#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCC9	10060	genome.wustl.edu	37	12	21981923	21981923	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:21981923G>A	ENST00000261201.4	-	29	3637	c.3638C>T	c.(3637-3639)tCa>tTa	p.S1213L	RP11-729I10.2_ENST00000539874.1_RNA|ABCC9_ENST00000261200.4_Missense_Mutation_p.S1213L|ABCC9_ENST00000345162.2_Missense_Mutation_p.S1177L	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1213	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	GTTGGCAGCTGAGAGAAATAA	0.438																																																	0													222.0	198.0	206.0					12																	21981923		2203	4300	6503	SO:0001583	missense	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.3638C>T	12.37:g.21981923G>A	ENSP00000261201:p.Ser1213Leu		O60707	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2	p.S1213L	ENST00000261201.4	37	c.3638	CCDS8694.1	12	.	.	.	.	.	.	.	.	.	.	G	17.10	3.303476	0.60195	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.87650	-2.28;-1.63;-2.28;-2.28	4.2	4.2	0.49525	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	T	0.75191	0.3816	N	0.11341	0.13	0.80722	D	1	B;B	0.23854	0.009;0.092	B;B	0.17433	0.017;0.018	T	0.70619	-0.4822	10	0.18276	T	0.48	-1.5765	17.0962	0.86635	0.0:0.0:1.0:0.0	.	1213;1213	O60706;O60706-2	ABCC9_HUMAN;.	L	1213;840;1213;1177	ENSP00000261200:S1213L;ENSP00000440521:S840L;ENSP00000261201:S1213L;ENSP00000261202:S1177L	ENSP00000261200:S1213L	S	-	2	0	ABCC9	21873190	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.131000	0.94446	2.331000	0.79229	0.467000	0.42956	TCA	ABCC9	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000069431		0.438	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	-	0.00	33	0	G	NM_005691		21981923	-1	tier1	-	no_errors	ENST00000261200	ensembl	human	known	74_37	missense	31.58	26	12	SNP	1.000	A
AAAS	8086	genome.wustl.edu	37	12	53703390	53703390	+	Missense_Mutation	SNP	T	T	C	rs567219779		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:53703390T>C	ENST00000209873.4	-	8	970	c.805A>G	c.(805-807)Atc>Gtc	p.I269V	AAAS_ENST00000549983.1_5'UTR|AAAS_ENST00000394384.3_Missense_Mutation_p.I236V|AAAS_ENST00000550286.1_Missense_Mutation_p.I145V	NM_015665.5	NP_056480.1	Q9NRG9	AAAS_HUMAN	achalasia, adrenocortical insufficiency, alacrimia	269					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nucleocytoplasmic transport (GO:0006913)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of nucleocytoplasmic transport (GO:0046822)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)		p.I269V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	20						CTCACCCGGATAGCAGCATCC	0.607																																																	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											33.0	40.0	38.0					12																	53703390		2203	4300	6503	SO:0001583	missense	0			AJ289841	CCDS8856.1, CCDS53797.1	12q13	2013-06-27	2010-06-24		ENSG00000094914	ENSG00000094914		"""WD repeat domain containing"""	13666	protein-coding gene	gene with protein product	"""aladin"", ""Allgrove, triple-A"""	605378	"""achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A)"""			11062474	Standard	NM_015665		Approved		uc001scr.4	Q9NRG9	OTTHUMG00000169729	ENST00000209873.4:c.805A>G	12.37:g.53703390T>C	ENSP00000209873:p.Ile269Val		Q5JB47|Q9NWI6|Q9UG19	Missense_Mutation	SNP	pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I269V	ENST00000209873.4	37	c.805	CCDS8856.1	12	.	.	.	.	.	.	.	.	.	.	T	13.85	2.358836	0.41801	.	.	