	5.03	5.03	0.67393	.	0.549004	0.17114	N	0.186520	T	0.24470	0.0593	L	0.42245	1.32	0.25774	N	0.98481	P	0.45827	0.867	B	0.41202	0.35	T	0.17319	-1.0373	10	0.87932	D	0	-25.1401	11.7233	0.51696	1.0:0.0:0.0:0.0	.	75	Q8IYV9	IZUM1_HUMAN	T	75	ENSP00000327786:M75T	ENSP00000327786:M75T	M	-	2	0	IZUMO1	53940705	0.937000	0.31787	0.915000	0.36163	0.071000	0.16799	2.561000	0.45905	2.200000	0.70718	0.459000	0.35465	ATG	IZUMO1	-	NULL	ENSG00000182264		0.577	IZUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IZUMO1	HGNC	protein_coding	OTTHUMT00000466189.1	-	0.00	47	0	A	NM_182575		49248893	-1	tier1	-	no_errors	ENST00000332955	ensembl	human	known	74_37	missense	12.82	34	5	SNP	0.957	G
KALRN	8997	genome.wustl.edu	37	3	124438117	124438117	+	Nonsense_Mutation	SNP	G	G	T	rs184120997		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:124438117G>T	ENST00000291478.5	+	27	3833	c.3670G>T	c.(3670-3672)Gaa>Taa	p.E1224*	KALRN_ENST00000428018.2_Nonsense_Mutation_p.E1192*|KALRN_ENST00000360013.3_Nonsense_Mutation_p.E2921*	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2920					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E2921*(1)|p.E1224*(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GATCTTACAGGAAGATTTTCG	0.522																																																	2	Substitution - Nonsense(2)	endometrium(2)											58.0	58.0	58.0					3																	124438117		2203	4300	6503	SO:0001587	stop_gained	0			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.3670G>T	3.37:g.124438117G>T	ENSP00000291478:p.Glu1224*		A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Nonsense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.E2921*	ENST00000291478.5	37	c.8761	CCDS3028.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	41|41	8.883624|8.883624	0.98990|0.98990	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000360013;ENST00000291478;ENST00000428018|ENST00000354186	.|.	.|.	.|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	0.063439|.	0.64402|.	D|.	0.000005|.	.|T	.|0.75583	.|0.3869	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72640	.|-0.4232	.|4	0.05525|.	T|.	0.97|.	.|.	19.6296|19.6296	0.95694|0.95694	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|S	2921;1224;1192|2889	.|.	ENSP00000291478:E1224X|.	E|R	+|+	1|3	0|2	KALRN|KALRN	125920807|125920807	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.968000|0.968000	0.65278|0.65278	3.352000|3.352000	0.52239|0.52239	2.873000|2.873000	0.98535|0.98535	0.563000|0.563000	0.77884|0.77884	GAA|AGG	KALRN	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000160145		0.522	KALRN-001	KNOWN	basic|CCDS	protein_coding	KALRN	HGNC	protein_coding	OTTHUMT00000246891.5		0.00	22	0	G	NM_003947		124438117	+1			no_errors	ENST00000360013	ensembl	human	known	74_37	nonsense	5.56	34	2	SNP	1.000	T
KAT7	11143	genome.wustl.edu	37	17	47874232	47874232	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:47874232G>T	ENST00000259021.4	+	3	564	c.284G>T	c.(283-285)cGg>cTg	p.R95L	KAT7_ENST00000454930.2_Intron|KAT7_ENST00000424009.2_Missense_Mutation_p.R95L|KAT7_ENST00000510819.1_Intron|KAT7_ENST00000509773.1_Missense_Mutation_p.R95L|KAT7_ENST00000435742.2_5'UTR|KAT7_ENST00000503935.2_5'UTR	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	95					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TACCCTCTTCGGCAGACTCGT	0.488																																																	0													162.0	163.0	163.0					17																	47874232		2203	4300	6503	SO:0001583	missense	0			AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.284G>T	17.37:g.47874232G>T	ENSP00000259021:p.Arg95Leu		B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_C2HC,superfamily_Acyl_CoA_acyltransferase	p.R95L	ENST00000259021.4	37	c.284	CCDS11554.1	17	.	.	.	.	.	.	.	.	.	.	G	35	5.539268	0.96474	.	.	ENSG00000136504	ENST00000259021;ENST00000509773;ENST00000424009	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.76271	0.3964	L	0.50333	1.59	0.80722	D	1	D;D;D	0.63046	0.987;0.987;0.992	D;D;D	0.70487	0.931;0.931;0.969	T	0.76236	-0.3033	9	0.72032	D	0.01	-12.3726	19.9388	0.97151	0.0:0.0:1.0:0.0	.	95;95;95	B4DFB4;O95251;G5E9K7	.;KAT7_HUMAN;.	L	95	.	ENSP00000259021:R95L	R	+	2	0	KAT7	45229231	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.860000	0.92272	2.815000	0.96918	0.561000	0.74099	CGG	KAT7	-	NULL	ENSG00000136504		0.488	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT7	HGNC	protein_coding	OTTHUMT00000366032.1	-	0.00	43	0	G	NM_007067		47874232	+1	tier1	-	no_errors	ENST00000259021	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
KAZALD1	81621	genome.wustl.edu	37	10	102824320	102824320	+	Silent	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:102824320C>T	ENST00000370200.5	+	4	1061	c.735C>T	c.(733-735)ccC>ccT	p.P245P		NM_030929.4	NP_112191.2	Q96I82	KAZD1_HUMAN	Kazal-type serine peptidase inhibitor domain 1	245	Ig-like C2-type.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|regulation of cell growth (GO:0001558)	interstitial matrix (GO:0005614)				endometrium(1)|ovary(1)|prostate(2)	4				Epithelial(162;6.21e-09)|all cancers(201;3.14e-07)		CTGTGCGTCCCAGTGATGAGG	0.607																																																	0													61.0	54.0	56.0					10																	102824320		2203	4300	6503	SO:0001819	synonymous_variant	0			AF333487	CCDS7509.1	10q24.32	2013-01-11	2005-08-17		ENSG00000107821	ENSG00000107821		"""Immunoglobulin superfamily / I-set domain containing"""	25460	protein-coding gene	gene with protein product		609208	"""Kazal-type serine protease inhibitor domain 1"""			12975309	Standard	NM_030929		Approved	FKSG40, FKSG28	uc001ksr.3	Q96I82	OTTHUMG00000018918	ENST00000370200.5:c.735C>T	10.37:g.102824320C>T			D3DR74|Q6ZMB1|Q9BQ73	Silent	SNP	pfam_Ig_I-set,pfam_Kazal_dom,pfam_Immunoglobulin,pfam_IGFBP-like,smart_Kazal_dom,smart_Ig_sub,smart_Ig_sub2,pirsf_IGFBP_rP_mac25,pfscan_Ig-like_dom	p.P245	ENST00000370200.5	37	c.735	CCDS7509.1	10																																																																																			KAZALD1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pirsf_IGFBP_rP_mac25,pfscan_Ig-like_dom	ENSG00000107821		0.607	KAZALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAZALD1	HGNC	protein_coding	OTTHUMT00000049891.2		0.00	30	0	C	NM_030929		102824320	+1			no_errors	ENST00000370200	ensembl	human	known	74_37	silent	14.29	24	4	SNP	0.668	T
KCNH8	131096	genome.wustl.edu	37	3	19491739	19491739	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:19491739G>T	ENST00000328405.2	+	9	1783	c.1517G>T	c.(1516-1518)aGg>aTg	p.R506M	KCNH8_ENST00000537696.1_Missense_Mutation_p.R175M	NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	506					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CTCAAGCAGAGGATGCTCGAA	0.408																																					NSCLC(124;1625 1765 8018 24930 42026)												0													171.0	154.0	160.0					3																	19491739		2203	4300	6503	SO:0001583	missense	0			AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.1517G>T	3.37:g.19491739G>T	ENSP00000328813:p.Arg506Met		B7Z2I7|Q59GQ6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,pfam_PAS_4,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,superfamily_tRNA-bd_arm,smart_PAC,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_EAG,tigrfam_PAS	p.R506M	ENST00000328405.2	37	c.1517	CCDS2632.1	3	.	.	.	.	.	.	.	.	.	.	G	33	5.289449	0.95517	.	.	ENSG00000183960	ENST00000328405;ENST00000537696	D;T	0.97455	-4.39;1.79	6.02	6.02	0.97574	Cyclic nucleotide-binding-like (1);	0.000000	0.34959	U	0.003550	D	0.98924	0.9635	M	0.92459	3.31	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.988	D	0.99120	1.0849	9	.	.	.	.	20.5373	0.99239	0.0:0.0:1.0:0.0	.	175;506;506	B7Z2I7;B7Z398;Q96L42	.;.;KCNH8_HUMAN	M	506;175	ENSP00000328813:R506M;ENSP00000446294:R175M	.	R	+	2	0	KCNH8	19466743	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.835000	0.99442	2.857000	0.98124	0.650000	0.86243	AGG	KCNH8	-	superfamily_cNMP-bd-like,prints_K_chnl_volt-dep_ERG	ENSG00000183960		0.408	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH8	HGNC	protein_coding	OTTHUMT00000252139.2	-	0.00	47	0	G	NM_144633		19491739	+1	tier1	-	no_errors	ENST00000328405	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
KCNN3	3782	genome.wustl.edu	37	1	154794625	154794625	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:154794625G>T	ENST00000271915.4	-	2	1284	c.969C>A	c.(967-969)atC>atA	p.I323I	KCNN3_ENST00000358505.2_Silent_p.I10I|KCNN3_ENST00000361147.4_Silent_p.I18I	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	328					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	TGGACAGACTGATAAGGCATT	0.532																																																	0													157.0	126.0	137.0					1																	154794625		2203	4300	6503	SO:0001819	synonymous_variant	0			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.969C>A	1.37:g.154794625G>T			B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_2pore_dom_K_chnl_dom,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.I323	ENST00000271915.4	37	c.969	CCDS30880.1	1																																																																																			KCNN3	-	pfam_K_chnl_Ca-activ_SK	ENSG00000143603		0.532	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	HGNC	protein_coding	OTTHUMT00000090688.3	-	0.00	42	0	G	NM_002249		154794625	-1	tier1	-	no_errors	ENST00000271915	ensembl	human	novel	74_37	silent	6.15	61	4	SNP	1.000	T
KDM2B	84678	genome.wustl.edu	37	12	121878953	121878953	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:121878953C>T	ENST00000377071.4	-	20	3440	c.3368G>A	c.(3367-3369)cGg>cAg	p.R1123Q	KDM2B_ENST00000377069.4_Missense_Mutation_p.R1054Q|KDM2B_ENST00000536437.1_Intron|KDM2B_ENST00000542973.1_Missense_Mutation_p.R491Q	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	1123					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						GGGCTGTCGCCGGATGATGCC	0.622																																																	0													56.0	62.0	60.0					12																	121878953		2078	4216	6294	SO:0001583	missense	0			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.3368G>A	12.37:g.121878953C>T	ENSP00000366271:p.Arg1123Gln		A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	pfam_Znf_CXXC,pfam_F-box_dom,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.R1123Q	ENST00000377071.4	37	c.3368	CCDS41850.1	12	.	.	.	.	.	.	.	.	.	.	C	34	5.369375	0.95900	.	.	ENSG00000089094	ENST00000397480;ENST00000542973;ENST00000377069;ENST00000377071;ENST00000540043;ENST00000261824	T;T;T	0.34472	1.36;1.36;1.36	6.05	4.15	0.48705	.	0.473298	0.17875	N	0.159068	T	0.63319	0.2501	M	0.83483	2.645	0.80722	D	1	P;D;D;B	0.89917	0.693;0.996;1.0;0.212	B;P;D;B	0.79108	0.253;0.575;0.992;0.07	T	0.66468	-0.5916	10	0.54805	T	0.06	-28.3911	15.1839	0.72982	0.2577:0.7423:0.0:0.0	.	563;1123;1054;566	B7ZB05;Q8NHM5;A8MRS1;B4DSN4	.;KDM2B_HUMAN;.;.	Q	1111;491;1054;1123;566;1126	ENSP00000437821:R491Q;ENSP00000366269:R1054Q;ENSP00000366271:R1123Q	ENSP00000261824:R1126Q	R	-	2	0	KDM2B	120363336	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	4.902000	0.63266	0.806000	0.34183	0.643000	0.83706	CGG	KDM2B	-	NULL	ENSG00000089094		0.622	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KDM2B	HGNC	protein_coding	OTTHUMT00000402132.2	-	0.00	20	0	C	NM_032590		121878953	-1	tier1	-	no_errors	ENST00000377071	ensembl	human	known	74_37	missense	28.57	15	6	SNP	1.000	T
KIAA0100	9703	genome.wustl.edu	37	17	26945891	26945891	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:26945891G>T	ENST00000528896.2	-	32	5815	c.5741C>A	c.(5740-5742)gCt>gAt	p.A1914D	SPAG5-AS1_ENST00000414744.1_RNA|KIAA0100_ENST00000579924.2_5'UTR|SPAG5-AS1_ENST00000424210.1_RNA|SPAG5-AS1_ENST00000554154.1_RNA|KIAA0100_ENST00000544884.1_Missense_Mutation_p.A1771D|KIAA0100_ENST00000389003.3_Missense_Mutation_p.A1771D	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	1914						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					CCGTGCCTGAGCAAAGTAAAA	0.502																																																	0													133.0	111.0	119.0					17																	26945891		2203	4300	6503	SO:0001583	missense	0			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.5741C>A	17.37:g.26945891G>T	ENSP00000436773:p.Ala1914Asp		A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	pfam_FMP27_C,pfam_FMP27_N,pfam_FMP27_GFWDK_dom	p.A1914D	ENST00000528896.2	37	c.5741	CCDS32595.1	17	.	.	.	.	.	.	.	.	.	.	G	28.5	4.923867	0.92319	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.37752	1.18;1.18	5.36	5.36	0.76844	FMP27,  C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.44993	0.1320	N	0.25647	0.755	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.14200	-1.0481	10	0.07030	T	0.85	.	18.6657	0.91489	0.0:0.0:1.0:0.0	.	1914	Q14667	K0100_HUMAN	D	1914;1884;1914;1771	ENSP00000436773:A1914D;ENSP00000446443:A1771D	ENSP00000005905:A1914D	A	-	2	0	KIAA0100	23970018	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.153000	0.94687	2.518000	0.84900	0.655000	0.94253	GCT	KIAA0100	-	pfam_FMP27_C	ENSG00000007202		0.502	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	HGNC	protein_coding	OTTHUMT00000390571.3	-	0.00	36	0	G	NM_014680		26945891	-1	tier1	-	no_errors	ENST00000528896	ensembl	human	known	74_37	missense	13.64	19	3	SNP	1.000	T
KIAA0100	9703	genome.wustl.edu	37	17	26966978	26966978	+	Missense_Mutation	SNP	A	A	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:26966978A>C	ENST00000528896.2	-	9	1030	c.956T>G	c.(955-957)cTt>cGt	p.L319R	KIAA0100_ENST00000544884.1_Missense_Mutation_p.L176R|KIAA0100_ENST00000389003.3_Missense_Mutation_p.L176R	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	319						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					GAAGCTTCGAAGGGGCAGCTG	0.547																																																	0													126.0	120.0	122.0					17																	26966978		2203	4300	6503	SO:0001583	missense	0			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.956T>G	17.37:g.26966978A>C	ENSP00000436773:p.Leu319Arg		A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	pfam_FMP27_C,pfam_FMP27_N,pfam_FMP27_GFWDK_dom	p.L319R	ENST00000528896.2	37	c.956	CCDS32595.1	17	.	.	.	.	.	.	.	.	.	.	A	26.8	4.775819	0.90195	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.54071	0.59;0.71	5.72	5.72	0.89469	FMP27, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.63792	0.2541	L	0.34521	1.04	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.998	T	0.66709	-0.5855	10	0.66056	D	0.02	.	16.0037	0.80327	1.0:0.0:0.0:0.0	.	176;319;319	Q14667-4;F6XS94;Q14667	.;.;K0100_HUMAN	R	319;319;319;176	ENSP00000436773:L319R;ENSP00000446443:L176R	ENSP00000005905:L319R	L	-	2	0	KIAA0100	23991105	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	8.087000	0.89521	2.184000	0.69523	0.533000	0.62120	CTT	KIAA0100	-	pfam_FMP27_N	ENSG00000007202		0.547	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	HGNC	protein_coding	OTTHUMT00000390571.3		0.00	35	0	A	NM_014680		26966978	-1			no_errors	ENST00000528896	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	C
KIAA0586	9786	genome.wustl.edu	37	14	58979346	58979346	+	Splice_Site	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr14:58979346G>T	ENST00000556134.1	+	30	4658		c.e30+1		KIAA0586_ENST00000261244.5_Splice_Site|KIAA0586_ENST00000538571.2_Splice_Site|KIAA0586_ENST00000354386.6_Splice_Site|KIAA0586_ENST00000423743.3_Splice_Site	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586						cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CAGCAACAAGGTAAGACTTGT	0.313																																																	0													58.0	52.0	54.0					14																	58979346		1821	4072	5893	SO:0001630	splice_region_variant	0			AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.4384+1G>T	14.37:g.58979346G>T			B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Splice_Site	SNP	-	e29+1	ENST00000556134.1	37	c.4384+1	CCDS58321.1	14	.	.	.	.	.	.	.	.	.	.	G	18.12	3.553634	0.65425	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244;ENST00000555397	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.942	0.64062	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIAA0586	58049099	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.223000	0.58587	2.668000	0.90789	0.591000	0.81541	.	KIAA0586	-	-	ENSG00000100578		0.313	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0586	HGNC	protein_coding	OTTHUMT00000411887.1		0.00	47	0	G	NM_014749	Intron	58979346	+1			no_errors	ENST00000556134	ensembl	human	known	74_37	splice_site	6.12	46	3	SNP	1.000	T
KIAA1211	57482	genome.wustl.edu	37	4	57181632	57181632	+	Frame_Shift_Del	DEL	G	G	-	rs7672073	byFrequency	TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:57181632delG	ENST00000504228.1	+	6	2069	c.1964delG	c.(1963-1965)cgcfs	p.R655fs	KIAA1211_ENST00000264229.6_Frame_Shift_Del_p.R655fs|KIAA1211_ENST00000541073.1_Frame_Shift_Del_p.R648fs			Q6ZU35	K1211_HUMAN	KIAA1211	655			R -> P (in dbSNP:rs7672073). {ECO:0000269|PubMed:10574462, ECO:0000269|PubMed:11230166, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:17974005, ECO:0000269|Ref.4}.					p.R655fs*22(1)		endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					GCTAAGCCCCGCCAGGAGTCT	0.682																																																	1	Deletion - Frameshift(1)	large_intestine(1)											18.0	23.0	21.0					4																	57181632		1934	4105	6039	SO:0001589	frameshift_variant	0			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.1964delG	4.37:g.57181632delG	ENSP00000423366:p.Arg655fs		Q9NTE2|Q9NTP8|Q9ULK9	Frame_Shift_Del	DEL	NULL	p.R655fs	ENST00000504228.1	37	c.1964	CCDS43230.1	4																																																																																			KIAA1211	-	NULL	ENSG00000109265		0.682	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	HGNC	protein_coding	OTTHUMT00000362097.2		0.00	32	0	G	NM_020722		57181632	+1	tier1		no_errors	ENST00000504228	ensembl	human	known	74_37	frame_shift_del	8.70	21	2	DEL	0.003	-
KIAA1456	57604	genome.wustl.edu	37	8	12879455	12879455	+	Silent	SNP	C	C	T	rs371288288		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:12879455C>T	ENST00000524591.2	+	5	1756	c.1267C>T	c.(1267-1269)Ctg>Ttg	p.L423L	KIAA1456_ENST00000447063.2_Intron	NM_001099677.1|NM_020844.2	NP_001093147.1|NP_065895.2	Q9P272	K1456_HUMAN	KIAA1456	423							methyltransferase activity (GO:0008168)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7						GCTCTGCAGTCTGCTCAAGGA	0.453																																																	0													65.0	62.0	63.0					8																	12879455		1900	4122	6022	SO:0001819	synonymous_variant	0			BC035082	CCDS47808.1	8p22	2013-10-04	2011-02-23	2011-02-23	ENSG00000250305	ENSG00000250305			26725	protein-coding gene	gene with protein product		615666	"""chromosome 8 open reading frame 79"""	C8orf79		23381944	Standard	NM_020844		Approved	FLJ36980	uc010lsq.3	Q8N9K7	OTTHUMG00000165477	ENST00000524591.2:c.1267C>T	8.37:g.12879455C>T			Q96AW6	Silent	SNP	pfam_Methyltransf_11,pfam_Methyltransf_12,pfam_UbiE/COQ5_MeTrFase,pfam_Methyltransferase-rel	p.L423	ENST00000524591.2	37	c.1267	CCDS47808.1	8																																																																																			KIAA1456	-	NULL	ENSG00000250305		0.453	KIAA1456-008	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1456	HGNC	protein_coding	OTTHUMT00000383262.2		0.00	16	0	C	NM_001099677		12879455	+1			no_errors	ENST00000524591	ensembl	human	known	74_37	silent	42.86	8	6	SNP	0.732	T
KIAA2026	158358	genome.wustl.edu	37	9	5922857	5922857	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr9:5922857G>T	ENST00000399933.3	-	8	3138	c.3139C>A	c.(3139-3141)Ccg>Acg	p.P1047T	KIAA2026_ENST00000381461.2_Missense_Mutation_p.P1017T	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1047										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		GGCTTTATCGGGCTTGCTTCC	0.433																																																	0													99.0	93.0	95.0					9																	5922857		1896	4121	6017	SO:0001583	missense	0			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.3139C>A	9.37:g.5922857G>T	ENSP00000382815:p.Pro1047Thr		A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	superfamily_Bromodomain	p.P1047T	ENST00000399933.3	37	c.3139		9	.	.	.	.	.	.	.	.	.	.	G	7.774	0.708041	0.15239	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	5.33	2.02	0.26589	.	0.787818	0.11268	N	0.581827	T	0.31199	0.0789	L	0.27053	0.805	0.20926	N	0.999822	B	0.31548	0.328	B	0.34242	0.178	T	0.20638	-1.0269	9	0.38643	T	0.18	0.0379	9.9066	0.41379	0.2514:0.0:0.7486:0.0	.	1047	Q5HYC2	K2026_HUMAN	T	1047;1017	.	ENSP00000370870:P1017T	P	-	1	0	KIAA2026	5912857	0.989000	0.36119	0.790000	0.31976	0.054000	0.15201	1.470000	0.35354	0.095000	0.17434	-0.367000	0.07326	CCG	KIAA2026	-	NULL	ENSG00000183354		0.433	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2	-	0.00	40	0	G	NM_001017969		5922857	-1	tier1	-	no_errors	ENST00000399933	ensembl	human	novel	74_37	missense	7.27	51	4	SNP	0.551	T
KIF26B	55083	genome.wustl.edu	37	1	245850119	245850119	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:245850119C>G	ENST00000407071.2	+	12	4274	c.3834C>G	c.(3832-3834)atC>atG	p.I1278M	KIF26B_ENST00000366518.4_Missense_Mutation_p.I897M	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1278					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GCTCTTCCATCAGCTCCTGGC	0.627																																																	0													34.0	40.0	38.0					1																	245850119		2142	4237	6379	SO:0001583	missense	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.3834C>G	1.37:g.245850119C>G	ENSP00000385545:p.Ile1278Met		Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.I1278M	ENST00000407071.2	37	c.3834	CCDS44342.1	1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.317176	0.40996	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	D;D	0.84442	-1.85;-1.85	5.92	5.92	0.95590	.	.	.	.	.	D	0.91848	0.7420	M	0.82630	2.6	0.38123	D	0.93793	D;D	0.67145	0.996;0.996	P;P	0.61940	0.896;0.896	D	0.93483	0.6829	9	0.87932	D	0	.	15.0828	0.72127	0.1417:0.8583:0.0:0.0	.	897;1278	B7WPD9;Q2KJY2	.;KI26B_HUMAN	M	1278;897;894	ENSP00000385545:I1278M;ENSP00000355475:I897M	ENSP00000355475:I897M	I	+	3	3	KIF26B	243916742	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.148000	0.31614	2.813000	0.96785	0.561000	0.74099	ATC	KIF26B	-	NULL	ENSG00000162849		0.627	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1		0.00	21	0	C	XM_371354		245850119	+1			no_errors	ENST00000407071	ensembl	human	known	74_37	missense	10.00	27	3	SNP	1.000	G
KIFC3	3801	genome.wustl.edu	37	16	57798133	57798133	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr16:57798133G>T	ENST00000379655.4	-	12	1796	c.1539C>A	c.(1537-1539)gtC>gtA	p.V513V	KIFC3_ENST00000445690.2_Silent_p.V513V|KIFC3_ENST00000541240.1_Silent_p.V535V|KIFC3_ENST00000540079.2_Silent_p.V411V|KIFC3_ENST00000543930.1_Silent_p.V371V|KIFC3_ENST00000562903.1_Silent_p.V374V|KIFC3_ENST00000465878.2_Silent_p.V374V|KIFC3_ENST00000421376.2_Silent_p.V374V|KIFC3_ENST00000539578.1_Silent_p.V455V	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3	513	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				TGCAAGAGGTGACCAGGGCCT	0.647																																																	0													54.0	45.0	48.0					16																	57798133		2198	4300	6498	SO:0001819	synonymous_variant	0			BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455	ENST00000379655.4:c.1539C>A	16.37:g.57798133G>T			A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.V513	ENST00000379655.4	37	c.1539	CCDS10789.2	16																																																																																			KIFC3	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000140859		0.647	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIFC3	HGNC	protein_coding	OTTHUMT00000257329.2	-	0.00	23	0	G	NM_005550		57798133	-1	tier1	-	no_errors	ENST00000379655	ensembl	human	known	74_37	silent	20.00	12	3	SNP	1.000	T
KLHL33	123103	genome.wustl.edu	37	14	20897035	20897035	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr14:20897035G>T	ENST00000344581.4	-	4	1797	c.1575C>A	c.(1573-1575)acC>acA	p.T525T		NM_001109997.2	NP_001103467.2	A6NCF5	KLH33_HUMAN	kelch-like family member 33	525												all_cancers(95;0.00123)		Epithelial(56;7.57e-08)|all cancers(55;8.63e-07)	GBM - Glioblastoma multiforme(265;0.0223)|READ - Rectum adenocarcinoma(17;0.193)		TTTGGTGTGGGGTGGGAACCA	0.582																																																	0													65.0	63.0	64.0					14																	20897035		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS53882.1	14q11.2	2013-10-15	2013-02-22		ENSG00000185271	ENSG00000185271		"""Kelch-like"""	31952	protein-coding gene	gene with protein product			"""kelch-like 33 (Drosophila)"""				Standard	NM_001109997		Approved		uc010tli.2	A6NCF5	OTTHUMG00000170982	ENST00000344581.4:c.1575C>A	14.37:g.20897035G>T				Silent	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,superfamily_BTB/POZ_fold,smart_BACK,smart_Kelch_1	p.T525	ENST00000344581.4	37	c.1575	CCDS53882.1	14																																																																																			KLHL33	-	NULL	ENSG00000185271		0.582	KLHL33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL33	HGNC	protein_coding	OTTHUMT00000411038.1	-	0.00	75	0	G	XM_063481		20897035	-1	tier1	-	no_errors	ENST00000344581	ensembl	human	known	74_37	silent	6.94	67	5	SNP	0.002	T
KLRK1	22914	genome.wustl.edu	37	12	10541397	10541397	+	Missense_Mutation	SNP	G	G	T	rs544134653	byFrequency	TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:10541397G>T	ENST00000240618.6	-	2	153	c.13C>A	c.(13-15)Cgt>Agt	p.R5S	RP11-277P12.20_ENST00000500682.1_RNA|KLRK1_ENST00000540818.1_Missense_Mutation_p.R5S|KLRC4-KLRK1_ENST00000539300.1_3'UTR	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	5					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						CTCCGACCACGAATCCACCCC	0.383																																																	0													101.0	92.0	95.0					12																	10541397		2203	4300	6503	SO:0001583	missense	0			AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.13C>A	12.37:g.10541397G>T	ENSP00000240618:p.Arg5Ser		A8K7K5|A8K7P4|Q9NR41	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.R5S	ENST00000240618.6	37	c.13	CCDS8623.1	12	.	.	.	.	.	.	.	.	.	.	G	14.24	2.477666	0.44044	.	.	ENSG00000213809	ENST00000240618;ENST00000540818	T;T	0.01933	4.55;4.55	3.62	0.797	0.18654	.	1.108170	0.06929	N	0.810797	T	0.05547	0.0146	L	0.46157	1.445	0.09310	N	1	D;P	0.63880	0.993;0.953	P;P	0.55749	0.783;0.511	T	0.42292	-0.9460	10	0.87932	D	0	.	5.7336	0.18053	0.353:0.0:0.647:0.0	.	5;5	Q8WZ67;P26718	.;NKG2D_HUMAN	S	5	ENSP00000240618:R5S;ENSP00000446003:R5S	ENSP00000240618:R5S	R	-	1	0	KLRK1	10432664	0.001000	0.12720	0.010000	0.14722	0.012000	0.07955	0.638000	0.24674	0.168000	0.19655	-0.170000	0.13304	CGT	KLRK1	-	NULL	ENSG00000213809		0.383	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRK1	HGNC	protein_coding	OTTHUMT00000400269.1		0.00	23	0	G	NM_007360		10541397	-1			no_errors	ENST00000240618	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.012	T
KPNA1	3836	genome.wustl.edu	37	3	122180154	122180154	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:122180154G>T	ENST00000344337.6	-	5	525	c.349C>A	c.(349-351)Cct>Act	p.P117T	KPNA1_ENST00000466923.1_5'Flank	NM_002264.3	NP_002255.3	P52294	IMA5_HUMAN	karyopherin alpha 1 (importin alpha 5)	117					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|regulation of DNA recombination (GO:0000018)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	21				GBM - Glioblastoma multiforme(114;0.0898)		TCATCAATAGGAGGGTTAGGT	0.378																																					Melanoma(12;340 801 11196 19797)												0													69.0	70.0	70.0					3																	122180154		2203	4300	6503	SO:0001583	missense	0			S75295	CCDS3013.1	3q21	2013-02-14			ENSG00000114030	ENSG00000114030		"""Importins"", ""Armadillo repeat containing"""	6394	protein-coding gene	gene with protein product		600686				8052633	Standard	NM_002264		Approved	SRP1, RCH2, NPI-1, IPOA5	uc003efe.2	P52294	OTTHUMG00000159487	ENST00000344337.6:c.349C>A	3.37:g.122180154G>T	ENSP00000343701:p.Pro117Thr		D3DN93|Q6IBQ9|Q9BQ56	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.P117T	ENST00000344337.6	37	c.349	CCDS3013.1	3	.	.	.	.	.	.	.	.	.	.	G	25.2	4.614906	0.87359	.	.	ENSG00000114030	ENST00000344337;ENST00000465882;ENST00000482287;ENST00000476916;ENST00000493510	T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41	5.1	5.1	0.69264	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85230	0.5649	M	0.94101	3.495	0.80722	D	1	D	0.69078	0.997	P	0.61201	0.885	D	0.88933	0.3374	10	0.87932	D	0	-12.5199	18.0465	0.89334	0.0:0.0:1.0:0.0	.	117	P52294	IMA1_HUMAN	T	117	ENSP00000343701:P117T;ENSP00000419890:P117T;ENSP00000417166:P117T;ENSP00000417319:P117T;ENSP00000419257:P117T	ENSP00000343701:P117T	P	-	1	0	KPNA1	123662844	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.569000	0.98170	2.805000	0.96524	0.655000	0.94253	CCT	KPNA1	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000114030		0.378	KPNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA1	HGNC	protein_coding	OTTHUMT00000355740.1		0.00	25	0	G	NM_002264		122180154	-1			no_errors	ENST00000344337	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
KPNB1	3837	genome.wustl.edu	37	17	45750492	45750492	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:45750492G>T	ENST00000290158.4	+	13	2063	c.1656G>T	c.(1654-1656)ttG>ttT	p.L552F	KPNB1_ENST00000540627.1_Missense_Mutation_p.L407F|KPNB1_ENST00000537679.1_Missense_Mutation_p.L336F|KPNB1_ENST00000535458.2_Missense_Mutation_p.L407F	NM_001276453.1|NM_002265.4	NP_001263382.1|NP_002256.2	Q14974	IMB1_HUMAN	karyopherin (importin) beta 1	552					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|protein import into nucleus (GO:0006606)|protein import into nucleus, translocation (GO:0000060)|ribosomal protein import into nucleus (GO:0006610)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)	p.L552F(1)		breast(1)|ovary(1)|pancreas(1)|skin(1)	4						AAACGACTTTGGTCATCATGG	0.463																																																	1	Substitution - Missense(1)	endometrium(1)											125.0	119.0	121.0					17																	45750492		2203	4300	6503	SO:0001583	missense	0			L39793	CCDS11513.1, CCDS62228.1	17q21.32	2013-02-14			ENSG00000108424	ENSG00000108424		"""Importins"", ""Armadillo repeat containing"""	6400	protein-coding gene	gene with protein product	"""importin 1"""	602738				7615630, 7627554	Standard	NM_002265		Approved	NTF97, IPOB, MGC2155, MGC2156, MGC2157, IMB1, Impnb, IPO1	uc002ilt.2	Q14974	OTTHUMG00000036957	ENST00000290158.4:c.1656G>T	17.37:g.45750492G>T	ENSP00000290158:p.Leu552Phe		B7ZAV6|D3DTT3|Q14637|Q53XN2|Q96J27	Missense_Mutation	SNP	pfam_HEAT,pfam_Importin-beta_N,pfam_Armadillo,superfamily_ARM-type_fold,smart_Importin-beta_N,smart_Armadillo,pfscan_HEAT_type_2,pfscan_Importin-beta_N	p.L552F	ENST00000290158.4	37	c.1656	CCDS11513.1	17	.	.	.	.	.	.	.	.	.	.	G	12.93	2.085870	0.36758	.	.	ENSG00000108424	ENST00000535458;ENST00000290158;ENST00000540627;ENST00000537679	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	5.52	-2.18	0.07037	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.52805	0.1757	L	0.50333	1.59	0.38797	D	0.955109	P;P	0.46784	0.884;0.776	B;B	0.40782	0.34;0.198	T	0.60301	-0.7290	9	0.56958	D	0.05	-16.5928	7.3697	0.26794	0.4933:0.1129:0.3938:0.0	.	336;552	F5H4R7;Q14974	.;IMB1_HUMAN	F	407;552;407;336	ENSP00000438253:L407F;ENSP00000290158:L552F;ENSP00000438964:L407F;ENSP00000445006:L336F	ENSP00000290158:L552F	L	+	3	2	KPNB1	43105491	1.000000	0.71417	0.930000	0.37139	0.990000	0.78478	1.490000	0.35573	-0.010000	0.14271	0.655000	0.94253	TTG	KPNB1	-	superfamily_ARM-type_fold	ENSG00000108424		0.463	KPNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNB1	HGNC	protein_coding	OTTHUMT00000089755.2	-	0.00	74	0	G	NM_002265		45750492	+1	tier1	-	no_errors	ENST00000290158	ensembl	human	known	74_37	missense	6.33	74	5	SNP	0.952	T
KRTAP5-5	439915	genome.wustl.edu	37	11	1651241	1651241	+	Silent	SNP	A	A	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:1651241A>C	ENST00000399676.2	+	1	209	c.171A>C	c.(169-171)ggA>ggC	p.G57G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	57						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		gctgtgggggatgtggctccg	0.682																																																	0													47.0	59.0	55.0					11																	1651241		2188	4272	6460	SO:0001819	synonymous_variant	0			AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.171A>C	11.37:g.1651241A>C			A8MWN2	Silent	SNP	NULL	p.G57	ENST00000399676.2	37	c.171	CCDS41592.1	11																																																																																			KRTAP5-5	-	NULL	ENSG00000185940		0.682	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	HGNC	protein_coding	OTTHUMT00000127919.1	-	0.00	57	0	A			1651241	+1	tier1	-	no_errors	ENST00000399676	ensembl	human	known	74_37	silent	15.56	38	7	SNP	0.753	C
KSR1	8844	genome.wustl.edu	37	17	25877646	25877646	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:25877646C>T	ENST00000319524.6	+	2	284	c.284C>T	c.(283-285)gCt>gTt	p.A95V	KSR1_ENST00000509603.2_Missense_Mutation_p.A95V|KSR1_ENST00000268763.6_5'UTR|KSR1_ENST00000398988.3_5'UTR			Q8IVT5	KSR1_HUMAN	kinase suppressor of ras 1	95					Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	28	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		CTGAGCGTGGCTCCCGGTGAG	0.562																																					Esophageal Squamous(88;1120 1336 6324 10502 16832)												0													186.0	178.0	180.0					17																	25877646		876	1991	2867	SO:0001583	missense	0			U43586	CCDS58532.1	17q11.2	2012-05-23	2005-12-14	2005-12-14	ENSG00000141068	ENSG00000141068			6465	protein-coding gene	gene with protein product		601132	"""kinase suppressor of ras"""	KSR		8521512	Standard	XM_006722151		Approved	RSU2	uc031qzj.1	Q8IVT5	OTTHUMG00000132051	ENST00000319524.6:c.284C>T	17.37:g.25877646C>T	ENSP00000323178:p.Ala95Val		F8WEA9|H7BYU0|Q13476	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A95V	ENST00000319524.6	37	c.284		17	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996744	0.74818	.	.	ENSG00000141068	ENST00000319524;ENST00000509603	T;T	0.81163	-1.46;-1.45	4.79	4.79	0.61399	.	0.118743	0.56097	D	0.000022	D	0.87261	0.6133	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.88437	0.3039	7	0.62326	D	0.03	.	15.3873	0.74711	0.0:1.0:0.0:0.0	.	.	.	.	V	95	ENSP00000323178:A95V;ENSP00000438795:A95V	ENSP00000323178:A95V	A	+	2	0	KSR1	22901773	1.000000	0.71417	0.997000	0.53966	0.890000	0.51754	5.060000	0.64312	2.492000	0.84095	0.643000	0.83706	GCT	KSR1	-	NULL	ENSG00000141068		0.562	KSR1-202	KNOWN	basic|appris_candidate_longest	protein_coding	KSR1	HGNC	protein_coding		-	0.00	62	0	C	NM_014238		25877646	+1	tier1	-	no_errors	ENST00000319524	ensembl	human	known	74_37	missense	16.95	49	10	SNP	1.000	T
L3HYPDH	112849	genome.wustl.edu	37	14	59942614	59942614	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr14:59942614G>T	ENST00000247194.4	-	4	1025	c.912C>A	c.(910-912)ggC>ggA	p.G304G	L3HYPDH_ENST00000543619.1_5'Flank|L3HYPDH_ENST00000487285.1_Silent_p.G133G	NM_144581.1	NP_653182.1	Q96EM0	T3HPD_HUMAN	L-3-hydroxyproline dehydratase (trans-)	304					metabolic process (GO:0008152)		hydro-lyase activity (GO:0016836)|trans-L-3-hydroxyproline dehydratase activity (GO:0050346)									L-Proline(DB00172)	TGAATACTGAGCCAGTTGCAC	0.488																																																	0													87.0	83.0	85.0					14																	59942614		2203	4300	6503	SO:0001819	synonymous_variant	0			AI762327	CCDS9739.1	14q23.1	2012-08-15	2012-08-15	2012-08-15	ENSG00000126790	ENSG00000126790	4.2.1.77		20488	protein-coding gene	gene with protein product	"""trans-L-3-hydroxyproline dehydratase"""	614811	"""chromosome 14 open reading frame 149"""	C14orf149		22528483	Standard	NM_144581		Approved	FLJ25436	uc001xee.1	Q96EM0	OTTHUMG00000028941	ENST00000247194.4:c.912C>A	14.37:g.59942614G>T			Q96LJ5	Silent	SNP	pfam_Pro_racemase_fam,pirsf_Pro_racemase_fam	p.G304	ENST00000247194.4	37	c.912	CCDS9739.1	14																																																																																			L3HYPDH	-	pfam_Pro_racemase_fam,pirsf_Pro_racemase_fam	ENSG00000126790		0.488	L3HYPDH-003	KNOWN	basic|appris_principal|CCDS	protein_coding	L3HYPDH	HGNC	protein_coding	OTTHUMT00000072254.5	-	0.00	31	0	G	NM_144581		59942614	-1	tier1	-	no_errors	ENST00000247194	ensembl	human	known	74_37	silent	7.84	47	4	SNP	1.000	T
LAMB4	22798	genome.wustl.edu	37	7	107720173	107720173	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:107720173G>T	ENST00000388781.3	-	15	1843	c.1760C>A	c.(1759-1761)cCt>cAt	p.P587H	LAMB4_ENST00000388780.3_Missense_Mutation_p.P587H|LAMB4_ENST00000414450.2_Missense_Mutation_p.P587H|LAMB4_ENST00000205386.4_Missense_Mutation_p.P587H|LAMB4_ENST00000418464.1_Missense_Mutation_p.P587H	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	587	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						AGGGTTCCCAGGAACTGGCTC	0.507																																																	0													62.0	58.0	59.0					7																	107720173		2203	4300	6503	SO:0001583	missense	0			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.1760C>A	7.37:g.107720173G>T	ENSP00000373433:p.Pro587His		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.P587H	ENST00000388781.3	37	c.1760	CCDS34732.1	7	.	.	.	.	.	.	.	.	.	.	G	21.5	4.151319	0.78001	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780;ENST00000418464;ENST00000414450	T;T;T;T;T	0.32023	1.47;1.47;1.49;1.47;1.52	5.31	5.31	0.75309	Laminin IV (1);	0.129573	0.35320	N	0.003286	T	0.37128	0.0992	L	0.41710	1.295	0.39811	D	0.972702	D	0.71674	0.998	P	0.49999	0.628	T	0.06679	-1.0813	10	0.39692	T	0.17	.	18.7665	0.91874	0.0:0.0:1.0:0.0	.	587	A4D0S4	LAMB4_HUMAN	H	587	ENSP00000205386:P587H;ENSP00000373433:P587H;ENSP00000373432:P587H;ENSP00000402353:P587H;ENSP00000402265:P587H	ENSP00000205386:P587H	P	-	2	0	LAMB4	107507409	1.000000	0.71417	0.959000	0.39883	0.905000	0.53344	3.222000	0.51223	2.764000	0.94973	0.655000	0.94253	CCT	LAMB4	-	pfscan_Laminin_IV	ENSG00000091128		0.507	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB4	HGNC	protein_coding	OTTHUMT00000337442.1	-	0.00	49	0	G	XM_209857		107720173	-1	tier1	-	no_errors	ENST00000205386	ensembl	human	known	74_37	missense	13.51	32	5	SNP	0.999	T
LAP3	51056	genome.wustl.edu	37	4	17600162	17600162	+	Silent	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:17600162C>G	ENST00000226299.4	+	10	1435	c.1161C>G	c.(1159-1161)ctC>ctG	p.L387L	LAP3_ENST00000606142.1_Silent_p.L356L|LAP3_ENST00000503467.1_3'UTR|AC006160.5_ENST00000511010.1_RNA	NM_015907.2	NP_056991.2	P28838	AMPL_HUMAN	leucine aminopeptidase 3	387					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|urinary_tract(1)	20						AGGTCATCCTCAATGCCGCCA	0.488																																																	0													195.0	146.0	163.0					4																	17600162		2203	4300	6503	SO:0001819	synonymous_variant	0			AF061738	CCDS3422.1	4p15.33	2012-07-25	2003-09-12		ENSG00000002549	ENSG00000002549	3.4.11.1		18449	protein-coding gene	gene with protein product		170250	"""peptidase S"""	PEPS		6350155, 689684	Standard	NM_015907		Approved	LAPEP, LAP	uc003gph.1	P28838	OTTHUMG00000048214	ENST00000226299.4:c.1161C>G	4.37:g.17600162C>G			B3KMQ3|Q6IAM6|Q6P0L6|Q9UQE3	Silent	SNP	pfam_Peptidase_M17_C,pfam_Peptidase_M17_N,prints_Leucine_aapep/pepB	p.L387	ENST00000226299.4	37	c.1161	CCDS3422.1	4																																																																																			LAP3	-	pfam_Peptidase_M17_C,prints_Leucine_aapep/pepB	ENSG00000002549		0.488	LAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAP3	HGNC	protein_coding	OTTHUMT00000250365.1		0.00	51	0	C			17600162	+1			no_errors	ENST00000226299	ensembl	human	known	74_37	silent	22.22	28	8	SNP	0.967	G
LEPREL1	55214	genome.wustl.edu	37	3	189838136	189838136	+	Missense_Mutation	SNP	C	C	A	rs200731219		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:189838136C>A	ENST00000319332.5	-	1	582	c.385G>T	c.(385-387)Ggg>Tgg	p.G129W	LEPREL1_ENST00000427335.2_Intron|LEPREL1-AS1_ENST00000412203.1_RNA	NM_018192.3	NP_060662.2	Q8IVL5	P3H2_HUMAN	leprecan-like 1	129					collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|peptidyl-proline hydroxylation (GO:0019511)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(5)	41	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	GCGGGGCCCCCGAGGCGCTGG	0.711																																																	0								C	,TRP/GLY	1,4371		0,1,2185	10.0	9.0	10.0		,385	4.1	1.0	3		10	1,8565		0,1,4282	yes	intron,missense	LEPREL1	NM_001134418.1,NM_018192.3	,184	0,2,6467	AA,AC,CC		0.0117,0.0229,0.0155	,probably-damaging	,129/709	189838136	2,12936	2186	4283	6469	SO:0001583	missense	0				CCDS3294.1, CCDS46981.1	3q29	2014-01-28			ENSG00000090530	ENSG00000090530	1.14.11.7		19317	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 2"""	610341				15063763, 21885030	Standard	NM_018192		Approved	FLJ10718, MLAT4, P3H2	uc011bsk.2	Q8IVL5	OTTHUMG00000156312	ENST00000319332.5:c.385G>T	3.37:g.189838136C>A	ENSP00000316881:p.Gly129Trp		B3KPK0|B3KWI9|D3DNV8|Q9NVI2	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.G129W	ENST00000319332.5	37	c.385	CCDS3294.1	3	.	.	.	.	.	.	.	.	.	.	C	20.7	4.030921	0.75504	2.29E-4	1.17E-4	ENSG00000090530	ENST00000319332	T	0.38240	1.15	5.01	4.1	0.47936	.	0.121527	0.53938	D	0.000047	T	0.54854	0.1884	M	0.66439	2.03	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	T	0.53330	-0.8454	9	.	.	.	-20.1107	12.6692	0.56858	0.0:0.8349:0.1651:0.0	.	129	Q8IVL5	P3H2_HUMAN	W	129	ENSP00000316881:G129W	.	G	-	1	0	LEPREL1	191320830	0.992000	0.36948	1.000000	0.80357	0.809000	0.45718	4.305000	0.59110	2.607000	0.88179	0.462000	0.41574	GGG	LEPREL1	-	NULL	ENSG00000090530		0.711	LEPREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPREL1	HGNC	protein_coding	OTTHUMT00000343855.1	-	0.00	14	0	C	NM_018192		189838136	-1	tier1	rs200731219	no_errors	ENST00000319332	ensembl	human	known	74_37	missense	35.14	24	13	SNP	1.000	A
LIG3	3980	genome.wustl.edu	37	17	33318055	33318055	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:33318055G>C	ENST00000378526.4	+	5	1096	c.963G>C	c.(961-963)ttG>ttC	p.L321F	LIG3_ENST00000262327.5_Missense_Mutation_p.L321F	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	321					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	TTTACAACTTGAACGATAAGC	0.488								Other BER factors																																									0													128.0	116.0	120.0					17																	33318055		2203	4300	6503	SO:0001583	missense	0				CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.963G>C	17.37:g.33318055G>C	ENSP00000367787:p.Leu321Phe		Q16714|Q6NVK3	Missense_Mutation	SNP	pfam_DNA_ligase_ATP-dep_cent,pfam_DNA_ligase_ATP-dep_N,pfam_Znf_PARP,pfam_DNA_ligase_ATP-dep_C,superfamily_NA-bd_OB-fold,superfamily_BRCT_dom,superfamily_DNA_ligase_ATP-dep_N,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_PARP,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	p.L321F	ENST00000378526.4	37	c.963	CCDS11284.2	17	.	.	.	.	.	.	.	.	.	.	G	20.7	4.030402	0.75504	.	.	ENSG00000005156	ENST00000378526;ENST00000262327	T;T	0.23552	1.9;1.9	5.65	4.68	0.58851	DNA ligase, ATP-dependent, N-terminal (3);	0.000000	0.64402	D	0.000001	T	0.51584	0.1683	M	0.86268	2.805	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.995;0.995;0.995	T	0.56583	-0.7955	10	0.62326	D	0.03	-12.722	9.4263	0.38581	0.0748:0.1436:0.7816:0.0	.	321;321;321	E5KLB5;P49916;E5KLB6	.;DNLI3_HUMAN;.	F	321	ENSP00000367787:L321F;ENSP00000262327:L321F	ENSP00000262327:L321F	L	+	3	2	LIG3	30342168	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.610000	0.46325	1.621000	0.50320	0.655000	0.94253	TTG	LIG3	-	pfam_DNA_ligase_ATP-dep_N,superfamily_DNA_ligase_ATP-dep_N,tigrfam_DNA_ligase_ATP-dep	ENSG00000005156		0.488	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG3	HGNC	protein_coding	OTTHUMT00000250330.3	-	0.00	39	0	G	NM_013975		33318055	+1	tier1	-	no_errors	ENST00000378526	ensembl	human	known	74_37	missense	27.66	34	13	SNP	1.000	C
LIMA1	51474	genome.wustl.edu	37	12	50615856	50615856	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:50615856G>T	ENST00000341247.4	-	4	727	c.578C>A	c.(577-579)cCg>cAg	p.P193Q	LIMA1_ENST00000552783.1_Missense_Mutation_p.P33Q|LIMA1_ENST00000552909.1_Missense_Mutation_p.P33Q|LIMA1_ENST00000552823.1_Missense_Mutation_p.P33Q|LIMA1_ENST00000552008.1_5'Flank|LIMA1_ENST00000394943.3_Missense_Mutation_p.P193Q|RP3-405J10.4_ENST00000551284.1_RNA	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1	193					actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						CCTGTTCAGCGGAACATTATA	0.378																																																	0													184.0	183.0	183.0					12																	50615856		2203	4300	6503	SO:0001583	missense	0			AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.578C>A	12.37:g.50615856G>T	ENSP00000340184:p.Pro193Gln		B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.P193Q	ENST00000341247.4	37	c.578	CCDS8802.1	12	.	.	.	.	.	.	.	.	.	.	G	18.51	3.639277	0.67244	.	.	ENSG00000050405	ENST00000552823;ENST00000394943;ENST00000341247;ENST00000552783;ENST00000552909;ENST00000420992	D;D;D;D;D	0.90676	-2.32;-2.71;-1.97;-2.32;-2.33	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.95227	0.8452	M	0.69823	2.125	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.87578	0.988;0.944;0.998	D	0.94343	0.7572	10	0.54805	T	0.06	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	202;193;33	Q59FE8;Q9UHB6;F8VQE1	.;LIMA1_HUMAN;.	Q	33;193;193;33;33;112	ENSP00000450266:P33Q;ENSP00000378400:P193Q;ENSP00000340184:P193Q;ENSP00000448779:P33Q;ENSP00000450087:P33Q	ENSP00000340184:P193Q	P	-	2	0	LIMA1	48902123	1.000000	0.71417	0.998000	0.56505	0.658000	0.38924	6.537000	0.73847	2.941000	0.99782	0.655000	0.94253	CCG	LIMA1	-	NULL	ENSG00000050405		0.378	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	LIMA1	HGNC	protein_coding	OTTHUMT00000406235.2	-	0.00	38	0	G	NM_016357		50615856	-1	tier1	-	no_errors	ENST00000394943	ensembl	human	known	74_37	missense	8.20	56	5	SNP	0.997	T
LIMCH1	22998	genome.wustl.edu	37	4	41699228	41699228	+	3'UTR	SNP	T	T	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:41699228T>C	ENST00000313860.7	+	0	3332				LIMCH1_ENST00000396595.3_3'UTR|LIMCH1_ENST00000515785.1_3'UTR|LIMCH1_ENST00000381753.4_3'UTR|LIMCH1_ENST00000513024.1_3'UTR|LIMCH1_ENST00000508501.1_3'UTR|LIMCH1_ENST00000509277.1_3'UTR|LIMCH1_ENST00000514096.1_3'UTR|LIMCH1_ENST00000512820.1_3'UTR|LIMCH1_ENST00000512632.1_3'UTR|LIMCH1_ENST00000511496.1_3'UTR|LIMCH1_ENST00000503057.1_3'UTR|LIMCH1_ENST00000512946.1_3'UTR	NM_014988.2	NP_055803.2	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1						actomyosin structure organization (GO:0031032)		zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(5)	41						TCCGGATCACTCACCATTTCT	0.453																																																	0													148.0	132.0	138.0					4																	41699228		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AB029025	CCDS33977.1, CCDS47047.1, CCDS54763.1, CCDS54764.1, CCDS54765.1, CCDS75119.1, CCDS75121.1	4p13	2007-06-14		2008-01-09	ENSG00000064042	ENSG00000064042			29191	protein-coding gene	gene with protein product						10470851	Standard	XM_005248057		Approved	DKFZP686A01247, LIMCH1A, LMO7B	uc003gvz.4	Q9UPQ0	OTTHUMG00000160575	ENST00000313860.7:c.*26T>C	4.37:g.41699228T>C			A8MXC3|E9PHM7|Q503B5|Q5CZB1|Q5CZB6|Q5H9S8|Q68E07|Q6PJ44|Q7Z3G5|Q8N3S9|Q8N6M2	RNA	SNP	-	NULL	ENST00000313860.7	37	NULL	CCDS33977.1	4																																																																																			LIMCH1	-	-	ENSG00000064042		0.453	LIMCH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LIMCH1	HGNC	protein_coding	OTTHUMT00000361249.2	-	0.00	30	0	T	NM_014988		41699228	+1	tier1	-	no_errors	ENST00000515785	ensembl	human	known	74_37	rna	13.79	25	4	SNP	0.027	C
LINC00205	257103	genome.wustl.edu	37	21	46716123	46716123	+	lincRNA	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr21:46716123C>G	ENST00000433465.1	+	0	245							P59089	CU086_HUMAN	long intergenic non-protein coding RNA 205																		acagcaggctccctccccgag	0.532																																																	0																																												0			AF426264		21q22.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000223768	ENSG00000223768		"""Long non-coding RNAs"""	16420	non-coding RNA	RNA, long non-coding			"""chromosome 21 open reading frame 86"", ""non-protein coding RNA 205"""	C21orf86, NCRNA00205		12036297	Standard			Approved			P59089	OTTHUMG00000090403		21.37:g.46716123C>G				RNA	SNP	-	NULL	ENST00000433465.1	37	NULL		21																																																																																			LINC00205	-	-	ENSG00000223768		0.532	LINC00205-001	KNOWN	basic|exp_conf	lincRNA	LINC00205	HGNC	lincRNA	OTTHUMT00000206823.2	-	0.00	45	0	C			46716123	+1	tier1	-	no_errors	ENST00000433465	ensembl	human	known	74_37	rna	25.64	29	10	SNP	0.001	G
LINC00452	643365	genome.wustl.edu	37	13	114622591	114622591	+	lincRNA	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr13:114622591C>T	ENST00000609661.1	+	0	795									long intergenic non-protein coding RNA 452																		GGCCCAGCACCTGGAAACTCC	0.567																																																	0																																												0					13q34	2014-04-09			ENSG00000229373	ENSG00000229373		"""Long non-coding RNAs"""	42800	other	unknown			"""long intergenic non-protein coding RNA 453"""	LINC00453			Standard	NM_001278674		Approved				OTTHUMG00000017394		13.37:g.114622591C>T				RNA	SNP	-	NULL	ENST00000609661.1	37	NULL		13																																																																																			LINC00452	-	-	ENSG00000229373		0.567	LINC00452-003	KNOWN	basic	lincRNA	LINC00452	HGNC	lincRNA	OTTHUMT00000473163.1		0.00	59	0	C			114622591	+1			no_errors	ENST00000426859	ensembl	human	known	74_37	rna	5.88	48	3	SNP	0.004	T
LIPM	340654	genome.wustl.edu	37	10	90580014	90580014	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:90580014G>T	ENST00000404743.4	+	9	1195	c.1028G>T	c.(1027-1029)aGa>aTa	p.R343I	LIPM_ENST00000539337.1_Missense_Mutation_p.R303I|ANKRD22_ENST00000476963.1_5'Flank	NM_001128215.1	NP_001121687.1	Q5VYY2	LIPM_HUMAN	lipase, family member M	343					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)|skin(1)	7						TACAGAGTCAGAGATATGACG	0.433																																																	0													90.0	74.0	79.0					10																	90580014		692	1591	2283	SO:0001583	missense	0				CCDS44457.1	10q23.31	2008-02-04	2007-02-27	2007-02-27	ENSG00000173239	ENSG00000173239			23455	protein-coding gene	gene with protein product		613923	"""lipase-like, ab-hydrolase domain containing 3"""	LIPL3			Standard	NM_001128215		Approved	bA304I5.1	uc009xtm.1	Q5VYY2	OTTHUMG00000018698	ENST00000404743.4:c.1028G>T	10.37:g.90580014G>T	ENSP00000383901:p.Arg343Ile		A6PVS3|B2RXK7|B5MCR3	Missense_Mutation	SNP	pfam_AB_hydrolase_lipase,pfam_AB_hydrolase_1	p.R343I	ENST00000404743.4	37	c.1028	CCDS44457.1	10	.	.	.	.	.	.	.	.	.	.	G	13.45	2.240675	0.39598	.	.	ENSG00000173239	ENST00000404743;ENST00000539337	T;T	0.72167	-0.63;-0.63	5.75	2.47	0.30058	Alpha/beta hydrolase fold-1 (1);	0.635785	0.16046	N	0.232166	T	0.66237	0.2769	L	0.54323	1.7	0.09310	N	0.999999	B;B	0.27013	0.022;0.166	B;B	0.33620	0.148;0.167	T	0.61128	-0.7125	10	0.59425	D	0.04	-3.3781	9.2144	0.37337	0.3408:0.0:0.6592:0.0	.	303;343	B2RXK7;Q5VYY2	.;LIPM_HUMAN	I	343;303	ENSP00000383901:R343I;ENSP00000440375:R303I	ENSP00000383901:R343I	R	+	2	0	LIPM	90569994	0.307000	0.24500	0.414000	0.26521	0.981000	0.71138	2.114000	0.41911	0.784000	0.33661	0.655000	0.94253	AGA	LIPM	-	pfam_AB_hydrolase_1	ENSG00000173239		0.433	LIPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPM	HGNC	protein_coding	OTTHUMT00000049261.3	-	0.00	25	0	G	XM_291663		90580014	+1	tier1	-	no_errors	ENST00000404743	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.011	T
LNX2	222484	genome.wustl.edu	37	13	28122482	28122482	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr13:28122482C>T	ENST00000316334.3	-	10	2192	c.2063G>A	c.(2062-2064)aGc>aAc	p.S688N		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	688	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		CTATACAAGGCTGCCAGGCCA	0.423																																																	0													81.0	69.0	73.0					13																	28122482		2203	4300	6503	SO:0001583	missense	0			AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.2063G>A	13.37:g.28122482C>T	ENSP00000325929:p.Ser688Asn		Q5W0P0|Q6ZMH2|Q96SH4	Missense_Mutation	SNP	pfam_PDZ,pfam_Znf_C3HC4_RING-type,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.S688N	ENST00000316334.3	37	c.2063	CCDS9323.1	13	.	.	.	.	.	.	.	.	.	.	C	27.3	4.816072	0.90790	.	.	ENSG00000139517	ENST00000316334	T	0.08984	3.03	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.27832	0.0685	M	0.68952	2.095	0.80722	D	1	D	0.63046	0.992	P	0.61477	0.889	T	0.00143	-1.1996	10	0.87932	D	0	.	20.0362	0.97558	0.0:1.0:0.0:0.0	.	688	Q8N448	LNX2_HUMAN	N	688	ENSP00000325929:S688N	ENSP00000325929:S688N	S	-	2	0	LNX2	27020482	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	7.818000	0.86416	2.737000	0.93849	0.585000	0.79938	AGC	LNX2	-	NULL	ENSG00000139517		0.423	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNX2	HGNC	protein_coding	OTTHUMT00000044302.2	-	0.00	26	0	C			28122482	-1	tier1	-	no_errors	ENST00000316334	ensembl	human	known	74_37	missense	33.33	18	9	SNP	1.000	T
RP11-435B5.5	0	genome.wustl.edu	37	1	143392560	143392560	+	lincRNA	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:143392560C>T	ENST00000428624.1	+	0	2183				RP11-435B5.4_ENST00000423249.1_lincRNA																							AAAATGAAAACTGCTTATGAA	0.318																																																	0																																												0																															1.37:g.143392560C>T				RNA	SNP	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			RP11-435B5.5	-	-	ENSG00000238261		0.318	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	Clone_based_vega_gene	lincRNA	OTTHUMT00000037971.1	-	0.00	479	0	C			143392560	+1	tier1	-	no_errors	ENST00000415543	ensembl	human	known	74_37	rna	7.69	384	32	SNP	0.012	T
GOLGA2P9	440518	genome.wustl.edu	37	19	22782276	22782276	+	RNA	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:22782276G>T	ENST00000600260.1	+	0	326				RN7SL860P_ENST00000473738.2_RNA	NR_033899.1																						AGATACATTTGCTGAGATTCT	0.488																																																	0																																												0																															19.37:g.22782276G>T				RNA	SNP	-	NULL	ENST00000600260.1	37	NULL		19																																																																																			CTC-457E21.3	-	-	ENSG00000269332		0.488	CTC-457E21.3-001	KNOWN	basic	processed_transcript	LOC440518	Clone_based_vega_gene	pseudogene	OTTHUMT00000464572.1	-	0.00	93	0	G			22782276	+1	tier1	-	no_errors	ENST00000597408	ensembl	human	known	74_37	rna	15.87	53	10	SNP	0.747	T
LOC653786	653786	genome.wustl.edu	37	16	22558146	22558146	+	RNA	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr16:22558146C>G	ENST00000550753.1	+	0	1128					NR_003676.2																						ccaatTTTCTCGGTCAAGGAA	0.473																																																	0																																												0																															16.37:g.22558146C>G				RNA	SNP	-	NULL	ENST00000550753.1	37	NULL		16																																																																																			RP11-368J21.3	-	-	ENSG00000257838		0.473	RP11-368J21.3-001	KNOWN	basic	processed_transcript	LOC653786	Clone_based_vega_gene	pseudogene	OTTHUMT00000409041.1		0.00	50	0	C			22558146	+1			no_errors	ENST00000550753	ensembl	human	known	74_37	rna	9.76	37	4	SNP	0.002	G
LOC728715	728715	genome.wustl.edu	37	12	9728249	9728249	+	RNA	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:9728249C>G	ENST00000520314.1	+	0	7248																											AAGAATATGCCCTAGCTTTTT	0.303																																																	0																																												0																															12.37:g.9728249C>G				RNA	SNP	-	NULL	ENST00000520314.1	37	NULL		12																																																																																			RP11-726G1.1	-	-	ENSG00000214776		0.303	RP11-726G1.1-002	KNOWN	basic	processed_transcript	LOC728715	Clone_based_vega_gene	pseudogene	OTTHUMT00000381543.1	-	0.00	70	0	C			9728249	+1	tier1	-	no_errors	ENST00000520314	ensembl	human	known	74_37	rna	28.43	72	29	SNP	0.032	G
LPHN3	23284	genome.wustl.edu	37	4	62812670	62812670	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:62812670G>T	ENST00000514591.1	+	15	2583	c.2254G>T	c.(2254-2256)Ggt>Tgt	p.G752C	LPHN3_ENST00000504896.1_Missense_Mutation_p.G752C|LPHN3_ENST00000509896.1_Missense_Mutation_p.G820C|LPHN3_ENST00000545650.1_Missense_Mutation_p.G752C|LPHN3_ENST00000507164.1_Missense_Mutation_p.G820C|LPHN3_ENST00000506700.1_Missense_Mutation_p.G752C|LPHN3_ENST00000506746.1_Missense_Mutation_p.G820C|LPHN3_ENST00000507625.1_Missense_Mutation_p.G820C|LPHN3_ENST00000511324.1_Missense_Mutation_p.G820C|LPHN3_ENST00000514157.1_Missense_Mutation_p.G752C|LPHN3_ENST00000512091.2_Missense_Mutation_p.G752C|LPHN3_ENST00000506720.1_Missense_Mutation_p.G820C|LPHN3_ENST00000514996.1_Missense_Mutation_p.G752C|LPHN3_ENST00000508946.1_Missense_Mutation_p.G752C|LPHN3_ENST00000508078.1_3'UTR|LPHN3_ENST00000508693.1_Missense_Mutation_p.G820C			Q9HAR2	LPHN3_HUMAN	latrophilin 3	739					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						TAACAACTTGGGTCCTTATTT	0.393																																																	0													261.0	243.0	249.0					4																	62812670		1877	4117	5994	SO:0001583	missense	0			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.2254G>T	4.37:g.62812670G>T	ENSP00000422533:p.Gly752Cys		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like	p.G820C	ENST00000514591.1	37	c.2458	CCDS54768.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.0|29.0	4.971556|4.971556	0.92919|0.92919	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996|ENST00000502815	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.22539|.	1.95;1.95;1.95;1.95;1.95;1.95;1.95;1.95;1.95;1.95;1.95;1.95;1.95;1.95;1.95|.	5.51|5.51	5.51|5.51	0.81932|0.81932	Domain of unknown function DUF3497 (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.75064|0.75064	0.3799|0.3799	M|M	0.67397|0.67397	2.05|2.05	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	T|T	0.73222|0.73222	-0.4051|-0.4051	10|6	0.87932|.	D|.	0|.	.|.	19.4278|19.4278	0.94751|0.94751	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	752;739;752|.	E9PE04;Q9HAR2;Q9HAR2-2|.	.;LPHN3_HUMAN;.|.	C|V	752;752;820;820;752;752;739;752;820;820;820;752;752;752;820;820;752|209	ENSP00000423388:G752C;ENSP00000422533:G752C;ENSP00000423787:G820C;ENSP00000425033:G820C;ENSP00000424120:G752C;ENSP00000439831:G752C;ENSP00000421476:G820C;ENSP00000424030:G820C;ENSP00000421372:G820C;ENSP00000425201:G752C;ENSP00000423434:G752C;ENSP00000421627:G752C;ENSP00000420931:G820C;ENSP00000425884:G820C;ENSP00000424258:G752C|.	ENSP00000280009:G752C|.	G|G	+|+	1|2	0|0	LPHN3|LPHN3	62495265|62495265	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	8.007000|8.007000	0.88571|0.88571	2.595000|2.595000	0.87683|0.87683	0.557000|0.557000	0.71058|0.71058	GGT|GGG	LPHN3	-	pfam_DUF3497	ENSG00000150471		0.393	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	LPHN3	HGNC	protein_coding	OTTHUMT00000361765.1	-	0.00	98	0	G			62812670	+1	tier1	-	no_errors	ENST00000507625	ensembl	human	known	74_37	missense	8.94	112	11	SNP	1.000	T
LRP6	4040	genome.wustl.edu	37	12	12279828	12279828	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:12279828G>T	ENST00000261349.4	-	20	4185	c.4109C>A	c.(4108-4110)gCc>gAc	p.A1370D	LRP6_ENST00000543091.1_Missense_Mutation_p.A1325D|BCL2L14_ENST00000396369.1_Intron|LRP6_ENST00000540415.1_Intron	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1370					anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				TGTATTGGTGGCCTGTGGTGC	0.383																																																	0													92.0	87.0	89.0					12																	12279828		2203	4300	6503	SO:0001583	missense	0			AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.4109C>A	12.37:g.12279828G>T	ENSP00000261349:p.Ala1370Asp		Q17RZ2	Missense_Mutation	SNP	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.A1370D	ENST00000261349.4	37	c.4109	CCDS8647.1	12	.	.	.	.	.	.	.	.	.	.	G	12.67	2.008513	0.35415	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.93659	-3.21;-3.26	5.84	4.92	0.64577	.	0.317556	0.26355	N	0.024841	T	0.82171	0.4979	N	0.01168	-0.975	0.42344	D	0.992347	B;B	0.18310	0.027;0.01	B;B	0.15484	0.009;0.013	T	0.77910	-0.2411	10	0.34782	T	0.22	.	17.0532	0.86525	0.0:0.1265:0.8735:0.0	.	1325;1370	F5H7J9;O75581	.;LRP6_HUMAN	D	1370;1325	ENSP00000261349:A1370D;ENSP00000442472:A1325D	ENSP00000261349:A1370D	A	-	2	0	LRP6	12171095	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.409000	0.80053	2.751000	0.94390	0.563000	0.77884	GCC	LRP6	-	pirsf_Low_density_Lipo_rcpt-rel_p5/6,superfamily_LDrepeatLR_classA_rpt	ENSG00000070018		0.383	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP6	HGNC	protein_coding	OTTHUMT00000400137.1	-	0.00	76	0	G			12279828	-1	tier1	-	no_errors	ENST00000261349	ensembl	human	known	74_37	missense	6.25	89	6	SNP	1.000	T
LRRC28	123355	genome.wustl.edu	37	15	99816796	99816796	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:99816796C>G	ENST00000301981.3	+	3	424	c.184C>G	c.(184-186)Cag>Gag	p.Q62E	LRRC28_ENST00000422500.2_Missense_Mutation_p.Q62E|LRRC28_ENST00000331450.5_Missense_Mutation_p.Q62E|LRRC28_ENST00000447360.2_Missense_Mutation_p.Q62E|LRRC28_ENST00000442993.2_Missense_Mutation_p.Q62E|LRRC28_ENST00000559399.1_3'UTR|LRRC28_ENST00000558879.1_Intron	NM_144598.2	NP_653199.2	Q86X40	LRC28_HUMAN	leucine rich repeat containing 28	62										endometrium(2)|large_intestine(3)|lung(6)|prostate(1)	12	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)			AAACCTTGCTCAGAAGCTTCC	0.259																																																	0													34.0	37.0	36.0					15																	99816796		2183	4273	6456	SO:0001583	missense	0			AK091588	CCDS10380.1, CCDS66873.1	15q26.3	2004-06-29			ENSG00000168904	ENSG00000168904			28355	protein-coding gene	gene with protein product						12975309	Standard	XM_005254861		Approved	MGC24976, FLJ34269, FLJ45242	uc002bva.1	Q86X40	OTTHUMG00000149854	ENST00000301981.3:c.184C>G	15.37:g.99816796C>G	ENSP00000304923:p.Gln62Glu		A8KA22|Q6UY49|Q6ZSS6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.Q62E	ENST00000301981.3	37	c.184	CCDS10380.1	15	.	.	.	.	.	.	.	.	.	.	C	15.73	2.919504	0.52653	.	.	ENSG00000168904	ENST00000301981;ENST00000447360;ENST00000422500;ENST00000442993;ENST00000331450	T;T;T;T;T	0.56103	0.48;0.48;0.48;0.48;0.7	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.49983	0.1589	N	0.03209	-0.39	0.58432	D	0.999997	D;P;D;P	0.59357	0.985;0.593;0.982;0.843	D;B;D;P	0.73708	0.981;0.388;0.968;0.848	T	0.56998	-0.7886	10	0.28530	T	0.3	.	16.4823	0.84161	0.0:1.0:0.0:0.0	.	62;62;62;62	B4DHL3;Q8WUS2;Q86X40-2;Q86X40	.;.;.;LRC28_HUMAN	E	62	ENSP00000304923:Q62E;ENSP00000404520:Q62E;ENSP00000398606:Q62E;ENSP00000404206:Q62E;ENSP00000332035:Q62E	ENSP00000304923:Q62E	Q	+	1	0	LRRC28	97634319	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.382000	0.59594	2.675000	0.91044	0.650000	0.86243	CAG	LRRC28	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000168904		0.259	LRRC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC28	HGNC	protein_coding	OTTHUMT00000313546.1	-	0.00	63	0	C	NM_144598		99816796	+1	tier1	-	no_errors	ENST00000301981	ensembl	human	known	74_37	missense	8.64	74	7	SNP	1.000	G
LRRC41	10489	genome.wustl.edu	37	1	46752057	46752057	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:46752057G>C	ENST00000343304.6	-	4	757	c.472C>G	c.(472-474)Ctg>Gtg	p.L158V	LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	158					protein ubiquitination (GO:0016567)	membrane (GO:0016020)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					GAGCTGTGCAGAAGAGGTGAG	0.557																																																	0													58.0	60.0	59.0					1																	46752057		2203	4300	6503	SO:0001583	missense	0			AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.472C>G	1.37:g.46752057G>C	ENSP00000343298:p.Leu158Val		A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.L158V	ENST00000343304.6	37	c.472	CCDS533.1	1	.	.	.	.	.	.	.	.	.	.	g	16.03	3.008311	0.54361	.	.	ENSG00000132128	ENST00000343304;ENST00000371972	D	0.83992	-1.79	5.08	5.08	0.68730	.	0.331668	0.25708	N	0.028821	T	0.74084	0.3670	N	0.14661	0.345	0.31648	N	0.647114	P;P;B	0.35745	0.518;0.518;0.347	B;B;B	0.40477	0.246;0.33;0.094	T	0.78283	-0.2264	10	0.44086	T	0.13	-4.2606	14.2275	0.65871	0.0:0.1494:0.8506:0.0	.	158;136;158	Q15345-3;E9PE58;Q15345	.;.;LRC41_HUMAN	V	158;136	ENSP00000343298:L158V	ENSP00000343298:L158V	L	-	1	2	LRRC41	46524644	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.586000	0.60984	2.389000	0.81357	0.430000	0.28490	CTG	LRRC41	-	NULL	ENSG00000132128		0.557	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC41	HGNC	protein_coding	OTTHUMT00000021438.1		0.00	18	0	G	NM_006369		46752057	-1			no_errors	ENST00000343304	ensembl	human	known	74_37	missense	20.00	12	3	SNP	1.000	C
LRRC4C	57689	genome.wustl.edu	37	11	40137250	40137250	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:40137250T>A	ENST00000278198.2	-	2	2556	c.593A>T	c.(592-594)aAc>aTc	p.N198I	LRRC4C_ENST00000530763.1_Missense_Mutation_p.N198I|LRRC4C_ENST00000528697.1_Missense_Mutation_p.N198I|LRRC4C_ENST00000527150.1_Missense_Mutation_p.N198I			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	198					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				ATACCTCAAGTTGGACAGACC	0.423																																																	0													93.0	90.0	91.0					11																	40137250		2203	4300	6503	SO:0001583	missense	0			AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.593A>T	11.37:g.40137250T>A	ENSP00000278198:p.Asn198Ile		A8K0T1|Q7L0N3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.N198I	ENST00000278198.2	37	c.593	CCDS31464.1	11	.	.	.	.	.	.	.	.	.	.	T	16.87	3.242572	0.58995	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.05855	3.38;3.38;3.38;3.38	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.28466	0.0704	M	0.83012	2.62	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.02202	-1.1196	10	0.72032	D	0.01	.	15.3632	0.74499	0.0:0.0:0.0:1.0	.	198	Q9HCJ2	LRC4C_HUMAN	I	198	ENSP00000278198:N198I;ENSP00000436976:N198I;ENSP00000437132:N198I;ENSP00000434761:N198I	ENSP00000278198:N198I	N	-	2	0	LRRC4C	40093826	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.222000	0.72286	0.528000	0.53228	AAC	LRRC4C	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000148948		0.423	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRRC4C	HGNC	protein_coding	OTTHUMT00000389499.1	-	0.00	21	0	T	NM_020929		40137250	-1	tier1	-	no_errors	ENST00000527150	ensembl	human	known	74_37	missense	16.67	20	4	SNP	1.000	A
LYST	1130	genome.wustl.edu	37	1	235897834	235897834	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:235897834G>T	ENST00000389794.3	-	32	8658	c.8484C>A	c.(8482-8484)tgC>tgA	p.C2828*	LYST_ENST00000389793.2_Nonsense_Mutation_p.C2828*|LYST_ENST00000473037.1_5'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2828					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TGGGAGGGATGCACTTGTGAC	0.393																																																	0													249.0	217.0	228.0					1																	235897834		2203	4300	6503	SO:0001587	stop_gained	0			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.8484C>A	1.37:g.235897834G>T	ENSP00000374444:p.Cys2828*		O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Nonsense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.C2828*	ENST00000389794.3	37	c.8484	CCDS31062.1	1	.	.	.	.	.	.	.	.	.	.	G	51	17.505381	0.99888	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	.	.	.	5.06	5.06	0.68205	.	0.044849	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.1052	0.36694	0.2081:0.0:0.7919:0.0	.	.	.	.	X	2828	.	ENSP00000374443:C2828X	C	-	3	2	LYST	233964457	1.000000	0.71417	0.981000	0.43875	0.993000	0.82548	2.364000	0.44187	2.496000	0.84212	0.591000	0.81541	TGC	LYST	-	superfamily_ARM-type_fold	ENSG00000143669		0.393	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5	-	0.00	61	0	G			235897834	-1	tier1	-	no_errors	ENST00000389793	ensembl	human	known	74_37	nonsense	7.32	76	6	SNP	1.000	T
MAGEL2	54551	genome.wustl.edu	37	15	23890265	23890265	+	Silent	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:23890265G>C	ENST00000532292.1	-	1	910	c.816C>G	c.(814-816)tcC>tcG	p.S272S		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	155					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		GCGGCTCGACGGAGGTCTTGG	0.632																																																	0													33.0	41.0	39.0					15																	23890265		2183	4287	6470	SO:0001819	synonymous_variant	0			AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.816C>G	15.37:g.23890265G>C				Silent	SNP	pfam_MAGE,pfscan_MAGE	p.S272	ENST00000532292.1	37	c.816		15	.	.	.	.	.	.	.	.	.	.	G	0.027	-1.365002	0.01235	.	.	ENSG00000254585	ENST00000532292	.	.	.	2.61	-2.99	0.05497	.	.	.	.	.	T	0.17746	0.0426	.	.	.	0.19300	N	0.999975	.	.	.	.	.	.	T	0.23726	-1.0180	4	.	.	.	.	0.8904	0.01253	0.2921:0.1655:0.3748:0.1676	.	.	.	.	R	304	.	.	P	-	2	0	MAGEL2	21441358	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	-0.190000	0.09615	-0.737000	0.04824	0.563000	0.77884	CCG	MAGEL2	-	NULL	ENSG00000254585		0.632	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	MAGEL2	HGNC	protein_coding	OTTHUMT00000395182.2	-	0.00	95	0	G	NM_019066		23890265	-1	tier1	-	no_errors	ENST00000532292	ensembl	human	known	74_37	silent	22.97	57	17	SNP	0.000	C
MAGI3	260425	genome.wustl.edu	37	1	114184884	114184884	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:114184884G>T	ENST00000307546.9	+	10	1787	c.1712G>T	c.(1711-1713)aGc>aTc	p.S571I	MAGI3_ENST00000369617.4_Missense_Mutation_p.S596I|MAGI3_ENST00000369615.1_Missense_Mutation_p.S571I|MAGI3_ENST00000369611.4_Missense_Mutation_p.S571I	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	596					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCGTCAGGCAGCTCCCAGCCT	0.488																																																	0													113.0	115.0	114.0					1																	114184884		2203	4300	6503	SO:0001583	missense	0			AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.1712G>T	1.37:g.114184884G>T	ENSP00000304604:p.Ser571Ile		Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.S571I	ENST00000307546.9	37	c.1712	CCDS44196.1	1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.771744	0.49680	.	.	ENSG00000081026	ENST00000369617;ENST00000307546;ENST00000369615;ENST00000369611	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.48	5.48	0.80851	.	0.249134	0.49305	D	0.000151	T	0.24851	0.0603	L	0.36672	1.1	0.42463	D	0.992791	P;B;B	0.43519	0.809;0.05;0.118	B;B;B	0.41332	0.354;0.037;0.109	T	0.11179	-1.0598	10	0.87932	D	0	-4.4162	12.9993	0.58666	0.0742:0.0:0.9258:0.0	.	571;571;596	Q5TCQ9-4;Q5TCQ9-3;Q5TCQ9-2	.;.;.	I	596;571;571;571	ENSP00000358630:S596I;ENSP00000304604:S571I;ENSP00000358628:S571I;ENSP00000358624:S571I	ENSP00000304604:S571I	S	+	2	0	MAGI3	113986407	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.299000	0.43611	2.731000	0.93534	0.650000	0.86243	AGC	MAGI3	-	superfamily_PDZ	ENSG00000081026		0.488	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	MAGI3	HGNC	protein_coding	OTTHUMT00000032429.1		0.00	88	0	G	NM_152900		114184884	+1			no_errors	ENST00000369611	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	T