ENSG00000094914	ENST00000209873;ENST00000394384;ENST00000550286;ENST00000547757	T;T;T;T	0.62105	0.05;0.05;0.05;0.05	5.55	1.92	0.25849	WD40/YVTN repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.128212	0.64402	N	0.000001	T	0.38692	0.1050	N	0.16307	0.4	0.33964	D	0.646034	B;B	0.09022	0.002;0.0	B;B	0.06405	0.002;0.001	T	0.34354	-0.9832	10	0.15066	T	0.55	-21.3213	8.1057	0.30885	0.0:0.2401:0.0:0.7599	.	236;269	Q5JB47;Q9NRG9	.;AAAS_HUMAN	V	269;236;145;236	ENSP00000209873:I269V;ENSP00000377908:I236V;ENSP00000446885:I145V;ENSP00000448020:I236V	ENSP00000209873:I269V	I	-	1	0	AAAS	51989657	1.000000	0.71417	0.918000	0.36340	0.939000	0.58152	2.384000	0.44362	0.489000	0.27749	0.374000	0.22700	ATC	AAAS	-	pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000094914		0.607	AAAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AAAS	HGNC	protein_coding	OTTHUMT00000405632.1		0.00	13	0	T			53703390	-1			no_errors	ENST00000209873	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.948	C
ABCF2	10061	genome.wustl.edu	37	7	150912737	150912737	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:150912737C>G	ENST00000287844.2	-	13	1592	c.1483G>C	c.(1483-1485)Gaa>Caa	p.E495Q	ABCF2_ENST00000473874.1_5'Flank|ABCF2_ENST00000222388.2_Missense_Mutation_p.E495Q	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	495	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TTCCTCATTTCTTCCTTCTCC	0.483																																																	0													281.0	241.0	254.0					7																	150912737		2203	4300	6503	SO:0001583	missense	0			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.1483G>C	7.37:g.150912737C>G	ENSP00000287844:p.Glu495Gln		O60864|Q75MJ0|Q75MJ1|Q96TE8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E495Q	ENST00000287844.2	37	c.1483	CCDS5923.1	7	.	.	.	.	.	.	.	.	.	.	C	14.79	2.640192	0.47153	.	.	ENSG00000033050	ENST00000222388;ENST00000287844	D;D	0.93763	-3.28;-3.28	5.63	5.63	0.86233	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.043666	0.85682	D	0.000000	D	0.91925	0.7443	L	0.52011	1.625	0.80722	D	1	B;B	0.21520	0.033;0.057	B;B	0.26310	0.068;0.068	D	0.88287	0.2940	10	0.44086	T	0.13	-18.8715	18.6737	0.91521	0.0:1.0:0.0:0.0	.	495;495	Q9UG63;Q75MJ1	ABCF2_HUMAN;.	Q	495	ENSP00000222388:E495Q;ENSP00000287844:E495Q	ENSP00000222388:E495Q	E	-	1	0	ABCF2	150543670	1.000000	0.71417	0.986000	0.45419	0.994000	0.84299	7.237000	0.78164	2.637000	0.89404	0.561000	0.74099	GAA	ABCF2	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000033050		0.483	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF2	HGNC	protein_coding	OTTHUMT00000336086.1	-	0.00	127	0	C	NM_005692		150912737	-1	tier1	-	no_errors	ENST00000222388	ensembl	human	known	74_37	missense	15.13	129	23	SNP	1.000	G
ACACB	32	genome.wustl.edu	37	12	109647044	109647044	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:109647044C>T	ENST00000338432.7	+	21	3254	c.3135C>T	c.(3133-3135)atC>atT	p.I1045I	ACACB_ENST00000377854.5_Silent_p.I1045I|ACACB_ENST00000377848.3_Silent_p.I1045I			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1045					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	TGCAGGAGATCATGACCAGCG	0.637																																																	0													37.0	31.0	33.0					12																	109647044		2203	4300	6503	SO:0001819	synonymous_variant	0			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.3135C>T	12.37:g.109647044C>T			A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Silent	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.I1045	ENST00000338432.7	37	c.3135	CCDS31898.1	12																																																																																			ACACB	-	pfam_AcCoA_COase_cen	ENSG00000076555		0.637	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	HGNC	protein_coding	OTTHUMT00000403077.1	-	0.00	82	0	C	NM_001093		109647044	+1	tier1	-	no_errors	ENST00000338432	ensembl	human	known	74_37	silent	14.81	69	12	SNP	1.000	T
ACD	65057	genome.wustl.edu	37	16	67693165	67693165	+	Splice_Site	SNP	C	C	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:67693165C>A	ENST00000393919.4	-	6	982	c.718G>T	c.(718-720)Gag>Tag	p.E240*	PARD6A_ENST00000602551.1_5'Flank|PARD6A_ENST00000219255.3_5'Flank|PARD6A_ENST00000458121.2_5'Flank|ACD_ENST00000219251.8_Splice_Site_p.E237*			Q96AP0	ACD_HUMAN	adrenocortical dysplasia homolog (mouse)	240					intracellular protein transport (GO:0006886)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of single-stranded telomeric DNA binding (GO:0060381)|positive regulation of telomerase activity (GO:0051973)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|telomere assembly (GO:0032202)|telomere capping (GO:0016233)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	17		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		GAAAGGTGCTCCCTACAGGAA	0.547																																																	0													179.0	173.0	175.0					16																	67693165		2198	4300	6498	SO:0001630	splice_region_variant	0			AF070535	CCDS10842.1, CCDS42181.1	16q22	2012-08-23			ENSG00000102977	ENSG00000102977			25070	protein-coding gene	gene with protein product	"""TIN2 interacting protein 1"", ""POT1 and TIN2 organizing protein"""	609377				15231715, 15181449	Standard	NM_001082486		Approved	Ptop, Pip1, Tpp1, Tint1	uc002etq.4	Q96AP0	OTTHUMG00000137547	ENST00000393919.4:c.717-1G>T	16.37:g.67693165C>A			Q562H5|Q9H8F9	Nonsense_Mutation	SNP	NULL	p.E240*	ENST00000393919.4	37	c.718	CCDS42181.1	16	.	.	.	.	.	.	.	.	.	.	C	36	5.946809	0.97134	.	.	ENSG00000102977	ENST00000219251;ENST00000393919	.	.	.	4.99	2.61	0.31194	.	0.566483	0.17977	N	0.155661	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-13.9607	5.3761	0.16166	0.0:0.7115:0.0:0.2885	.	.	.	.	X	237;240	.	ENSP00000219251:E237X	E	-	1	0	ACD	66250666	0.997000	0.39634	1.000000	0.80357	0.622000	0.37654	0.549000	0.23329	1.229000	0.43630	0.462000	0.41574	GAG	ACD	-	NULL	ENSG00000102977		0.547	ACD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACD	HGNC	protein_coding	OTTHUMT00000268880.1	-	0.00	34	0	C	NM_022914	Nonsense_Mutation	67693165	-1	tier1	-	no_errors	ENST00000393919	ensembl	human	known	74_37	nonsense	15.25	50	9	SNP	1.000	A
ACSF3	197322	genome.wustl.edu	37	16	89167110	89167110	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:89167110C>T	ENST00000317447.4	+	3	398	c.21C>T	c.(19-21)ctC>ctT	p.L7L	ACSF3_ENST00000378345.4_Intron|ACSF3_ENST00000406948.3_Silent_p.L7L	NM_001127214.2|NM_001243279.1|NM_001284316.1|NM_174917.3	NP_001120686.1|NP_001230208.1|NP_001271245.1|NP_777577.2	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3	7					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|malonate catabolic process (GO:0090410)	mitochondrion (GO:0005739)	acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)|malonyl-CoA synthetase activity (GO:0090409)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(9)|prostate(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(80;0.0281)		ATGTGGTGCTCACCTTCCGGC	0.662																																																	0													14.0	15.0	15.0					16																	89167110		2170	4246	6416	SO:0001819	synonymous_variant	0			AK075499	CCDS10974.1, CCDS73926.1	16q24.3	2013-01-15			ENSG00000176715	ENSG00000176715		"""Acyl-CoA synthetase family"""	27288	protein-coding gene	gene with protein product	"""malonyl-CoA synthetase"""	614245				17762044, 21846720	Standard	XM_005256293		