MAK	4117	genome.wustl.edu	37	6	10803989	10803989	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:10803989G>C	ENST00000313243.2	-	7	1009	c.627C>G	c.(625-627)atC>atG	p.I209M	RP11-637O19.3_ENST00000480294.1_Intron|MAK_ENST00000474039.1_Missense_Mutation_p.I209M|MAK_ENST00000354489.2_Missense_Mutation_p.I209M|MAK_ENST00000536370.1_Missense_Mutation_p.I209M|SYCP2L_ENST00000543878.1_Intron|MAK_ENST00000538030.1_Missense_Mutation_p.I209M			P20794	MAK_HUMAN	male germ cell-associated kinase	209	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|photoreceptor cell maintenance (GO:0045494)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)	22	Breast(50;0.107)|Ovarian(93;0.107)	all_hematologic(90;0.117)				AAATTTTAAAGATTTCATCGA	0.373																																																	0													100.0	102.0	102.0					6																	10803989		2203	4300	6503	SO:0001583	missense	0				CCDS4516.1, CCDS75398.1, CCDS75399.1	6p24.2	2014-01-28			ENSG00000111837	ENSG00000111837			6816	protein-coding gene	gene with protein product		154235				16951154	Standard	NM_005906		Approved	dJ417M14.2, RP62	uc021ylk.1	P20794	OTTHUMG00000014247	ENST00000313243.2:c.627C>G	6.37:g.10803989G>C	ENSP00000313021:p.Ile209Met		F1T0K6|G1FL29|Q547D0|Q9NUH7	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.I209M	ENST00000313243.2	37	c.627	CCDS4516.1	6	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686861	0.88639	.	.	ENSG00000111837	ENST00000313243;ENST00000354489;ENST00000538030;ENST00000536370	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.43	5.43	0.79202	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.37598	0.1009	N	0.20574	0.59	0.80722	D	1	P	0.46277	0.875	P	0.55667	0.781	T	0.36163	-0.9759	10	0.59425	D	0.04	.	19.2488	0.93913	0.0:0.0:1.0:0.0	.	209	P20794	MAK_HUMAN	M	209	ENSP00000313021:I209M;ENSP00000346484:I209M;ENSP00000442250:I209M;ENSP00000442221:I209M	ENSP00000313021:I209M	I	-	3	3	MAK	10911975	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.670000	0.46833	2.547000	0.85894	0.557000	0.71058	ATC	MAK	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000111837		0.373	MAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAK	HGNC	protein_coding	OTTHUMT00000039841.1	-	0.00	42	0	G	NM_005906		10803989	-1	tier1	-	no_errors	ENST00000313243	ensembl	human	known	74_37	missense	26.67	22	8	SNP	1.000	C
MAN2C1	4123	genome.wustl.edu	37	15	75651697	75651697	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:75651697G>T	ENST00000267978.5	-	17	2064	c.2018C>A	c.(2017-2019)cCc>cAc	p.P673H	MAN2C1_ENST00000563622.1_Missense_Mutation_p.P574H|MAN2C1_ENST00000565683.1_Silent_p.A677A|MAN2C1_ENST00000569482.1_Missense_Mutation_p.P673H	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	673					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						AGGCTGCTGGGGCAGCAGGGG	0.632																																																	0													28.0	31.0	30.0					15																	75651697		2195	4294	6489	SO:0001583	missense	0			AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.2018C>A	15.37:g.75651697G>T	ENSP00000267978:p.Pro673His		H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Missense_Mutation	SNP	pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.P673H	ENST00000267978.5	37	c.2018	CCDS32298.1	15	.	.	.	.	.	.	.	.	.	.	G	19.90	3.912340	0.72983	.	.	ENSG00000140400	ENST00000267978	T	0.77620	-1.11	5.25	5.25	0.73442	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.85682	D	0.000000	D	0.82747	0.5104	L	0.49126	1.545	0.58432	D	0.999996	B;D	0.55172	0.011;0.97	B;P	0.59288	0.015;0.855	T	0.82719	-0.0318	10	0.48119	T	0.1	-26.331	15.9374	0.79723	0.0:0.0:1.0:0.0	.	673;673	Q68EM8;Q9NTJ4	.;MA2C1_HUMAN	H	673	ENSP00000267978:P673H	ENSP00000267978:P673H	P	-	2	0	MAN2C1	73438750	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.634000	0.46528	2.623000	0.88846	0.561000	0.74099	CCC	MAN2C1	-	pfam_Glyco_hydro_38_C,superfamily_Gal_mutarotase_SF_dom	ENSG00000140400		0.632	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2C1	HGNC	protein_coding	OTTHUMT00000419965.1		0.00	71	0	G			75651697	-1			no_errors	ENST00000267978	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
MAP3K5	4217	genome.wustl.edu	37	6	137015331	137015331	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:137015331C>T	ENST00000359015.4	-	7	1560	c.1200G>A	c.(1198-1200)atG>atA	p.M400I		NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	400					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		AGTCCAAAAACATATCTTTGT	0.378																																																	0													116.0	109.0	111.0					6																	137015331		2203	4300	6503	SO:0001583	missense	0			U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.1200G>A	6.37:g.137015331C>T	ENSP00000351908:p.Met400Ile		A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.M400I	ENST00000359015.4	37	c.1200	CCDS5179.1	6	.	.	.	.	.	.	.	.	.	.	C	10.74	1.435717	0.25813	.	.	ENSG00000197442	ENST00000359015;ENST00000367768	T	0.08720	3.06	5.43	4.55	0.56014	.	0.113853	0.85682	D	0.000000	T	0.01695	0.0054	N	0.17631	0.505	0.80722	D	1	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.15052	0.012;0.004;0.005	T	0.37549	-0.9701	10	0.09590	T	0.72	.	9.9291	0.41512	0.1389:0.7886:0.0:0.0726	.	480;245;400	Q59GL6;B4DF67;Q99683	.;.;M3K5_HUMAN	I	400;480	ENSP00000351908:M400I	ENSP00000351908:M400I	M	-	3	0	MAP3K5	137057024	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.391000	0.34475	1.400000	0.46741	0.591000	0.81541	ATG	MAP3K5	-	NULL	ENSG00000197442		0.378	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K5	HGNC	protein_coding	OTTHUMT00000042383.1	-	0.00	49	0	C			137015331	-1	tier1	-	no_errors	ENST00000359015	ensembl	human	known	74_37	missense	16.92	54	11	SNP	1.000	T
MAPK8	5599	genome.wustl.edu	37	10	49632587	49632587	+	Intron	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:49632587G>T	ENST00000374189.1	+	7	869				MAPK8_ENST00000395611.3_Intron|MAPK8_ENST00000374182.3_Intron|MAPK8_ENST00000374174.1_Intron|MAPK8_ENST00000360332.3_Intron			P45983	MK08_HUMAN	mitogen-activated protein kinase 8						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nitric oxide (GO:0071732)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|programmed necrotic cell death (GO:0097300)|regulation of histone deacetylation (GO:0031063)|regulation of protein localization (GO:0032880)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to cadmium ion (GO:0046686)|response to stress (GO:0006950)|response to UV (GO:0009411)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|JUN kinase activity (GO:0004705)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	34		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)		TGCATCATGGGAGAAATGATC	0.318																																																	0													199.0	184.0	189.0					10																	49632587		2203	4300	6503	SO:0001627	intron_variant	0			L26318	CCDS7223.1, CCDS7224.1, CCDS7225.1, CCDS7226.1, CCDS60527.1	10q11	2011-06-09			ENSG00000107643	ENSG00000107643	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6881	protein-coding gene	gene with protein product	"""JUN N-terminal kinase"""	601158		PRKM8		8137421, 8654373	Standard	NM_002750		Approved	JNK, JNK1, SAPK1	uc001jgp.3	P45983	OTTHUMG00000018172	ENST00000374189.1:c.688+385G>T	10.37:g.49632587G>T			B5BTZ5|B7ZLV4|D3DX88|D3DX92|Q15709|Q15712|Q15713|Q308M2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_MAPK_JNK,pfscan_Prot_kinase_dom	p.G216V	ENST00000374189.1	37	c.647	CCDS7224.1	10	.	.	.	.	.	.	.	.	.	.	G	18.35	3.605294	0.66445	.	.	ENSG00000107643	ENST00000374179;ENST00000374176	D;D	0.82081	-1.57;-1.57	5.68	5.68	0.88126	.	0.051570	0.85682	D	0.000000	D	0.88952	0.6577	L	0.45581	1.43	0.80722	D	1	D;D	0.65815	0.995;0.983	D;P	0.68943	0.961;0.899	D	0.89084	0.3478	10	0.87932	D	0	.	20.1412	0.98058	0.0:0.0:1.0:0.0	.	216;216	A1L4K2;P45983-3	.;.	V	216	ENSP00000363294:G216V;ENSP00000363291:G216V	ENSP00000363291:G216V	G	+	2	0	MAPK8	49302593	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.920000	0.75799	2.838000	0.97847	0.585000	0.79938	GGA	MAPK8	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000107643		0.318	MAPK8-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAPK8	HGNC	protein_coding	OTTHUMT00000047931.1	-	0.00	67	0	G			49632587	+1	tier1	-	no_errors	ENST00000374176	ensembl	human	known	74_37	missense	8.57	63	6	SNP	1.000	T
MATR3	9782	genome.wustl.edu	37	5	138654624	138654624	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:138654624G>T	ENST00000394805.3	+	8	1671	c.1336G>T	c.(1336-1338)Gat>Tat	p.D446Y	MATR3_ENST00000509990.1_Missense_Mutation_p.D446Y|MATR3_ENST00000502499.1_Missense_Mutation_p.D108Y|MATR3_ENST00000502929.1_Missense_Mutation_p.D446Y|MATR3_ENST00000394800.2_Missense_Mutation_p.D446Y|MATR3_ENST00000510056.1_Missense_Mutation_p.D446Y|MATR3_ENST00000503811.1_Missense_Mutation_p.D158Y|MATR3_ENST00000504203.1_Missense_Mutation_p.D108Y|MATR3_ENST00000361059.2_Missense_Mutation_p.D446Y	NM_001194955.1|NM_018834.5	NP_001181884.1|NP_061322.2	P43243	MATR3_HUMAN	matrin 3	446	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell death (GO:0008219)	membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AACCACAGAGGATGCTCAGGC	0.358																																																	0													50.0	51.0	51.0					5																	138654624		2203	4300	6503	SO:0001583	missense	0			M63483	CCDS4210.1, CCDS54908.1, CCDS75316.1	5q31.3	2010-08-12			ENSG00000015479	ENSG00000015479			6912	protein-coding gene	gene with protein product		164015	"""myopathy, distal 2"""	MPD2		2033075, 19344878	Standard	NM_018834		Approved	KIAA0723, MGC9105, VCPDM	uc003ldx.3	P43243	OTTHUMG00000129229	ENST00000394805.3:c.1336G>T	5.37:g.138654624G>T	ENSP00000378284:p.Asp446Tyr		B7ZAV5|D3DQC3|Q9UHW0|Q9UQ27	Missense_Mutation	SNP	smart_Znf_U1,smart_RRM_dom,pfscan_Znf_C2H2_matrin,pfscan_RRM_dom	p.D446Y	ENST00000394805.3	37	c.1336	CCDS4210.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.2|21.2	4.115063|4.115063	0.77210|0.77210	.|.	.|.	ENSG00000015479|ENSG00000015479	ENST00000509990;ENST00000361059;ENST00000504203;ENST00000502929;ENST00000394800;ENST00000394805;ENST00000512876;ENST00000504311;ENST00000502499;ENST00000510056;ENST00000511249;ENST00000503811|ENST00000515833	T;T;T;T;T;T;T;T;T;T;T;T|.	0.80824|.	-1.32;-1.32;-1.32;-1.32;-1.32;-1.32;-1.32;-1.42;-1.32;-1.32;-1.32;-1.32|.	5.8|5.8	4.93|4.93	0.64822|0.64822	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);|.	0.100460|.	0.64402|.	D|.	0.000002|.	T|T	0.54515|0.54515	0.1863|0.1863	L|L	0.29908|0.29908	0.895|0.895	0.44247|0.44247	D|D	0.997099|0.997099	D;D;D;D;D;D|.	0.89917|.	1.0;0.99;1.0;0.975;0.998;0.99|.	D;P;D;P;D;P|.	0.87578|.	0.998;0.796;0.998;0.761;0.996;0.796|.	T|T	0.50800|0.50800	-0.8785|-0.8785	10|5	0.62326|.	D|.	0.03|.	-10.729|-10.729	15.0659|15.0659	0.71996|0.71996	0.0682:0.0:0.9318:0.0|0.0682:0.0:0.9318:0.0	.|.	158;446;158;446;446;446|.	B7ZAV5;D6REM6;B4DRS1;Q68D11;A8MXP9;P43243|.	.;.;.;.;.;MATR3_HUMAN|.	Y|S	446;446;108;446;446;446;108;108;108;446;44;158|205	ENSP00000423533:D446Y;ENSP00000354346:D446Y;ENSP00000421218:D108Y;ENSP00000422319:D446Y;ENSP00000378279:D446Y;ENSP00000378284:D446Y;ENSP00000425150:D108Y;ENSP00000422700:D108Y;ENSP00000426030:D108Y;ENSP00000426743:D446Y;ENSP00000422649:D44Y;ENSP00000423587:D158Y|.	ENSP00000354346:D446Y|.	D|R	+|+	1|3	0|2	MATR3|MATR3	138682523|138682523	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	5.603000|5.603000	0.67619|0.67619	1.461000|1.461000	0.47929|0.47929	0.655000|0.655000	0.94253|0.94253	GAT|AGG	MATR3	-	smart_RRM_dom,pfscan_RRM_dom	ENSG00000015479		0.358	MATR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MATR3	HGNC	protein_coding	OTTHUMT00000251324.2	-	0.00	41	0	G	NM_018834		138654624	+1	tier1	-	no_errors	ENST00000361059	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
MAU2	23383	genome.wustl.edu	37	19	19460134	19460134	+	Splice_Site	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:19460134G>T	ENST00000392313.6	+	16	1616	c.1437G>T	c.(1435-1437)aaG>aaT	p.K479N	MAU2_ENST00000262815.8_Splice_Site_p.K479N	NM_015329.3	NP_056144.3	Q9Y6X3	SCC4_HUMAN	MAU2 sister chromatid cohesion factor	479					maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	protein N-terminus binding (GO:0047485)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	18						TCCTTGTCAGGCGATTTCTGC	0.592																																																	0													185.0	177.0	179.0					19																	19460134		2203	4300	6503	SO:0001630	splice_region_variant	0			AB020699	CCDS32969.2	19p13.11	2013-08-28	2013-08-28	2013-08-28	ENSG00000129933	ENSG00000129933			29140	protein-coding gene	gene with protein product	"""sister chromatid cohesion 4"""	614560	"""KIAA0892"", ""MAU2 chromatid cohesion factor homolog (C. elegans)"""	KIAA0892		10048485	Standard	NM_015329		Approved	MGC75361, mau-2, MAU2L, SCC4	uc002nmk.4	Q9Y6X3	OTTHUMG00000150188	ENST00000392313.6:c.1437-1G>T	19.37:g.19460134G>T			Q66PT1|Q6P3S7|Q6ZTT2|Q9UFX8	Missense_Mutation	SNP	pfam_Cohesin_loading_factor,smart_TPR_repeat	p.K479N	ENST00000392313.6	37	c.1437	CCDS32969.2	19	.	.	.	.	.	.	.	.	.	.	G	16.85	3.237392	0.58886	.	.	ENSG00000129933	ENST00000392313;ENST00000262815	T;T	0.63417	-0.04;-0.04	5.13	1.79	0.24919	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.74275	0.3695	M	0.76002	2.32	0.80722	D	1	P;P;D	0.89917	0.939;0.914;1.0	B;B;D	0.81914	0.402;0.254;0.995	T	0.71586	-0.4548	9	.	.	.	.	9.5703	0.39425	0.2354:0.0:0.7646:0.0	.	55;84;479	Q9Y6X3-3;Q9Y6X3-2;Q9Y6X3	.;.;SCC4_HUMAN	N	479	ENSP00000376127:K479N;ENSP00000262815:K479N	.	K	+	3	2	MAU2	19321134	1.000000	0.71417	0.633000	0.29310	0.673000	0.39480	0.924000	0.28777	0.196000	0.20367	-0.258000	0.10820	AAG	MAU2	-	pfam_Cohesin_loading_factor,smart_TPR_repeat	ENSG00000129933		0.592	MAU2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAU2	HGNC	protein_coding	OTTHUMT00000316748.6		0.00	88	0	G	NM_015329	Missense_Mutation	19460134	+1			no_errors	ENST00000262815	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
MBD5	55777	genome.wustl.edu	37	2	149226195	149226195	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:149226195G>C	ENST00000407073.1	+	9	1680	c.683G>C	c.(682-684)gGt>gCt	p.G228A	MBD5_ENST00000404807.1_Missense_Mutation_p.G228A	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	228					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		GCGTCATCAGGTTCCCAGATA	0.527																																																	0													99.0	103.0	102.0					2																	149226195		2203	4300	6503	SO:0001583	missense	0			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.683G>C	2.37:g.149226195G>C	ENSP00000386049:p.Gly228Ala		A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	superfamily_DNA-bd_dom,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd,pfscan_PWWP_dom	p.G228A	ENST00000407073.1	37	c.683	CCDS33302.1	2	.	.	.	.	.	.	.	.	.	.	G	11.84	1.757757	0.31137	.	.	ENSG00000204406	ENST00000407073;ENST00000404807	T;T	0.53640	0.61;0.61	5.16	5.16	0.70880	.	0.000000	0.64402	D	0.000014	T	0.50837	0.1639	N	0.14661	0.345	0.58432	D	0.999994	D	0.69078	0.997	P	0.62813	0.907	T	0.52071	-0.8624	10	0.34782	T	0.22	-4.7336	19.0076	0.92857	0.0:0.0:1.0:0.0	.	228	Q9P267	MBD5_HUMAN	A	228	ENSP00000386049:G228A;ENSP00000384672:G228A	ENSP00000384672:G228A	G	+	2	0	MBD5	148942665	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.644000	0.83416	2.571000	0.86741	0.591000	0.81541	GGT	MBD5	-	NULL	ENSG00000204406		0.527	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD5	HGNC	protein_coding	OTTHUMT00000318111.2	-	0.00	25	0	G			149226195	+1	tier1	-	no_errors	ENST00000407073	ensembl	human	known	74_37	missense	31.25	22	10	SNP	1.000	C
MBIP	51562	genome.wustl.edu	37	14	36785950	36785950	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr14:36785950G>T	ENST00000416007.4	-	2	285	c.198C>A	c.(196-198)ttC>ttA	p.F66L	MBIP_ENST00000359527.7_Missense_Mutation_p.F66L|MBIP_ENST00000603913.1_5'Flank|MBIP_ENST00000318473.7_Missense_Mutation_p.F66L	NM_001144891.1|NM_016586.2	NP_001138363.1|NP_057670.2	Q9NS73	MBIP1_HUMAN	MAP3K12 binding inhibitory protein 1	66					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|inactivation of MAPK activity involved in osmosensory signaling pathway (GO:0000173)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|protein kinase inhibitor activity (GO:0004860)			breast(2)|large_intestine(1)|lung(5)	8	all_cancers(3;1.55e-52)|all_epithelial(1;2.69e-62)|Breast(36;0.0505)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.28e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.0303)|all cancers(34;0.0781)	GBM - Glioblastoma multiforme(112;0.0191)		ATGCAGGCTGGAATGCCGAGA	0.383																																																	0													84.0	79.0	81.0					14																	36785950		2203	4299	6502	SO:0001583	missense	0			BC016821	CCDS9658.1, CCDS45096.1	14q13.2	2005-01-10			ENSG00000151332	ENSG00000151332			20427	protein-coding gene	gene with protein product		609431				10801814	Standard	NM_016586		Approved		uc001wtm.2	Q9NS73	OTTHUMG00000140222	ENST00000416007.4:c.198C>A	14.37:g.36785950G>T	ENSP00000399718:p.Phe66Leu		Q86TZ2|Q96AS5|Q9BS93|Q9NZE1	Missense_Mutation	SNP	NULL	p.F66L	ENST00000416007.4	37	c.198	CCDS9658.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.488|3.488	-0.104499|-0.104499	0.06967|0.06967	.|.	.|.	ENSG00000151332|ENSG00000151332	ENST00000416007;ENST00000318473;ENST00000359527;ENST00000396329;ENST00000553549;ENST00000556427|ENST00000553977	T;T;T|.	0.35236|.	1.32;1.32;1.32|.	5.17|5.17	4.25|4.25	0.50352|0.50352	.|.	0.656465|.	0.16745|.	N|.	0.201286|.	T|T	0.14227|0.14227	0.0344|0.0344	N|N	0.02916|0.02916	-0.46|-0.46	0.24098|0.24098	N|N	0.995881|0.995881	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.04013|.	0.0;0.001;0.0|.	T|T	0.20140|0.20140	-1.0284|-1.0284	10|5	0.02654|.	T|.	1|.	-2.4148|-2.4148	6.7962|6.7962	0.23727|0.23727	0.1131:0.4165:0.4704:0.0|0.1131:0.4165:0.4704:0.0	.|.	66;66;66|.	Q9NS73-5;Q9NS73-3;Q9NS73|.	.;.;MBIP1_HUMAN|.	L|T	66;66;66;66;45;24|63	ENSP00000399718:F66L;ENSP00000324444:F66L;ENSP00000352517:F66L|.	ENSP00000324444:F66L|.	F|P	-|-	3|1	2|0	MBIP|MBIP	35855701|35855701	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	0.957000|0.957000	0.29215|0.29215	1.217000|1.217000	0.43442|0.43442	0.585000|0.585000	0.79938|0.79938	TTC|CCA	MBIP	-	NULL	ENSG00000151332		0.383	MBIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MBIP	HGNC	protein_coding	OTTHUMT00000276685.2	-	0.00	35	0	G	NM_016586		36785950	-1	tier1	-	no_errors	ENST00000416007	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
MBTPS1	8720	genome.wustl.edu	37	16	84132850	84132850	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr16:84132850G>T	ENST00000343411.3	-	3	724	c.229C>A	c.(229-231)Ctg>Atg	p.L77M		NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	77					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						CTGCTCTTCAGGGCACTTGAA	0.343																																																	0													107.0	96.0	100.0					16																	84132850		2200	4300	6500	SO:0001583	missense	0			D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.229C>A	16.37:g.84132850G>T	ENSP00000344223:p.Leu77Met		A8K6V8|Q24JQ2|Q9UF67	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,superfamily_Peptidase_S8/S53_dom,prints_Peptidase_S8_subtilisin-rel	p.L77M	ENST00000343411.3	37	c.229	CCDS10941.1	16	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307590	0.81247	.	.	ENSG00000140943	ENST00000343411	T	0.52754	0.65	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.69205	0.3085	M	0.78049	2.395	0.58432	D	0.999998	D	0.89917	1.0	D	0.77557	0.99	T	0.72207	-0.4360	10	0.72032	D	0.01	-15.4681	14.9298	0.70906	0.0705:0.0:0.9295:0.0	.	77	Q14703	MBTP1_HUMAN	M	77	ENSP00000344223:L77M	ENSP00000344223:L77M	L	-	1	2	MBTPS1	82690351	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.047000	0.49854	2.670000	0.90874	0.650000	0.86243	CTG	MBTPS1	-	NULL	ENSG00000140943		0.343	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTPS1	HGNC	protein_coding	OTTHUMT00000269080.2	-	0.00	57	0	G	NM_003791		84132850	-1	tier1	-	no_errors	ENST00000343411	ensembl	human	known	74_37	missense	10.87	41	5	SNP	1.000	T
MCM3AP	8888	genome.wustl.edu	37	21	47704488	47704488	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr21:47704488G>T	ENST00000397708.1	-	2	967	c.713C>A	c.(712-714)cCt>cAt	p.P238H	YBEY_ENST00000397692.1_5'Flank|YBEY_ENST00000339195.6_5'Flank|YBEY_ENST00000397691.1_5'Flank|YBEY_ENST00000397694.1_5'Flank|YBEY_ENST00000397701.4_5'Flank|MCM3AP_ENST00000291688.1_Missense_Mutation_p.P238H|YBEY_ENST00000329319.3_5'Flank			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	238	FG-repeats.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					TATTGACTTAGGTCCTCTCTT	0.398																																																	0													85.0	89.0	88.0					21																	47704488		2203	4300	6503	SO:0001583	missense	0			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.713C>A	21.37:g.47704488G>T	ENSP00000380820:p.Pro238His		C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	p.P238H	ENST00000397708.1	37	c.713	CCDS13734.1	21	.	.	.	.	.	.	.	.	.	.	G	15.57	2.874140	0.51695	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.17854	2.25;2.25	5.42	3.62	0.41486	.	0.389746	0.28940	N	0.013644	T	0.19886	0.0478	L	0.27053	0.805	0.09310	N	0.999999	D	0.58620	0.983	P	0.54499	0.754	T	0.03739	-1.1008	10	0.52906	T	0.07	-3.3462	10.4613	0.44581	0.1585:0.0:0.8415:0.0	.	238	O60318	MCM3A_HUMAN	H	238	ENSP00000380820:P238H;ENSP00000291688:P238H	ENSP00000291688:P238H	P	-	2	0	MCM3AP	46528916	0.817000	0.29147	0.003000	0.11579	0.829000	0.46940	3.446000	0.52928	0.669000	0.31146	0.563000	0.77884	CCT	MCM3AP	-	NULL	ENSG00000160294		0.398	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM3AP	HGNC	protein_coding	OTTHUMT00000207254.1	-	0.00	73	0	G	NM_003906		47704488	-1	tier1	-	no_errors	ENST00000291688	ensembl	human	known	74_37	missense	9.62	47	5	SNP	0.261	T
MED12L	116931	genome.wustl.edu	37	3	151105597	151105597	+	Splice_Site	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:151105597G>T	ENST00000474524.1	+	35	5021		c.e35-1		P2RY12_ENST00000302632.3_5'Flank|MED12L_ENST00000273432.4_Splice_Site	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like							mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TTTTCCCACAGGGTCTCCAGG	0.522																																																	0													80.0	86.0	84.0					3																	151105597		2203	4300	6503	SO:0001630	splice_region_variant	0			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.4984-1G>T	3.37:g.151105597G>T			Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Splice_Site	SNP	-	e35-1	ENST00000474524.1	37	c.4984-1	CCDS33876.1	3	.	.	.	.	.	.	.	.	.	.	G	26.7	4.760029	0.89932	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0715	0.89408	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MED12L	152588287	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.666000	0.83877	2.793000	0.96121	0.655000	0.94253	.	MED12L	-	-	ENSG00000144893		0.522	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2	-	0.00	56	0	G	NM_053002	Intron	151105597	+1	tier1	-	no_errors	ENST00000474524	ensembl	human	known	74_37	splice_site	5.19	73	4	SNP	1.000	T
MEIS1	4211	genome.wustl.edu	37	2	66665074	66665074	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:66665074G>A	ENST00000272369.9	+	2	675	c.218G>A	c.(217-219)aGa>aAa	p.R73K	MEIS1_ENST00000488550.1_Missense_Mutation_p.R73K|MEIS1-AS1_ENST00000454595.1_RNA|MEIS1_ENST00000444274.2_Missense_Mutation_p.R41K|MEIS1-AS2_ENST00000439433.1_RNA|MEIS1_ENST00000560281.2_Missense_Mutation_p.R73K|MEIS1_ENST00000495021.2_5'Flank|MEIS1_ENST00000398506.2_Missense_Mutation_p.R71K|MEIS1_ENST00000407092.2_Missense_Mutation_p.R73K	NM_002398.2	NP_002389.1	O00470	MEIS1_HUMAN	Meis homeobox 1	73					angiogenesis (GO:0001525)|definitive hemopoiesis (GO:0060216)|lens morphogenesis in camera-type eye (GO:0002089)|megakaryocyte development (GO:0035855)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron differentiation (GO:0045665)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	24						GCTTTAAAGAGAGATAAAGAT	0.517																																																	0													36.0	38.0	37.0					2																	66665074		2041	4188	6229	SO:0001583	missense	0				CCDS46309.1	2p14	2011-06-20	2007-02-15		ENSG00000143995	ENSG00000143995		"""Homeoboxes / TALE class"""	7000	protein-coding gene	gene with protein product		601739	"""Meis1 (mouse) homolog"", ""Meis1, myeloid ecotropic viral integration site 1 homolog (mouse)"""			7565694	Standard	NM_002398		Approved		uc002sdu.3	O00470	OTTHUMG00000150714	ENST00000272369.9:c.218G>A	2.37:g.66665074G>A	ENSP00000272369:p.Arg73Lys		A8MV50	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.R73K	ENST00000272369.9	37	c.218	CCDS46309.1	2	.	.	.	.	.	.	.	.	.	.	G	27.1	4.803375	0.90623	.	.	ENSG00000143995	ENST00000272369;ENST00000407092;ENST00000398506;ENST00000444274	T;T;T;T	0.33216	1.42;1.42;1.42;1.42	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.55097	0.1899	L	0.60957	1.885	0.58432	D	0.999994	P;D;P	0.67145	0.808;0.996;0.514	P;D;P	0.77004	0.839;0.989;0.626	T	0.51593	-0.8686	10	0.62326	D	0.03	.	19.9089	0.97019	0.0:0.0:1.0:0.0	.	71;73;73	O00470-2;O00470;F8W8U3	.;MEIS1_HUMAN;.	K	73;73;71;41	ENSP00000272369:R73K;ENSP00000384461:R73K;ENSP00000381518:R71K;ENSP00000403206:R41K	ENSP00000272369:R73K	R	+	2	0	MEIS1	66518578	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.296000	0.96104	2.793000	0.96121	0.655000	0.94253	AGA	MEIS1	-	NULL	ENSG00000143995		0.517	MEIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEIS1	HGNC	protein_coding	OTTHUMT00000319725.4	-	0.00	21	0	G	NM_002398		66665074	+1	tier1	-	no_errors	ENST00000407092	ensembl	human	known	74_37	missense	34.48	19	10	SNP	1.000	A
MET	4233	genome.wustl.edu	37	7	116397741	116397741	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:116397741G>A	ENST00000318493.6	+	8	2202	c.2015G>A	c.(2014-2016)gGc>gAc	p.G672D	MET_ENST00000436117.2_Missense_Mutation_p.G672D|MET_ENST00000397752.3_Missense_Mutation_p.G672D			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0	Arg/Glu-rich.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			ATGGCTGGTGGCACTTTACTT	0.338			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																															Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	0													73.0	73.0	73.0					7																	116397741		1856	4093	5949	SO:0001583	missense	0	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.2015G>A	7.37:g.116397741G>A	ENSP00000317272:p.Gly672Asp		A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semap_dom,pfscan_Prot_kinase_dom	p.G672D	ENST00000318493.6	37	c.2015	CCDS47689.1	7	.	.	.	.	.	.	.	.	.	.	G	20.4	3.984679	0.74474	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	D;D;D	0.86366	-2.11;-2.11;-2.11	5.45	5.45	0.79879	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.300125	0.42172	D	0.000754	D	0.95847	0.8648	H	0.95745	3.715	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.969;0.999;1.0;0.998;0.999;0.998;1.0	P;D;D;D;D;D;D	0.97110	0.709;0.988;0.999;0.995;0.99;0.921;1.0	D	0.96578	0.9428	10	0.72032	D	0.01	.	19.6495	0.95795	0.0:0.0:1.0:0.0	.	672;672;672;672;644;672;672	B5A929;E7EQ94;B5A930;B5A934;B5A936;P08581-2;P08581	.;.;.;.;.;.;MET_HUMAN	D	672	ENSP00000380860:G672D;ENSP00000317272:G672D;ENSP00000410980:G672D	ENSP00000317272:G672D	G	+	2	0	MET	116184977	1.000000	0.71417	1.000000	0.80357	0.674000	0.39518	6.821000	0.75272	2.717000	0.92951	0.585000	0.79938	GGC	MET	-	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_IPT,superfamily_Ig_E-set,smart_IPT	ENSG00000105976		0.338	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MET	HGNC	protein_coding	OTTHUMT00000059620.3	-	0.00	61	0	G			116397741	+1	tier1	-	no_errors	ENST00000318493	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	A
METTL4	64863	genome.wustl.edu	37	18	2547509	2547509	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr18:2547509G>T	ENST00000574538.1	-	6	1694	c.919C>A	c.(919-921)Ctg>Atg	p.L307M	METTL4_ENST00000319888.6_Missense_Mutation_p.L307M	NM_022840.3	NP_073751.3	Q8N3J2	METL4_HUMAN	methyltransferase like 4	307					nucleobase-containing compound metabolic process (GO:0006139)		methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	17						TGTATTTGCAGGGGTGACAAA	0.378																																																	0													55.0	53.0	54.0					18																	2547509		2203	4300	6503	SO:0001583	missense	0				CCDS11826.1	18p11.31	2008-02-05			ENSG00000101574	ENSG00000101574			24726	protein-coding gene	gene with protein product						12477932	Standard	NM_022840		Approved	FLJ23017, HsT661	uc002klh.4	Q8N3J2	OTTHUMG00000131482	ENST00000574538.1:c.919C>A	18.37:g.2547509G>T	ENSP00000458290:p.Leu307Met		B2RNA1|Q2TAA7|Q9H5U9	Missense_Mutation	SNP	pfam_MT-A70-like,pfscan_MT-A70-like	p.L307M	ENST00000574538.1	37	c.919	CCDS11826.1	18	.	.	.	.	.	.	.	.	.	.	G	7.152	0.583959	0.13749	.	.	ENSG00000101574	ENST00000319888	T	0.44482	0.92	5.57	-1.36	0.09085	.	0.767779	0.12672	N	0.448697	T	0.22126	0.0533	L	0.27053	0.805	0.09310	N	1	B;B	0.19445	0.036;0.022	B;B	0.21151	0.033;0.024	T	0.16928	-1.0386	10	0.40728	T	0.16	-12.521	0.607	0.00754	0.4032:0.1306:0.2023:0.2639	.	307;307	A8K1T6;Q8N3J2	.;METL4_HUMAN	M	307	ENSP00000320349:L307M	ENSP00000320349:L307M	L	-	1	2	METTL4	2537509	0.500000	0.26091	0.153000	0.22517	0.784000	0.44337	1.262000	0.32992	-0.131000	0.11578	-0.145000	0.13849	CTG	METTL4	-	pfam_MT-A70-like,pfscan_MT-A70-like	ENSG00000101574		0.378	METTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL4	HGNC	protein_coding	OTTHUMT00000254326.3		0.00	45	0	G	NM_022840		2547509	-1			no_errors	ENST00000574538	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.002	T
MIER3	166968	genome.wustl.edu	37	5	56219767	56219767	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:56219767delT	ENST00000381199.3	-	11	1037	c.1027delA	c.(1027-1029)agafs	p.R343fs	MIER3_ENST00000409421.1_Frame_Shift_Del_p.R280fs|MIER3_ENST00000381226.3_Frame_Shift_Del_p.R348fs|MIER3_ENST00000381213.3_Frame_Shift_Del_p.R342fs|SETD9_ENST00000541720.1_Intron			Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family member 3	343					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R342fs*15(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(2)|urinary_tract(1)	19		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		TGGTTATATCTTTTTTTCCCA	0.368																																																	1	Deletion - Frameshift(1)	large_intestine(1)											144.0	141.0	142.0					5																	56219767		2203	4300	6503	SO:0001589	frameshift_variant	0			BX537798	CCDS3973.2, CCDS75248.1	5q11.2	2009-03-19			ENSG00000155545	ENSG00000155545			26678	protein-coding gene	gene with protein product						12477932	Standard	XM_005248448		Approved	FLJ35954, DKFZp686L09111, DKFZp781I1119	uc003jra.1	Q7Z3K6	OTTHUMG00000059589	ENST00000381199.3:c.1027delA	5.37:g.56219767delT	ENSP00000370596:p.Arg343fs		B4DRI9|B8ZZQ0|Q5CZI0|Q68CS3|Q6MZS7|Q86YG8|Q8NA13	Frame_Shift_Del	DEL	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.R343fs	ENST00000381199.3	37	c.1027		5																																																																																			MIER3	-	NULL	ENSG00000155545		0.368	MIER3-004	KNOWN	basic|appris_candidate	protein_coding	MIER3	HGNC	protein_coding	OTTHUMT00000132523.2		0.00	34	0	T	NM_152622		56219767	-1	tier1		no_errors	ENST00000381199	ensembl	human	known	74_37	frame_shift_del	5.56	34	2	DEL	1.000	-
ELMO1	9844	genome.wustl.edu	37	7	36959021	36959021	+	Intron	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:36959021G>T	ENST00000310758.4	-	17	2085				ELMO1_ENST00000448602.1_Intron|ELMO1_ENST00000396045.3_Intron|MIR1200_ENST00000408398.1_RNA|ELMO1_ENST00000341056.3_Intron|ELMO1_ENST00000396040.2_Intron|ELMO1_ENST00000442504.1_Intron	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1						actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GCTCAGAATGGCTCAGgagaa	0.468																																																	0													73.0	64.0	67.0					7																	36959021		1568	3582	5150	SO:0001627	intron_variant	0			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.1438-24399C>A	7.37:g.36959021G>T			A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	RNA	SNP	-	NULL	ENST00000310758.4	37	NULL	CCDS5449.1	7																																																																																			MIR1200	-	-	ENSG00000221325		0.468	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR1200	HGNC	protein_coding	OTTHUMT00000219830.4	-	0.00	45	0	G	NM_130442		36959021	-1	tier1	-	no_errors	ENST00000408398	ensembl	human	known	74_37	rna	9.09	40	4	SNP	0.000	T
MKI67	4288	genome.wustl.edu	37	10	129913420	129913420	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:129913420G>C	ENST00000368654.3	-	7	1627	c.1252C>G	c.(1252-1254)Ctc>Gtc	p.L418V	MKI67_ENST00000368653.3_Intron|MKI67_ENST00000484853.1_5'Flank	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	418					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TTGGAAGAGAGATTTTCTGGC	0.433																																																	0													93.0	96.0	95.0					10																	129913420		2203	4300	6503	SO:0001583	missense	0			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.1252C>G	10.37:g.129913420G>C	ENSP00000357643:p.Leu418Val		Q5VWH2	Missense_Mutation	SNP	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.L418V	ENST00000368654.3	37	c.1252	CCDS7659.1	10	.	.	.	.	.	.	.	.	.	.	G	10.18	1.279850	0.23392	.	.	ENSG00000148773	ENST00000368654;ENST00000537609	T	0.01252	5.1	3.94	1.99	0.26369	.	1.051650	0.07458	N	0.900082	T	0.02380	0.0073	N	0.24115	0.695	0.09310	N	1	D	0.55172	0.97	P	0.54346	0.749	T	0.52087	-0.8622	10	0.87932	D	0	.	4.846	0.13514	0.1249:0.2218:0.6533:0.0	.	418	P46013	KI67_HUMAN	V	418	ENSP00000357643:L418V	ENSP00000357643:L418V	L	-	1	0	MKI67	129803410	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	-0.225000	0.09151	0.397000	0.25310	0.655000	0.94253	CTC	MKI67	-	NULL	ENSG00000148773		0.433	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	HGNC	protein_coding	OTTHUMT00000050999.1	-	0.00	51	0	G	NM_002417		129913420	-1	tier1	-	no_errors	ENST00000368654	ensembl	human	known	74_37	missense	39.13	28	18	SNP	0.000	C
MKRN3	7681	genome.wustl.edu	37	15	23811569	23811569	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:23811569G>A	ENST00000314520.3	+	1	1116	c.640G>A	c.(640-642)Ggc>Agc	p.G214S	RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000564592.1_Intron|MKRN3_ENST00000568252.1_Intron	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	214					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		GCCCTACCGGGGCCGCTGGGT	0.592																																																	0													39.0	45.0	43.0					15																	23811569		2203	4300	6503	SO:0001583	missense	0			U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.640G>A	15.37:g.23811569G>A	ENSP00000313881:p.Gly214Ser			Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.G214S	ENST00000314520.3	37	c.640	CCDS10013.1	15	.	.	.	.	.	.	.	.	.	.	G	22.9	4.346694	0.82022	.	.	ENSG00000179455	ENST00000314520	T	0.33438	1.41	4.07	4.07	0.47477	.	0.000000	0.85682	D	0.000000	T	0.44746	0.1308	L	0.45352	1.415	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.19844	-1.0293	10	0.44086	T	0.13	.	12.0845	0.53690	0.0:0.0:1.0:0.0	.	214	Q13064	MKRN3_HUMAN	S	214	ENSP00000313881:G214S	ENSP00000313881:G214S	G	+	1	0	MKRN3	21362662	1.000000	0.71417	0.994000	0.49952	0.885000	0.51271	6.675000	0.74493	2.567000	0.86603	0.655000	0.94253	GGC	MKRN3	-	NULL	ENSG00000179455		0.592	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN3	HGNC	protein_coding	OTTHUMT00000251225.1	-	0.00	51	0	G	NM_005664		23811569	+1	tier1	-	no_errors	ENST00000314520	ensembl	human	known	74_37	missense	42.65	39	29	SNP	1.000	A
MMP13	4322	genome.wustl.edu	37	11	102822858	102822858	+	Silent	SNP	A	A	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:102822858A>G	ENST00000260302.3	-	5	710	c.682T>C	c.(682-684)Tta>Cta	p.L228L	MMP13_ENST00000340273.4_Silent_p.L228L	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	228	Interaction with TIMP2.				bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	TCAAGACCTAAGGAGTGGCCG	0.453																																																	0													191.0	180.0	184.0					11																	102822858		2202	4299	6501	SO:0001819	synonymous_variant	0			X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.682T>C	11.37:g.102822858A>G			A8K846|B2RCZ3|Q6NWN6	Silent	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	p.L228	ENST00000260302.3	37	c.682	CCDS8324.1	11																																																																																			MMP13	-	pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	ENSG00000137745		0.453	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MMP13	HGNC	protein_coding	OTTHUMT00000386648.1	-	0.00	37	0	A	NM_002427		102822858	-1	tier1	-	no_errors	ENST00000340273	ensembl	human	novel	74_37	silent	44.44	10	8	SNP	0.998	G
MOV10	4343	genome.wustl.edu	37	1	113235508	113235508	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:113235508delC	ENST00000413052.2	+	7	1487	c.1097delC	c.(1096-1098)accfs	p.T366fs	MOV10_ENST00000357443.2_Frame_Shift_Del_p.T366fs|MOV10_ENST00000369645.1_Frame_Shift_Del_p.T366fs|MOV10_ENST00000369644.1_Frame_Shift_Del_p.T310fs|MOV10_ENST00000468624.1_3'UTR|RP11-426L16.3_ENST00000421943.1_RNA	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	366					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		GTGCCCATGACCTGGGACCCT	0.602																																																	0													39.0	33.0	35.0					1																	113235508		2203	4300	6503	SO:0001589	frameshift_variant	0			AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.1097delC	1.37:g.113235508delC	ENSP00000399797:p.Thr366fs		Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Frame_Shift_Del	DEL	superfamily_P-loop_NTPase	p.W367fs	ENST00000413052.2	37	c.1097	CCDS853.1	1																																																																																			MOV10	-	NULL	ENSG00000155363		0.602	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOV10	HGNC	protein_coding	OTTHUMT00000032906.1		0.00	38	0	C	NM_020963		113235508	+1	tier1		no_errors	ENST00000357443	ensembl	human	known	74_37	frame_shift_del	14.29	12	2	DEL	0.997	-
MPHOSPH8	54737	genome.wustl.edu	37	13	20235848	20235848	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr13:20235848G>T	ENST00000361479.5	+	8	1870	c.1802G>T	c.(1801-1803)gGa>gTa	p.G601V	MPHOSPH8_ENST00000414242.2_Missense_Mutation_p.G601V	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	601					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)			breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		GATTCCAGTGGAATGACACTG	0.483																																																	0													142.0	152.0	149.0					13																	20235848		2203	4300	6503	SO:0001583	missense	0			AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.1802G>T	13.37:g.20235848G>T	ENSP00000355388:p.Gly601Val		B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Chromo_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Chromo_domain/shadow	p.G601V	ENST00000361479.5	37	c.1802	CCDS9287.1	13	.	.	.	.	.	.	.	.	.	.	G	29.2	4.986481	0.93044	.	.	ENSG00000196199	ENST00000414242;ENST00000361479	T;T	0.78816	-1.21;-1.21	6.08	6.08	0.98989	Ankyrin repeat-containing domain (4);	0.104769	0.64402	D	0.000003	D	0.91841	0.7418	M	0.93898	3.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92794	0.6251	10	0.87932	D	0	.	20.2672	0.98462	0.0:0.0:1.0:0.0	.	601;601	Q99549;Q99549-2	MPP8_HUMAN;.	V	601	ENSP00000414663:G601V;ENSP00000355388:G601V	ENSP00000355388:G601V	G	+	2	0	MPHOSPH8	19133848	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	9.128000	0.94424	2.894000	0.99253	0.591000	0.81541	GGA	MPHOSPH8	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000196199		0.483	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPHOSPH8	HGNC	protein_coding	OTTHUMT00000044028.2	-	0.00	52	0	G	NM_017520		20235848	+1	tier1	-	no_errors	ENST00000414242	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
MSR1	4481	genome.wustl.edu	37	8	16021760	16021760	+	Splice_Site	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:16021760C>T	ENST00000262101.5	-	5	752	c.631G>A	c.(631-633)Gaa>Aaa	p.E211K	MSR1_ENST00000536385.1_5'UTR|MSR1_ENST00000381998.4_Splice_Site_p.E211K|MSR1_ENST00000355282.2_Splice_Site_p.E211K|MSR1_ENST00000445506.2_Splice_Site_p.E229K|MSR1_ENST00000350896.3_Splice_Site_p.E211K			P21757	MSRE_HUMAN	macrophage scavenger receptor 1	211					cholesterol transport (GO:0030301)|lipoprotein transport (GO:0042953)|plasma lipoprotein particle clearance (GO:0034381)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)			haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		TTACTGATTTCCTGTAAAACA	0.328																																																	0													99.0	87.0	91.0					8																	16021760		2202	4299	6501	SO:0001630	splice_region_variant	0			D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945		"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622				2251254	Standard	NM_138715		Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000262101.5:c.631-1G>A	8.37:g.16021760C>T			D3DSP3|O60505|P21759|Q45F10	Missense_Mutation	SNP	pfam_SRCR,pfam_Macro_scav_rcpt,pfam_Collagen,superfamily_Srcr_rcpt-rel,superfamily_STAT_TF_coiled-coil,smart_Srcr_rcpt-rel,prints_Macro_scav_rcpt,prints_SRCR,pfscan_SRCR	p.E211K	ENST00000262101.5	37	c.631	CCDS5995.1	8	.	.	.	.	.	.	.	.	.	.	C	15.97	2.990763	0.54041	.	.	ENSG00000038945	ENST00000350896;ENST00000262101;ENST00000445506;ENST00000355282;ENST00000522672;ENST00000381998	T;T;T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29;-1.29;-1.29	4.56	4.56	0.56223	Macrophage scavenger receptor (1);	0.312551	0.27558	N	0.018821	T	0.74336	0.3703	L	0.47716	1.5	0.80722	D	1	P;P;P;P	0.43094	0.799;0.787;0.634;0.682	B;B;B;B	0.39379	0.188;0.298;0.234;0.156	T	0.72852	-0.4167	10	0.22706	T	0.39	.	15.6466	0.77061	0.0:1.0:0.0:0.0	.	229;211;211;211	B4DDJ5;P21757-2;P21757-3;P21757	.;.;.;MSRE_HUMAN	K	211;211;229;211;1;211	ENSP00000262100:E211K;ENSP00000262101:E211K;ENSP00000405453:E229K;ENSP00000347430:E211K;ENSP00000430536:E1K;ENSP00000371428:E211K	ENSP00000262101:E211K	E	-	1	0	MSR1	16066131	0.995000	0.38212	0.757000	0.31301	0.648000	0.38561	1.715000	0.37971	2.472000	0.83506	0.655000	0.94253	GAA	MSR1	-	superfamily_STAT_TF_coiled-coil,prints_Macro_scav_rcpt	ENSG00000038945		0.328	MSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSR1	HGNC	protein_coding	OTTHUMT00000211627.2	-	0.00	38	0	C		Missense_Mutation	16021760	-1	tier1	-	no_errors	ENST00000262101	ensembl	human	known	74_37	missense	33.33	18	9	SNP	0.999	T
MUC16	94025	genome.wustl.edu	37	19	9075971	9075971	+	Silent	SNP	T	T	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:9075971T>A	ENST00000397910.4	-	3	11678	c.11475A>T	c.(11473-11475)ccA>ccT	p.P3825P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3826	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P3825P(4)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GCACCTGCCCTGGATGTGCAG	0.507																																																	4	Substitution - coding silent(4)	lung(4)											211.0	198.0	202.0					19																	9075971		2056	4210	6266	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.11475A>T	19.37:g.9075971T>A			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.P3825	ENST00000397910.4	37	c.11475	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	30	0	T	NM_024690		9075971	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	30.00	28	12	SNP	0.008	A
MUC4	4585	genome.wustl.edu	37	3	195508451	195508451	+	Missense_Mutation	SNP	G	G	T	rs201933946		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:195508451G>T	ENST00000463781.3	-	2	10459	c.10000C>A	c.(10000-10002)Cct>Act	p.P3334T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P3334T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V3305_S3336delVSTGHATPLLVTDASSASTGHATPLHVTSPSS(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGGGCTGGTGACA	0.592																																																	1	Deletion - In frame(1)	stomach(1)											28.0	22.0	24.0					3																	195508451		689	1573	2262	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10000C>A	3.37:g.195508451G>T	ENSP00000417498:p.Pro3334Thr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.P3334T	ENST00000463781.3	37	c.10000	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	N	0.698	-0.792084	0.02884	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29655	1.63;1.56	0.423	-0.846	0.10734	.	.	.	.	.	T	0.09686	0.0238	N	0.03608	-0.345	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.22906	-1.0203	7	.	.	.	.	.	.	.	.	3206	E7ESK3	.	T	3334	ENSP00000417498:P3334T;ENSP00000420243:P3334T	.	P	-	1	0	MUC4	196993230	0.000000	0.05858	0.003000	0.11579	0.008000	0.06430	-4.124000	0.00290	-1.978000	0.00993	-1.863000	0.00559	CCT	MUC4	-	NULL	ENSG00000145113		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	177	0	G	NM_018406		195508451	-1	tier1	rs201933946	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	5.73	181	11	SNP	0.081	T
MYB	4602	genome.wustl.edu	37	6	135507099	135507099	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:135507099G>T	ENST00000367814.4	+	2	268	c.82G>T	c.(82-84)Ggg>Tgg	p.G28W	MYB_ENST00000534044.1_Missense_Mutation_p.G28W|MYB_ENST00000341911.5_Missense_Mutation_p.G28W|MYB_ENST00000527615.1_Missense_Mutation_p.G28W|MYB_ENST00000533624.1_Missense_Mutation_p.G28W|MYB_ENST00000525369.1_Missense_Mutation_p.G28W|MYB_ENST00000420123.2_Missense_Mutation_p.G28W|MYB_ENST00000534121.1_Missense_Mutation_p.G28W|MYB_ENST00000442647.2_Missense_Mutation_p.G28W|MYB_ENST00000316528.8_Missense_Mutation_p.G28W|MYB_ENST00000531845.1_3'UTR|MYB_ENST00000528774.1_Missense_Mutation_p.G28W	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog	28					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		TGACTATGATGGGCTGCTTCC	0.453			T	NFIB	adenoid cystic carcinoma																																			Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	0													155.0	141.0	146.0					6																	135507099		2203	4300	6503	SO:0001583	missense	0				CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.82G>T	6.37:g.135507099G>T	ENSP00000356788:p.Gly28Trp		E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	Missense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.G28W	ENST00000367814.4	37	c.82	CCDS5174.1	6	.	.	.	.	.	.	.	.	.	.	G	25.0	4.591919	0.86953	.	.	ENSG00000118513	ENST00000341911;ENST00000442647;ENST00000316528;ENST00000237302;ENST00000367814;ENST00000527615;ENST00000420123;ENST00000525369;ENST00000528774;ENST00000534121;ENST00000534044;ENST00000533624	T;T;T;T;T;T;T;T;T;T	0.32753	2.69;2.2;2.19;2.2;1.44;1.91;2.69;2.69;1.86;2.22	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.48314	0.1493	M	0.63428	1.95	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.997;0.999;1.0;0.998;1.0	D;D;D;D;D;D;D;D;D	0.97110	1.0;0.985;0.992;0.994;0.958;0.982;0.996;0.958;0.991	T	0.49969	-0.8882	10	0.72032	D	0.01	-10.4013	18.9715	0.92716	0.0:0.0:1.0:0.0	.	28;28;28;28;28;28;28;28;28	E9PI07;E9PLZ5;P10242-2;E9PNL6;E9PRS2;E9PNA4;P10242-4;P10242;Q708E1	.;.;.;.;.;.;.;MYB_HUMAN;.	W	28	ENSP00000339992:G28W;ENSP00000410825:G28W;ENSP00000326328:G28W;ENSP00000356788:G28W;ENSP00000433227:G28W;ENSP00000435938:G28W;ENSP00000434723:G28W;ENSP00000432851:G28W;ENSP00000435055:G28W;ENSP00000436605:G28W	ENSP00000237302:G28W	G	+	1	0	MYB	135548792	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.561000	0.86390	0.563000	0.77884	GGG	MYB	-	NULL	ENSG00000118513		0.453	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYB	HGNC	protein_coding	OTTHUMT00000042347.4	-	0.00	53	0	G			135507099	+1	tier1	-	no_errors	ENST00000341911	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
MYBL1	4603	genome.wustl.edu	37	8	67488558	67488558	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:67488558G>T	ENST00000522677.3	-	10	1564	c.1154C>A	c.(1153-1155)gCt>gAt	p.A385D	MYBL1_ENST00000524176.2_Missense_Mutation_p.A385D|MYBL1_ENST00000517885.1_Intron	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	385	Negative regulatory domain. {ECO:0000250}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			GATAGGAGAAGCAGCAGCATC	0.373																																																	0													146.0	138.0	140.0					8																	67488558		1876	4127	6003	SO:0001583	missense	0			X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.1154C>A	8.37:g.67488558G>T	ENSP00000429633:p.Ala385Asp		E7EW29|Q495F9	Missense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.A385D	ENST00000522677.3	37	c.1154	CCDS47867.1	8	.	.	.	.	.	.	.	.	.	.	G	11.59	1.684822	0.29872	.	.	ENSG00000185697	ENST00000522677;ENST00000524176	T;T	0.17370	2.76;2.28	5.5	5.5	0.81552	.	0.217837	0.48286	D	0.000181	T	0.18215	0.0437	L	0.53249	1.67	0.49051	D	0.999746	B;B;B	0.34103	0.106;0.437;0.134	B;B;B	0.35607	0.044;0.206;0.043	T	0.03193	-1.1062	10	0.12103	T	0.63	-9.8974	14.5971	0.68415	0.0718:0.0:0.9282:0.0	.	385;384;385	Q495F9;Q495G0;P10243	.;.;MYBA_HUMAN	D	385	ENSP00000429633:A385D;ENSP00000428011:A385D	ENSP00000429633:A385D	A	-	2	0	MYBL1	67651112	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.030000	0.57260	2.600000	0.87896	0.591000	0.81541	GCT	MYBL1	-	NULL	ENSG00000185697		0.373	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBL1	HGNC	protein_coding	OTTHUMT00000379221.3	-	0.00	75	0	G	XM_034274		67488558	-1	tier1	-	no_errors	ENST00000522677	ensembl	human	known	74_37	missense	5.05	94	5	SNP	1.000	T
MYH15	22989	genome.wustl.edu	37	3	108129652	108129652	+	Missense_Mutation	SNP	C	C	T	rs368421301		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:108129652C>T	ENST00000273353.3	-	32	4389	c.4333G>A	c.(4333-4335)Ggg>Agg	p.G1445R		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1445						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						CGGACCTTCCCGAGGTCAGAC	0.652																																																	0								C	ARG/GLY	1,4075		0,1,2037	36.0	38.0	37.0		4333	4.4	0.0	3		37	0,8364		0,0,4182	no	missense	MYH15	NM_014981.1	125	0,1,6219	TT,TC,CC		0.0,0.0245,0.0080	probably-damaging	1445/1947	108129652	1,12439	2038	4182	6220	SO:0001583	missense	0			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.4333G>A	3.37:g.108129652C>T	ENSP00000273353:p.Gly1445Arg			Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.G1445R	ENST00000273353.3	37	c.4333	CCDS43127.1	3	.	.	.	.	.	.	.	.	.	.	C	12.72	2.023788	0.35701	2.45E-4	0.0	ENSG00000144821	ENST00000273353	T	0.77489	-1.1	5.31	4.44	0.53790	Myosin tail (1);	.	.	.	.	T	0.72244	0.3436	L	0.46157	1.445	0.40512	D	0.980743	B	0.25312	0.123	B	0.22601	0.04	T	0.72023	-0.4415	9	0.87932	D	0	.	13.9592	0.64168	0.0:0.9268:0.0:0.0732	.	1445	Q9Y2K3	MYH15_HUMAN	R	1445	ENSP00000273353:G1445R	ENSP00000273353:G1445R	G	-	1	0	MYH15	109612342	0.903000	0.30736	0.005000	0.12908	0.138000	0.21146	1.977000	0.40589	1.248000	0.43934	0.561000	0.74099	GGG	MYH15	-	pfam_Myosin_tail	ENSG00000144821		0.652	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1		0.00	10	0	C	XM_036988		108129652	-1			no_errors	ENST00000273353	ensembl	human	known	74_37	missense	16.67	15	3	SNP	0.964	T
MYH8	4626	genome.wustl.edu	37	17	10299898	10299898	+	Silent	SNP	C	C	G	rs146773971		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:10299898C>G	ENST00000403437.2	-	32	4594	c.4500G>C	c.(4498-4500)acG>acC	p.T1500T	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1500					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CTCTTCTTAGCGTTTCGAGTT	0.478									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																								0													85.0	87.0	86.0					17																	10299898		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.4500G>C	17.37:g.10299898C>G			Q14910	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.T1500	ENST00000403437.2	37	c.4500	CCDS11153.1	17																																																																																			MYH8	-	pfam_Myosin_tail,superfamily_t-SNARE	ENSG00000133020		0.478	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	HGNC	protein_coding	OTTHUMT00000252724.2		0.00	45	0	C	NM_002472		10299898	-1			no_errors	ENST00000403437	ensembl	human	known	74_37	silent	7.41	25	2	SNP	0.010	G
MYH4	4622	genome.wustl.edu	37	17	10355270	10355270	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:10355270G>T	ENST00000255381.2	-	27	3836	c.3726C>A	c.(3724-3726)gtC>gtA	p.V1242V	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1242					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TGGCTTTGGAGACAGTCTCCA	0.398																																																	0													132.0	108.0	116.0					17																	10355270		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.3726C>A	17.37:g.10355270G>T				Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.V1242	ENST00000255381.2	37	c.3726	CCDS11154.1	17																																																																																			MYH4	-	pfam_Myosin_tail,superfamily_Prefoldin	ENSG00000264424		0.398	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	HGNC	protein_coding	OTTHUMT00000252731.1	-	0.00	74	0	G	NM_017533		10355270	-1	tier1	-	no_errors	ENST00000255381	ensembl	human	known	74_37	silent	7.69	48	4	SNP	1.000	T
MYH2	4620	genome.wustl.edu	37	17	10429074	10429074	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:10429074A>G	ENST00000245503.5	-	31	4691	c.4307T>C	c.(4306-4308)cTt>cCt	p.L1436P	MYH2_ENST00000397183.2_Missense_Mutation_p.L1436P|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000532183.2_Intron|CTC-297N7.11_ENST00000587182.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1436					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CTCCACATCAAGCATGAGGTC	0.507																																																	0													97.0	89.0	92.0					17																	10429074		2203	4300	6503	SO:0001583	missense	0				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.4307T>C	17.37:g.10429074A>G	ENSP00000245503:p.Leu1436Pro		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1436P	ENST00000245503.5	37	c.4307	CCDS11156.1	17	.	.	.	.	.	.	.	.	.	.	A	23.0	4.364938	0.82463	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	D;D	0.87412	-2.25;-2.25	4.9	4.9	0.64082	Myosin tail (1);	0.621647	0.11740	U	0.534138	D	0.92061	0.7484	M	0.78801	2.425	0.80722	D	1	B	0.33583	0.418	P	0.48552	0.581	D	0.90832	0.4717	10	0.87932	D	0	.	14.6913	0.69087	1.0:0.0:0.0:0.0	.	1436	Q9UKX2	MYH2_HUMAN	P	1436	ENSP00000245503:L1436P;ENSP00000380367:L1436P	ENSP00000245503:L1436P	L	-	2	0	MYH2	10369799	1.000000	0.71417	0.915000	0.36163	0.897000	0.52465	9.139000	0.94554	2.068000	0.61886	0.260000	0.18958	CTT	MYH2	-	pfam_Myosin_tail	ENSG00000125414		0.507	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3		0.00	58	0	A	NM_017534		10429074	-1			no_errors	ENST00000245503	ensembl	human	known	74_37	missense	6.25	45	3	SNP	0.998	G
MYO1H	283446	genome.wustl.edu	37	12	109845751	109845751	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:109845751G>T	ENST00000431443.2	+	9	1140	c.1140G>T	c.(1138-1140)ttG>ttT	p.L380F	MYO1H_ENST00000310903.5_Intron	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	380	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						CCTTGCTCTTGCTCACGTGGT	0.433																																																	0													150.0	137.0	141.0					12																	109845751		1957	4136	6093	SO:0001583	missense	0				CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.1140G>T	12.37:g.109845751G>T	ENSP00000444076:p.Leu380Phe		F5H3C6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.L380F	ENST00000431443.2	37	c.1140		12	.	.	.	.	.	.	.	.	.	.	G	0.264	-0.997551	0.02145	.	.	ENSG00000174527	ENST00000431443	D	0.88124	-2.34	3.4	-6.8	0.01709	.	.	.	.	.	T	0.77718	0.4172	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.66139	-0.5998	5	.	.	.	.	7.8552	0.29478	0.1652:0.0:0.4925:0.3422	.	.	.	.	F	380	ENSP00000444076:L380F	.	L	+	3	2	MYO1H	108330134	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.312000	0.08113	-1.912000	0.01081	-0.681000	0.03757	TTG	MYO1H	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000174527		0.433	MYO1H-201	KNOWN	basic	protein_coding	MYO1H	HGNC	protein_coding		-	0.00	71	0	G	NM_173597		109845751	+1	tier1	-	no_errors	ENST00000431443	ensembl	human	known	74_37	missense	6.67	69	5	SNP	0.000	T
MYO5B	4645	genome.wustl.edu	37	18	47404149	47404149	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr18:47404149G>T	ENST00000285039.7	-	25	3679	c.3380C>A	c.(3379-3381)gCc>gAc	p.A1127D	MYO5B_ENST00000324581.6_Missense_Mutation_p.A268D|MYO5B_ENST00000587895.1_5'Flank	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	1127					endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)	p.A1127D(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		CTGCTGGAGGGCATCCTCAGT	0.502																																																	1	Substitution - Missense(1)	endometrium(1)											166.0	163.0	164.0					18																	47404149		1999	4174	6173	SO:0001583	missense	0			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.3380C>A	18.37:g.47404149G>T	ENSP00000285039:p.Ala1127Asp		B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1127D	ENST00000285039.7	37	c.3380	CCDS42436.1	18	.	.	.	.	.	.	.	.	.	.	G	13.88	2.367710	0.42003	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	T;T	0.18657	2.2;2.2	5.67	5.67	0.87782	.	0.307790	0.34603	N	0.003828	T	0.11495	0.0280	N	0.08118	0	0.39130	D	0.961831	B;P	0.36753	0.042;0.568	B;B	0.37550	0.039;0.253	T	0.27971	-1.0058	10	0.12766	T	0.61	.	13.9919	0.64372	0.0745:0.0:0.9255:0.0	.	1127;268	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	D	1127;268	ENSP00000285039:A1127D;ENSP00000315531:A268D	ENSP00000285039:A1127D	A	-	2	0	MYO5B	45658147	1.000000	0.71417	1.000000	0.80357	0.369000	0.29798	5.997000	0.70646	2.681000	0.91329	0.561000	0.74099	GCC	MYO5B	-	NULL	ENSG00000167306		0.502	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	HGNC	protein_coding	OTTHUMT00000448515.2	-	0.00	72	0	G			47404149	-1	tier1	-	no_errors	ENST00000285039	ensembl	human	known	74_37	missense	12.82	34	5	SNP	0.997	T
NAA20	51126	genome.wustl.edu	37	20	20013246	20013246	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr20:20013246G>T	ENST00000334982.4	+	5	681	c.400G>T	c.(400-402)Gtc>Ttc	p.V134F	NAA20_ENST00000398602.2_Missense_Mutation_p.V122F|NAA20_ENST00000310450.4_Intron|NAA20_ENST00000484480.1_3'UTR	NM_016100.4	NP_057184.1	P61599	NAA20_HUMAN	N(alpha)-acetyltransferase 20, NatB catalytic subunit	134	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.					cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	peptide alpha-N-acetyltransferase activity (GO:0004596)			endometrium(3)|lung(2)|prostate(1)	6						ATATAGGACGGTCATAGAGTA	0.443																																																	0													98.0	91.0	94.0					20																	20013246		2203	4300	6503	SO:0001583	missense	0			AF085355	CCDS13141.1, CCDS13142.1, CCDS42854.1	20p11.23	2010-05-07	2010-01-14	2010-01-14	ENSG00000173418	ENSG00000173418	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	15908	protein-coding gene	gene with protein product	"""N-acetyltransferase 3 homolog (S. cerevisiae)"""	610833	"""N-acetyltransferase 5, ARD1 subunit (arrest-defective 1, S. cerevisiae, homolog)"", ""N-acetyltransferase 5 (ARD1 homolog, S. cerevisiae)"", ""N-acetyltransferase 5"", ""N-acetyltransferase 5 (GCN5-related, putative)"""	NAT5		12888564, 19660095	Standard	NM_016100		Approved	dJ1002M8.1, NAT3	uc002wrp.3	P61599	OTTHUMG00000031998	ENST00000334982.4:c.400G>T	20.37:g.20013246G>T	ENSP00000335636:p.Val134Phe		A6NHA3|B2R4G4|Q5TFT7|Q9D7H8|Q9H0Y4|Q9NQH6|Q9Y6D2	Missense_Mutation	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.V134F	ENST00000334982.4	37	c.400	CCDS13141.1	20	.	.	.	.	.	.	.	.	.	.	G	31	5.101582	0.94245	.	.	ENSG00000173418	ENST00000334982;ENST00000398602	T;T	0.68181	0.3;-0.31	5.62	5.62	0.85841	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.132351	0.51477	D	0.000086	D	0.86981	0.6064	H	0.95079	3.62	0.80722	D	1	P;D	0.65815	0.703;0.995	P;D	0.64410	0.664;0.925	D	0.90526	0.4492	9	.	.	.	-12.62	18.4866	0.90831	0.0:0.0:1.0:0.0	.	122;134	A8MZB2;P61599	.;NAA20_HUMAN	F	134;122	ENSP00000335636:V134F;ENSP00000381603:V122F	.	V	+	1	0	NAA20	19961246	1.000000	0.71417	0.986000	0.45419	0.764000	0.43329	9.700000	0.98707	2.664000	0.90586	0.650000	0.86243	GTC	NAA20	-	superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000173418		0.443	NAA20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA20	HGNC	protein_coding	OTTHUMT00000078217.2	-	0.00	30	0	G	NM_016100		20013246	+1	tier1	-	no_errors	ENST00000334982	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	T
NBEA	26960	genome.wustl.edu	37	13	36245305	36245305	+	3'UTR	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr13:36245305G>A	ENST00000400445.3	+	0	9552				NBEA_ENST00000379939.2_3'UTR|NBEA_ENST00000310336.4_3'UTR|NBEA_ENST00000461581.1_3'UTR|NBEA_ENST00000379922.3_3'UTR|NBEA_ENST00000540320.1_3'UTR|NBEA_ENST00000537702.1_3'UTR	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin						protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GTTTTTTCACGACTGAACACC	0.343																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.*177G>A	13.37:g.36245305G>A			B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	RNA	SNP	-	NULL	ENST00000400445.3	37	NULL	CCDS45026.1	13																																																																																			NBEA	-	-	ENSG00000172915		0.343	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		-	0.00	42	0	G	NM_015678		36245305	+1	tier1	-	no_errors	ENST00000461581	ensembl	human	known	74_37	rna	16.67	35	7	SNP	0.988	A
NCAPG	64151	genome.wustl.edu	37	4	17813843	17813843	+	Splice_Site	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:17813843G>T	ENST00000251496.2	+	2	287		c.e2-1		DCAF16_ENST00000507768.1_5'Flank|DCAF16_ENST00000536863.1_5'Flank|DCAF16_ENST00000382247.1_5'Flank	NM_022346.4	NP_071741.2	Q9BPX3	CND3_HUMAN	non-SMC condensin I complex, subunit G						mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	27				STAD - Stomach adenocarcinoma(129;0.18)		TTGTCTTTCAGATGGATGATA	0.368																																																	0													93.0	88.0	89.0					4																	17813843		2203	4300	6503	SO:0001630	splice_region_variant	0			AF331796	CCDS3424.1	4p15.32	2014-01-15			ENSG00000109805	ENSG00000109805			24304	protein-coding gene	gene with protein product	"""chromosome condensation protein G"""	606280				10910072, 11136719	Standard	NM_022346		Approved	FLJ12450, hCAP-G, CAP-G, YCG1	uc003gpp.4	Q9BPX3	OTTHUMG00000128539	ENST00000251496.2:c.112-1G>T	4.37:g.17813843G>T			Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Splice_Site	SNP	-	e2-1	ENST00000251496.2	37	c.112-1	CCDS3424.1	4	.	.	.	.	.	.	.	.	.	.	G	20.8	4.047281	0.75846	.	.	ENSG00000109805	ENST00000251496	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2689	0.94000	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NCAPG	17422941	1.000000	0.71417	0.951000	0.38953	0.823000	0.46562	9.434000	0.97515	2.546000	0.85860	0.655000	0.94253	.	NCAPG	-	-	ENSG00000109805		0.368	NCAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPG	HGNC	protein_coding	OTTHUMT00000250375.1	-	0.00	43	0	G	NM_022346	Intron	17813843	+1	tier1	-	no_errors	ENST00000251496	ensembl	human	known	74_37	splice_site	11.76	45	6	SNP	1.000	T
NCK1	4690	genome.wustl.edu	37	3	136664643	136664643	+	Missense_Mutation	SNP	A	A	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:136664643A>C	ENST00000481752.1	+	3	609	c.445A>C	c.(445-447)Aat>Cat	p.N149H	NCK1_ENST00000469404.1_Missense_Mutation_p.N85H|NCK1_ENST00000288986.2_Missense_Mutation_p.N149H			P16333	NCK1_HUMAN	NCK adaptor protein 1	149	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|axon guidance (GO:0007411)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|negative regulation of cell death (GO:0060548)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of translation (GO:0006417)|response to other organism (GO:0051707)|signal complex assembly (GO:0007172)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	cytoskeletal adaptor activity (GO:0008093)|protein kinase inhibitor activity (GO:0004860)|receptor binding (GO:0005102)|receptor signaling complex scaffold activity (GO:0030159)|receptor tyrosine kinase binding (GO:0030971)			cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	13						TGGTAGCTACAATGGACAAGT	0.453																																																	0													270.0	261.0	264.0					3																	136664643		2203	4300	6503	SO:0001583	missense	0			X17576	CCDS3092.1, CCDS54644.1	3q21	2013-02-14			ENSG00000158092	ENSG00000158092		"""SH2 domain containing"""	7664	protein-coding gene	gene with protein product		600508		NCK		7806213, 9737977	Standard	XM_005247498		Approved	NCKalpha	uc003erh.3	P16333	OTTHUMG00000159781	ENST00000481752.1:c.445A>C	3.37:g.136664643A>C	ENSP00000417273:p.Asn149His		B7Z751|D3DNE3	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_SH2,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pirsf_Cytoplasmic_NCK,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain	p.N149H	ENST00000481752.1	37	c.445	CCDS3092.1	3	.	.	.	.	.	.	.	.	.	.	A	22.4	4.290888	0.80914	.	.	ENSG00000158092	ENST00000288986;ENST00000481752;ENST00000469404	T;T;T	0.49139	0.79;0.79;0.79	6.16	6.16	0.99307	Src homology-3 domain (5);	0.088101	0.85682	D	0.000000	T	0.42108	0.1188	L	0.28649	0.875	0.58432	D	0.999999	B;B	0.27140	0.024;0.169	B;B	0.34242	0.141;0.178	T	0.30621	-0.9972	10	0.42905	T	0.14	-20.7963	14.7581	0.69583	1.0:0.0:0.0:0.0	.	85;149	B7Z751;P16333	.;NCK1_HUMAN	H	149;149;85	ENSP00000288986:N149H;ENSP00000417273:N149H;ENSP00000419631:N85H	ENSP00000288986:N149H	N	+	1	0	NCK1	138147333	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.859000	0.92264	2.367000	0.80283	0.528000	0.53228	AAT	NCK1	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pirsf_Cytoplasmic_NCK,pfscan_SH3_domain,prints_SH3_domain	ENSG00000158092		0.453	NCK1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NCK1	HGNC	protein_coding	OTTHUMT00000357307.1	-	0.00	92	0	A	NM_006153		136664643	+1	tier1	-	no_errors	ENST00000288986	ensembl	human	known	74_37	missense	14.17	109	18	SNP	1.000	C
NCL	4691	genome.wustl.edu	37	2	232327928	232327928	+	Missense_Mutation	SNP	C	C	T	rs375715628		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:232327928C>T	ENST00000322723.4	-	2	358	c.118G>A	c.(118-120)Gat>Aat	p.D40N	SNORD82_ENST00000365530.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	40					angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		CCACTGCTATCATCTTCTTCA	0.378																																																	0								C	ASN/ASP	2,4404	4.2+/-10.8	0,2,2201	303.0	269.0	281.0		118	3.6	0.7	2		281	0,8600		0,0,4300	no	missense	NCL	NM_005381.2	23	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	40/711	232327928	2,13004	2203	4300	6503	SO:0001583	missense	0				CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.118G>A	2.37:g.232327928C>T	ENSP00000318195:p.Asp40Asn		Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom	p.D40N	ENST00000322723.4	37	c.118	CCDS33397.1	2	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851746	0.51270	4.54E-4	0.0	ENSG00000115053	ENST00000322723;ENST00000392033;ENST00000322732;ENST00000454824;ENST00000417652;ENST00000453992;ENST00000436894	T;T;T;T;T	0.67345	3.0;-0.26;-0.26;3.04;1.94	3.6	3.6	0.41247	.	1.206810	0.06068	N	0.659686	T	0.62938	0.2469	L	0.34521	1.04	0.35625	D	0.809766	B	0.20780	0.048	B	0.25405	0.06	T	0.56456	-0.7976	10	0.72032	D	0.01	-2.4598	15.5647	0.76281	0.0:1.0:0.0:0.0	.	40	P19338	NUCL_HUMAN	N	40;40;40;24;24;24;24	ENSP00000318195:D40N;ENSP00000401620:D24N;ENSP00000392747:D24N;ENSP00000413775:D24N;ENSP00000401322:D24N	ENSP00000318195:D40N	D	-	1	0	NCL	232036172	0.985000	0.35326	0.717000	0.30585	0.506000	0.33950	2.966000	0.49208	2.335000	0.79485	0.650000	0.86243	GAT	NCL	-	NULL	ENSG00000115053		0.378	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCL	HGNC	protein_coding	OTTHUMT00000332731.1	-	0.00	69	0	C	NM_005381		232327928	-1	tier1	-	no_errors	ENST00000322723	ensembl	human	known	74_37	missense	10.96	65	8	SNP	1.000	T
NCOA5	57727	genome.wustl.edu	37	20	44691014	44691014	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr20:44691014G>T	ENST00000290231.6	-	8	1829	c.1665C>A	c.(1663-1665)tcC>tcA	p.S555S		NM_020967.2	NP_066018.1	Q9HCD5	NCOA5_HUMAN	nuclear receptor coactivator 5	555	Transcription activation.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				TAACCAGGTGGGAGAGAGCAG	0.537																																																	0													62.0	53.0	56.0					20																	44691014		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13392.1	20q12-q13.12	2008-07-02			ENSG00000124160	ENSG00000124160			15909	protein-coding gene	gene with protein product	"""coactivator independent of AF-2"""					11780052, 11113208	Standard	XM_005260474		Approved	bA465L10.6, CIA	uc002xre.3	Q9HCD5	OTTHUMG00000032639	ENST00000290231.6:c.1665C>A	20.37:g.44691014G>T			B2RTV9|E1P5R0|Q6HA99|Q9H1F2|Q9H2T2|Q9H4Y9	Silent	SNP	superfamily_Anticodon-bd	p.S555	ENST00000290231.6	37	c.1665	CCDS13392.1	20																																																																																			NCOA5	-	NULL	ENSG00000124160		0.537	NCOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA5	HGNC	protein_coding	OTTHUMT00000079559.1	-	0.00	56	0	G	NM_020967		44691014	-1	tier1	-	no_errors	ENST00000290231	ensembl	human	known	74_37	silent	9.09	50	5	SNP	0.998	T
NEK3	4752	genome.wustl.edu	37	13	52730333	52730333	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr13:52730333G>T	ENST00000452082.2	-	1	1287	c.57C>A	c.(55-57)tgC>tgA	p.C19*	NEK3_ENST00000339406.3_5'UTR|NEK3_ENST00000378101.2_5'UTR|NEK3_ENST00000400357.2_5'UTR			P51956	NEK3_HUMAN	NIMA-related kinase 3	0	Interaction with VAV2.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|stomach(2)	18		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.81e-08)		CCATGCTGGGGCATCCACACA	0.478																																																	0													43.0	41.0	42.0					13																	52730333		1987	4177	6164	SO:0001587	stop_gained	0			AK290259, BC019916	CCDS73576.1	13q14.2-q21.1	2014-07-17	2012-11-15		ENSG00000136098	ENSG00000136098	2.7.11.1		7746	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase NEK3"", ""phosphorylase B kinase kinase"", ""glycogen synthase A kinase"", ""hydroxyalkyl-protein kinase"""	604044	"""NIMA (never in mitosis gene a)-related kinase 3"""			8274451, 7522034	Standard	NM_002498		Approved	HSPK36, MGC29949	uc010tgy.2	P51956	OTTHUMG00000016958	ENST00000452082.2:c.57C>A	13.37:g.52730333G>T	ENSP00000404197:p.Cys19*		A8K2J4|Q5TAP2|Q8J023|Q8WUN5	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.C19*	ENST00000452082.2	37	c.57		13	.	.	.	.	.	.	.	.	.	.	G	43	10.520853	0.99420	.	.	ENSG00000136098	ENST00000452082	.	.	.	0.948	-1.18	0.09617	.	.	.	.	.	.	.	.	.	.	.	0.19300	N	0.999972	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	1.8972	0.03260	0.2352:0.0:0.4515:0.3133	.	.	.	.	X	19	.	ENSP00000404197:C19X	C	-	3	2	NEK3	51628334	0.462000	0.25791	0.288000	0.24862	0.471000	0.32888	0.000000	0.12993	-0.535000	0.06307	-0.361000	0.07541	TGC	NEK3	-	superfamily_Kinase-like_dom	ENSG00000136098		0.478	NEK3-203	KNOWN	basic	protein_coding	NEK3	HGNC	protein_coding		-	0.00	52	0	G			52730333	-1	tier1	-	no_errors	ENST00000452082	ensembl	human	known	74_37	nonsense	10.91	49	6	SNP	0.083	T