Approved		uc010cig.2	Q4G176	OTTHUMG00000138044	ENST00000317447.4:c.21C>T	16.37:g.89167110C>T			A8K4J8|C9JQL6|Q6INA0|Q8N2F7	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.L7	ENST00000317447.4	37	c.21	CCDS10974.1	16																																																																																			ACSF3	-	NULL	ENSG00000176715		0.662	ACSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSF3	HGNC	protein_coding	OTTHUMT00000269919.1		0.00	17	0	C	NM_174917		89167110	+1			no_errors	ENST00000317447	ensembl	human	known	74_37	silent	11.43	31	4	SNP	0.000	T
ACTN4	81	genome.wustl.edu	37	19	39208683	39208683	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:39208683G>A	ENST00000252699.2	+	11	1336	c.1260G>A	c.(1258-1260)caG>caA	p.Q420Q	ACTN4_ENST00000390009.3_Silent_p.Q201Q|ACTN4_ENST00000424234.2_Intron	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	420					actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AGTTCCGGCAGAAGGCCTCCA	0.662																																					Colon(168;199 1940 10254 46213 46384)												0													52.0	37.0	42.0					19																	39208683		2203	4298	6501	SO:0001819	synonymous_variant	0			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.1260G>A	19.37:g.39208683G>A			A4K467|D6PXK4|O76048	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.Q420	ENST00000252699.2	37	c.1260	CCDS12518.1	19																																																																																			ACTN4	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000130402		0.662	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN4	HGNC	protein_coding	OTTHUMT00000268091.1	-	0.00	63	0	G			39208683	+1	tier1	-	no_errors	ENST00000252699	ensembl	human	known	74_37	silent	27.50	58	22	SNP	1.000	A
ADAM21P1	145241	genome.wustl.edu	37	14	70714259	70714259	+	RNA	SNP	A	A	G	rs7144638	byFrequency	TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:70714259A>G	ENST00000530196.1	-	0	259					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		CACCACTTCCAGGGAAGTGAA	0.527													G|||	786	0.156949	0.1505	0.085	5008	,	,		20010	0.2907		0.1262	False		,,,				2504	0.1104																0																																												0					14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70714259A>G				RNA	SNP	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			ADAM21P1	-	-	ENSG00000235812		0.527	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	HGNC	pseudogene	OTTHUMT00000390451.1		0.00	41	0	A	NG_002467		70714259	-1			no_errors	ENST00000530196	ensembl	human	known	74_37	rna	9.52	38	4	SNP	0.006	G
ADAMTS18	170692	genome.wustl.edu	37	16	77317946	77317946	+	Missense_Mutation	SNP	G	G	C	rs147053635	byFrequency	TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:77317946G>C	ENST00000282849.5	-	23	3991	c.3573C>G	c.(3571-3573)ttC>ttG	p.F1191L	RP11-538I12.3_ENST00000561672.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	1191	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						ACCAGTTGAAGAAATCTACGC	0.388																																																	0													158.0	140.0	146.0					16																	77317946		2198	4300	6498	SO:0001583	missense	0			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.3573C>G	16.37:g.77317946G>C	ENSP00000282849:p.Phe1191Leu		Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.F1191L	ENST00000282849.5	37	c.3573	CCDS10926.1	16	.	.	.	.	.	.	.	.	.	.	G	9.673	1.147153	0.21288	.	.	ENSG00000140873	ENST00000282849	T	0.40225	1.04	5.93	4.98	0.66077	PLAC (2);	0.312619	0.35151	N	0.003405	T	0.29158	0.0725	N	0.25647	0.755	0.48185	D	0.999605	B	0.06786	0.001	B	0.06405	0.002	T	0.07908	-1.0748	10	0.11485	T	0.65	.	