NFATC3	4775	genome.wustl.edu	37	16	68217182	68217182	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr16:68217182G>T	ENST00000346183.3	+	8	2035	c.2011G>T	c.(2011-2013)Gca>Tca	p.A671S	NFATC3_ENST00000535127.2_3'UTR|NFATC3_ENST00000575270.1_Missense_Mutation_p.A671S|NFATC3_ENST00000329524.4_Missense_Mutation_p.A671S|NFATC3_ENST00000349223.5_Missense_Mutation_p.A671S	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	671					cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		TCATAACCCAGCAGTTACAGC	0.413																																																	0													212.0	193.0	200.0					16																	68217182		2198	4300	6498	SO:0001583	missense	0			L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.2011G>T	16.37:g.68217182G>T	ENSP00000300659:p.Ala671Ser		O75211|Q14516|Q99840|Q99841|Q99842	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.A671S	ENST00000346183.3	37	c.2011	CCDS10860.1	16	.	.	.	.	.	.	.	.	.	.	G	8.177	0.793068	0.16327	.	.	ENSG00000072736	ENST00000349223;ENST00000346183;ENST00000329524;ENST00000535127	T;T;T	0.07327	3.2;3.2;3.2	5.05	1.33	0.21861	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.191497	0.53938	D	0.000042	T	0.03220	0.0094	N	0.05280	-0.08	0.31577	N	0.655625	B;B;B;B	0.10296	0.002;0.003;0.002;0.002	B;B;B;B	0.09377	0.001;0.004;0.001;0.001	T	0.23976	-1.0173	10	0.35671	T	0.21	-0.4293	3.7925	0.08726	0.5386:0.0:0.2908:0.1706	.	671;671;671;671	Q12968;Q12968-3;B5B2S0;B5B2S2	NFAC3_HUMAN;.;.;.	S	671;671;671;192	ENSP00000264008:A671S;ENSP00000300659:A671S;ENSP00000331324:A671S	ENSP00000331324:A671S	A	+	1	0	NFATC3	66774683	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.355000	0.34068	0.183000	0.20059	0.563000	0.77884	GCA	NFATC3	-	superfamily_Ig_E-set,smart_IPT	ENSG00000072736		0.413	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NFATC3	HGNC	protein_coding	OTTHUMT00000268890.2	-	0.00	58	0	G	NM_004555		68217182	+1	tier1	-	no_errors	ENST00000346183	ensembl	human	known	74_37	missense	6.85	68	5	SNP	1.000	T
NIF3L1	60491	genome.wustl.edu	37	2	201761925	201761925	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:201761925G>T	ENST00000409020.1	+	5	1147	c.853G>T	c.(853-855)Ggg>Tgg	p.G285W	NIF3L1_ENST00000409357.1_Missense_Mutation_p.G285W|NIF3L1_ENST00000359683.4_Missense_Mutation_p.G258W|NIF3L1_ENST00000409588.1_Intron|RNU6-762P_ENST00000517107.1_RNA|NIF3L1_ENST00000416651.1_Missense_Mutation_p.G285W			Q9GZT8	GTPC1_HUMAN	NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)	285					7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|metal ion binding (GO:0046872)|transcription factor binding (GO:0008134)	p.G285W(1)|p.G258W(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(2)	13						CCTTGGGGTGGGGAGAACCTT	0.403																																																	2	Substitution - Missense(2)	lung(2)											114.0	105.0	108.0					2																	201761925		1885	4118	6003	SO:0001583	missense	0			AB038949	CCDS42797.1, CCDS46485.1, CCDS46486.1	2q33	2011-11-10	2011-11-10		ENSG00000196290	ENSG00000196290			13390	protein-coding gene	gene with protein product		605778	"""NIF3 (Ngg1 interacting factor 3, S.pombe homolog)-like 1"", ""NIF3 NGG1 interacting factor 3-like 1 (S. pombe)"""	ALS2CR1		11124544, 11161814, 12522100	Standard	NM_001136039		Approved	CALS-7, MDS015	uc002uwm.2	Q9GZT8	OTTHUMG00000154588	ENST00000409020.1:c.853G>T	2.37:g.201761925G>T	ENSP00000386394:p.Gly285Trp		Q53TX4|Q6X735|Q9H2D2|Q9HC18	Missense_Mutation	SNP	pfam_Interacting_NIF3,superfamily_Interacting_NIF3,pirsf_UCP037490_NIF3_euk,tigrfam_Interacting_NIF3	p.G285W	ENST00000409020.1	37	c.853	CCDS46485.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.9|21.9	4.212773|4.212773	0.79352|0.79352	.|.	.|.	ENSG00000196290|ENSG00000196290	ENST00000416651;ENST00000409020;ENST00000359683;ENST00000409357|ENST00000436412	T;T;T;T|.	0.51817|.	0.69;0.69;0.69;0.69|.	6.01|6.01	5.12|5.12	0.69794|0.69794	.|.	0.208163|.	0.51477|.	D|.	0.000090|.	D|D	0.84156|0.84156	0.5410|0.5410	M|M	0.90425|0.90425	3.115|3.115	0.58432|0.58432	D|D	0.999997|0.999997	D|.	0.76494|.	0.999|.	D|.	0.79784|.	0.993|.	D|D	0.87563|0.87563	0.2473|0.2473	10|5	0.87932|.	D|.	0|.	-6.0384|-6.0384	17.0922|17.0922	0.86625|0.86625	0.0:0.1269:0.8731:0.0|0.0:0.1269:0.8731:0.0	.|.	285|.	Q9GZT8|.	NIF3L_HUMAN|.	W|C	285;285;258;285|43	ENSP00000400787:G285W;ENSP00000386394:G285W;ENSP00000352711:G258W;ENSP00000387315:G285W|.	ENSP00000352711:G258W|.	G|W	+|+	1|3	0|0	NIF3L1|NIF3L1	201470170|201470170	1.000000|1.000000	0.71417|0.71417	0.905000|0.905000	0.35620|0.35620	0.979000|0.979000	0.70002|0.70002	5.178000|5.178000	0.65037|0.65037	1.507000|1.507000	0.48752|0.48752	0.655000|0.655000	0.94253|0.94253	GGG|TGG	NIF3L1	-	pfam_Interacting_NIF3,superfamily_Interacting_NIF3,pirsf_UCP037490_NIF3_euk,tigrfam_Interacting_NIF3	ENSG00000196290		0.403	NIF3L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	NIF3L1	HGNC	protein_coding	OTTHUMT00000336201.1		0.00	12	0	G	NM_021824		201761925	+1			no_errors	ENST00000409020	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.998	T
NIPA2	81614	genome.wustl.edu	37	15	23006735	23006735	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:23006735G>T	ENST00000337451.3	-	8	1181	c.569C>A	c.(568-570)gCg>gAg	p.A190E	NIPA2_ENST00000398013.3_Missense_Mutation_p.A190E|NIPA2_ENST00000539711.2_Missense_Mutation_p.A171E|NIPA2_ENST00000359727.4_Missense_Mutation_p.A171E|NIPA2_ENST00000398014.2_Missense_Mutation_p.A190E	NM_030922.6	NP_112184.4	Q8N8Q9	NIPA2_HUMAN	non imprinted in Prader-Willi/Angelman syndrome 2	190						early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	magnesium ion transmembrane transporter activity (GO:0015095)	p.A171V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(4)|skin(1)	15		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;1.48e-06)|Epithelial(43;1.44e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000353)		GACTGAAAACGCGCCGATTAC	0.517																																																	1	Substitution - Missense(1)	endometrium(1)											71.0	65.0	67.0					15																	23006735		2203	4300	6503	SO:0001583	missense	0			AY732242	CCDS73693.1, CCDS73694.1	15q11.2	2008-02-05			ENSG00000140157	ENSG00000140157			17044	protein-coding gene	gene with protein product		608146				14508708	Standard	NM_001008860		Approved		uc001yuz.3	Q8N8Q9	OTTHUMG00000129101	ENST00000337451.3:c.569C>A	15.37:g.23006735G>T	ENSP00000337618:p.Ala190Glu		F8W7Y8|Q96F03|Q9BVS2	Missense_Mutation	SNP	pfam_Mg_trans_NIPA,pfam_DMT	p.A190E	ENST00000337451.3	37	c.569	CCDS10010.1	15	.	.	.	.	.	.	.	.	.	.	G	17.27	3.347098	0.61183	.	.	ENSG00000140157	ENST00000337451;ENST00000398014;ENST00000359727;ENST00000539711;ENST00000398013	D;D;D	0.91351	-2.83;-2.83;-2.83	5.54	5.54	0.83059	.	0.045801	0.85682	D	0.000000	D	0.94568	0.8250	M	0.61703	1.905	0.80722	D	1	P;D	0.65815	0.862;0.995	P;D	0.66716	0.765;0.946	D	0.94588	0.7785	10	0.87932	D	0	-6.2548	19.8379	0.96666	0.0:0.0:1.0:0.0	.	171;190	F8W7Y8;Q8N8Q9	.;NIPA2_HUMAN	E	190;190;171;190;171	ENSP00000337618:A190E;ENSP00000381096:A190E;ENSP00000352762:A171E	ENSP00000337618:A190E	A	-	2	0	NIPA2	20558176	1.000000	0.71417	0.789000	0.31954	0.005000	0.04900	9.731000	0.98807	2.765000	0.95021	0.655000	0.94253	GCG	NIPA2	-	pfam_Mg_trans_NIPA	ENSG00000140157		0.517	NIPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPA2	HGNC	protein_coding	OTTHUMT00000251137.1		0.00	32	0	G	NM_030922		23006735	-1			no_errors	ENST00000337451	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
NMS	129521	genome.wustl.edu	37	2	101093850	101093850	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:101093850G>C	ENST00000376865.1	+	5	242	c.235G>C	c.(235-237)Gag>Cag	p.E79Q		NM_001011717.1	NP_001011717.1	Q5H8A3	NMS_HUMAN	neuromedin S	79					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				breast(1)|large_intestine(4)|lung(7)|ovary(1)|stomach(1)	14						CAGAACTCAGGAGGCAACACA	0.378																																																	0													92.0	85.0	87.0					2																	101093850		2203	4300	6503	SO:0001583	missense	0			AB164464	CCDS33259.1	2q11.2	2013-02-26			ENSG00000204640	ENSG00000204640		"""Endogenous ligands"""	32203	protein-coding gene	gene with protein product	"""prepro-NMS"""					15635449	Standard	NM_001011717		Approved		uc002tan.1	Q5H8A3	OTTHUMG00000153142	ENST00000376865.1:c.235G>C	2.37:g.101093850G>C	ENSP00000366061:p.Glu79Gln			Missense_Mutation	SNP	pfam_NMU_C	p.E79Q	ENST00000376865.1	37	c.235	CCDS33259.1	2	.	.	.	.	.	.	.	.	.	.	G	12.98	2.099569	0.37048	.	.	ENSG00000204640	ENST00000376865	T	0.25414	1.8	4.88	2.64	0.31445	.	0.513245	0.18895	N	0.128196	T	0.25494	0.0620	L	0.56769	1.78	0.09310	N	0.999999	D	0.54047	0.964	P	0.45310	0.476	T	0.09422	-1.0675	10	0.38643	T	0.18	-8.8828	6.4552	0.21926	0.2741:0.0:0.7259:0.0	.	79	Q5H8A3	NMS_HUMAN	Q	79	ENSP00000366061:E79Q	ENSP00000366061:E79Q	E	+	1	0	NMS	100460282	0.990000	0.36364	0.519000	0.27824	0.946000	0.59487	1.565000	0.36386	0.515000	0.28320	0.655000	0.94253	GAG	NMS	-	NULL	ENSG00000204640		0.378	NMS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMS	HGNC	protein_coding	OTTHUMT00000329737.1	-	0.00	48	0	G	NM_001011717		101093850	+1	tier1	-	no_errors	ENST00000376865	ensembl	human	known	74_37	missense	13.11	53	8	SNP	0.454	C
NUDT6	11162	genome.wustl.edu	37	4	123838727	123838727	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:123838727G>T	ENST00000304430.5	-	2	404	c.371C>A	c.(370-372)aCg>aAg	p.T124K	NUDT6_ENST00000339154.2_5'UTR	NM_007083.4	NP_009014.2	P53370	NUDT6_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 6	124						mitochondrion (GO:0005739)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|hydrolase activity (GO:0016787)	p.T124M(1)		endometrium(2)|lung(1)|prostate(1)|skin(1)|stomach(1)	6						CAGAGTCAACGTTGATGAATC	0.498																																																	1	Substitution - Missense(1)	endometrium(1)											158.0	154.0	155.0					4																	123838727		2016	4208	6224	SO:0001583	missense	0			AF019632	CCDS3729.1, CCDS43268.1	4q26	2011-02-21			ENSG00000170917	ENSG00000170917		"""Nudix motif containing"""	8053	protein-coding gene	gene with protein product		606261				7984147, 10022609	Standard	NM_198041		Approved	gfg-1, gfg, FGF2AS, FGF-AS	uc003iew.3	P53370	OTTHUMG00000039507	ENST00000304430.5:c.371C>A	4.37:g.123838727G>T	ENSP00000306070:p.Thr124Lys		A8K756|O95097|Q9UQD9	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,prints_Nudix_hydrolase6-like	p.T124K	ENST00000304430.5	37	c.371	CCDS43268.1	4	.	.	.	.	.	.	.	.	.	.	G	15.05	2.718408	0.48622	.	.	ENSG00000170917	ENST00000304430	T	0.28895	1.59	4.63	2.73	0.32206	NUDIX hydrolase domain-like (1);	0.334564	0.31199	N	0.008071	T	0.33118	0.0852	M	0.74258	2.255	0.09310	N	0.999997	B	0.31910	0.346	B	0.31337	0.128	T	0.35051	-0.9804	10	0.66056	D	0.02	0.0219	11.189	0.48675	0.1781:0.0:0.8219:0.0	.	124	P53370	NUDT6_HUMAN	K	124	ENSP00000306070:T124K	ENSP00000306070:T124K	T	-	2	0	NUDT6	124058177	0.761000	0.28439	0.006000	0.13384	0.760000	0.43138	2.787000	0.47798	1.185000	0.42971	0.561000	0.74099	ACG	NUDT6	-	superfamily_NUDIX_hydrolase_dom-like,prints_Nudix_hydrolase6-like	ENSG00000170917		0.498	NUDT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT6	HGNC	protein_coding	OTTHUMT00000095331.3		0.00	48	0	G	NM_007083		123838727	-1			no_errors	ENST00000304430	ensembl	human	known	74_37	missense	5.26	54	3	SNP	0.002	T
OAS1	4938	genome.wustl.edu	37	12	113346558	113346558	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:113346558G>T	ENST00000202917.5	+	2	661	c.398G>T	c.(397-399)aGc>aTc	p.S133I	RP1-71H24.1_ENST00000552784.1_RNA|OAS1_ENST00000553185.1_Missense_Mutation_p.S133I|OAS1_ENST00000452357.2_Missense_Mutation_p.S133I|OAS1_ENST00000445409.2_Missense_Mutation_p.S133I|OAS1_ENST00000551241.1_Missense_Mutation_p.S133I	NM_016816.2	NP_058132.2	P00973	OAS1_HUMAN	2'-5'-oligoadenylate synthetase 1, 40/46kDa	133					cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|protein oligomerization (GO:0051259)|purine nucleotide biosynthetic process (GO:0006164)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)|skin(1)	16						CGTGCGCTCAGCTTCGTACTG	0.577																																																	0													85.0	80.0	81.0					12																	113346558		2203	4300	6503	SO:0001583	missense	0			X04371	CCDS31905.1, CCDS41838.1, CCDS44980.1	12q24.2	2014-05-21	2011-07-21				2.7.7.-		8086	protein-coding gene	gene with protein product		164350	"""2',5'-oligoadenylate synthetase 1 (40-46 kD)"""	OIAS		9344649, 9325053	Standard	XM_006719434		Approved	OIASI, IFI-4	uc001tud.3	P00973		ENST00000202917.5:c.398G>T	12.37:g.113346558G>T	ENSP00000202917:p.Ser133Ile		A8K4N8|P04820|P29080|P29081|P78485|P78486|Q16700|Q16701|Q1PG42|Q3ZM01|Q53GC5|Q53YA4|Q6A1Z3|Q6IPC6|Q6P7N9|Q96J61	Missense_Mutation	SNP	pfam_2-5-oligoAdlate_synth_1_dom2/C,pfam_Nucleotidyltransferase,pfscan_2-5-oligoadenylate_synth_N	p.S133I	ENST00000202917.5	37	c.398	CCDS41838.1	12	.	.	.	.	.	.	.	.	.	.	G	18.41	3.617907	0.66787	.	.	ENSG00000089127	ENST00000202917;ENST00000445409;ENST00000452357;ENST00000549820;ENST00000551241;ENST00000377508;ENST00000553185;ENST00000550689	T;T;T;T;T;T	0.09163	3.01;3.01;3.01;3.01;3.01;3.01	4.31	4.31	0.51392	.	0.539176	0.18034	N	0.153827	T	0.38799	0.1054	M	0.90650	3.135	0.32222	N	0.575104	D;D;D;D;D;D	0.89917	0.999;0.998;1.0;0.997;0.999;0.997	D;D;D;D;D;P	0.79108	0.974;0.936;0.992;0.927;0.967;0.894	T	0.55321	-0.8159	10	0.87932	D	0	-36.4445	12.456	0.55704	0.0:0.0:1.0:0.0	.	133;133;133;133;133;133	B4DWE7;E7EMI9;F8VXY3;P00973;P00973-3;P00973-2	.;.;.;OAS1_HUMAN;.;.	I	133;133;133;133;133;133;133;129	ENSP00000202917:S133I;ENSP00000388001:S133I;ENSP00000415721:S133I;ENSP00000448790:S133I;ENSP00000448001:S133I;ENSP00000448348:S129I	ENSP00000202917:S133I	S	+	2	0	OAS1	111830941	1.000000	0.71417	0.933000	0.37362	0.053000	0.15095	2.614000	0.46359	2.420000	0.82092	0.455000	0.32223	AGC	OAS1	-	NULL	ENSG00000089127		0.577	OAS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OAS1	HGNC	protein_coding	OTTHUMT00000405896.2	-	0.00	26	0	G			113346558	+1	tier1	-	no_errors	ENST00000445409	ensembl	human	known	74_37	missense	17.65	14	3	SNP	0.980	T
OAS3	4940	genome.wustl.edu	37	12	113385763	113385763	+	Silent	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:113385763G>A	ENST00000228928.7	+	5	1067	c.888G>A	c.(886-888)ctG>ctA	p.L296L	RP1-71H24.1_ENST00000552784.1_RNA	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	296	OAS domain 1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						CTGTGATCCTGGACCCAGCTG	0.562																																																	0													31.0	31.0	31.0					12																	113385763		2007	4191	6198	SO:0001819	synonymous_variant	0			AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.888G>A	12.37:g.113385763G>A			Q2HJ14|Q9H3P5	Silent	SNP	pfam_2-5-oligoAdlate_synth_1_dom2/C,pfam_Nucleotidyltransferase,pfscan_2-5-oligoadenylate_synth_N	p.L296	ENST00000228928.7	37	c.888	CCDS44981.1	12																																																																																			OAS3	-	pfam_2-5-oligoAdlate_synth_1_dom2/C	ENSG00000111331		0.562	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OAS3	HGNC	protein_coding	OTTHUMT00000405920.1	-	0.00	31	0	G			113385763	+1	tier1	-	no_errors	ENST00000228928	ensembl	human	known	74_37	silent	15.79	16	3	SNP	1.000	A
OPA1	4976	genome.wustl.edu	37	3	193335055	193335055	+	Silent	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:193335055G>A	ENST00000392438.3	+	4	771	c.537G>A	c.(535-537)ttG>ttA	p.L179L	OPA1_ENST00000487986.1_3'UTR|OPA1_ENST00000361510.2_Silent_p.L179L|OPA1_ENST00000361150.2_Intron|OPA1-AS1_ENST00000444085.1_RNA|OPA1_ENST00000361908.3_Silent_p.L179L|OPA1_ENST00000361828.2_Silent_p.L179L|OPA1-AS1_ENST00000433105.1_RNA|OPA1_ENST00000361715.2_Intron	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	179					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		TTAGCTTATTGAAGGACTTTT	0.338																																																	0													56.0	59.0	58.0					3																	193335055		2202	4298	6500	SO:0001819	synonymous_variant	0			AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.537G>A	3.37:g.193335055G>A			D3DNW4	Silent	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,prints_Dynamin_SF	p.L179	ENST00000392438.3	37	c.537	CCDS43186.1	3																																																																																			OPA1	-	NULL	ENSG00000198836		0.338	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OPA1	HGNC	protein_coding	OTTHUMT00000313812.2		0.00	26	0	G	NM_130837		193335055	+1			no_errors	ENST00000361510	ensembl	human	known	74_37	silent	7.50	37	3	SNP	0.993	A
OR10X1	128367	genome.wustl.edu	37	1	158549211	158549211	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:158549211A>T	ENST00000368150.1	-	1	478	c.479T>A	c.(478-480)cTt>cAt	p.L160H		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	160						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					AGAGGCCACAAGTTGTCCACA	0.453																																																	0													58.0	59.0	59.0					1																	158549211		2203	4300	6503	SO:0001583	missense	0			BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.479T>A	1.37:g.158549211A>T	ENSP00000357132:p.Leu160His		Q6IFR8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L160H	ENST00000368150.1	37	c.479	CCDS30900.1	1	.	.	.	.	.	.	.	.	.	.	A	10.29	1.310360	0.23821	.	.	ENSG00000186400	ENST00000368150	T	0.45668	0.89	5.0	2.59	0.31030	GPCR, rhodopsin-like superfamily (1);	0.207901	0.23079	N	0.052169	T	0.41627	0.1167	H	0.98111	4.15	0.09310	N	1	B	0.23650	0.089	B	0.28232	0.087	T	0.52697	-0.8541	10	0.87932	D	0	.	7.6614	0.28404	0.7164:0.145:0.0:0.1386	.	160	Q8NGY0	O10X1_HUMAN	H	160	ENSP00000357132:L160H	ENSP00000357132:L160H	L	-	2	0	OR10X1	156815835	0.002000	0.14202	0.100000	0.21137	0.695000	0.40330	1.646000	0.37249	0.333000	0.23563	0.455000	0.32223	CTT	OR10X1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000186400		0.453	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10X1	HGNC	protein_coding	OTTHUMT00000051850.2	-	0.00	37	0	A	NM_001004477		158549211	-1	tier1	-	no_errors	ENST00000368150	ensembl	human	known	74_37	missense	14.71	29	5	SNP	0.020	T
OR12D2	26529	genome.wustl.edu	37	6	29364598	29364598	+	Missense_Mutation	SNP	G	G	T	rs111677372		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:29364598G>T	ENST00000383555.2	+	1	183	c.122G>T	c.(121-123)gGa>gTa	p.G41V	OR5V1_ENST00000377154.1_Intron	NM_013936.3	NP_039224.2	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D, member 2 (gene/pseudogene)	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	31						ACTGGGAATGGAGCCGTTCTG	0.463																																																	0													132.0	143.0	139.0					6																	29364598		1510	2709	4219	SO:0001583	missense	0				CCDS4659.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000168787	ENSG00000168787		"""GPCR / Class A : Olfactory receptors"""	8178	protein-coding gene	gene with protein product			"""olfactory receptor, family 12, subfamily D, member 2"""				Standard	NM_013936		Approved	hs6M1-20	uc003nmf.4	P58182	OTTHUMG00000031049	ENST00000383555.2:c.122G>T	6.37:g.29364598G>T	ENSP00000373047:p.Gly41Val		B0S862|Q5SUN9|Q6IET9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G41V	ENST00000383555.2	37	c.122	CCDS4659.1	6	.	.	.	.	.	.	.	.	.	.	G	0.001	-2.920012	0.00055	.	.	ENSG00000168787	ENST00000383555	T	0.00433	7.43	4.07	1.11	0.20524	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000020	T	0.00073	0.0002	N	0.20304	0.555	0.18873	N	0.999987	B	0.27971	0.196	B	0.28385	0.089	T	0.07139	-1.0788	10	0.21540	T	0.41	.	8.9547	0.35809	0.0:0.1335:0.3228:0.5437	.	41	P58182	O12D2_HUMAN	V	41	ENSP00000373047:G41V	ENSP00000373047:G41V	G	+	2	0	OR12D2	29472577	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.812000	0.27211	0.007000	0.14760	-0.718000	0.03613	GGA	OR12D2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000168787		0.463	OR12D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR12D2	HGNC	protein_coding	OTTHUMT00000076054.2	-	0.00	64	0	G			29364598	+1	tier1	-	no_errors	ENST00000383555	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.001	T
OR13H1	347468	genome.wustl.edu	37	X	130678783	130678783	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chrX:130678783G>A	ENST00000338616.3	+	1	834	c.736G>A	c.(736-738)Gtg>Atg	p.V246M		NM_001004486.1	NP_001004486.1	Q8NG92	O13H1_HUMAN	olfactory receptor, family 13, subfamily H, member 1	246						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	15	Acute lymphoblastic leukemia(192;0.000636)					TCACCTGACCGTGGTGACAAT	0.478																																																	0													166.0	149.0	155.0					X																	130678783		2203	4300	6503	SO:0001583	missense	0				CCDS35396.1	Xq26.2	2012-08-23			ENSG00000171054	ENSG00000171054		"""GPCR / Class A : Olfactory receptors"""	14755	protein-coding gene	gene with protein product							Standard	NM_001004486		Approved		uc011muw.2	Q8NG92	OTTHUMG00000022411	ENST00000338616.3:c.736G>A	X.37:g.130678783G>A	ENSP00000340748:p.Val246Met		B2RNQ3|Q6IET8|Q96R12	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V246M	ENST00000338616.3	37	c.736	CCDS35396.1	X	.	.	.	.	.	.	.	.	.	.	G	9.801	1.180491	0.21787	.	.	ENSG00000171054	ENST00000338616	T	0.00277	8.34	4.87	3.11	0.35812	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35870	U	0.002926	T	0.00845	0.0028	H	0.94698	3.57	0.23956	N	0.996357	D	0.89917	1.0	D	0.91635	0.999	T	0.26395	-1.0104	10	0.72032	D	0.01	.	8.5601	0.33505	0.1926:0.0:0.8074:0.0	.	246	Q8NG92	O13H1_HUMAN	M	246	ENSP00000340748:V246M	ENSP00000340748:V246M	V	+	1	0	OR13H1	130506464	0.273000	0.24181	0.373000	0.26003	0.110000	0.19582	1.736000	0.38187	0.485000	0.27652	-0.185000	0.12909	GTG	OR13H1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000171054		0.478	OR13H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13H1	HGNC	protein_coding	OTTHUMT00000058297.1	-	0.00	27	0	G			130678783	+1	tier1	-	no_errors	ENST00000338616	ensembl	human	known	74_37	missense	34.78	15	8	SNP	0.428	A
OR14K1	343170	genome.wustl.edu	37	1	247902091	247902091	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:247902091T>A	ENST00000283225.2	+	1	175	c.175T>A	c.(175-177)Ttt>Att	p.F59I	RP11-634B7.4_ENST00000449298.1_RNA			Q8NGZ2	O14K1_HUMAN	olfactory receptor, family 14, subfamily K, member 1	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|lung(18)|ovary(1)|urinary_tract(1)	27						GGCAATGTACTTTTTCCTCCG	0.473																																																	0													155.0	151.0	152.0					1																	247902091		2154	4264	6418	SO:0001583	missense	0			BK004377		1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000153230	ENSG00000153230		"""GPCR / Class A : Olfactory receptors"""	15025	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AY, member 1"""	OR5AY1			Standard	NG_007559		Approved			Q8NGZ2	OTTHUMG00000040211	ENST00000283225.2:c.175T>A	1.37:g.247902091T>A	ENSP00000283225:p.Phe59Ile		A8MPV5|Q6IF85|Q96R53	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F59I	ENST00000283225.2	37	c.175		1	.	.	.	.	.	.	.	.	.	.	T	14.91	2.677439	0.47886	.	.	ENSG00000153230	ENST00000283225	T	0.01397	4.94	3.74	3.74	0.42951	.	0.000000	0.40728	U	0.001036	T	0.03178	0.0093	.	.	.	0.24060	N	0.996017	.	.	.	.	.	.	T	0.20840	-1.0263	7	0.72032	D	0.01	.	11.368	0.49684	0.0:0.0:0.0:1.0	.	.	.	.	I	59	ENSP00000283225:F59I	ENSP00000283225:F59I	F	+	1	0	OR14K1	245968714	0.716000	0.27956	0.996000	0.52242	0.297000	0.27493	0.515000	0.22801	1.525000	0.49052	0.496000	0.49642	TTT	OR14K1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000153230		0.473	OR14K1-001	KNOWN	basic|appris_principal	protein_coding	OR14K1	HGNC	protein_coding	OTTHUMT00000096868.1	-	0.00	78	0	T	NM_001004732		247902091	+1	tier1	-	no_errors	ENST00000283225	ensembl	human	known	74_37	missense	6.00	94	6	SNP	0.996	A
OR2J1	442185	genome.wustl.edu	37	6	29068913	29068913	+	Nonsense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:29068913C>G	ENST00000377171.3	+	1	528	c.194C>G	c.(193-195)tCa>tGa	p.S65*				Q9GZK6	OR2J1_HUMAN	olfactory receptor, family 2, subfamily J, member 1 (gene/pseudogene)	65						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|lung(6)	7						TTCTTCCTTTCAAATCTCTCA	0.458																																																	0																																										SO:0001587	stop_gained	0					6p22.2-p21.31	2012-08-09	2011-08-30	2004-05-28	ENSG00000204702	ENSG00000204702		"""GPCR / Class A : Olfactory receptors"""	8259	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily J, member 1 pseudogene"", ""olfactory receptor, family 2, subfamily J, member 1"""	OR2J1P			Standard	NG_004683		Approved	OR6-5, hs6M1-4, dJ80I19.2		Q9GZK6	OTTHUMG00000031280	ENST00000377171.3:c.194C>G	6.37:g.29068913C>G	ENSP00000366376:p.Ser65*		A2AAS1|B0V1T2|Q9GZK1	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.S65*	ENST00000377171.3	37	c.194		6	.	.	.	.	.	.	.	.	.	.	C	25.5	4.648411	0.87958	.	.	ENSG00000204702	ENST00000377171	.	.	.	2.21	1.31	0.21738	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	3.8745	0.09050	0.0:0.3599:0.3709:0.2691	.	.	.	.	X	65	.	ENSP00000366376:S65X	S	+	2	0	OR2J1	29176892	0.000000	0.05858	0.975000	0.42487	0.730000	0.41778	-1.909000	0.01586	0.245000	0.21373	0.467000	0.42956	TCA	OR2J1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000204702		0.458	OR2J1-001	KNOWN	basic|appris_principal	protein_coding	OR2J1	HGNC	protein_coding	OTTHUMT00000076612.2	-	0.00	79	0	C	NG_004683		29068913	+1	tier1	-	no_errors	ENST00000377171	ensembl	human	known	74_37	nonsense	22.22	70	20	SNP	0.294	G
OR2J1	442185	genome.wustl.edu	37	6	29069584	29069584	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:29069584C>G	ENST00000377171.3	+	1	1199	c.865C>G	c.(865-867)Cta>Gta	p.L289V				Q9GZK6	OR2J1_HUMAN	olfactory receptor, family 2, subfamily J, member 1 (gene/pseudogene)	289						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|lung(6)	7						TCTTAACCCTCTAATCTACAC	0.443																																																	0																																										SO:0001583	missense	0					6p22.2-p21.31	2012-08-09	2011-08-30	2004-05-28	ENSG00000204702	ENSG00000204702		"""GPCR / Class A : Olfactory receptors"""	8259	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily J, member 1 pseudogene"", ""olfactory receptor, family 2, subfamily J, member 1"""	OR2J1P			Standard	NG_004683		Approved	OR6-5, hs6M1-4, dJ80I19.2		Q9GZK6	OTTHUMG00000031280	ENST00000377171.3:c.865C>G	6.37:g.29069584C>G	ENSP00000366376:p.Leu289Val		A2AAS1|B0V1T2|Q9GZK1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.L289V	ENST00000377171.3	37	c.865		6	.	.	.	.	.	.	.	.	.	.	C	13.54	2.268439	0.40095	.	.	ENSG00000204702	ENST00000377171	T	0.39592	1.07	2.78	1.89	0.25635	.	.	.	.	.	T	0.29945	0.0749	.	.	.	0.31945	N	0.610465	.	.	.	.	.	.	T	0.11842	-1.0571	6	0.59425	D	0.04	.	9.2038	0.37275	0.0:0.885:0.0:0.115	.	.	.	.	V	289	ENSP00000366376:L289V	ENSP00000366376:L289V	L	+	1	2	OR2J1	29177563	0.000000	0.05858	0.996000	0.52242	0.869000	0.49853	-2.243000	0.01194	0.474000	0.27392	0.591000	0.81541	CTA	OR2J1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000204702		0.443	OR2J1-001	KNOWN	basic|appris_principal	protein_coding	OR2J1	HGNC	protein_coding	OTTHUMT00000076612.2	-	0.00	54	0	C	NG_004683		29069584	+1	tier1	-	no_errors	ENST00000377171	ensembl	human	known	74_37	missense	20.41	39	10	SNP	0.991	G
OR51A7	119687	genome.wustl.edu	37	11	4929161	4929161	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:4929161G>T	ENST00000359350.4	+	1	562	c.562G>T	c.(562-564)Gcc>Tcc	p.A188S	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	188						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		CATGAAGCTGGCCTGCTCTGA	0.398																																																	0													203.0	166.0	178.0					11																	4929161		2201	4298	6499	SO:0001583	missense	0			AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.562G>T	11.37:g.4929161G>T	ENSP00000352305:p.Ala188Ser		Q6IFH8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.A188S	ENST00000359350.4	37	c.562	CCDS31364.1	11	.	.	.	.	.	.	.	.	.	.	G	16.70	3.196320	0.58126	.	.	ENSG00000176895	ENST00000359350;ENST00000545959;ENST00000544684	T	0.36699	1.24	5.02	5.02	0.67125	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000244	T	0.38878	0.1057	L	0.35723	1.085	0.36365	D	0.860935	P	0.39551	0.678	P	0.47075	0.536	T	0.29305	-1.0016	10	0.21014	T	0.42	.	17.069	0.86568	0.0:0.0:1.0:0.0	.	188	Q8NH64	O51A7_HUMAN	S	188;188;177	ENSP00000352305:A188S	ENSP00000352305:A188S	A	+	1	0	OR51A7	4885737	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.792000	0.38754	2.596000	0.87737	0.655000	0.94253	GCC	OR51A7	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176895		0.398	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51A7	HGNC	protein_coding	OTTHUMT00000142175.1	-	0.00	72	0	G	NM_001004749		4929161	+1	tier1	-	no_errors	ENST00000359350	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
OR51I2	390064	genome.wustl.edu	37	11	5475435	5475435	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:5475435C>A	ENST00000341449.2	+	1	798	c.717C>A	c.(715-717)aaC>aaA	p.N239K	AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron	NM_001004754.2	NP_001004754.1	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I, member 2	239					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAGCTCTCAACACATGTGTGT	0.493																																																	0													280.0	235.0	250.0					11																	5475435		2201	4297	6498	SO:0001583	missense	0			BK004381	CCDS31383.1	11p15.4	2012-08-09			ENSG00000187918	ENSG00000187918		"""GPCR / Class A : Olfactory receptors"""	15201	protein-coding gene	gene with protein product							Standard	NM_001004754		Approved		uc010qzf.2	Q9H344	OTTHUMG00000066902	ENST00000341449.2:c.717C>A	11.37:g.5475435C>A	ENSP00000341987:p.Asn239Lys		Q6IF81	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N239K	ENST00000341449.2	37	c.717	CCDS31383.1	11	.	.	.	.	.	.	.	.	.	.	C	12.20	1.867626	0.32977	.	.	ENSG00000187918	ENST00000341449	T	0.00069	8.77	5.58	1.65	0.23941	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	T	0.00271	0.0008	M	0.90082	3.085	0.34427	D	0.698147	P	0.40000	0.698	B	0.41946	0.371	T	0.56366	-0.7991	10	0.72032	D	0.01	.	9.7293	0.40350	0.0:0.7127:0.0:0.2873	.	239	Q9H344	O51I2_HUMAN	K	239	ENSP00000341987:N239K	ENSP00000341987:N239K	N	+	3	2	OR51I2	5432011	0.000000	0.05858	0.998000	0.56505	0.434000	0.31775	-0.264000	0.08658	0.482000	0.27582	0.655000	0.94253	AAC	OR51I2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000187918		0.493	OR51I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51I2	HGNC	protein_coding	OTTHUMT00000143385.1		0.00	65	0	C	NM_001004754		5475435	+1			no_errors	ENST00000341449	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.998	A
OR4C12	283093	genome.wustl.edu	37	11	50003299	50003299	+	Missense_Mutation	SNP	A	A	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:50003299A>C	ENST00000335238.4	-	1	772	c.739T>G	c.(739-741)Tta>Gta	p.L247V		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	247						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						ACAAAGAATAAGACAACTACT	0.413																																																	0													78.0	71.0	73.0					11																	50003299		2201	4296	6497	SO:0001583	missense	0			BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.739T>G	11.37:g.50003299A>C	ENSP00000334418:p.Leu247Val		B2RNF0|Q6IF49	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.L247V	ENST00000335238.4	37	c.739	CCDS31496.1	11	.	.	.	.	.	.	.	.	.	.	.	11.87	1.767248	0.31320	.	.	ENSG00000221954	ENST00000335238	T	0.00265	8.39	2.98	2.98	0.34508	GPCR, rhodopsin-like superfamily (1);	0.239135	0.21324	U	0.076410	T	0.00412	0.0013	M	0.74467	2.265	0.09310	N	1	P	0.47302	0.893	P	0.61940	0.896	T	0.36648	-0.9739	10	0.87932	D	0	.	5.5805	0.17247	0.7549:0.0:0.0:0.2451	.	247	Q96R67	OR4CC_HUMAN	V	247	ENSP00000334418:L247V	ENSP00000334418:L247V	L	-	1	2	OR4C12	49959875	0.000000	0.05858	0.235000	0.24058	0.631000	0.37964	-0.566000	0.05922	1.387000	0.46486	0.325000	0.21440	TTA	OR4C12	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000221954		0.413	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C12	HGNC	protein_coding	OTTHUMT00000391104.1	-	0.00	41	0	A	NM_001005270		50003299	-1	tier1	-	no_errors	ENST00000335238	ensembl	human	known	74_37	missense	13.33	39	6	SNP	0.007	C
OR5D14	219436	genome.wustl.edu	37	11	55563633	55563633	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:55563633T>G	ENST00000335605.1	+	1	602	c.602T>G	c.(601-603)cTt>cGt	p.L201R		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	201						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				CACCTGCTGCTTTTCAGCTTC	0.408																																																	0													206.0	197.0	200.0					11																	55563633		2200	4296	6496	SO:0001583	missense	0			AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.602T>G	11.37:g.55563633T>G	ENSP00000334456:p.Leu201Arg		Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L201R	ENST00000335605.1	37	c.602	CCDS31508.1	11	.	.	.	.	.	.	.	.	.	.	t	9.117	1.007941	0.19199	.	.	ENSG00000186113	ENST00000335605	T	0.00237	8.47	5.08	2.76	0.32466	GPCR, rhodopsin-like superfamily (1);	0.178467	0.27181	N	0.020560	T	0.00412	0.0013	M	0.87097	2.86	0.09310	N	1	P	0.42078	0.77	P	0.54590	0.756	T	0.35001	-0.9806	10	0.87932	D	0	-14.1801	3.5992	0.08018	0.1563:0.2574:0.0:0.5863	.	201	Q8NGL3	OR5DE_HUMAN	R	201	ENSP00000334456:L201R	ENSP00000334456:L201R	L	+	2	0	OR5D14	55320209	0.004000	0.15560	0.003000	0.11579	0.004000	0.04260	1.314000	0.33597	0.292000	0.22492	-0.269000	0.10298	CTT	OR5D14	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000186113		0.408	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D14	HGNC	protein_coding	OTTHUMT00000391513.1	-	0.00	117	0	T	NM_001004735		55563633	+1	tier1	-	no_errors	ENST00000335605	ensembl	human	known	74_37	missense	27.43	82	31	SNP	0.000	G
OR5W2	390148	genome.wustl.edu	37	11	55681210	55681210	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:55681210G>T	ENST00000344514.1	-	1	848	c.849C>A	c.(847-849)ccC>ccA	p.P283P		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	283						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						GGTTCAACATGGGAACCACAA	0.358																																					Melanoma(48;171 1190 15239 43886 49348)												0													47.0	53.0	51.0					11																	55681210		2201	4296	6497	SO:0001819	synonymous_variant	0			BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.849C>A	11.37:g.55681210G>T				Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P283	ENST00000344514.1	37	c.849	CCDS31513.1	11																																																																																			OR5W2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	ENSG00000187612		0.358	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5W2	HGNC	protein_coding	OTTHUMT00000391523.1		0.00	33	0	G	NM_001001960		55681210	-1			no_errors	ENST00000344514	ensembl	human	known	74_37	silent	10.71	25	3	SNP	0.981	T
OR8H3	390152	genome.wustl.edu	37	11	55890770	55890770	+	Silent	SNP	A	A	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:55890770A>C	ENST00000313472.3	+	1	922	c.922A>C	c.(922-924)Aga>Cga	p.R308R		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					CATGCAGAGAAGACAGGACTC	0.338																																																	0													80.0	85.0	84.0					11																	55890770		2201	4294	6495	SO:0001819	synonymous_variant	0			AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.922A>C	11.37:g.55890770A>C			Q6IFB7	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R308	ENST00000313472.3	37	c.922	CCDS31519.1	11																																																																																			OR8H3	-	NULL	ENSG00000181761		0.338	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H3	HGNC	protein_coding	OTTHUMT00000391541.1	-	0.00	26	0	A	NM_001005201		55890770	+1	tier1	-	no_errors	ENST00000313472	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.000	C
OSBPL1A	114876	genome.wustl.edu	37	18	21894264	21894264	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr18:21894264G>T	ENST00000319481.3	-	12	1124	c.918C>A	c.(916-918)gaC>gaA	p.D306E	OSBPL1A_ENST00000357041.4_5'Flank	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	306	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					CATGAATGGTGTCATCAAAGC	0.368																																																	0													106.0	105.0	105.0					18																	21894264		2203	4300	6503	SO:0001583	missense	0			AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.918C>A	18.37:g.21894264G>T	ENSP00000320291:p.Asp306Glu		B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pleckstrin_homology,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,prints_Ankyrin_rpt	p.D306E	ENST00000319481.3	37	c.918	CCDS11884.1	18	.	.	.	.	.	.	.	.	.	.	G	14.77	2.635243	0.47049	.	.	ENSG00000141447	ENST00000319481	T	0.43294	0.95	5.7	3.59	0.41128	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.048867	0.85682	D	0.000000	T	0.40015	0.1100	M	0.75447	2.3	0.80722	D	1	P;P	0.46395	0.877;0.608	B;B	0.40741	0.339;0.097	T	0.37056	-0.9722	10	0.12766	T	0.61	-28.3725	11.8317	0.52299	0.2125:0.0:0.7875:0.0	.	306;306	B0YJ56;Q9BXW6	.;OSBL1_HUMAN	E	306	ENSP00000320291:D306E	ENSP00000320291:D306E	D	-	3	2	OSBPL1A	20148262	1.000000	0.71417	0.998000	0.56505	0.915000	0.54546	4.550000	0.60733	1.407000	0.46875	0.585000	0.79938	GAC	OSBPL1A	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000141447		0.368	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL1A	HGNC	protein_coding	OTTHUMT00000254902.1	-	0.00	31	0	G	NM_080597		21894264	-1	tier1	-	no_errors	ENST00000319481	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
OTOF	9381	genome.wustl.edu	37	2	26703078	26703078	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:26703078G>T	ENST00000272371.2	-	16	2031	c.1905C>A	c.(1903-1905)gtC>gtA	p.V635V	OTOF_ENST00000403946.3_Silent_p.V635V|OTOF_ENST00000402415.3_5'Flank|OTOF_ENST00000338581.6_5'Flank|OTOF_ENST00000339598.3_5'Flank	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	635					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACCTATGGTGACCTCAAAGG	0.587																																					GBM(102;732 1451 20652 24062 31372)												0													87.0	84.0	85.0					2																	26703078		2203	4300	6503	SO:0001819	synonymous_variant	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.1905C>A	2.37:g.26703078G>T			B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Silent	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.V635	ENST00000272371.2	37	c.1905	CCDS1725.1	2																																																																																			OTOF	-	NULL	ENSG00000115155		0.587	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3	-	0.00	47	0	G			26703078	-1	tier1	-	no_errors	ENST00000272371	ensembl	human	known	74_37	silent	10.00	35	4	SNP	1.000	T
OVOL1	5017	genome.wustl.edu	37	11	65554863	65554863	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:65554863G>T	ENST00000335987.3	+	1	371	c.19G>T	c.(19-21)Gtg>Ttg	p.V7L	RP11-770G2.4_ENST00000527453.1_RNA|RP11-770G2.4_ENST00000532454.1_RNA|RP11-770G2.4_ENST00000534178.1_RNA	NM_004561.3	NP_004552.2	O14753	OVOL1_HUMAN	ovo-like zinc finger 1	7					cytoskeleton organization (GO:0007010)|epidermal cell differentiation (GO:0009913)|germline cell cycle switching, mitotic to meiotic cell cycle (GO:0051729)|kidney development (GO:0001822)|mesoderm development (GO:0007498)|negative regulation of meiotic cell cycle phase transition (GO:1901994)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	6				READ - Rectum adenocarcinoma(159;0.17)		CGCGTTCCTGGTGAAGAAGCC	0.667																																																	0													33.0	32.0	32.0					11																	65554863		2187	4287	6474	SO:0001583	missense	0			BC059408	CCDS8112.1	11q13	2013-10-17	2013-10-17		ENSG00000172818	ENSG00000172818		"""Zinc fingers, C2H2-type"""	8525	protein-coding gene	gene with protein product		602313	"""ovo (Drosophila) homolog-like 1"", ""ovo-like 1(Drosophila)"""			9383297	Standard	NM_004561		Approved	HOVO1	uc001ofp.3	O14753	OTTHUMG00000166600	ENST00000335987.3:c.19G>T	11.37:g.65554863G>T	ENSP00000337862:p.Val7Leu		Q6PCB1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V7L	ENST00000335987.3	37	c.19	CCDS8112.1	11	.	.	.	.	.	.	.	.	.	.	G	29.8	5.040452	0.93630	.	.	ENSG00000172818	ENST00000335987	T	0.15718	2.4	3.31	3.31	0.37934	.	0.000000	0.44285	U	0.000468	T	0.39172	0.1068	M	0.74647	2.275	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	T	0.33879	-0.9851	10	0.66056	D	0.02	-15.9848	12.104	0.53801	0.0:0.0:1.0:0.0	.	7	O14753	OVOL1_HUMAN	L	7	ENSP00000337862:V7L	ENSP00000337862:V7L	V	+	1	0	OVOL1	65311439	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	6.239000	0.72356	1.393000	0.46605	0.442000	0.29010	GTG	OVOL1	-	NULL	ENSG00000172818		0.667	OVOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OVOL1	HGNC	protein_coding	OTTHUMT00000390690.1		0.00	37	0	G	NM_004561		65554863	+1			no_errors	ENST00000335987	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	T
PABPC1	26986	genome.wustl.edu	37	8	101719226	101719226	+	Splice_Site	SNP	C	C	G	rs112580522		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:101719226C>G	ENST00000318607.5	-	10	2465		c.e10-1		PABPC1_ENST00000519004.1_Splice_Site|PABPC1_ENST00000522387.1_Splice_Site|PABPC1_ENST00000519596.1_Intron|AP001205.1_ENST00000579868.1_RNA	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)	p.?(1)		breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			TTTTGGAATGCTGCATTTTAA	0.413																																																	1	Unknown(1)	lung(1)											39.0	41.0	40.0					8																	101719226		2203	4300	6503	SO:0001630	splice_region_variant	0			Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.1337-1G>C	8.37:g.101719226C>G			Q15097|Q93004	Splice_Site	SNP	-	e10-1	ENST00000318607.5	37	c.1337-1	CCDS6289.1	8	.	.	.	.	.	.	.	.	.	.	C	21.1	4.096182	0.76870	.	.	ENSG00000070756	ENST00000318607;ENST00000519004;ENST00000522387;ENST00000517403	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5891	0.99427	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PABPC1	101788402	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	5.388000	0.66249	2.876000	0.98609	0.650000	0.86243	.	PABPC1	-	-	ENSG00000070756		0.413	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC1	HGNC	protein_coding	OTTHUMT00000380217.1		0.00	10	0	C	NM_002568	Intron	101719226	-1			no_errors	ENST00000318607	ensembl	human	known	74_37	splice_site	11.54	22	3	SNP	1.000	G
PALLD	23022	genome.wustl.edu	37	4	169819706	169819706	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:169819706G>T	ENST00000505667.1	+	14	2486	c.2313G>T	c.(2311-2313)agG>agT	p.R771S	PALLD_ENST00000261509.6_Missense_Mutation_p.R754S|PALLD_ENST00000507735.1_Missense_Mutation_p.R267S|CBR4_ENST00000509108.1_Intron|PALLD_ENST00000512127.1_Missense_Mutation_p.R372S|PALLD_ENST00000335742.7_Missense_Mutation_p.R596S			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	978	Interaction with EPS8. {ECO:0000250}.|Pro-rich.				cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		GGCTAGAAAGGTCTCCTGTGG	0.418									Pancreatic Cancer, Familial Clustering of																												Esophageal Squamous(109;1482 1532 18347 40239 51172)												0													109.0	102.0	104.0					4																	169819706		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.2313G>T	4.37:g.169819706G>T	ENSP00000425556:p.Arg771Ser		B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R754S	ENST00000505667.1	37	c.2262	CCDS54818.1	4	.	.	.	.	.	.	.	.	.	.	G	11.47	1.649230	0.29336	.	.	ENSG00000129116	ENST00000261509;ENST00000335742;ENST00000505667;ENST00000512127;ENST00000510998;ENST00000393726;ENST00000507735	T;T;T;T;T;T;T	0.64260	-0.06;-0.09;0.25;0.0;0.09;0.24;0.29	5.55	4.69	0.59074	.	0.000000	0.29034	U	0.013348	T	0.69079	0.3071	M	0.66297	2.02	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.991;0.991;0.994	T	0.69595	-0.5103	10	0.08837	T	0.75	.	4.8796	0.13672	0.1886:0.203:0.6083:0.0	.	771;978;372;754	B7ZMM5;Q8WX93;B3KTG2;B2RTX2	.;PALLD_HUMAN;.;.	S	754;596;771;372;47;47;267	ENSP00000261509:R754S;ENSP00000336735:R596S;ENSP00000425556:R771S;ENSP00000426947:R372S;ENSP00000422135:R47S;ENSP00000377327:R47S;ENSP00000424016:R267S	ENSP00000261509:R754S	R	+	3	2	PALLD	170056281	0.999000	0.42202	1.000000	0.80357	0.235000	0.25334	0.603000	0.24149	1.301000	0.44836	0.585000	0.79938	AGG	PALLD	-	NULL	ENSG00000129116		0.418	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PALLD	HGNC	protein_coding	OTTHUMT00000363762.1	-	0.00	45	0	G	NM_016081		169819706	+1	tier1	-	no_errors	ENST00000261509	ensembl	human	known	74_37	missense	9.09	50	5	SNP	1.000	T
PCDH15	65217	genome.wustl.edu	37	10	55568657	55568657	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:55568657G>T	ENST00000395445.1	-	36	5547	c.5153C>A	c.(5152-5154)cCt>cAt	p.P1718H	PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395446.1_Missense_Mutation_p.P914H|PCDH15_ENST00000409834.1_3'UTR|PCDH15_ENST00000395438.1_3'UTR|PCDH15_ENST00000395440.1_Missense_Mutation_p.P652H|PCDH15_ENST00000395442.1_Missense_Mutation_p.P583H|PCDH15_ENST00000414778.1_Intron	NM_001142769.1	NP_001136241.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	0					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GCCCTCTTCAGGGATATCTTG	0.468										HNSCC(58;0.16)																																							0													112.0	89.0	96.0					10																	55568657		1568	3579	5147	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000395445.1:c.5153C>A	10.37:g.55568657G>T	ENSP00000378832:p.Pro1718His		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P1718H	ENST00000395445.1	37	c.5153		10	.	.	.	.	.	.	.	.	.	.	G	11.94	1.789300	0.31685	.	.	ENSG00000150275	ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	5.46	2.24	0.28232	.	.	.	.	.	T	0.44540	0.1298	N	0.14661	0.345	0.09310	N	1	B;B	0.24368	0.102;0.102	B;B	0.25140	0.058;0.058	T	0.38672	-0.9650	9	0.87932	D	0	.	2.0562	0.03582	0.1745:0.1556:0.5094:0.1605	.	1716;1718	C6ZEF5;A2A3E2	.;.	H	1718;914;583;652	ENSP00000378832:P1718H;ENSP00000378833:P914H;ENSP00000378829:P583H;ENSP00000378827:P652H	ENSP00000378827:P652H	P	-	2	0	PCDH15	55238663	0.004000	0.15560	0.026000	0.17262	0.039000	0.13416	1.251000	0.32862	1.309000	0.44985	0.655000	0.94253	CCT	PCDH15	-	NULL	ENSG00000150275		0.468	PCDH15-007	NOVEL	not_organism_supported|basic	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000291335.1	-	0.00	93	0	G	NM_033056		55568657	-1	tier1	-	no_errors	ENST00000395445	ensembl	human	novel	74_37	missense	6.93	94	7	SNP	0.000	T
PCDH15	65217	genome.wustl.edu	37	10	55755437	55755437	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:55755437G>T	ENST00000320301.6	-	21	3234	c.2840C>A	c.(2839-2841)aCa>aAa	p.T947K	PCDH15_ENST00000373955.1_Missense_Mutation_p.T947K|PCDH15_ENST00000373965.2_Missense_Mutation_p.T954K|PCDH15_ENST00000395445.1_Missense_Mutation_p.T954K|PCDH15_ENST00000395430.1_Missense_Mutation_p.T947K|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000409834.1_Missense_Mutation_p.T558K|PCDH15_ENST00000437009.1_Missense_Mutation_p.T876K|PCDH15_ENST00000395438.1_Missense_Mutation_p.T947K|PCDH15_ENST00000395432.2_Missense_Mutation_p.T910K|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395433.1_Missense_Mutation_p.T925K|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000361849.3_Missense_Mutation_p.T947K|PCDH15_ENST00000414778.1_Missense_Mutation_p.T952K	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	947	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				AGCATAAACTGTTGTGATAGG	0.388										HNSCC(58;0.16)																																							0													163.0	149.0	153.0					10																	55755437		2203	4300	6503	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.2840C>A	10.37:g.55755437G>T	ENSP00000322604:p.Thr947Lys		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T947K	ENST00000320301.6	37	c.2840	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	G	14.82	2.650082	0.47362	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T	0.60548	0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.18	5.93	4.06	0.47325	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.68109	0.2965	L	0.58354	1.805	0.58432	D	0.999999	P;P;P;P;D;B;P;P;D;D;P;P;P;D	0.63880	0.776;0.776;0.776;0.776;0.993;0.384;0.776;0.494;0.988;0.98;0.776;0.776;0.803;0.979	P;P;P;B;D;B;P;B;P;P;P;P;P;P	0.64410	0.515;0.672;0.493;0.41;0.925;0.299;0.515;0.392;0.904;0.833;0.515;0.515;0.571;0.864	T	0.70612	-0.4824	9	0.72032	D	0.01	.	10.4431	0.44477	0.0695:0.0:0.7948:0.1357	.	925;947;947;952;876;910;947;947;954;954;947;952;947;947	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	K	954;952;947;947;558;954;910;947;925;947;947;952;876;947	ENSP00000363076:T954K;ENSP00000410304:T952K;ENSP00000378826:T947K;ENSP00000386693:T558K;ENSP00000378832:T954K;ENSP00000378820:T910K;ENSP00000354950:T947K;ENSP00000378821:T925K;ENSP00000322604:T947K;ENSP00000378818:T947K;ENSP00000412628:T876K;ENSP00000363066:T947K	ENSP00000322604:T947K	T	-	2	0	PCDH15	55425443	1.000000	0.71417	0.544000	0.28141	0.140000	0.21249	5.007000	0.63984	1.483000	0.48342	-0.181000	0.13052	ACA	PCDH15	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000150275		0.388	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2		0.00	46	0	G	NM_033056		55755437	-1			no_errors	ENST00000320301	ensembl	human	known	74_37	missense	5.26	54	3	SNP	0.980	T
PCDHB3	56132	genome.wustl.edu	37	5	140481417	140481417	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:140481417C>A	ENST00000231130.2	+	1	1184	c.1184C>A	c.(1183-1185)cCa>cAa	p.P395Q	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	395	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCCTGAAACCATCTGTAGAG	0.468																																																	0													91.0	89.0	89.0					5																	140481417		2203	4300	6503	SO:0001583	missense	0			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1184C>A	5.37:g.140481417C>A	ENSP00000231130:p.Pro395Gln		B2R8P2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P395Q	ENST00000231130.2	37	c.1184	CCDS4245.1	5	.	.	.	.	.	.	.	.	.	.	C	12.57	1.977730	0.34848	.	.	ENSG00000113205	ENST00000231130	T	0.53640	0.61	4.73	2.87	0.33458	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.62356	0.2421	M	0.73753	2.245	0.09310	N	1	D	0.71674	0.998	D	0.72625	0.978	T	0.49153	-0.8969	9	0.56958	D	0.05	.	4.9531	0.14025	0.1536:0.6179:0.1485:0.0799	.	395	Q9Y5E6	PCDB3_HUMAN	Q	395	ENSP00000231130:P395Q	ENSP00000231130:P395Q	P	+	2	0	PCDHB3	140461601	0.000000	0.05858	0.334000	0.25495	0.640000	0.38277	1.128000	0.31369	1.069000	0.40788	0.655000	0.94253	CCA	PCDHB3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113205		0.468	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB3	HGNC	protein_coding	OTTHUMT00000251817.2		0.00	35	0	C	NM_018937		140481417	+1			no_errors	ENST00000231130	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.025	A
PCDHB14	56122	genome.wustl.edu	37	5	140604233	140604233	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:140604233C>G	ENST00000239449.4	+	1	1156	c.1156C>G	c.(1156-1158)Caa>Gaa	p.Q386E	PCDHB14_ENST00000515856.2_Missense_Mutation_p.Q233E	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	386	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTGCTCTATTCAAGATAACCT	0.423																																					Ovarian(141;50 1831 27899 33809 37648)												0													110.0	115.0	113.0					5																	140604233		2203	4300	6503	SO:0001583	missense	0			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.1156C>G	5.37:g.140604233C>G	ENSP00000239449:p.Gln386Glu		B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q386E	ENST00000239449.4	37	c.1156	CCDS4256.1	5	.	.	.	.	.	.	.	.	.	.	-	2.296	-0.361210	0.05103	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.51817	0.69;0.69	4.54	3.66	0.41972	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.37433	0.1003	L	0.35487	1.065	0.09310	N	1	B	0.21147	0.052	B	0.20384	0.029	T	0.18085	-1.0348	9	0.22109	T	0.4	.	13.6752	0.62449	0.0:0.5208:0.4792:0.0	.	386	Q9Y5E9	PCDBE_HUMAN	E	233;386	ENSP00000444518:Q233E;ENSP00000239449:Q386E	ENSP00000239449:Q386E	Q	+	1	0	PCDHB14	140584417	0.000000	0.05858	0.085000	0.20634	0.667000	0.39255	-0.242000	0.08928	1.021000	0.39600	0.586000	0.80456	CAA	PCDHB14	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000120327		0.423	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB14	HGNC	protein_coding	OTTHUMT00000251814.2	-	0.00	45	0	C	NM_018934		140604233	+1	tier1	-	no_errors	ENST00000239449	ensembl	human	known	74_37	missense	12.50	42	6	SNP	0.041	G
PCDHGB7	56099	genome.wustl.edu	37	5	140799311	140799311	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:140799311G>C	ENST00000398594.2	+	1	1885	c.1885G>C	c.(1885-1887)Gtg>Ctg	p.V629L	PCDHGA7_ENST00000518325.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA4_ENST00000571252.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	629	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGCGCATGGTGCGTGCTTT	0.657																																																	0													57.0	63.0	61.0					5																	140799311		2181	4288	6469	SO:0001583	missense	0			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1885G>C	5.37:g.140799311G>C	ENSP00000381594:p.Val629Leu		Q9UN63	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V629L	ENST00000398594.2	37	c.1885	CCDS47293.1	5	.	.	.	.	.	.	.	.	.	.	g	5.747	0.322288	0.10900	.	.	ENSG00000254122	ENST00000398594	T	0.53206	0.63	5.57	5.57	0.84162	Cadherin (4);Cadherin-like (1);	0.268660	0.18828	U	0.130071	T	0.35393	0.0930	N	0.22421	0.69	0.09310	N	1	B;B	0.22800	0.075;0.035	B;B	0.29524	0.103;0.062	T	0.24977	-1.0145	10	0.59425	D	0.04	.	8.805	0.34932	0.0769:0.0:0.7719:0.1511	.	629;629	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	L	629	ENSP00000381594:V629L	ENSP00000381594:V629L	V	+	1	0	PCDHGB7	140779495	0.000000	0.05858	0.006000	0.13384	0.143000	0.21401	0.042000	0.13949	2.619000	0.88677	0.491000	0.48974	GTG	PCDHGB7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000254122		0.657	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB7	HGNC	protein_coding	OTTHUMT00000376973.1	-	0.00	41	0	G	NM_018927		140799311	+1	tier1	-	no_errors	ENST00000398594	ensembl	human	known	74_37	missense	20.59	27	7	SNP	0.003	C
PDCD6IP	10015	genome.wustl.edu	37	3	33870405	33870405	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:33870405C>T	ENST00000307296.3	+	7	1155	c.778C>T	c.(778-780)Cag>Tag	p.Q260*	PDCD6IP_ENST00000457054.2_Nonsense_Mutation_p.Q265*			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	260	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.|Interaction with CHMP4A, CHMP4B and CHMP4C.|Interaction with EIAV p9.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						TGAGTACCATCAGTCTATCCT	0.423																																																	0													115.0	112.0	113.0					3																	33870405		2203	4300	6503	SO:0001587	stop_gained	0			BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.778C>T	3.37:g.33870405C>T	ENSP00000307387:p.Gln260*		C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Nonsense_Mutation	SNP	pfam_BRO1_dom,pfscan_BRO1_dom	p.Q265*	ENST00000307296.3	37	c.793	CCDS2660.1	3	.	.	.	.	.	.	.	.	.	.	C	33	5.268024	0.95429	.	.	ENSG00000170248	ENST00000307296;ENST00000457054	.	.	.	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-9.4248	19.0901	0.93224	0.0:1.0:0.0:0.0	.	.	.	.	X	260;265	.	ENSP00000307387:Q260X	Q	+	1	0	PDCD6IP	33845409	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.772000	0.85439	2.586000	0.87340	0.655000	0.94253	CAG	PDCD6IP	-	pfam_BRO1_dom,pfscan_BRO1_dom	ENSG00000170248		0.423	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PDCD6IP	HGNC	protein_coding	OTTHUMT00000253251.2	-	0.00	46	0	C			33870405	+1	tier1	-	no_errors	ENST00000457054	ensembl	human	known	74_37	nonsense	24.19	47	15	SNP	1.000	T
PCOLCE2	26577	genome.wustl.edu	37	3	142557648	142557648	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:142557648C>T	ENST00000295992.3	-	5	980	c.674G>A	c.(673-675)aGa>aAa	p.R225K	PCOLCE2_ENST00000485766.1_Missense_Mutation_p.R225K	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	225	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)			NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						TCCAATTCTTCTAGCATCGTT	0.373																																																	0													131.0	117.0	121.0					3																	142557648		2203	4300	6503	SO:0001583	missense	0			AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.674G>A	3.37:g.142557648C>T	ENSP00000295992:p.Arg225Lys		B2RCH9|D3DNG4|Q9BRH3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Netrin_module_non-TIMP,superfamily_CUB_dom,superfamily_TIMP-like_OB-fold,smart_CUB_dom,smart_Netrin_module_non-TIMP,pfscan_CUB_dom,pfscan_Netrin_domain	p.R225K	ENST00000295992.3	37	c.674	CCDS3127.1	3	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.540127	0.00934	.	.	ENSG00000163710	ENST00000295992;ENST00000485766	T;T	0.27557	1.66;1.66	5.77	2.12	0.27331	CUB (5);	0.527516	0.22801	N	0.055468	T	0.15349	0.0370	N	0.21545	0.675	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.35226	-0.9797	10	0.02654	T	1	-0.0602	9.0077	0.36122	0.0:0.2794:0.0:0.7206	.	225	Q9UKZ9	PCOC2_HUMAN	K	225	ENSP00000295992:R225K;ENSP00000419842:R225K	ENSP00000295992:R225K	R	-	2	0	PCOLCE2	144040338	0.016000	0.18221	0.000000	0.03702	0.167000	0.22549	1.616000	0.36933	0.138000	0.18790	-0.312000	0.09012	AGA	PCOLCE2	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000163710		0.373	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCOLCE2	HGNC	protein_coding	OTTHUMT00000354509.1	-	0.00	37	0	C	NM_013363		142557648	-1	tier1	-	no_errors	ENST00000295992	ensembl	human	known	74_37	missense	9.64	75	8	SNP	0.001	T
PDE3B	5140	genome.wustl.edu	37	11	14865564	14865564	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:14865564G>T	ENST00000282096.4	+	12	2865	c.2512G>T	c.(2512-2514)Gcc>Tcc	p.A838S	PDE3B_ENST00000455098.2_Missense_Mutation_p.A787S	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	838	Catalytic. {ECO:0000250}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	GGCTACAAATGCCCCTCAGGT	0.373																																																	0													90.0	88.0	88.0					11																	14865564		2200	4294	6494	SO:0001583	missense	0			U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.2512G>T	11.37:g.14865564G>T	ENSP00000282096:p.Ala838Ser		B7ZM37|O00639|Q14408|Q6SEI4	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	p.A838S	ENST00000282096.4	37	c.2512	CCDS7817.1	11	.	.	.	.	.	.	.	.	.	.	G	21.6	4.166179	0.78339	.	.	ENSG00000152270	ENST00000282096;ENST00000455098	T;T	0.77098	-1.07;-1.07	5.83	5.83	0.93111	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.050899	0.85682	D	0.000000	T	0.74846	0.3770	N	0.02985	-0.445	0.58432	D	0.999998	D;D	0.71674	0.992;0.998	P;D	0.69824	0.893;0.966	T	0.78114	-0.2330	10	0.28530	T	0.3	.	20.1374	0.98035	0.0:0.0:1.0:0.0	.	787;838	B7ZM37;Q13370	.;PDE3B_HUMAN	S	838;787	ENSP00000282096:A838S;ENSP00000388644:A787S	ENSP00000282096:A838S	A	+	1	0	PDE3B	14822140	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.763000	0.94921	0.563000	0.77884	GCC	PDE3B	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	ENSG00000152270		0.373	PDE3B-001	KNOWN	basic|CCDS	protein_coding	PDE3B	HGNC	protein_coding	OTTHUMT00000386974.1		0.00	18	0	G	NM_000922		14865564	+1			no_errors	ENST00000282096	ensembl	human	known	74_37	missense	9.38	29	3	SNP	1.000	T
PDE7A	5150	genome.wustl.edu	37	8	66753636	66753636	+	Silent	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:66753636G>A	ENST00000401827.3	-	1	551	c.108C>T	c.(106-108)ttC>ttT	p.F36F	CTD-2532N20.1_ENST00000607622.1_lincRNA|PDE7A_ENST00000396642.3_Silent_p.F36F	NM_001242318.2	NP_001229247.1	Q13946	PDE7A_HUMAN	phosphodiesterase 7A	36					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			large_intestine(5)|lung(3)|stomach(1)|urinary_tract(1)	10			Epithelial(68;0.0509)|BRCA - Breast invasive adenocarcinoma(89;0.111)|all cancers(69;0.168)|OV - Ovarian serous cystadenocarcinoma(28;0.238)		Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	TGGGGCAGCCGAAGAGAGCGG	0.652																																																	0													14.0	20.0	18.0					8																	66753636		1927	4138	6065	SO:0001819	synonymous_variant	0			L12052	CCDS34901.1, CCDS56538.1	8q13	2008-03-18				ENSG00000205268	3.1.4.17	"""Phosphodiesterases"""	8791	protein-coding gene	gene with protein product		171885				8389765, 9521885	Standard	NM_001242318		Approved	HCP1	uc003xvq.3	Q13946		ENST00000401827.3:c.108C>T	8.37:g.66753636G>A			A0AVH6|A8K436|A8K9G5|O15380|Q96T72	Silent	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.F36	ENST00000401827.3	37	c.108	CCDS56538.1	8																																																																																			PDE7A	-	NULL	ENSG00000205268		0.652	PDE7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE7A	HGNC	protein_coding	OTTHUMT00000378905.1	-	0.00	67	0	G			66753636	-1	tier1	-	no_errors	ENST00000401827	ensembl	human	known	74_37	silent	16.28	36	7	SNP	1.000	A
PDZD8	118987	genome.wustl.edu	37	10	119100605	119100605	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:119100605G>T	ENST00000334464.5	-	2	1120	c.881C>A	c.(880-882)cCg>cAg	p.P294Q		NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	294					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		TGGAAAAAACGGCTTAAACCT	0.358																																																	0													119.0	107.0	111.0					10																	119100605		2203	4300	6503	SO:0001583	missense	0			AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.881C>A	10.37:g.119100605G>T	ENSP00000334642:p.Pro294Gln		Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	pfam_PDZ,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_PDZ,smart_PDZ,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_PDZ,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.P294Q	ENST00000334464.5	37	c.881	CCDS7600.1	10	.	.	.	.	.	.	.	.	.	.	G	20.9	4.066810	0.76301	.	.	ENSG00000165650	ENST00000334464	D	0.95756	-3.8	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.97564	0.9202	M	0.80616	2.505	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.97309	0.9936	10	0.51188	T	0.08	-12.5675	15.6304	0.76904	0.0:0.0:1.0:0.0	.	294	Q8NEN9	PDZD8_HUMAN	Q	294	ENSP00000334642:P294Q	ENSP00000334642:P294Q	P	-	2	0	PDZD8	119090595	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.181000	0.65054	2.837000	0.97791	0.591000	0.81541	CCG	PDZD8	-	NULL	ENSG00000165650		0.358	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD8	HGNC	protein_coding	OTTHUMT00000050565.1	-	0.00	63	0	G	NM_173791		119100605	-1	tier1	-	no_errors	ENST00000334464	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
PHF10	55274	genome.wustl.edu	37	6	170117959	170117959	+	Silent	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:170117959C>G	ENST00000339209.4	-	4	492	c.369G>C	c.(367-369)ctG>ctC	p.L123L	PHF10_ENST00000464779.1_5'UTR|PHF10_ENST00000366780.4_Silent_p.L121L	NM_018288.3|NM_133325.2	NP_060758.2|NP_579866.2	Q8WUB8	PHF10_HUMAN	PHD finger protein 10	123	Essential to induce neural progenitor proliferation. {ECO:0000250}.|SAY.				nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	npBAF complex (GO:0071564)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(3)|lung(4)|prostate(2)|urinary_tract(1)	14		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		TTAGCTCTCTCAGGTAGAGTT	0.328																																																	0													47.0	43.0	44.0					6																	170117959		2202	4299	6501	SO:0001819	synonymous_variant	0			AF338735	CCDS5308.2, CCDS5309.2	6q27	2014-05-13			ENSG00000130024	ENSG00000130024		"""Zinc fingers, PHD-type"""	18250	protein-coding gene	gene with protein product		613069				11827455	Standard	NM_018288		Approved	FLJ10975, XAP135, BAF45a	uc011egy.2	Q8WUB8	OTTHUMG00000016058	ENST00000339209.4:c.369G>C	6.37:g.170117959C>G			Q2YDA3|Q53HG8|Q9BXD2|Q9NV26	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.L123	ENST00000339209.4	37	c.369	CCDS5308.2	6																																																																																			PHF10	-	NULL	ENSG00000130024		0.328	PHF10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHF10	HGNC	protein_coding	OTTHUMT00000346732.1	-	0.00	19	0	C	NM_018288		170117959	-1	tier1	-	no_errors	ENST00000339209	ensembl	human	known	74_37	silent	25.00	18	6	SNP	0.987	G
PIAS1	8554	genome.wustl.edu	37	15	68438944	68438944	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:68438944G>T	ENST00000249636.6	+	6	882	c.734G>T	c.(733-735)cGa>cTa	p.R245L	PIAS1_ENST00000545237.1_Missense_Mutation_p.R247L	NM_016166.1	NP_057250.1	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	245	PINIT. {ECO:0000255|PROSITE- ProRule:PRU00799}.				androgen receptor signaling pathway (GO:0030521)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|protein-DNA complex assembly (GO:0065004)|regulation of cell proliferation (GO:0042127)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.R245L(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)	24						GAACCAAAGCGACCCAGCCGA	0.378																																																	1	Substitution - Missense(1)	endometrium(1)											114.0	108.0	110.0					15																	68438944		1832	4072	5904	SO:0001583	missense	0			AF077951	CCDS45290.1	15q	2011-10-11	2002-04-19	2002-04-19		ENSG00000033800		"""Zinc fingers, MIZ-type"""	2752	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 3"""	603566	"""DEAD/H (Asp-Glu-Ala-Asp/His) box binding protein 1"""	DDXBP1		9724754, 9177271	Standard	XM_005254735		Approved	GBP, GU/RH-II, ZMIZ3	uc002aqz.3	O75925		ENST00000249636.6:c.734G>T	15.37:g.68438944G>T	ENSP00000249636:p.Arg245Leu		B2RB67|B3KSY9|C5J4B4|Q147X4|Q99751|Q9UN02	Missense_Mutation	SNP	pfam_Znf_MIZ,smart_SAP_dom,pfscan_Znf_MIZ,pfscan_SAP_dom	p.R245L	ENST00000249636.6	37	c.734	CCDS45290.1	15	.	.	.	.	.	.	.	.	.	.	G	34	5.307116	0.95629	.	.	ENSG00000033800	ENST00000249636;ENST00000545237	T;T	0.39592	1.08;1.07	5.54	5.54	0.83059	PINIT domain (1);	0.061993	0.64402	D	0.000003	T	0.71358	0.3330	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	T	0.76418	-0.2966	10	0.87932	D	0	-8.5286	19.4841	0.95022	0.0:0.0:1.0:0.0	.	245;245	C5J4B4;O75925	.;PIAS1_HUMAN	L	245;247	ENSP00000249636:R245L;ENSP00000438574:R247L	ENSP00000249636:R245L	R	+	2	0	PIAS1	66225998	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.592000	0.87571	0.650000	0.86243	CGA	PIAS1	-	NULL	ENSG00000033800		0.378	PIAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS1	HGNC	protein_coding	OTTHUMT00000419642.2		0.00	36	0	G			68438944	+1			no_errors	ENST00000249636	ensembl	human	known	74_37	missense	6.90	27	2	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	-	0.00	66	0	G			178936091	+1	tier1	rs104886003	no_errors	ENST00000263967	ensembl	human	known	74_37	missense	18.75	104	24	SNP	1.000	A
PIK3R6	146850	genome.wustl.edu	37	17	8731963	8731963	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:8731963G>T	ENST00000311434.9	-	11	1473	c.1234C>A	c.(1234-1236)Cgg>Agg	p.R412R	PIK3R6_ENST00000434064.2_5'UTR	NM_001010855.2	NP_001010855.1	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6	412					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of MAP kinase activity (GO:0043406)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)										GTGTGCAGCCGGGACACGCCG	0.706																																																	0													16.0	18.0	18.0					17																	8731963		1927	4093	6020	SO:0001819	synonymous_variant	0			AK091819	CCDS73985.1	17p13.1	2013-01-31	2008-02-04	2008-02-04	ENSG00000174083	ENSG00000276231			27101	protein-coding gene	gene with protein product		611462	"""chromosome 17 open reading frame 38"""	C17orf38		16476736	Standard	NM_001010855		Approved	FLJ34500, HsT41028, p87PIKAP	uc002glq.1	Q5UE93	OTTHUMG00000132861	ENST00000311434.9:c.1234C>A	17.37:g.8731963G>T			Q658R3	Silent	SNP	pfam_PI3K_1B_gamma_p101_su	p.R412	ENST00000311434.9	37	c.1234		17																																																																																			PIK3R6	-	pfam_PI3K_1B_gamma_p101_su	ENSG00000174083		0.706	PIK3R6-201	KNOWN	basic|appris_principal	protein_coding	PIK3R6	HGNC	protein_coding		-	0.00	12	0	G	NM_001010855		8731963	-1	tier1	-	no_errors	ENST00000311434	ensembl	human	known	74_37	silent	44.44	5	4	SNP	0.777	T
PKD1	5310	genome.wustl.edu	37	16	2139786	2139786	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr16:2139786G>C	ENST00000262304.4	-	46	13062	c.12854C>G	c.(12853-12855)aCt>aGt	p.T4285S	RP11-304L19.1_ENST00000570072.1_RNA|MIR1225_ENST00000408729.1_RNA|PKD1_ENST00000423118.1_Missense_Mutation_p.T4284S	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	4285					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GCTGGGGCCAGTGGCCAGGTC	0.726																																																	0													6.0	7.0	7.0					16																	2139786		1955	4054	6009	SO:0001583	missense	0			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.12854C>G	16.37:g.2139786G>C	ENSP00000262304:p.Thr4285Ser		Q15140|Q15141	Missense_Mutation	SNP	pfam_PKD_dom,pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_PLAT/LH2_dom,pfam_C-type_lectin,pfam_WSC_carb-bd,pfam_GPS_dom,superfamily_C-type_lectin_fold,superfamily_Lipase_LipOase,superfamily_PKD_dom,superfamily_Fe_hydrogenase,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_WSC_carb-bd_subgr,smart_PKD/Chitinase_dom,smart_C-type_lectin,smart_GPS_dom,smart_PLAT/LH2_dom,prints_PKD_1,pfscan_GPS_dom,pfscan_C-type_lectin,pfscan_PKD_dom,pfscan_PLAT/LH2_dom,pfscan_REJ-like,pfscan_WSC_carb-bd,tigrfam_Polycystin_cat	p.T4285S	ENST00000262304.4	37	c.12854	CCDS32369.1	16	.	.	.	.	.	.	.	.	.	.	G	5.724	0.318046	0.10845	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.34275	1.37;1.37	4.51	0.0615	0.14341	.	1.235260	0.05842	N	0.619631	T	0.20495	0.0493	N	0.16307	0.4	0.09310	N	1	B;B	0.14438	0.01;0.006	B;B	0.12837	0.008;0.004	T	0.24657	-1.0154	10	0.09084	T	0.74	.	7.7823	0.29072	0.3453:0.0:0.6547:0.0	.	4284;4285	P98161-3;P98161	.;PKD1_HUMAN	S	4285;4284;3619	ENSP00000262304:T4285S;ENSP00000399501:T4284S	ENSP00000262304:T4285S	T	-	2	0	PKD1	2079787	0.000000	0.05858	0.000000	0.03702	0.089000	0.18198	0.195000	0.17155	-0.236000	0.09753	0.491000	0.48974	ACT	PKD1	-	NULL	ENSG00000008710		0.726	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKD1	HGNC	protein_coding	OTTHUMT00000341688.1		0.00	17	0	G			2139786	-1			no_errors	ENST00000262304	ensembl	human	known	74_37	missense	21.74	18	5	SNP	0.000	C
PKD2	5311	genome.wustl.edu	37	4	88957371	88957371	+	Splice_Site	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:88957371G>T	ENST00000237596.2	+	3	775		c.e3-1			NM_000297.3	NP_000288.1	Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)						angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		CTGTGTTCCAGTGACCTACGG	0.478																																																	1	Unknown(1)	endometrium(1)											166.0	156.0	160.0					4																	88957371		2203	4300	6503	SO:0001630	splice_region_variant	0			U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000237596.2:c.710-1G>T	4.37:g.88957371G>T			Q8TB08|Q9P0T6|Q9Y3X8	Splice_Site	SNP	-	e3-1	ENST00000237596.2	37	c.710-1	CCDS3627.1	4	.	.	.	.	.	.	.	.	.	.	G	22.4	4.282606	0.80692	.	.	ENSG00000118762	ENST00000237596	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2257	0.93817	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PKD2	89176395	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.753000	0.98904	2.541000	0.85698	0.655000	0.94253	.	PKD2	-	-	ENSG00000118762		0.478	PKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD2	HGNC	protein_coding	OTTHUMT00000253042.4		0.00	19	0	G	NM_000297	Intron	88957371	+1			no_errors	ENST00000237596	ensembl	human	known	74_37	splice_site	33.33	6	3	SNP	1.000	T
PLA2R1	22925	genome.wustl.edu	37	2	160832730	160832730	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:160832730G>T	ENST00000283243.7	-	17	2650	c.2444C>A	c.(2443-2445)cCc>cAc	p.P815H	PLA2R1_ENST00000392771.1_Missense_Mutation_p.P815H	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	815					cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)	p.P815R(1)	PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						AAAGAGCCAGGGTACATCTGA	0.373																																																	1	Substitution - Missense(1)	lung(1)											74.0	71.0	72.0					2																	160832730		2203	4300	6503	SO:0001583	missense	0			U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.2444C>A	2.37:g.160832730G>T	ENSP00000283243:p.Pro815His		B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.P815H	ENST00000283243.7	37	c.2444	CCDS33309.1	2	.	.	.	.	.	.	.	.	.	.	G	14.83	2.652309	0.47362	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.07908	3.15;3.15	5.18	5.18	0.71444	C-type lectin fold (1);C-type lectin (1);	0.057125	0.64402	D	0.000001	T	0.28499	0.0705	M	0.66506	2.035	0.54753	D	0.999989	B;D;D	0.89917	0.431;1.0;1.0	B;D;D	0.83275	0.269;0.996;0.985	T	0.00397	-1.1765	10	0.46703	T	0.11	.	17.8206	0.88649	0.0:0.0:1.0:0.0	.	815;815;815	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	H	815	ENSP00000283243:P815H;ENSP00000376524:P815H	ENSP00000283243:P815H	P	-	2	0	PLA2R1	160540976	1.000000	0.71417	0.999000	0.59377	0.620000	0.37586	6.289000	0.72696	2.560000	0.86352	0.561000	0.74099	CCC	PLA2R1	-	superfamily_C-type_lectin_fold,smart_C-type_lectin	ENSG00000153246		0.373	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2R1	HGNC	protein_coding	OTTHUMT00000333820.1		0.00	30	0	G			160832730	-1			no_errors	ENST00000283243	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.999	T
PLAA	9373	genome.wustl.edu	37	9	26916525	26916525	+	Intron	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr9:26916525G>T	ENST00000397292.3	-	10	1904				PLAA_ENST00000520641.1_5'UTR|PLAA_ENST00000520884.1_Intron	NM_001031689.2	NP_001026859.1	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein						inflammatory response (GO:0006954)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	phospholipase A2 activator activity (GO:0016005)			breast(1)|endometrium(7)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	17		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		GACTACTCCTGGGTAGTTGGG	0.413																																					Melanoma(175;2670 2735 14091 35526)												0													165.0	148.0	153.0					9																	26916525		692	1591	2283	SO:0001627	intron_variant	0			AF083395	CCDS35000.1	9p21	2013-01-10			ENSG00000137055	ENSG00000137055		"""WD repeat domain containing"""	9043	protein-coding gene	gene with protein product	"""DOA1 homolog (S. cerevisiae)"""	603873				9931468, 10644453	Standard	NM_001031689		Approved	PLAP, PLA2P, FLJ11281, FLJ12699, DOA1	uc003zqd.3	Q9Y263	OTTHUMG00000019708	ENST00000397292.3:c.1486+569C>A	9.37:g.26916525G>T			Q53EU5|Q5VY33|Q9NUL8|Q9NVE9|Q9UF53|Q9Y5L1	RNA	SNP	-	NULL	ENST00000397292.3	37	NULL	CCDS35000.1	9																																																																																			PLAA	-	-	ENSG00000137055		0.413	PLAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAA	HGNC	protein_coding	OTTHUMT00000051958.2	-	0.00	41	0	G	NM_001031689		26916525	-1	tier1	-	no_errors	ENST00000520641	ensembl	human	known	74_37	rna	9.30	39	4	SNP	0.303	T
PLEKHM2	23207	genome.wustl.edu	37	1	16053861	16053861	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:16053861delC	ENST00000375799.3	+	9	1521	c.1294delC	c.(1294-1296)cccfs	p.P433fs	PLEKHM2_ENST00000375793.2_Frame_Shift_Del_p.P413fs|RP11-288I21.1_ENST00000453804.1_RNA	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	433					Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		CCGTGCTGAGCCCCCAGACCA	0.647																																																	0													8.0	9.0	9.0					1																	16053861		1855	4079	5934	SO:0001589	frameshift_variant	0			AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.1294delC	1.37:g.16053861delC	ENSP00000364956:p.Pro433fs		O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Frame_Shift_Del	DEL	pfam_Run,pfam_Pleckstrin_homology,smart_Run,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Run	p.P433fs	ENST00000375799.3	37	c.1294	CCDS44063.1	1																																																																																			PLEKHM2	-	NULL	ENSG00000116786		0.647	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM2	HGNC	protein_coding	OTTHUMT00000008463.1		0.00	27	0	C	NM_015164		16053861	+1	tier1		no_errors	ENST00000375799	ensembl	human	known	74_37	frame_shift_del	9.09	20	2	DEL	1.000	-
PLD5	200150	genome.wustl.edu	37	1	242271125	242271125	+	Silent	SNP	A	A	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:242271125A>G	ENST00000536534.2	-	8	1328	c.1087T>C	c.(1087-1089)Ttg>Ctg	p.L363L	PLD5_ENST00000442594.2_Silent_p.L271L|PLD5_ENST00000427495.1_Silent_p.L301L			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	363						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			TTTGCATCCAAGTCTGGCCAG	0.343																																																	0													69.0	70.0	70.0					1																	242271125		2203	4300	6503	SO:0001819	synonymous_variant	0			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1087T>C	1.37:g.242271125A>G			A1KXV0|B7Z324|Q494U9|Q8NB22	Silent	SNP	smart_PLipase_D/transphosphatidylase	p.L363	ENST00000536534.2	37	c.1087	CCDS1621.2	1																																																																																			PLD5	-	NULL	ENSG00000180287		0.343	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD5	HGNC	protein_coding	OTTHUMT00000397213.2	-	0.00	38	0	A	NM_152666		242271125	-1	tier1	-	no_errors	ENST00000536534	ensembl	human	known	74_37	silent	8.16	45	4	SNP	0.998	G
PLIN3	10226	genome.wustl.edu	37	19	4839479	4839479	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:4839479G>T	ENST00000221957.4	-	8	1206	c.1030C>A	c.(1030-1032)Ctg>Atg	p.L344M	PLIN3_ENST00000585479.1_Missense_Mutation_p.L343M|PLIN3_ENST00000592528.1_Missense_Mutation_p.L332M|CTC-518P12.6_ENST00000591657.1_RNA	NM_001164189.1|NM_001164194.1|NM_005817.4	NP_001157661.1|NP_001157666.1|NP_005808.3	O60664	PLIN3_HUMAN	perilipin 3	344					vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|membrane (GO:0016020)				cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	9					Galsulfase(DB01279)|Idursulfase(DB01271)	CTGGACCCCAGGGAGGTACAG	0.637																																																	0													35.0	29.0	31.0					19																	4839479		2203	4300	6503	SO:0001583	missense	0			AF051314	CCDS12137.1, CCDS59337.1, CCDS59338.1	19p13.3	2009-08-12	2009-08-12	2009-08-12		ENSG00000105355		"""Perilipins"""	16893	protein-coding gene	gene with protein product	"""cargo selection protein (mannose 6 phosphate receptor binding protein)"", ""placental protein 17"", ""MPR-BINDING PROTEIN, 47-KD"""	602702	"""mannose-6-phosphate receptor binding protein 1"""	M6PRBP1		9590177, 6856484, 19638644	Standard	NM_005817		Approved	TIP47, PP17	uc002mbj.2	O60664		ENST00000221957.4:c.1030C>A	19.37:g.4839479G>T	ENSP00000221957:p.Leu344Met		A8K4Y9|K7EQF4|Q53G77|Q9BS03|Q9UBD7|Q9UP92	Missense_Mutation	SNP	pfam_Perilipin,pirsf_Perilipin	p.L344M	ENST00000221957.4	37	c.1030	CCDS12137.1	19	.	.	.	.	.	.	.	.	.	.	G	11.18	1.562298	0.27915	.	.	ENSG00000105355	ENST00000221957	T	0.34072	1.38	4.85	2.62	0.31277	.	1.788910	0.03536	U	0.223215	T	0.65471	0.2694	M	0.87971	2.92	0.29147	N	0.878644	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.994;0.999;0.996	T	0.11991	-1.0565	10	0.87932	D	0	-23.5374	6.4749	0.22031	0.1605:0.1499:0.6896:0.0	.	343;161;344	O60664-3;O60664-2;O60664	.;.;PLIN3_HUMAN	M	344	ENSP00000221957:L344M	ENSP00000221957:L344M	L	-	1	2	PLIN3	4790479	0.856000	0.29760	0.218000	0.23776	0.041000	0.13682	1.164000	0.31810	0.425000	0.26087	-0.266000	0.10368	CTG	PLIN3	-	pfam_Perilipin,pirsf_Perilipin	ENSG00000105355		0.637	PLIN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLIN3	HGNC	protein_coding	OTTHUMT00000450436.1	-	0.00	51	0	G	NM_005817		4839479	-1	tier1	-	no_errors	ENST00000221957	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.537	T
PLK4	10733	genome.wustl.edu	37	4	128811266	128811266	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:128811266G>T	ENST00000270861.5	+	7	1979	c.1705G>T	c.(1705-1707)Gaa>Taa	p.E569*	PLK4_ENST00000514379.1_Nonsense_Mutation_p.E528*|PLK4_ENST00000513090.1_Nonsense_Mutation_p.E537*|RNU6-583P_ENST00000516012.1_RNA|PLK4_ENST00000507249.1_Nonsense_Mutation_p.E535*|PLK4_ENST00000515069.1_Nonsense_Mutation_p.E491*	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	569					centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						TCCTCTTTCTGAACAGAGCAA	0.398																																					Colon(135;508 1718 19061 31832 42879)												0													87.0	79.0	82.0					4																	128811266		2203	4300	6503	SO:0001587	stop_gained	0			Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.1705G>T	4.37:g.128811266G>T	ENSP00000270861:p.Glu569*		B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_POLO_box_duplicated_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_POLO_box_duplicated_dom,pfscan_Prot_kinase_dom	p.E569*	ENST00000270861.5	37	c.1705	CCDS3735.1	4	.	.	.	.	.	.	.	.	.	.	G	38	6.717570	0.97784	.	.	ENSG00000142731	ENST00000270861;ENST00000515069;ENST00000513090;ENST00000507249;ENST00000514379	.	.	.	4.76	3.91	0.45181	.	0.368817	0.30235	N	0.010085	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-13.6016	12.7632	0.57376	0.0793:0.0:0.9207:0.0	.	.	.	.	X	569;491;537;535;528	.	ENSP00000270861:E569X	E	+	1	0	PLK4	129030716	1.000000	0.71417	0.988000	0.46212	0.694000	0.40290	4.706000	0.61845	1.225000	0.43566	0.491000	0.48974	GAA	PLK4	-	NULL	ENSG00000142731		0.398	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK4	HGNC	protein_coding	OTTHUMT00000257095.3	-	0.00	39	0	G			128811266	+1	tier1	-	no_errors	ENST00000270861	ensembl	human	known	74_37	nonsense	6.67	56	4	SNP	0.916	T
PLK4	10733	genome.wustl.edu	37	4	128819601	128819601	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:128819601G>C	ENST00000270861.5	+	16	3092	c.2818G>C	c.(2818-2820)Gaa>Caa	p.E940Q	PLK4_ENST00000514379.1_Missense_Mutation_p.E899Q|PLK4_ENST00000513090.1_Missense_Mutation_p.E908Q|PLK4_ENST00000507249.1_Missense_Mutation_p.E879Q|PLK4_ENST00000515069.1_Missense_Mutation_p.E862Q	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	940	POLO box. {ECO:0000255|PROSITE- ProRule:PRU00154}.				centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						TAGGTATGGAGAAAATGAAAA	0.308																																					Colon(135;508 1718 19061 31832 42879)												0													103.0	102.0	103.0					4																	128819601		2203	4293	6496	SO:0001583	missense	0			Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.2818G>C	4.37:g.128819601G>C	ENSP00000270861:p.Glu940Gln		B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_POLO_box_duplicated_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_POLO_box_duplicated_dom,pfscan_Prot_kinase_dom	p.E940Q	ENST00000270861.5	37	c.2818	CCDS3735.1	4	.	.	.	.	.	.	.	.	.	.	G	21.5	4.158545	0.78114	.	.	ENSG00000142731	ENST00000270861;ENST00000515069;ENST00000513090;ENST00000507249;ENST00000514379;ENST00000508113	T;T;T;T;T;T	0.11495	2.77;2.77;2.77;2.77;2.77;2.77	5.55	5.55	0.83447	POLO box duplicated domain (2);	0.000000	0.85682	D	0.000000	T	0.28896	0.0717	L	0.48362	1.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.00071	-1.2131	10	0.39692	T	0.17	-13.736	19.6873	0.95984	0.0:0.0:1.0:0.0	.	908;940	O00444-2;O00444	.;PLK4_HUMAN	Q	940;862;908;879;899;186	ENSP00000270861:E940Q;ENSP00000421774:E862Q;ENSP00000427554:E908Q;ENSP00000423412:E879Q;ENSP00000423582:E899Q;ENSP00000427568:E186Q	ENSP00000270861:E940Q	E	+	1	0	PLK4	129039051	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	8.419000	0.90253	2.890000	0.99128	0.585000	0.79938	GAA	PLK4	-	pfam_POLO_box_duplicated_dom,pfscan_POLO_box_duplicated_dom	ENSG00000142731		0.308	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK4	HGNC	protein_coding	OTTHUMT00000257095.3	-	0.00	41	0	G			128819601	+1	tier1	-	no_errors	ENST00000270861	ensembl	human	known	74_37	missense	16.22	31	6	SNP	1.000	C
PLP1	5354	genome.wustl.edu	37	X	103040564	103040564	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chrX:103040564G>T	ENST00000303958.2	+	2	204	c.58G>T	c.(58-60)Gtg>Ttg	p.V20L	PLP1_ENST00000361621.2_Missense_Mutation_p.V20L|PLP1_ENST00000418604.1_Missense_Mutation_p.V20L	NM_000533.3	NP_000524.3	P60201	MYPR_HUMAN	proteolipid protein 1	20					astrocyte development (GO:0014002)|axon development (GO:0061564)|axon ensheathment (GO:0008366)|cell death (GO:0008219)|cell maturation (GO:0048469)|central nervous system myelination (GO:0022010)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|long-chain fatty acid biosynthetic process (GO:0042759)|positive regulation of gene expression (GO:0010628)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)	structural constituent of myelin sheath (GO:0019911)|structural molecule activity (GO:0005198)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	17						TGCTTCCCTGGTGGCCACTGG	0.522																																																	0													195.0	184.0	187.0					X																	103040564		2203	4300	6503	SO:0001583	missense	0			M27110	CCDS14513.1, CCDS14514.1	Xq22	2013-05-14	2008-07-28		ENSG00000123560	ENSG00000123560			9086	protein-coding gene	gene with protein product	"""Pelizaeus-Merzbacher disease"""	300401	"""spastic paraplegia 2, uncomplicated"""	SPG2, PLP			Standard	NM_001128834		Approved	GPM6C	uc004elk.3	P60201	OTTHUMG00000022111	ENST00000303958.2:c.58G>T	X.37:g.103040564G>T	ENSP00000305152:p.Val20Leu		P04400|P06905|Q502Y1|Q6FHZ6	Missense_Mutation	SNP	pfam_Myelin_PLP,smart_Myelin_PLP,prints_Myelin_PLP	p.V20L	ENST00000303958.2	37	c.58	CCDS14513.1	X	.	.	.	.	.	.	.	.	.	.	G	17.47	3.396449	0.62177	.	.	ENSG00000123560	ENST00000434483;ENST00000429977;ENST00000455268;ENST00000422393;ENST00000433491;ENST00000418604;ENST00000443502;ENST00000303958;ENST00000361621;ENST00000428755	D;D;D;D;D;D;D;D;D	0.99287	-5.69;-5.69;-5.69;-5.69;-5.69;-5.69;-5.69;-5.69;-5.69	5.32	5.32	0.75619	.	0.118551	0.56097	D	0.000021	D	0.97253	0.9102	L	0.33339	1.005	0.43330	D	0.995363	B;B;B	0.29085	0.093;0.232;0.037	B;B;B	0.31614	0.092;0.133;0.007	D	0.95807	0.8838	10	0.62326	D	0.03	-6.5614	9.0686	0.36478	0.1018:0.0:0.8982:0.0	.	20;20;20	B1B1G6;P60201;P60201-2	.;MYPR_HUMAN;.	L	20	ENSP00000403335:V20L;ENSP00000399913:V20L;ENSP00000409802:V20L;ENSP00000413931:V20L;ENSP00000393391:V20L;ENSP00000405750:V20L;ENSP00000391853:V20L;ENSP00000305152:V20L;ENSP00000354860:V20L	ENSP00000305152:V20L	V	+	1	0	PLP1	102927220	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.354000	0.73036	2.210000	0.71456	0.600000	0.82982	GTG	PLP1	-	pfam_Myelin_PLP,prints_Myelin_PLP	ENSG00000123560		0.522	PLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLP1	HGNC	protein_coding	OTTHUMT00000057743.2	-	0.00	62	0	G			103040564	+1	tier1	-	no_errors	ENST00000303958	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
PMP22	5376	genome.wustl.edu	37	17	15142816	15142816	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:15142816G>T	ENST00000395938.2	-	4	485	c.291C>A	c.(289-291)taC>taA	p.Y97*	PMP22_ENST00000395936.1_Nonsense_Mutation_p.Y97*|PMP22_ENST00000312280.3_Nonsense_Mutation_p.Y97*|PMP22_ENST00000494511.1_Missense_Mutation_p.H38N|PMP22_ENST00000426385.3_Nonsense_Mutation_p.Y97*|snoU13_ENST00000458745.1_RNA	NM_001281455.1|NM_153321.1	NP_001268384.1|NP_696996.1	Q01453	PMP22_HUMAN	peripheral myelin protein 22	97					cell death (GO:0008219)|peripheral nervous system development (GO:0007422)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	8				UCEC - Uterine corpus endometrioid carcinoma (92;0.0884)|BRCA - Breast invasive adenocarcinoma(8;4.92e-06)		TTCCAGTGATGTAAAACCTGC	0.483																																																	0													127.0	107.0	114.0					17																	15142816		2203	4300	6503	SO:0001587	stop_gained	0			D11428	CCDS11168.1	17p12	2014-09-17			ENSG00000109099	ENSG00000109099			9118	protein-coding gene	gene with protein product		601097				8482547, 1497668	Standard	NM_001281456		Approved	HNPP, GAS-3, Sp110	uc002goj.3	Q01453	OTTHUMG00000058960	ENST00000395938.2:c.291C>A	17.37:g.15142816G>T	ENSP00000379269:p.Tyr97*		Q8WV01	Nonsense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_PMP22,prints_PMP22_EMP_MP20	p.Y97*	ENST00000395938.2	37	c.291	CCDS11168.1	17	.	.	.	.	.	.	.	.	.	.	G	25.8	4.674533	0.88445	.	.	ENSG00000109099	ENST00000395938;ENST00000312280;ENST00000426385;ENST00000395936	.	.	.	5.76	3.44	0.39384	.	0.114062	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-30.0425	10.856	0.46800	0.2273:0.0:0.7727:0.0	.	.	.	.	X	97	.	ENSP00000308937:Y97X	Y	-	3	2	PMP22	15083541	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.006000	0.57083	1.446000	0.47643	0.655000	0.94253	TAC	PMP22	-	pfam_PMP22/EMP/MP20/Claudin,prints_PMP22_EMP_MP20	ENSG00000109099		0.483	PMP22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMP22	HGNC	protein_coding	OTTHUMT00000130378.1	-	0.00	76	0	G	NM_000304		15142816	-1	tier1	-	no_errors	ENST00000312280	ensembl	human	known	74_37	nonsense	6.67	56	4	SNP	1.000	T
POGK	57645	genome.wustl.edu	37	1	166818379	166818379	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:166818379G>T	ENST00000367875.1	+	5	923	c.563G>T	c.(562-564)gGg>gTg	p.G188V	POGK_ENST00000537173.1_Missense_Mutation_p.G70V|POGK_ENST00000536514.1_Missense_Mutation_p.G103V|POGK_ENST00000367876.4_Missense_Mutation_p.G188V			Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	188					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	22						GACATAGCTGGGAAGTTTCAG	0.577																																					GBM(76;192 1530 30153 48742)												0													82.0	71.0	75.0					1																	166818379		2203	4300	6503	SO:0001583	missense	0			AB040946	CCDS1254.1	1q23.2	2013-01-08			ENSG00000143157	ENSG00000143157		"""-"""	18800	protein-coding gene	gene with protein product	"""KRAB box domain containing 2"""						Standard	NM_017542		Approved	KIAA15131, LST003, BASS2, KRBOX2	uc001gdt.1	Q9P215	OTTHUMG00000034325	ENST00000367875.1:c.563G>T	1.37:g.166818379G>T	ENSP00000356849:p.Gly188Val		Q5TIJ1|Q8TE07	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_Brinker_DNA-bd,pfam_HTH_CenpB_DNA-bd_dom,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,superfamily_Homeodomain-like,smart_Krueppel-associated_box,smart_HTH_CenpB_DNA-bd_dom,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.G188V	ENST00000367875.1	37	c.563	CCDS1254.1	1	.	.	.	.	.	.	.	.	.	.	G	10.45	1.352713	0.24512	.	.	ENSG00000143157	ENST00000537173;ENST00000536514;ENST00000449930;ENST00000367876;ENST00000367875	T;T;T;T;T	0.30182	1.55;1.54;4.8;4.79;4.79	5.39	-0.03	0.13916	.	0.478447	0.18081	N	0.152302	T	0.07818	0.0196	N	0.19112	0.55	0.28654	N	0.906513	B;B;B	0.13594	0.004;0.008;0.008	B;B;B	0.14023	0.01;0.004;0.007	T	0.18304	-1.0341	9	0.66056	D	0.02	-16.428	10.5065	0.44836	0.0824:0.6068:0.3108:0.0	.	70;103;188	G3V1P0;B4DS22;Q9P215	.;.;POGK_HUMAN	V	70;103;188;188;188	ENSP00000442763:G70V;ENSP00000441187:G103V;ENSP00000404402:G188V;ENSP00000356850:G188V;ENSP00000356849:G188V	ENSP00000356849:G188V	G	+	2	0	POGK	165085003	0.006000	0.16342	0.000000	0.03702	0.995000	0.86356	0.458000	0.21892	-0.145000	0.11294	0.655000	0.94253	GGG	POGK	-	NULL	ENSG00000143157		0.577	POGK-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	POGK	HGNC	protein_coding	OTTHUMT00000082888.1	-	0.00	39	0	G	NM_017542		166818379	+1	tier1	-	no_errors	ENST00000367875	ensembl	human	known	74_37	missense	12.50	21	3	SNP	0.000	T
POLR1A	25885	genome.wustl.edu	37	2	86258456	86258456	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:86258456G>T	ENST00000263857.6	-	30	4953	c.4575C>A	c.(4573-4575)tgC>tgA	p.C1525*	POLR1A_ENST00000409681.1_Intron			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	1525					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						CACTGACCTGGCACCACAGGC	0.662																																																	0													68.0	73.0	71.0					2																	86258456		2102	4214	6316	SO:0001587	stop_gained	0			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.4575C>A	2.37:g.86258456G>T	ENSP00000263857:p.Cys1525*		B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Nonsense_Mutation	SNP	pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_Rpb1_1,smart_RNA_pol_N	p.C1525*	ENST00000263857.6	37	c.4575	CCDS42706.1	2	.	.	.	.	.	.	.	.	.	.	G	44	10.573001	0.99430	.	.	ENSG00000068654	ENST00000263857	.	.	.	5.11	-3.71	0.04424	.	0.198315	0.53938	D	0.000043	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.4037	9.2059	0.37289	0.6584:0.1179:0.2236:0.0	.	.	.	.	X	1525	.	ENSP00000263857:C1525X	C	-	3	2	POLR1A	86111967	0.989000	0.36119	0.823000	0.32752	0.667000	0.39255	0.120000	0.15647	-0.811000	0.04369	-1.023000	0.02433	TGC	POLR1A	-	pfam_RNA_pol_Rpb1_5	ENSG00000068654		0.662	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1A	HGNC	protein_coding	OTTHUMT00000329830.2		0.00	37	0	G	NM_015425		86258456	-1			no_errors	ENST00000263857	ensembl	human	known	74_37	nonsense	6.67	28	2	SNP	0.962	T
POLR2A	5430	genome.wustl.edu	37	17	7416403	7416403	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:7416403G>T	ENST00000322644.6	+	29	5219	c.4820G>T	c.(4819-4821)gGc>gTc	p.G1607V		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	1607	C-terminal domain (CTD); 52 X 7 AA approximate tandem repeats of Y-[ST]-P- [STQ]-[ST]-P-[SRTEVKGN].				7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)	p.G1607V(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				TCTCCTGGGGGCTACACACCC	0.577																																																	1	Substitution - Missense(1)	endometrium(1)											234.0	241.0	239.0					17																	7416403		2203	4300	6503	SO:0001583	missense	0					17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.4820G>T	17.37:g.7416403G>T	ENSP00000314949:p.Gly1607Val		A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	pfam_RNA_pol_Rpb1_1,pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_Rpb1_6,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_7,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_II_repeat_euk,smart_RNA_pol_N	p.G1607V	ENST00000322644.6	37	c.4820	CCDS32548.1	17	.	.	.	.	.	.	.	.	.	.	G	15.49	2.848175	0.51164	.	.	ENSG00000181222	ENST00000535204;ENST00000545644;ENST00000322644	T	0.71817	-0.6	3.93	3.93	0.45458	.	0.366839	0.19849	N	0.104663	T	0.60457	0.2270	N	0.22421	0.69	0.80722	D	1	P	0.34562	0.457	B	0.38156	0.266	T	0.62220	-0.6900	10	0.37606	T	0.19	-13.8057	15.2975	0.73922	0.0:0.0:1.0:0.0	.	1607	P24928	RPB1_HUMAN	V	1563;506;1607	ENSP00000314949:G1607V	ENSP00000314949:G1607V	G	+	2	0	SLC35G6	7357127	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.556000	0.67307	2.190000	0.69967	0.456000	0.33151	GGC	POLR2A	-	NULL	ENSG00000181222		0.577	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2A	HGNC	protein_coding	OTTHUMT00000437967.1	-	0.00	82	0	G	NM_000937		7416403	+1	tier1	-	no_errors	ENST00000322644	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
POLR2J	5439	genome.wustl.edu	37	7	102119272	102119272	+	Silent	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:102119272G>C	ENST00000292614.5	-	1	82	c.36C>G	c.(34-36)ctC>ctG	p.L12L	AC093668.3_ENST00000607525.1_RNA|POLR2J_ENST00000393794.3_Silent_p.L12L	NM_006234.4	NP_006225.1	P52435	RPB11_HUMAN	polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa	12					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|LRR domain binding (GO:0030275)			pancreas(2)	2						CGCCCTCGAAGAGCAAGAACG	0.677											OREG0018232	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													16.0	21.0	19.0					7																	102119272		1975	3952	5927	SO:0001819	synonymous_variant	0			X98433	CCDS5724.1	7q11.2	2013-01-21	2002-08-29		ENSG00000005075	ENSG00000005075		"""RNA polymerase subunits"""	9197	protein-coding gene	gene with protein product		604150	"""polymerase (RNA) II (DNA directed) polypeptide J (13.3kD)"""				Standard	XM_005250452		Approved	RPB11, hRPB14, RPB11A, RPB11m, POLR2J1	uc003uzp.1	P52435	OTTHUMG00000150387	ENST00000292614.5:c.36C>G	7.37:g.102119272G>C		1364	A5D6V8|O43375	Silent	SNP	pfam_RBP11-like_dimer,superfamily_RBP11-like_dimer	p.L12	ENST00000292614.5	37	c.36	CCDS5724.1	7																																																																																			POLR2J	-	superfamily_RBP11-like_dimer	ENSG00000005075		0.677	POLR2J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2J	HGNC	protein_coding	OTTHUMT00000317913.1	-	0.00	61	0	G	NM_006234		102119272	-1	tier1	-	no_errors	ENST00000393794	ensembl	human	known	74_37	silent	25.40	47	16	SNP	1.000	C
PRDM14	63978	genome.wustl.edu	37	8	70981438	70981438	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:70981438G>T	ENST00000276594.2	-	2	859	c.658C>A	c.(658-660)Cac>Aac	p.H220N		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	220					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			ATCGCATGGTGCAGGCTGGCT	0.607																																					NSCLC(129;99 1813 5906 40656 46114)												0													76.0	81.0	79.0					8																	70981438		2203	4300	6503	SO:0001583	missense	0			AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.658C>A	8.37:g.70981438G>T	ENSP00000276594:p.His220Asn		Q86UX9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.H220N	ENST00000276594.2	37	c.658	CCDS6206.1	8	.	.	.	.	.	.	.	.	.	.	G	18.71	3.681697	0.68042	.	.	ENSG00000147596	ENST00000276594	T	0.11385	2.78	5.2	4.3	0.51218	.	0.844365	0.10456	N	0.672537	T	0.15089	0.0364	L	0.56769	1.78	0.22266	N	0.999247	B	0.18166	0.026	B	0.18561	0.022	T	0.14783	-1.0460	10	0.40728	T	0.16	-11.5174	13.8027	0.63212	0.0:0.0:0.8456:0.1544	.	220	Q9GZV8	PRD14_HUMAN	N	220	ENSP00000276594:H220N	ENSP00000276594:H220N	H	-	1	0	PRDM14	71143992	0.453000	0.25721	0.052000	0.19188	0.574000	0.36063	2.157000	0.42320	1.368000	0.46115	0.655000	0.94253	CAC	PRDM14	-	NULL	ENSG00000147596		0.607	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM14	HGNC	protein_coding	OTTHUMT00000318505.1	-	0.00	56	0	G			70981438	-1	tier1	-	no_errors	ENST00000276594	ensembl	human	known	74_37	missense	9.09	50	5	SNP	0.677	T
PREPL	9581	genome.wustl.edu	37	2	44586763	44586763	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:44586763T>C	ENST00000409936.1	-	2	529	c.92A>G	c.(91-93)tAt>tGt	p.Y31C	PREPL_ENST00000260648.6_Missense_Mutation_p.Y31C|PREPL_ENST00000541738.1_Intron|CAMKMT_ENST00000378494.3_5'Flank|PREPL_ENST00000540817.1_Intron|PREPL_ENST00000378520.3_Missense_Mutation_p.Y31C|CAMKMT_ENST00000403853.3_5'Flank|PREPL_ENST00000409411.1_Intron|PREPL_ENST00000378511.3_Missense_Mutation_p.Y31C|CAMKMT_ENST00000407131.1_5'Flank|CAMKMT_ENST00000402247.1_5'Flank|PREPL_ENST00000410081.1_Missense_Mutation_p.Y31C|PREPL_ENST00000409272.1_Missense_Mutation_p.Y31C|PREPL_ENST00000409957.1_Intron	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	31						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				AGCGAAGTTATAGTGATTCAA	0.333																																																	0													131.0	130.0	130.0					2																	44586763		2203	4300	6503	SO:0001583	missense	0			AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.92A>G	2.37:g.44586763T>C	ENSP00000386543:p.Tyr31Cys		A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Missense_Mutation	SNP	pfam_Peptidase_S9,pfam_Pept_S9A_N,prints_Peptidase_S9A	p.Y31C	ENST00000409936.1	37	c.92	CCDS33190.1	2	.	.	.	.	.	.	.	.	.	.	T	10.30	1.311988	0.23821	.	.	ENSG00000138078	ENST00000409936;ENST00000260648;ENST00000409272;ENST00000410081;ENST00000378520;ENST00000378511;ENST00000438314	.	.	.	5.27	-1.42	0.08913	.	1.326970	0.04739	N	0.422563	T	0.17831	0.0428	N	0.08118	0	0.25299	N	0.989299	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.19128	-1.0315	9	0.36615	T	0.2	0.0078	4.2858	0.10855	0.1568:0.3866:0.0:0.4566	.	31;31;31	Q4J6C6-3;Q4J6C6-2;Q4J6C6	.;.;PPCEL_HUMAN	C	31	.	ENSP00000260648:Y31C	Y	-	2	0	PREPL	44440267	0.732000	0.28121	0.920000	0.36463	0.982000	0.71751	-0.501000	0.06398	-0.111000	0.12001	-0.177000	0.13119	TAT	PREPL	-	NULL	ENSG00000138078		0.333	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PREPL	HGNC	protein_coding	OTTHUMT00000327900.1	-	0.00	41	0	T	NM_006036		44586763	-1	tier1	-	no_errors	ENST00000260648	ensembl	human	known	74_37	missense	32.86	47	23	SNP	0.439	C
PRKAB2	5565	genome.wustl.edu	37	1	146634077	146634077	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:146634077G>T	ENST00000254101.3	-	6	752	c.614C>A	c.(613-615)cCa>cAa	p.P205Q	PRKAB2_ENST00000425272.2_Missense_Mutation_p.P123Q|PRKAB2_ENST00000496858.1_5'UTR	NM_005399.3	NP_005390.1	O43741	AAKB2_HUMAN	protein kinase, AMP-activated, beta 2 non-catalytic subunit	205					carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|insulin receptor signaling pathway (GO:0008286)|membrane organization (GO:0061024)|protein phosphorylation (GO:0006468)|regulation of fatty acid biosynthetic process (GO:0042304)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)			NS(1)|endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11	all_hematologic(923;0.0487)				Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)	AAGGATGGGTGGGGATTTGAA	0.418																																																	0													106.0	104.0	105.0					1																	146634077		2203	4300	6503	SO:0001583	missense	0			BC053610	CCDS925.1	1q21.2	2008-02-05			ENSG00000131791	ENSG00000131791			9379	protein-coding gene	gene with protein product	"""AMPK beta 2"""	602741				8557660	Standard	NM_005399		Approved		uc001epe.3	O43741	OTTHUMG00000014032	ENST00000254101.3:c.614C>A	1.37:g.146634077G>T	ENSP00000254101:p.Pro205Gln		A8K9V5|B4DH06|Q5VXY0	Missense_Mutation	SNP	pfam_AMP_prot_kin_bsu_interact-dom,superfamily_Ig_E-set	p.P205Q	ENST00000254101.3	37	c.614	CCDS925.1	1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.944915	0.92593	.	.	ENSG00000131791	ENST00000254101;ENST00000425272	.	.	.	5.74	5.74	0.90152	5-AMP-activated protein kinase, beta subunit, interaction domain (1);	0.000000	0.85682	D	0.000000	D	0.86564	0.5963	H	0.96208	3.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.90167	0.4232	9	0.87932	D	0	.	17.4083	0.87479	0.0:0.0:1.0:0.0	.	123;205	B4DH06;O43741	.;AAKB2_HUMAN	Q	205;123	.	ENSP00000254101:P205Q	P	-	2	0	PRKAB2	145100701	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.476000	0.97823	2.709000	0.92574	0.655000	0.94253	CCA	PRKAB2	-	pfam_AMP_prot_kin_bsu_interact-dom	ENSG00000131791		0.418	PRKAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAB2	HGNC	protein_coding	OTTHUMT00000039471.1		0.00	28	0	G	NM_005399		146634077	-1			no_errors	ENST00000254101	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
PRKG1	5592	genome.wustl.edu	37	10	53667299	53667299	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:53667299T>C	ENST00000401604.2	+	5	880	c.686T>C	c.(685-687)aTc>aCc	p.I229T	PRKG1_ENST00000373985.1_Missense_Mutation_p.I217T|PRKG1_ENST00000373980.4_Missense_Mutation_p.I244T			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	229	cGMP-binding, low affinity.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		CCTGAAGAGATCCTCAGCAAG	0.408																																																	0													213.0	194.0	201.0					10																	53667299		2203	4300	6503	SO:0001583	missense	0				CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.686T>C	10.37:g.53667299T>C	ENSP00000384200:p.Ile229Thr		A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation	SNP	pirsf_cGMP-dependent_protein_kinase,pfam_Prot_kinase_dom,pfam_cNMP-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,prints_cGMP_dep_kinase,prints_cAMP/cGMP_kin,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_dom	p.I244T	ENST00000401604.2	37	c.731	CCDS44399.1	10	.	.	.	.	.	.	.	.	.	.	T	9.536	1.112007	0.20795	.	.	ENSG00000185532	ENST00000401604;ENST00000373985;ENST00000373980;ENST00000373976	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	5.14	5.14	0.70334	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (2);	0.000000	0.85682	D	0.000000	T	0.11153	0.0272	N	0.00746	-1.225	0.50632	D	0.999885	B;B	0.02656	0.0;0.0	B;B	0.12156	0.006;0.007	T	0.14144	-1.0483	10	0.29301	T	0.29	-12.1389	12.8965	0.58101	0.0:0.0:0.0:1.0	.	244;229	Q13976-2;Q13976	.;KGP1_HUMAN	T	229;217;244;102	ENSP00000384200:I229T;ENSP00000363097:I217T;ENSP00000363092:I244T;ENSP00000363087:I102T	ENSP00000363087:I102T	I	+	2	0	PRKG1	53337305	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.663000	0.54518	1.946000	0.56461	0.402000	0.26972	ATC	PRKG1	-	pirsf_cGMP-dependent_protein_kinase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_cGMP_dep_kinase,pfscan_cNMP-bd_dom	ENSG00000185532		0.408	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG1	HGNC	protein_coding		-	0.00	64	0	T			53667299	+1	tier1	-	no_errors	ENST00000373980	ensembl	human	known	74_37	missense	42.59	31	23	SNP	1.000	C
PROC	5624	genome.wustl.edu	37	2	128183756	128183756	+	Missense_Mutation	SNP	C	C	T	rs121918143		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:128183756C>T	ENST00000234071.3	+	7	718	c.631C>T	c.(631-633)Cgg>Tgg	p.R211W	MIR4783_ENST00000580343.1_RNA|PROC_ENST00000409048.1_Missense_Mutation_p.R245W|PROC_ENST00000453608.2_Missense_Mutation_p.R266W|PROC_ENST00000422777.3_Missense_Mutation_p.R211W	NM_000312.3	NP_000303.1	P04070	PROC_HUMAN	protein C (inactivator of coagulation factors Va and VIIIa)	211		Cleavage; by thrombin.	R -> Q (in patients with PROC deficiency; dbSNP:rs28933987). {ECO:0000269|PubMed:8499565}.|R -> W (in THPH3; London-1/Tochigi; dbSNP:rs28933986). {ECO:0000269|PubMed:2602169, ECO:0000269|PubMed:8292730}.		blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood coagulation (GO:0030195)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0673)	Antihemophilic Factor(DB00025)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	AGTAGATCCGCGGCTCATTGA	0.607																																																	0			GRCh37	CM880060	PROC	M	rs121918143	C	TRP/ARG	0,4406		0,0,2203	145.0	120.0	128.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	631	0.6	0.0	2	dbSNP_133	128	1,8599	1.2+/-3.3	0,1,4299	no	missense	PROC	NM_000312.3	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	211/462	128183756	1,13005	2203	4300	6503	SO:0001583	missense	0			X02750	CCDS2145.1	2q13-q14	2014-01-30			ENSG00000115718	ENSG00000115718		"""Endogenous ligands"""	9451	protein-coding gene	gene with protein product	"""prepro-protein C"""	612283				2991887, 2437584	Standard	NM_000312		Approved		uc002tok.3	P04070	OTTHUMG00000131528	ENST00000234071.3:c.631C>T	2.37:g.128183756C>T	ENSP00000234071:p.Arg211Trp		B4DPQ7|Q15189|Q15190|Q16001|Q53S74|Q9UC55	Missense_Mutation	SNP	pirsf_Pept_S1A_FX,pfam_Peptidase_S1,pfam_GLA_domain,superfamily_Trypsin-like_Pept_dom,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Peptidase_S1,prints_Peptidase_S1A,prints_GLA_domain,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Peptidase_S1	p.R266W	ENST00000234071.3	37	c.796	CCDS2145.1	2	.	.	.	.	.	.	.	.	.	.	C	10.66	1.412948	0.25465	0.0	1.16E-4	ENSG00000115718	ENST00000234071;ENST00000537436;ENST00000453608;ENST00000409048;ENST00000422777	D;D;D;D	0.95035	-3.59;-3.59;-3.59;-3.59	3.94	0.633	0.17712	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.168023	0.28182	N	0.016298	D	0.91740	0.7388	N	0.22421	0.69	0.32734	A	0.491369	P;P;D;P	0.62365	0.53;0.488;0.991;0.53	B;B;P;B	0.54270	0.069;0.088;0.747;0.041	D	0.91506	0.5223	9	0.52906	T	0.07	.	11.2372	0.48946	0.6604:0.3396:0.0:0.0	rs28933986	266;267;245;211	B4DPQ7;B4DPQ3;E7END6;P04070	.;.;.;PROC_HUMAN	W	211;170;266;245;211	ENSP00000234071:R211W;ENSP00000404030:R266W;ENSP00000386679:R245W;ENSP00000409543:R211W	ENSP00000234071:R211W	R	+	1	2	PROC	127900226	0.050000	0.20438	0.001000	0.08648	0.006000	0.05464	0.275000	0.18698	-0.031000	0.13781	-0.310000	0.09108	CGG	PROC	-	pirsf_Pept_S1A_FX,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1	ENSG00000115718		0.607	PROC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROC	HGNC	protein_coding	OTTHUMT00000254385.2	-	0.00	16	0	C	NM_000312		128183756	+1	tier1	rs28933986	no_errors	ENST00000453608	ensembl	human	known	74_37	missense	21.21	26	7	SNP	0.020	T
PSG8	440533	genome.wustl.edu	37	19	43348520	43348520	+	Intron	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:43348520C>T	ENST00000401467.2	-	1	136				PSG10P_ENST00000597171.1_RNA			Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8							extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				CCAGAGACTTCGACTGTCATG	0.453																																																	0																																										SO:0001627	intron_variant	0			M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000401467.2:c.64+11187G>A	19.37:g.43348520C>T			A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	RNA	SNP	-	NULL	ENST00000401467.2	37	NULL		19																																																																																			PSG10P	-	-	ENSG00000248257		0.453	PSG8-009	PUTATIVE	basic	protein_coding	PSG10P	HGNC	protein_coding	OTTHUMT00000464525.1	-	0.00	176	0	C			43348520	-1	tier1	-	no_errors	ENST00000597171	ensembl	human	known	74_37	rna	28.57	130	52	SNP	0.000	T
PSMB3	5691	genome.wustl.edu	37	17	36909465	36909465	+	Silent	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:36909465C>T	ENST00000225426.4	+	2	157	c.66C>T	c.(64-66)atC>atT	p.I22I	RNU6-866P_ENST00000516469.1_RNA	NM_002795.2	NP_002786.2	P49720	PSB3_HUMAN	proteasome (prosome, macropain) subunit, beta type, 3	22					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			endometrium(2)|large_intestine(1)|lung(1)	4						GTGTGGCCATCGCTGCAGACA	0.612																																																	0													52.0	46.0	48.0					17																	36909465		2203	4300	6503	SO:0001819	synonymous_variant	0			BC013008	CCDS11328.1	17q12	2014-05-06			ENSG00000108294	ENSG00000277791		"""Proteasome (prosome, macropain) subunits"""	9540	protein-coding gene	gene with protein product		602176				7918633	Standard	NM_002795		Approved	HC10-II, MGC4147	uc002hqr.3	P49720	OTTHUMG00000188503	ENST00000225426.4:c.66C>T	17.37:g.36909465C>T			P31147|Q0P6J7|Q96E27	Silent	SNP	pfam_Proteasome_sua/b	p.I22	ENST00000225426.4	37	c.66	CCDS11328.1	17																																																																																			PSMB3	-	pfam_Proteasome_sua/b	ENSG00000108294		0.612	PSMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMB3	HGNC	protein_coding	OTTHUMT00000256810.2	-	0.00	59	0	C	NM_002795		36909465	+1	tier1	-	no_errors	ENST00000225426	ensembl	human	known	74_37	silent	16.67	30	6	SNP	1.000	T
PSMD5	5711	genome.wustl.edu	37	9	123580395	123580395	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr9:123580395G>T	ENST00000210313.3	-	10	1378	c.1304C>A	c.(1303-1305)cCa>cAa	p.P435Q	PSMD5_ENST00000373904.5_Missense_Mutation_p.P392Q|PSMD5_ENST00000604848.1_Intron	NM_001270427.1|NM_005047.3	NP_001257356.1|NP_005038.1	Q16401	PSMD5_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 5	435					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome regulatory particle assembly (GO:0070682)|protein folding (GO:0006457)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)				endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|prostate(1)	10						TACAAAACCTGGACTGTTAAA	0.428																																																	0													94.0	91.0	92.0					9																	123580395		2203	4300	6503	SO:0001583	missense	0			AK001065	CCDS6824.1, CCDS59143.1	9q34.11	2008-02-05			ENSG00000095261	ENSG00000095261		"""Proteasome (prosome, macropain) subunits"""	9563	protein-coding gene	gene with protein product		604452				7559544	Standard	NM_005047		Approved	S5B, KIAA0072	uc004bko.4	Q16401	OTTHUMG00000020573	ENST00000210313.3:c.1304C>A	9.37:g.123580395G>T	ENSP00000210313:p.Pro435Gln		B4DZM8|Q15045|Q4VXG8	Missense_Mutation	SNP	pfam_26S_Psome_nonATP_su5,superfamily_ARM-type_fold	p.P435Q	ENST00000210313.3	37	c.1304	CCDS6824.1	9	.	.	.	.	.	.	.	.	.	.	G	29.1	4.976873	0.92982	.	.	ENSG00000095261	ENST00000210313;ENST00000373904	T;T	0.29917	1.55;1.55	5.96	5.96	0.96718	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.60612	0.2282	M	0.82517	2.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.55598	-0.8116	10	0.30078	T	0.28	.	19.4101	0.94667	0.0:0.0:1.0:0.0	.	392;435	B4DZM8;Q16401	.;PSMD5_HUMAN	Q	435;392	ENSP00000210313:P435Q;ENSP00000363011:P392Q	ENSP00000210313:P435Q	P	-	2	0	PSMD5	122620216	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.476000	0.97823	2.832000	0.97577	0.655000	0.94253	CCA	PSMD5	-	pfam_26S_Psome_nonATP_su5	ENSG00000095261		0.428	PSMD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD5	HGNC	protein_coding	OTTHUMT00000053825.2	-	0.00	47	0	G	NM_005047		123580395	-1	tier1	-	no_errors	ENST00000210313	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
PSMD9	5715	genome.wustl.edu	37	12	122326826	122326826	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:122326826G>T	ENST00000541212.1	+	1	190	c.64G>T	c.(64-66)Gac>Tac	p.D22Y	RP11-87C12.2_ENST00000546333.1_Missense_Mutation_p.D22Y|PSMD9_ENST00000542602.1_Missense_Mutation_p.D22Y|PSMD9_ENST00000261817.2_Missense_Mutation_p.D22Y|PSMD9_ENST00000340175.5_Missense_Mutation_p.D22Y			O00233	PSMD9_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 9	22					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion (GO:0046676)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of insulin secretion (GO:0032024)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome regulatory particle assembly (GO:0070682)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome regulatory particle (GO:0005838)	bHLH transcription factor binding (GO:0043425)|transcription coactivator activity (GO:0003713)			endometrium(1)|large_intestine(1)|lung(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000117)|Epithelial(86;0.000415)|BRCA - Breast invasive adenocarcinoma(302;0.231)		GACTGTCAGCGACGTCCAGGA	0.657											OREG0022209	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													35.0	22.0	26.0					12																	122326826		2198	4298	6496	SO:0001583	missense	0			AB003177	CCDS9225.1, CCDS58284.1	12q24.31-q24.32	2008-05-22			ENSG00000110801	ENSG00000110801		"""Proteasome (prosome, macropain) subunits"""	9567	protein-coding gene	gene with protein product		603146				9653651	Standard	NM_002813		Approved	p27, Rpn4	uc001ubl.4	O00233	OTTHUMG00000168945	ENST00000541212.1:c.64G>T	12.37:g.122326826G>T	ENSP00000440485:p.Asp22Tyr	1518	B2RD35|G3V1Q6|Q9BQ42	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ	p.D22Y	ENST00000541212.1	37	c.64	CCDS9225.1	12	.	.	.	.	.	.	.	.	.	.	G	19.10	3.761462	0.69763	.	.	ENSG00000110801;ENSG00000110801;ENSG00000110801;ENSG00000110801;ENSG00000256950	ENST00000541212;ENST00000340175;ENST00000261817;ENST00000538613;ENST00000542602	T;T;T;T;T	0.18657	2.2;2.2;2.2;2.2;2.2	4.72	3.83	0.44106	.	0.045750	0.85682	D	0.000000	T	0.40094	0.1103	L	0.57536	1.79	0.54753	D	0.999986	D;D	0.89917	0.999;1.0	D;D	0.71656	0.974;0.971	T	0.24048	-1.0171	10	0.56958	D	0.05	-43.816	12.8522	0.57864	0.0:0.0:0.8371:0.1629	.	22;22	F8W7V8;O00233	.;PSMD9_HUMAN	Y	22	ENSP00000440485:D22Y;ENSP00000340847:D22Y;ENSP00000261817:D22Y;ENSP00000443081:D22Y;ENSP00000443772:D22Y	ENSP00000261817:D22Y	D	+	1	0	RP11-87C12.2;PSMD9	120811209	1.000000	0.71417	1.000000	0.80357	0.652000	0.38707	1.544000	0.36158	1.332000	0.45431	0.561000	0.74099	GAC	PSMD9	-	NULL	ENSG00000110801		0.657	PSMD9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSMD9	HGNC	protein_coding	OTTHUMT00000401686.1		0.00	38	0	G	NM_002813		122326826	+1			no_errors	ENST00000541212	ensembl	human	known	74_37	missense	9.68	28	3	SNP	1.000	T
PTP4A1	7803	genome.wustl.edu	37	6	64289199	64289199	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:64289199G>T	ENST00000370651.3	+	5	1520	c.367G>T	c.(367-369)Gga>Tga	p.G123*	PTP4A1_ENST00000370650.2_Intron	NM_003463.3	NP_003454.1	Q93096	TP4A1_HUMAN	protein tyrosine phosphatase type IVA, member 1	123	Interaction with ATF5. {ECO:0000250}.|Tyrosine-protein phosphatase.				cell cycle (GO:0007049)|multicellular organismal development (GO:0007275)|positive regulation of cell migration (GO:0030335)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)			large_intestine(3)|lung(4)|skin(1)	8	all_cancers(3;0.071)|all_epithelial(2;0.0146)|Lung NSC(77;0.175)		Epithelial(2;0.0365)|LUSC - Lung squamous cell carcinoma(74;0.0644)|all cancers(2;0.112)|Lung(124;0.13)			AATTGAAGGTGGAATGAAATA	0.328																																					Pancreas(91;1019 1502 28028 38110 51645)												0													123.0	114.0	117.0					6																	64289199		2203	4300	6503	SO:0001587	stop_gained	0			U48296	CCDS4965.1	6q12	2011-06-09			ENSG00000112245	ENSG00000112245		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9634	protein-coding gene	gene with protein product		601585				9642300	Standard	NM_003463		Approved	PTPCAAX1, PRL-1	uc003pel.3	Q93096	OTTHUMG00000014949	ENST00000370651.3:c.367G>T	6.37:g.64289199G>T	ENSP00000359685:p.Gly123*		B2R6C8|O00648|Q49A54	Nonsense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Dual-sp_phosphatase_cat-dom,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase	p.G123*	ENST00000370651.3	37	c.367	CCDS4965.1	6	.	.	.	.	.	.	.	.	.	.	G	47	13.566667	0.99750	.	.	ENSG00000112245	ENST00000370651	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-27.5203	20.394	0.98981	0.0:0.0:1.0:0.0	.	.	.	.	X	123	.	ENSP00000359685:G123X	G	+	1	0	PTP4A1	64347158	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.966000	0.87956	2.830000	0.97506	0.585000	0.79938	GGA	PTP4A1	-	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Dual-sp_phosphatase_cat-dom,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase	ENSG00000112245		0.328	PTP4A1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PTP4A1	HGNC	protein_coding	OTTHUMT00000041083.2	-	0.00	35	0	G			64289199	+1	tier1	-	no_errors	ENST00000370651	ensembl	human	known	74_37	nonsense	7.27	51	4	SNP	1.000	T
PTPN18	26469	genome.wustl.edu	37	2	131128322	131128322	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:131128322G>A	ENST00000175756.5	+	10	902	c.801G>A	c.(799-801)atG>atA	p.M267I	PTPN18_ENST00000347849.3_Missense_Mutation_p.M160I	NM_014369.3	NP_055184.2	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type 18 (brain-derived)	267	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)	15	Colorectal(110;0.1)					TCCTTAAGATGAGGAAGCAGC	0.577																																																	0													105.0	98.0	100.0					2																	131128322		2203	4300	6503	SO:0001583	missense	0			X79568	CCDS2161.1, CCDS46410.1	2q21	2011-06-09			ENSG00000072135	ENSG00000072135		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9649	protein-coding gene	gene with protein product		606587				8950995	Standard	NM_014369		Approved	BDP1	uc002trc.3	Q99952	OTTHUMG00000131630	ENST00000175756.5:c.801G>A	2.37:g.131128322G>A	ENSP00000175756:p.Met267Ile		B4E1E6|Q53P42	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.M267I	ENST00000175756.5	37	c.801	CCDS2161.1	2	.	.	.	.	.	.	.	.	.	.	G	13.67	2.307376	0.40795	.	.	ENSG00000072135	ENST00000175756;ENST00000347849;ENST00000409022	D;D	0.82433	-1.61;-1.61	4.88	2.05	0.26809	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	0.529823	0.16048	N	0.232081	T	0.71341	0.3328	L	0.28694	0.88	0.36816	D	0.88614	B;B;B	0.17465	0.007;0.022;0.022	B;B;B	0.20577	0.015;0.03;0.022	T	0.65508	-0.6151	10	0.59425	D	0.04	.	5.9931	0.19478	0.1732:0.0:0.6641:0.1627	.	246;267;160	E7EMB8;Q99952;B4E1E6	.;PTN18_HUMAN;.	I	267;160;246	ENSP00000175756:M267I;ENSP00000310092:M160I	ENSP00000175756:M267I	M	+	3	0	PTPN18	130844792	0.998000	0.40836	0.712000	0.30502	0.618000	0.37518	0.944000	0.29043	0.313000	0.23062	0.591000	0.81541	ATG	PTPN18	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	ENSG00000072135		0.577	PTPN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN18	HGNC	protein_coding	OTTHUMT00000254523.2	-	0.00	66	0	G			131128322	+1	tier1	-	no_errors	ENST00000175756	ensembl	human	known	74_37	missense	19.57	37	9	SNP	0.998	A
PTPN9	5780	genome.wustl.edu	37	15	75763043	75763043	+	Missense_Mutation	SNP	G	G	T	rs552177179		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:75763043G>T	ENST00000306726.2	-	11	1849	c.1337C>A	c.(1336-1338)aCg>aAg	p.T446K		NM_002833.2	NP_002824.1	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type 9	446	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AATTTCTAGCGTTGTTTTCTT	0.413																																																	0													140.0	135.0	137.0					15																	75763043		2197	4294	6491	SO:0001583	missense	0				CCDS10280.1	15q23	2011-06-09			ENSG00000169410	ENSG00000169410		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9661	protein-coding gene	gene with protein product		600768				1557404	Standard	NM_002833		Approved	MEG2	uc002bal.3	P43378	OTTHUMG00000142838	ENST00000306726.2:c.1337C>A	15.37:g.75763043G>T	ENSP00000303554:p.Thr446Lys		Q53XR9	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_CRAL-TRIO_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_CRAL-bd_toc_tran	p.T446K	ENST00000306726.2	37	c.1337	CCDS10280.1	15	.	.	.	.	.	.	.	.	.	.	G	11.76	1.735760	0.30774	.	.	ENSG00000169410	ENST00000306726;ENST00000544966	D	0.82984	-1.67	5.87	1.74	0.24563	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.325509	0.36200	N	0.002721	T	0.68586	0.3017	L	0.45137	1.4	0.49483	D	0.999799	P	0.37914	0.611	B	0.32805	0.153	T	0.57682	-0.7769	10	0.22109	T	0.4	.	4.5094	0.11903	0.3287:0.0:0.5216:0.1497	.	446	P43378	PTN9_HUMAN	K	446;436	ENSP00000303554:T446K	ENSP00000303554:T446K	T	-	2	0	PTPN9	73550096	1.000000	0.71417	0.686000	0.30086	0.677000	0.39632	3.322000	0.52007	0.322000	0.23283	0.655000	0.94253	ACG	PTPN9	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000169410		0.413	PTPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN9	HGNC	protein_coding	OTTHUMT00000286474.1		0.00	90	0	G			75763043	-1			no_errors	ENST00000306726	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.911	T
RAB26	25837	genome.wustl.edu	37	16	2202871	2202871	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr16:2202871G>T	ENST00000210187.6	+	6	679	c.519G>T	c.(517-519)atG>atT	p.M173I	SNORD60_ENST00000383903.1_RNA|TRAF7_ENST00000326181.6_5'Flank|RAB26_ENST00000541451.1_Missense_Mutation_p.M107I|RP11-304L19.5_ENST00000563192.1_lincRNA	NM_014353.4	NP_055168.2	Q9ULW5	RAB26_HUMAN	RAB26, member RAS oncogene family	173					exocrine system development (GO:0035272)|Golgi to plasma membrane protein transport (GO:0043001)|regulated secretory pathway (GO:0045055)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	Golgi membrane (GO:0000139)|intrinsic component of plasma membrane (GO:0031226)|secretory granule membrane (GO:0030667)	GMP binding (GO:0019002)|GTP binding (GO:0005525)			kidney(1)|large_intestine(1)|lung(3)	5						TGGCGCTCATGCTGCTGGGGA	0.682																																																	0													31.0	31.0	31.0					16																	2202871		2195	4292	6487	SO:0001583	missense	0			AB027137	CCDS10460.1	16p13.3	2008-07-28			ENSG00000167964	ENSG00000167964		"""RAB, member RAS oncogene"""	14259	protein-coding gene	gene with protein product		605455				11043516	Standard	NM_014353		Approved		uc002cou.3	Q9ULW5	OTTHUMG00000128829	ENST00000210187.6:c.519G>T	16.37:g.2202871G>T	ENSP00000210187:p.Met173Ile		B2RAA6|Q3L6K5|Q6NXS7	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.M173I	ENST00000210187.6	37	c.519	CCDS10460.1	16	.	.	.	.	.	.	.	.	.	.	G	13.94	2.388027	0.42308	.	.	ENSG00000167964	ENST00000541451;ENST00000210187	T;T	0.76186	-1.0;-1.0	3.96	3.96	0.45880	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.49779	0.1577	N	0.00686	-1.255	0.58432	D	0.999994	B	0.23540	0.087	B	0.36959	0.237	T	0.55042	-0.8202	10	0.35671	T	0.21	.	13.5665	0.61822	0.0:0.0:1.0:0.0	.	173	Q9ULW5	RAB26_HUMAN	I	107;173	ENSP00000441580:M107I;ENSP00000210187:M173I	ENSP00000210187:M173I	M	+	3	0	RAB26	2142872	1.000000	0.71417	1.000000	0.80357	0.719000	0.41307	9.249000	0.95470	2.049000	0.60858	0.313000	0.20887	ATG	RAB26	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000167964		0.682	RAB26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB26	HGNC	protein_coding	OTTHUMT00000250767.2	-	0.00	29	0	G			2202871	+1	tier1	-	no_errors	ENST00000210187	ensembl	human	known	74_37	missense	19.05	17	4	SNP	1.000	T
RABGAP1	23637	genome.wustl.edu	37	9	125827753	125827753	+	Intron	DEL	A	A	-	rs3214358		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr9:125827753delA	ENST00000373647.4	+	14	2042				RABGAP1_ENST00000373643.5_Intron|RABGAP1_ENST00000493854.1_Intron	NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1						cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)			breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						ATTTCATGTCAAAAAAAAAAA	0.343																																																	0													36.0	38.0	37.0					9																	125827753		2203	4300	6503	SO:0001627	intron_variant	0			AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.1908+13A>-	9.37:g.125827753delA			B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Frame_Shift_Del	DEL	pfam_Kinesin-like,pfam_Rab-GTPase-TBC_dom,pfam_PTB/PI_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom,pfscan_Rab-GTPase-TBC_dom	p.K576fs	ENST00000373647.4	37	c.1717	CCDS6848.2	9																																																																																			RABGAP1	-	pfscan_Rab-GTPase-TBC_dom	ENSG00000011454		0.343	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGAP1	HGNC	protein_coding	OTTHUMT00000053976.3		0.00	21	0	A	NM_012197		125827753	+1	tier1		no_errors	ENST00000456584	ensembl	human	known	74_37	frame_shift_del	15.00	17	3	DEL	0.000	-
RASAL2	9462	genome.wustl.edu	37	1	178062346	178062346	+	5'Flank	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:178062346G>A	ENST00000367649.3	+	0	0				RASAL2_ENST00000448150.3_5'Flank|RASAL2-AS1_ENST00000421505.1_lincRNA			Q9UJF2	NGAP_HUMAN	RAS protein activator like 2						negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						TCATGTGCCTGAGAGGCCCGT	0.483																																																	0																																										SO:0001631	upstream_gene_variant	0			AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022		1.37:g.178062346G>A	Exception_encountered		F8W755|O95174|Q2TB22|Q5TFU9	RNA	SNP	-	NULL	ENST00000367649.3	37	NULL	CCDS1321.2	1																																																																																			RASAL2-AS1	-	-	ENSG00000224687		0.483	RASAL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASAL2-AS1	HGNC	protein_coding	OTTHUMT00000352415.1	-	0.00	37	0	G	NM_170692		178062346	-1	tier1	-	no_errors	ENST00000419458	ensembl	human	known	74_37	rna	17.07	34	7	SNP	0.001	A
RASGEF1A	221002	genome.wustl.edu	37	10	43692530	43692530	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:43692530G>T	ENST00000395809.1	-	11	3748	c.1242C>A	c.(1240-1242)tcC>tcA	p.S414S	RASGEF1A_ENST00000374459.1_Silent_p.S422S|RASGEF1A_ENST00000395810.1_Silent_p.S414S			Q8N9B8	RGF1A_HUMAN	RasGEF domain family, member 1A	414	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				cell migration (GO:0016477)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)	11						GGATCTGTCTGGAGATCTCCC	0.507																																																	0													155.0	136.0	142.0					10																	43692530		2203	4300	6503	SO:0001819	synonymous_variant	0			AK095136	CCDS7202.2, CCDS60517.1	10q11.21	2006-01-11			ENSG00000198915	ENSG00000198915			24246	protein-coding gene	gene with protein product		614531				12477932	Standard	XM_005271808		Approved	CG4853, FLJ37817	uc001jap.1	Q8N9B8	OTTHUMG00000018025	ENST00000395809.1:c.1242C>A	10.37:g.43692530G>T			Q8TBF1	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.S414	ENST00000395809.1	37	c.1242	CCDS7202.2	10																																																																																			RASGEF1A	-	superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000198915		0.507	RASGEF1A-003	KNOWN	basic|CCDS	protein_coding	RASGEF1A	HGNC	protein_coding	OTTHUMT00000313989.1	-	0.00	64	0	G	NM_145313		43692530	-1	tier1	-	no_errors	ENST00000395809	ensembl	human	known	74_37	silent	15.38	33	6	SNP	1.000	T
RBM5	10181	genome.wustl.edu	37	3	50147857	50147857	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:50147857G>T	ENST00000347869.3	+	16	1499	c.1324G>T	c.(1324-1326)Gcc>Tcc	p.A442S	RBM5_ENST00000441812.2_Intron	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	442	Required for interaction with U2AF2.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ACAGGCCCCAGCCGCTTCCCC	0.458																																																	0													54.0	58.0	57.0					3																	50147857		2203	4300	6503	SO:0001583	missense	0			U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.1324G>T	3.37:g.50147857G>T	ENSP00000343054:p.Ala442Ser		B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Missense_Mutation	SNP	pfam_G_patch_dom,pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,smart_G_patch_dom,pfscan_Znf_RanBP2,pfscan_Znf_C2H2,pfscan_G_patch_dom,pfscan_RRM_dom	p.A442S	ENST00000347869.3	37	c.1324	CCDS2810.1	3	.	.	.	.	.	.	.	.	.	.	G	15.09	2.730797	0.48939	.	.	ENSG00000003756	ENST00000347869;ENST00000543047;ENST00000544851	T	0.15952	2.38	6.01	4.96	0.65561	.	0.401606	0.28047	N	0.016815	T	0.13628	0.0330	L	0.43923	1.385	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.07065	-1.0792	10	0.14252	T	0.57	-12.9566	10.445	0.44488	0.1111:0.0:0.7593:0.1296	.	132;442	Q59HE6;P52756	.;RBM5_HUMAN	S	442;441;132	ENSP00000343054:A442S	ENSP00000343054:A442S	A	+	1	0	RBM5	50122861	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.484000	0.45242	2.861000	0.98227	0.650000	0.86243	GCC	RBM5	-	NULL	ENSG00000003756		0.458	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM5	HGNC	protein_coding	OTTHUMT00000345797.3	-	0.00	58	0	G	NM_005778		50147857	+1	tier1	-	no_errors	ENST00000347869	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.993	T
RBM8A	9939	genome.wustl.edu	37	1	145508235	145508235	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:145508235G>T	ENST00000330165.8	+	3	225	c.156G>T	c.(154-156)gaG>gaT	p.E52D	GNRHR2_ENST00000312753.5_RNA|RP11-315I20.1_ENST00000447686.2_RNA|RP11-315I20.1_ENST00000595494.1_RNA|RP11-315I20.1_ENST00000599469.1_RNA|RP11-315I20.1_ENST00000601726.1_RNA|RBM8A_ENST00000369307.3_Missense_Mutation_p.E51D|RP11-315I20.1_ENST00000596355.1_RNA|RP11-315I20.1_ENST00000412239.1_RNA|RP11-315I20.1_ENST00000600340.1_RNA|RP11-315I20.1_ENST00000448561.1_RNA|RP11-315I20.1_ENST00000421764.1_RNA|RP11-315I20.1_ENST00000597144.1_RNA|RP11-315I20.1_ENST00000437797.1_RNA|RP11-315I20.1_ENST00000598103.1_RNA|RP11-315I20.1_ENST00000598354.1_RNA|RP11-315I20.1_ENST00000599626.1_RNA|RP11-315I20.1_ENST00000599147.1_RNA|RP11-315I20.1_ENST00000595518.1_RNA	NM_005105.3	NP_005096.1	Q9Y5S9	RBM8A_HUMAN	RNA binding motif protein 8A	52					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGATGCGTGAGGATTATGACA	0.527											OREG0013748	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													106.0	106.0	106.0					1																	145508235		2203	4300	6503	SO:0001583	missense	0			AF127761	CCDS72872.1	1q21.1	2013-02-12			ENSG00000131795			"""RNA binding motif (RRM) containing"""	9905	protein-coding gene	gene with protein product		605313		RBM8		11004516, 11013075	Standard	NM_005105		Approved	ZNRP, BOV-1A, BOV-1B, BOV-1C, RBM8B, Y14	uc001ent.2	Q9Y5S9	OTTHUMG00000013736	ENST00000330165.8:c.156G>T	1.37:g.145508235G>T	ENSP00000333001:p.Glu52Asp	1695	B3KQI9|Q6FHD1|Q6IQ40|Q9GZX8|Q9NZI4	Missense_Mutation	SNP	pfam_RRM_dom,pfam_RRM_3,smart_RRM_dom,pfscan_RRM_dom,prints_RNA-bd_8	p.E52D	ENST00000330165.8	37	c.156	CCDS916.1	1	.	.	.	.	.	.	.	.	.	.	G	14.77	2.635075	0.47049	.	.	ENSG00000131795	ENST00000330165;ENST00000369307	T;T	0.14516	2.55;2.5	5.3	-0.884	0.10597	.	0.051039	0.85682	D	0.000000	T	0.02571	0.0078	L	0.29908	0.895	0.48087	D	0.999587	B;B	0.15141	0.012;0.007	B;B	0.13407	0.009;0.004	T	0.39396	-0.9616	10	0.12766	T	0.61	-14.4254	9.6448	0.39861	0.5923:0.0:0.4077:0.0	.	51;52	Q9Y5S9-2;Q9Y5S9	.;RBM8A_HUMAN	D	52;51	ENSP00000333001:E52D;ENSP00000358313:E51D	ENSP00000333001:E52D	E	+	3	2	RBM8A	144219592	1.000000	0.71417	0.979000	0.43373	0.993000	0.82548	0.929000	0.28844	-0.188000	0.10499	-0.300000	0.09419	GAG	RBM8A	-	NULL	ENSG00000131795		0.527	RBM8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM8A	HGNC	protein_coding	OTTHUMT00000038503.2	-	0.00	36	0	G	NM_005105		145508235	+1	tier1	-	no_errors	ENST00000330165	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.998	T
RC3H2	54542	genome.wustl.edu	37	9	125652626	125652626	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr9:125652626G>T	ENST00000373670.1	-	3	1148	c.548C>A	c.(547-549)gCt>gAt	p.A183D	RC3H2_ENST00000335387.5_Missense_Mutation_p.A183D|RC3H2_ENST00000423239.2_Missense_Mutation_p.A183D|RC3H2_ENST00000373665.2_Missense_Mutation_p.A183D|RC3H2_ENST00000357244.2_Missense_Mutation_p.A183D|RC3H2_ENST00000478216.1_5'UTR|RC3H2_ENST00000471874.2_Missense_Mutation_p.A183D			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	183	ROQ.				B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						AGCCCTGACAGCGGCCCATAG	0.478																																																	0													62.0	63.0	62.0					9																	125652626		1910	4128	6038	SO:0001583	missense	0			AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.548C>A	9.37:g.125652626G>T	ENSP00000362774:p.Ala183Asp		Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_RING,smart_Znf_CCCH,pfscan_Znf_RING	p.A183D	ENST00000373670.1	37	c.548	CCDS43874.1	9	.	.	.	.	.	.	.	.	.	.	G	31	5.102283	0.94245	.	.	ENSG00000056586	ENST00000373670;ENST00000357244;ENST00000373663;ENST00000423239;ENST00000373665;ENST00000335387	D;D;D;D;D	0.95554	-3.74;-3.74;-3.74;-3.74;-3.74	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.97470	0.9172	M	0.73217	2.22	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;0.999	D;D;D;D	0.97110	0.999;0.981;1.0;0.991	D	0.98085	1.0406	10	0.87932	D	0	-18.2447	18.241	0.89967	0.0:0.0:1.0:0.0	.	183;183;183;183	A6NHN2;Q9HBD1;Q9HBD1-5;Q9HBD1-4	.;RC3H2_HUMAN;.;.	D	183;183;54;183;183;183	ENSP00000362774:A183D;ENSP00000349783:A183D;ENSP00000411767:A183D;ENSP00000362769:A183D;ENSP00000335150:A183D	ENSP00000335150:A183D	A	-	2	0	RC3H2	124692447	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.441000	0.97557	2.559000	0.86315	0.491000	0.48974	GCT	RC3H2	-	NULL	ENSG00000056586		0.478	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RC3H2	HGNC	protein_coding	OTTHUMT00000053966.1	-	0.00	50	0	G	NM_018835		125652626	-1	tier1	-	no_errors	ENST00000357244	ensembl	human	known	74_37	missense	7.84	46	4	SNP	1.000	T
REXO1	57455	genome.wustl.edu	37	19	1820106	1820106	+	Intron	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:1820106G>T	ENST00000170168.4	-	7	2621				CTB-31O20.4_ENST00000593201.1_RNA|CTB-31O20.4_ENST00000590531.1_RNA	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)							nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGTGCCGGGGAGCCCCAGCG	0.692																																																	0													19.0	20.0	20.0					19																	1820106		2199	4298	6497	SO:0001627	intron_variant	0			AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.2527-50C>A	19.37:g.1820106G>T			Q9ULT2	RNA	SNP	-	NULL	ENST00000170168.4	37	NULL	CCDS32866.1	19																																																																																			REXO1	-	-	ENSG00000079313		0.692	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REXO1	HGNC	protein_coding	OTTHUMT00000449200.1	-	0.00	36	0	G	NM_020695		1820106	-1	tier1	-	no_errors	ENST00000586343	ensembl	human	known	74_37	rna	30.30	23	10	SNP	0.006	T
RFC1	5981	genome.wustl.edu	37	4	39297293	39297293	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:39297293G>T	ENST00000381897.1	-	22	3031	c.2898C>A	c.(2896-2898)caC>caA	p.H966Q	RNU6-32P_ENST00000383948.1_RNA|RFC1_ENST00000349703.2_Missense_Mutation_p.H965Q	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	966					DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						CTGTAGACGAGTGCTTCCCCA	0.478																																					Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)												0													116.0	102.0	107.0					4																	39297293		2203	4300	6503	SO:0001583	missense	0			L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.2898C>A	4.37:g.39297293G>T	ENSP00000371321:p.His966Gln		A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Missense_Mutation	SNP	pfam_DNA_replication_fac_RFC1_C,pfam_BRCT_dom,pfam_ATPase_AAA_core,superfamily_DNA_pol3_clamp-load_cplx_C,superfamily_P-loop_NTPase,superfamily_BRCT_dom,smart_BRCT_dom,smart_AAA+_ATPase,pirsf_DNA_replication_fac_C_lsu,pfscan_BRCT_dom	p.H966Q	ENST00000381897.1	37	c.2898	CCDS56329.1	4	.	.	.	.	.	.	.	.	.	.	G	13.44	2.238558	0.39598	.	.	ENSG00000035928	ENST00000381897;ENST00000349703	T;T	0.41065	1.01;1.01	5.65	4.81	0.61882	DNA replication factor RFC1, C-terminal (1);DNA polymerase III, clamp loader complex, gamma/delta/delta subunit, C-terminal (1);	0.759186	0.13348	N	0.394616	T	0.35799	0.0944	L	0.34521	1.04	0.41080	D	0.985518	B;B	0.31705	0.336;0.284	B;B	0.38156	0.266;0.195	T	0.25222	-1.0138	10	0.56958	D	0.05	-0.8281	6.9904	0.24751	0.2903:0.0:0.7097:0.0	.	966;965	P35251;P35251-2	RFC1_HUMAN;.	Q	966;965	ENSP00000371321:H966Q;ENSP00000261424:H965Q	ENSP00000261424:H965Q	H	-	3	2	RFC1	38973688	1.000000	0.71417	0.999000	0.59377	0.943000	0.58893	3.316000	0.51960	1.390000	0.46547	0.585000	0.79938	CAC	RFC1	-	pfam_DNA_replication_fac_RFC1_C,superfamily_DNA_pol3_clamp-load_cplx_C,pirsf_DNA_replication_fac_C_lsu	ENSG00000035928		0.478	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RFC1	HGNC	protein_coding	OTTHUMT00000216808.1	-	0.00	38	0	G	NM_002913		39297293	-1	tier1	-	no_errors	ENST00000381897	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.994	T
RGS20	8601	genome.wustl.edu	37	8	54764502	54764502	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:54764502C>T	ENST00000297313.3	+	1	135	c.43C>T	c.(43-45)Cat>Tat	p.H15Y	RGS20_ENST00000344277.6_Missense_Mutation_p.H15Y	NM_170587.2	NP_733466.1	O76081	RGS20_HUMAN	regulator of G-protein signaling 20	15					positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			CCTCCAGAAACATTTCTCCAG	0.453																																																	0													120.0	124.0	123.0					8																	54764502		2203	4300	6503	SO:0001583	missense	0			AF074979	CCDS6155.1, CCDS6156.1, CCDS69482.1	8q11.23	2008-07-25	2007-08-14		ENSG00000147509	ENSG00000147509		"""Regulators of G-protein signaling"""	14600	protein-coding gene	gene with protein product		607193	"""regulator of G-protein signalling 20"""			9748279, 9748280	Standard	NM_003702		Approved	RGSZ1, ZGAP1	uc003xrp.3	O76081	OTTHUMG00000164750	ENST00000297313.3:c.43C>T	8.37:g.54764502C>T	ENSP00000297313:p.His15Tyr		Q96BG9	Missense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.H15Y	ENST00000297313.3	37	c.43	CCDS6155.1	8	.	.	.	.	.	.	.	.	.	.	C	8.515	0.867419	0.17250	.	.	ENSG00000147509	ENST00000297313;ENST00000344277	T;T	0.55052	0.86;0.54	4.84	2.11	0.27256	.	.	.	.	.	T	0.44644	0.1303	L	0.53249	1.67	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.001	T	0.40365	-0.9567	9	0.52906	T	0.07	.	6.3966	0.21616	0.0:0.7054:0.0:0.2946	.	15;15	O76081-2;O76081	.;RGS20_HUMAN	Y	15	ENSP00000297313:H15Y;ENSP00000344630:H15Y	ENSP00000297313:H15Y	H	+	1	0	RGS20	54927055	0.000000	0.05858	0.044000	0.18714	0.530000	0.34684	-0.368000	0.07543	0.776000	0.33473	-0.126000	0.14955	CAT	RGS20	-	NULL	ENSG00000147509		0.453	RGS20-001	KNOWN	basic|CCDS	protein_coding	RGS20	HGNC	protein_coding	OTTHUMT00000380058.1	-	0.00	31	0	C			54764502	+1	tier1	-	no_errors	ENST00000297313	ensembl	human	known	74_37	missense	24.39	31	10	SNP	0.036	T
RIMS2	9699	genome.wustl.edu	37	8	104933054	104933055	+	Intron	DEL	AA	AA	-	rs61400627		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:104933054_104933055delAA	ENST00000436393.2	+	8	1658				RIMS2_ENST00000262231.10_Intron|RIMS2_ENST00000406091.3_Intron|RIMS2_ENST00000507740.1_Intron			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			cgtctctactaaaaaaaaaaaa	0.545										HNSCC(12;0.0054)																																							0																																										SO:0001627	intron_variant	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.1418-845AA>-	8.37:g.104933064_104933065delAA			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	RNA	DEL	-	NULL	ENST00000436393.2	37	NULL		8																																																																																			RIMS2	-	-	ENSG00000176406		0.545	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1		0.00	11	0	AA	NM_001100117		104933055	+1	tier1		no_errors	ENST00000501515	ensembl	human	known	74_37	rna	9.09	20	2	DEL	0.054:0.048	-
RIMS2	9699	genome.wustl.edu	37	8	105001620	105001620	+	Missense_Mutation	SNP	G	G	A	rs199654709		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:105001620G>A	ENST00000436393.2	+	15	2590	c.2349G>A	c.(2347-2349)atG>atA	p.M783I	RIMS2_ENST00000262231.10_Missense_Mutation_p.M844I|RIMS2_ENST00000406091.3_Missense_Mutation_p.M1005I|RIMS2_ENST00000507740.1_Missense_Mutation_p.M797I			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1067					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			ATCGTGTCATGGATGACCATT	0.393										HNSCC(12;0.0054)																																							0								G	ILE/MET,ILE/MET	0,3714		0,0,1857	111.0	107.0	108.0		3015,2391	2.7	1.0	8		108	6,8172		0,6,4083	yes	missense,missense	RIMS2	NM_001100117.2,NM_014677.4	10,10	0,6,5940	AA,AG,GG		0.0734,0.0,0.0505	benign,benign	1005/1350,797/1164	105001620	6,11886	1857	4089	5946	SO:0001583	missense	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.2349G>A	8.37:g.105001620G>A	ENSP00000390665:p.Met783Ile		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.M1005I	ENST00000436393.2	37	c.3015		8	.	.	.	.	.	.	.	.	.	.	G	9.712	1.157397	0.21454	0.0	7.34E-4	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T	0.17213	2.29;2.71;2.38;2.47;2.4;2.74	5.54	2.67	0.31697	.	.	.	.	.	T	0.11665	0.0284	L	0.40543	1.245	0.80722	D	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.0;0.001;0.001;0.0;0.0	T	0.11842	-1.0571	9	0.24483	T	0.36	.	4.9563	0.14041	0.2922:0.0:0.5688:0.1389	.	1067;783;844;797;1005	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	I	1005;1020;1005;1067;844;797;797;783	ENSP00000427018:M1005I;ENSP00000384892:M1005I;ENSP00000262231:M844I;ENSP00000423559:M797I;ENSP00000386228:M797I;ENSP00000390665:M783I	ENSP00000262231:M844I	M	+	3	0	RIMS2	105070796	0.995000	0.38212	1.000000	0.80357	0.975000	0.68041	0.937000	0.28951	0.715000	0.32103	-0.350000	0.07774	ATG	RIMS2	-	NULL	ENSG00000176406		0.393	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1		0.00	48	0	G	NM_001100117		105001620	+1			no_errors	ENST00000406091	ensembl	human	known	74_37	missense	14.63	35	6	SNP	0.998	A
ROBO1	6091	genome.wustl.edu	37	3	78689030	78689030	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:78689030G>T	ENST00000464233.1	-	22	3014	c.2901C>A	c.(2899-2901)atC>atA	p.I967I	ROBO1_ENST00000436010.2_Silent_p.I928I|ROBO1_ENST00000495273.1_Silent_p.I922I|ROBO1_ENST00000467549.1_Silent_p.I922I	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	967					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		CAGGTTCACTGATGTTGAGAA	0.408																																																	0													45.0	42.0	43.0					3																	78689030		1907	4124	6031	SO:0001819	synonymous_variant	0			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.2901C>A	3.37:g.78689030G>T			B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.I967	ENST00000464233.1	37	c.2901	CCDS54611.1	3																																																																																			ROBO1	-	NULL	ENSG00000169855		0.408	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	HGNC	protein_coding	OTTHUMT00000352610.1	-	0.00	36	0	G	NM_002941		78689030	-1	tier1	-	no_errors	ENST00000464233	ensembl	human	known	74_37	silent	19.57	37	9	SNP	1.000	T