14.2478	0.65999	0.0711:0.0:0.9289:0.0	.	1191	Q8TE60	ATS18_HUMAN	L	1191	ENSP00000282849:F1191L	ENSP00000282849:F1191L	F	-	3	2	ADAMTS18	75875447	1.000000	0.71417	1.000000	0.80357	0.605000	0.37080	1.945000	0.40273	1.525000	0.49052	0.655000	0.94253	TTC	ADAMTS18	-	pfam_PLAC,pfscan_PLAC	ENSG00000140873		0.388	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS18	HGNC	protein_coding	OTTHUMT00000269037.1	-	0.00	35	0	G			77317946	-1	tier1	-	no_errors	ENST00000282849	ensembl	human	known	74_37	missense	13.89	31	5	SNP	1.000	C
ADHFE1	137872	genome.wustl.edu	37	8	67355081	67355081	+	Splice_Site	SNP	T	T	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:67355081T>C	ENST00000396623.3	+	3	175		c.e3+2		ADHFE1_ENST00000415254.1_Splice_Site|ADHFE1_ENST00000379385.4_Splice_Site|ADHFE1_ENST00000496501.1_Intron	NM_144650.2	NP_653251.2	Q8IWW8	HOT_HUMAN	alcohol dehydrogenase, iron containing, 1						2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|molecular hydrogen transport (GO:0015993)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxyacid-oxoacid transhydrogenase activity (GO:0047988)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	29		Lung NSC(129;0.197)	Epithelial(68;0.0321)|all cancers(69;0.0751)|BRCA - Breast invasive adenocarcinoma(89;0.0855)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			GCCTTTGAGGTATATTCACTC	0.269																																																	0													86.0	78.0	81.0					8																	67355081		1787	4064	5851	SO:0001630	splice_region_variant	0			AK056992	CCDS6190.2	8q12.3	2013-05-21			ENSG00000147576	ENSG00000147576	1.1.99.24	"""Alcohol dehydrogenases"""	16354	protein-coding gene	gene with protein product	"""hydroxyacid-oxoacid transhydrogenase"""	611083				12592711	Standard	NM_144650		Approved	ADHFe1, FLJ32430	uc003xwb.4	Q8IWW8	OTTHUMG00000150215	ENST00000396623.3:c.144+2T>C	8.37:g.67355081T>C			B4DTJ8|Q49A19|Q68CI7|Q6P2B6|Q96MF9	Splice_Site	SNP	-	e3+2	ENST00000396623.3	37	c.144+2	CCDS6190.2	8	.	.	.	.	.	.	.	.	.	.	T	18.81	3.703389	0.68501	.	.	ENSG00000147576	ENST00000379385;ENST00000396623	.	.	.	6.02	6.02	0.97574	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3687	0.74545	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADHFE1	67517635	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	5.191000	0.65110	2.311000	0.77944	0.533000	0.62120	.	ADHFE1	-	-	ENSG00000147576		0.269	ADHFE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADHFE1	HGNC	protein_coding	OTTHUMT00000316867.3		0.00	22	0	T	NM_144650	Intron	67355081	+1			no_errors	ENST00000396623	ensembl	human	known	74_37	splice_site	7.41	25	2	SNP	1.000	C
AEBP1	165	genome.wustl.edu	37	7	44147454	44147454	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:44147454delA	ENST00000223357.3	+	5	1091	c.786delA	c.(784-786)agafs	p.R265fs	MIR4649_ENST00000582839.1_RNA|AEBP1_ENST00000450684.2_5'Flank	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	265	Pro-rich.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						CCCCAAGCAGAAGGAGGAGGC	0.687																																																	0													13.0	17.0	16.0					7																	44147454		2194	4283	6477	SO:0001589	frameshift_variant	0			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.786delA	7.37:g.44147454delA	ENSP00000223357:p.Arg265fs		Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Frame_Shift_Del	DEL	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.R263fs	ENST00000223357.3	37	c.786	CCDS5476.1	7																																																																																			AEBP1	-	NULL	ENSG00000106624		0.687	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AEBP1	HGNC	protein_coding	OTTHUMT00000250993.2		0.00	38	0	A	NM_001129		44147454	+1	tier1		no_errors	ENST00000223357	ensembl	human	known	74_37	frame_shift_del	35.29	44	24	DEL	1.000	-