ROS1	6098	genome.wustl.edu	37	6	117686360	117686360	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:117686360G>T	ENST00000368508.3	-	20	3179	c.2981C>A	c.(2980-2982)gCt>gAt	p.A994D	ROS1_ENST00000368507.3_Missense_Mutation_p.A989D|GOPC_ENST00000467125.1_Intron	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	994	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TTGTTCACTAGCCAAGAACTA	0.338			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																			Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	0													54.0	53.0	54.0					6																	117686360		2203	4300	6503	SO:0001583	missense	0			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.2981C>A	6.37:g.117686360G>T	ENSP00000357494:p.Ala994Asp		Q15368|Q5TDB5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_LDLR_classB_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A994D	ENST00000368508.3	37	c.2981	CCDS5116.1	6	.	.	.	.	.	.	.	.	.	.	G	5.084	0.201153	0.09652	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	T;T	0.53640	0.61;0.61	5.73	1.46	0.22682	.	1.024070	0.07757	N	0.949481	T	0.11623	0.0283	N	0.08118	0	0.34315	D	0.685956	B	0.02656	0.0	B	0.01281	0.0	T	0.08249	-1.0731	10	0.62326	D	0.03	.	5.2827	0.15684	0.1624:0.0:0.4431:0.3945	.	994	P08922	ROS1_HUMAN	D	994;989	ENSP00000357494:A994D;ENSP00000357493:A989D	ENSP00000357493:A989D	A	-	2	0	ROS1	117793053	0.963000	0.33076	0.994000	0.49952	0.412000	0.31113	1.106000	0.31098	0.683000	0.31428	0.655000	0.94253	GCT	ROS1	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000047936		0.338	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	HGNC	protein_coding	OTTHUMT00000043464.1		0.00	43	0	G			117686360	-1			no_errors	ENST00000368508	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.656	T
RP1	6101	genome.wustl.edu	37	8	55541969	55541969	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:55541969G>T	ENST00000220676.1	+	4	5675	c.5527G>T	c.(5527-5529)Gcc>Tcc	p.A1843S		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1843					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TGAAACCTGTGCCAAGGAAAG	0.408																																					Colon(91;1014 1389 7634 14542 40420)												0													96.0	91.0	93.0					8																	55541969		2203	4300	6503	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.5527G>T	8.37:g.55541969G>T	ENSP00000220676:p.Ala1843Ser			Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.A1843S	ENST00000220676.1	37	c.5527	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	G	0.624	-0.820018	0.02755	.	.	ENSG00000104237	ENST00000220676	T	0.44482	0.92	6.03	-1.24	0.09435	.	0.907903	0.09170	N	0.839003	T	0.27278	0.0669	L	0.39898	1.24	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.24835	-1.0149	10	0.30078	T	0.28	.	2.7467	0.05268	0.1493:0.3697:0.2932:0.1879	.	1843	P56715	RP1_HUMAN	S	1843	ENSP00000220676:A1843S	ENSP00000220676:A1843S	A	+	1	0	RP1	55704522	0.000000	0.05858	0.000000	0.03702	0.263000	0.26337	0.122000	0.15687	0.068000	0.16574	0.655000	0.94253	GCC	RP1	-	NULL	ENSG00000104237		0.408	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	-	0.00	34	0	G	NM_006269		55541969	+1	tier1	-	no_errors	ENST00000220676	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.000	T
RPL11	6135	genome.wustl.edu	37	1	24019156	24019156	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:24019156C>G	ENST00000374550.3	+	2	109	c.64C>G	c.(64-66)Ctc>Gtc	p.L22V	RPL11_ENST00000482370.1_3'UTR	NM_000975.3|NM_001199802.1	NP_000966.2|NP_001186731.1	P62913	RL11_HUMAN	ribosomal protein L11	22					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein localization to nucleus (GO:0034504)|protein targeting (GO:0006605)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.13e-24)|Colorectal(126;5.06e-08)|COAD - Colon adenocarcinoma(152;2.92e-06)|GBM - Glioblastoma multiforme(114;4.4e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|KIRC - Kidney renal clear cell carcinoma(1967;0.00322)|STAD - Stomach adenocarcinoma(196;0.0124)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0837)|LUSC - Lung squamous cell carcinoma(448;0.185)		CAAACTCTGTCTCAACATCTG	0.542																																																	0													131.0	130.0	130.0					1																	24019156		2203	4300	6503	SO:0001583	missense	0			L05092	CCDS238.1	1p36.1-p35	2011-04-06			ENSG00000142676	ENSG00000142676		"""L ribosomal proteins"""	10301	protein-coding gene	gene with protein product		604175				9582194, 10343117	Standard	NM_000975		Approved	L11	uc001bhk.3	P62913	OTTHUMG00000002926	ENST00000374550.3:c.64C>G	1.37:g.24019156C>G	ENSP00000363676:p.Leu22Val		P25121|P39026|Q8TDH2|Q9Y674	Missense_Mutation	SNP	pfam_Ribosomal_L5,superfamily_Ribosomal_L5_domain,pirsf_Ribosomal_L5	p.L22V	ENST00000374550.3	37	c.64	CCDS238.1	1	.	.	.	.	.	.	.	.	.	.	C	14.99	2.698895	0.48307	.	.	ENSG00000142676	ENST00000374550;ENST00000443624;ENST00000458455	T;T;T	0.78364	-1.17;-1.17;-1.17	5.07	5.07	0.68467	Ribosomal protein L5 domain (2);	0.000000	0.85682	D	0.000000	T	0.67392	0.2888	L	0.28274	0.84	0.80722	D	1	B;B	0.10296	0.003;0.0	B;B	0.32149	0.141;0.058	T	0.60449	-0.7261	10	0.16896	T	0.51	-3.3469	11.8977	0.52665	0.0:0.9198:0.0:0.0802	.	21;22	P62913-2;P62913	.;RL11_HUMAN	V	22;20;20	ENSP00000363676:L22V;ENSP00000390839:L20V;ENSP00000398888:L20V	ENSP00000363676:L22V	L	+	1	0	RPL11	23891743	1.000000	0.71417	1.000000	0.80357	0.394000	0.30568	4.507000	0.60434	2.352000	0.79861	0.585000	0.79938	CTC	RPL11	-	pfam_Ribosomal_L5,superfamily_Ribosomal_L5_domain,pirsf_Ribosomal_L5	ENSG00000142676		0.542	RPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL11	HGNC	protein_coding	OTTHUMT00000008168.1	-	0.00	33	0	C	NM_000975		24019156	+1	tier1	-	no_errors	ENST00000374550	ensembl	human	known	74_37	missense	18.75	26	6	SNP	1.000	G
RPL3	6122	genome.wustl.edu	37	22	39708981	39708981	+	Silent	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr22:39708981C>G	ENST00000216146.4	-	10	1349	c.1176G>C	c.(1174-1176)ctG>ctC	p.L392L	RPL3_ENST00000401609.1_Silent_p.L340L|SNORD83A_ENST00000386747.1_RNA|SNORD83B_ENST00000386745.1_RNA|RPL3_ENST00000465618.1_5'UTR	NM_000967.3|NM_001033853.1	NP_000958.1|NP_001029025.1	P39023	RL3_HUMAN	ribosomal protein L3	392					cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.L392L(1)		breast(1)|kidney(4)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	Melanoma(58;0.04)				Homoharringtonine(DB04865)	GGTCTTTCTTCAGTGGTCCCT	0.498																																																	1	Substitution - coding silent(1)	urinary_tract(1)											70.0	66.0	67.0					22																	39708981		2203	4300	6503	SO:0001819	synonymous_variant	0			AB007166	CCDS13988.1	22q13	2011-04-06			ENSG00000100316	ENSG00000100316		"""L ribosomal proteins"""	10332	protein-coding gene	gene with protein product		604163				2891103, 9582194	Standard	NM_000967		Approved	L3	uc003axi.3	P39023	OTTHUMG00000151079	ENST00000216146.4:c.1176G>C	22.37:g.39708981C>G			B2RDV9|Q15548|Q5I0G0	Silent	SNP	pfam_Ribosomal_L3,superfamily_Transl_B-barrel	p.L392	ENST00000216146.4	37	c.1176	CCDS13988.1	22																																																																																			RPL3	-	NULL	ENSG00000100316		0.498	RPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL3	HGNC	protein_coding	OTTHUMT00000321196.1		0.00	35	0	C	NM_000967		39708981	-1			no_errors	ENST00000216146	ensembl	human	known	74_37	silent	5.56	34	2	SNP	0.986	G
RRP8	23378	genome.wustl.edu	37	11	6623317	6623317	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:6623317G>T	ENST00000254605.6	-	2	345	c.228C>A	c.(226-228)ccC>ccA	p.P76P	RRP8_ENST00000534343.1_Intron|ILK_ENST00000299421.4_5'Flank|ILK_ENST00000396751.2_5'Flank|ILK_ENST00000420936.2_5'Flank|ILK_ENST00000528995.1_5'Flank|RP11-732A19.8_ENST00000527191.1_RNA|ILK_ENST00000537806.1_5'Flank	NM_015324.3	NP_056139.1	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase, homolog (yeast)	76					cellular response to glucose starvation (GO:0042149)|chromatin modification (GO:0016568)|chromatin silencing at rDNA (GO:0000183)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription by glucose (GO:0046015)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|rDNA heterochromatin (GO:0033553)	methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)	13						ATGCCTTTTTGGGGCATTTCT	0.507																																																	0													99.0	95.0	97.0					11																	6623317		2201	4296	6497	SO:0001819	synonymous_variant	0			AB007869	CCDS31411.1	11p15.4	2009-02-23	2009-02-23	2009-02-23	ENSG00000132275	ENSG00000132275			29030	protein-coding gene	gene with protein product	RRP8 methyltransferase homolog (S. cerevisiae)	615818	"""KIAA0409"""	KIAA0409		9455477	Standard	NM_015324		Approved		uc001med.3	O43159		ENST00000254605.6:c.228C>A	11.37:g.6623317G>T			Q7KZ78|Q9BVM6	Silent	SNP	pfam_Methyltransferase-rel,pfam_Methyltransf_11	p.P76	ENST00000254605.6	37	c.228	CCDS31411.1	11																																																																																			RRP8	-	NULL	ENSG00000132275		0.507	RRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP8	HGNC	protein_coding	OTTHUMT00000384505.1		0.00	73	0	G	NM_015324		6623317	-1			no_errors	ENST00000254605	ensembl	human	known	74_37	silent	5.00	76	4	SNP	0.000	T
RYK	6259	genome.wustl.edu	37	3	133910826	133910826	+	Splice_Site	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:133910826G>T	ENST00000427044.2	-	9	925	c.315C>A	c.(313-315)agC>agA	p.S105R	RYK_ENST00000296084.4_Splice_Site_p.S295R			P34925	RYK_HUMAN	receptor-like tyrosine kinase	294	WIF. {ECO:0000255|PROSITE- ProRule:PRU00222}.				axon guidance (GO:0007411)|corpus callosum development (GO:0022038)|neuron differentiation (GO:0030182)|neuron projection development (GO:0031175)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of MAPK cascade (GO:0043410)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			lung(1)|ovary(3)	4						AACCTAAGGAGCCAACAAAGC	0.428																																																	0													69.0	64.0	65.0					3																	133910826		1858	4104	5962	SO:0001630	splice_region_variant	0			S59184	CCDS75016.1	3q22.1	2012-02-28	2012-02-28		ENSG00000163785	ENSG00000163785	2.7.10.1		10481	protein-coding gene	gene with protein product		600524	"""JTK5A protein tyrosine kinase"", ""RYK receptor-like tyrosine kinase"""	JTK5A		8386829	Standard	NM_001005861		Approved	D3S3195, RYK1, JTK5	uc003eqc.1	P34925	OTTHUMG00000159750	ENST00000427044.2:c.314-1C>A	3.37:g.133910826G>T			Q04696	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S105R	ENST00000427044.2	37	c.315		3	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033021	0.54896	.	.	ENSG00000163785	ENST00000296084;ENST00000427044	T;T	0.79141	1.99;-1.24	6.02	6.02	0.97574	.	0.513188	0.17321	U	0.178520	T	0.73976	0.3656	L	0.29908	0.895	0.58432	D	0.999999	D	0.53151	0.958	P	0.45506	0.483	T	0.71573	-0.4552	9	.	.	.	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	294	P34925-2	.	R	295;105	ENSP00000296084:S295R;ENSP00000399527:S105R	.	S	-	3	2	RYK	135393516	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.832000	0.48152	2.865000	0.98341	0.655000	0.94253	AGC	RYK	-	NULL	ENSG00000163785		0.428	RYK-202	KNOWN	basic|appris_principal	protein_coding	RYK	HGNC	protein_coding		-	0.00	50	0	G	NM_001005861	Missense_Mutation	133910826	-1	tier1	-	no_errors	ENST00000427044	ensembl	human	known	74_37	missense	6.49	72	5	SNP	1.000	T
SARDH	1757	genome.wustl.edu	37	9	136599116	136599116	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr9:136599116G>T	ENST00000371872.4	-	2	437	c.180C>A	c.(178-180)agC>agA	p.S60R	SARDH_ENST00000298628.5_Missense_Mutation_p.S60R|SARDH_ENST00000439388.1_Missense_Mutation_p.S60R|SARDH_ENST00000371867.1_5'UTR|SARDH_ENST00000422262.2_Intron	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	60					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		GCAGGGGCCGGCTTGGGCCTT	0.677																																																	0													29.0	27.0	27.0					9																	136599116		2199	4292	6491	SO:0001583	missense	0				CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.180C>A	9.37:g.136599116G>T	ENSP00000360938:p.Ser60Arg		B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C	p.S60R	ENST00000371872.4	37	c.180	CCDS6978.1	9	.	.	.	.	.	.	.	.	.	.	G	8.048	0.765461	0.15914	.	.	ENSG00000123453	ENST00000371872;ENST00000439388;ENST00000427237;ENST00000539227;ENST00000535281;ENST00000393050;ENST00000298628	T;T;T	0.73258	-0.73;-0.73;1.65	4.77	3.87	0.44632	.	0.311877	0.34223	N	0.004157	T	0.54191	0.1843	N	0.19112	0.55	0.09310	N	1	B	0.32010	0.351	B	0.33042	0.157	T	0.51772	-0.8663	10	0.62326	D	0.03	-35.7416	8.7942	0.34870	0.0794:0.0:0.7715:0.1491	.	60	Q9UL12	SARDH_HUMAN	R	60;60;60;60;60;38;60	ENSP00000360938:S60R;ENSP00000403084:S60R;ENSP00000298628:S60R	ENSP00000298628:S60R	S	-	3	2	SARDH	135588937	1.000000	0.71417	0.482000	0.27366	0.055000	0.15305	2.962000	0.49176	1.008000	0.39264	0.591000	0.81541	AGC	SARDH	-	NULL	ENSG00000123453		0.677	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARDH	HGNC	protein_coding	OTTHUMT00000054931.1		0.00	42	0	G			136599116	-1			no_errors	ENST00000371872	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.024	T
SART1	9092	genome.wustl.edu	37	11	65733370	65733370	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:65733370G>T	ENST00000312397.5	+	7	843	c.751G>T	c.(751-753)Gcc>Tcc	p.A251S		NM_005146.4	NP_005137.1	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T cells	251					cell cycle arrest (GO:0007050)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of cytotoxic T cell differentiation (GO:0045585)|spliceosomal snRNP assembly (GO:0000387)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CCTGTACAGTGCCCGGGACCT	0.582																																																	0													107.0	99.0	102.0					11																	65733370		2201	4296	6497	SO:0001583	missense	0			AB006198	CCDS31611.1	11q13.1	2009-01-06	2006-12-07		ENSG00000175467	ENSG00000175467			10538	protein-coding gene	gene with protein product	"""small nuclear ribonucleoprotein 110kDa (U4/U6.U5)"""	605941	"""squamous cell carcinoma antigen recognised by T cells"""			9449708	Standard	NM_005146		Approved	Ara1, Snu66, SNRNP110	uc001ogl.3	O43290	OTTHUMG00000166771	ENST00000312397.5:c.751G>T	11.37:g.65733370G>T	ENSP00000310448:p.Ala251Ser		A6NDN1|Q53GB5	Missense_Mutation	SNP	pfam_SART_1	p.A251S	ENST00000312397.5	37	c.751	CCDS31611.1	11	.	.	.	.	.	.	.	.	.	.	G	9.634	1.137266	0.21123	.	.	ENSG00000175467	ENST00000312397;ENST00000542816	T	0.20598	2.06	3.95	3.95	0.45737	.	0.154695	0.42821	D	0.000644	T	0.10551	0.0258	N	0.04705	-0.18	0.38254	D	0.94168	B;B	0.25563	0.129;0.051	B;B	0.26094	0.033;0.066	T	0.10660	-1.0620	10	0.87932	D	0	-10.0867	8.8807	0.35374	0.0:0.0:0.777:0.223	.	93;251	B4DMR4;O43290	.;SNUT1_HUMAN	S	251;93	ENSP00000310448:A251S	ENSP00000310448:A251S	A	+	1	0	SART1	65489946	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	3.590000	0.53979	2.048000	0.60808	0.313000	0.20887	GCC	SART1	-	pfam_SART_1	ENSG00000175467		0.582	SART1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SART1	HGNC	protein_coding	OTTHUMT00000391409.1	-	0.00	45	0	G			65733370	+1	tier1	-	no_errors	ENST00000312397	ensembl	human	known	74_37	missense	10.87	40	5	SNP	0.998	T
SCAMP2	10066	genome.wustl.edu	37	15	75165585	75165585	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:75165585G>T	ENST00000268099.9	-	1	121	c.12C>A	c.(10-12)ttC>ttA	p.F4L		NM_005697.3	NP_005688.2	O15127	SCAM2_HUMAN	secretory carrier membrane protein 2	4					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|recycling endosome membrane (GO:0055038)|trans-Golgi network membrane (GO:0032588)|transport vesicle (GO:0030133)				kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	9						GGTTGGTGTCGAAAGCCGACA	0.662																																																	0													43.0	39.0	40.0					15																	75165585		2009	3889	5898	SO:0001583	missense	0			AF005038	CCDS10271.1	15q23-q25	2013-02-21			ENSG00000140497	ENSG00000140497		"""Secretory carrier membrane proteins"""	10564	protein-coding gene	gene with protein product		606912				9378760	Standard	NM_005697		Approved		uc002azb.1	O15127	OTTHUMG00000142817	ENST00000268099.9:c.12C>A	15.37:g.75165585G>T	ENSP00000268099:p.Phe4Leu		B2RDF0|Q9BQE8	Missense_Mutation	SNP	pfam_SCAMP	p.F4L	ENST00000268099.9	37	c.12	CCDS10271.1	15	.	.	.	.	.	.	.	.	.	.	G	14.79	2.640225	0.47153	.	.	ENSG00000140497	ENST00000268099;ENST00000543345	T	0.14893	2.47	5.19	2.26	0.28386	.	0.169976	0.52532	D	0.000079	T	0.09774	0.0240	N	0.25286	0.73	0.33373	D	0.573862	B	0.10296	0.003	B	0.13407	0.009	T	0.16394	-1.0404	10	0.23891	T	0.37	.	7.4434	0.27196	0.2734:0.0:0.7266:0.0	.	4	O15127	SCAM2_HUMAN	L	4	ENSP00000268099:F4L	ENSP00000268099:F4L	F	-	3	2	SCAMP2	72952638	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.646000	0.37249	0.786000	0.33708	0.650000	0.86243	TTC	SCAMP2	-	NULL	ENSG00000140497		0.662	SCAMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAMP2	HGNC	protein_coding	OTTHUMT00000286403.3	-	0.00	103	0	G	NM_005697		75165585	-1	tier1	-	no_errors	ENST00000268099	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
SCHIP1	29970	genome.wustl.edu	37	3	159557928	159557928	+	3'UTR	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:159557928C>T	ENST00000483730.1	+	0	80				SCHIP1_ENST00000445224.2_5'UTR|IQCJ-SCHIP1_ENST00000527095.1_Intron|IQCJ-SCHIP1_ENST00000337808.6_Intron|IQCJ-SCHIP1_ENST00000476809.1_Intron|IQCJ-SCHIP1_ENST00000485419.1_Intron|IQCJ-SCHIP1_ENST00000460298.1_Intron|IQCJ-SCHIP1_ENST00000412423.2_Intron			Q9P0W5	SCHI1_HUMAN	schwannomin interacting protein 1							cytoplasm (GO:0005737)	identical protein binding (GO:0042802)			breast(1)|central_nervous_system(2)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	14			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			TCCGCAGCCTCGCTCAGCAGT	0.582																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF070614	CCDS3186.1, CCDS56292.1, CCDS56293.1, CCDS56294.1	3q25.32-q25.33	2013-09-23	2001-11-29		ENSG00000151967	ENSG00000151967			15678	protein-coding gene	gene with protein product	"""schwannomin interacting protein 1 variant 2"", ""schwannomin interacting protein 1 variant 1"""		"""schwannomin-interacting protein 1"""			10669747, 8619474, 17045569	Standard	NM_014575		Approved	SCHIP-1		Q9P0W5		ENST00000483730.1:c.*77C>T	3.37:g.159557928C>T			B3KRM0|O75543|Q00P30|Q00P31|Q7Z3Y3|Q8IY83|Q9P0W3|Q9P0W4	RNA	SNP	-	NULL	ENST00000483730.1	37	NULL		3																																																																																			SCHIP1	-	-	ENSG00000151967		0.582	SCHIP1-013	PUTATIVE	basic|exp_conf	processed_transcript	SCHIP1	HGNC	protein_coding	OTTHUMT00000352569.1	-	0.00	38	0	C	NM_014575		159557928	+1	tier1	-	no_errors	ENST00000483730	ensembl	human	putative	74_37	rna	16.67	44	9	SNP	0.963	T
SCN3A	6328	genome.wustl.edu	37	2	165996004	165996004	+	Silent	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:165996004G>A	ENST00000360093.3	-	14	2625	c.2134C>T	c.(2134-2136)Ctg>Ttg	p.L712L	SCN3A_ENST00000409101.3_Silent_p.L663L|SCN3A_ENST00000283254.7_Silent_p.L712L	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	712					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GTGTTGGTCAGAATGCTGGCT	0.428																																																	0													170.0	143.0	152.0					2																	165996004		2203	4300	6503	SO:0001819	synonymous_variant	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.2134C>T	2.37:g.165996004G>A			Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.L712	ENST00000360093.3	37	c.2134		2																																																																																			SCN3A	-	NULL	ENSG00000153253		0.428	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		-	0.00	34	0	G	NM_006922		165996004	-1	tier1	-	no_errors	ENST00000283254	ensembl	human	known	74_37	silent	28.57	20	8	SNP	0.995	A
SCN1A	6323	genome.wustl.edu	37	2	166900304	166900304	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:166900304T>G	ENST00000303395.4	-	11	1917	c.1918A>C	c.(1918-1920)Aag>Cag	p.K640Q	SCN1A_ENST00000423058.2_Missense_Mutation_p.K640Q|AC010127.3_ENST00000599041.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.K640Q|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000595268.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.K640Q			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	640					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTGTGCATCTTCCCATTCGCT	0.532																																																	0													168.0	137.0	148.0					2																	166900304		2203	4300	6503	SO:0001583	missense	0			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.1918A>C	2.37:g.166900304T>G	ENSP00000303540:p.Lys640Gln		E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.K640Q	ENST00000303395.4	37	c.1918	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	T	17.26	3.345703	0.61073	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.92199	-2.99;-2.99;-2.99;-2.99	5.05	5.05	0.67936	Domain of unknown function DUF3451 (1);	0.000000	0.64402	D	0.000001	D	0.95027	0.8390	M	0.91090	3.175	0.45330	D	0.998323	P;P;P	0.50710	0.924;0.938;0.767	P;P;P	0.48982	0.461;0.597;0.505	D	0.96008	0.8999	10	0.87932	D	0	.	15.0904	0.72188	0.0:0.0:0.0:1.0	.	640;640;640	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	Q	640	ENSP00000407030:K640Q;ENSP00000303540:K640Q;ENSP00000364554:K640Q;ENSP00000386312:K640Q	ENSP00000303540:K640Q	K	-	1	0	SCN1A	166608550	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.197000	0.72100	2.026000	0.59711	0.459000	0.35465	AAG	SCN1A	-	pfam_DUF3451	ENSG00000144285		0.532	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	HGNC	protein_coding	OTTHUMT00000102661.1	-	0.00	53	0	T	NM_006920		166900304	-1	tier1	-	no_errors	ENST00000303395	ensembl	human	known	74_37	missense	21.82	43	12	SNP	1.000	G
SEC24A	10802	genome.wustl.edu	37	5	134007577	134007577	+	Splice_Site	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:134007577G>T	ENST00000398844.2	+	4	1105		c.e4+1		SEC24A_ENST00000322887.4_Splice_Site	NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GGCTTATTGGGTGAGATGCTA	0.333																																																	0													137.0	120.0	125.0					5																	134007577		1833	4092	5925	SO:0001630	splice_region_variant	0			AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.817+1G>T	5.37:g.134007577G>T			A8MVW3|Q8WUV2|Q96GP7	Splice_Site	SNP	-	e4+1	ENST00000398844.2	37	c.817+1	CCDS43363.1	5	.	.	.	.	.	.	.	.	.	.	G	21.5	4.157015	0.78114	.	.	ENSG00000113615	ENST00000398844;ENST00000322887	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0754	0.86585	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SEC24A	134035476	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.029000	0.70895	2.464000	0.83262	0.591000	0.81541	.	SEC24A	-	-	ENSG00000113615		0.333	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24A	HGNC	protein_coding	OTTHUMT00000371563.1		0.00	28	0	G		Intron	134007577	+1			no_errors	ENST00000398844	ensembl	human	known	74_37	splice_site	9.52	38	4	SNP	1.000	T
COA7	65260	genome.wustl.edu	37	1	53153409	53153409	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:53153409G>T	ENST00000371538.3	-	3	718	c.679C>A	c.(679-681)Ccc>Acc	p.P227T	SELRC1_ENST00000486918.1_5'UTR	NM_023077.2	NP_075565.2												p.P227S(1)		breast(1)|lung(3)|prostate(1)|urinary_tract(1)	6						AATGTTAAGGGTTGGACACCT	0.522																																																	1	Substitution - Missense(1)	lung(1)											149.0	131.0	137.0					1																	53153409		2203	4300	6503	SO:0001583	missense	0																														ENST00000371538.3:c.679C>A	1.37:g.53153409G>T	ENSP00000360593:p.Pro227Thr			Missense_Mutation	SNP	pfam_Sel1-like,smart_Sel1-like	p.P227T	ENST00000371538.3	37	c.679	CCDS570.1	1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.059105	0.00390	.	.	ENSG00000162377	ENST00000371538	T	0.41065	1.01	5.55	3.68	0.42216	.	0.188173	0.49305	D	0.000157	T	0.22975	0.0555	N	0.19112	0.55	0.23903	N	0.996517	B	0.17038	0.02	B	0.11329	0.006	T	0.16660	-1.0395	10	0.12103	T	0.63	-16.8545	7.9473	0.29993	0.2696:0.0:0.7304:0.0	.	227	Q96BR5	SELR1_HUMAN	T	227	ENSP00000360593:P227T	ENSP00000360593:P227T	P	-	1	0	SELRC1	52925997	0.998000	0.40836	0.279000	0.24732	0.083000	0.17756	2.782000	0.47758	1.363000	0.46019	-0.272000	0.10252	CCC	SELRC1	-	NULL	ENSG00000162377		0.522	SELRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELRC1	HGNC	protein_coding	OTTHUMT00000023462.1		0.00	58	0	G			53153409	-1			no_errors	ENST00000371538	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.625	T
SEMA4F	10505	genome.wustl.edu	37	2	74902360	74902360	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:74902360C>G	ENST00000357877.2	+	10	1370	c.1221C>G	c.(1219-1221)ttC>ttG	p.F407L	SEMA4F_ENST00000473350.1_Intron|SEMA4F_ENST00000339773.5_Missense_Mutation_p.F252L	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	407	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)			biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						TACTCACCTTCATCCGGGACC	0.562											OREG0014721	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													94.0	86.0	88.0					2																	74902360		2203	4300	6503	SO:0001583	missense	0			AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.1221C>G	2.37:g.74902360C>G	ENSP00000350547:p.Phe407Leu	1156	Q542Y7|Q9NS35	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.F407L	ENST00000357877.2	37	c.1221	CCDS1955.1	2	.	.	.	.	.	.	.	.	.	.	C	18.92	3.725847	0.69074	.	.	ENSG00000135622	ENST00000357877;ENST00000339773	T;T	0.34472	1.36;1.36	5.26	1.95	0.26073	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.58278	0.2111	M	0.82630	2.6	0.35484	D	0.798407	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.68469	-0.5400	10	0.87932	D	0	.	9.3551	0.38161	0.0:0.7041:0.0:0.2959	.	252;407	O95754-2;O95754	.;SEM4F_HUMAN	L	407;252	ENSP00000350547:F407L;ENSP00000342675:F252L	ENSP00000342675:F252L	F	+	3	2	SEMA4F	74755868	0.487000	0.25988	1.000000	0.80357	0.953000	0.61014	-0.119000	0.10676	0.589000	0.29677	0.453000	0.30009	TTC	SEMA4F	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000135622		0.562	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4F	HGNC	protein_coding	OTTHUMT00000252214.2	-	0.00	45	0	C	NM_004263		74902360	+1	tier1	-	no_errors	ENST00000357877	ensembl	human	known	74_37	missense	41.94	18	13	SNP	0.999	G
SERPINA1	5265	genome.wustl.edu	37	14	94847363	94847363	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr14:94847363C>G	ENST00000448921.1	-	5	1334	c.762G>C	c.(760-762)caG>caC	p.Q254H	SERPINA1_ENST00000404814.4_Missense_Mutation_p.Q254H|SERPINA1_ENST00000402629.1_Missense_Mutation_p.Q254H|SERPINA1_ENST00000440909.1_Missense_Mutation_p.Q254H|SERPINA1_ENST00000437397.1_Missense_Mutation_p.Q254H|SERPINA1_ENST00000555289.1_5'Flank|SERPINA1_ENST00000393088.4_Missense_Mutation_p.Q254H|SERPINA1_ENST00000355814.4_Missense_Mutation_p.Q254H|SERPINA1_ENST00000393087.4_Missense_Mutation_p.Q254H|SERPINA1_ENST00000449399.3_Missense_Mutation_p.Q254H	NM_001002236.2|NM_001127701.1|NM_001127703.1|NM_001127704.1|NM_001127705.1	NP_001002236.1|NP_001121173.1|NP_001121175.1|NP_001121176.1|NP_001121177.1	P01009	A1AT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1	254					acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of proteolysis (GO:0030162)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)	glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|skin(6)|stomach(1)	24		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		TCTTACAGTGCTGGATGTTAA	0.532																																																	0													128.0	100.0	109.0					14																	94847363		2203	4300	6503	SO:0001583	missense	0			X01683	CCDS9925.1	14q32.1	2014-02-18	2005-08-18		ENSG00000197249	ENSG00000197249		"""Serine (or cysteine) peptidase inhibitors"""	8941	protein-coding gene	gene with protein product	"""protease inhibitor 1 (anti-elastase), alpha-1-antitrypsin"""	107400	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1"""	PI		24172014	Standard	NM_000295		Approved	AAT, A1A, PI1, alpha-1-antitrypsin, A1AT, alpha1AT	uc010aux.3	P01009	OTTHUMG00000150355	ENST00000448921.1:c.762G>C	14.37:g.94847363C>G	ENSP00000416066:p.Gln254His		A6PX14|B2RDQ8|Q0PVP5|Q13672|Q53XB8|Q5U0M1|Q7M4R2|Q86U18|Q86U19|Q96BF9|Q96ES1|Q9P1P0|Q9UCE6|Q9UCM3	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.Q254H	ENST00000448921.1	37	c.762	CCDS9925.1	14	.	.	.	.	.	.	.	.	.	.	C	0.565	-0.843444	0.02671	.	.	ENSG00000197249	ENST00000440909;ENST00000448921;ENST00000437397;ENST00000355814;ENST00000393087;ENST00000393088;ENST00000404814;ENST00000449399;ENST00000402629	D;D;D;D;D;D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24;-2.24;-2.24;-2.24;-2.24;-2.24	5.05	-6.84	0.01687	Serpin domain (3);	2.595080	0.00868	N	0.001994	T	0.58708	0.2141	N	0.00707	-1.245	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.64058	-0.6496	10	0.08179	T	0.78	.	6.8404	0.23959	0.2327:0.5526:0.1217:0.093	.	254;254	P01009-2;P01009	.;A1AT_HUMAN	H	254	ENSP00000390299:Q254H;ENSP00000416066:Q254H;ENSP00000408474:Q254H;ENSP00000348068:Q254H;ENSP00000376802:Q254H;ENSP00000376803:Q254H;ENSP00000385960:Q254H;ENSP00000416354:Q254H;ENSP00000386094:Q254H	ENSP00000348068:Q254H	Q	-	3	2	SERPINA1	93917116	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.836000	0.01690	-0.949000	0.03663	-0.387000	0.06579	CAG	SERPINA1	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000197249		0.532	SERPINA1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA1	HGNC	protein_coding	OTTHUMT00000317768.2	-	0.00	74	0	C	NM_001002235		94847363	-1	tier1	-	no_errors	ENST00000355814	ensembl	human	known	74_37	missense	13.04	40	6	SNP	0.000	G
SETBP1	26040	genome.wustl.edu	37	18	42532361	42532361	+	Missense_Mutation	SNP	G	G	A	rs140544874		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr18:42532361G>A	ENST00000282030.5	+	4	3352	c.3056G>A	c.(3055-3057)cGt>cAt	p.R1019H		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1019						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R965H(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		AAGAAGAAGCGTGGTAGGCCT	0.438									Schinzel-Giedion syndrome																																								1	Substitution - Missense(1)	upper_aerodigestive_tract(1)						G	HIS/ARG	0,4406		0,0,2203	89.0	82.0	85.0		3056	5.8	1.0	18	dbSNP_134	85	1,8599	1.2+/-3.3	0,1,4299	no	missense	SETBP1	NM_015559.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1019/1597	42532361	1,13005	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.3056G>A	18.37:g.42532361G>A	ENSP00000282030:p.Arg1019His		A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	smart_AT_hook_DNA-bd_motif	p.R1019H	ENST00000282030.5	37	c.3056	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	G	19.60	3.857601	0.71834	0.0	1.16E-4	ENSG00000152217	ENST00000282030	D	0.93019	-3.15	5.82	5.82	0.92795	AT hook, DNA-binding motif (1);	0.000000	0.85682	D	0.000000	D	0.94899	0.8351	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95365	0.8459	10	0.87932	D	0	.	20.0893	0.97812	0.0:0.0:1.0:0.0	.	1019	Q9Y6X0	SETBP_HUMAN	H	1019	ENSP00000282030:R1019H	ENSP00000282030:R1019H	R	+	2	0	SETBP1	40786359	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.030000	0.88816	2.761000	0.94854	0.655000	0.94253	CGT	SETBP1	-	smart_AT_hook_DNA-bd_motif	ENSG00000152217		0.438	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4	-	0.00	33	0	G	NM_001130110		42532361	+1	tier1	rs140544874	no_errors	ENST00000282030	ensembl	human	known	74_37	missense	24.62	49	16	SNP	1.000	A
SGCB	6443	genome.wustl.edu	37	4	52895000	52895000	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:52895000G>T	ENST00000381431.5	-	4	739	c.517C>A	c.(517-519)Ccg>Acg	p.P173T	SGCB_ENST00000535450.1_Missense_Mutation_p.P103T	NM_000232.4	NP_000223.1	Q16585	SGCB_HUMAN	sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)	173	Cys-rich.				cardiac muscle cell development (GO:0055013)|muscle fiber development (GO:0048747)|muscle organ development (GO:0007517)|vascular smooth muscle cell development (GO:0097084)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(6)|prostate(1)	17			GBM - Glioblastoma multiforme(4;7.63e-12)|LUSC - Lung squamous cell carcinoma(32;0.00204)			TGAGTCCTCGGGTCAAAAAAC	0.363																																																	0													79.0	78.0	78.0					4																	52895000		2203	4300	6503	SO:0001583	missense	0			U29586	CCDS3488.1	4q12	2014-09-17	2002-08-29		ENSG00000163069	ENSG00000163069			10806	protein-coding gene	gene with protein product		600900	"""sarcoglycan, beta (43kD dystrophin-associated glycoprotein)"""	LGMD2E		8968749	Standard	NM_000232		Approved	SGC, A3b	uc003gzj.2	Q16585	OTTHUMG00000128697	ENST00000381431.5:c.517C>A	4.37:g.52895000G>T	ENSP00000370839:p.Pro173Thr		B7Z635|O00661	Missense_Mutation	SNP	pfam_Sarcoglycan	p.P173T	ENST00000381431.5	37	c.517	CCDS3488.1	4	.	.	.	.	.	.	.	.	.	.	G	22.7	4.323777	0.81580	.	.	ENSG00000163069	ENST00000381431;ENST00000535450	D;D	0.94613	-3.47;-3.47	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.95043	0.8395	M	0.73217	2.22	0.80722	D	1	P;P	0.45634	0.863;0.863	P;P	0.48063	0.565;0.565	D	0.94081	0.7344	10	0.33141	T	0.24	-17.4702	18.0782	0.89435	0.0:0.0:1.0:0.0	.	103;173	B7Z635;Q16585	.;SGCB_HUMAN	T	173;103	ENSP00000370839:P173T;ENSP00000441199:P103T	ENSP00000370839:P173T	P	-	1	0	SGCB	52589757	1.000000	0.71417	0.996000	0.52242	0.552000	0.35366	9.869000	0.99810	2.528000	0.85240	0.655000	0.94253	CCG	SGCB	-	pfam_Sarcoglycan	ENSG00000163069		0.363	SGCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGCB	HGNC	protein_coding	OTTHUMT00000250596.2	-	0.00	44	0	G			52895000	-1	tier1	-	no_errors	ENST00000381431	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
SKAP2	8935	genome.wustl.edu	37	7	26709727	26709727	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:26709727C>G	ENST00000345317.2	-	12	1385	c.1072G>C	c.(1072-1074)Gat>Cat	p.D358H	SKAP2_ENST00000539623.1_Missense_Mutation_p.D186H	NM_003930.3	NP_003921.2	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	358	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				B cell activation (GO:0042113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(3)	17						TCTCAAATATCATACATCTCC	0.368																																																	0													107.0	99.0	102.0					7																	26709727		2203	4300	6503	SO:0001583	missense	0				CCDS5400.1	7p15.2	2013-01-10	2006-09-28	2006-09-28	ENSG00000005020	ENSG00000005020		"""Pleckstrin homology (PH) domain containing"""	15687	protein-coding gene	gene with protein product		605215	"""src family associated phosphoprotein 2"""	SCAP2		9837776, 9755858	Standard	NM_003930		Approved	RA70, SKAP-HOM, SKAP55R, SAPS	uc003syc.3	O75563	OTTHUMG00000023495	ENST00000345317.2:c.1072G>C	7.37:g.26709727C>G	ENSP00000005587:p.Asp358His		A4D173|Q53GP6|Q75MK6|Q75MZ4|Q9UBZ3|Q9UED8	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,prints_SH3_domain	p.D358H	ENST00000345317.2	37	c.1072	CCDS5400.1	7	.	.	.	.	.	.	.	.	.	.	C	20.6	4.012331	0.75046	.	.	ENSG00000005020	ENST00000345317;ENST00000539623;ENST00000535331	T;T	0.32988	1.43;1.43	5.34	5.34	0.76211	Src homology-3 domain (1);	0.161424	0.53938	D	0.000044	T	0.41834	0.1176	N	0.14661	0.345	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.942	T	0.50389	-0.8834	10	0.87932	D	0	-13.1448	19.0511	0.93046	0.0:1.0:0.0:0.0	.	343;358	B7Z5N4;O75563	.;SKAP2_HUMAN	H	358;186;343	ENSP00000005587:D358H;ENSP00000443593:D186H	ENSP00000005587:D358H	D	-	1	0	SKAP2	26676252	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.058000	0.71126	2.512000	0.84698	0.655000	0.94253	GAT	SKAP2	-	pfscan_SH3_domain	ENSG00000005020		0.368	SKAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKAP2	HGNC	protein_coding	OTTHUMT00000214128.1	-	0.00	72	0	C			26709727	-1	tier1	-	no_errors	ENST00000345317	ensembl	human	known	74_37	missense	31.37	70	32	SNP	1.000	G
SKOR2	652991	genome.wustl.edu	37	18	44774974	44774974	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr18:44774974G>T	ENST00000425639.1	-	1	580	c.581C>A	c.(580-582)cCc>cAc	p.P194H	SKOR2_ENST00000400404.1_Missense_Mutation_p.P194H	NM_001278063.1	NP_001264992.1	Q2VWA4	SKOR2_HUMAN	SKI family transcriptional corepressor 2	194					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of cerebellar granule cell precursor proliferation (GO:0021936)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			endometrium(1)	1						CTTGGCGTCGGGCGTGCGGTG	0.592																																																	0																																										SO:0001583	missense	0			AY669508	CCDS62441.1, CCDS74222.1	18q21.1	2011-08-04			ENSG00000215474	ENSG00000215474		"""SKI transcriptional corepressors"""	32695	protein-coding gene	gene with protein product	"""functional smad suppressing element 18"""					16200078, 18522874	Standard	NM_001278063		Approved	CORL2, FUSSEL18, Fussel-18	uc031rif.1	Q2VWA4		ENST00000425639.1:c.581C>A	18.37:g.44774974G>T	ENSP00000414750:p.Pro194His			Missense_Mutation	SNP	pfam_Transform_Ski,pfam_c-SKI_SMAD4-bd_dom,superfamily_DNA-bd_dom_put,superfamily_SAND_dom-like	p.P194H	ENST00000425639.1	37	c.581		18	.	.	.	.	.	.	.	.	.	.	G	18.01	3.526872	0.64860	.	.	ENSG00000215474	ENST00000425639;ENST00000400404	T;D	0.83419	-0.76;-1.72	4.07	3.18	0.36537	.	0.317418	0.21603	U	0.071909	D	0.89619	0.6767	M	0.80616	2.505	0.54753	D	0.999981	D	0.71674	0.998	D	0.63703	0.917	D	0.89643	0.3864	10	0.49607	T	0.09	-8.8213	13.4357	0.61082	0.0:0.0:0.8419:0.1581	.	194	Q2VWA4-2	.	H	194	ENSP00000414750:P194H;ENSP00000383255:P194H	ENSP00000383255:P194H	P	-	2	0	SKOR2	43028972	1.000000	0.71417	0.947000	0.38551	0.987000	0.75469	7.649000	0.83500	1.025000	0.39708	0.555000	0.69702	CCC	SKOR2	-	pfam_c-SKI_SMAD4-bd_dom,superfamily_SAND_dom-like	ENSG00000215474		0.592	SKOR2-002	NOVEL	basic|appris_candidate_longest	protein_coding	SKOR2	HGNC	protein_coding	OTTHUMT00000450685.2	-	0.00	81	0	G	NM_001037802		44774974	-1	tier1	-	no_errors	ENST00000400404	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.998	T
SLC12A7	10723	genome.wustl.edu	37	5	1083966	1083966	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:1083966G>T	ENST00000264930.5	-	8	1066	c.1023C>A	c.(1021-1023)ctC>ctA	p.L341L		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	341					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CGTTGCAGAAGAGGCCCCAGA	0.652																																																	0													84.0	76.0	79.0					5																	1083966		2201	4300	6501	SO:0001819	synonymous_variant	0			AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.1023C>A	5.37:g.1083966G>T			A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Silent	SNP	pfam_AA-permease/SLC12A_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.L341	ENST00000264930.5	37	c.1023	CCDS34129.1	5																																																																																			SLC12A7	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000113504		0.652	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SLC12A7	HGNC	protein_coding	OTTHUMT00000366446.2	-	0.00	99	0	G	NM_006598		1083966	-1	tier1	-	no_errors	ENST00000264930	ensembl	human	known	74_37	silent	5.31	107	6	SNP	1.000	T
SLC16A5	9121	genome.wustl.edu	37	17	73096682	73096682	+	Silent	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:73096682C>T	ENST00000450736.2	+	4	1339	c.924C>T	c.(922-924)ttC>ttT	p.F308F	SLC16A5_ENST00000538213.2_Silent_p.F348F|SLC16A5_ENST00000329783.4_Silent_p.F308F|SLC16A5_ENST00000580123.1_Silent_p.F308F			O15375	MOT6_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 5	308					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	AGTACCTGTTCAGCCTGGCAC	0.607																																																	0													623.0	544.0	571.0					17																	73096682		2203	4300	6503	SO:0001819	synonymous_variant	0			U59299	CCDS11713.1	17q25.1	2013-07-18	2013-07-18		ENSG00000170190	ENSG00000170190		"""Solute carriers"""	10926	protein-coding gene	gene with protein product		603879	"""solute carrier family 16 (monocarboxylic acid transporters), member 5"", ""solute carrier family 16, member 5 (monocarboxylic acid transporter 6)"""			9425115	Standard	NM_004695		Approved	MCT5, MCT6	uc002jmr.4	O15375	OTTHUMG00000179277	ENST00000450736.2:c.924C>T	17.37:g.73096682C>T			B4E288	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.F308	ENST00000450736.2	37	c.924	CCDS11713.1	17																																																																																			SLC16A5	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	ENSG00000170190		0.607	SLC16A5-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC16A5	HGNC	protein_coding	OTTHUMT00000445547.1	-	0.00	28	0	C	NM_004695		73096682	+1	tier1	-	no_errors	ENST00000329783	ensembl	human	known	74_37	silent	12.24	43	6	SNP	0.955	T
SLC25A36	55186	genome.wustl.edu	37	3	140675495	140675495	+	Silent	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:140675495C>G	ENST00000324194.6	+	2	336	c.168C>G	c.(166-168)gtC>gtG	p.V56V	SLC25A36_ENST00000453248.2_Silent_p.V56V|SLC25A36_ENST00000393015.4_3'UTR|SLC25A36_ENST00000507429.1_Silent_p.V56V|SLC25A36_ENST00000446041.2_Silent_p.V56V			Q96CQ1	S2536_HUMAN	solute carrier family 25 (pyrimidine nucleotide carrier ), member 36	56					response to estradiol (GO:0032355)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						GAGCCAGTGTCAACCGAGTAG	0.438																																																	0													139.0	134.0	136.0					3																	140675495		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001480	CCDS3114.1, CCDS46927.1	3q23	2013-05-22	2012-03-29		ENSG00000114120	ENSG00000114120		"""Solute carriers"""	25554	protein-coding gene	gene with protein product			"""solute carrier family 25, member 36"""				Standard	NM_001104647		Approved	FLJ10618, PNC2	uc003etr.2	Q96CQ1	OTTHUMG00000160260	ENST00000324194.6:c.168C>G	3.37:g.140675495C>G			A8MYF7|Q05CY1|Q9H0G8|Q9NVN5	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier,prints_Mit_uncoupling	p.V56	ENST00000324194.6	37	c.168	CCDS46927.1	3																																																																																			SLC25A36	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000114120		0.438	SLC25A36-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A36	HGNC	protein_coding	OTTHUMT00000359929.1	-	0.00	49	0	C	NM_018155		140675495	+1	tier1	-	no_errors	ENST00000324194	ensembl	human	known	74_37	silent	13.25	72	11	SNP	1.000	G
SLC39A6	25800	genome.wustl.edu	37	18	33689687	33689687	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr18:33689687C>A	ENST00000590986.1	-	10	2426	c.2137G>T	c.(2137-2139)Gat>Tat	p.D713Y	SLC39A6_ENST00000269187.5_Missense_Mutation_p.D713Y			Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter), member 6	713					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|lamellipodium membrane (GO:0031258)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	41						TCACTAGCATCATTGTGCAGC	0.328																																																	0													118.0	116.0	116.0					18																	33689687		1825	4083	5908	SO:0001583	missense	0			U41060	CCDS42428.1, CCDS45854.1	18q12.2	2013-05-22				ENSG00000141424		"""Solute carriers"""	18607	protein-coding gene	gene with protein product		608731	"""solute carrier family 39 (metal ion transporter), member 6"""			12659941, 12839489	Standard	NM_012319		Approved	LIV-1	uc010dmy.3	Q13433		ENST00000590986.1:c.2137G>T	18.37:g.33689687C>A	ENSP00000465915:p.Asp713Tyr		B4DR49|B4E224|Q8IXR3|Q96HP5	Missense_Mutation	SNP	pfam_ZIP	p.D713Y	ENST00000590986.1	37	c.2137	CCDS42428.1	18	.	.	.	.	.	.	.	.	.	.	C	27.5	4.834439	0.91036	.	.	ENSG00000141424	ENST00000269187;ENST00000543723	T	0.51817	0.69	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.59101	0.2169	L	0.39245	1.2	0.80722	D	1	P	0.50819	0.939	P	0.60541	0.876	T	0.59643	-0.7416	10	0.72032	D	0.01	-28.6648	17.3058	0.87194	0.0:1.0:0.0:0.0	.	713	Q13433	S39A6_HUMAN	Y	713;368	ENSP00000269187:D713Y	ENSP00000269187:D713Y	D	-	1	0	SLC39A6	31943685	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.850000	0.69473	2.762000	0.94881	0.591000	0.81541	GAT	SLC39A6	-	pfam_ZIP	ENSG00000141424		0.328	SLC39A6-004	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	SLC39A6	HGNC	protein_coding	OTTHUMT00000444136.1	-	0.00	23	0	C			33689687	-1	tier1	-	no_errors	ENST00000269187	ensembl	human	known	74_37	missense	14.71	29	5	SNP	1.000	A
SLC4A10	57282	genome.wustl.edu	37	2	162751319	162751319	+	Missense_Mutation	SNP	A	A	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:162751319A>C	ENST00000446997.1	+	11	1418	c.1325A>C	c.(1324-1326)aAa>aCa	p.K442T	SLC4A10_ENST00000272716.5_Missense_Mutation_p.K412T|SLC4A10_ENST00000535165.1_3'UTR|SLC4A10_ENST00000493021.1_3'UTR|SLC4A10_ENST00000415876.2_Missense_Mutation_p.K412T|SLC4A10_ENST00000375514.5_Missense_Mutation_p.K423T|SLC4A10_ENST00000421911.1_Missense_Mutation_p.K442T	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	442					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	GAGCCTCCCAAAAATGTTCCT	0.328																																																	0													114.0	106.0	108.0					2																	162751319		1808	4075	5883	SO:0001583	missense	0				CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.1325A>C	2.37:g.162751319A>C	ENSP00000393066:p.Lys442Thr		B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.K442T	ENST00000446997.1	37	c.1325	CCDS54411.1	2	.	.	.	.	.	.	.	.	.	.	A	23.7	4.451266	0.84209	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	T;T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32;-1.32	5.37	5.37	0.77165	Bicarbonate transporter, cytoplasmic (1);Phosphotransferase/anion transporter (1);	0.000000	0.85682	D	0.000000	D	0.90349	0.6980	M	0.84511	2.7	0.80722	D	1	D;P;D;D	0.89917	1.0;0.786;1.0;0.996	D;P;D;P	0.97110	1.0;0.627;1.0;0.807	D	0.91167	0.4965	10	0.51188	T	0.08	.	15.6669	0.77236	1.0:0.0:0.0:0.0	.	423;442;412;442	F8W675;E7EW28;Q6U841-2;Q6U841	.;.;.;S4A10_HUMAN	T	423;412;412;411;442;442;441	ENSP00000364664:K423T;ENSP00000395797:K412T;ENSP00000272716:K412T;ENSP00000393066:K442T;ENSP00000404486:K442T	ENSP00000272716:K412T	K	+	2	0	SLC4A10	162459565	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.287000	0.95975	2.170000	0.68504	0.533000	0.62120	AAA	SLC4A10	-	superfamily_PTrfase/Anion_transptr,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	ENSG00000144290		0.328	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC4A10	HGNC	protein_coding	OTTHUMT00000333090.1	-	0.00	41	0	A	NM_022058		162751319	+1	tier1	-	no_errors	ENST00000446997	ensembl	human	known	74_37	missense	13.21	46	7	SNP	1.000	C
SLC40A1	30061	genome.wustl.edu	37	2	190428330	190428330	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:190428330C>T	ENST00000261024.2	-	7	1808	c.1382G>A	c.(1381-1383)gGc>gAc	p.G461D		NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1	461					anatomical structure morphogenesis (GO:0009653)|cellular iron ion homeostasis (GO:0006879)|endothelium development (GO:0003158)|iron ion transmembrane transport (GO:0034755)|lymphocyte homeostasis (GO:0002260)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of apoptotic process (GO:0043066)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|spleen trabecula formation (GO:0060345)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	iron ion transmembrane transporter activity (GO:0005381)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			AGCAATGACGCCTGCAAACAG	0.358																																																	0													63.0	65.0	65.0					2																	190428330		2203	4300	6503	SO:0001583	missense	0			AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449		"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3		10828623	Standard	NM_014585		Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.1382G>A	2.37:g.190428330C>T	ENSP00000261024:p.Gly461Asp		Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	Missense_Mutation	SNP	pfam_Ferroportin-1,superfamily_MFS_dom_general_subst_transpt	p.G461D	ENST00000261024.2	37	c.1382	CCDS2299.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.397144	0.96009	.	.	ENSG00000138449	ENST00000261024	D	0.95690	-3.78	6.02	6.02	0.97574	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.98102	0.9374	M	0.86953	2.85	0.80722	D	1	D	0.65815	0.995	D	0.72075	0.976	D	0.98095	1.0411	10	0.66056	D	0.02	-20.1984	20.5373	0.99239	0.0:1.0:0.0:0.0	.	461	Q9NP59	S40A1_HUMAN	D	461	ENSP00000261024:G461D	ENSP00000261024:G461D	G	-	2	0	SLC40A1	190136575	1.000000	0.71417	0.990000	0.47175	0.989000	0.77384	7.804000	0.85993	2.857000	0.98124	0.650000	0.86243	GGC	SLC40A1	-	pfam_Ferroportin-1,superfamily_MFS_dom_general_subst_transpt	ENSG00000138449		0.358	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC40A1	HGNC	protein_coding	OTTHUMT00000255916.2		0.00	39	0	C			190428330	-1			no_errors	ENST00000261024	ensembl	human	known	74_37	missense	8.70	21	2	SNP	1.000	T
SLC7A14	57709	genome.wustl.edu	37	3	170198910	170198910	+	Silent	SNP	G	G	A	rs375259922		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:170198910G>A	ENST00000231706.5	-	7	1476	c.1161C>T	c.(1159-1161)gcC>gcT	p.A387A	CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	387					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			ACACGATGCAGGCCACCACTG	0.592																																																	0								G		0,4406		0,0,2203	44.0	38.0	40.0		1161	2.4	1.0	3		40	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC7A14	NM_020949.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		387/772	170198910	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1161C>T	3.37:g.170198910G>A			B3KV33|Q9HCF9	Silent	SNP	pfam_AA-permease/SLC12A_dom	p.A387	ENST00000231706.5	37	c.1161	CCDS33892.1	3																																																																																			SLC7A14	-	pfam_AA-permease/SLC12A_dom	ENSG00000013293		0.592	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A14	HGNC	protein_coding	OTTHUMT00000352598.2	-	0.00	19	0	G	NM_020949		170198910	-1	tier1	-	no_errors	ENST00000231706	ensembl	human	known	74_37	silent	28.21	28	11	SNP	1.000	A
SLC7A3	84889	genome.wustl.edu	37	X	70148789	70148789	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chrX:70148789G>C	ENST00000374299.3	-	3	578	c.434C>G	c.(433-435)tCt>tGt	p.S145C	SLC7A3_ENST00000298085.4_Missense_Mutation_p.S145C			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	145					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CAGAGTCTTAGAGATGTGGTT	0.542																																																	0													65.0	59.0	61.0					X																	70148789		2203	4300	6503	SO:0001583	missense	0			AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.434C>G	X.37:g.70148789G>C	ENSP00000363417:p.Ser145Cys		D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease	p.S145C	ENST00000374299.3	37	c.434	CCDS14404.1	X	.	.	.	.	.	.	.	.	.	.	G	15.07	2.725405	0.48833	.	.	ENSG00000165349	ENST00000374299;ENST00000298085	D;D	0.90197	-2.63;-2.63	5.16	5.16	0.70880	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.96334	0.8804	M	0.92555	3.32	0.54753	D	0.999987	D	0.67145	0.996	D	0.72075	0.976	D	0.97220	0.9877	10	0.72032	D	0.01	.	16.6231	0.84935	0.0:0.0:1.0:0.0	.	145	Q8WY07	CTR3_HUMAN	C	145	ENSP00000363417:S145C;ENSP00000298085:S145C	ENSP00000298085:S145C	S	-	2	0	SLC7A3	70065514	1.000000	0.71417	0.918000	0.36340	0.153000	0.21895	4.405000	0.59741	2.388000	0.81334	0.436000	0.28706	TCT	SLC7A3	-	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease	ENSG00000165349		0.542	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A3	HGNC	protein_coding	OTTHUMT00000057080.1	-	0.00	22	0	G	NM_032803		70148789	-1	tier1	-	no_errors	ENST00000298085	ensembl	human	known	74_37	missense	35.29	11	6	SNP	0.997	C
SLC9A6	10479	genome.wustl.edu	37	X	135098866	135098866	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chrX:135098866G>T	ENST00000370698.3	+	10	1238	c.1203G>T	c.(1201-1203)ctG>ctT	p.L401L	SLC9A6_ENST00000370701.1_Silent_p.L381L|SLC9A6_ENST00000370695.4_Silent_p.L433L	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	401					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					GGCTGACACTGTTCACCTTCC	0.328																																																	0													130.0	111.0	117.0					X																	135098866		2203	4300	6503	SO:0001819	synonymous_variant	0			AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.1203G>T	X.37:g.135098866G>T			A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Silent	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_6,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.L433	ENST00000370698.3	37	c.1299	CCDS14654.1	X																																																																																			SLC9A6	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000198689		0.328	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	SLC9A6	HGNC	protein_coding	OTTHUMT00000058450.1	-	0.00	33	0	G	NM_006359		135098866	+1	tier1	-	no_errors	ENST00000370695	ensembl	human	known	74_37	silent	11.76	30	4	SNP	0.955	T
SLCO1B3	28234	genome.wustl.edu	37	12	21028192	21028192	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:21028192G>C	ENST00000381545.3	+	9	970	c.751G>C	c.(751-753)Gac>Cac	p.D251H	SLCO1B3_ENST00000553473.1_Missense_Mutation_p.D251H|SLCO1B3_ENST00000261196.2_Missense_Mutation_p.D251H|SLCO1B7_ENST00000554957.1_Intron|LST3_ENST00000381541.3_Intron|LST3_ENST00000540229.1_Missense_Mutation_p.D251H	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	251					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.D251N(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	AACTCCTAAGGACTCTCGTTG	0.373																																																	1	Substitution - Missense(1)	skin(1)											229.0	232.0	231.0					12																	21028192		2203	4300	6503	SO:0001583	missense	0				CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.751G>C	12.37:g.21028192G>C	ENSP00000370956:p.Asp251His		E7EMT8|Q5JAR4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.D251H	ENST00000381545.3	37	c.751	CCDS8684.1	12	.	.	.	.	.	.	.	.	.	.	.	13.55	2.269220	0.40095	.	.	ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000257046	ENST00000540853;ENST00000261196;ENST00000381545;ENST00000553473;ENST00000544370;ENST00000540229	T;T;T;T;T;T	0.62498	0.02;0.02;0.02;0.02;0.02;0.02	3.92	3.92	0.45320	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.80670	0.4667	M	0.87758	2.905	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.996;0.996	D	0.84761	0.0762	10	0.87932	D	0	.	13.8538	0.63513	0.0:0.0:1.0:0.0	.	251;251;251	Q5JAR4;B3KP78;Q9NPD5	.;.;SO1B3_HUMAN	H	251;251;251;251;75;251	ENSP00000442000:D251H;ENSP00000261196:D251H;ENSP00000370956:D251H;ENSP00000451758:D251H;ENSP00000443225:D75H;ENSP00000441269:D251H	ENSP00000441269:D251H	D	+	1	0	SLCO1B3;RP11-545J16.1	20919459	1.000000	0.71417	0.766000	0.31476	0.009000	0.06853	7.370000	0.79589	2.034000	0.60081	0.461000	0.40582	GAC	SLCO1B3	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000111700		0.373	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	SLCO1B3	HGNC	protein_coding	OTTHUMT00000401936.1	-	0.00	154	0	G	NM_019844		21028192	+1	tier1	-	no_errors	ENST00000553473	ensembl	human	known	74_37	missense	30.69	130	58	SNP	0.957	C
SLCO4C1	353189	genome.wustl.edu	37	5	101592993	101592993	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:101592993G>A	ENST00000310954.6	-	8	1581	c.1295C>T	c.(1294-1296)gCt>gTt	p.A432V		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1											breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		ACCGAGAGCAGCTCCAGGAAT	0.363																																																	0													59.0	61.0	60.0					5																	101592993		2203	4300	6503	SO:0001583	missense	0			AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.1295C>T	5.37:g.101592993G>A	ENSP00000309741:p.Ala432Val			Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.A432V	ENST00000310954.6	37	c.1295	CCDS34205.1	5	.	.	.	.	.	.	.	.	.	.	G	28.7	4.942701	0.92526	.	.	ENSG00000173930	ENST00000310954	D	0.81579	-1.51	5.78	5.78	0.91487	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.64402	D	0.000003	D	0.84669	0.5523	L	0.58101	1.795	0.47905	D	0.999549	P	0.42649	0.786	P	0.52031	0.688	T	0.79264	-0.1875	10	0.15952	T	0.53	.	19.9918	0.97368	0.0:0.0:1.0:0.0	.	432	Q6ZQN7	SO4C1_HUMAN	V	432	ENSP00000309741:A432V	ENSP00000309741:A432V	A	-	2	0	SLCO4C1	101620892	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	6.960000	0.76036	2.728000	0.93425	0.585000	0.79938	GCT	SLCO4C1	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000173930		0.363	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO4C1	HGNC	protein_coding	OTTHUMT00000370332.1	-	0.00	37	0	G	NM_180991		101592993	-1	tier1	-	no_errors	ENST00000310954	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	A
SMC4	10051	genome.wustl.edu	37	3	160135727	160135727	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:160135727G>C	ENST00000357388.3	+	11	2105	c.1654G>C	c.(1654-1656)Gaa>Caa	p.E552Q	SMC4_ENST00000462787.1_Missense_Mutation_p.E552Q|SMC4_ENST00000469762.1_Missense_Mutation_p.E527Q|SMC4_ENST00000344722.5_Missense_Mutation_p.E552Q|SMC4_ENST00000360111.2_Missense_Mutation_p.E552Q|RP11-432B6.3_ENST00000483754.1_Intron	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	552					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CCCTCAAACTGAACAAGAATT	0.378																																																	0													41.0	43.0	42.0					3																	160135727		2201	4298	6499	SO:0001583	missense	0			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.1654G>C	3.37:g.160135727G>C	ENSP00000349961:p.Glu552Gln		A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,superfamily_Chemotax_Me-accpt_rcpt_lig-bd,superfamily_Prefoldin,smart_SMC_hinge	p.E552Q	ENST00000357388.3	37	c.1654	CCDS3189.1	3	.	.	.	.	.	.	.	.	.	.	G	19.08	3.756955	0.69648	.	.	ENSG00000113810	ENST00000357388;ENST00000360111;ENST00000469762;ENST00000462787;ENST00000344722;ENST00000545277	D;D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9;-1.9	5.73	4.85	0.62838	RecF/RecN/SMC (1);	0.139459	0.64402	N	0.000005	D	0.84745	0.5540	M	0.64567	1.98	0.49389	D	0.999785	B;B;B;B	0.17038	0.016;0.001;0.003;0.02	B;B;B;B	0.29077	0.048;0.035;0.028;0.098	T	0.80511	-0.1350	10	0.32370	T	0.25	-15.0375	16.4124	0.83723	0.0:0.136:0.864:0.0	.	552;527;527;552	Q9NTJ3-2;B3KXX5;E9PD53;Q9NTJ3	.;.;.;SMC4_HUMAN	Q	552;552;527;552;552;146	ENSP00000349961:E552Q;ENSP00000353225:E552Q;ENSP00000417964:E527Q;ENSP00000420734:E552Q;ENSP00000341382:E552Q	ENSP00000341382:E552Q	E	+	1	0	SMC4	161618421	1.000000	0.71417	0.010000	0.14722	0.734000	0.41952	6.114000	0.71560	1.378000	0.46305	0.650000	0.86243	GAA	SMC4	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	ENSG00000113810		0.378	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC4	HGNC	protein_coding	OTTHUMT00000352862.1		0.00	19	0	G			160135727	+1			no_errors	ENST00000344722	ensembl	human	known	74_37	missense	11.90	37	5	SNP	0.906	C
SMYD1	150572	genome.wustl.edu	37	2	88405881	88405881	+	Missense_Mutation	SNP	A	A	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:88405881A>C	ENST00000419482.2	+	8	1104	c.1019A>C	c.(1018-1020)gAg>gCg	p.E340A	SMYD1_ENST00000438570.1_Intron|SMYD1_ENST00000444564.2_Missense_Mutation_p.E327A	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	340					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						GAGAAGCAGGAGCCAGTGTTT	0.517																																																	0													163.0	121.0	136.0					2																	88405881		2203	4300	6503	SO:0001583	missense	0			AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.1019A>C	2.37:g.88405881A>C	ENSP00000393453:p.Glu340Ala		A0AV30|A6NE13	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_MYND,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_MYND	p.E340A	ENST00000419482.2	37	c.1019	CCDS33240.1	2	.	.	.	.	.	.	.	.	.	.	A	16.83	3.229924	0.58777	.	.	ENSG00000115593	ENST00000419482;ENST00000444564;ENST00000295833	T;T	0.24908	1.83;1.87	5.03	5.03	0.67393	.	0.237949	0.49305	D	0.000159	T	0.28764	0.0713	M	0.65975	2.015	0.80722	D	1	B	0.13145	0.007	B	0.17433	0.018	T	0.06215	-1.0839	10	0.23302	T	0.38	-14.3319	14.2602	0.66080	1.0:0.0:0.0:0.0	.	340	Q8NB12	SMYD1_HUMAN	A	340;327;161	ENSP00000393453:E340A;ENSP00000407888:E327A	ENSP00000295833:E161A	E	+	2	0	SMYD1	88186996	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	8.332000	0.90024	2.016000	0.59253	0.433000	0.28618	GAG	SMYD1	-	NULL	ENSG00000115593		0.517	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD1	HGNC	protein_coding	OTTHUMT00000338229.2	-	0.00	81	0	A	XM_097915		88405881	+1	tier1	-	no_errors	ENST00000419482	ensembl	human	known	74_37	missense	8.86	72	7	SNP	1.000	C
SMYD4	114826	genome.wustl.edu	37	17	1703288	1703288	+	Missense_Mutation	SNP	A	A	G	rs534023803	byFrequency	TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:1703288A>G	ENST00000305513.7	-	5	1567	c.1400T>C	c.(1399-1401)aTt>aCt	p.I467T		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	467	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						GGAGTTCACAATCCTCTCAGT	0.498													A|||	16	0.00319489	0.0	0.0	5008	,	,		20403	0.001		0.0	False		,,,				2504	0.0153																0													103.0	80.0	88.0					17																	1703288		2203	4300	6503	SO:0001583	missense	0			AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.1400T>C	17.37:g.1703288A>G	ENSP00000304360:p.Ile467Thr		Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_MYND,pfscan_SET_dom,pfscan_Znf_MYND	p.I467T	ENST00000305513.7	37	c.1400	CCDS11013.1	17	.	.	.	.	.	.	.	.	.	.	a	4.793	0.147376	0.09134	.	.	ENSG00000186532	ENST00000305513	T	0.09630	2.96	5.25	-10.5	0.00291	SET domain (2);	20.420000	0.02051	U	0.050095	T	0.04182	0.0116	N	0.14661	0.345	0.09310	N	1	B	0.18013	0.025	B	0.04013	0.001	T	0.30387	-0.9980	10	0.22706	T	0.39	.	1.8358	0.03139	0.1498:0.2013:0.2956:0.3533	.	467	Q8IYR2	SMYD4_HUMAN	T	467	ENSP00000304360:I467T	ENSP00000304360:I467T	I	-	2	0	SMYD4	1650038	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.404000	0.02494	-1.795000	0.01255	-1.625000	0.00788	ATT	SMYD4	-	pfam_SET_dom	ENSG00000186532		0.498	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD4	HGNC	protein_coding	OTTHUMT00000207108.4	-	0.00	41	0	A	XM_056082		1703288	-1	tier1	-	no_errors	ENST00000305513	ensembl	human	known	74_37	missense	34.09	29	15	SNP	0.000	G
SNRPG	6637	genome.wustl.edu	37	2	70514409	70514409	+	Intron	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:70514409G>T	ENST00000272348.2	-	3	302				SNRPG_ENST00000413456.2_Intron|SNRPG_ENST00000454893.1_Missense_Mutation_p.T92N|SNRPG_ENST00000449935.2_Intron|SNRPG_ENST00000438261.1_Intron|SNRPG_ENST00000482975.2_Intron|SNRPG_ENST00000429728.1_Intron	NM_003096.2	NP_003087.1	P62308	RUXG_HUMAN	small nuclear ribonucleoprotein polypeptide G						gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	poly(A) RNA binding (GO:0044822)			endometrium(1)	1						CTCCTTGGAGGTCTTTATGCT	0.338																																					NSCLC(57;761 1258 15082 39958 48415)												0																																										SO:0001627	intron_variant	0			X85373	CCDS1903.1	2p13.3	2011-10-11			ENSG00000143977	ENSG00000143977			11163	protein-coding gene	gene with protein product		603542				7744013	Standard	NM_003096		Approved	Sm-G	uc002sgp.3	P62308	OTTHUMG00000129670	ENST00000272348.2:c.180+790C>A	2.37:g.70514409G>T			D6W5G6|Q15357|Q6IB86	Missense_Mutation	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	p.T92N	ENST00000272348.2	37	c.275	CCDS1903.1	2	.	.	.	.	.	.	.	.	.	.	G	8.687	0.906551	0.17833	.	.	ENSG00000143977	ENST00000454893	.	.	.	2.05	1.13	0.20643	.	.	.	.	.	T	0.39253	0.1071	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36212	-0.9757	5	0.87932	D	0	.	5.7372	0.18073	0.0:0.0:0.6819:0.318	.	.	.	.	N	92	.	ENSP00000393388:T92N	T	-	2	0	SNRPG	70367913	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	-0.327000	0.07955	0.437000	0.26423	0.467000	0.42956	ACC	SNRPG	-	NULL	ENSG00000143977		0.338	SNRPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRPG	HGNC	protein_coding	OTTHUMT00000251871.2	-	0.00	27	0	G			70514409	-1	tier1	-	no_errors	ENST00000454893	ensembl	human	putative	74_37	missense	6.94	67	5	SNP	0.002	T
SNX29	92017	genome.wustl.edu	37	16	12571616	12571616	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr16:12571616G>T	ENST00000566228.1	+	19	2147	c.2078G>T	c.(2077-2079)cGc>cTc	p.R693L	SNX29_ENST00000323433.4_Missense_Mutation_p.R308L|SNX29_ENST00000306030.3_Missense_Mutation_p.R308L	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	693	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.					extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)	p.R308L(2)		endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						AATATTTATCGCCGGTATACA	0.403																																																	2	Substitution - Missense(2)	lung(2)											70.0	67.0	68.0					16																	12571616		1872	4102	5974	SO:0001583	missense	0			AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.2078G>T	16.37:g.12571616G>T	ENSP00000456480:p.Arg693Leu		B5MDW2|Q8N2X2|Q9HA26	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.R308L	ENST00000566228.1	37	c.923	CCDS10553.2	16	.	.	.	.	.	.	.	.	.	.	G	25.3	4.628264	0.87560	.	.	ENSG00000048471	ENST00000306030;ENST00000323433	T;T	0.66099	-0.19;-0.19	5.73	5.73	0.89815	.	0.066079	0.64402	D	0.000014	D	0.86104	0.5853	H	0.96208	3.785	0.37812	D	0.928098	.	.	.	.	.	.	D	0.91292	0.5060	8	0.87932	D	0	-21.6809	17.3886	0.87424	0.0:0.0:1.0:0.0	.	.	.	.	L	308	ENSP00000306940:R308L;ENSP00000322226:R308L	ENSP00000306940:R308L	R	+	2	0	SNX29	12479117	1.000000	0.71417	0.636000	0.29352	0.710000	0.40934	9.236000	0.95360	2.699000	0.92147	0.655000	0.94253	CGC	SNX29	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000048471		0.403	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SNX29	HGNC	protein_coding	OTTHUMT00000422622.1		0.00	40	0	G			12571616	+1			no_errors	ENST00000306030	ensembl	human	known	74_37	missense	5.77	49	3	SNP	0.962	T
SPANXN3	139067	genome.wustl.edu	37	X	142596676	142596676	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chrX:142596676C>G	ENST00000370503.2	-	2	477	c.394G>C	c.(394-396)Gaa>Caa	p.E132Q	GS1-256O22.5_ENST00000431432.1_RNA	NM_001009609.2	NP_001009609.1	Q5MJ09	SPXN3_HUMAN	SPANX family, member N3	132										endometrium(1)|large_intestine(1)|lung(9)|ovary(2)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;6.56e-05)					GAAGATCCTTCAGATAAGCCT	0.448																																																	0													140.0	114.0	123.0					X																	142596676		2203	4300	6503	SO:0001583	missense	0				CCDS35418.1	Xq27.3	2012-06-12			ENSG00000189252	ENSG00000189252			33176	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 8"""	300666				14973187, 17012309	Standard	NM_001009609		Approved	SPANX-N3, CT11.8	uc004fbw.3	Q5MJ09	OTTHUMG00000022582	ENST00000370503.2:c.394G>C	X.37:g.142596676C>G	ENSP00000359534:p.Glu132Gln		Q0ZNK4	Missense_Mutation	SNP	pfam_SPANX_prot	p.E132Q	ENST00000370503.2	37	c.394	CCDS35418.1	X	.	.	.	.	.	.	.	.	.	.	c	8.606	0.888082	0.17540	.	.	ENSG00000189252	ENST00000370503	T	0.11604	2.76	0.498	0.498	0.16908	.	.	.	.	.	T	0.17662	0.0424	L	0.43152	1.355	0.09310	N	1	D	0.57571	0.98	P	0.59424	0.857	T	0.13282	-1.0515	8	0.46703	T	0.11	.	.	.	.	.	132	Q5MJ09	SPXN3_HUMAN	Q	132	ENSP00000359534:E132Q	ENSP00000359534:E132Q	E	-	1	0	SPANXN3	142424342	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	-1.162000	0.03141	0.507000	0.28148	0.368000	0.22195	GAA	SPANXN3	-	NULL	ENSG00000189252		0.448	SPANXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXN3	HGNC	protein_coding	OTTHUMT00000058620.2	-	0.00	47	0	C	NM_001009609		142596676	-1	tier1	-	no_errors	ENST00000370503	ensembl	human	known	74_37	missense	29.79	33	14	SNP	0.002	G
SPATA17	128153	genome.wustl.edu	37	1	217856693	217856693	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:217856693G>A	ENST00000366933.4	+	5	440	c.385G>A	c.(385-387)Gat>Aat	p.D129N		NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	129						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		AGAGACCAATGATGCAATTAG	0.343																																																	0													90.0	104.0	100.0					1																	217856693		2200	4300	6500	SO:0001583	missense	0			AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.385G>A	1.37:g.217856693G>A	ENSP00000355900:p.Asp129Asn		A5D6N2	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.D129N	ENST00000366933.4	37	c.385	CCDS1519.1	1	.	.	.	.	.	.	.	.	.	.	G	13.38	2.220358	0.39201	.	.	ENSG00000162814	ENST00000366933	T	0.43688	0.94	5.43	4.46	0.54185	.	0.364852	0.30036	N	0.010575	T	0.31918	0.0812	L	0.35723	1.085	0.33129	D	0.542786	B	0.11235	0.004	B	0.08055	0.003	T	0.34004	-0.9846	10	0.33940	T	0.23	-5.0851	11.2949	0.49272	0.0747:0.14:0.7853:0.0	.	129	Q96L03	SPT17_HUMAN	N	129	ENSP00000355900:D129N	ENSP00000355900:D129N	D	+	1	0	SPATA17	215923316	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	4.808000	0.62583	2.537000	0.85549	0.555000	0.69702	GAT	SPATA17	-	NULL	ENSG00000162814		0.343	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA17	HGNC	protein_coding	OTTHUMT00000092433.2	-	0.00	32	0	G	NM_138796		217856693	+1	tier1	-	no_errors	ENST00000366933	ensembl	human	known	74_37	missense	12.50	35	5	SNP	1.000	A
SPATA9	83890	genome.wustl.edu	37	5	95018302	95018302	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:95018302G>T	ENST00000274432.8	-	2	221	c.80C>A	c.(79-81)gCa>gAa	p.A27E	RFESD_ENST00000508206.1_Intron|SPATA9_ENST00000395899.3_Missense_Mutation_p.A27E|SPATA9_ENST00000477047.2_5'UTR	NM_031952.3	NP_114158.2	Q9BWV2	SPAT9_HUMAN	spermatogenesis associated 9	27					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)	7		all_cancers(142;1.28e-06)|all_epithelial(76;1.55e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.91e-16)		GTCCATGATTGCTTTCTGGAT	0.338																																																	0													97.0	100.0	99.0					5																	95018302		2203	4300	6503	SO:0001583	missense	0			AK093225	CCDS4076.1	5q15	2008-02-05			ENSG00000145757	ENSG00000145757			22988	protein-coding gene	gene with protein product		608039				12493713	Standard	NM_031952		Approved	NYD-SP16, FLJ35906	uc003klj.1	Q9BWV2	OTTHUMG00000121169	ENST00000274432.8:c.80C>A	5.37:g.95018302G>T	ENSP00000274432:p.Ala27Glu		A8K8H3|Q4G122|Q86X33|Q8NA28	Missense_Mutation	SNP	NULL	p.A27E	ENST00000274432.8	37	c.80	CCDS4076.1	5	.	.	.	.	.	.	.	.	.	.	G	10.63	1.403129	0.25291	.	.	ENSG00000145757	ENST00000274432;ENST00000395899	T	0.53640	0.61	4.7	-5.77	0.02369	.	1.133940	0.06768	N	0.782990	T	0.36468	0.0968	N	0.24115	0.695	0.20563	N	0.999883	P	0.35908	0.527	B	0.38954	0.286	T	0.48559	-0.9025	10	0.72032	D	0.01	0.0487	14.0309	0.64615	0.7658:0.0:0.2342:0.0	.	27	Q9BWV2	SPAT9_HUMAN	E	27	ENSP00000274432:A27E	ENSP00000274432:A27E	A	-	2	0	SPATA9	95044058	0.045000	0.20229	0.074000	0.20217	0.975000	0.68041	-0.805000	0.04530	-1.941000	0.01042	-1.012000	0.02466	GCA	SPATA9	-	NULL	ENSG00000145757		0.338	SPATA9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA9	HGNC	protein_coding	OTTHUMT00000304036.1	-	0.00	46	0	G	NM_031952		95018302	-1	tier1	-	no_errors	ENST00000274432	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.149	T
SPDL1	54908	genome.wustl.edu	37	5	169021623	169021623	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:169021623G>T	ENST00000265295.4	+	7	1108	c.829G>T	c.(829-831)Gtc>Ttc	p.V277F	SPDL1_ENST00000510751.1_3'UTR	NM_017785.4	NP_060255.3			spindle apparatus coiled-coil protein 1																		CAGTATGAAAGTCAAGTATCA	0.333																																																	0													119.0	113.0	115.0					5																	169021623		2203	4300	6503	SO:0001583	missense	0			BC012568	CCDS4370.1	5q35.1	2012-09-27	2012-09-27	2012-09-27	ENSG00000040275	ENSG00000040275			26010	protein-coding gene	gene with protein product	"""spindly homolog (Drosophila)"""		"""coiled-coil domain containing 99"""	CCDC99		20427577	Standard	NM_017785		Approved	FLJ20364, hSpindly	uc003mae.4	Q96EA4	OTTHUMG00000130438	ENST00000265295.4:c.829G>T	5.37:g.169021623G>T	ENSP00000265295:p.Val277Phe			Missense_Mutation	SNP	NULL	p.V277F	ENST00000265295.4	37	c.829	CCDS4370.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	20.9|20.9	4.066623|4.066623	0.76301|0.76301	.|.	.|.	ENSG00000040275|ENSG00000040275	ENST00000505977|ENST00000265295;ENST00000274631	.|T	.|0.37235	.|1.21	5.8|5.8	4.93|4.93	0.64822|0.64822	.|.	.|0.121727	.|0.53938	.|D	.|0.000048	T|T	0.52322|0.52322	0.1727|0.1727	L|L	0.59436|0.59436	1.845|1.845	0.30925|0.30925	N|N	0.727591|0.727591	.|D;D;D	.|0.67145	.|0.996;0.996;0.977	.|P;D;P	.|0.64237	.|0.907;0.923;0.847	T|T	0.58685|0.58685	-0.7593|-0.7593	5|10	.|0.48119	.|T	.|0.1	-1.9536|-1.9536	12.9147|12.9147	0.58199|0.58199	0.1349:0.0:0.8651:0.0|0.1349:0.0:0.8651:0.0	.|.	.|199;178;277	.|B4E393;Q96EA4-2;Q96EA4	.|.;.;SPDLY_HUMAN	I|F	205|277;178	.|ENSP00000265295:V277F	.|ENSP00000265295:V277F	S|V	+|+	2|1	0|0	CCDC99|CCDC99	168954201|168954201	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	3.787000|3.787000	0.55439|0.55439	1.446000|1.446000	0.47643|0.47643	0.651000|0.651000	0.88453|0.88453	AGT|GTC	SPDL1	-	NULL	ENSG00000040275		0.333	SPDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPDL1	HGNC	protein_coding	OTTHUMT00000252829.2	-	0.00	30	0	G	NM_017785		169021623	+1	tier1	-	no_errors	ENST00000265295	ensembl	human	known	74_37	missense	15.38	22	4	SNP	1.000	T
SPEG	10290	genome.wustl.edu	37	2	220357321	220357321	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:220357321G>T	ENST00000312358.7	+	41	9749	c.9617G>T	c.(9616-9618)cGg>cTg	p.R3206L	AC053503.11_ENST00000429882.1_RNA|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	3206	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R3206Q(1)		breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GGCAGGAGCCGGCCCTCCCTG	0.657																																																	1	Substitution - Missense(1)	lung(1)											48.0	54.0	52.0					2																	220357321		1988	4140	6128	SO:0001583	missense	0			BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.9617G>T	2.37:g.220357321G>T	ENSP00000311684:p.Arg3206Leu		A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R3206L	ENST00000312358.7	37	c.9617	CCDS42824.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.644897	0.96704	.	.	ENSG00000072195	ENST00000312358	T	0.80653	-1.4	5.06	5.06	0.68205	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.35615	N	0.003082	D	0.93815	0.8022	H	0.98027	4.13	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.96226	0.9164	10	0.87932	D	0	.	18.0348	0.89296	0.0:0.0:1.0:0.0	.	3206	Q15772	SPEG_HUMAN	L	3206	ENSP00000311684:R3206L	ENSP00000311684:R3206L	R	+	2	0	SPEG	220065565	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.711000	0.98735	2.361000	0.80049	0.591000	0.81541	CGG	SPEG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000072195		0.657	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	HGNC	protein_coding	OTTHUMT00000130252.2		0.00	52	0	G	NM_005876		220357321	+1			no_errors	ENST00000312358	ensembl	human	novel	74_37	missense	5.88	32	2	SNP	1.000	T
SPTA1	6708	genome.wustl.edu	37	1	158581100	158581100	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:158581100G>T	ENST00000368147.4	-	52	7394	c.7214C>A	c.(7213-7215)tCt>tAt	p.S2405Y	SPTA1_ENST00000485680.1_5'UTR	NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2405				GRSHLSGYDYVGFTNSYFGN -> VEAISLAMTTLASPIPT LATNKQLLVDRRKS (in Ref. 1; AAA60577/ AAA60994). {ECO:0000305}.	actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GTCATAGCCAGAGAGATGGCT	0.458																																																	0													84.0	86.0	86.0					1																	158581100		1926	4128	6054	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.7214C>A	1.37:g.158581100G>T	ENSP00000357129:p.Ser2405Tyr		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.S2405Y	ENST00000368147.4	37	c.7214	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.049244	0.36181	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.28255	1.62;1.62	5.58	4.66	0.58398	EF-hand, Ca insensitive (1);EF-hand-like domain (1);	0.879425	0.09240	N	0.829389	T	0.20047	0.0482	N	0.19112	0.55	0.22511	N	0.999031	P	0.34629	0.46	P	0.47891	0.56	T	0.49762	-0.8905	10	0.62326	D	0.03	.	13.9373	0.64032	0.0:0.0:0.8467:0.1533	.	2405	P02549	SPTA1_HUMAN	Y	2405;2402	ENSP00000357130:S2405Y;ENSP00000357129:S2402Y	ENSP00000357129:S2402Y	S	-	2	0	SPTA1	156847724	0.992000	0.36948	0.423000	0.26634	0.009000	0.06853	4.017000	0.57167	1.474000	0.48178	0.655000	0.94253	TCT	SPTA1	-	pfam_EF-hand_Ca_insen	ENSG00000163554		0.458	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	-	0.00	55	0	G	NM_003126		158581100	-1	tier1	-	no_errors	ENST00000368147	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.715	T
SPTBN4	57731	genome.wustl.edu	37	19	41003463	41003463	+	Missense_Mutation	SNP	C	C	T	rs138314115		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:41003463C>T	ENST00000352632.3	+	7	822	c.736C>T	c.(736-738)Cgc>Tgc	p.R246C	SPTBN4_ENST00000338932.3_Missense_Mutation_p.R246C|SPTBN4_ENST00000344104.3_Missense_Mutation_p.R246C|SPTBN4_ENST00000598249.1_Missense_Mutation_p.R246C|SPTBN4_ENST00000595535.1_Missense_Mutation_p.R246C			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	246	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.R246C(1)		breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GAGAGCCTTCCGCACAGCTGA	0.642																																																	1	Substitution - Missense(1)	kidney(1)											95.0	83.0	87.0					19																	41003463		2203	4300	6503	SO:0001583	missense	0			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.736C>T	19.37:g.41003463C>T	ENSP00000263373:p.Arg246Cys		E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.R246C	ENST00000352632.3	37	c.736	CCDS12559.1	19	.	.	.	.	.	.	.	.	.	.	C	18.97	3.735138	0.69189	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.60299	0.2;0.2;0.2	3.92	2.84	0.33178	Calponin homology domain (5);	0.645014	0.13846	U	0.358703	T	0.68357	0.2992	L	0.56769	1.78	0.80722	D	1	B;D	0.76494	0.006;0.999	B;D	0.68039	0.01;0.955	T	0.65582	-0.6133	10	0.54805	T	0.06	.	9.4856	0.38928	0.5267:0.4733:0.0:0.0	.	246;246	Q9H254;Q71S06	SPTN4_HUMAN;.	C	246	ENSP00000263373:R246C;ENSP00000340345:R246C;ENSP00000340741:R246C	ENSP00000340345:R246C	R	+	1	0	SPTBN4	45695303	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.504000	0.73704	0.815000	0.34398	0.460000	0.39030	CGC	SPTBN4	-	pirsf_Spectrin_bsu,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000160460		0.642	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN4	HGNC	protein_coding	OTTHUMT00000462559.2		0.00	43	0	C			41003463	+1			no_errors	ENST00000352632	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
SRGAP2B	647135	genome.wustl.edu	37	1	144013980	144013980	+	RNA	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:144013980C>G	ENST00000467933.1	+	0	995							P0DMP2	SRG2B_HUMAN	SLIT-ROBO Rho GTPase activating protein 2B						nervous system development (GO:0007399)												TGCAGGACCTCCAGGACTTCT	0.532																																																	0																																												0				CCDS72854.1	1q21.1	2014-07-10	2013-02-13	2012-05-08	ENSG00000196369	ENSG00000196369			35237	protein-coding gene	gene with protein product		614703	"""SLIT-ROBO Rho GTPase activating protein 2 pseudogene 2"", ""SLIT-ROBO Rho GTPase activating protein 2B (pseudogene)"""	SRGAP2P2		22559943, 22559944	Standard	NM_001271870		Approved		uc010oxm.1	P0DMP2	OTTHUMG00000041442		1.37:g.144013980C>G				RNA	SNP	-	NULL	ENST00000467933.1	37	NULL		1																																																																																			SRGAP2B	-	-	ENSG00000196369		0.532	SRGAP2B-002	KNOWN	basic	processed_transcript	SRGAP2B	HGNC	pseudogene	OTTHUMT00000352915.1	-	0.00	85	0	C	NM_001271870		144013980	+1	tier1	-	no_errors	ENST00000467933	ensembl	human	known	74_37	rna	12.37	85	12	SNP	1.000	G
SSB	6741	genome.wustl.edu	37	2	170662222	170662222	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:170662222G>T	ENST00000409333.1	+	4	465	c.218G>T	c.(217-219)aGc>aTc	p.S73I	SSB_ENST00000260956.4_Missense_Mutation_p.S73I			P05455	LA_HUMAN	Sjogren syndrome antigen B (autoantigen La)	73	HTH La-type RNA-binding. {ECO:0000255|PROSITE-ProRule:PRU00332}.				histone mRNA metabolic process (GO:0008334)|tRNA modification (GO:0006400)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(3)|large_intestine(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						GAAGCATTGAGCAAATCCAAG	0.368																																																	0													64.0	66.0	65.0					2																	170662222		2203	4300	6503	SO:0001583	missense	0				CCDS2237.1	2q31.1	2014-02-14		2005-06-16	ENSG00000138385	ENSG00000138385		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	11316	protein-coding gene	gene with protein product	"""La ribonucleoprotein domain family, member 3"""	109090					Standard	NM_003142		Approved	LARP3, La, La/SSB	uc002ufk.3	P05455	OTTHUMG00000132212	ENST00000409333.1:c.218G>T	2.37:g.170662222G>T	ENSP00000386636:p.Ser73Ile		Q15367|Q53XJ4	Missense_Mutation	SNP	pfam_RRM_3,pfam_Lupus_La_RNA-bd,pfam_RRM_dom,smart_Lupus_La_RNA-bd,smart_RRM_dom,pfscan_Lupus_La_RNA-bd,pfscan_RRM_dom,prints_Lupus_La	p.S73I	ENST00000409333.1	37	c.218	CCDS2237.1	2	.	.	.	.	.	.	.	.	.	.	G	15.12	2.739020	0.49045	.	.	ENSG00000138385	ENST00000422006;ENST00000260956;ENST00000409005;ENST00000417292;ENST00000409333	T;T;T;T	0.44881	0.91;0.91;0.93;0.91	5.62	4.51	0.55191	Winged helix-turn-helix transcription repressor DNA-binding (1);RNA-binding protein Lupus La (3);	0.248176	0.48286	D	0.000189	T	0.50701	0.1631	M	0.75085	2.285	0.40554	D	0.981148	B;B	0.32302	0.363;0.347	B;P	0.44732	0.222;0.459	T	0.55903	-0.8067	10	0.56958	D	0.05	-7.5783	8.0371	0.30499	0.237:0.0:0.763:0.0	.	73;73	E9PFH8;P05455	.;LA_HUMAN	I	73;73;73;22;73	ENSP00000397029:S73I;ENSP00000260956:S73I;ENSP00000396890:S22I;ENSP00000386636:S73I	ENSP00000260956:S73I	S	+	2	0	SSB	170370468	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.162000	0.42367	2.809000	0.96659	0.467000	0.42956	AGC	SSB	-	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd	ENSG00000138385		0.368	SSB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SSB	HGNC	protein_coding	OTTHUMT00000333316.1	-	0.00	59	0	G	NM_003142		170662222	+1	tier1	-	no_errors	ENST00000260956	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
SSBP4	170463	genome.wustl.edu	37	19	18543996	18543996	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:18543996G>C	ENST00000270061.7	+	15	1258	c.964G>C	c.(964-966)Gag>Cag	p.E322Q	SSBP4_ENST00000599699.2_5'Flank|SSBP4_ENST00000348495.6_Missense_Mutation_p.E300Q	NM_032627.4	NP_116016.1	Q9BWG4	SSBP4_HUMAN	single stranded DNA binding protein 4	322						nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)			endometrium(2)|kidney(1)|skin(1)	4						GAGCGCGATGGAGCCTCACCA	0.726																																																	0													14.0	14.0	14.0					19																	18543996		2182	4267	6449	SO:0001583	missense	0				CCDS12378.1, CCDS32960.1	19p13.1	2008-02-05				ENSG00000130511			15676	protein-coding gene	gene with protein product		607391				12079286	Standard	NM_032627		Approved		uc002niy.3	Q9BWG4		ENST00000270061.7:c.964G>C	19.37:g.18543996G>C	ENSP00000270061:p.Glu322Gln		Q9BWW5	Missense_Mutation	SNP	smart_LisH_dimerisation,pfscan_LisH_dimerisation,prints_SSDP_DNA-bd	p.E322Q	ENST00000270061.7	37	c.964	CCDS12378.1	19	.	.	.	.	.	.	.	.	.	.	G	21.3	4.121434	0.77436	.	.	ENSG00000130511	ENST00000270061;ENST00000348495	.	.	.	3.55	3.55	0.40652	.	0.000000	0.64402	U	0.000002	T	0.68458	0.3003	M	0.67397	2.05	0.50313	D	0.999862	D;D	0.67145	0.988;0.996	D;D	0.72075	0.948;0.976	T	0.65228	-0.6219	9	0.18276	T	0.48	-14.8518	11.0141	0.47679	0.0:0.0:1.0:0.0	.	300;322	Q9BWW5;Q9BWG4	.;SSBP4_HUMAN	Q	322;300	.	ENSP00000270061:E322Q	E	+	1	0	SSBP4	18404996	1.000000	0.71417	0.985000	0.45067	0.862000	0.49288	4.886000	0.63149	1.732000	0.51606	0.491000	0.48974	GAG	SSBP4	-	NULL	ENSG00000130511		0.726	SSBP4-002	KNOWN	basic|CCDS	protein_coding	SSBP4	HGNC	protein_coding	OTTHUMT00000466348.3	-	0.00	20	0	G	NM_032627		18543996	+1	tier1	-	no_errors	ENST00000270061	ensembl	human	known	74_37	missense	24.14	22	7	SNP	1.000	C
STAB2	55576	genome.wustl.edu	37	12	104156110	104156110	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:104156110G>T	ENST00000388887.2	+	67	7622	c.7418G>T	c.(7417-7419)gGg>gTg	p.G2473V	RP11-341G23.4_ENST00000551299.1_RNA|RP11-341G23.4_ENST00000550029.1_RNA	NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CTGGTGACTGGGGCTGTTGCC	0.478																																																	0													143.0	128.0	133.0					12																	104156110		2203	4300	6503	SO:0001583	missense	0			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.7418G>T	12.37:g.104156110G>T	ENSP00000373539:p.Gly2473Val			Missense_Mutation	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_FAS1_domain,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.G2473V	ENST00000388887.2	37	c.7418	CCDS31888.1	12	.	.	.	.	.	.	.	.	.	.	G	15.42	2.829391	0.50845	.	.	ENSG00000136011	ENST00000388887	T	0.67171	-0.25	5.25	4.34	0.51931	.	0.144413	0.45126	D	0.000390	T	0.80954	0.4723	M	0.74258	2.255	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	T	0.81790	-0.0771	10	0.45353	T	0.12	.	15.6735	0.77297	0.0:0.1376:0.8624:0.0	.	2473	Q8WWQ8	STAB2_HUMAN	V	2473	ENSP00000373539:G2473V	ENSP00000373539:G2473V	G	+	2	0	STAB2	102680240	1.000000	0.71417	0.026000	0.17262	0.003000	0.03518	3.893000	0.56243	1.178000	0.42870	0.561000	0.74099	GGG	STAB2	-	NULL	ENSG00000136011		0.478	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	HGNC	protein_coding	OTTHUMT00000407089.1		0.00	84	0	G			104156110	+1			no_errors	ENST00000388887	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.724	T
STAC2	342667	genome.wustl.edu	37	17	37381698	37381698	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:37381698G>T	ENST00000333461.5	-	1	427	c.58C>A	c.(58-60)Cca>Aca	p.P20T		NM_198993.3	NP_945344.1	Q6ZMT1	STAC2_HUMAN	SH3 and cysteine rich domain 2	20					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			NS(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(2)	17						ACGGTCCCTGGGGGGCTGTGG	0.706																																																	0													62.0	52.0	55.0					17																	37381698		2203	4300	6503	SO:0001583	missense	0			AJ608762	CCDS11335.1	17q21.2	2012-11-19			ENSG00000141750	ENSG00000141750			23990	protein-coding gene	gene with protein product							Standard	NM_198993		Approved	24b2	uc002hrs.3	Q6ZMT1	OTTHUMG00000179039	ENST00000333461.5:c.58C>A	17.37:g.37381698G>T	ENSP00000327509:p.Pro20Thr		Q32MA3	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_SH3_domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_SH3_domain,prints_p67phox	p.P20T	ENST00000333461.5	37	c.58	CCDS11335.1	17	.	.	.	.	.	.	.	.	.	.	g	13.33	2.205928	0.39003	.	.	ENSG00000141750	ENST00000333461	T	0.80393	-1.37	5.42	4.43	0.53597	.	0.000000	0.48767	D	0.000165	T	0.72137	0.3423	L	0.46157	1.445	0.28247	N	0.925434	P	0.34522	0.455	B	0.26310	0.068	T	0.69154	-0.5220	10	0.66056	D	0.02	-15.7642	11.9918	0.53180	0.0:0.1746:0.8254:0.0	.	20	Q6ZMT1	STAC2_HUMAN	T	20	ENSP00000327509:P20T	ENSP00000327509:P20T	P	-	1	0	STAC2	34635224	1.000000	0.71417	0.996000	0.52242	0.515000	0.34225	2.069000	0.41481	1.259000	0.44117	0.455000	0.32223	CCA	STAC2	-	NULL	ENSG00000141750		0.706	STAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAC2	HGNC	protein_coding	OTTHUMT00000444533.2	-	0.00	47	0	G	NM_198993		37381698	-1	tier1	-	no_errors	ENST00000333461	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.997	T
STARD13	90627	genome.wustl.edu	37	13	33692207	33692207	+	Missense_Mutation	SNP	T	T	C	rs553359255		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr13:33692207T>C	ENST00000336934.5	-	8	2392	c.2276A>G	c.(2275-2277)tAt>tGt	p.Y759C	STARD13_ENST00000255486.4_Missense_Mutation_p.Y751C|STARD13_ENST00000399365.3_Missense_Mutation_p.Y641C	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	759	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		CTTACACTGATAGATATGGAG	0.403													T|||	1	0.000199681	0.0	0.0014	5008	,	,		19436	0.0		0.0	False		,,,				2504	0.0																0													115.0	119.0	118.0					13																	33692207		2203	4300	6503	SO:0001583	missense	0			AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.2276A>G	13.37:g.33692207T>C	ENSP00000338785:p.Tyr759Cys		A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Missense_Mutation	SNP	pfam_START_lipid-bd_dom,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_RhoGAP_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom,pfscan_RhoGAP_dom	p.Y759C	ENST00000336934.5	37	c.2276	CCDS9348.1	13	.	.	.	.	.	.	.	.	.	.	T	22.0	4.233188	0.79688	.	.	ENSG00000133121	ENST00000399365;ENST00000255486;ENST00000336934	T;T;T	0.11821	2.74;2.74;2.74	5.2	5.2	0.72013	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.34135	0.0887	L	0.59967	1.855	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.997	D;D;D	0.97110	1.0;1.0;0.961	T	0.03121	-1.1070	10	0.54805	T	0.06	.	15.3518	0.74396	0.0:0.0:0.0:1.0	.	724;759;751	Q9Y3M8-4;Q9Y3M8;Q9Y3M8-2	.;STA13_HUMAN;.	C	641;751;759	ENSP00000382300:Y641C;ENSP00000255486:Y751C;ENSP00000338785:Y759C	ENSP00000255486:Y751C	Y	-	2	0	STARD13	32590207	1.000000	0.71417	0.991000	0.47740	0.980000	0.70556	7.840000	0.86819	2.098000	0.63641	0.472000	0.43445	TAT	STARD13	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000133121		0.403	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD13	HGNC	protein_coding	OTTHUMT00000276118.2	-	0.00	53	0	T	NM_001243466		33692207	-1	tier1	-	no_errors	ENST00000336934	ensembl	human	known	74_37	missense	19.70	53	13	SNP	1.000	C
STARD13	90627	genome.wustl.edu	37	13	33692350	33692350	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr13:33692350G>T	ENST00000336934.5	-	8	2249	c.2133C>A	c.(2131-2133)cgC>cgA	p.R711R	STARD13_ENST00000255486.4_Silent_p.R703R|STARD13_ENST00000399365.3_Silent_p.R593R	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	711	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		CATTCATTTGGCGAAGGGCAT	0.493																																																	0													154.0	149.0	151.0					13																	33692350		2203	4300	6503	SO:0001819	synonymous_variant	0			AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.2133C>A	13.37:g.33692350G>T			A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Silent	SNP	pfam_START_lipid-bd_dom,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_RhoGAP_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom,pfscan_RhoGAP_dom	p.R711	ENST00000336934.5	37	c.2133	CCDS9348.1	13																																																																																			STARD13	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000133121		0.493	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD13	HGNC	protein_coding	OTTHUMT00000276118.2	-	0.00	65	0	G	NM_001243466		33692350	-1	tier1	-	no_errors	ENST00000336934	ensembl	human	known	74_37	silent	5.71	66	4	SNP	0.977	T
STX19	415117	genome.wustl.edu	37	3	93733383	93733383	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:93733383C>G	ENST00000315099.2	-	2	987	c.731G>C	c.(730-732)gGa>gCa	p.G244A	ARL13B_ENST00000303097.7_Intron|ARL13B_ENST00000535334.1_Intron|ARL13B_ENST00000394222.3_Intron|ARL13B_ENST00000539730.1_Intron|ARL13B_ENST00000471138.1_Intron|ARL13B_ENST00000486562.1_Intron	NM_001001850.2	NP_001001850.1	Q8N4C7	STX19_HUMAN	syntaxin 19	244	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)				kidney(2)|large_intestine(2)|lung(4)|prostate(1)	9						GATGCTCTCTCCTTGTTCCTC	0.313																																																	0													70.0	68.0	69.0					3																	93733383		2202	4298	6500	SO:0001583	missense	0			AF461456	CCDS33793.1	3q11	2005-12-30			ENSG00000178750	ENSG00000178750			19300	protein-coding gene	gene with protein product							Standard	NM_001001850		Approved	MGC21382	uc003drh.1	Q8N4C7	OTTHUMG00000159013	ENST00000315099.2:c.731G>C	3.37:g.93733383C>G	ENSP00000320679:p.Gly244Ala			Missense_Mutation	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.G244A	ENST00000315099.2	37	c.731	CCDS33793.1	3	.	.	.	.	.	.	.	.	.	.	C	14.75	2.628021	0.46944	.	.	ENSG00000178750	ENST00000315099	T	0.35236	1.32	4.71	4.71	0.59529	t-SNARE (1);Syntaxin/epimorphin, conserved site (1);Target SNARE coiled-coil domain (3);	0.000000	0.85682	D	0.000000	T	0.62563	0.2438	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64153	-0.6474	10	0.45353	T	0.12	.	18.5999	0.91246	0.0:1.0:0.0:0.0	.	244	Q8N4C7	STX19_HUMAN	A	244	ENSP00000320679:G244A	ENSP00000320679:G244A	G	-	2	0	STX19	95216073	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	7.252000	0.78309	2.573000	0.86826	0.650000	0.86243	GGA	STX19	-	pfam_T_SNARE_dom,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	ENSG00000178750		0.313	STX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX19	HGNC	protein_coding	OTTHUMT00000352909.1		0.00	32	0	C	NM_001001850		93733383	-1			no_errors	ENST00000315099	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	G
SUCO	51430	genome.wustl.edu	37	1	172558897	172558897	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:172558897G>T	ENST00000263688.3	+	18	2875	c.2656G>T	c.(2656-2658)Gat>Tat	p.D886Y	SUCO_ENST00000367723.4_Missense_Mutation_p.D1037Y|SUCO_ENST00000610051.1_Intron|SUCO_ENST00000608151.1_Missense_Mutation_p.D1038Y	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	886					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)		p.D1038Y(1)|p.D886Y(1)									GACAGCTACAGATTTTTATGC	0.358																																																	2	Substitution - Missense(2)	large_intestine(2)											90.0	93.0	92.0					1																	172558897		2200	4296	6496	SO:0001583	missense	0			AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.2656G>T	1.37:g.172558897G>T	ENSP00000263688:p.Asp886Tyr		B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	p.D1038Y	ENST00000263688.3	37	c.3112	CCDS1303.1	1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.089001	0.76756	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	5.29	5.29	0.74685	.	0.044149	0.85682	D	0.000000	T	0.74966	0.3786	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.78137	-0.2321	9	0.87932	D	0	-21.0784	17.492	0.87707	0.0:0.0:1.0:0.0	.	886;1038;886	B4DZJ3;Q5H945;Q9UBS9	.;.;OSPT_HUMAN	Y	1038;886	.	ENSP00000263688:D886Y	D	+	1	0	C1orf9	170825520	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.400000	0.97290	2.460000	0.83146	0.655000	0.94253	GAT	SUCO	-	NULL	ENSG00000094975		0.358	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUCO	HGNC	protein_coding	OTTHUMT00000084273.1		0.00	28	0	G	NM_016227		172558897	+1			no_errors	ENST00000608151	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	T
SVIL	6840	genome.wustl.edu	37	10	29821901	29821901	+	Silent	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:29821901C>G	ENST00000355867.4	-	8	2147	c.1395G>C	c.(1393-1395)gtG>gtC	p.V465V	SVIL_ENST00000375400.3_Intron|SVIL_ENST00000375398.2_Silent_p.V465V	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	465					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				CTGGGCTTCTCACTAGCCCAT	0.488																																																	0													98.0	91.0	94.0					10																	29821901		2203	4300	6503	SO:0001819	synonymous_variant	0			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.1395G>C	10.37:g.29821901C>G			D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Silent	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.V465	ENST00000355867.4	37	c.1395	CCDS7164.1	10																																																																																			SVIL	-	NULL	ENSG00000197321		0.488	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SVIL	HGNC	protein_coding	OTTHUMT00000047395.1	-	0.00	39	0	C			29821901	-1	tier1	-	no_errors	ENST00000355867	ensembl	human	known	74_37	silent	23.81	32	10	SNP	0.000	G
SYNE1	23345	genome.wustl.edu	37	6	152675868	152675868	+	Missense_Mutation	SNP	C	C	T	rs577389543		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:152675868C>T	ENST00000367255.5	-	67	11453	c.10852G>A	c.(10852-10854)Gag>Aag	p.E3618K	SYNE1_ENST00000265368.4_Missense_Mutation_p.E3618K|SYNE1_ENST00000423061.1_Missense_Mutation_p.E3625K|SYNE1_ENST00000341594.5_Missense_Mutation_p.E3589K|SYNE1_ENST00000448038.1_Missense_Mutation_p.E3625K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3618					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ACTTTCTCCTCTGCTGTTTTG	0.443										HNSCC(10;0.0054)			C|||	1	0.000199681	0.0	0.0	5008	,	,		19972	0.0		0.001	False		,,,				2504	0.0																0													252.0	221.0	232.0					6																	152675868		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10852G>A	6.37:g.152675868C>T	ENSP00000356224:p.Glu3618Lys		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E3618K	ENST00000367255.5	37	c.10852	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	17.97	3.519167	0.64634	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000017	T	0.62417	0.2426	M	0.68952	2.095	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.998;0.999	T	0.58346	-0.7652	10	0.39692	T	0.17	.	19.5287	0.95219	0.0:1.0:0.0:0.0	.	3618;3618;3618;3625	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	K	3618;3625;3618;3625;3589	ENSP00000356224:E3618K;ENSP00000396024:E3625K;ENSP00000265368:E3618K;ENSP00000390975:E3625K;ENSP00000341887:E3589K	ENSP00000265368:E3618K	E	-	1	0	SYNE1	152717561	1.000000	0.71417	0.940000	0.37924	0.356000	0.29392	5.726000	0.68515	2.676000	0.91093	0.650000	0.86243	GAG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.443	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	90	0	C	NM_182961		152675868	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	18.89	73	17	SNP	1.000	T
SYNE1	23345	genome.wustl.edu	37	6	152792774	152792774	+	Silent	SNP	G	G	A	rs369178017		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:152792774G>A	ENST00000367255.5	-	16	2191	c.1590C>T	c.(1588-1590)taC>taT	p.Y530Y	SYNE1_ENST00000367248.3_Silent_p.Y520Y|SYNE1_ENST00000466159.2_Silent_p.Y530Y|SYNE1_ENST00000265368.4_Silent_p.Y530Y|SYNE1_ENST00000423061.1_Silent_p.Y537Y|SYNE1_ENST00000341594.5_Silent_p.Y537Y|SYNE1_ENST00000448038.1_Silent_p.Y537Y|SYNE1_ENST00000367253.4_Silent_p.Y530Y|SYNE1_ENST00000495090.2_Silent_p.Y97Y|SYNE1_ENST00000413186.2_Silent_p.Y530Y	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	530					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTCTCCTCCCGTACTTAATGA	0.443										HNSCC(10;0.0054)																																							0								G	,	0,4406		0,0,2203	152.0	147.0	149.0		1611,1590	-6.0	0.8	6		149	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SYNE1	NM_033071.3,NM_182961.3	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	537/8750,530/8798	152792774	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.1590C>T	6.37:g.152792774G>A			E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Y530	ENST00000367255.5	37	c.1590	CCDS5236.2	6																																																																																			SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom	ENSG00000131018		0.443	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	41	0	G	NM_182961		152792774	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	silent	19.23	42	10	SNP	0.933	A
SYNE3	161176	genome.wustl.edu	37	14	95918609	95918609	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr14:95918609T>A	ENST00000334258.5	-	6	1263	c.1249A>T	c.(1249-1251)Atc>Ttc	p.I417F	SYNE3_ENST00000553340.1_Missense_Mutation_p.I417F|SYNE3_ENST00000557275.1_Missense_Mutation_p.I417F|SYNE3_ENST00000554873.1_Missense_Mutation_p.I174F	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	417					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						ATGGTAGCGATGACACTATCA	0.612											OREG0022900	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													122.0	102.0	109.0					14																	95918609		2203	4300	6503	SO:0001583	missense	0			AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.1249A>T	14.37:g.95918609T>A	ENSP00000334308:p.Ile417Phe	1316	A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	pfam_KASH,pfam_Spectrin_repeat,superfamily_Retrov_capsid_C,smart_Spectrin/alpha-actinin,pfscan_KASH	p.I417F	ENST00000334258.5	37	c.1249	CCDS9935.1	14	.	.	.	.	.	.	.	.	.	.	T	5.418	0.262323	0.10239	.	.	ENSG00000176438	ENST00000334258;ENST00000554873;ENST00000557275;ENST00000553340	T;T;T;T	0.14266	3.46;2.52;3.46;2.87	4.68	1.77	0.24775	.	0.206205	0.24039	N	0.042113	T	0.07279	0.0184	N	0.19112	0.55	0.23838	N	0.996702	P;P;P	0.42757	0.789;0.789;0.684	B;B;B	0.38106	0.265;0.265;0.136	T	0.24190	-1.0167	10	0.48119	T	0.1	-24.9213	5.3006	0.15776	0.0:0.5504:0.1453:0.3042	.	417;417;417	Q6ZMZ3-2;Q6ZMZ3-3;Q6ZMZ3	.;.;SYNE3_HUMAN	F	417;174;417;417	ENSP00000334308:I417F;ENSP00000452154:I174F;ENSP00000450562:I417F;ENSP00000450774:I417F	ENSP00000334308:I417F	I	-	1	0	C14orf49	94988362	0.708000	0.27876	0.010000	0.14722	0.002000	0.02628	0.261000	0.18442	0.155000	0.19261	-1.552000	0.00895	ATC	SYNE3	-	NULL	ENSG00000176438		0.612	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE3	HGNC	protein_coding	OTTHUMT00000420529.2	-	0.00	64	0	T	NM_152592		95918609	-1	tier1	-	no_errors	ENST00000334258	ensembl	human	known	74_37	missense	41.86	25	18	SNP	0.527	A
SYNRG	11276	genome.wustl.edu	37	17	35902238	35902238	+	Missense_Mutation	SNP	G	G	C	rs372539300		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:35902238G>C	ENST00000339208.6	-	15	3178	c.3038C>G	c.(3037-3039)tCt>tGt	p.S1013C	SYNRG_ENST00000345615.4_Missense_Mutation_p.S935C|SYNRG_ENST00000585472.1_Missense_Mutation_p.S934C|SYNRG_ENST00000502449.2_Missense_Mutation_p.S890C|SYNRG_ENST00000394378.2_Missense_Mutation_p.S935C|SYNRG_ENST00000346661.4_Missense_Mutation_p.S1013C|SYNRG_ENST00000591288.1_Missense_Mutation_p.S807C	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	1013					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						GGTTTCTTGAGAGGCACCACT	0.478													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18520	0.0		0.0	False		,,,				2504	0.0																0								G	CYS/SER,CYS/SER,CYS/SER,CYS/SER,CYS/SER,CYS/SER,CYS/SER	1,4405	2.1+/-5.4	0,1,2202	78.0	81.0	80.0		2804,2801,2669,2420,3038,2804,2804	6.0	0.8	17		80	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense,missense	SYNRG	NM_001163544.1,NM_001163545.1,NM_001163546.1,NM_001163547.1,NM_007247.4,NM_080550.3,NM_198882.1	112,112,112,112,112,112,112	0,1,6502	CC,CG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	935/1237,934/1236,890/1180,807/1109,1013/1315,935/1225,935/1260	35902238	1,13005	2203	4300	6503	SO:0001583	missense	0			AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.3038C>G	17.37:g.35902238G>C	ENSP00000343610:p.Ser1013Cys		A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Missense_Mutation	SNP	smart_EPS15_homology,pfscan_EPS15_homology	p.S1013C	ENST00000339208.6	37	c.3038	CCDS11321.1	17	.	.	.	.	.	.	.	.	.	.	G	24.1	4.490867	0.84962	2.27E-4	0.0	ENSG00000006114	ENST00000346661;ENST00000339208;ENST00000345615;ENST00000502449;ENST00000394378	T;T;T	0.53423	1.2;0.81;0.62	6.02	6.02	0.97574	.	0.056444	0.64402	D	0.000001	T	0.66056	0.2751	L	0.53249	1.67	0.54753	D	0.999983	B;D;D;D;D;D	0.76494	0.078;0.998;0.998;0.998;0.999;0.999	B;D;D;D;D;D	0.68353	0.057;0.922;0.922;0.922;0.957;0.957	T	0.65298	-0.6202	10	0.72032	D	0.01	-16.9694	19.5352	0.95251	0.0:0.0:1.0:0.0	.	807;935;935;935;1013;1013	B7ZKZ2;Q9UMZ2-3;A8MWU4;Q9UMZ2-4;Q9UMZ2-5;Q9UMZ2	.;.;.;.;.;SYNRG_HUMAN	C	1013;807;1013;935;935	ENSP00000005279:S1013C;ENSP00000343610:S807C;ENSP00000377903:S935C	ENSP00000343610:S807C	S	-	2	0	SYNRG	32976351	1.000000	0.71417	0.783000	0.31826	0.911000	0.54048	6.481000	0.73608	2.850000	0.98022	0.650000	0.86243	TCT	SYNRG	-	NULL	ENSG00000006114		0.478	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNRG	HGNC	protein_coding	OTTHUMT00000256811.2	-	0.00	40	0	G	NM_007247		35902238	-1	tier1	-	no_errors	ENST00000339208	ensembl	human	known	74_37	missense	32.81	43	21	SNP	0.937	C
HYI	81888	genome.wustl.edu	37	1	43916150	43916150	+	IGR	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:43916150G>A	ENST00000372425.4	-	0	1115				SZT2_ENST00000372442.1_Silent_p.*2534*|SZT2_ENST00000562955.1_Silent_p.*3376*|SZT2-AS1_ENST00000396885.2_RNA			Q5T013	HYI_HUMAN	hydroxypyruvate isomerase (putative)								hydroxypyruvate isomerase activity (GO:0008903)			large_intestine(1)|lung(2)|ovary(1)|urinary_tract(2)	6	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CGCCTCCTCTGAGGGAGTGGA	0.607																																																	0													122.0	119.0	120.0					1																	43916150		2203	4300	6503	SO:0001628	intergenic_variant	0				CCDS488.1, CCDS488.2, CCDS53309.1, CCDS72771.1	1p34.2	2010-06-24	2010-06-24		ENSG00000178922	ENSG00000178922	5.3.1.22		26948	protein-coding gene	gene with protein product			"""hydroxypyruvate isomerase homolog (E. coli)"""			10561547	Standard	NM_031207		Approved	HT036	uc001cjo.3	Q5T013	OTTHUMG00000007502		1.37:g.43916150G>A			D3DPX4|D3DPX5|Q5Q9A2|Q7Z778|Q96S83|Q9BZR3|Q9BZR4	Silent	SNP	NULL	p.*3376	ENST00000372425.4	37	c.10127	CCDS53309.1	1																																																																																			SZT2	-	NULL	ENSG00000198198		0.607	HYI-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SZT2	HGNC	protein_coding			0.00	24	0	G	NM_031207		43916150	+1			no_errors	ENST00000562955	ensembl	human	known	74_37	silent	11.54	23	3	SNP	1.000	A
TANGO6	79613	genome.wustl.edu	37	16	68941396	68941396	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr16:68941396G>T	ENST00000261778.1	+	10	1730	c.1718G>T	c.(1717-1719)gGc>gTc	p.G573V		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	573						integral component of membrane (GO:0016021)											TCTGAGCAGGGCCGGGTGGAG	0.483																																																	0													94.0	95.0	95.0					16																	68941396		1889	4104	5993	SO:0001583	missense	0				CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.1718G>T	16.37:g.68941396G>T	ENSP00000261778:p.Gly573Val		Q569F9|Q9H9K1	Missense_Mutation	SNP	pfam_DUF2435,pfam_DUF2411,superfamily_ARM-type_fold	p.G573V	ENST00000261778.1	37	c.1718	CCDS45516.1	16	.	.	.	.	.	.	.	.	.	.	G	3.913	-0.019681	0.07634	.	.	ENSG00000103047	ENST00000261778	.	.	.	5.95	2.99	0.34606	Armadillo-type fold (1);	0.513117	0.26684	N	0.023025	T	0.28863	0.0716	N	0.22421	0.69	0.30602	N	0.76036	B	0.15473	0.013	B	0.16289	0.015	T	0.20009	-1.0288	9	0.17369	T	0.5	0.0059	8.485	0.33065	0.2399:0.0:0.7601:0.0	.	573	Q9C0B7	TMCO7_HUMAN	V	573	.	ENSP00000261778:G573V	G	+	2	0	TMCO7	67498897	1.000000	0.71417	0.709000	0.30452	0.210000	0.24377	2.381000	0.44336	0.866000	0.35629	-0.137000	0.14449	GGC	TANGO6	-	pfam_DUF2435,superfamily_ARM-type_fold	ENSG00000103047		0.483	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANGO6	HGNC	protein_coding	OTTHUMT00000433471.2		0.00	47	0	G	XM_928235.2		68941396	+1			no_errors	ENST00000261778	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.688	T
TAS2R14	50840	genome.wustl.edu	37	12	11230569	11230569	+	Intron	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:11230569G>C	ENST00000381852.4	-	2	152				TAS2R64P_ENST00000534866.1_RNA|PRR4_ENST00000536668.1_Intron			Q9NYV8	T2R14_HUMAN	taste receptor, type 2, member 14						detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	8						TGAAATGGTTGATTATTGCTG	0.358																																																	0																																										SO:0001627	intron_variant	0			AF227138	CCDS8637.1	12p13	2012-08-22			ENSG00000212127	ENSG00000212127		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14920	protein-coding gene	gene with protein product		604790				10761934, 10766242	Standard	NM_023922		Approved	T2R14, TRB1	uc010shi.2	Q9NYV8	OTTHUMG00000162720	ENST00000381852.4:c.1511-30782C>G	12.37:g.11230569G>C			Q645X3	RNA	SNP	-	NULL	ENST00000381852.4	37	NULL		12																																																																																			TAS2R64P	-	-	ENSG00000256274		0.358	TAS2R14-002	KNOWN	basic	processed_transcript	TAS2R64P	HGNC	protein_coding	OTTHUMT00000402305.1	-	0.00	41	0	G	NM_023922		11230569	-1	tier1	-	no_errors	ENST00000534866	ensembl	human	known	74_37	rna	10.53	51	6	SNP	0.003	C
TATDN2	9797	genome.wustl.edu	37	3	10290925	10290925	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:10290925G>T	ENST00000287652.4	+	2	1092	c.41G>T	c.(40-42)aGc>aTc	p.S14I	TATDN2_ENST00000448281.2_Missense_Mutation_p.S14I|RP11-438J1.1_ENST00000450534.1_5'Flank	NM_014760.3	NP_055575.3	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	14					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|DNA catabolic process (GO:0006308)|endoplasmic reticulum unfolded protein response (GO:0030968)	intracellular organelle (GO:0043229)|nucleoplasm (GO:0005654)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(9)|pancreas(2)|prostate(1)|stomach(2)	28						AACTGGAGCAGCACGTCGGAA	0.677																																																	0													48.0	49.0	49.0					3																	10290925		2203	4298	6501	SO:0001583	missense	0			D86972	CCDS33698.1	3p25.3	2010-11-24			ENSG00000157014	ENSG00000157014			28988	protein-coding gene	gene with protein product						9039502	Standard	NM_014760		Approved	KIAA0218	uc003bvf.3	Q93075	OTTHUMG00000155361	ENST00000287652.4:c.41G>T	3.37:g.10290925G>T	ENSP00000287652:p.Ser14Ile		Q3MIL9|Q5BKU0	Missense_Mutation	SNP	pfam_TatD_family	p.S14I	ENST00000287652.4	37	c.41	CCDS33698.1	3	.	.	.	.	.	.	.	.	.	.	G	17.99	3.523853	0.64747	.	.	ENSG00000157014	ENST00000287652;ENST00000448281	T;T	0.30714	1.52;1.52	3.55	3.55	0.40652	.	.	.	.	.	T	0.33556	0.0867	L	0.54323	1.7	0.36207	D	0.85111	P	0.51791	0.948	P	0.46144	0.505	T	0.50110	-0.8866	9	0.87932	D	0	-12.0939	10.833	0.46671	0.0:0.0:1.0:0.0	.	14	Q93075	TATD2_HUMAN	I	14	ENSP00000287652:S14I;ENSP00000408736:S14I	ENSP00000287652:S14I	S	+	2	0	TATDN2	10265925	0.992000	0.36948	0.996000	0.52242	0.995000	0.86356	1.560000	0.36331	1.987000	0.57996	0.563000	0.77884	AGC	TATDN2	-	NULL	ENSG00000157014		0.677	TATDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TATDN2	HGNC	protein_coding	OTTHUMT00000339641.1	-	0.00	57	0	G	XM_376203		10290925	+1	tier1	-	no_errors	ENST00000287652	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.993	T
TBCK	93627	genome.wustl.edu	37	4	107229985	107229985	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:107229985G>T	ENST00000273980.5	-	3	580	c.133C>A	c.(133-135)Ctt>Att	p.L45I	TBCK_ENST00000432496.2_Missense_Mutation_p.L45I|TBCK_ENST00000394706.3_Missense_Mutation_p.L45I|TBCK_ENST00000361687.4_Missense_Mutation_p.L45I|TBCK_ENST00000394708.2_Missense_Mutation_p.L45I					TBC1 domain containing kinase											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						ATGGTTTTAAGGATTTGAAAG	0.403																																																	0													139.0	146.0	144.0					4																	107229985		2203	4300	6503	SO:0001583	missense	0				CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.133C>A	4.37:g.107229985G>T	ENSP00000273980:p.Leu45Ile			Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Rhodanese-like_dom,superfamily_Kinase-like_dom,superfamily_Rab-GTPase-TBC_dom,superfamily_Rhodanese-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Rab-GTPase-TBC_dom,smart_Rhodanese-like_dom,pfscan_Rab-GTPase-TBC_dom,pfscan_Prot_kinase_dom,pfscan_Rhodanese-like_dom	p.L45I	ENST00000273980.5	37	c.133	CCDS54788.1	4	.	.	.	.	.	.	.	.	.	.	G	21.3	4.121501	0.77436	.	.	ENSG00000145348	ENST00000273980;ENST00000432496;ENST00000361687;ENST00000394706;ENST00000394708;ENST00000509532;ENST00000509862;ENST00000507696	T;T;T;T;T;T;T;T	0.70749	2.25;2.25;2.25;2.25;2.25;2.25;-0.51;2.89	5.39	5.39	0.77823	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.82683	0.5090	M	0.74881	2.28	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.991;0.998;0.998	D	0.84390	0.0554	10	0.87932	D	0	.	12.4934	0.55914	0.0766:0.0:0.9234:0.0	.	45;45;45	Q8TEA7;Q8TEA7-2;Q8TEA7-3	TBCK_HUMAN;.;.	I	45	ENSP00000273980:L45I;ENSP00000405847:L45I;ENSP00000355338:L45I;ENSP00000378196:L45I;ENSP00000378198:L45I;ENSP00000420985:L45I;ENSP00000425197:L45I;ENSP00000423637:L45I	ENSP00000273980:L45I	L	-	1	0	TBCK	107449434	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.056000	0.64287	2.549000	0.85964	0.591000	0.81541	CTT	TBCK	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000145348		0.403	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCK	HGNC	protein_coding	OTTHUMT00000253953.4	-	0.00	36	0	G	NM_033115		107229985	-1	tier1	-	no_errors	ENST00000273980	ensembl	human	known	74_37	missense	8.93	51	5	SNP	1.000	T
TBRG4	9238	genome.wustl.edu	37	7	45139978	45139978	+	Silent	SNP	G	G	T	rs370363199		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:45139978G>T	ENST00000258770.3	-	11	1963	c.1842C>A	c.(1840-1842)ggC>ggA	p.G614G	TBRG4_ENST00000494076.1_Silent_p.G614G|TBRG4_ENST00000361278.3_Silent_p.G504G|TBRG4_ENST00000395655.4_Silent_p.G504G	NM_004749.3	NP_004740.2	Q969Z0	TBRG4_HUMAN	transforming growth factor beta regulator 4	614	RAP. {ECO:0000255|PROSITE- ProRule:PRU00619}.				cell cycle arrest (GO:0007050)|cellular respiration (GO:0045333)|positive regulation of cell proliferation (GO:0008284)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			cervix(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(2)	17						TGAGGTAGGCGCCTTTCTGCC	0.587																																																	0													117.0	82.0	94.0					7																	45139978		2203	4300	6503	SO:0001819	synonymous_variant	0			AB023165	CCDS5501.1, CCDS5502.1	7p13	2006-07-07			ENSG00000136270	ENSG00000136270			17443	protein-coding gene	gene with protein product	"""FAST kinase domains 4"", ""cell cycle progression 2 protein"""	611325				9383053	Standard	NM_004749		Approved	Cpr2, KIAA0948, H_TD2522F11.8, FASTKD4	uc011kcd.3	Q969Z0	OTTHUMG00000129247	ENST00000258770.3:c.1842C>A	7.37:g.45139978G>T			A4D2L2|A4D2L3|D3DVL5|D3DVL6|O14710|Q53GI8|Q8NDM4|Q9BUC6|Q9Y2F6	Silent	SNP	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.G614	ENST00000258770.3	37	c.1842	CCDS5501.1	7																																																																																			TBRG4	-	pfam_RAP,smart_RAP	ENSG00000136270		0.587	TBRG4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TBRG4	HGNC	protein_coding	OTTHUMT00000251351.1		0.00	54	0	G	NM_030900		45139978	-1			no_errors	ENST00000258770	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.005	T
TCF20	6942	genome.wustl.edu	37	22	42557353	42557353	+	3'UTR	SNP	C	C	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr22:42557353C>A	ENST00000359486.3	-	0	6075				TCF20_ENST00000335626.4_Missense_Mutation_p.W1937C|TCF20_ENST00000404876.1_3'UTR	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						CTTCTCATCTCCACAGTCTCA	0.642																																																	0													112.0	79.0	90.0					22																	42557353		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.*56G>T	22.37:g.42557353C>A			A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	smart_Znf_PHD	p.W1937C	ENST00000359486.3	37	c.5811	CCDS14033.1	22	.	.	.	.	.	.	.	.	.	.	C	14.14	2.446482	0.43429	.	.	ENSG00000100207	ENST00000335626	T	0.58797	0.31	5.31	5.31	0.75309	.	.	.	.	.	T	0.64327	0.2588	.	.	.	0.80722	D	1	D	0.58268	0.982	P	0.50378	0.639	T	0.64795	-0.6323	8	0.44086	T	0.13	.	17.5482	0.87869	0.0:1.0:0.0:0.0	.	1937	Q9UGU0-2	.	C	1937	ENSP00000335561:W1937C	ENSP00000335561:W1937C	W	-	3	0	TCF20	40887297	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.653000	0.61462	2.657000	0.90304	0.655000	0.94253	TGG	TCF20	-	NULL	ENSG00000100207		0.642	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	HGNC	protein_coding	OTTHUMT00000320531.1	-	0.00	87	0	C	NM_181492		42557353	-1	tier1	-	no_errors	ENST00000335626	ensembl	human	known	74_37	missense	14.55	47	8	SNP	1.000	A
TDRD5	163589	genome.wustl.edu	37	1	179659934	179659934	+	Silent	SNP	G	G	A	rs371987660		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:179659934G>A	ENST00000367614.1	+	17	3161	c.2802G>A	c.(2800-2802)ttG>ttA	p.L934L	TDRD5_ENST00000294848.8_Silent_p.L934L|TDRD5_ENST00000444136.1_Silent_p.L988L	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	934					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						AGCTGTCTTTGATTTTGTCTT	0.448																																																	0								G	,,,,	0,4406		0,0,2203	75.0	73.0	74.0		2964,2964,2802,1467,2802	0.6	1.0	1		74	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TDRD5	NM_001199085.1,NM_001199089.1,NM_001199091.1,NM_001199092.1,NM_173533.3	,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,	988/1036,988/1036,934/982,489/537,934/982	179659934	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.2802G>A	1.37:g.179659934G>A			A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Silent	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.L988	ENST00000367614.1	37	c.2964	CCDS1332.1	1																																																																																			TDRD5	-	NULL	ENSG00000162782		0.448	TDRD5-002	KNOWN	basic|CCDS	protein_coding	TDRD5	HGNC	protein_coding	OTTHUMT00000085295.1	-	0.00	30	0	G	NM_173533		179659934	+1	tier1	-	no_errors	ENST00000444136	ensembl	human	known	74_37	silent	20.00	36	9	SNP	0.993	A
TELO2	9894	genome.wustl.edu	37	16	1549238	1549238	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr16:1549238G>T	ENST00000262319.6	+	6	1116	c.837G>T	c.(835-837)gaG>gaT	p.E279D		NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	279					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				GCAGGCCTGAGGTCCTTTCGA	0.602																																																	0													115.0	107.0	110.0					16																	1549238		2199	4300	6499	SO:0001583	missense	0			AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.837G>T	16.37:g.1549238G>T	ENSP00000262319:p.Glu279Asp		D3DU73|O75168|Q7LDV4|Q9BR21	Missense_Mutation	SNP	pfam_Telomere_length_regulation_dom,superfamily_ARM-type_fold	p.E279D	ENST00000262319.6	37	c.837	CCDS32363.1	16	.	.	.	.	.	.	.	.	.	.	G	2.961	-0.214627	0.06101	.	.	ENSG00000100726	ENST00000262319	D	0.84370	-1.84	4.86	-5.33	0.02713	.	0.352642	0.33127	N	0.005254	T	0.67069	0.2854	N	0.25647	0.755	0.09310	N	1	B	0.18461	0.028	B	0.14023	0.01	T	0.55842	-0.8077	10	0.15499	T	0.54	-2.1874	8.1818	0.31315	0.2363:0.1855:0.5781:0.0	.	279	Q9Y4R8	TELO2_HUMAN	D	279	ENSP00000262319:E279D	ENSP00000262319:E279D	E	+	3	2	TELO2	1489239	0.026000	0.19158	0.044000	0.18714	0.032000	0.12392	-1.064000	0.03461	-0.615000	0.05679	-0.379000	0.06801	GAG	TELO2	-	NULL	ENSG00000100726		0.602	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TELO2	HGNC	protein_coding	OTTHUMT00000103602.2		0.00	54	0	G	NM_016111		1549238	+1			no_errors	ENST00000262319	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.003	T
TG	7038	genome.wustl.edu	37	8	134125817	134125817	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr8:134125817C>G	ENST00000220616.4	+	44	7764	c.7724C>G	c.(7723-7725)tCc>tGc	p.S2575C	TG_ENST00000519543.1_Missense_Mutation_p.S708C|TG_ENST00000542445.1_Missense_Mutation_p.S945C|TG_ENST00000377869.1_Missense_Mutation_p.S2518C	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	2575					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GACTATGCCTCCTTCTCCCGG	0.562																																																	0													64.0	58.0	60.0					8																	134125817		2203	4300	6503	SO:0001583	missense	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.7724C>G	8.37:g.134125817C>G	ENSP00000220616:p.Ser2575Cys		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.S2575C	ENST00000220616.4	37	c.7724	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	C	17.60	3.430788	0.62844	.	.	ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616;ENST00000542445;ENST00000519543;ENST00000521107	T;T;T;T;T	0.69685	-0.42;-0.42;-0.42;-0.42;0.8	4.83	4.83	0.62350	Carboxylesterase, type B (1);	0.343633	0.25288	N	0.031754	D	0.82683	0.5090	M	0.86343	2.81	0.27096	N	0.96273	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.72982	0.962;0.947;0.979	T	0.77270	-0.2650	10	0.87932	D	0	.	13.0908	0.59166	0.0:0.8389:0.1611:0.0	.	708;945;2575	E7EVM0;F5GWW5;P01266	.;.;THYG_HUMAN	C	2518;1381;2575;945;708;24	ENSP00000367100:S2518C;ENSP00000220616:S2575C;ENSP00000441693:S945C;ENSP00000430430:S708C;ENSP00000430161:S24C	ENSP00000220616:S2575C	S	+	2	0	TG	134194999	0.639000	0.27234	1.000000	0.80357	0.797000	0.45037	2.982000	0.49337	2.381000	0.81170	0.655000	0.94253	TCC	TG	-	pfam_CarbesteraseB,pirsf_Thyroglobulin	ENSG00000042832		0.562	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	-	0.00	45	0	C	NM_003235		134125817	+1	tier1	-	no_errors	ENST00000220616	ensembl	human	known	74_37	missense	16.36	46	9	SNP	0.999	G
TGFBR3	7049	genome.wustl.edu	37	1	92193264	92193264	+	Silent	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:92193264G>C	ENST00000525962.1	-	6	898	c.837C>G	c.(835-837)gtC>gtG	p.V279V	TGFBR3_ENST00000370399.2_Silent_p.V279V|TGFBR3_ENST00000212355.4_Silent_p.V279V|TGFBR3_ENST00000468996.2_5'Flank			Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	279					blastocyst development (GO:0001824)|blood vessel development (GO:0001568)|BMP signaling pathway (GO:0030509)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cell growth (GO:0016049)|cell migration (GO:0016477)|definitive erythrocyte differentiation (GO:0060318)|definitive hemopoiesis (GO:0060216)|epithelial to mesenchymal transition (GO:0001837)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|negative regulation of cellular component movement (GO:0051271)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of protein binding (GO:0043393)|response to follicle-stimulating hormone (GO:0032354)|response to hypoxia (GO:0001666)|response to luteinizing hormone (GO:0034699)|response to prostaglandin E (GO:0034695)|transforming growth factor beta receptor complex assembly (GO:0007181)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	coreceptor activity (GO:0015026)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|PDZ domain binding (GO:0030165)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type III (GO:0070123)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(24)|ovary(3)|prostate(4)|skin(1)|stomach(1)|urinary_tract(3)	55		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		TCACCCAGTTGACAGACTTTT	0.353																																																	0													101.0	96.0	97.0					1																	92193264		2203	4300	6503	SO:0001819	synonymous_variant	0			L07594	CCDS30770.1, CCDS55614.1	1p33-p32	2008-02-05	2007-02-15		ENSG00000069702	ENSG00000069702		"""Proteoglycans / Cell surface : Other"""	11774	protein-coding gene	gene with protein product	"""betaglycan proteoglycan"""	600742	"""transforming growth factor, beta receptor III (betaglycan, 300kDa)"""			1333192, 1319842	Standard	NM_001195684		Approved	betaglycan, BGCAN	uc001doh.3	Q03167	OTTHUMG00000010097	ENST00000525962.1:c.837C>G	1.37:g.92193264G>C			A0AUW8|A8K5N0|B9EG88|Q5T2T4|Q5U731|Q9UGI2	Silent	SNP	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom,prints_ZP_dom	p.V279	ENST00000525962.1	37	c.837	CCDS30770.1	1																																																																																			TGFBR3	-	NULL	ENSG00000069702		0.353	TGFBR3-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TGFBR3	HGNC	protein_coding	OTTHUMT00000382308.1	-	0.00	37	0	G	NM_003243		92193264	-1	tier1	-	no_errors	ENST00000212355	ensembl	human	known	74_37	silent	17.14	29	6	SNP	1.000	C
THEMIS2	9473	genome.wustl.edu	37	1	28211733	28211733	+	Intron	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:28211733G>T	ENST00000373921.3	+	5	1723				THEMIS2_ENST00000373925.1_Intron|THEMIS2_ENST00000492877.1_3'UTR|THEMIS2_ENST00000373927.3_Intron|THEMIS2_ENST00000328928.7_Intron	NM_001105556.1	NP_001099026.1	Q5TEJ8	THMS2_HUMAN	thymocyte selection associated family member 2						cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|T cell receptor signaling pathway (GO:0050852)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											CACTTAACGTGAATGACCGTT	0.433																																																	0																																										SO:0001627	intron_variant	0			AF044896	CCDS30653.1, CCDS30654.1, CCDS41290.1, CCDS65461.1	1p35.2	2012-07-10	2012-07-10	2012-07-10	ENSG00000130775	ENSG00000130775			16839	protein-coding gene	gene with protein product	"""induced by contact to basement membrane 1"""		"""chromosome 1 open reading frame 38"""	C1orf38		16219472	Standard	XM_005246041		Approved	ICB-1, Icb-1	uc001bpc.4	Q5TEJ8	OTTHUMG00000003735	ENST00000373921.3:c.1720-73G>T	1.37:g.28211733G>T			A2RTZ3|B4DZT9|B4DZY3|O60560|Q5TEJ1|Q5TEJ9|Q5TEK1|Q68DP4|Q9BYB6|Q9NS90	RNA	SNP	-	NULL	ENST00000373921.3	37	NULL	CCDS41290.1	1																																																																																			THEMIS2	-	-	ENSG00000130775		0.433	THEMIS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	THEMIS2	HGNC	protein_coding	OTTHUMT00000011148.1	-	0.00	31	0	G	NM_004848		28211733	+1	tier1	-	no_errors	ENST00000492877	ensembl	human	known	74_37	rna	9.80	46	5	SNP	0.000	T
TGFBR3	7049	genome.wustl.edu	37	1	92224237	92224237	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:92224237G>A	ENST00000525962.1	-	3	378	c.317C>T	c.(316-318)tCc>tTc	p.S106F	TGFBR3_ENST00000370399.2_Missense_Mutation_p.S106F|TGFBR3_ENST00000212355.4_Missense_Mutation_p.S106F|TGFBR3_ENST00000468996.2_5'UTR			Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	106					blastocyst development (GO:0001824)|blood vessel development (GO:0001568)|BMP signaling pathway (GO:0030509)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cell growth (GO:0016049)|cell migration (GO:0016477)|definitive erythrocyte differentiation (GO:0060318)|definitive hemopoiesis (GO:0060216)|epithelial to mesenchymal transition (GO:0001837)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|negative regulation of cellular component movement (GO:0051271)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of protein binding (GO:0043393)|response to follicle-stimulating hormone (GO:0032354)|response to hypoxia (GO:0001666)|response to luteinizing hormone (GO:0034699)|response to prostaglandin E (GO:0034695)|transforming growth factor beta receptor complex assembly (GO:0007181)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	coreceptor activity (GO:0015026)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|PDZ domain binding (GO:0030165)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type III (GO:0070123)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(24)|ovary(3)|prostate(4)|skin(1)|stomach(1)|urinary_tract(3)	55		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		GGGGTGTGGGGAGTTGAGCAG	0.512																																																	0													152.0	138.0	142.0					1																	92224237		2203	4300	6503	SO:0001583	missense	0			L07594	CCDS30770.1, CCDS55614.1	1p33-p32	2008-02-05	2007-02-15		ENSG00000069702	ENSG00000069702		"""Proteoglycans / Cell surface : Other"""	11774	protein-coding gene	gene with protein product	"""betaglycan proteoglycan"""	600742	"""transforming growth factor, beta receptor III (betaglycan, 300kDa)"""			1333192, 1319842	Standard	NM_001195684		Approved	betaglycan, BGCAN	uc001doh.3	Q03167	OTTHUMG00000010097	ENST00000525962.1:c.317C>T	1.37:g.92224237G>A	ENSP00000436127:p.Ser106Phe		A0AUW8|A8K5N0|B9EG88|Q5T2T4|Q5U731|Q9UGI2	Missense_Mutation	SNP	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom,prints_ZP_dom	p.S106F	ENST00000525962.1	37	c.317	CCDS30770.1	1	.	.	.	.	.	.	.	.	.	.	G	19.77	3.888966	0.72524	.	.	ENSG00000069702	ENST00000212355;ENST00000370399;ENST00000525962;ENST00000465892	T;T;T;T	0.50813	0.73;0.73;0.73;0.73	5.5	4.57	0.56435	.	0.052412	0.85682	D	0.000000	T	0.59569	0.2203	M	0.66939	2.045	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.66720	-0.5852	10	0.72032	D	0.01	-17.2147	16.1698	0.81801	0.0:0.1336:0.8664:0.0	.	106;106	Q03167-2;Q03167	.;TGBR3_HUMAN	F	106	ENSP00000212355:S106F;ENSP00000359426:S106F;ENSP00000436127:S106F;ENSP00000432638:S106F	ENSP00000212355:S106F	S	-	2	0	TGFBR3	91996825	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	7.543000	0.82106	1.290000	0.44636	0.561000	0.74099	TCC	TGFBR3	-	NULL	ENSG00000069702		0.512	TGFBR3-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TGFBR3	HGNC	protein_coding	OTTHUMT00000382308.1	-	0.00	65	0	G	NM_003243		92224237	-1	tier1	-	no_errors	ENST00000212355	ensembl	human	known	74_37	missense	11.11	48	6	SNP	1.000	A
THSD7B	80731	genome.wustl.edu	37	2	138320820	138320820	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:138320820G>T	ENST00000409968.1	+	16	3346	c.3168G>T	c.(3166-3168)gaG>gaT	p.E1056D	THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000272643.3_Missense_Mutation_p.E1059D|THSD7B_ENST00000413152.2_Missense_Mutation_p.E1028D			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1058	TSP type-1 13. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		GTTACAGTGAGTGCAATCAGT	0.413																																																	0													118.0	112.0	114.0					2																	138320820		1952	4144	6096	SO:0001583	missense	0					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.3168G>T	2.37:g.138320820G>T	ENSP00000387145:p.Glu1056Asp			Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.E1059D	ENST00000409968.1	37	c.3177		2	.	.	.	.	.	.	.	.	.	.	G	0.998	-0.691769	0.03303	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.58358	0.34;0.34;0.34	5.14	1.1	0.20463	.	0.105097	0.64402	D	0.000005	T	0.19685	0.0473	N	0.02011	-0.69	0.80722	D	1	B	0.16802	0.019	B	0.20384	0.029	T	0.26121	-1.0112	10	0.05620	T	0.96	.	9.4415	0.38670	0.3727:0.0:0.6273:0.0	.	1028	C9JKN6	.	D	1056;1059;1028	ENSP00000387145:E1056D;ENSP00000272643:E1059D;ENSP00000413841:E1028D	ENSP00000272643:E1059D	E	+	3	2	THSD7B	138037290	0.958000	0.32768	1.000000	0.80357	0.998000	0.95712	0.045000	0.14013	0.228000	0.21019	0.585000	0.79938	GAG	THSD7B	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000144229		0.413	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	-	0.00	32	0	G	XM_046570.9		138320820	+1	tier1	-	no_errors	ENST00000272643	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.994	T
TIMM17A	10440	genome.wustl.edu	37	1	201932800	201932800	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:201932800G>T	ENST00000367287.4	+	4	283	c.247G>T	c.(247-249)Gtc>Ttc	p.V83F	TIMM17A_ENST00000482943.1_3'UTR	NM_006335.2	NP_006326.1	Q99595	TI17A_HUMAN	translocase of inner mitochondrial membrane 17 homolog A (yeast)	83					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane presequence translocase complex (GO:0005744)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			kidney(1)|lung(3)|stomach(1)	5						TATGGTTCAAGTCAGAGGAAA	0.393																																																	0													95.0	90.0	91.0					1																	201932800		2203	4300	6503	SO:0001583	missense	0			AF106622	CCDS1417.1	1q32.1	2008-05-23			ENSG00000134375	ENSG00000134375			17315	protein-coding gene	gene with protein product		605057				8893850, 10339406	Standard	NM_006335		Approved	TIM17, TIM17A	uc001gxc.3	Q99595	OTTHUMG00000035806	ENST00000367287.4:c.247G>T	1.37:g.201932800G>T	ENSP00000356256:p.Val83Phe		B2RDM5|Q9BWF5	Missense_Mutation	SNP	pfam_Tim17/Tim22/Tim23/PMP24,tigrfam_Tim17	p.V83F	ENST00000367287.4	37	c.247	CCDS1417.1	1	.	.	.	.	.	.	.	.	.	.	G	12.70	2.018024	0.35606	.	.	ENSG00000134375	ENST00000367287	T	0.30182	1.54	5.35	3.46	0.39613	.	0.211136	0.49305	D	0.000158	T	0.23210	0.0561	L	0.33339	1.005	0.45648	D	0.998571	B	0.23377	0.084	B	0.32677	0.15	T	0.05209	-1.0899	10	0.27785	T	0.31	-13.5443	7.2394	0.26088	0.2784:0.0:0.7216:0.0	.	83	Q99595	TI17A_HUMAN	F	83	ENSP00000356256:V83F	ENSP00000356256:V83F	V	+	1	0	TIMM17A	200199423	0.994000	0.37717	0.230000	0.23976	0.963000	0.63663	1.745000	0.38278	0.725000	0.32318	0.655000	0.94253	GTC	TIMM17A	-	pfam_Tim17/Tim22/Tim23/PMP24,tigrfam_Tim17	ENSG00000134375		0.393	TIMM17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMM17A	HGNC	protein_coding	OTTHUMT00000087092.1	-	0.00	54	0	G	NM_006335		201932800	+1	tier1	-	no_errors	ENST00000367287	ensembl	human	known	74_37	missense	9.52	57	6	SNP	0.972	T
TMC3	342125	genome.wustl.edu	37	15	81644086	81644086	+	Silent	SNP	G	G	T	rs61750033		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:81644086G>T	ENST00000359440.5	-	10	1167	c.1032C>A	c.(1030-1032)tcC>tcA	p.S344S	RP11-761I4.3_ENST00000560851.1_RNA|TMC3_ENST00000558726.1_Silent_p.S344S|RP11-761I4.3_ENST00000559781.1_RNA	NM_001080532.1	NP_001074001.1			transmembrane channel-like 3											autonomic_ganglia(2)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	34						CCAGCTTCTGGGACCGGTCCA	0.522																																																	0													56.0	55.0	55.0					15																	81644086		1987	4176	6163	SO:0001819	synonymous_variant	0			AY263163	CCDS45324.1	15q24.3	2006-11-24				ENSG00000188869			22995	protein-coding gene	gene with protein product						12906855, 12812529	Standard	NM_001080532		Approved		uc021ssk.1	Q7Z5M5		ENST00000359440.5:c.1032C>A	15.37:g.81644086G>T				Silent	SNP	pfam_TMC	p.S344	ENST00000359440.5	37	c.1032	CCDS45324.1	15																																																																																			TMC3	-	NULL	ENSG00000188869		0.522	TMC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TMC3	HGNC	protein_coding	OTTHUMT00000417795.3	-	0.00	26	0	G	NM_181841		81644086	-1	tier1	-	no_errors	ENST00000359440	ensembl	human	known	74_37	silent	11.43	31	4	SNP	1.000	T
TMEM104	54868	genome.wustl.edu	37	17	72781707	72781707	+	Silent	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:72781707C>T	ENST00000335464.5	+	3	294	c.132C>T	c.(130-132)gtC>gtT	p.V44V	TMEM104_ENST00000582330.1_Silent_p.V44V|TMEM104_ENST00000582773.1_Silent_p.V44V|TMEM104_ENST00000417024.2_Intron	NM_017728.3	NP_060198.3	Q8NE00	TM104_HUMAN	transmembrane protein 104	44						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(1)	19	all_lung(278;0.23)					GGTGGCTTGTCAGCCTCGTCC	0.627																																																	0													94.0	72.0	79.0					17																	72781707		2203	4300	6503	SO:0001819	synonymous_variant	0			AK074029	CCDS32723.1	17q25.1	2005-12-19				ENSG00000109066			25984	protein-coding gene	gene with protein product							Standard	NM_017728		Approved	FLJ20255, FLJ00021	uc002jls.4	Q8NE00		ENST00000335464.5:c.132C>T	17.37:g.72781707C>T			Q8TEU1|Q9NT56|Q9NXH1	Silent	SNP	pfam_AA_transpt_TM	p.V44	ENST00000335464.5	37	c.132	CCDS32723.1	17																																																																																			TMEM104	-	pfam_AA_transpt_TM	ENSG00000109066		0.627	TMEM104-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM104	HGNC	protein_coding	OTTHUMT00000444442.1	-	0.00	38	0	C	NM_017728		72781707	+1	tier1	-	no_errors	ENST00000335464	ensembl	human	known	74_37	silent	43.75	36	28	SNP	1.000	T
TMEM132C	92293	genome.wustl.edu	37	12	128899806	128899806	+	Silent	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:128899806C>T	ENST00000435159.2	+	2	615	c.615C>T	c.(613-615)ttC>ttT	p.F205F		NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	205						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CCAGCTGGTTCAGTGCCCCGA	0.647																																																	0													20.0	25.0	24.0					12																	128899806		692	1591	2283	SO:0001819	synonymous_variant	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.615C>T	12.37:g.128899806C>T			Q69YX8	Silent	SNP	NULL	p.F205	ENST00000435159.2	37	c.615		12																																																																																			TMEM132C	-	NULL	ENSG00000181234		0.647	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		-	0.00	54	0	C	XM_044062		128899806	+1	tier1	-	no_errors	ENST00000435159	ensembl	human	known	74_37	silent	15.38	22	4	SNP	0.953	T
TMEM200C	645369	genome.wustl.edu	37	18	5890236	5890236	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr18:5890236G>T	ENST00000581347.2	-	3	2472	c.1827C>A	c.(1825-1827)gcC>gcA	p.A609A	RP11-945C19.4_ENST00000582939.1_RNA|TMEM200C_ENST00000383490.2_Silent_p.A609A|RP11-945C19.4_ENST00000580845.1_RNA|RP11-945C19.4_ENST00000577694.1_RNA			A6NKL6	T200C_HUMAN	transmembrane protein 200C	609						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)	12						CTACCCCTATGGCATGAGACC	0.527																																																	0													95.0	91.0	92.0					18																	5890236		1878	4109	5987	SO:0001819	synonymous_variant	0				CCDS45825.1	18p11.31	2009-09-08			ENSG00000206432	ENSG00000206432			37208	protein-coding gene	gene with protein product						15722956	Standard	NM_001080209		Approved	TTMA	uc002kmx.1	A6NKL6		ENST00000581347.2:c.1827C>A	18.37:g.5890236G>T				Silent	SNP	pfam_DUF2371_TMEM200	p.A609	ENST00000581347.2	37	c.1827	CCDS45825.1	18																																																																																			TMEM200C	-	NULL	ENSG00000206432		0.527	TMEM200C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM200C	HGNC	protein_coding	OTTHUMT00000441917.4	-	0.00	54	0	G	NM_001080209		5890236	-1	tier1	-	no_errors	ENST00000383490	ensembl	human	known	74_37	silent	6.56	57	4	SNP	0.004	T
TMEM241	85019	genome.wustl.edu	37	18	20932195	20932195	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr18:20932195G>T	ENST00000383233.3	-	13	782	c.730C>A	c.(730-732)Cca>Aca	p.P244T	TMEM241_ENST00000542162.1_3'UTR|TMEM241_ENST00000450466.2_Missense_Mutation_p.P123T	NM_032933.4	NP_116322.3	Q24JQ0	TM241_HUMAN	transmembrane protein 241	244						integral component of membrane (GO:0016021)											CACTGCCCTGGGGCCAGAAGG	0.448																																																	0													100.0	98.0	98.0					18																	20932195		1851	4100	5951	SO:0001583	missense	0			BC082984	CCDS11876.2	18q11.2	2011-11-25	2011-11-25	2011-11-25	ENSG00000134490	ENSG00000134490			31723	protein-coding gene	gene with protein product		615430	"""chromosome 18 open reading frame 45"""	C18orf45		12477932	Standard	NM_032933		Approved	MGC11386, FLJ44259	uc002kuf.3	Q24JQ0	OTTHUMG00000131771	ENST00000383233.3:c.730C>A	18.37:g.20932195G>T	ENSP00000372720:p.Pro244Thr		I0J130|Q6ZTS7|Q6ZW41	Missense_Mutation	SNP	NULL	p.P244T	ENST00000383233.3	37	c.730	CCDS11876.2	18	.	.	.	.	.	.	.	.	.	.	G	10.32	1.317479	0.23908	.	.	ENSG00000134490	ENST00000450466;ENST00000383233	T;T	0.69806	0.78;-0.43	5.48	4.58	0.56647	.	0.513127	0.14003	U	0.347965	T	0.52191	0.1719	L	0.27053	0.805	0.80722	D	1	B	0.33583	0.418	B	0.27796	0.083	T	0.57335	-0.7829	10	0.66056	D	0.02	-19.0497	12.4526	0.55684	0.0:0.1669:0.8331:0.0	.	244	Q24JQ0	CR045_HUMAN	T	123;244	ENSP00000414899:P123T;ENSP00000372720:P244T	ENSP00000372720:P244T	P	-	1	0	C18orf45	19186193	1.000000	0.71417	0.995000	0.50966	0.093000	0.18481	2.835000	0.48175	2.575000	0.86900	0.655000	0.94253	CCA	TMEM241	-	NULL	ENSG00000134490		0.448	TMEM241-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM241	HGNC	protein_coding	OTTHUMT00000254702.3	-	0.00	45	0	G	NM_032933		20932195	-1	tier1	-	no_errors	ENST00000383233	ensembl	human	known	74_37	missense	6.93	94	7	SNP	0.998	T
TMEM30A	55754	genome.wustl.edu	37	6	75974998	75974998	+	Silent	SNP	G	G	A	rs370998387		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:75974998G>A	ENST00000230461.6	-	3	731	c.402C>T	c.(400-402)taC>taT	p.Y134Y	TMEM30A_ENST00000475111.2_Silent_p.Y98Y|TMEM30A_ENST00000370050.5_Silent_p.Y15Y	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A	134					drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GAGATTTCACGTAACGACGAT	0.299																																																	0													77.0	75.0	76.0					6																	75974998		2203	4297	6500	SO:0001819	synonymous_variant	0			AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.402C>T	6.37:g.75974998G>A			A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Silent	SNP	pfam_DUF284_TM_euk,pirsf_DUF284_TM_euk	p.Y134	ENST00000230461.6	37	c.402	CCDS4983.1	6																																																																																			TMEM30A	-	pfam_DUF284_TM_euk,pirsf_DUF284_TM_euk	ENSG00000112697		0.299	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM30A	HGNC	protein_coding	OTTHUMT00000041248.2	-	0.00	33	0	G	NM_018247		75974998	-1	tier1	-	no_errors	ENST00000230461	ensembl	human	known	74_37	silent	23.73	45	14	SNP	0.953	A
TMEM9B	56674	genome.wustl.edu	37	11	8969870	8969870	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:8969870G>T	ENST00000534025.1	-	5	1053	c.594C>A	c.(592-594)agC>agA	p.S198R	TMEM9B_ENST00000309134.5_Missense_Mutation_p.S124R|TMEM9B_ENST00000525069.1_Missense_Mutation_p.S124R	NM_020644.1	NP_065695.1	Q9NQ34	TMM9B_HUMAN	TMEM9 domain family, member B	198					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			breast(1)|lung(1)|prostate(1)	3				Epithelial(150;4.39e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0237)		TTCCCAATTAGCTGAGGACAA	0.448																																																	0													122.0	117.0	119.0					11																	8969870		2201	4296	6497	SO:0001583	missense	0			AJ400877	CCDS7796.1, CCDS66021.1	11p15.3	2008-02-05	2005-10-06	2005-10-06	ENSG00000175348	ENSG00000175348			1168	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 15"""	C11orf15		11528127	Standard	NM_001286095		Approved		uc001mhe.1	Q9NQ34	OTTHUMG00000165676	ENST00000534025.1:c.594C>A	11.37:g.8969870G>T	ENSP00000433361:p.Ser198Arg		Q7Z649	Missense_Mutation	SNP	pfam_TMEM9	p.S198R	ENST00000534025.1	37	c.594	CCDS7796.1	11	.	.	.	.	.	.	.	.	.	.	G	17.42	3.385831	0.61956	.	.	ENSG00000175348	ENST00000309134;ENST00000534025;ENST00000525069	.	.	.	5.96	3.89	0.44902	.	0.000000	0.85682	D	0.000000	T	0.63260	0.2496	L	0.40543	1.245	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.64984	-0.6278	9	0.87932	D	0	.	7.1635	0.25677	0.3064:0.0:0.6936:0.0	.	198	Q9NQ34	TMM9B_HUMAN	R	124;198;124	.	ENSP00000311842:S124R	S	-	3	2	TMEM9B	8926446	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	3.853000	0.55941	1.532000	0.49169	0.655000	0.94253	AGC	TMEM9B	-	NULL	ENSG00000175348		0.448	TMEM9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM9B	HGNC	protein_coding	OTTHUMT00000385722.1	-	0.00	66	0	G			8969870	-1	tier1	-	no_errors	ENST00000534025	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
TNK2	10188	genome.wustl.edu	37	3	195595154	195595154	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:195595154G>T	ENST00000333602.6	-	12	2587	c.1970C>A	c.(1969-1971)gCg>gAg	p.A657E	TNK2_ENST00000428187.1_Missense_Mutation_p.A689E|TNK2_ENST00000392400.1_Missense_Mutation_p.A657E|TNK2_ENST00000381916.2_Missense_Mutation_p.A735E	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	657	Pro-rich.			Missing (in Ref. 4; AAH08884). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	AGGGACCCCCGCGCCCACGAG	0.701																																																	0													17.0	24.0	21.0					3																	195595154		2184	4276	6460	SO:0001583	missense	0			L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.1970C>A	3.37:g.195595154G>T	ENSP00000329425:p.Ala657Glu		Q6ZMQ0|Q8N6U7|Q96H59	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Cdc42_binding_dom_like,pfam_Inhibitor_Mig-6,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_SAM/pointed,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SH3_domain,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.A735E	ENST00000333602.6	37	c.2204	CCDS33928.1	3	.	.	.	.	.	.	.	.	.	.	G	0.729	-0.780468	0.02929	.	.	ENSG00000061938	ENST00000333602;ENST00000381916;ENST00000416152;ENST00000428187;ENST00000392400	T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42	5.19	3.39	0.38822	.	1.185490	0.05849	N	0.620879	T	0.36110	0.0955	N	0.12182	0.205	0.23016	N	0.998422	B;B;B;B	0.15930	0.004;0.015;0.001;0.015	B;B;B;B	0.11329	0.002;0.006;0.001;0.006	T	0.25467	-1.0131	10	0.15499	T	0.54	.	10.771	0.46323	0.2286:0.0:0.7714:0.0	.	657;735;689;182	Q07912;Q07912-3;C9J1X3;B3KXJ4	ACK1_HUMAN;.;.;.	E	657;735;224;689;657	ENSP00000329425:A657E;ENSP00000371341:A735E;ENSP00000398614:A224E;ENSP00000392546:A689E;ENSP00000376201:A657E	ENSP00000329425:A657E	A	-	2	0	TNK2	197079551	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.479000	0.22228	0.221000	0.20879	-1.120000	0.02017	GCG	TNK2	-	NULL	ENSG00000061938		0.701	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TNK2	HGNC	protein_coding	OTTHUMT00000341437.3		0.00	51	0	G	NM_005781		195595154	-1			no_errors	ENST00000381916	ensembl	human	known	74_37	missense	6.98	40	3	SNP	0.012	T