AKAP6	9472	genome.wustl.edu	37	14	33292102	33292102	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:33292102G>T	ENST00000280979.4	+	13	5253	c.5083G>T	c.(5083-5085)Gac>Tac	p.D1695Y	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1695	Ser-rich.				action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)	p.D1695N(1)		NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TAGCAGCAGTGACGAGCTCTC	0.463																																					Melanoma(49;821 1200 7288 13647 42351)												1	Substitution - Missense(1)	lung(1)											98.0	92.0	94.0					14																	33292102		2203	4300	6503	SO:0001583	missense	0			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.5083G>T	14.37:g.33292102G>T	ENSP00000280979:p.Asp1695Tyr		A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.D1695Y	ENST00000280979.4	37	c.5083	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	G	17.91	3.504487	0.64410	.	.	ENSG00000151320	ENST00000280979	T	0.08370	3.1	5.98	5.98	0.97165	.	0.104295	0.64402	D	0.000004	T	0.29716	0.0742	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.67231	0.95	T	0.00125	-1.2022	10	0.87932	D	0	-21.1608	20.4561	0.99145	0.0:0.0:1.0:0.0	.	1695	Q13023	AKAP6_HUMAN	Y	1695	ENSP00000280979:D1695Y	ENSP00000280979:D1695Y	D	+	1	0	AKAP6	32361853	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.922000	0.92789	2.843000	0.97960	0.650000	0.86243	GAC	AKAP6	-	NULL	ENSG00000151320		0.463	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2		0.00	32	0	G	NM_004274		33292102	+1			no_errors	ENST00000280979	ensembl	human	known	74_37	missense	6.67	42	3	SNP	1.000	T
ALDH18A1	5832	genome.wustl.edu	37	10	97373617	97373617	+	Missense_Mutation	SNP	C	C	A	rs543845150		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr10:97373617C>A	ENST00000371224.2	-	15	1942	c.1805G>T	c.(1804-1806)aGa>aTa	p.R602I	ALDH18A1_ENST00000371221.3_Missense_Mutation_p.R600I	NM_002860.3	NP_002851.2	P54886	P5CS_HUMAN	aldehyde dehydrogenase 18 family, member A1	602	Gamma-glutamyl phosphate reductase.				cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|glutamate metabolic process (GO:0006536)|L-proline biosynthetic process (GO:0055129)|ornithine biosynthetic process (GO:0006592)|proline biosynthetic process (GO:0006561)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate 5-kinase activity (GO:0004349)|glutamate-5-semialdehyde dehydrogenase activity (GO:0004350)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(9)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)		TTTAGAGTCTCTGACTGAAAG	0.423																																																	0													146.0	150.0	148.0					10																	97373617		2203	4300	6503	SO:0001583	missense	0			X94453	CCDS7443.1, CCDS31257.1	10q24.3-q24.6	2004-08-12	2004-08-12	2004-08-12	ENSG00000059573	ENSG00000059573		"""Aldehyde dehydrogenases"""	9722	protein-coding gene	gene with protein product		138250	"""pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase)"""	GSAS, PYCS		8921385	Standard	XM_006717933		Approved	P5CS	uc001kkz.3	P54886	OTTHUMG00000018815	ENST00000371224.2:c.1805G>T	10.37:g.97373617C>A	ENSP00000360268:p.Arg602Ile		B2R5Q4|B7Z350|B7Z5X8|B7ZLP1|D3DR44|O95952|Q3KQU2|Q5T566|Q5T567|Q9UM72	Missense_Mutation	SNP	pfam_Asp/Glu/Uridylate_kinase,pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,superfamily_Asp/Glu/Uridylate_kinase,pirsf_P5_carboxy_syn,prints_Glu/AcGlu_kinase,tigrfam_P5_carboxy_syn,tigrfam_G-glutamylP_reductase	p.R602I	ENST00000371224.2	37	c.1805	CCDS7443.1	10	.	