TNRC6C	57690	genome.wustl.edu	37	17	76061018	76061018	+	Splice_Site	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:76061018G>T	ENST00000588061.1	+	6	3338	c.2611G>T	c.(2611-2613)Gct>Tct	p.A871S	TNRC6C_ENST00000588847.1_Splice_Site_p.A868S|RNU6-625P_ENST00000459412.1_RNA|TNRC6C_ENST00000301624.4_Splice_Site_p.A871S|TNRC6C_ENST00000541771.1_Splice_Site_p.A871S|TNRC6C_ENST00000335749.4_Splice_Site_p.A868S|TNRC6C_ENST00000544502.1_Splice_Site_p.A868S			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	871	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			GTGCAAACCAGGTAAGCCTAG	0.502																																																	0													14.0	16.0	16.0					17																	76061018		1957	4162	6119	SO:0001630	splice_region_variant	0			AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.2611+1G>T	17.37:g.76061018G>T			G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.A868S	ENST00000588061.1	37	c.2602	CCDS45798.1	17	.	.	.	.	.	.	.	.	.	.	G	21.0	4.078084	0.76528	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.39	5.39	0.77823	Argonaute hook domain (1);	0.107851	0.64402	D	0.000005	T	0.64294	0.2585	M	0.75447	2.3	0.80722	D	1	P;D;D	0.63880	0.553;0.962;0.993	B;P;D	0.65323	0.306;0.743;0.934	T	0.62393	-0.6864	10	0.36615	T	0.2	-9.7369	19.1425	0.93451	0.0:0.0:1.0:0.0	.	868;871;871	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	S	871;868;868;871;871;868	ENSP00000336783:A868S;ENSP00000301624:A871S;ENSP00000440310:A871S;ENSP00000442421:A868S	ENSP00000301624:A871S	A	+	1	0	TNRC6C	73572613	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	9.329000	0.96413	2.519000	0.84933	0.655000	0.94253	GCT	TNRC6C	-	pfam_Argonaute_hook_dom	ENSG00000078687		0.502	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TNRC6C	HGNC	protein_coding	OTTHUMT00000395947.1		0.00	18	0	G	NM_018996	Missense_Mutation	76061018	+1			no_errors	ENST00000335749	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577106	7577106	+	Missense_Mutation	SNP	G	G	A	rs17849781		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:7577106G>A	ENST00000269305.4	-	8	1021	c.832C>T	c.(832-834)Cct>Tct	p.P278S	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.P278S|TP53_ENST00000420246.2_Missense_Mutation_p.P278S|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.P278S|TP53_ENST00000445888.2_Missense_Mutation_p.P278S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	278	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation; dbSNP:rs17849781). {ECO:0000269|PubMed:15489334}.|P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.|P -> R (in sporadic cancers; somatic mutation).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:9450901}.|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P278S(55)|p.P278A(24)|p.P278T(23)|p.0?(8)|p.P278F(3)|p.P278fs*67(3)|p.?(2)|p.P278fs*28(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.F270_D281del12(1)|p.C275fs*67(1)|p.V274_P278del(1)|p.S269fs*21(1)|p.C277_P278insXXXXXXX(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTCTCCCAGGACAGGCACAA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	131	Substitution - Missense(105)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Insertion - Frameshift(2)|Unknown(2)|Insertion - In frame(1)	upper_aerodigestive_tract(19)|breast(18)|skin(16)|large_intestine(14)|oesophagus(11)|lung(11)|central_nervous_system(7)|stomach(5)|haematopoietic_and_lymphoid_tissue(5)|ovary(4)|bone(4)|kidney(3)|endometrium(3)|urinary_tract(3)|soft_tissue(2)|pancreas(2)|eye(1)|biliary_tract(1)|liver(1)|prostate(1)	GRCh37	CM011015|CM052927	TP53	M	rs17849781						72.0	62.0	65.0					17																	7577106		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.832C>T	17.37:g.7577106G>A	ENSP00000269305:p.Pro278Ser		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.P278S	ENST00000269305.4	37	c.832	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	31	5.064500	0.93898	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99881	-7.47;-7.47;-7.47;-7.47;-7.47;-7.47	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.050655	0.85682	D	0.000000	D	0.99906	0.9955	M	0.92459	3.31	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.97110	0.988;1.0;0.987;0.975	D	0.96190	0.9137	10	0.87932	D	0	-13.7877	16.1198	0.81342	0.0:0.0:1.0:0.0	.	278;278;278;278	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	S	278;278;278;278;278;267;146	ENSP00000352610:P278S;ENSP00000269305:P278S;ENSP00000398846:P278S;ENSP00000391127:P278S;ENSP00000391478:P278S;ENSP00000425104:P146S	ENSP00000269305:P278S	P	-	1	0	TP53	7517831	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.573000	0.98181	2.667000	0.90743	0.462000	0.41574	CCT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	350	0	G	NM_000546		7577106	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	27.54	171	65	SNP	1.000	A
TNRC6C	57690	genome.wustl.edu	37	17	76083023	76083023	+	Silent	SNP	G	G	T	rs34543719	byFrequency	TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:76083023G>T	ENST00000588061.1	+	15	4378	c.3651G>T	c.(3649-3651)ccG>ccT	p.P1217P	TNRC6C_ENST00000588847.1_Silent_p.P1214P|TNRC6C_ENST00000301624.4_Silent_p.P1217P|TNRC6C_ENST00000541771.1_Silent_p.P1217P|TNRC6C_ENST00000335749.4_Silent_p.P1214P|TNRC6C_ENST00000544502.1_Silent_p.P1214P			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	1217	Pro-rich.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			AGCCACCACCGCCACCGCCCC	0.672																																																	0													36.0	47.0	43.0					17																	76083023		2099	4217	6316	SO:0001819	synonymous_variant	0			AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.3651G>T	17.37:g.76083023G>T			G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Silent	SNP	pfam_Argonaute_hook_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.P1214	ENST00000588061.1	37	c.3642	CCDS45798.1	17																																																																																			TNRC6C	-	NULL	ENSG00000078687		0.672	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TNRC6C	HGNC	protein_coding	OTTHUMT00000395947.1		0.00	33	0	G	NM_018996		76083023	+1			no_errors	ENST00000335749	ensembl	human	known	74_37	silent	5.66	50	3	SNP	0.999	T
TPX2	22974	genome.wustl.edu	37	20	30380547	30380547	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr20:30380547G>C	ENST00000300403.6	+	13	1951	c.1423G>C	c.(1423-1425)Gaa>Caa	p.E475Q	TPX2_ENST00000340513.4_Missense_Mutation_p.E511Q	NM_012112.4	NP_036244.2	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated	475					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|regulation of mitotic spindle organization (GO:0060236)	axon hillock (GO:0043203)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			GGGTGTTCCTGAAAAGAAGGT	0.428																																																	0													148.0	138.0	142.0					20																	30380547		2203	4300	6503	SO:0001583	missense	0			AF098158	CCDS13190.1	20q11.2	2013-07-23	2013-07-23	2003-10-08	ENSG00000088325	ENSG00000088325			1249	protein-coding gene	gene with protein product		605917	"""chromosome 20 open reading frame 1"", ""TPX2, microtubule-associated, homolog (Xenopus laevis)"""	C20orf2, C20orf1		9207457, 10393424	Standard	NM_012112		Approved	p100, DIL-2	uc002wwp.1	Q9ULW0	OTTHUMG00000032190	ENST00000300403.6:c.1423G>C	20.37:g.30380547G>C	ENSP00000300403:p.Glu475Gln		Q9H1R4|Q9NRA3|Q9UFN9|Q9UL00|Q9Y2M1	Missense_Mutation	SNP	pfam_TPX2_central_dom,pfam_Aurora-A-bd,pfam_TPX2_dom_C	p.E511Q	ENST00000300403.6	37	c.1531	CCDS13190.1	20	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622257	0.46840	.	.	ENSG00000088325	ENST00000300403;ENST00000340513	T	0.32753	1.44	5.85	4.85	0.62838	.	0.193819	0.43919	D	0.000517	T	0.22589	0.0545	N	0.21282	0.65	0.49915	D	0.999833	P;P	0.40282	0.659;0.711	B;B	0.39119	0.284;0.291	T	0.02098	-1.1214	10	0.36615	T	0.2	-21.4246	14.2259	0.65858	0.0:0.2685:0.7315:0.0	.	511;475	Q96RR5;Q9ULW0	.;TPX2_HUMAN	Q	475;511	ENSP00000341145:E511Q	ENSP00000300403:E475Q	E	+	1	0	TPX2	29844208	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	5.840000	0.69402	2.770000	0.95276	0.650000	0.86243	GAA	TPX2	-	pfam_TPX2_central_dom	ENSG00000088325		0.428	TPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPX2	HGNC	protein_coding	OTTHUMT00000078569.2	-	0.00	32	0	G			30380547	+1	tier1	-	no_errors	ENST00000340513	ensembl	human	known	74_37	missense	38.24	21	13	SNP	1.000	C
TRAF3IP1	26146	genome.wustl.edu	37	2	239257449	239257449	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:239257449G>T	ENST00000373327.4	+	11	1549	c.1327G>T	c.(1327-1329)Gag>Tag	p.E443*	TRAF3IP1_ENST00000391994.2_Nonsense_Mutation_p.E443*|TRAF3IP1_ENST00000391993.3_Nonsense_Mutation_p.E377*	NM_015650.3	NP_056465.2	Q8TDR0	MIPT3_HUMAN	TNF receptor-associated factor 3 interacting protein 1	443	DISC1-interaction domain.				cilium assembly (GO:0042384)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic heart tube development (GO:0035050)|intraciliary transport (GO:0042073)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube patterning (GO:0021532)|post-anal tail morphogenesis (GO:0036342)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(2)	23		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)		TGAGGTGCCAGAGACTCCAGA	0.438																																																	0													127.0	130.0	129.0					2																	239257449		2203	4300	6503	SO:0001587	stop_gained	0			AF230877	CCDS33415.1, CCDS46557.1	2q37.3	2014-02-21			ENSG00000204104	ENSG00000204104		"""Intraflagellar transport homologs"""	17861	protein-coding gene	gene with protein product	"""microtubule interacting protein that associates with TRAF3"""	607380				10791955, 12935900	Standard	NM_015650		Approved	MIP-T3, DKFZP434F124, MIPT3, IFT54	uc002vye.3	Q8TDR0	OTTHUMG00000152872	ENST00000373327.4:c.1327G>T	2.37:g.239257449G>T	ENSP00000362424:p.Glu443*		Q6PCT1|Q7L8N9|Q9NRD6|Q9Y4Q1	Nonsense_Mutation	SNP	NULL	p.E443*	ENST00000373327.4	37	c.1327	CCDS33415.1	2	.	.	.	.	.	.	.	.	.	.	G	38	6.776944	0.97829	.	.	ENSG00000204104	ENST00000391993;ENST00000373327;ENST00000391994;ENST00000440998	.	.	.	4.94	4.07	0.47477	.	0.335345	0.30547	N	0.009396	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-37.218	9.2566	0.37586	0.1003:0.0:0.8997:0.0	.	.	.	.	X	377;443;443;377	.	ENSP00000362424:E443X	E	+	1	0	TRAF3IP1	238922188	0.985000	0.35326	0.061000	0.19648	0.004000	0.04260	4.477000	0.60223	1.086000	0.41228	0.650000	0.86243	GAG	TRAF3IP1	-	NULL	ENSG00000204104		0.438	TRAF3IP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRAF3IP1	HGNC	protein_coding	OTTHUMT00000328312.1	-	0.00	55	0	G	NM_015650		239257449	+1	tier1	-	no_errors	ENST00000373327	ensembl	human	known	74_37	nonsense	6.90	54	4	SNP	0.280	T
TRAPPC4	51399	genome.wustl.edu	37	11	118890872	118890872	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:118890872C>G	ENST00000533632.1	+	3	727	c.363C>G	c.(361-363)atC>atG	p.I121M	RPS25_ENST00000528547.1_5'Flank|TRAPPC4_ENST00000359005.4_Missense_Mutation_p.I121M|TRAPPC4_ENST00000434101.2_Intron|TRAPPC4_ENST00000525303.1_Intron|TRAPPC4_ENST00000533058.1_Missense_Mutation_p.I121M|TRAPPC4_ENST00000528230.1_Missense_Mutation_p.I78M|RPS25_ENST00000527673.1_5'Flank|MIR3656_ENST00000577421.1_RNA	NM_016146.4	NP_057230.1	Q9Y296	TPPC4_HUMAN	trafficking protein particle complex 4	121					dendrite development (GO:0016358)|ER to Golgi vesicle-mediated transport (GO:0006888)|extracellular matrix organization (GO:0030198)	cis-Golgi network (GO:0005801)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi stack (GO:0005795)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)|TRAPP complex (GO:0030008)				NS(1)|endometrium(1)|large_intestine(2)|lung(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		TCTTTGCCATCGGCTCCCAGC	0.488																																																	0													77.0	63.0	68.0					11																	118890872		2200	4295	6495	SO:0001583	missense	0			AF078862	CCDS8407.1	11q23.3	2011-10-10				ENSG00000196655		"""Trafficking protein particle complex"""	19943	protein-coding gene	gene with protein product		610971				10810093	Standard	NM_016146		Approved	TRS23, SBDN, PTD009	uc010ryo.2	Q9Y296		ENST00000533632.1:c.363C>G	11.37:g.118890872C>G	ENSP00000436005:p.Ile121Met		A8K3A5|B4DME1	Missense_Mutation	SNP	pfam_Sybindin,pfam_Sedlin,superfamily_Longin-like_dom	p.I121M	ENST00000533632.1	37	c.363	CCDS8407.1	11	.	.	.	.	.	.	.	.	.	.	C	16.76	3.211027	0.58343	.	.	ENSG00000196655	ENST00000533632;ENST00000528230;ENST00000359005;ENST00000533058	T;T;T;T	0.56103	0.48;0.48;0.48;0.48	5.8	1.6	0.23607	Longin-like (1);	0.000000	0.85682	D	0.000000	T	0.64249	0.2581	M	0.69358	2.11	0.80722	D	1	D;D;D	0.76494	0.999;0.992;0.999	D;D;D	0.76071	0.967;0.934;0.987	T	0.59069	-0.7523	10	0.45353	T	0.12	-10.2603	7.5708	0.27907	0.0:0.4853:0.0:0.5147	.	121;121;121	B4DF86;Q9Y296;B4DF36	.;TPPC4_HUMAN;.	M	121;78;121;121	ENSP00000436005:I121M;ENSP00000436827:I78M;ENSP00000351896:I121M;ENSP00000432920:I121M	ENSP00000351896:I121M	I	+	3	3	TRAPPC4	118396082	0.972000	0.33761	0.998000	0.56505	0.995000	0.86356	0.064000	0.14437	0.009000	0.14813	0.650000	0.86243	ATC	TRAPPC4	-	pfam_Sybindin,superfamily_Longin-like_dom	ENSG00000196655		0.488	TRAPPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAPPC4	HGNC	protein_coding	OTTHUMT00000389332.1		0.00	25	0	C	NM_016146		118890872	+1			no_errors	ENST00000533632	ensembl	human	known	74_37	missense	9.38	29	3	SNP	0.998	G
TRIM42	287015	genome.wustl.edu	37	3	140401907	140401907	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:140401907C>G	ENST00000286349.3	+	2	1136	c.945C>G	c.(943-945)ttC>ttG	p.F315L		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	315						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						TCTGCAAGTTCTCTTTCCACA	0.562																																																	0													255.0	219.0	231.0					3																	140401907		2203	4300	6503	SO:0001583	missense	0			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.945C>G	3.37:g.140401907C>G	ENSP00000286349:p.Phe315Leu		A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Znf_B-box,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.F315L	ENST00000286349.3	37	c.945	CCDS3113.1	3	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.484091	0.01027	.	.	ENSG00000155890	ENST00000286349	T	0.38887	1.11	5.46	-3.37	0.04898	Zinc finger, B-box (2);	1.038480	0.07593	N	0.922284	T	0.17746	0.0426	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35992	-0.9766	10	0.02654	T	1	-26.6273	9.8838	0.41249	0.0:0.2227:0.6128:0.1646	.	315	Q8IWZ5	TRI42_HUMAN	L	315	ENSP00000286349:F315L	ENSP00000286349:F315L	F	+	3	2	TRIM42	141884597	0.000000	0.05858	0.000000	0.03702	0.373000	0.29922	-1.545000	0.02190	-0.640000	0.05495	-0.305000	0.09177	TTC	TRIM42	-	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box	ENSG00000155890		0.562	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM42	HGNC	protein_coding	OTTHUMT00000359531.2	-	0.00	43	0	C	NM_152616		140401907	+1	tier1	-	no_errors	ENST00000286349	ensembl	human	known	74_37	missense	19.40	54	13	SNP	0.000	G
TRIM9	114088	genome.wustl.edu	37	14	51464729	51464729	+	Intron	SNP	G	G	T	rs369002549		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr14:51464729G>T	ENST00000298355.3	-	7	2725				TRIM9_ENST00000360392.4_Missense_Mutation_p.R548S|TRIM9_ENST00000338969.5_Intron	NM_015163.5	NP_055978.4	Q9C026	TRIM9_HUMAN	tripartite motif containing 9						negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of SNARE complex assembly (GO:0035544)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|synaptic vesicle (GO:0008021)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_epithelial(31;0.00418)|Breast(41;0.148)					TAGATGCCACGCAGTTCTCGC	0.562																																																	0													69.0	57.0	61.0					14																	51464729		2203	4300	6503	SO:0001627	intron_variant	0			AF220036	CCDS9703.1, CCDS45105.1	14q21.3	2013-02-11	2011-01-25		ENSG00000100505	ENSG00000100505		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16288	protein-coding gene	gene with protein product		606555	"""tripartite motif-containing 9"""			11331580, 11524423	Standard	NM_015163		Approved	SPRING, RNF91	uc001wyx.4	Q9C026	OTTHUMG00000140291	ENST00000298355.3:c.1603+38C>A	14.37:g.51464729G>T			D3DSB7|D3DSB8|Q92557|Q96D24|Q96NI4|Q9C025|Q9C027	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_Fibronectin_type3,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.R548S	ENST00000298355.3	37	c.1642	CCDS9703.1	14	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299243	0.40694	.	.	ENSG00000100505	ENST00000360392	T	0.51071	0.72	6.06	4.99	0.66335	.	.	.	.	.	T	0.35740	0.0942	.	.	.	0.21553	N	0.999643	B	0.29253	0.239	B	0.28553	0.091	T	0.17198	-1.0377	8	0.56958	D	0.05	.	7.2833	0.26324	0.1256:0.1677:0.7068:0.0	.	548	Q9C026-5	.	S	548	ENSP00000353561:R548S	ENSP00000353561:R548S	R	-	1	0	TRIM9	50534479	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	3.461000	0.53035	2.882000	0.98803	0.655000	0.94253	CGT	TRIM9	-	NULL	ENSG00000100505		0.562	TRIM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM9	HGNC	protein_coding	OTTHUMT00000276874.1		0.00	42	0	G	NM_015163		51464729	-1			no_errors	ENST00000360392	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.994	T
TRMT13	54482	genome.wustl.edu	37	1	100609662	100609662	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:100609662G>T	ENST00000370141.2	+	9	786	c.780G>T	c.(778-780)gtG>gtT	p.V260V	TRMT13_ENST00000493651.1_3'UTR	NM_019083.2	NP_061956.2	Q9NUP7	TRM13_HUMAN	tRNA methyltransferase 13 homolog (S. cerevisiae)	260					tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										AACTACCTGTGGTAGGAATTG	0.373																																																	0													96.0	93.0	94.0					1																	100609662		2203	4300	6503	SO:0001819	synonymous_variant	0			BC075811	CCDS765.1	1p21.2	2012-06-07	2012-06-07	2012-06-07	ENSG00000122435	ENSG00000122435			25502	protein-coding gene	gene with protein product			"""coiled-coil domain containing 76"""	CCDC76		11799066	Standard	NM_019083		Approved	FLJ10287, FLJ11219	uc001dsv.3	Q9NUP7	OTTHUMG00000010841	ENST00000370141.2:c.780G>T	1.37:g.100609662G>T			Q5VVL0|Q9NW65	Silent	SNP	pfam_Methyltransferase_TRM13,pfam_Znf_CCCH-type_TRM13,pfam_TRM13/UPF0224_CHHC_Znf_dom	p.V260	ENST00000370141.2	37	c.780	CCDS765.1	1																																																																																			TRMT13	-	pfam_Methyltransferase_TRM13	ENSG00000122435		0.373	TRMT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT13	HGNC	protein_coding	OTTHUMT00000029919.1	-	0.00	85	0	G	NM_019083		100609662	+1	tier1	-	no_errors	ENST00000370141	ensembl	human	known	74_37	silent	6.25	75	5	SNP	0.966	T
TRMU	55687	genome.wustl.edu	37	22	46752874	46752874	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr22:46752874G>T	ENST00000290846.4	+	11	1577	c.1237G>T	c.(1237-1239)Gat>Tat	p.D413Y	TRMU_ENST00000381019.3_3'UTR	NM_018006.4	NP_060476.2	O75648	MTU1_HUMAN	tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase	413					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|sulfurtransferase activity (GO:0016783)|tRNA binding (GO:0000049)			NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)	10		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)		CAGCCCAGAAGATGGTCCAGG	0.637																																																	0													49.0	52.0	51.0					22																	46752874		2203	4300	6503	SO:0001583	missense	0			AY062123	CCDS14075.1, CCDS63510.1	22q13	2005-08-11	2005-08-11	2005-08-11	ENSG00000100416	ENSG00000100416	2.1.1.61		25481	protein-coding gene	gene with protein product		610230	"""tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase """	TRMT		14746906	Standard	XM_005261678		Approved	FLJ10140, MTO2	uc003bhp.3	O75648	OTTHUMG00000150424	ENST00000290846.4:c.1237G>T	22.37:g.46752874G>T	ENSP00000290846:p.Asp413Tyr		A8K3U7|Q05C99|Q5W9C8|Q66K31|Q6ICC3|Q9NWC1	Missense_Mutation	SNP	pfam_tRNA-specific_2-thiouridylase,pfam_ThiI_C_dom,pfam_NAD/GMP_synthase,tigrfam_tRNA-specific_2-thiouridylase	p.D413Y	ENST00000290846.4	37	c.1237	CCDS14075.1	22	.	.	.	.	.	.	.	.	.	.	G	11.24	1.581503	0.28180	.	.	ENSG00000100416	ENST00000290846	T	0.71579	-0.58	4.16	3.06	0.35304	.	1.375530	0.04565	N	0.392146	T	0.55049	0.1896	N	0.08118	0	0.27307	N	0.957421	P;B	0.38711	0.643;0.006	B;B	0.38056	0.264;0.016	T	0.55108	-0.8192	10	0.62326	D	0.03	.	10.3528	0.43945	0.0:0.2007:0.7993:0.0	.	259;413	O75648-4;O75648	.;MTU1_HUMAN	Y	413	ENSP00000290846:D413Y	ENSP00000290846:D413Y	D	+	1	0	TRMU	45131538	0.000000	0.05858	0.004000	0.12327	0.007000	0.05969	-0.352000	0.07701	2.042000	0.60477	0.491000	0.48974	GAT	TRMU	-	NULL	ENSG00000100416		0.637	TRMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMU	HGNC	protein_coding	OTTHUMT00000318042.2	-	0.00	63	0	G	NM_018006		46752874	+1	tier1	-	no_errors	ENST00000290846	ensembl	human	known	74_37	missense	30.56	25	11	SNP	0.005	T
TRPM3	80036	genome.wustl.edu	37	9	73164474	73164474	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr9:73164474G>T	ENST00000377111.2	-	24	3898	c.3655C>A	c.(3655-3657)Cgg>Agg	p.R1219R	TRPM3_ENST00000396292.4_Silent_p.R1091R|TRPM3_ENST00000377110.3_Silent_p.R1219R|TRPM3_ENST00000360823.2_Silent_p.R1081R|TRPM3_ENST00000358082.3_Silent_p.R1081R|TRPM3_ENST00000396285.1_Silent_p.R1078R|TRPM3_ENST00000377106.1_Silent_p.R1091R|TRPM3_ENST00000377105.1_Silent_p.R1078R|TRPM3_ENST00000423814.3_Silent_p.R1246R|TRPM3_ENST00000396280.5_Silent_p.R1068R|TRPM3_ENST00000408909.2_Silent_p.R1078R|TRPM3_ENST00000357533.2_Silent_p.R1223R	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1244					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GAAGTCACCCGTATCCTCTCA	0.428																																																	0													193.0	150.0	165.0					9																	73164474		2203	4300	6503	SO:0001819	synonymous_variant	0			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.3655C>A	9.37:g.73164474G>T			A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	pfam_Ion_trans_dom	p.R1246	ENST00000377111.2	37	c.3736		9	.	.	.	.	.	.	.	.	.	.	G	9.233	1.036387	0.19669	.	.	ENSG00000083067	ENST00000396280	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	T	0.77418	0.4127	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73503	-0.3962	4	.	.	.	-19.6412	20.8598	0.99761	0.0:0.0:1.0:0.0	.	.	.	.	K	1067	.	.	T	-	2	0	TRPM3	72354294	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	4.922000	0.63404	2.937000	0.99478	0.650000	0.86243	ACG	TRPM3	-	NULL	ENSG00000083067		0.428	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	TRPM3	HGNC	protein_coding	OTTHUMT00000214157.5	-	0.00	59	0	G	NM_206945		73164474	-1	tier1	-	no_errors	ENST00000423814	ensembl	human	known	74_37	silent	6.56	57	4	SNP	1.000	T
TSPYL4	23270	genome.wustl.edu	37	6	116574213	116574213	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:116574213G>T	ENST00000420283.1	-	1	1048	c.959C>A	c.(958-960)tCt>tAt	p.S320Y	RP3-486I3.7_ENST00000448740.2_lincRNA|DSE_ENST00000540275.1_5'Flank	NM_021648.4	NP_067680.3	Q9UJ04	TSYL4_HUMAN	TSPY-like 4	320					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				endometrium(2)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(2)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.045)|OV - Ovarian serous cystadenocarcinoma(136;0.0666)|GBM - Glioblastoma multiforme(226;0.095)|Epithelial(106;0.125)		CACCCGGCCAGAGGATCTGCG	0.537																																																	0													81.0	80.0	80.0					6																	116574213		1937	4170	6107	SO:0001583	missense	0				CCDS5106.1	6q22.1	2010-05-12			ENSG00000187189	ENSG00000187189			21559	protein-coding gene	gene with protein product							Standard	NM_021648		Approved	dJ486I3.2, KIAA0721	uc003pwn.3	Q9UJ04	OTTHUMG00000015429	ENST00000420283.1:c.959C>A	6.37:g.116574213G>T	ENSP00000410943:p.Ser320Tyr		B4DYQ2|O94828|Q96GW8	Missense_Mutation	SNP	pfam_NAP_family	p.S320Y	ENST00000420283.1	37	c.959	CCDS5106.1	6	.	.	.	.	.	.	.	.	.	.	G	13.72	2.320464	0.41096	.	.	ENSG00000187189	ENST00000420283	T	0.27256	1.68	3.98	3.11	0.35812	.	0.774949	0.10130	U	0.712186	T	0.27559	0.0677	M	0.71206	2.165	0.27693	N	0.946052	P	0.41546	0.754	P	0.54431	0.752	T	0.18209	-1.0344	10	0.59425	D	0.04	-4.9977	7.8066	0.29206	0.1118:0.0:0.8882:0.0	.	320	Q9UJ04	TSYL4_HUMAN	Y	320	ENSP00000410943:S320Y	ENSP00000410943:S320Y	S	-	2	0	TSPYL4	116680906	0.999000	0.42202	0.853000	0.33588	0.469000	0.32828	3.634000	0.54302	1.268000	0.44264	0.462000	0.41574	TCT	TSPYL4	-	pfam_NAP_family	ENSG00000187189		0.537	TSPYL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPYL4	HGNC	protein_coding	OTTHUMT00000041934.2		0.00	42	0	G			116574213	-1			no_errors	ENST00000420283	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.861	T
TTC22	55001	genome.wustl.edu	37	1	55253446	55253446	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:55253446G>T	ENST00000371276.4	-	3	780	c.677C>A	c.(676-678)gCc>gAc	p.A226D	TTC22_ENST00000371274.4_Missense_Mutation_p.A226D	NM_001114108.1	NP_001107580.1	Q5TAA0	TTC22_HUMAN	tetratricopeptide repeat domain 22	226										kidney(1)|large_intestine(1)|lung(7)|skin(1)	10						GCGGTTGAAGGCAGGCAGTCT	0.662																																																	0													63.0	55.0	57.0					1																	55253446		2203	4300	6503	SO:0001583	missense	0			AK000626	CCDS598.1, CCDS44152.1	1p32.3	2013-01-11			ENSG00000006555	ENSG00000006555		"""Tetratricopeptide (TTC) repeat domain containing"""	26067	protein-coding gene	gene with protein product							Standard	NM_017904		Approved	FLJ20619	uc009vzt.1	Q5TAA0	OTTHUMG00000009916	ENST00000371276.4:c.677C>A	1.37:g.55253446G>T	ENSP00000360323:p.Ala226Asp		Q9NWT4	Missense_Mutation	SNP	smart_TPR_repeat	p.A226D	ENST00000371276.4	37	c.677	CCDS44152.1	1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.518444	0.27211	.	.	ENSG00000006555	ENST00000371276;ENST00000371274;ENST00000448308	T;T	0.46819	0.86;2.7	4.49	4.49	0.54785	Tetratricopeptide-like helical (1);	0.286229	0.35013	N	0.003514	T	0.33789	0.0875	N	0.19112	0.55	0.39771	D	0.97216	B;B	0.30281	0.18;0.275	B;B	0.30646	0.082;0.118	T	0.25676	-1.0125	10	0.36615	T	0.2	-13.4493	14.2224	0.65836	0.0:0.0:1.0:0.0	.	226;226	Q5TAA0;Q5TAA0-2	TTC22_HUMAN;.	D	226;226;7	ENSP00000360323:A226D;ENSP00000360321:A226D	ENSP00000360321:A226D	A	-	2	0	TTC22	55026034	0.995000	0.38212	0.988000	0.46212	0.232000	0.25224	2.679000	0.46909	2.328000	0.79073	0.462000	0.41574	GCC	TTC22	-	NULL	ENSG00000006555		0.662	TTC22-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TTC22	HGNC	protein_coding	OTTHUMT00000027438.1	-	0.00	105	0	G	NM_017904		55253446	-1	tier1	-	no_errors	ENST00000371276	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.986	T
TTC23	64927	genome.wustl.edu	37	15	99768848	99768848	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:99768848G>C	ENST00000394132.2	-	5	887	c.70C>G	c.(70-72)Cat>Gat	p.H24D	TTC23_ENST00000558613.1_Missense_Mutation_p.H24D|TTC23_ENST00000394136.1_Missense_Mutation_p.H24D|TTC23_ENST00000558663.1_Missense_Mutation_p.H24D|TTC23_ENST00000394130.1_Missense_Mutation_p.H24D|TTC23_ENST00000394129.2_Missense_Mutation_p.H24D|TTC23_ENST00000262074.4_Missense_Mutation_p.H24D|TTC23_ENST00000394135.3_Missense_Mutation_p.H24D			Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23	24										endometrium(2)|large_intestine(3)|lung(9)|urinary_tract(2)	16	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			TTCTTTCTATGAGTGATGCTA	0.393																																																	0													148.0	148.0	148.0					15																	99768848		2197	4297	6494	SO:0001583	missense	0				CCDS10379.2	15q26.3	2013-01-11			ENSG00000103852	ENSG00000103852		"""Tetratricopeptide (TTC) repeat domain containing"""	25730	protein-coding gene	gene with protein product						12477932	Standard	NM_001288615		Approved	FLJ12572, HCC-8	uc002bux.3	Q5W5X9	OTTHUMG00000147344	ENST00000394132.2:c.70C>G	15.37:g.99768848G>C	ENSP00000377690:p.His24Asp		A8K6M5|Q53HK0|Q96BC9|Q9H8W9|Q9H9S7	Missense_Mutation	SNP	smart_TPR_repeat	p.H24D	ENST00000394132.2	37	c.70	CCDS10379.2	15	.	.	.	.	.	.	.	.	.	.	G	2.367	-0.345356	0.05208	.	.	ENSG00000103852	ENST00000394132;ENST00000394136;ENST00000262074;ENST00000394135;ENST00000394130;ENST00000394129	T;T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06;1.06	5.87	2.27	0.28462	.	0.361272	0.28927	N	0.013685	T	0.15132	0.0365	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.19386	-1.0307	10	0.14656	T	0.56	-5.8102	4.7418	0.13015	0.1252:0.0:0.5328:0.342	.	24;24	Q5W5X9-2;Q5W5X9	.;TTC23_HUMAN	D	24	ENSP00000377690:H24D;ENSP00000377693:H24D;ENSP00000262074:H24D;ENSP00000377692:H24D;ENSP00000377688:H24D;ENSP00000457901:H24D	ENSP00000262074:H24D	H	-	1	0	TTC23	97586371	0.022000	0.18835	0.006000	0.13384	0.111000	0.19643	0.574000	0.23714	0.690000	0.31570	-0.122000	0.15005	CAT	TTC23	-	NULL	ENSG00000103852		0.393	TTC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC23	HGNC	protein_coding	OTTHUMT00000303953.2	-	0.00	55	0	G	NM_022905		99768848	-1	tier1	-	no_errors	ENST00000262074	ensembl	human	known	74_37	missense	13.21	46	7	SNP	0.006	C
TTC3	7267	genome.wustl.edu	37	21	38462544	38462544	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr21:38462544C>A	ENST00000399017.2	+	6	3185	c.438C>A	c.(436-438)ttC>ttA	p.F146L	TTC3_ENST00000540756.1_Intron|TTC3_ENST00000399010.1_Missense_Mutation_p.F146L|TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000355666.1_Missense_Mutation_p.F146L|TTC3_ENST00000354749.2_Missense_Mutation_p.F146L	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	146					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				ATGATTCATTCCTTATTGGAG	0.338																																					Ovarian(38;194 1649 35661)												0													79.0	80.0	80.0					21																	38462544		2202	4300	6502	SO:0001583	missense	0			D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.438C>A	21.37:g.38462544C>A	ENSP00000381981:p.Phe146Leu		A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,superfamily_DEATH-like_dom,smart_TPR_repeat,smart_Znf_RING,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.F146L	ENST00000399017.2	37	c.438	CCDS13651.1	21	.	.	.	.	.	.	.	.	.	.	C	15.17	2.752994	0.49362	.	.	ENSG00000182670	ENST00000418766;ENST00000450533;ENST00000355666;ENST00000399010;ENST00000399017;ENST00000354749	T;T;T;T;T	0.48201	2.66;0.82;2.98;2.98;2.98	5.62	3.8	0.43715	.	0.343984	0.24866	N	0.034962	T	0.38268	0.1034	L	0.56769	1.78	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.17289	-1.0374	10	0.19147	T	0.46	-7.893	6.7308	0.23383	0.0:0.7419:0.0:0.2581	.	146	P53804	TTC3_HUMAN	L	146	ENSP00000403943:F146L;ENSP00000408456:F146L;ENSP00000347889:F146L;ENSP00000381981:F146L;ENSP00000346791:F146L	ENSP00000346791:F146L	F	+	3	2	TTC3	37384414	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.681000	0.25320	1.373000	0.46208	0.650000	0.86243	TTC	TTC3	-	NULL	ENSG00000182670		0.338	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC3	HGNC	protein_coding	OTTHUMT00000194776.1	-	0.00	38	0	C			38462544	+1	tier1	-	no_errors	ENST00000354749	ensembl	human	known	74_37	missense	14.63	35	6	SNP	1.000	A
TTI1	9675	genome.wustl.edu	37	20	36625251	36625251	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr20:36625251G>T	ENST00000373448.2	-	7	3136	c.2898C>A	c.(2896-2898)atC>atA	p.I966I	TTI1_ENST00000449821.1_Silent_p.I966I|TTI1_ENST00000373447.3_Silent_p.I966I	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	966					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)				breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						CCCTGGCACTGATGGGGGCCT	0.597																																																	0													94.0	99.0	97.0					20																	36625251		2203	4300	6503	SO:0001819	synonymous_variant	0			BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.2898C>A	20.37:g.36625251G>T			D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Silent	SNP	superfamily_ARM-type_fold,pirsf_UCP005250	p.I966	ENST00000373448.2	37	c.2898	CCDS13300.1	20																																																																																			TTI1	-	superfamily_ARM-type_fold,pirsf_UCP005250	ENSG00000101407		0.597	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTI1	HGNC	protein_coding	OTTHUMT00000079138.2		0.00	26	0	G	NM_014657		36625251	-1			no_errors	ENST00000373447	ensembl	human	known	74_37	silent	5.13	37	2	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179510630	179510630	+	Intron	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:179510630G>A	ENST00000591111.1	-	167	35710				TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000431752.1_RNA|RP11-171I2.3_ENST00000605021.1_lincRNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000418062.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAAAACTTTGGAAGTGGCATT	0.398																																																	0													87.0	81.0	83.0					2																	179510630		1813	4086	5899	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.35485+16C>T	2.37:g.179510630G>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	RNA	SNP	-	NULL	ENST00000591111.1	37	NULL		2																																																																																			TTN-AS1	-	-	ENSG00000237298		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN-AS1	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	92	0	G	NM_133378		179510630	+1	tier1	-	no_errors	ENST00000418062	ensembl	human	known	74_37	rna	17.07	68	14	SNP	0.000	A
TTN	7273	genome.wustl.edu	37	2	179592947	179592947	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:179592947G>T	ENST00000591111.1	-	65	18877	c.18653C>A	c.(18652-18654)tCt>tAt	p.S6218Y	TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.S6535Y|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.S5291Y|RP11-171I2.1_ENST00000590024.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12998	Ig-like 43.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGAGACACAGATCTCTCATG	0.398																																																	0													72.0	69.0	70.0					2																	179592947		1887	4124	6011	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.18653C>A	2.37:g.179592947G>T	ENSP00000465570:p.Ser6218Tyr		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S5291Y	ENST00000591111.1	37	c.15872		2	.	.	.	.	.	.	.	.	.	.	G	7.084	0.570727	0.13560	.	.	ENSG00000155657	ENST00000342992	T	0.68331	-0.32	5.78	5.78	0.91487	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70894	0.3276	L	0.48935	1.535	0.80722	D	1	B	0.30793	0.295	B	0.41332	0.354	T	0.70026	-0.4985	9	0.87932	D	0	.	20.3754	0.98918	0.0:0.0:1.0:0.0	.	6218	Q8WZ42	TITIN_HUMAN	Y	5291	ENSP00000343764:S5291Y	ENSP00000343764:S5291Y	S	-	2	0	TTN	179301192	1.000000	0.71417	0.807000	0.32361	0.548000	0.35241	6.456000	0.73501	2.894000	0.99253	0.591000	0.81541	TCT	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000155657		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	24	0	G	NM_133378		179592947	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.991	T
TTN	7273	genome.wustl.edu	37	2	179658217	179658217	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:179658217C>T	ENST00000591111.1	-	9	1674	c.1450G>A	c.(1450-1452)Gat>Aat	p.D484N	TTN_ENST00000460472.2_Missense_Mutation_p.D484N|TTN_ENST00000589042.1_Missense_Mutation_p.D484N|TTN_ENST00000360870.5_Missense_Mutation_p.D484N|TTN_ENST00000359218.5_Missense_Mutation_p.D484N|TTN_ENST00000342175.6_Missense_Mutation_p.D484N|TTN_ENST00000342992.6_Missense_Mutation_p.D484N			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGGCTTTATCGGCGGCCACT	0.398																																																	0													280.0	277.0	278.0					2																	179658217		2203	4300	6503	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.1450G>A	2.37:g.179658217C>T	ENSP00000465570:p.Asp484Asn		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.D484N	ENST00000591111.1	37	c.1450		2	.	.	.	.	.	.	.	.	.	.	C	14.58	2.578155	0.45902	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870;ENST00000436599	T;T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07;-0.07	5.61	5.61	0.85477	Titin Z (1);Ribonuclease H-like (1);	.	.	.	.	T	0.65964	0.2742	M	0.67953	2.075	0.23632	N	0.99724	B;B;B;B;P	0.47106	0.224;0.224;0.224;0.224;0.89	B;B;B;B;B	0.44224	0.089;0.089;0.121;0.089;0.444	T	0.65010	-0.6272	9	0.87932	D	0	.	14.9885	0.71368	0.0:0.8567:0.1433:0.0	.	484;484;484;484;484	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	N	484;484;484;484;484;484;80	ENSP00000343764:D484N;ENSP00000434586:D484N;ENSP00000340554:D484N;ENSP00000352154:D484N;ENSP00000354117:D484N;ENSP00000405517:D80N	ENSP00000340554:D484N	D	-	1	0	TTN	179366462	0.999000	0.42202	1.000000	0.80357	0.870000	0.49936	3.343000	0.52167	2.791000	0.96007	0.650000	0.86243	GAT	TTN	-	pfam_Titin_Z,superfamily_RNaseH-like_dom	ENSG00000155657		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	59	0	C	NM_133378		179658217	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	12.86	61	9	SNP	1.000	T
TTYH3	80727	genome.wustl.edu	37	7	2691859	2691859	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:2691859G>T	ENST00000258796.7	+	8	1115	c.910G>T	c.(910-912)Gcc>Tcc	p.A304S	TTYH3_ENST00000407643.1_Missense_Mutation_p.A272S|TTYH3_ENST00000403167.1_Missense_Mutation_p.A133S	NM_025250.2	NP_079526.1	Q9C0H2	TTYH3_HUMAN	tweety family member 3	304					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|intracellular calcium activated chloride channel activity (GO:0005229)	p.A304T(1)|p.A304S(1)		kidney(1)|large_intestine(3)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	17		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		GCCCCGCGCCGCCAACCCCTT	0.652																																																	2	Substitution - Missense(2)	large_intestine(1)|lung(1)											43.0	34.0	37.0					7																	2691859		2203	4300	6503	SO:0001583	missense	0				CCDS34588.1	7p22	2013-09-02	2013-09-02		ENSG00000136295	ENSG00000136295			22222	protein-coding gene	gene with protein product		608919	"""tweety homolog 3 (Drosophila)"""				Standard	NM_025250		Approved	KIAA1691	uc003smp.3	Q9C0H2	OTTHUMG00000152050	ENST00000258796.7:c.910G>T	7.37:g.2691859G>T	ENSP00000258796:p.Ala304Ser		A4D201|B7WP98|Q6L749|Q6ZVG3|Q8TEG6	Missense_Mutation	SNP	pfam_Tweety	p.A304S	ENST00000258796.7	37	c.910	CCDS34588.1	7	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.501849	0.00157	.	.	ENSG00000136295	ENST00000258796;ENST00000407643;ENST00000403167	T;T;T	0.10573	2.86;2.86;2.86	4.1	-4.65	0.03339	.	0.594657	0.18439	N	0.141198	T	0.02380	0.0073	N	0.03608	-0.345	0.09310	N	1	B;B	0.17038	0.02;0.001	B;B	0.19148	0.024;0.007	T	0.34875	-0.9811	10	0.07482	T	0.82	-6.5676	1.0808	0.01642	0.4205:0.1669:0.2314:0.1812	.	133;304	Q9C0H2-3;Q9C0H2	.;TTYH3_HUMAN	S	304;272;133	ENSP00000258796:A304S;ENSP00000385316:A272S;ENSP00000385015:A133S	ENSP00000258796:A304S	A	+	1	0	TTYH3	2658385	0.000000	0.05858	0.009000	0.14445	0.053000	0.15095	-0.872000	0.04219	-1.274000	0.02421	-1.151000	0.01829	GCC	TTYH3	-	pfam_Tweety	ENSG00000136295		0.652	TTYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTYH3	HGNC	protein_coding	OTTHUMT00000325082.2		0.00	14	0	G	XM_166523		2691859	+1			no_errors	ENST00000258796	ensembl	human	known	74_37	missense	12.50	21	3	SNP	0.001	T
UBE2D3	7323	genome.wustl.edu	37	4	103720628	103720628	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:103720628C>G	ENST00000453744.2	-	7	847	c.334G>C	c.(334-336)Gat>Cat	p.D112H	UBE2D3_ENST00000394801.4_Missense_Mutation_p.D112H|UBE2D3_ENST00000357194.6_Missense_Mutation_p.D114H|UBE2D3_ENST00000349311.8_Missense_Mutation_p.D112H|UBE2D3_ENST00000502404.1_Missense_Mutation_p.D83H|UBE2D3_ENST00000350435.7_Missense_Mutation_p.D106H|UBE2D3_ENST00000394803.5_Missense_Mutation_p.D112H|UBE2D3_ENST00000507845.1_Missense_Mutation_p.D83H|UBE2D3_ENST00000504211.1_Missense_Mutation_p.D83H|UBE2D3_ENST00000505207.1_Missense_Mutation_p.D83H|UBE2D3_ENST00000321805.7_Missense_Mutation_p.D112H|UBE2D3_ENST00000343106.5_Missense_Mutation_p.D112H|UBE2D3_ENST00000394804.2_Missense_Mutation_p.D112H|UBE2D3_ENST00000338145.3_Missense_Mutation_p.D112H	NM_181891.1	NP_871620.1	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3	112					apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|lung(3)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		GGGTTTGGATCACATAGCAGT	0.343																																																	0													58.0	59.0	58.0					4																	103720628		2203	4299	6502	SO:0001583	missense	0			U39318	CCDS3659.1, CCDS3660.1, CCDS3661.1, CCDS75172.1	4q24	2011-05-19	2011-05-19		ENSG00000109332	ENSG00000109332		"""Ubiquitin-conjugating enzymes E2"""	12476	protein-coding gene	gene with protein product		602963	"""ubiquitin-conjugating enzyme E2D 3 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181886		Approved	UbcH5C	uc003hwl.3	P61077	OTTHUMG00000131119	ENST00000453744.2:c.334G>C	4.37:g.103720628C>G	ENSP00000396901:p.Asp112His		A6NJ93|A6NJB1|A6NM99|P47986|Q6IB88|Q6NXS4|Q8N924	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.D114H	ENST00000453744.2	37	c.340	CCDS3660.1	4	.	.	.	.	.	.	.	.	.	.	C	34	5.336761	0.95758	.	.	ENSG00000109332	ENST00000453744;ENST00000394801;ENST00000394803;ENST00000394804;ENST00000343106;ENST00000321805;ENST00000350435;ENST00000338145;ENST00000349311;ENST00000504211;ENST00000357194;ENST00000505207;ENST00000507845;ENST00000502404	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	5.89	5.89	0.94794	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.138248	0.64402	D	0.000005	D	0.86255	0.5889	M	0.71206	2.165	0.80722	D	1	D;D;D	0.89917	0.997;1.0;0.994	D;D;D	0.71656	0.963;0.974;0.926	D	0.86525	0.1818	10	0.87932	D	0	.	20.2361	0.98357	0.0:1.0:0.0:0.0	.	114;112;112	P61077-3;P61077;P61077-2	.;UB2D3_HUMAN;.	H	112;112;112;112;112;112;106;112;112;83;114;83;83;83	ENSP00000396901:D112H;ENSP00000378280:D112H;ENSP00000378282:D112H;ENSP00000378283:D112H;ENSP00000345285:D112H;ENSP00000318494:D112H;ENSP00000337262:D106H;ENSP00000337208:D112H;ENSP00000344069:D112H;ENSP00000426620:D83H;ENSP00000349722:D114H;ENSP00000426586:D83H;ENSP00000424359:D83H;ENSP00000421904:D83H	ENSP00000318494:D112H	D	-	1	0	UBE2D3	103939740	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.619000	0.83057	2.791000	0.96007	0.591000	0.81541	GAT	UBE2D3	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000109332		0.343	UBE2D3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UBE2D3	HGNC	protein_coding	OTTHUMT00000253791.2	-	0.00	30	0	C	NM_181893		103720628	-1	tier1	-	no_errors	ENST00000357194	ensembl	human	known	74_37	missense	30.00	21	9	SNP	1.000	G
USP1	7398	genome.wustl.edu	37	1	62907260	62907260	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:62907260A>G	ENST00000339950.4	+	3	1087	c.272A>G	c.(271-273)tAt>tGt	p.Y91C	USP1_ENST00000371146.1_Missense_Mutation_p.Y91C	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	91	USP.				DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		AATACTTGCTATCTTAATAGT	0.343																																					Ovarian(122;1846 2315 3982 19504)												0													108.0	110.0	109.0					1																	62907260		2203	4300	6503	SO:0001583	missense	0				CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.272A>G	1.37:g.62907260A>G	ENSP00000343526:p.Tyr91Cys		A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.Y91C	ENST00000339950.4	37	c.272	CCDS621.1	1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.954026	0.73902	.	.	ENSG00000162607	ENST00000452143;ENST00000371146;ENST00000339950	T;D;D	0.87103	0.48;-2.21;-2.21	5.34	4.18	0.49190	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.91965	0.7455	M	0.67397	2.05	0.54753	D	0.999981	D	0.89917	1.0	D	0.97110	1.0	D	0.92291	0.5841	10	0.87932	D	0	-13.0884	12.8377	0.57782	0.8634:0.1366:0.0:0.0	.	91	O94782	UBP1_HUMAN	C	91	ENSP00000403662:Y91C;ENSP00000360188:Y91C;ENSP00000343526:Y91C	ENSP00000343526:Y91C	Y	+	2	0	USP1	62679848	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.653000	0.91088	1.078000	0.41014	0.528000	0.53228	TAT	USP1	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000162607		0.343	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP1	HGNC	protein_coding	OTTHUMT00000024881.1	-	0.00	27	0	A	NM_001017415		62907260	+1	tier1	-	no_errors	ENST00000339950	ensembl	human	known	74_37	missense	28.95	27	11	SNP	1.000	G
USP33	23032	genome.wustl.edu	37	1	78177527	78177527	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:78177527G>T	ENST00000370793.1	-	22	2750	c.2404C>A	c.(2404-2406)Cca>Aca	p.P802T	USP33_ENST00000370794.3_Missense_Mutation_p.P771T|USP33_ENST00000370792.3_Missense_Mutation_p.P794T|USP33_ENST00000357428.1_Missense_Mutation_p.P802T	NM_015017.4	NP_055832.3	Q8TEY7	UBP33_HUMAN	ubiquitin specific peptidase 33	802	DUSP 1. {ECO:0000255|PROSITE- ProRule:PRU00613}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|centrosome duplication (GO:0051298)|endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell body (GO:0044297)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|VCB complex (GO:0030891)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	44						TTGACAGCTGGTCCTCCACCA	0.328																																					Melanoma(152;72 1870 11110 26780 42647)												0													36.0	38.0	37.0					1																	78177527		2203	4300	6503	SO:0001583	missense	0			AF383173	CCDS678.1, CCDS679.1, CCDS680.1	1p31	2008-02-05	2005-08-08		ENSG00000077254	ENSG00000077254		"""Ubiquitin-specific peptidases"""	20059	protein-coding gene	gene with protein product		615146	"""ubiquitin specific protease 33"""			12838346	Standard	NM_015017		Approved	KIAA1097, VDU1	uc001dht.4	Q8TEY7	OTTHUMG00000009651	ENST00000370793.1:c.2404C>A	1.37:g.78177527G>T	ENSP00000359829:p.Pro802Thr		Q8TEY6|Q96AV6|Q9H9F0|Q9UPQ5	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Pept_C19_DUSP,pfam_Znf_UBP,smart_Znf_UBP,smart_Pept_C19_DUSP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.P802T	ENST00000370793.1	37	c.2404	CCDS678.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.3|25.3	4.624942|4.624942	0.87560|0.87560	.|.	.|.	ENSG00000077254|ENSG00000077254	ENST00000481579|ENST00000370794;ENST00000370793;ENST00000357428;ENST00000370792	.|T;T;T;T	.|0.26957	.|1.76;1.7;1.7;1.79	5.37|5.37	5.37|5.37	0.77165|0.77165	.|Peptidase C19, ubiquitin-specific peptidase, DUSP domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.54854|0.54854	0.1884|0.1884	M|M	0.89715|0.89715	3.055|3.055	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.76494	.|0.999;0.999;0.999;0.999	.|D;D;D;D	.|0.74674	.|0.984;0.976;0.963;0.973	T|T	0.64605|0.64605	-0.6368|-0.6368	5|10	.|0.87932	.|D	.|0	.|.	19.4888|19.4888	0.95042|0.95042	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|794;771;802;136	.|Q8TEY7-3;Q8TEY7-2;Q8TEY7;Q9Y417	.|.;.;UBP33_HUMAN;.	E|T	406|771;802;802;794	.|ENSP00000359830:P771T;ENSP00000359829:P802T;ENSP00000350009:P802T;ENSP00000359828:P794T	.|ENSP00000350009:P802T	D|P	-|-	3|1	2|0	USP33|USP33	77950115|77950115	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	9.336000|9.336000	0.96533|0.96533	2.683000|2.683000	0.91414|0.91414	0.655000|0.655000	0.94253|0.94253	GAC|CCA	USP33	-	smart_Pept_C19_DUSP	ENSG00000077254		0.328	USP33-002	KNOWN	basic|CCDS	protein_coding	USP33	HGNC	protein_coding	OTTHUMT00000026923.2	-	0.00	40	0	G	NM_015017		78177527	-1	tier1	-	no_errors	ENST00000357428	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
USH2A	7399	genome.wustl.edu	37	1	216144008	216144008	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:216144008C>T	ENST00000307340.3	-	36	7302	c.6916G>A	c.(6916-6918)Gtc>Atc	p.V2306I	USH2A_ENST00000366943.2_Missense_Mutation_p.V2306I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2306	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CATGCTTGGACTCTGAAGGAA	0.403										HNSCC(13;0.011)																																							0													102.0	96.0	98.0					1																	216144008		2203	4300	6503	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.6916G>A	1.37:g.216144008C>T	ENSP00000305941:p.Val2306Ile		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.V2306I	ENST00000307340.3	37	c.6916	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	13.78	2.338604	0.41398	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.63096	-0.02;-0.02	5.81	2.85	0.33270	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.39687	N	0.001286	T	0.51483	0.1677	L	0.43701	1.375	0.34555	D	0.711773	B	0.18461	0.028	B	0.12837	0.008	T	0.58434	-0.7637	10	0.51188	T	0.08	.	10.3972	0.44207	0.0:0.5458:0.386:0.0681	.	2306	O75445	USH2A_HUMAN	I	2306	ENSP00000305941:V2306I;ENSP00000355910:V2306I	ENSP00000305941:V2306I	V	-	1	0	USH2A	214210631	0.997000	0.39634	0.936000	0.37596	0.964000	0.63967	1.118000	0.31246	0.756000	0.33013	0.591000	0.81541	GTC	USH2A	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.403	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	-	0.00	58	0	C	NM_007123		216144008	-1	tier1	-	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	41.46	23	17	SNP	0.998	T
USP38	84640	genome.wustl.edu	37	4	144106812	144106812	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:144106812G>T	ENST00000307017.4	+	1	715	c.209G>T	c.(208-210)cGa>cTa	p.R70L	RP11-284M14.1_ENST00000507486.1_RNA|RP11-284M14.1_ENST00000507826.1_RNA|USP38_ENST00000510377.1_Missense_Mutation_p.R70L	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	70					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					GCCTACGCACGATACCACCGG	0.607																																																	0													93.0	71.0	79.0					4																	144106812		2203	4300	6503	SO:0001583	missense	0			AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.209G>T	4.37:g.144106812G>T	ENSP00000303434:p.Arg70Leu		B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.R70L	ENST00000307017.4	37	c.209	CCDS3758.1	4	.	.	.	.	.	.	.	.	.	.	G	33	5.263185	0.95399	.	.	ENSG00000170185	ENST00000510377;ENST00000307017	T;T	0.67865	-0.28;-0.29	5.3	5.3	0.74995	.	0.062033	0.64402	D	0.000007	T	0.74390	0.3710	L	0.29908	0.895	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.70016	0.94;0.967	T	0.77027	-0.2740	10	0.87932	D	0	-7.744	19.1462	0.93469	0.0:0.0:1.0:0.0	.	70;70	Q8NB14;Q3ZCV1	UBP38_HUMAN;.	L	70	ENSP00000427647:R70L;ENSP00000303434:R70L	ENSP00000303434:R70L	R	+	2	0	USP38	144326262	0.983000	0.35010	0.087000	0.20705	0.973000	0.67179	2.722000	0.47269	2.758000	0.94735	0.561000	0.74099	CGA	USP38	-	NULL	ENSG00000170185		0.607	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP38	HGNC	protein_coding	OTTHUMT00000364869.1	-	0.00	39	0	G	NM_032557		144106812	+1	tier1	-	no_errors	ENST00000307017	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.998	T
USP40	55230	genome.wustl.edu	37	2	234429703	234429703	+	Missense_Mutation	SNP	G	G	T	rs148095295	byFrequency	TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:234429703G>T	ENST00000427112.2	-	16	2291	c.2256C>A	c.(2254-2256)caC>caA	p.H752Q	USP40_ENST00000450966.1_Missense_Mutation_p.H764Q|USP40_ENST00000251722.6_Missense_Mutation_p.H752Q			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	752					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		AATTTTTAACGTGGAGCCAGT	0.343																																																	0													107.0	99.0	101.0					2																	234429703		1824	4069	5893	SO:0001583	missense	0			AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.2256C>A	2.37:g.234429703G>T	ENSP00000387898:p.His752Gln		Q6NX38|Q70EL0	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.H764Q	ENST00000427112.2	37	c.2292	CCDS46547.1	2	.	.	.	.	.	.	.	.	.	.	G	0.457	-0.890991	0.02491	.	.	ENSG00000085982	ENST00000450966;ENST00000251722;ENST00000427112;ENST00000452724	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	5.43	-3.13	0.05266	.	2.555070	0.01075	N	0.004887	T	0.06645	0.0170	N	0.00146	-1.995	0.22156	N	0.999324	B;B	0.09022	0.001;0.002	B;B	0.01281	0.0;0.0	T	0.40905	-0.9538	10	0.02654	T	1	.	2.4575	0.04533	0.1199:0.3004:0.1148:0.4648	.	752;764	Q9NVE5;Q9NVE5-3	UBP40_HUMAN;.	Q	764;752;752;47	ENSP00000415434:H764Q;ENSP00000251722:H752Q;ENSP00000387898:H752Q;ENSP00000408853:H47Q	ENSP00000251722:H752Q	H	-	3	2	USP40	234094442	0.962000	0.33011	0.960000	0.40013	0.805000	0.45488	-0.239000	0.08965	-0.451000	0.07097	-2.110000	0.00354	CAC	USP40	-	NULL	ENSG00000085982		0.343	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	USP40	HGNC	protein_coding	OTTHUMT00000397235.1	-	0.00	29	0	G	XM_114294		234429703	-1	tier1	-	no_errors	ENST00000450966	ensembl	human	known	74_37	missense	16.22	31	6	SNP	0.930	T
VDAC1	7416	genome.wustl.edu	37	5	133316708	133316708	+	Intron	DEL	T	T	-	rs76032174|rs76341281		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:133316708delT	ENST00000265333.3	-	6	568				VDAC1_ENST00000395047.2_Intron|VDAC1_ENST00000395044.3_Intron	NM_003374.2	NP_003365.1	P21796	VDAC1_HUMAN	voltage-dependent anion channel 1						anion transport (GO:0006820)|apoptotic process (GO:0006915)|behavioral fear response (GO:0001662)|epithelial cell differentiation (GO:0030855)|learning (GO:0007612)|neuron-neuron synaptic transmission (GO:0007270)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pore complex (GO:0046930)	porin activity (GO:0015288)|protein kinase binding (GO:0019901)|voltage-gated anion channel activity (GO:0008308)			endometrium(1)|large_intestine(1)|lung(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		Dihydroxyaluminium(DB01375)	GCAAGTTGTCTTTTTTTTTTT	0.413																																					NSCLC(127;1776 1806 35523 41489 48154)												0																																										SO:0001627	intron_variant	0				CCDS4168.1	5q31	2011-11-15			ENSG00000213585	ENSG00000213585		"""Voltage-dependent anion channels"""	12669	protein-coding gene	gene with protein product		604492				7517385	Standard	NM_003374		Approved	MGC111064, PORIN	uc003kyr.2	P21796	OTTHUMG00000129118	ENST00000265333.3:c.324-61A>-	5.37:g.133316708delT			B3KVK4|D3DQ93|Q5FVE7|Q9UIQ5|Q9UPL0	RNA	DEL	-	NULL	ENST00000265333.3	37	NULL	CCDS4168.1	5																																																																																			VDAC1	-	-	ENSG00000213585		0.413	VDAC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VDAC1	HGNC	protein_coding	OTTHUMT00000259208.1		0.00	12	0	T			133316708	-1	tier1		no_errors	ENST00000492324	ensembl	human	known	74_37	rna	21.05	15	4	DEL	0.001	-
VEZT	55591	genome.wustl.edu	37	12	95656735	95656735	+	Silent	SNP	G	G	T	rs576048583		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:95656735G>T	ENST00000436874.1	+	4	417	c.312G>T	c.(310-312)ctG>ctT	p.L104L	VEZT_ENST00000261219.6_Silent_p.L56L|VEZT_ENST00000356859.4_3'UTR	NM_017599.3	NP_060069.3	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane protein	104					chordate embryonic development (GO:0043009)|single organismal cell-cell adhesion (GO:0016337)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stereocilia ankle link complex (GO:0002142)				endometrium(2)|kidney(3)|large_intestine(1)|lung(14)|ovary(2)|upper_aerodigestive_tract(1)	23						AGGAAGTCCTGTTACAAGAGG	0.418																																																	0																																										SO:0001819	synonymous_variant	0			AF216644	CCDS44954.1	12q22	2011-02-15			ENSG00000028203	ENSG00000028203			18258	protein-coding gene	gene with protein product						11080149, 16199027, 21156161	Standard	NM_017599		Approved	DKFZP761C241	uc001tdz.2	Q9HBM0	OTTHUMG00000170182	ENST00000436874.1:c.312G>T	12.37:g.95656735G>T			Q6P1Q3|Q9H2F4|Q9H2U5|Q9NT70|Q9NVW0|Q9UF91	Silent	SNP	NULL	p.L104	ENST00000436874.1	37	c.312	CCDS44954.1	12																																																																																			VEZT	-	NULL	ENSG00000028203		0.418	VEZT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VEZT	HGNC	protein_coding	OTTHUMT00000407804.2	-	0.00	62	0	G	NM_017599		95656735	+1	tier1	-	no_errors	ENST00000436874	ensembl	human	known	74_37	silent	7.84	47	4	SNP	1.000	T
VPS11	55823	genome.wustl.edu	37	11	118942398	118942398	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:118942398G>T	ENST00000300793.6	+	6	768	c.726G>T	c.(724-726)caG>caT	p.Q242H	VPS11_ENST00000527798.1_3'UTR	NM_021729.4	NP_068375.3	Q9H270	VPS11_HUMAN	vacuolar protein sorting 11 homolog (S. cerevisiae)	243					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	29	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.88e-05)		ACCCTTCTCAGGACCTGCAGT	0.557																																																	0													112.0	114.0	114.0					11																	118942398		2059	4192	6251	SO:0001583	missense	0			AB027508	CCDS73404.1	11q23	2008-02-05	2006-12-19			ENSG00000160695		"""RING-type (C3HC4) zinc fingers"""	14583	protein-coding gene	gene with protein product		608549	"""vacuolar protein sorting 11 (yeast homolog)"""				Standard	NM_021729		Approved	RNF108, PEP5	uc010ryx.2	Q9H270		ENST00000300793.6:c.726G>T	11.37:g.118942398G>T	ENSP00000475301:p.Gln242His		Q8WY89|Q96EP8|Q9H6D9|Q9HCS6	Missense_Mutation	SNP	pfam_VPS11_C,pfam_Clathrin_H-chain/VPS_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_RING,pirsf_VPS11,pfscan_Znf_RING	p.Q242H	ENST00000300793.6	37	c.726		11																																																																																			VPS11	-	superfamily_WD40_repeat_dom,pirsf_VPS11	ENSG00000160695		0.557	VPS11-201	KNOWN	basic|appris_principal	protein_coding	VPS11	HGNC	protein_coding		-	0.00	107	0	G	NM_021729		118942398	+1	tier1	-	no_errors	ENST00000300793	ensembl	human	known	74_37	missense	5.56	85	5	SNP	1.000	T
VPS13A	23230	genome.wustl.edu	37	9	79910572	79910572	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr9:79910572G>T	ENST00000360280.3	+	33	3882	c.3622G>T	c.(3622-3624)Gca>Tca	p.A1208S	VPS13A_ENST00000357409.5_Missense_Mutation_p.A1208S|VPS13A_ENST00000423463.2_3'UTR|VPS13A_ENST00000376634.4_Missense_Mutation_p.A1208S|VPS13A_ENST00000376636.3_Missense_Mutation_p.A1169S	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	1208					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TTCCAGAATGGCACTGGATAT	0.443																																																	0													144.0	131.0	135.0					9																	79910572		2203	4300	6503	SO:0001583	missense	0			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.3622G>T	9.37:g.79910572G>T	ENSP00000353422:p.Ala1208Ser		Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.A1208S	ENST00000360280.3	37	c.3622	CCDS6655.1	9	.	.	.	.	.	.	.	.	.	.	G	7.328	0.618361	0.14129	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.16073	2.37;2.37;2.37;2.37	5.36	4.45	0.53987	.	0.215439	0.37393	N	0.002108	T	0.14787	0.0357	L	0.31752	0.955	0.80722	D	1	B;P;P;P	0.48640	0.365;0.736;0.913;0.913	B;B;B;B	0.44278	0.09;0.198;0.445;0.445	T	0.04413	-1.0953	10	0.10636	T	0.68	.	15.8032	0.78471	0.0:0.0:0.8629:0.1371	.	1169;1208;1208;1208	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	S	1208;1169;1208;1208	ENSP00000365821:A1208S;ENSP00000365823:A1169S;ENSP00000353422:A1208S;ENSP00000349985:A1208S	ENSP00000349985:A1208S	A	+	1	0	VPS13A	79100392	0.992000	0.36948	0.939000	0.37840	0.397000	0.30659	1.681000	0.37618	1.385000	0.46445	0.563000	0.77884	GCA	VPS13A	-	NULL	ENSG00000197969		0.443	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	HGNC	protein_coding	OTTHUMT00000052753.2	-	0.00	49	0	G	NM_015186		79910572	+1	tier1	-	no_errors	ENST00000360280	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
VPS13C	54832	genome.wustl.edu	37	15	62147080	62147080	+	Missense_Mutation	SNP	G	G	T	rs150119821		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:62147080G>T	ENST00000261517.5	-	84	11223	c.11150C>A	c.(11149-11151)gCc>gAc	p.A3717D	RP11-16B9.1_ENST00000559251.1_RNA|VPS13C_ENST00000249837.3_Missense_Mutation_p.A3674D	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						CTCTGCTGTGGCGGTGTCCTT	0.363													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16417	0.0		0.0	False		,,,				2504	0.0																0								G	ASP/ALA,ASP/ALA	5,4401	9.9+/-24.2	0,5,2198	63.0	62.0	62.0		11021,11150	-0.2	0.2	15	dbSNP_134	62	0,8600		0,0,4300	no	missense,missense	VPS13C	NM_017684.4,NM_020821.2	126,126	0,5,6498	TT,TG,GG		0.0,0.1135,0.0384	benign,benign	3674/3711,3717/3754	62147080	5,13001	2203	4300	6503	SO:0001583	missense	0			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.11150C>A	15.37:g.62147080G>T	ENSP00000261517:p.Ala3717Asp			Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.A3717D	ENST00000261517.5	37	c.11150	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	G	3.548	-0.092349	0.07053	0.001135	0.0	ENSG00000129003	ENST00000249837;ENST00000261517	T;T	0.44482	0.92;0.92	4.92	-0.202	0.13208	.	1.296490	0.05046	N	0.477316	T	0.23649	0.0572	N	0.22421	0.69	0.18873	N	0.999984	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.13845	-1.0494	10	0.18276	T	0.48	.	0.8151	0.01100	0.2553:0.1723:0.3962:0.1761	.	3674;3717	Q709C8-3;Q709C8	.;VP13C_HUMAN	D	3674;3717	ENSP00000249837:A3674D;ENSP00000261517:A3717D	ENSP00000249837:A3674D	A	-	2	0	VPS13C	59934372	0.894000	0.30519	0.179000	0.23059	0.058000	0.15608	1.318000	0.33643	0.069000	0.16605	0.591000	0.81541	GCC	VPS13C	-	NULL	ENSG00000129003		0.363	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	-	0.00	41	0	G	NM_017684		62147080	-1	tier1	rs150119821	no_errors	ENST00000261517	ensembl	human	known	74_37	missense	9.43	48	5	SNP	0.056	T
VPS72	6944	genome.wustl.edu	37	1	151158058	151158058	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:151158058G>T	ENST00000354473.4	-	3	345	c.309C>A	c.(307-309)acC>acA	p.T103T	VPS72_ENST00000496809.1_5'UTR			Q15906	VPS72_HUMAN	vacuolar protein sorting 72 homolog (S. cerevisiae)	103					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TACCAGCCGGGGTGTTGACCT	0.493																																					Pancreas(109;1131 2287 3209 24201)												0													185.0	184.0	184.0					1																	151158058		2203	4300	6503	SO:0001819	synonymous_variant	0			D43642	CCDS989.1, CCDS59201.1	1q21	2008-02-05	2006-12-19	2005-09-08	ENSG00000163159	ENSG00000163159			11644	protein-coding gene	gene with protein product		600607	"""transcription factor-like 1"", ""vacuolar protein sorting 72 (yeast)"""	TCFL1		7702631	Standard	NM_001271087		Approved	YL-1, YL1, Swc2	uc001exe.2	Q15906	OTTHUMG00000012345	ENST00000354473.4:c.309C>A	1.37:g.151158058G>T			A6NLK9|A6PW55|Q53GJ2|Q5U0R4	Silent	SNP	pfam_YL1,pfam_YL1_C	p.T103	ENST00000354473.4	37	c.309	CCDS59201.1	1																																																																																			VPS72	-	pfam_YL1	ENSG00000163159		0.493	VPS72-002	NOVEL	mRNA_start_NF|basic|exp_conf|CCDS	protein_coding	VPS72	HGNC	protein_coding	OTTHUMT00000034394.3	-	0.00	42	0	G	NM_005997		151158058	-1	tier1	-	no_errors	ENST00000368892	ensembl	human	known	74_37	silent	13.16	33	5	SNP	0.999	T
VRK1	7443	genome.wustl.edu	37	14	97322574	97322574	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr14:97322574G>T	ENST00000216639.3	+	9	966	c.817G>T	c.(817-819)Gat>Tat	p.D273Y		NM_003384.2	NP_003375.1	Q99986	VRK1_HUMAN	vaccinia related kinase 1	273	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				Golgi disassembly (GO:0090166)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-T3 phosphorylation (GO:0072355)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi stack (GO:0005795)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H3-S10 specific) (GO:0035175)|histone kinase activity (H3-T3 specific) (GO:0072354)|nucleosomal histone binding (GO:0031493)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.D273Y(1)		NS(1)|endometrium(1)|large_intestine(5)|lung(3)|skin(1)|stomach(1)	12		Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.234)		ATATGTTAGAGATTCCAAAAT	0.328																																																	1	Substitution - Missense(1)	large_intestine(1)											85.0	86.0	86.0					14																	97322574		2203	4300	6503	SO:0001583	missense	0			AB000449	CCDS9947.1	14q32.2	2012-07-05			ENSG00000100749	ENSG00000100749			12718	protein-coding gene	gene with protein product		602168				9344656	Standard	XM_006720247		Approved		uc001yft.3	Q99986	OTTHUMG00000171459	ENST00000216639.3:c.817G>T	14.37:g.97322574G>T	ENSP00000216639:p.Asp273Tyr		Q3SYL2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.D273Y	ENST00000216639.3	37	c.817	CCDS9947.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.1|20.1	3.936206|3.936206	0.73442|0.73442	.|.	.|.	ENSG00000100749|ENSG00000100749	ENST00000216639|ENST00000557222;ENST00000557352	T|T;T	0.63913|0.66280	-0.07|-0.2;2.1	5.96|5.96	5.07|5.07	0.68467|0.68467	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.090395|.	0.85682|.	D|.	0.000000|.	T|T	0.55752|0.55752	0.1940|0.1940	L|L	0.31476|0.31476	0.935|0.935	0.80722|0.80722	D|D	1|1	D|.	0.54397|.	0.966|.	P|.	0.50934|.	0.654|.	T|T	0.52741|0.52741	-0.8535|-0.8535	10|6	0.25106|.	T|.	0.35|.	-12.8922|-12.8922	10.7606|10.7606	0.46261|0.46261	0.0682:0.132:0.7998:0.0|0.0682:0.132:0.7998:0.0	.|.	273|.	Q99986|.	VRK1_HUMAN|.	Y|I	273|129;54	ENSP00000216639:D273Y|ENSP00000450820:R129I;ENSP00000451682:R54I	ENSP00000216639:D273Y|.	D|R	+|+	1|2	0|0	VRK1|VRK1	96392327|96392327	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.964000|0.964000	0.63967|0.63967	4.887000|4.887000	0.63156|0.63156	1.492000|1.492000	0.48499|0.48499	0.655000|0.655000	0.94253|0.94253	GAT|AGA	VRK1	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000100749		0.328	VRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VRK1	HGNC	protein_coding	OTTHUMT00000413520.1		0.00	53	0	G	NM_003384		97322574	+1			no_errors	ENST00000216639	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
VSX1	30813	genome.wustl.edu	37	20	25053267	25053267	+	IGR	SNP	A	A	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr20:25053267A>G	ENST00000376709.4	-	0	2155				VSX1_ENST00000429762.3_Intron|VSX1_ENST00000444511.2_Intron|VSX1_ENST00000424574.1_Missense_Mutation_p.L274S|VSX1_ENST00000451258.1_Missense_Mutation_p.W214R	NM_014588.5	NP_055403.2	Q9NZR4	VSX1_HUMAN	visual system homeobox 1						neuron maturation (GO:0042551)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(3)|lung(2)	6						TCTGCAGCCCAATGTCTCACC	0.383																																																	0																																										SO:0001628	intergenic_variant	0			AF176797	CCDS13168.1, CCDS13169.1, CCDS58766.1, CCDS58767.1	20p11.21	2014-02-14	2007-07-12		ENSG00000100987	ENSG00000100987		"""Homeoboxes / PRD class"""	12723	protein-coding gene	gene with protein product		605020	"""posterior polymorphous corneal dystrophy"", ""visual system homeobox 1 homolog, CHX10-like (zebrafish)"""	PPCD		10673340	Standard	NM_001256272		Approved	PPD, PPCD1	uc002wuf.4	Q9NZR4	OTTHUMG00000032111		20.37:g.25053267A>G			B9EGJ4|D1MF28|Q0GM60|Q0GM61|Q0GM62|Q0GM63|Q0GM64|Q0GM65|Q5TF40|Q5TF41|Q9HCU3|Q9NU27	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.L274S	ENST00000376709.4	37	c.821	CCDS13168.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	2.540|2.540	-0.306516|-0.306516	0.05458|0.05458	.|.	.|.	ENSG00000100987|ENSG00000100987	ENST00000424574|ENST00000451258	D|D	0.91521|0.92199	-2.86|-2.99	1.57|1.57	-1.14|-1.14	0.09741|0.09741	.|.	.|.	.|.	.|.	.|.	D|D	0.87849|0.87849	0.6281|0.6281	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.79205|0.79205	-0.1899|-0.1899	6|6	0.20519|0.66056	T|D	0.43|0.02	.|.	2.2727|2.2727	0.04095|0.04095	0.473:0.3132:0.2138:0.0|0.473:0.3132:0.2138:0.0	.|.	.|.	.|.	.|.	S|R	274|214	ENSP00000399496:L274S|ENSP00000389654:W214R	ENSP00000386612:L274S|ENSP00000387069:W214R	L|W	-|-	2|1	0|0	VSX1|VSX1	25001267|25001267	0.072000|0.072000	0.21174|0.21174	0.002000|0.002000	0.10522|0.10522	0.005000|0.005000	0.04900|0.04900	0.306000|0.306000	0.19279|0.19279	-0.364000|-0.364000	0.08088|0.08088	-0.484000|-0.484000	0.04775|0.04775	TTG|TGG	VSX1	-	NULL	ENSG00000100987		0.383	VSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSX1	HGNC	protein_coding	OTTHUMT00000078384.3	-	0.00	75	0	A			25053267	-1	tier1	-	no_errors	ENST00000409285	ensembl	human	known	74_37	missense	26.67	44	16	SNP	0.004	G
WDPCP	51057	genome.wustl.edu	37	2	63815466	63815466	+	5'UTR	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:63815466G>T	ENST00000272321.7	-	0	467				MDH1_ENST00000539945.1_5'Flank|MDH1_ENST00000544381.1_5'Flank|MDH1_ENST00000233114.8_5'Flank|MDH1_ENST00000409908.1_5'Flank|MDH1_ENST00000409476.1_5'Flank|WDPCP_ENST00000409835.1_5'UTR|WDPCP_ENST00000409562.3_5'UTR	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector						auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						GAGAGGGAGCGACACGCTCGC	0.647																																																	0													35.0	36.0	36.0					2																	63815466		692	1591	2283	SO:0001623	5_prime_UTR_variant	0				CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.-61C>A	2.37:g.63815466G>T			Q53RW4|Q7Z2Z3	RNA	SNP	-	NULL	ENST00000272321.7	37	NULL	CCDS42688.1	2																																																																																			WDPCP	-	-	ENSG00000143951		0.647	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WDPCP	HGNC	protein_coding	OTTHUMT00000326820.1	-	0.00	44	0	G	NM_015910		63815466	-1	tier1	-	no_errors	ENST00000409835	ensembl	human	known	74_37	rna	9.09	40	4	SNP	0.000	T
VWA3B	200403	genome.wustl.edu	37	2	98852870	98852870	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr2:98852870G>T	ENST00000477737.1	+	18	2650	c.2446G>T	c.(2446-2448)Gct>Tct	p.A816S		NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	816										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						CATCTTGCTGGCTGAGGAGTG	0.443																																																	0													115.0	120.0	119.0					2																	98852870		1941	4157	6098	SO:0001583	missense	0			AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.2446G>T	2.37:g.98852870G>T	ENSP00000417955:p.Ala816Ser		B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.A816S	ENST00000477737.1	37	c.2446	CCDS42718.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.894|0.894	-0.724546|-0.724546	0.03158|0.03158	.|.	.|.	ENSG00000168658|ENSG00000168658	ENST00000477737|ENST00000473149	T|.	0.05925|.	3.37|.	4.48|4.48	-3.4|-3.4	0.04853|0.04853	.|.	1.295940|.	0.05351|.	N|.	0.531811|.	T|T	0.34890|0.34890	0.0913|0.0913	L|L	0.43152|0.43152	1.355|1.355	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.21071|.	0.013;0.051;0.013;0.034|.	B;B;B;B|.	0.22601|.	0.015;0.016;0.015;0.04|.	T|T	0.38499|0.38499	-0.9658|-0.9658	10|5	0.11182|.	T|.	0.66|.	.|.	8.5496|8.5496	0.33444|0.33444	0.2746:0.1566:0.5688:0.0|0.2746:0.1566:0.5688:0.0	.|.	208;816;816;816|.	Q502W6-5;Q502W6;Q502W6-8;Q502W6-6|.	.;VWA3B_HUMAN;.;.|.	S|V	816|226	ENSP00000417955:A816S|.	ENSP00000417955:A816S|.	A|G	+|+	1|2	0|0	VWA3B|VWA3B	98219302|98219302	0.002000|0.002000	0.14202|0.14202	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.167000|0.167000	0.16602|0.16602	-0.908000|-0.908000	0.03857|0.03857	-2.615000|-2.615000	0.00158|0.00158	GCT|GGC	VWA3B	-	NULL	ENSG00000168658		0.443	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3B	HGNC	protein_coding	OTTHUMT00000353469.2		0.00	50	0	G	NM_144992		98852870	+1			no_errors	ENST00000477737	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.000	T
WDR17	116966	genome.wustl.edu	37	4	177052858	177052858	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:177052858G>C	ENST00000280190.4	+	8	1295	c.1139G>C	c.(1138-1140)gGa>gCa	p.G380A	WDR17_ENST00000507824.2_Missense_Mutation_p.G363A|WDR17_ENST00000508596.1_Missense_Mutation_p.G356A|WDR17_ENST00000393643.2_Missense_Mutation_p.G356A			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	380										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TATGATATGGGAGCTAAGAAG	0.373																																																	0													276.0	269.0	271.0					4																	177052858		2203	4300	6503	SO:0001583	missense	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.1139G>C	4.37:g.177052858G>C	ENSP00000280190:p.Gly380Ala		E7EQX0|Q0QD35	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.G380A	ENST00000280190.4	37	c.1139	CCDS3825.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.87|14.87	2.665650|2.665650	0.47677|0.47677	.|.	.|.	ENSG00000150627|ENSG00000150627	ENST00000505894|ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	.|T;T;T	.|0.57273	.|0.44;0.47;0.41	5.45|5.45	5.45|5.45	0.79879|0.79879	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.54334|0.54334	0.1852|0.1852	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.87578	.|0.998;0.998	T|T	0.55114|0.55114	-0.8191|-0.8191	5|10	.|0.20519	.|T	.|0.43	-22.3371|-22.3371	19.6593|19.6593	0.95859|0.95859	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|356;380	.|E7EQX0;Q8IZU2	.|.;WDR17_HUMAN	Q|A	129|356;356;380;363	.|ENSP00000422763:G356A;ENSP00000377258:G356A;ENSP00000280190:G380A	.|ENSP00000280190:G380A	E|G	+|+	1|2	0|0	WDR17|WDR17	177289852|177289852	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.335000|7.335000	0.79234|0.79234	2.723000|2.723000	0.93209|0.93209	0.655000|0.655000	0.94253|0.94253	GAG|GGA	WDR17	-	superfamily_WD40_repeat_dom	ENSG00000150627		0.373	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2	-	0.00	94	0	G			177052858	+1	tier1	-	no_errors	ENST00000280190	ensembl	human	known	74_37	missense	9.21	69	7	SNP	1.000	C
WDR3	10885	genome.wustl.edu	37	1	118477290	118477290	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:118477290G>T	ENST00000349139.5	+	3	413	c.366G>T	c.(364-366)ctG>ctT	p.L122L	WDR3_ENST00000369441.3_3'UTR|WDR3_ENST00000471680.1_3'UTR	NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	122						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		GAGGCAGACTGGCATCTGGGT	0.453																																																	0													88.0	81.0	83.0					1																	118477290		2203	4300	6503	SO:0001819	synonymous_variant	0			AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.366G>T	1.37:g.118477290G>T				Silent	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L122	ENST00000349139.5	37	c.366	CCDS898.1	1																																																																																			WDR3	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	ENSG00000065183		0.453	WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR3	HGNC	protein_coding	OTTHUMT00000033720.2	-	0.00	36	0	G	NM_006784		118477290	+1	tier1	-	no_errors	ENST00000349139	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.997	T
WNT10B	7480	genome.wustl.edu	37	12	49364273	49364273	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr12:49364273G>T	ENST00000301061.4	-	2	388	c.40C>A	c.(40-42)Ctc>Atc	p.L14I	WNT10B_ENST00000407467.1_Missense_Mutation_p.L14I|WNT10B_ENST00000403957.1_Missense_Mutation_p.L14I	NM_003394.3	NP_003385.2	O00744	WN10B_HUMAN	wingless-type MMTV integration site family, member 10B	14					bone trabecula formation (GO:0060346)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to cAMP (GO:0071320)|cellular response to hydrostatic pressure (GO:0071464)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fungiform papilla development (GO:0061196)|G2/M transition of mitotic cell cycle (GO:0000086)|hematopoietic stem cell proliferation (GO:0071425)|lipid metabolic process (GO:0006629)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of anagen (GO:0051885)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of skeletal muscle tissue development (GO:0048641)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			central_nervous_system(1)|large_intestine(5)|lung(12)|prostate(1)|skin(4)	23						AGACCCGCGAGGCCCGAGGGC	0.682																																																	0													14.0	21.0	19.0					12																	49364273		2199	4300	6499	SO:0001583	missense	0			X97057	CCDS8775.1	12q13	2009-01-02			ENSG00000169884	ENSG00000169884		"""Wingless-type MMTV integration sites"""	12775	protein-coding gene	gene with protein product		601906				9121776, 9284937, 18515319	Standard	NM_003394		Approved	WNT-12, SHFM6	uc001rss.3	O00744	OTTHUMG00000150734	ENST00000301061.4:c.40C>A	12.37:g.49364273G>T	ENSP00000301061:p.Leu14Ile		B2R7A5|O00747|Q4VAJ4|Q4VAJ5|Q8WZ97	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt10	p.L14I	ENST00000301061.4	37	c.40	CCDS8775.1	12	.	.	.	.	.	.	.	.	.	.	G	14.67	2.605288	0.46423	.	.	ENSG00000169884	ENST00000301061;ENST00000407467;ENST00000403957;ENST00000413630;ENST00000420388	T;D;D;T;T	0.85411	-1.11;-1.98;-1.95;-1.21;-0.9	4.72	0.87	0.19102	.	0.830525	0.11078	N	0.602108	T	0.72203	0.3431	N	0.22421	0.69	0.22571	N	0.998978	B;B	0.22346	0.068;0.004	B;B	0.12837	0.008;0.001	T	0.55464	-0.8137	10	0.29301	T	0.29	.	7.2434	0.26109	0.3725:0.0:0.6275:0.0	.	14;14	Q4VAJ4;O00744	.;WN10B_HUMAN	I	14	ENSP00000301061:L14I;ENSP00000384691:L14I;ENSP00000385980:L14I;ENSP00000398473:L14I;ENSP00000404896:L14I	ENSP00000301061:L14I	L	-	1	0	WNT10B	47650540	0.994000	0.37717	0.996000	0.52242	0.994000	0.84299	0.772000	0.26647	-0.041000	0.13558	-0.143000	0.13931	CTC	WNT10B	-	NULL	ENSG00000169884		0.682	WNT10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT10B	HGNC	protein_coding	OTTHUMT00000319864.1		0.00	22	0	G	NM_003394		49364273	-1			no_errors	ENST00000301061	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
YAE1D1	57002	genome.wustl.edu	37	7	39610125	39610125	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:39610125A>G	ENST00000223273.2	+	2	193	c.150A>G	c.(148-150)atA>atG	p.I50M	YAE1D1_ENST00000469737.1_3'UTR|YAE1D1_ENST00000432096.2_Missense_Mutation_p.I50M|YAE1D1_ENST00000448268.1_Missense_Mutation_p.I50M	NM_020192.3	NP_064577.1	Q9NRH1	YAED1_HUMAN	Yae1 domain containing 1	50																	GAGATGGAATAGATGCTGGCA	0.368																																																	0													125.0	128.0	127.0					7																	39610125		2203	4300	6503	SO:0001583	missense	0			AF226046	CCDS5459.1, CCDS64630.1	7p14.1	2011-11-24	2011-11-24	2011-11-24	ENSG00000241127	ENSG00000241127			24857	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 36"""	C7orf36		12477932	Standard	NM_020192		Approved	GK003	uc003thc.4	Q9NRH1	OTTHUMG00000128689	ENST00000223273.2:c.150A>G	7.37:g.39610125A>G	ENSP00000223273:p.Ile50Met		A4D1W4|B4DE83|Q6IAF7|Q8WVZ5	Missense_Mutation	SNP	pfam_Essential_protein_Yae1_N	p.I50M	ENST00000223273.2	37	c.150	CCDS5459.1	7	.	.	.	.	.	.	.	.	.	.	A	18.13	3.555842	0.65425	.	.	ENSG00000241127	ENST00000223273;ENST00000448268;ENST00000432096	T;T;T	0.53640	0.61;0.61;0.61	6.02	-3.41	0.04839	Essential protein Yae1, N-terminal (1);	0.628649	0.17380	N	0.176324	T	0.43875	0.1267	M	0.82323	2.585	0.28966	N	0.88956	P	0.38335	0.627	B	0.40782	0.34	T	0.44190	-0.9344	10	0.52906	T	0.07	-14.3847	2.9138	0.05745	0.1942:0.4607:0.1911:0.154	.	50	Q9NRH1	CG036_HUMAN	M	50	ENSP00000223273:I50M;ENSP00000400511:I50M;ENSP00000395777:I50M	ENSP00000223273:I50M	I	+	3	3	C7orf36	39576650	0.872000	0.30054	0.706000	0.30403	0.996000	0.88848	-0.017000	0.12590	-0.099000	0.12263	0.528000	0.53228	ATA	YAE1D1	-	pfam_Essential_protein_Yae1_N	ENSG00000241127		0.368	YAE1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YAE1D1	HGNC	protein_coding	OTTHUMT00000250586.1	-	0.00	50	0	A	NM_020192		39610125	+1	tier1	-	no_errors	ENST00000223273	ensembl	human	known	74_37	missense	20.83	57	15	SNP	0.395	G
YAP1	10413	genome.wustl.edu	37	11	102076665	102076665	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr11:102076665C>T	ENST00000282441.5	+	5	1232	c.844C>T	c.(844-846)Cca>Tca	p.P282S	YAP1_ENST00000526343.1_Missense_Mutation_p.P244S|YAP1_ENST00000537274.1_Missense_Mutation_p.P282S|YAP1_ENST00000524575.1_Missense_Mutation_p.P104S|YAP1_ENST00000345877.2_Missense_Mutation_p.P244S|YAP1_ENST00000531439.1_Missense_Mutation_p.P282S	NM_001130145.2|NM_001282101.1	NP_001123617.1|NP_001269030.1	P46937	YAP1_HUMAN	Yes-associated protein 1	282					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|contact inhibition (GO:0060242)|embryonic heart tube morphogenesis (GO:0003143)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|keratinocyte differentiation (GO:0030216)|lateral mesoderm development (GO:0048368)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|notochord development (GO:0030903)|paraxial mesoderm development (GO:0048339)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of keratinocyte proliferation (GO:0010837)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of stem cell proliferation (GO:0072091)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)		AGTGAAACAGCCACCACCCCT	0.488																																					Colon(50;247 1103 7861 28956)												0													41.0	47.0	45.0					11																	102076665		2203	4299	6502	SO:0001583	missense	0				CCDS8314.1, CCDS44716.1, CCDS8314.2, CCDS53699.1, CCDS53700.1, CCDS60944.1, CCDS73373.1, CCDS73374.1	11q13	2010-03-19	2010-03-19		ENSG00000137693	ENSG00000137693			16262	protein-coding gene	gene with protein product		606608	"""Yes-associated protein 1, 65kDa"""			7782338	Standard	NM_001130145		Approved	YAP65	uc001pgt.3	P46937	OTTHUMG00000167322	ENST00000282441.5:c.844C>T	11.37:g.102076665C>T	ENSP00000282441:p.Pro282Ser		B4DTY1|B7ZA01|E3WEB5|E3WEB6|E9PRV2|F5H202|K0KQ18|K0KYZ8|K0L195|K0L1G3|Q7Z574|Q8IUY9	Missense_Mutation	SNP	pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.P282S	ENST00000282441.5	37	c.844	CCDS44716.1	11	.	.	.	.	.	.	.	.	.	.	C	17.28	3.348408	0.61183	.	.	ENSG00000137693	ENST00000526343;ENST00000282441;ENST00000537274;ENST00000345877;ENST00000445250;ENST00000531439;ENST00000524575	T;T;T	0.46451	0.98;1.0;0.87	5.21	5.21	0.72293	.	0.120042	0.56097	D	0.000021	T	0.51534	0.1680	N	0.22421	0.69	0.54753	D	0.999989	D;P;P;P;D;P	0.89917	0.993;0.95;0.9;0.9;1.0;0.94	D;P;P;P;D;P	0.87578	0.979;0.641;0.498;0.574;0.998;0.695	T	0.44513	-0.9323	10	0.26408	T	0.33	.	19.1202	0.93360	0.0:1.0:0.0:0.0	.	104;199;244;282;282;244	B4DTY1;F5GWC5;E9PRV2;P46937-2;P46937;P46937-3	.;.;.;.;YAP1_HUMAN;.	S	244;282;282;244;199;282;104	ENSP00000434134:P244S;ENSP00000331023:P244S;ENSP00000435602:P104S	ENSP00000282441:P282S	P	+	1	0	YAP1	101581875	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.055000	0.57441	2.592000	0.87571	0.561000	0.74099	CCA	YAP1	-	NULL	ENSG00000137693		0.488	YAP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YAP1	HGNC	protein_coding	OTTHUMT00000394151.1	-	0.00	23	0	C	NM_006106		102076665	+1	tier1	-	no_errors	ENST00000282441	ensembl	human	known	74_37	missense	21.43	11	3	SNP	1.000	T
YTHDC1	91746	genome.wustl.edu	37	4	69203304	69203304	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:69203304G>T	ENST00000344157.4	-	3	780	c.445C>A	c.(445-447)Cca>Aca	p.P149T	YTHDC1_ENST00000355665.3_Missense_Mutation_p.P149T|YTHDC1_ENST00000579690.1_Missense_Mutation_p.P149T	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	149					mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						GAACCATCTGGCGTAGGAGAT	0.403																																																	0													56.0	55.0	55.0					4																	69203304		2203	4300	6503	SO:0001583	missense	0			AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.445C>A	4.37:g.69203304G>T	ENSP00000339245:p.Pro149Thr		Q4W5Q3|Q7Z622|Q8TF35	Missense_Mutation	SNP	pfam_YTH_domain,pfscan_YTH_domain	p.P149T	ENST00000344157.4	37	c.445	CCDS33992.1	4	.	.	.	.	.	.	.	.	.	.	G	18.00	3.525798	0.64860	.	.	ENSG00000083896	ENST00000344157;ENST00000355665	T;T	0.28666	1.78;1.6	5.57	5.57	0.84162	.	0.111999	0.64402	D	0.000013	T	0.47948	0.1473	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.981	T	0.43130	-0.9410	10	0.56958	D	0.05	.	19.5388	0.95266	0.0:0.0:1.0:0.0	.	149;149	Q96MU7-2;Q96MU7	.;YTDC1_HUMAN	T	149	ENSP00000339245:P149T;ENSP00000347888:P149T	ENSP00000339245:P149T	P	-	1	0	YTHDC1	68885899	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	5.566000	0.67372	2.597000	0.87782	0.585000	0.79938	CCA	YTHDC1	-	NULL	ENSG00000083896		0.403	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YTHDC1	HGNC	protein_coding	OTTHUMT00000251437.1	-	0.00	60	0	G	NM_133370		69203304	-1	tier1	-	no_errors	ENST00000344157	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
ZBBX	79740	genome.wustl.edu	37	3	166958594	166958594	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:166958594G>T	ENST00000392766.2	-	21	2730	c.2390C>A	c.(2389-2391)tCa>tAa	p.S797*	ZBBX_ENST00000307529.5_Nonsense_Mutation_p.S836*|ZBBX_ENST00000455345.2_Nonsense_Mutation_p.S836*|ZBBX_ENST00000392767.2_Nonsense_Mutation_p.S797*|ZBBX_ENST00000392764.1_Nonsense_Mutation_p.S768*	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	797						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						AGTACTCTTTGACCACGGTAG	0.378																																																	0													178.0	167.0	171.0					3																	166958594		1895	4108	6003	SO:0001587	stop_gained	0			AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.2390C>A	3.37:g.166958594G>T	ENSP00000376519:p.Ser797*		A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Nonsense_Mutation	SNP	pfam_Znf_B-box	p.S836*	ENST00000392766.2	37	c.2507	CCDS3199.2	3	.	.	.	.	.	.	.	.	.	.	G	28.7	4.939935	0.92526	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	.	.	.	5.21	2.3	0.28687	.	2.061030	0.02422	N	0.082714	.	.	.	.	.	.	0.21627	N	0.999619	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	6.0375	4.2175	0.10542	0.2001:0.0:0.6218:0.1781	.	.	.	.	X	797;797;836;836;768	.	ENSP00000305065:S836X	S	-	2	0	ZBBX	168441288	0.085000	0.21516	0.001000	0.08648	0.107000	0.19398	1.543000	0.36147	0.375000	0.24679	0.557000	0.71058	TCA	ZBBX	-	NULL	ENSG00000169064		0.378	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZBBX	HGNC	protein_coding	OTTHUMT00000257657.3		0.00	30	0	G	NM_024687		166958594	-1			no_errors	ENST00000307529	ensembl	human	known	74_37	nonsense	5.97	63	4	SNP	0.001	T
ZBBX	79740	genome.wustl.edu	37	3	166958600	166958600	+	Missense_Mutation	SNP	G	G	T	rs200797025		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:166958600G>T	ENST00000392766.2	-	21	2724	c.2384C>A	c.(2383-2385)cCg>cAg	p.P795Q	ZBBX_ENST00000307529.5_Missense_Mutation_p.P834Q|ZBBX_ENST00000455345.2_Missense_Mutation_p.P834Q|ZBBX_ENST00000392767.2_Missense_Mutation_p.P795Q|ZBBX_ENST00000392764.1_Missense_Mutation_p.P766Q	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	795						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						CTTTGACCACGGTAGTGTGAT	0.378																																																	0													187.0	176.0	179.0					3																	166958600		1905	4118	6023	SO:0001583	missense	0			AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.2384C>A	3.37:g.166958600G>T	ENSP00000376519:p.Pro795Gln		A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	pfam_Znf_B-box	p.P834Q	ENST00000392766.2	37	c.2501	CCDS3199.2	3	.	.	.	.	.	.	.	.	.	.	G	11.16	1.556387	0.27827	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54	5.21	3.29	0.37713	.	0.539313	0.15913	N	0.238530	T	0.57431	0.2053	L	0.44542	1.39	0.09310	N	1	D;D	0.63046	0.989;0.992	P;P	0.62740	0.906;0.862	T	0.44605	-0.9317	10	0.87932	D	0	0.0603	5.9418	0.19198	0.095:0.0:0.7163:0.1887	.	834;795	A8MT70-2;A8MT70	.;ZBBX_HUMAN	Q	795;795;834;834;766	ENSP00000376519:P795Q;ENSP00000376520:P795Q;ENSP00000390232:P834Q;ENSP00000305065:P834Q;ENSP00000376517:P766Q	ENSP00000305065:P834Q	P	-	2	0	ZBBX	168441294	0.006000	0.16342	0.019000	0.16419	0.052000	0.14988	1.212000	0.32394	1.553000	0.49476	0.557000	0.71058	CCG	ZBBX	-	NULL	ENSG00000169064		0.378	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZBBX	HGNC	protein_coding	OTTHUMT00000257657.3	-	0.00	33	0	G	NM_024687		166958600	-1	tier1	-	no_errors	ENST00000307529	ensembl	human	known	74_37	missense	7.25	64	5	SNP	0.015	T
ZDHHC20	253832	genome.wustl.edu	37	13	21975811	21975811	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr13:21975811T>C	ENST00000400590.3	-	6	652	c.454A>G	c.(454-456)Atg>Gtg	p.M152V	ZDHHC20_ENST00000320220.9_Missense_Mutation_p.M152V|ZDHHC20_ENST00000415724.1_Missense_Mutation_p.M152V|ZDHHC20_ENST00000542645.1_Missense_Mutation_p.M89V|ZDHHC20_ENST00000382466.3_Missense_Mutation_p.M152V|ZDHHC20_ENST00000494731.1_5'UTR			Q5W0Z9	ZDH20_HUMAN	zinc finger, DHHC-type containing 20	152					protein palmitoylation (GO:0018345)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	9		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)		TGATGATCCATCTTAAGAATA	0.289																																																	0																																										SO:0001583	missense	0			AK090979	CCDS45017.1, CCDS73551.1	13q12.11	2008-10-21			ENSG00000180776	ENSG00000180776		"""Zinc fingers, DHHC-type"""	20749	protein-coding gene	gene with protein product							Standard	NM_153251		Approved	FLJ25952	uc001uoa.2	Q5W0Z9	OTTHUMG00000017410	ENST00000400590.3:c.454A>G	13.37:g.21975811T>C	ENSP00000383433:p.Met152Val		A8MTV9|C9JG20|I6L9D4|Q2TB82|Q6NVU8	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.M152V	ENST00000400590.3	37	c.454		13	.	.	.	.	.	.	.	.	.	.	T	22.2	4.251461	0.80135	.	.	ENSG00000180776	ENST00000400590;ENST00000320220;ENST00000382466;ENST00000542645;ENST00000415724	T;T;T;T;T	0.26518	1.73;1.73;1.73;1.73;1.73	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.62356	0.2421	H	0.98333	4.205	0.80722	D	1	P;B	0.44344	0.833;0.085	P;P	0.52386	0.697;0.571	T	0.77525	-0.2555	10	0.87932	D	0	-9.767	15.806	0.78513	0.0:0.0:0.0:1.0	.	89;152	B4DRN8;Q5W0Z9-3	.;.	V	152;152;152;89;152	ENSP00000383433:M152V;ENSP00000313583:M152V;ENSP00000371905:M152V;ENSP00000443236:M89V;ENSP00000401232:M152V	ENSP00000313583:M152V	M	-	1	0	ZDHHC20	20873811	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.567000	0.82357	2.135000	0.66039	0.528000	0.53228	ATG	ZDHHC20	-	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	ENSG00000180776		0.289	ZDHHC20-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZDHHC20	HGNC	protein_coding	OTTHUMT00000045994.1	-	0.00	59	0	T	NM_153251		21975811	-1	tier1	-	no_errors	ENST00000400590	ensembl	human	known	74_37	missense	18.42	62	14	SNP	1.000	C
ZDHHC7	55625	genome.wustl.edu	37	16	85012850	85012850	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr16:85012850G>T	ENST00000313732.4	-	5	834	c.482C>A	c.(481-483)cCg>cAg	p.P161Q	ZDHHC7_ENST00000569488.1_5'UTR|ZDHHC7_ENST00000564466.1_Missense_Mutation_p.P198Q	NM_017740.2	NP_060210.2	Q9NXF8	ZDHC7_HUMAN	zinc finger, DHHC-type containing 7	161					peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			large_intestine(6)|lung(4)	10						GTTCACCCACGGGCAGTGATG	0.328																																																	0													101.0	101.0	101.0					16																	85012850		2199	4300	6499	SO:0001583	missense	0			AK000286	CCDS10950.1, CCDS45538.1	16q23.1	2010-02-09			ENSG00000153786	ENSG00000153786		"""Zinc fingers, DHHC-type"""	18459	protein-coding gene	gene with protein product	"""Sertoli cell gene with zinc finger domain-&#946;"""	614604					Standard	NM_017740		Approved	FLJ10792, ZNF370, FLJ20279, SERZ-B, SERZ1	uc002fiq.2	Q9NXF8	OTTHUMG00000137645	ENST00000313732.4:c.482C>A	16.37:g.85012850G>T	ENSP00000315604:p.Pro161Gln		D3DUM1|Q8WV42|Q9NVD8	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.P198Q	ENST00000313732.4	37	c.593	CCDS10950.1	16	.	.	.	.	.	.	.	.	.	.	G	20.5	3.999630	0.74818	.	.	ENSG00000153786	ENST00000313732;ENST00000344861	T;T	0.34275	1.37;1.37	5.41	5.41	0.78517	Zinc finger, DHHC-type, palmitoyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.72431	0.3459	H	0.95294	3.65	0.80722	D	1	D;D	0.89917	0.992;1.0	D;D	0.77004	0.967;0.989	T	0.81701	-0.0813	10	0.87932	D	0	-4.8092	18.2113	0.89871	0.0:0.0:1.0:0.0	.	198;161	Q9NXF8-2;Q9NXF8	.;ZDHC7_HUMAN	Q	161;198	ENSP00000315604:P161Q;ENSP00000341681:P198Q	ENSP00000315604:P161Q	P	-	2	0	ZDHHC7	83570351	1.000000	0.71417	0.990000	0.47175	0.442000	0.32017	9.670000	0.98625	2.530000	0.85305	0.655000	0.94253	CCG	ZDHHC7	-	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	ENSG00000153786		0.328	ZDHHC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC7	HGNC	protein_coding	OTTHUMT00000269087.1	-	0.00	31	0	G	NM_017740		85012850	-1	tier1	-	no_errors	ENST00000344861	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
ZFR	51663	genome.wustl.edu	37	5	32385747	32385747	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:32385747G>T	ENST00000265069.8	-	15	2610	c.2508C>A	c.(2506-2508)agC>agA	p.S836R	ZFR_ENST00000510369.1_5'Flank	NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	836	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		ACTTCTCAGGGCTTATAACCT	0.363																																																	0													123.0	117.0	119.0					5																	32385747		2203	4300	6503	SO:0001583	missense	0			AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.2508C>A	5.37:g.32385747G>T	ENSP00000265069:p.Ser836Arg		B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Missense_Mutation	SNP	pfam_DZF,pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.S836R	ENST00000265069.8	37	c.2508	CCDS34139.1	5	.	.	.	.	.	.	.	.	.	.	G	13.06	2.124666	0.37533	.	.	ENSG00000056097	ENST00000265069;ENST00000382126	T	0.42513	0.97	5.61	4.47	0.54385	DZF (2);	0.081727	0.85682	D	0.000000	T	0.34077	0.0885	L	0.38175	1.15	0.43137	D	0.994886	P	0.44946	0.846	B	0.43623	0.425	T	0.16541	-1.0399	10	0.72032	D	0.01	.	7.0905	0.25282	0.7366:0.0:0.2634:0.0	.	836	Q96KR1	ZFR_HUMAN	R	836;814	ENSP00000265069:S836R	ENSP00000265069:S836R	S	-	3	2	ZFR	32421504	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.049000	0.30392	0.968000	0.38212	0.557000	0.71058	AGC	ZFR	-	pfam_DZF,smart_DZF	ENSG00000056097		0.363	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR	HGNC	protein_coding	OTTHUMT00000366586.1	-	0.00	37	0	G			32385747	-1	tier1	-	no_errors	ENST00000265069	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
ZIC4	84107	genome.wustl.edu	37	3	147124224	147124224	+	5'UTR	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:147124224C>T	ENST00000383075.3	-	0	423				ZIC4_ENST00000484399.1_5'Flank|ZIC4_ENST00000425731.3_5'Flank|ZIC1_ENST00000282928.4_5'Flank|ZIC4_ENST00000525172.2_5'Flank|ZIC4_ENST00000473123.1_5'Flank|ZIC4_ENST00000491672.1_5'UTR	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4							nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						ACCACAAACCCCTCCAAGCCT	0.537																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.-90G>A	3.37:g.147124224C>T			A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	RNA	SNP	-	NULL	ENST00000383075.3	37	NULL	CCDS43160.1	3																																																																																			ZIC4	-	-	ENSG00000174963		0.537	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	HGNC	protein_coding	OTTHUMT00000355504.1	-	0.00	21	0	C			147124224	-1	tier1	-	no_errors	ENST00000464144	ensembl	human	putative	74_37	rna	17.65	28	6	SNP	1.000	T
ZNF106	64397	genome.wustl.edu	37	15	42749300	42749300	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:42749300T>C	ENST00000263805.4	-	1	430	c.104A>G	c.(103-105)tAt>tGt	p.Y35C	ZNF106_ENST00000565380.1_Intron|ZNF106_ENST00000565611.1_Intron	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	35					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GTGCTTTGCATATGCAGAAAG	0.473																																																	0													75.0	67.0	70.0					15																	42749300		2203	4299	6502	SO:0001583	missense	0			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.104A>G	15.37:g.42749300T>C	ENSP00000263805:p.Tyr35Cys		B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_Znf_C2H2-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Y35C	ENST00000263805.4	37	c.104	CCDS32208.1	15	.	.	.	.	.	.	.	.	.	.	T	20.4	3.989780	0.74589	.	.	ENSG00000103994	ENST00000263805	T	0.46063	0.88	5.62	5.62	0.85841	Zinc finger, C2H2-like (1);	0.000000	0.64402	D	0.000001	T	0.62865	0.2463	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.66114	-0.6004	10	0.87932	D	0	-19.0884	15.8132	0.78581	0.0:0.0:0.0:1.0	.	35	Q9H2Y7	ZF106_HUMAN	C	35	ENSP00000263805:Y35C	ENSP00000263805:Y35C	Y	-	2	0	ZFP106	40536592	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.678000	0.84035	2.140000	0.66376	0.448000	0.29417	TAT	ZNF106	-	smart_Znf_C2H2-like	ENSG00000103994		0.473	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF106	HGNC	protein_coding	OTTHUMT00000422587.1	-	0.00	43	0	T	NM_022473		42749300	-1	tier1	-	no_errors	ENST00000263805	ensembl	human	known	74_37	missense	40.62	19	13	SNP	1.000	C
ZNF107	51427	genome.wustl.edu	37	7	64167974	64167974	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr7:64167974A>G	ENST00000395391.1	+	4	2667	c.1292A>G	c.(1291-1293)aAg>aGg	p.K431R	ZNF107_ENST00000344930.3_Missense_Mutation_p.K431R|ZNF107_ENST00000423627.1_Missense_Mutation_p.K431R			Q9UII5	ZN107_HUMAN	zinc finger protein 107	431					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(18)|ovary(1)|stomach(1)	37		Lung NSC(55;0.00948)|all_lung(88;0.0249)				ACTAGACATAAGAAAATTCAT	0.343																																																	0													33.0	36.0	35.0					7																	64167974		2193	4296	6489	SO:0001583	missense	0			AB027251	CCDS5527.1, CCDS75605.1, CCDS75606.1	7q11.2	2013-01-08	2007-06-26			ENSG00000196247		"""Zinc fingers, C2H2-type"""	12887	protein-coding gene	gene with protein product		603989	"""zinc finger protein 588"", ""zinc finger protein 107 (Y8)"""	ZNF588		8467795	Standard	NM_016220		Approved	ZFD25, smap-7	uc003tte.3	Q9UII5		ENST00000395391.1:c.1292A>G	7.37:g.64167974A>G	ENSP00000378789:p.Lys431Arg			Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K431R	ENST00000395391.1	37	c.1292	CCDS5527.1	7	.	.	.	.	.	.	.	.	.	.	.	17.74	3.463672	0.63513	.	.	ENSG00000196247	ENST00000344930;ENST00000423627;ENST00000395391	T;T;T	0.07444	3.19;3.19;3.19	1.27	-0.258	0.12975	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06781	0.0173	N	0.10664	0.02	0.19945	N	0.999946	P	0.49358	0.923	P	0.55303	0.773	T	0.33266	-0.9875	8	.	.	.	.	4.1822	0.10381	0.7553:0.0:0.2447:0.0	.	431	Q9UII5	ZN107_HUMAN	R	431	ENSP00000343443:K431R;ENSP00000400037:K431R;ENSP00000378789:K431R	.	K	+	2	0	ZNF107	63805409	0.000000	0.05858	0.491000	0.27477	0.966000	0.64601	0.029000	0.13666	-0.227000	0.09884	0.260000	0.18958	AAG	ZNF107	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196247		0.343	ZNF107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF107	HGNC	protein_coding	OTTHUMT00000251593.1	-	0.00	29	0	A	NM_016220		64167974	+1	tier1	-	no_errors	ENST00000344930	ensembl	human	known	74_37	missense	35.48	20	11	SNP	0.860	G
ZNF18	7566	genome.wustl.edu	37	17	11881932	11881932	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr17:11881932T>C	ENST00000322748.3	-	9	1596	c.992A>G	c.(991-993)gAg>gGg	p.E331G	RP11-1096G20.5_ENST00000580270.1_RNA|ZNF18_ENST00000580306.2_Missense_Mutation_p.E331G|ZNF18_ENST00000454073.3_Missense_Mutation_p.E330G	NM_144680.2	NP_653281.2	P17022	ZNF18_HUMAN	zinc finger protein 18	331					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)	14				Colorectal(4;3.33e-05)|COAD - Colon adenocarcinoma(4;0.000494)|READ - Rectum adenocarcinoma(10;0.233)		TGGCTCATCCTCAGTGAAGAA	0.517																																																	0													132.0	141.0	138.0					17																	11881932		2203	4300	6503	SO:0001583	missense	0			X52342	CCDS32568.1	17p12	2013-01-09	2006-05-10		ENSG00000154957	ENSG00000154957		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12969	protein-coding gene	gene with protein product		194524	"""zinc finger protein 18 (KOX 11)"""			15702252	Standard	XM_005256786		Approved	ZKSCAN6, KOX11, HDSG1, Zfp535, ZNF535, ZSCAN38	uc002gng.1	P17022	OTTHUMG00000178307	ENST00000322748.3:c.992A>G	17.37:g.11881932T>C	ENSP00000315664:p.Glu331Gly		Q5QHQ3|Q8IYC4|Q8NAH6	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.E331G	ENST00000322748.3	37	c.992	CCDS32568.1	17	.	.	.	.	.	.	.	.	.	.	T	14.50	2.554392	0.45487	.	.	ENSG00000154957	ENST00000454073;ENST00000322748	T	0.07444	3.19	5.39	4.24	0.50183	.	0.110989	0.40222	N	0.001143	T	0.05823	0.0152	N	0.24115	0.695	0.20873	N	0.999838	B;B	0.28850	0.225;0.144	B;B	0.21151	0.033;0.015	T	0.29088	-1.0023	10	0.66056	D	0.02	-11.3354	9.6913	0.40129	0.1555:0.0:0.0:0.8445	.	330;331	P17022-2;P17022	.;ZNF18_HUMAN	G	331	ENSP00000315664:E331G	ENSP00000315664:E331G	E	-	2	0	ZNF18	11822657	0.001000	0.12720	0.145000	0.22337	0.793000	0.44817	0.430000	0.21428	2.161000	0.67846	0.455000	0.32223	GAG	ZNF18	-	NULL	ENSG00000154957		0.517	ZNF18-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF18	HGNC	protein_coding	OTTHUMT00000441450.2	-	0.00	56	0	T	XM_085596		11881932	-1	tier1	-	no_errors	ENST00000322748	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.510	C
ZNF292	23036	genome.wustl.edu	37	6	87968551	87968551	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr6:87968551C>T	ENST00000369577.3	+	8	5247	c.5204C>T	c.(5203-5205)tCa>tTa	p.S1735L	ZNF292_ENST00000339907.4_Missense_Mutation_p.S1730L	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	1735						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GCTTTGAATTCATGCACAACT	0.313																																																	0													34.0	33.0	33.0					6																	87968551		1807	4069	5876	SO:0001583	missense	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.5204C>T	6.37:g.87968551C>T	ENSP00000358590:p.Ser1735Leu		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S1735L	ENST00000369577.3	37	c.5204	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	C	18.30	3.593101	0.66219	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.09817	2.94;2.95	5.89	5.89	0.94794	.	0.091610	0.44688	D	0.000428	T	0.09113	0.0225	N	0.24115	0.695	0.45284	D	0.998289	D	0.53151	0.958	P	0.49252	0.604	T	0.06588	-1.0818	10	0.87932	D	0	.	20.2625	0.98452	0.0:1.0:0.0:0.0	.	1735	O60281	ZN292_HUMAN	L	1735;1730	ENSP00000358590:S1735L;ENSP00000342847:S1730L	ENSP00000342847:S1730L	S	+	2	0	ZNF292	88025270	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.784000	0.68990	2.782000	0.95742	0.557000	0.71058	TCA	ZNF292	-	NULL	ENSG00000188994		0.313	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2		0.00	22	0	C	NM_015021		87968551	+1			no_errors	ENST00000369577	ensembl	human	known	74_37	missense	8.11	34	3	SNP	1.000	T
ZNF337	26152	genome.wustl.edu	37	20	25655911	25655911	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr20:25655911G>T	ENST00000376436.1	-	4	2552	c.2013C>A	c.(2011-2013)ctC>ctA	p.L671L	ZNF337_ENST00000538750.1_Silent_p.L639L|ZNF337_ENST00000481610.1_5'Flank|RP4-694B14.5_ENST00000414393.1_RNA|RP4-694B14.5_ENST00000439498.1_RNA|RP4-694B14.5_ENST00000455791.1_RNA|RP4-694B14.5_ENST00000428254.1_RNA|ZNF337_ENST00000252979.5_Silent_p.L671L|RP4-694B14.5_ENST00000421829.1_RNA			Q9Y3M9	ZN337_HUMAN	zinc finger protein 337	671					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGTGTCTGGTGAGACTTCTCT	0.512																																																	0													101.0	95.0	97.0					20																	25655911		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13174.1	20p11.1	2013-09-20			ENSG00000130684	ENSG00000130684		"""Zinc fingers, C2H2-type"", ""-"""	15809	protein-coding gene	gene with protein product							Standard	XM_005260702		Approved	dJ694B14.1	uc002wuz.3	Q9Y3M9	OTTHUMG00000032131	ENST00000376436.1:c.2013C>A	20.37:g.25655911G>T			B4DSM2|Q9Y3Y5	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L671	ENST00000376436.1	37	c.2013	CCDS13174.1	20																																																																																			ZNF337	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000130684		0.512	ZNF337-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF337	HGNC	protein_coding	OTTHUMT00000078454.1	-	0.00	51	0	G			25655911	-1	tier1	-	no_errors	ENST00000252979	ensembl	human	known	74_37	silent	5.48	69	4	SNP	0.003	T
ZNF365	22891	genome.wustl.edu	37	10	64416228	64416228	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr10:64416228G>T	ENST00000395251.1	+	5	798	c.464G>T	c.(463-465)gGa>gTa	p.G155V	AC067751.1_ENST00000579246.1_RNA|ZNF365_ENST00000410046.3_Missense_Mutation_p.G401V|ZNF365_ENST00000395249.1_Intron	NM_199452.3	NP_955524	Q70YC4	TALAN_HUMAN	zinc finger protein 365	155										breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	Prostate(12;0.0297)|all_hematologic(501;0.228)					gacgtcttaggactccaggac	0.433																																																	0													188.0	152.0	164.0					10																	64416228		2203	4300	6503	SO:0001583	missense	0			AB020651	CCDS7264.1, CCDS7265.1, CCDS31209.1, CCDS41531.1	10q21.2	2008-10-28			ENSG00000138311	ENSG00000138311		"""Zinc fingers, C2H2-type"""	18194	protein-coding gene	gene with protein product	"""Talanin"""	607818				10048485, 12740763	Standard	NM_199450		Approved	KIAA0844, UAN	uc001jmc.2	Q70YC4	OTTHUMG00000018302	ENST00000395251.1:c.464G>T	10.37:g.64416228G>T	ENSP00000378672:p.Gly155Val			Missense_Mutation	SNP	NULL	p.G401V	ENST00000395251.1	37	c.1202	CCDS7265.1	10	.	.	.	.	.	.	.	.	.	.	G	3.464	-0.109431	0.06924	.	.	ENSG00000138311	ENST00000410046;ENST00000395251	T	0.59083	0.29	0.593	0.593	0.17478	.	3.998870	0.00424	N	0.000067	T	0.58206	0.2106	N	0.08118	0	0.09310	N	1	D;D	0.76494	0.999;0.997	D;D	0.76575	0.988;0.979	T	0.55704	-0.8099	9	0.87932	D	0	.	.	.	.	.	155;401	Q70YC4;Q70YC5-3	TALAN_HUMAN;.	V	401;155	ENSP00000378672:G155V	ENSP00000378672:G155V	G	+	2	0	ZNF365	64086234	0.047000	0.20315	0.011000	0.14972	0.008000	0.06430	0.522000	0.22909	0.579000	0.29504	0.585000	0.79938	GGA	ZNF365	-	NULL	ENSG00000138311		0.433	ZNF365-006	KNOWN	basic|CCDS	protein_coding	ZNF365	HGNC	protein_coding	OTTHUMT00000277036.1		0.00	60	0	G	NM_014951		64416228	+1			no_errors	ENST00000410046	ensembl	human	known	74_37	missense	5.06	75	4	SNP	0.013	T
ZNF484	83744	genome.wustl.edu	37	9	95608570	95608570	+	Silent	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr9:95608570G>T	ENST00000375495.3	-	5	2647	c.2499C>A	c.(2497-2499)tcC>tcA	p.S833S	ZNF484_ENST00000395505.2_Silent_p.S797S|ANKRD19P_ENST00000473204.1_RNA|ZNF484_ENST00000332591.6_Silent_p.S797S|ZNF484_ENST00000395506.3_Silent_p.S835S	NM_031486.2	NP_113674.1	Q5JVG2	ZN484_HUMAN	zinc finger protein 484	833					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|kidney(8)|large_intestine(10)|lung(10)|prostate(2)	33						ATTGTGGCATGGAGCACTCTA	0.438																																																	0													185.0	179.0	181.0					9																	95608570		2203	4300	6503	SO:0001819	synonymous_variant	0			AK091203	CCDS35066.1, CCDS35067.1, CCDS59136.1	9q22.32	2013-01-08			ENSG00000127081	ENSG00000127081		"""Zinc fingers, C2H2-type"", ""-"""	23385	protein-coding gene	gene with protein product							Standard	NM_001007101		Approved	BA526D8.4, FLJ33884	uc004asu.2	Q5JVG2	OTTHUMG00000020236	ENST00000375495.3:c.2499C>A	9.37:g.95608570G>T			B1AL89|B4DRI2	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S835	ENST00000375495.3	37	c.2505	CCDS35066.1	9																																																																																			ZNF484	-	NULL	ENSG00000127081		0.438	ZNF484-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF484	HGNC	protein_coding	OTTHUMT00000053111.2	-	0.00	72	0	G	XM_046861		95608570	-1	tier1	-	no_errors	ENST00000395506	ensembl	human	known	74_37	silent	5.56	68	4	SNP	0.000	T
ZNF510	22869	genome.wustl.edu	37	9	99521732	99521732	+	Nonsense_Mutation	SNP	A	A	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr9:99521732A>T	ENST00000375231.1	-	6	2030	c.1380T>A	c.(1378-1380)taT>taA	p.Y460*	ZNF510_ENST00000223428.4_Nonsense_Mutation_p.Y460*			Q9Y2H8	ZN510_HUMAN	zinc finger protein 510	460					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	21		Acute lymphoblastic leukemia(62;0.0527)				CATTACATTTATAGGGTTTTT	0.388																																																	0													93.0	95.0	94.0					9																	99521732		2203	4300	6503	SO:0001587	stop_gained	0			AB023189	CCDS35074.1	9q22.33	2013-01-08			ENSG00000081386	ENSG00000081386		"""Zinc fingers, C2H2-type"", ""-"""	29161	protein-coding gene	gene with protein product						10231032	Standard	XM_005251807		Approved	KIAA0972	uc004awn.1	Q9Y2H8	OTTHUMG00000020303	ENST00000375231.1:c.1380T>A	9.37:g.99521732A>T	ENSP00000364379:p.Tyr460*		Q5SZP5	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y460*	ENST00000375231.1	37	c.1380	CCDS35074.1	9	.	.	.	.	.	.	.	.	.	.	a	42	9.543120	0.99201	.	.	ENSG00000081386	ENST00000375231;ENST00000223428	.	.	.	3.16	3.16	0.36331	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0494	0.42205	1.0:0.0:0.0:0.0	.	.	.	.	X	460	.	ENSP00000223428:Y460X	Y	-	3	2	ZNF510	98561553	0.000000	0.05858	1.000000	0.80357	0.998000	0.95712	-0.070000	0.11523	1.684000	0.51022	0.533000	0.62120	TAT	ZNF510	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000081386		0.388	ZNF510-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF510	HGNC	protein_coding	OTTHUMT00000053287.1	-	0.00	50	0	A	NM_014930		99521732	-1	tier1	-	no_errors	ENST00000223428	ensembl	human	known	74_37	nonsense	31.88	47	22	SNP	0.568	T
ZNF518B	85460	genome.wustl.edu	37	4	10446497	10446497	+	Silent	SNP	G	G	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr4:10446497G>A	ENST00000326756.3	-	3	1894	c.1456C>T	c.(1456-1458)Cta>Tta	p.L486L		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	486					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						ACAGATGCTAGAGAATGACCT	0.343																																																	0													78.0	82.0	81.0					4																	10446497		2203	4300	6503	SO:0001819	synonymous_variant	0			AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.1456C>T	4.37:g.10446497G>A			Q96LN8	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L486	ENST00000326756.3	37	c.1456	CCDS33960.1	4																																																																																			ZNF518B	-	NULL	ENSG00000178163		0.343	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF518B	HGNC	protein_coding	OTTHUMT00000359040.1		0.00	25	0	G	NM_053042		10446497	-1			no_errors	ENST00000326756	ensembl	human	known	74_37	silent	8.33	22	2	SNP	0.094	A
ZNF525	170958	genome.wustl.edu	37	19	53884541	53884541	+	5'Flank	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:53884541C>T	ENST00000355326.3	+	0	0				ZNF525_ENST00000474037.1_Missense_Mutation_p.H237Y|ZNF525_ENST00000467003.1_Missense_Mutation_p.H201Y|ZNF525_ENST00000475179.1_Intron|ZNF525_ENST00000593918.1_Intron			Q8N782	ZN525_HUMAN	zinc finger protein 525						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)|lung(3)	9						TCAGATTATTCATCTAGGAGA	0.388																																																	0																																										SO:0001631	upstream_gene_variant	0			AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277		19.37:g.53884541C>T	Exception_encountered		Q8TF23	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H237Y	ENST00000355326.3	37	c.709		19	.	.	.	.	.	.	.	.	.	.	C	11.83	1.754983	0.31046	.	.	ENSG00000203326	ENST00000474037;ENST00000467003	D;D	0.88896	-2.44;-2.44	1.16	-2.07	0.07276	.	.	.	.	.	D	0.88872	0.6555	.	.	.	0.51767	D	0.999932	.	.	.	.	.	.	D	0.83925	0.0303	6	0.62326	D	0.03	.	7.2525	0.26158	0.0:0.6834:0.0:0.3166	.	.	.	.	Y	237;201	ENSP00000417696:H237Y;ENSP00000419136:H201Y	ENSP00000419136:H201Y	H	+	1	0	ZNF525	58576353	0.056000	0.20664	0.000000	0.03702	0.001000	0.01503	1.825000	0.39081	-0.654000	0.05394	-1.261000	0.01458	CAT	ZNF525	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000203326		0.388	ZNF525-201	KNOWN	basic	protein_coding	ZNF525	HGNC	protein_coding		-	0.00	70	0	C	NR_003699		53884541	+1	tier1	-	no_errors	ENST00000474037	ensembl	human	putative	74_37	missense	16.33	41	8	SNP	0.460	T
ZNF598	90850	genome.wustl.edu	37	16	2053040	2053040	+	Silent	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr16:2053040C>T	ENST00000563630.1	-	3	494	c.252G>A	c.(250-252)cgG>cgA	p.R84R	ZNF598_ENST00000431526.1_Silent_p.R139R|ZNF598_ENST00000562103.1_Silent_p.R84R			Q86UK7	ZN598_HUMAN	zinc finger protein 598	139							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						CATGCTGCCTCCGCATGTGCT	0.677																																																	0													10.0	14.0	13.0					16																	2053040		2025	4158	6183	SO:0001819	synonymous_variant	0			BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.252G>A	16.37:g.2053040C>T			Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Silent	SNP	superfamily_PAH,smart_Znf_C2H2-like,pfscan_Znf_RING	p.R139	ENST00000563630.1	37	c.417		16																																																																																			ZNF598	-	smart_Znf_C2H2-like	ENSG00000167962		0.677	ZNF598-001	NOVEL	basic	protein_coding	ZNF598	HGNC	protein_coding	OTTHUMT00000434439.1		0.00	17	0	C	NM_178167		2053040	-1			no_errors	ENST00000431526	ensembl	human	known	74_37	silent	55.56	4	5	SNP	1.000	T
ZNF608	57507	genome.wustl.edu	37	5	123982500	123982500	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr5:123982500G>T	ENST00000306315.5	-	4	4012	c.3577C>A	c.(3577-3579)Ctt>Att	p.L1193I	ZNF608_ENST00000504926.1_Missense_Mutation_p.L766I|ZNF608_ENST00000513985.1_5'Flank	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	1193							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TCGGCCTGAAGCTGCTGCTGG	0.468																																																	0													162.0	156.0	158.0					5																	123982500		2203	4300	6503	SO:0001583	missense	0			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.3577C>A	5.37:g.123982500G>T	ENSP00000307746:p.Leu1193Ile		A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	NULL	p.L1193I	ENST00000306315.5	37	c.3577	CCDS34219.1	5	.	.	.	.	.	.	.	.	.	.	G	11.60	1.686996	0.29962	.	.	ENSG00000168916	ENST00000504926;ENST00000306315	T;T	0.44881	0.92;0.91	5.97	5.97	0.96955	.	0.312122	0.25929	N	0.027383	T	0.39517	0.1081	L	0.51422	1.61	0.39765	D	0.972087	B	0.11235	0.004	B	0.14578	0.011	T	0.14896	-1.0456	10	0.36615	T	0.2	-13.0674	14.3413	0.66627	0.0:0.0:0.8524:0.1476	.	1193	Q9ULD9	ZN608_HUMAN	I	766;1193	ENSP00000427657:L766I;ENSP00000307746:L1193I	ENSP00000307746:L1193I	L	-	1	0	ZNF608	124010399	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.978000	0.63799	2.831000	0.97527	0.643000	0.83706	CTT	ZNF608	-	NULL	ENSG00000168916		0.468	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	HGNC	protein_coding	OTTHUMT00000371300.1	-	0.00	90	0	G	XM_114432		123982500	-1	tier1	-	no_errors	ENST00000306315	ensembl	human	known	74_37	missense	5.38	88	5	SNP	1.000	T
ZNF670	93474	genome.wustl.edu	37	1	247201560	247201560	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr1:247201560G>T	ENST00000366503.2	-	4	519	c.361C>A	c.(361-363)Cac>Aac	p.H121N		NM_001204220.1|NM_033213.4	NP_001191149.1|NP_149990.1	Q9BS34	ZN670_HUMAN	zinc finger protein 670	121					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	17	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00427)			GACAGGATGTGCCTATGAAGG	0.383																																																	0													168.0	154.0	159.0					1																	247201560		2203	4300	6503	SO:0001583	missense	0				CCDS31087.1	1q44	2013-01-08			ENSG00000135747	ENSG00000135747		"""Zinc fingers, C2H2-type"", ""-"""	28167	protein-coding gene	gene with protein product						12477932	Standard	NM_033213		Approved	MGC12466	uc001icd.2	Q9BS34	OTTHUMG00000040868	ENST00000366503.2:c.361C>A	1.37:g.247201560G>T	ENSP00000355459:p.His121Asn			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H121N	ENST00000366503.2	37	c.361	CCDS31087.1	1	.	.	.	.	.	.	.	.	.	.	G	12.74	2.027126	0.35797	.	.	ENSG00000135747	ENST00000366503	T	0.34859	1.34	0.427	0.427	0.16489	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.65344	0.2682	H	0.95611	3.695	0.09310	N	1	D	0.89917	1.0	D	0.76071	0.987	T	0.51655	-0.8678	9	0.66056	D	0.02	.	6.6408	0.22909	1.0E-4:0.0:0.9999:0.0	.	121	Q9BS34	ZN670_HUMAN	N	121	ENSP00000355459:H121N	ENSP00000355459:H121N	H	-	1	0	ZNF670	245268183	0.388000	0.25197	0.180000	0.23079	0.433000	0.31745	1.714000	0.37961	0.458000	0.26988	0.467000	0.42956	CAC	ZNF670	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000135747		0.383	ZNF670-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF670	HGNC	protein_coding	OTTHUMT00000098183.3	-	0.00	32	0	G	NM_033213		247201560	-1	tier1	-	no_errors	ENST00000366503	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.055	T
ZNF724P	440519	genome.wustl.edu	37	19	23414089	23414089	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:23414089C>T	ENST00000418100.1	-	3	322	c.205G>A	c.(205-207)Gag>Aag	p.E69K	ZNF724P_ENST00000597037.1_Missense_Mutation_p.E69K			A8MTY0	ZN724_HUMAN	zinc finger protein 724, pseudogene	69	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|lung(2)|ovary(2)	8						GCCACCATCTCATGTCTCTCC	0.428																																																	0																																										SO:0001583	missense	0					19p12	2014-02-14	2010-08-03		ENSG00000196081	ENSG00000196081			32460	pseudogene	pseudogene			"""zinc finger protein 724 pseudogene"", ""zinc finger protein 724 (pseudogene)"""				Standard	NR_045525		Approved		uc021uru.1	A8MTY0	OTTHUMG00000183231	ENST00000418100.1:c.205G>A	19.37:g.23414089C>T	ENSP00000413411:p.Glu69Lys			Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.E69K	ENST00000418100.1	37	c.205		19	.	.	.	.	.	.	.	.	.	.	C	7.209	0.595103	0.13875	.	.	ENSG00000196081	ENST00000418100	T	0.06933	3.24	0.51	0.51	0.16983	Krueppel-associated box (1);	.	.	.	.	T	0.03695	0.0105	.	.	.	0.09310	N	1	B	0.20164	0.042	B	0.18561	0.022	T	0.47446	-0.9117	8	0.10377	T	0.69	.	6.791	0.23699	0.0:0.9999:0.0:1.0E-4	.	69	A8MTY0	ZN724_HUMAN	K	69	ENSP00000413411:E69K	ENSP00000413411:E69K	E	-	1	0	ZNF724P	23205929	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	-0.962000	0.03841	0.518000	0.28383	0.313000	0.20887	GAG	ZNF724P	-	pfscan_Krueppel-associated_box	ENSG00000196081		0.428	ZNF724P-001	NOVEL	basic|appris_principal	protein_coding	ZNF724P	HGNC	protein_coding	OTTHUMT00000465743.1	-	0.00	85	0	C			23414089	-1	tier1	-	no_errors	ENST00000597037	ensembl	human	putative	74_37	missense	7.46	62	5	SNP	0.013	T
ZNF770	54989	genome.wustl.edu	37	15	35274883	35274883	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:35274883C>A	ENST00000356321.4	-	3	1097	c.753G>T	c.(751-753)aaG>aaT	p.K251N		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	251					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		CTGTACGCCTCTTCTTTAATA	0.373																																																	0													41.0	43.0	42.0					15																	35274883		2201	4298	6499	SO:0001583	missense	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.753G>T	15.37:g.35274883C>A	ENSP00000348673:p.Lys251Asn		Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K251N	ENST00000356321.4	37	c.753	CCDS10042.1	15	.	.	.	.	.	.	.	.	.	.	C	0.765	-0.767931	0.02974	.	.	ENSG00000198146	ENST00000356321	T	0.10192	2.9	5.02	-0.942	0.10398	.	2.915120	0.01593	U	0.021682	T	0.07234	0.0183	N	0.19112	0.55	0.09310	N	1	B	0.28971	0.229	B	0.25759	0.063	T	0.29761	-1.0001	10	0.87932	D	0	10.7469	2.2316	0.03998	0.1444:0.1617:0.1433:0.5505	.	251	Q6IQ21	ZN770_HUMAN	N	251	ENSP00000348673:K251N	ENSP00000348673:K251N	K	-	3	2	ZNF770	33062175	0.151000	0.22747	0.007000	0.13788	0.098000	0.18820	0.362000	0.20284	-0.309000	0.08779	0.655000	0.94253	AAG	ZNF770	-	NULL	ENSG00000198146		0.373	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	-	0.00	27	0	C	NM_014106		35274883	-1	tier1	-	no_errors	ENST00000356321	ensembl	human	known	74_37	missense	63.89	13	23	SNP	0.013	A
ZNF770	54989	genome.wustl.edu	37	15	35274940	35274940	+	Silent	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:35274940C>T	ENST00000356321.4	-	3	1040	c.696G>A	c.(694-696)ctG>ctA	p.L232L		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	232					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		GTTTATGCTTCAGAAGTTTGC	0.353																																																	0													46.0	45.0	45.0					15																	35274940		2201	4297	6498	SO:0001819	synonymous_variant	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.696G>A	15.37:g.35274940C>T			Q6ZMZ6|Q9NWV2	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L232	ENST00000356321.4	37	c.696	CCDS10042.1	15																																																																																			ZNF770	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198146		0.353	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	-	0.00	36	0	C	NM_014106		35274940	-1	tier1	-	no_errors	ENST00000356321	ensembl	human	known	74_37	silent	47.27	29	26	SNP	0.992	T
ZNF770	54989	genome.wustl.edu	37	15	35274965	35274965	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:35274965C>G	ENST00000356321.4	-	3	1015	c.671G>C	c.(670-672)gGa>gCa	p.G224A		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	224					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		AATCTTAAATCCTTTTTGACA	0.348																																																	0													52.0	49.0	50.0					15																	35274965		2200	4298	6498	SO:0001583	missense	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.671G>C	15.37:g.35274965C>G	ENSP00000348673:p.Gly224Ala		Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G224A	ENST00000356321.4	37	c.671	CCDS10042.1	15	.	.	.	.	.	.	.	.	.	.	C	12.42	1.932119	0.34096	.	.	ENSG00000198146	ENST00000356321	T	0.06608	3.28	5.28	5.28	0.74379	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.251738	0.24991	N	0.033999	T	0.04003	0.0112	N	0.01824	-0.7	0.28739	N	0.902072	P	0.50272	0.933	P	0.55749	0.783	T	0.35400	-0.9790	10	0.02654	T	1	-10.6155	9.1211	0.36788	0.0:0.7751:0.1485:0.0765	.	224	Q6IQ21	ZN770_HUMAN	A	224	ENSP00000348673:G224A	ENSP00000348673:G224A	G	-	2	0	ZNF770	33062257	0.980000	0.34600	1.000000	0.80357	0.998000	0.95712	1.721000	0.38032	2.736000	0.93811	0.655000	0.94253	GGA	ZNF770	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198146		0.348	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	-	0.00	38	0	C	NM_014106		35274965	-1	tier1	-	no_errors	ENST00000356321	ensembl	human	known	74_37	missense	47.27	29	26	SNP	1.000	G
ZNF770	54989	genome.wustl.edu	37	15	35275079	35275079	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:35275079C>A	ENST00000356321.4	-	3	901	c.557G>T	c.(556-558)aGg>aTg	p.R186M		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	186					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		TTTAAAAGGCCTCTGACCAGT	0.348																																																	0													65.0	64.0	65.0					15																	35275079		2201	4298	6499	SO:0001583	missense	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.557G>T	15.37:g.35275079C>A	ENSP00000348673:p.Arg186Met		Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R186M	ENST00000356321.4	37	c.557	CCDS10042.1	15	.	.	.	.	.	.	.	.	.	.	C	14.41	2.525866	0.44969	.	.	ENSG00000198146	ENST00000356321	T	0.20332	2.08	5.28	1.1	0.20463	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.070768	0.52532	D	0.000071	T	0.38532	0.1044	M	0.74647	2.275	0.29698	N	0.840428	D	0.76494	0.999	D	0.71870	0.975	T	0.22661	-1.0210	10	0.87932	D	0	-9.9783	6.5284	0.22314	0.0:0.4155:0.0:0.5845	.	186	Q6IQ21	ZN770_HUMAN	M	186	ENSP00000348673:R186M	ENSP00000348673:R186M	R	-	2	0	ZNF770	33062371	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.481000	0.35476	0.381000	0.24851	0.655000	0.94253	AGG	ZNF770	-	pfscan_Znf_C2H2	ENSG00000198146		0.348	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	-	0.00	25	0	C	NM_014106		35275079	-1	tier1	-	no_errors	ENST00000356321	ensembl	human	known	74_37	missense	47.92	25	23	SNP	0.998	A
ZNF770	54989	genome.wustl.edu	37	15	35275110	35275110	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:35275110C>G	ENST00000356321.4	-	3	870	c.526G>C	c.(526-528)Gat>Cat	p.D176H		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	176					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		ACATGCCTATCAAGTTTTGAC	0.378																																																	0													77.0	75.0	76.0					15																	35275110		2201	4298	6499	SO:0001583	missense	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.526G>C	15.37:g.35275110C>G	ENSP00000348673:p.Asp176His		Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D176H	ENST00000356321.4	37	c.526	CCDS10042.1	15	.	.	.	.	.	.	.	.	.	.	C	12.60	1.986903	0.35036	.	.	ENSG00000198146	ENST00000356321	T	0.07908	3.15	5.28	4.37	0.52481	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.156215	0.40908	D	0.000982	T	0.15219	0.0367	L	0.31664	0.95	0.09310	N	0.999997	D	0.61697	0.99	D	0.66602	0.945	T	0.04737	-1.0930	10	0.41790	T	0.15	-14.4254	11.2489	0.49013	0.0:0.8537:0.0:0.1463	.	176	Q6IQ21	ZN770_HUMAN	H	176	ENSP00000348673:D176H	ENSP00000348673:D176H	D	-	1	0	ZNF770	33062402	0.515000	0.26210	0.984000	0.44739	0.992000	0.81027	1.136000	0.31467	1.455000	0.47813	0.655000	0.94253	GAT	ZNF770	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198146		0.378	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	-	0.00	31	0	C	NM_014106		35275110	-1	tier1	-	no_errors	ENST00000356321	ensembl	human	known	74_37	missense	43.14	29	22	SNP	0.269	G
ZNF770	54989	genome.wustl.edu	37	15	35275135	35275135	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:35275135C>G	ENST00000356321.4	-	3	845	c.501G>C	c.(499-501)aaG>aaC	p.K167N		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	167					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		ATGGAAACATCTTGCCACAGA	0.393																																																	0													90.0	86.0	88.0					15																	35275135		2201	4298	6499	SO:0001583	missense	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.501G>C	15.37:g.35275135C>G	ENSP00000348673:p.Lys167Asn		Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K167N	ENST00000356321.4	37	c.501	CCDS10042.1	15	.	.	.	.	.	.	.	.	.	.	C	14.84	2.656477	0.47467	.	.	ENSG00000198146	ENST00000356321	T	0.07908	3.15	5.28	1.33	0.21861	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000001	T	0.14614	0.0353	L	0.29908	0.895	0.32946	D	0.519143	D	0.89917	1.0	D	0.91635	0.999	T	0.08785	-1.0705	10	0.87932	D	0	-10.496	8.2872	0.31935	0.0:0.6238:0.0:0.3762	.	167	Q6IQ21	ZN770_HUMAN	N	167	ENSP00000348673:K167N	ENSP00000348673:K167N	K	-	3	2	ZNF770	33062427	1.000000	0.71417	0.985000	0.45067	0.984000	0.73092	2.245000	0.43133	0.091000	0.17302	0.655000	0.94253	AAG	ZNF770	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198146		0.393	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	-	0.00	30	0	C	NM_014106		35275135	-1	tier1	-	no_errors	ENST00000356321	ensembl	human	known	74_37	missense	40.38	31	21	SNP	0.999	G
ZNF770	54989	genome.wustl.edu	37	15	35275177	35275177	+	Missense_Mutation	SNP	C	C	T	rs146890379		TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:35275177C>T	ENST00000356321.4	-	3	803	c.459G>A	c.(457-459)atG>atA	p.M153I		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	153					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		TTCTTCTTTTCATGCTATACA	0.393																																																	0													101.0	97.0	98.0					15																	35275177		2201	4298	6499	SO:0001583	missense	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.459G>A	15.37:g.35275177C>T	ENSP00000348673:p.Met153Ile		Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.M153I	ENST00000356321.4	37	c.459	CCDS10042.1	15	.	.	.	.	.	.	.	.	.	.	C	1.081	-0.666896	0.03428	.	.	ENSG00000198146	ENST00000356321	T	0.07021	3.23	4.88	1.55	0.23275	.	0.931618	0.08861	N	0.883081	T	0.03220	0.0094	N	0.08118	0	0.09310	N	1	B	0.15141	0.012	B	0.12156	0.007	T	0.44667	-0.9313	10	0.02654	T	1	0.8896	3.7897	0.08715	0.0:0.2373:0.2097:0.553	.	153	Q6IQ21	ZN770_HUMAN	I	153	ENSP00000348673:M153I	ENSP00000348673:M153I	M	-	3	0	ZNF770	33062469	0.999000	0.42202	0.160000	0.22671	0.476000	0.33039	0.404000	0.20999	0.540000	0.28808	0.561000	0.74099	ATG	ZNF770	-	NULL	ENSG00000198146		0.393	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	-	0.00	38	0	C	NM_014106		35275177	-1	tier1	-	no_errors	ENST00000356321	ensembl	human	known	74_37	missense	45.24	23	19	SNP	0.001	T
ZNF770	54989	genome.wustl.edu	37	15	35275194	35275194	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:35275194C>G	ENST00000356321.4	-	3	786	c.442G>C	c.(442-444)Gat>Cat	p.D148H		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	148					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		TACATGGGATCAGACTTAGAG	0.393																																																	0													110.0	104.0	106.0					15																	35275194		2201	4298	6499	SO:0001583	missense	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.442G>C	15.37:g.35275194C>G	ENSP00000348673:p.Asp148His		Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D148H	ENST00000356321.4	37	c.442	CCDS10042.1	15	.	.	.	.	.	.	.	.	.	.	C	10.42	1.343956	0.24339	.	.	ENSG00000198146	ENST00000356321	T	0.10288	2.89	5.13	3.18	0.36537	.	0.069689	0.53938	N	0.000057	T	0.16557	0.0398	L	0.32530	0.975	0.30490	N	0.771468	D	0.69078	0.997	P	0.58077	0.832	T	0.02371	-1.1169	10	0.87932	D	0	-6.2949	10.704	0.45944	0.0:0.7959:0.1322:0.0719	.	148	Q6IQ21	ZN770_HUMAN	H	148	ENSP00000348673:D148H	ENSP00000348673:D148H	D	-	1	0	ZNF770	33062486	0.999000	0.42202	0.994000	0.49952	0.050000	0.14768	0.727000	0.25999	0.681000	0.31386	0.655000	0.94253	GAT	ZNF770	-	NULL	ENSG00000198146		0.393	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	-	0.00	35	0	C	NM_014106		35275194	-1	tier1	-	no_errors	ENST00000356321	ensembl	human	known	74_37	missense	45.45	24	20	SNP	0.974	G
ZNF770	54989	genome.wustl.edu	37	15	35275227	35275227	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:35275227C>A	ENST00000356321.4	-	3	753	c.409G>T	c.(409-411)Gaa>Taa	p.E137*		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	137					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		GCCCATCTTTCCTCTGTGGTA	0.388																																																	0													119.0	113.0	115.0					15																	35275227		2201	4298	6499	SO:0001587	stop_gained	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.409G>T	15.37:g.35275227C>A	ENSP00000348673:p.Glu137*		Q6ZMZ6|Q9NWV2	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E137*	ENST00000356321.4	37	c.409	CCDS10042.1	15	.	.	.	.	.	.	.	.	.	.	C	31	5.096130	0.94197	.	.	ENSG00000198146	ENST00000356321	.	.	.	4.7	4.7	0.59300	.	0.074395	0.52532	D	0.000080	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.2729	17.8245	0.88660	0.0:1.0:0.0:0.0	.	.	.	.	X	137	.	ENSP00000348673:E137X	E	-	1	0	ZNF770	33062519	0.999000	0.42202	1.000000	0.80357	0.861000	0.49209	2.934000	0.48956	2.434000	0.82447	0.655000	0.94253	GAA	ZNF770	-	NULL	ENSG00000198146		0.388	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	-	0.00	52	0	C	NM_014106		35275227	-1	tier1	-	no_errors	ENST00000356321	ensembl	human	known	74_37	nonsense	44.90	27	22	SNP	1.000	A
ZNF770	54989	genome.wustl.edu	37	15	35275230	35275230	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:35275230C>A	ENST00000356321.4	-	3	750	c.406G>T	c.(406-408)Gag>Tag	p.E136*		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	136					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		CATCTTTCCTCTGTGGTAAAA	0.383																																																	0													119.0	113.0	115.0					15																	35275230		2201	4298	6499	SO:0001587	stop_gained	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.406G>T	15.37:g.35275230C>A	ENSP00000348673:p.Glu136*		Q6ZMZ6|Q9NWV2	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E136*	ENST00000356321.4	37	c.406	CCDS10042.1	15	.	.	.	.	.	.	.	.	.	.	C	20.3	3.973894	0.74246	.	.	ENSG00000198146	ENST00000356321	.	.	.	4.86	2.95	0.34219	.	0.308202	0.29579	N	0.011745	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-1.4898	9.6105	0.39659	0.0:0.6563:0.2706:0.0731	.	.	.	.	X	136	.	ENSP00000348673:E136X	E	-	1	0	ZNF770	33062522	.	.	0.996000	0.52242	0.880000	0.50808	.	.	0.626000	0.30322	-0.150000	0.13652	GAG	ZNF770	-	NULL	ENSG00000198146		0.383	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	-	0.00	51	0	C	NM_014106		35275230	-1	tier1	-	no_errors	ENST00000356321	ensembl	human	known	74_37	nonsense	45.28	29	24	SNP	0.768	A
ZNF770	54989	genome.wustl.edu	37	15	35275289	35275289	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:35275289C>G	ENST00000356321.4	-	3	691	c.347G>C	c.(346-348)aGa>aCa	p.R116T		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	116					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		CTCCAGCAATCTTCTGACCTG	0.393																																																	0													109.0	106.0	107.0					15																	35275289		2201	4298	6499	SO:0001583	missense	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.347G>C	15.37:g.35275289C>G	ENSP00000348673:p.Arg116Thr		Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R116T	ENST00000356321.4	37	c.347	CCDS10042.1	15	.	.	.	.	.	.	.	.	.	.	C	12.70	2.017490	0.35606	.	.	ENSG00000198146	ENST00000356321	T	0.09445	2.98	4.86	4.86	0.63082	.	0.204103	0.41001	D	0.000972	T	0.09992	0.0245	L	0.27053	0.805	0.33963	D	0.64588	D	0.54207	0.965	P	0.47573	0.55	T	0.07177	-1.0786	10	0.87932	D	0	-11.5781	6.663	0.23024	0.0:0.8111:0.0:0.1889	.	116	Q6IQ21	ZN770_HUMAN	T	116	ENSP00000348673:R116T	ENSP00000348673:R116T	R	-	2	0	ZNF770	33062581	0.592000	0.26832	0.999000	0.59377	0.770000	0.43624	0.499000	0.22546	2.515000	0.84797	0.655000	0.94253	AGA	ZNF770	-	NULL	ENSG00000198146		0.393	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	-	0.00	46	0	C	NM_014106		35275289	-1	tier1	-	no_errors	ENST00000356321	ensembl	human	known	74_37	missense	44.87	43	35	SNP	0.998	G
ZNF770	54989	genome.wustl.edu	37	15	35275292	35275292	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:35275292C>T	ENST00000356321.4	-	3	688	c.344G>A	c.(343-345)aGa>aAa	p.R115K		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	115					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		CAGCAATCTTCTGACCTGTTT	0.378																																																	0													106.0	104.0	105.0					15																	35275292		2201	4298	6499	SO:0001583	missense	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.344G>A	15.37:g.35275292C>T	ENSP00000348673:p.Arg115Lys		Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R115K	ENST00000356321.4	37	c.344	CCDS10042.1	15	.	.	.	.	.	.	.	.	.	.	C	3.062	-0.193058	0.06259	.	.	ENSG00000198146	ENST00000356321	T	0.08896	3.04	4.86	3.86	0.44501	.	0.384566	0.25523	N	0.030094	T	0.05364	0.0142	N	0.11560	0.145	0.25533	N	0.987259	B	0.19583	0.037	B	0.10450	0.005	T	0.31861	-0.9928	10	0.87932	D	0	-6.5457	12.6268	0.56634	0.0:0.9078:0.0:0.0922	.	115	Q6IQ21	ZN770_HUMAN	K	115	ENSP00000348673:R115K	ENSP00000348673:R115K	R	-	2	0	ZNF770	33062584	0.926000	0.31397	0.997000	0.53966	0.721000	0.41392	0.730000	0.26043	2.515000	0.84797	0.655000	0.94253	AGA	ZNF770	-	NULL	ENSG00000198146		0.378	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	-	0.00	46	0	C	NM_014106		35275292	-1	tier1	-	no_errors	ENST00000356321	ensembl	human	known	74_37	missense	43.42	43	33	SNP	0.981	T
ZNF770	54989	genome.wustl.edu	37	15	35275345	35275345	+	Silent	SNP	C	C	A			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:35275345C>A	ENST00000356321.4	-	3	635	c.291G>T	c.(289-291)gtG>gtT	p.V97V		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	97					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		GTTGGTGCTTCACAAATGTCT	0.368																																																	0													85.0	86.0	86.0					15																	35275345		2201	4298	6499	SO:0001819	synonymous_variant	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.291G>T	15.37:g.35275345C>A			Q6ZMZ6|Q9NWV2	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V97	ENST00000356321.4	37	c.291	CCDS10042.1	15																																																																																			ZNF770	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198146		0.368	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	-	0.00	46	0	C	NM_014106		35275345	-1	tier1	-	no_errors	ENST00000356321	ensembl	human	known	74_37	silent	38.81	41	26	SNP	1.000	A
ZNF770	54989	genome.wustl.edu	37	15	35275357	35275357	+	Silent	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:35275357C>T	ENST00000356321.4	-	3	623	c.279G>A	c.(277-279)ctG>ctA	p.L93L		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	93					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		CAAATGTCTTCAGATTTTTAA	0.368																																																	0													82.0	84.0	84.0					15																	35275357		2201	4298	6499	SO:0001819	synonymous_variant	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.279G>A	15.37:g.35275357C>T			Q6ZMZ6|Q9NWV2	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L93	ENST00000356321.4	37	c.279	CCDS10042.1	15																																																																																			ZNF770	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198146		0.368	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	-	0.00	46	0	C	NM_014106		35275357	-1	tier1	-	no_errors	ENST00000356321	ensembl	human	known	74_37	silent	34.33	44	23	SNP	1.000	T
ZNF770	54989	genome.wustl.edu	37	15	35275442	35275442	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:35275442C>G	ENST00000356321.4	-	3	538	c.194G>C	c.(193-195)aGa>aCa	p.R65T		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	65					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		AACTAGTTGTCTAAAGGTTTT	0.353																																																	0													79.0	77.0	78.0					15																	35275442		2201	4298	6499	SO:0001583	missense	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.194G>C	15.37:g.35275442C>G	ENSP00000348673:p.Arg65Thr		Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R65T	ENST00000356321.4	37	c.194	CCDS10042.1	15	.	.	.	.	.	.	.	.	.	.	C	11.83	1.755761	0.31046	.	.	ENSG00000198146	ENST00000356321	T	0.16073	2.37	5.0	4.08	0.47627	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.172661	0.39475	N	0.001358	T	0.14787	0.0357	N	0.03084	-0.415	0.30663	N	0.754194	D	0.89917	1.0	D	0.77557	0.99	T	0.08785	-1.0705	10	0.14252	T	0.57	-10.4495	8.2712	0.31844	0.0:0.7597:0.1589:0.0814	.	65	Q6IQ21	ZN770_HUMAN	T	65	ENSP00000348673:R65T	ENSP00000348673:R65T	R	-	2	0	ZNF770	33062734	1.000000	0.71417	0.977000	0.42913	0.997000	0.91878	3.087000	0.50167	1.310000	0.45006	0.655000	0.94253	AGA	ZNF770	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198146		0.353	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	-	0.00	78	0	C	NM_014106		35275442	-1	tier1	-	no_errors	ENST00000356321	ensembl	human	known	74_37	missense	32.47	52	25	SNP	0.981	G
ZNF770	54989	genome.wustl.edu	37	15	35275464	35275464	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr15:35275464C>T	ENST00000356321.4	-	3	516	c.172G>A	c.(172-174)Gat>Aat	p.D58N		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	58					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		TGACACACATCACATTCAAAT	0.358																																																	0													78.0	75.0	76.0					15																	35275464		2201	4295	6496	SO:0001583	missense	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.172G>A	15.37:g.35275464C>T	ENSP00000348673:p.Asp58Asn		Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D58N	ENST00000356321.4	37	c.172	CCDS10042.1	15	.	.	.	.	.	.	.	.	.	.	C	4.203	0.036404	0.08148	.	.	ENSG00000198146	ENST00000356321	T	0.19532	2.14	5.0	3.05	0.35203	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.462765	0.21088	N	0.080368	T	0.09818	0.0241	N	0.17278	0.47	0.27611	N	0.948645	P	0.40970	0.734	B	0.37780	0.258	T	0.12451	-1.0547	10	0.09084	T	0.74	-5.0875	7.4483	0.27223	0.0:0.5872:0.3139:0.0989	.	58	Q6IQ21	ZN770_HUMAN	N	58	ENSP00000348673:D58N	ENSP00000348673:D58N	D	-	1	0	ZNF770	33062756	0.787000	0.28750	1.000000	0.80357	0.991000	0.79684	0.446000	0.21694	1.341000	0.45600	0.655000	0.94253	GAT	ZNF770	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198146		0.358	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	-	0.00	86	0	C	NM_014106		35275464	-1	tier1	-	no_errors	ENST00000356321	ensembl	human	known	74_37	missense	31.08	51	23	SNP	0.997	T
ZNF823	55552	genome.wustl.edu	37	19	11835025	11835025	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:11835025C>G	ENST00000341191.6	-	3	328	c.175G>C	c.(175-177)Gcc>Ccc	p.A59P	CTC-499B15.6_ENST00000586983.1_RNA|ZNF823_ENST00000545749.1_Intron|ZNF823_ENST00000440527.1_Intron	NM_001080493.2	NP_001073962.1	P16415	ZN823_HUMAN	zinc finger protein 823	59	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)	26						TTTCTCTTGGCATTTTGGCAC	0.343										HNSCC(68;0.2)																																							0													102.0	90.0	94.0					19																	11835025		1853	4132	5985	SO:0001583	missense	0			X51760	CCDS45981.1	19p13.2	2013-01-08			ENSG00000197933	ENSG00000197933		"""Zinc fingers, C2H2-type"", ""-"""	30936	protein-coding gene	gene with protein product	"""ZFP 36 for a zinc finger protein"""						Standard	XM_006722789		Approved	HSZFP36	uc002msm.2	P16415	OTTHUMG00000156528	ENST00000341191.6:c.175G>C	19.37:g.11835025C>G	ENSP00000340683:p.Ala59Pro		A0PJL4|B7Z8D4|Q6P4A9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A59P	ENST00000341191.6	37	c.175	CCDS45981.1	19	.	.	.	.	.	.	.	.	.	.	c	0.010	-1.774242	0.00640	.	.	ENSG00000197933	ENST00000341191;ENST00000431998	T;T	0.06687	4.14;3.27	1.35	-2.71	0.05986	Krueppel-associated box (3);	.	.	.	.	T	0.02304	0.0071	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42413	-0.9453	9	0.34782	T	0.22	.	3.8379	0.08902	0.2011:0.5052:0.2937:0.0	.	59	P16415	ZN823_HUMAN	P	59;15	ENSP00000340683:A59P;ENSP00000410654:A15P	ENSP00000340683:A59P	A	-	1	0	ZNF823	11696025	0.000000	0.05858	0.001000	0.08648	0.079000	0.17450	-1.065000	0.03458	-0.850000	0.04152	-2.924000	0.00089	GCC	ZNF823	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000197933		0.343	ZNF823-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF823	HGNC	protein_coding	OTTHUMT00000344516.2	-	0.00	70	0	C	NM_001080493		11835025	-1	tier1	-	no_errors	ENST00000341191	ensembl	human	known	74_37	missense	25.37	50	17	SNP	0.001	G
ZNF860	344787	genome.wustl.edu	37	3	32031299	32031299	+	Nonsense_Mutation	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr3:32031299C>G	ENST00000360311.4	+	2	1277	c.728C>G	c.(727-729)tCa>tGa	p.S243*		NM_001137674.2	NP_001131146.2	A6NHJ4	ZN860_HUMAN	zinc finger protein 860	243					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(4)|ovary(1)	8						AATTGTAGCTCACTCTTAAGG	0.348																																																	0													77.0	59.0	65.0					3																	32031299		692	1591	2283	SO:0001587	stop_gained	0			AK294003	CCDS46784.1	3p24.1	2013-01-08			ENSG00000197385	ENSG00000197385		"""Zinc fingers, C2H2-type"", ""-"""	34513	protein-coding gene	gene with protein product							Standard	NM_001137674		Approved		uc011axg.2	A6NHJ4	OTTHUMG00000155838	ENST00000360311.4:c.728C>G	3.37:g.32031299C>G	ENSP00000373274:p.Ser243*		B4DFA4	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S243*	ENST00000360311.4	37	c.728	CCDS46784.1	3	.	.	.	.	.	.	.	.	.	.	C	28.5	4.924217	0.92319	.	.	ENSG00000197385	ENST00000360311	.	.	.	0.345	-0.691	0.11305	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.5418	0.12061	0.0:0.6806:0.0:0.3194	.	.	.	.	X	243	.	.	S	+	2	0	ZNF860	32006303	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.174000	0.16743	-0.519000	0.06444	-0.515000	0.04445	TCA	ZNF860	-	pfscan_Znf_C2H2	ENSG00000197385		0.348	ZNF860-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF860	HGNC	protein_coding	OTTHUMT00000341957.1	-	0.00	80	0	C			32031299	+1	tier1	-	no_errors	ENST00000360311	ensembl	human	known	74_37	nonsense	45.92	53	45	SNP	0.003	G
ZSWIM4	65249	genome.wustl.edu	37	19	13919937	13919937	+	Silent	SNP	C	C	G			TCGA-IG-A4P3-01A-11D-A27G-09	TCGA-IG-A4P3-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b2011b65-8359-46c8-aeb2-dc9072492e6e	6e8584ca-e2e1-4e55-b776-23a453fc32e0	g.chr19:13919937C>G	ENST00000254323.2	+	5	1104	c.915C>G	c.(913-915)ctC>ctG	p.L305L	ZSWIM4_ENST00000440752.2_Silent_p.L22L	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	305							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			TGCTGATTCTCATGACCGAGC	0.697																																																	0													49.0	53.0	51.0					19																	13919937		2203	4300	6503	SO:0001819	synonymous_variant	0			AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.915C>G	19.37:g.13919937C>G				Silent	SNP	pfscan_Znf_SWIM	p.L305	ENST00000254323.2	37	c.915	CCDS32924.1	19																																																																																			ZSWIM4	-	NULL	ENSG00000132003		0.697	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM4	HGNC	protein_coding	OTTHUMT00000457457.1	-	0.00	32	0	C	XM_031342		13919937	+1	tier1	-	no_errors	ENST00000254323	ensembl	human	known	74_37	silent	30.00	14	6	SNP	1.000	G