.	.	.	.	.	.	.	.	.	C	10.18	1.279149	0.23307	.	.	ENSG00000059573	ENST00000371224;ENST00000371221	T;T	0.74421	-0.84;-0.84	5.56	5.56	0.83823	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);Gamma-glutamyl phosphate reductase GPR (1);	0.000000	0.85682	D	0.000000	T	0.53690	0.1812	N	0.05592	-0.015	0.80722	D	1	B;B	0.12630	0.006;0.005	B;B	0.21151	0.033;0.02	T	0.53711	-0.8400	10	0.02654	T	1	-16.7503	17.0314	0.86462	0.0:1.0:0.0:0.0	.	602;600	P54886;P54886-2	P5CS_HUMAN;.	I	602;600	ENSP00000360268:R602I;ENSP00000360265:R600I	ENSP00000360265:R600I	R	-	2	0	ALDH18A1	97363607	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	4.503000	0.60407	2.620000	0.88729	0.655000	0.94253	AGA	ALDH18A1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,pirsf_P5_carboxy_syn,tigrfam_P5_carboxy_syn,tigrfam_G-glutamylP_reductase	ENSG00000059573		0.423	ALDH18A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALDH18A1	HGNC	protein_coding	OTTHUMT00000049552.1	-	0.00	53	0	C	NM_002860		97373617	-1	tier1	-	no_errors	ENST00000371224	ensembl	human	known	74_37	missense	16.22	62	12	SNP	1.000	A
ALDH7A1	501	genome.wustl.edu	37	5	125915756	125915756	+	Intron	SNP	T	T	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:125915756T>C	ENST00000409134.3	-	5	737				ALDH7A1_ENST00000413020.1_Intron|ALDH7A1_ENST00000447989.2_Intron|ALDH7A1_ENST00000553117.1_Intron	NM_001182.4|NM_001201377.1	NP_001173.2|NP_001188306.1	P49419	AL7A1_HUMAN	aldehyde dehydrogenase 7 family, member A1						cellular aldehyde metabolic process (GO:0006081)|cellular nitrogen compound metabolic process (GO:0034641)|glycine betaine biosynthetic process from choline (GO:0019285)|lysine catabolic process (GO:0006554)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|betaine-aldehyde dehydrogenase activity (GO:0008802)|L-aminoadipate-semialdehyde dehydrogenase activity (GO:0004043)			endometrium(1)|kidney(4)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.24)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0417)|OV - Ovarian serous cystadenocarcinoma(64;0.068)|all cancers(49;0.109)		CACATGTACATATCCCCAAAT	0.368																																																	0																																										SO:0001627	intron_variant	0			S74728	CCDS4137.2, CCDS56380.1	5q31	2013-06-03			ENSG00000164904	ENSG00000164904	1.2.1.31	"""Aldehyde dehydrogenases"""	877	protein-coding gene	gene with protein product	"""antiquitin 1"", ""26g turgor protein homolog"", ""alpha-aminoadipic semialdehyde dehydrogenase"", ""alpha-AASA dehydrogenase"", ""delta1-piperideine-6-carboxylate dehydrogenease"", ""P6c dehydrogenase"""	107323		ATQ1		9417906	Standard	NM_001182		Approved	EPD, PDE	uc003ktx.3	P49419	OTTHUMG00000128942	ENST00000409134.3:c.517+2786A>G	5.37:g.125915756T>C			B2R669|B4DIC7|B4DMA0|E7EPT3|O14619|Q6IPU8|Q9BUL4	RNA	SNP	-	NULL	ENST00000409134.3	37	NULL	CCDS4137.2	5																																																																																			ALDH7A1	-	-	ENSG00000164904		0.368	ALDH7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH7A1	HGNC	protein_coding	OTTHUMT00000250921.2	-	0.00	51	0	T	NM_001182		125915756	-1	tier1	-	no_errors	ENST00000433026	ensembl	human	known	74_37	rna	20.29	55	14	SNP	0.000	C
ALKBH7	84266	genome.wustl.edu	37	19	6374962	6374962	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:6374962G>C	ENST00000245812.3	+	4	1032	c.644G>C	c.(643-645)gGa>gCa	p.G215A	ALKBH7_ENST00000599849.1_Missense_Mutation_p.G154A|ALKBH7_ENST00000596657.1_Missense_Mutation_p.G73A	NM_032306.3	NP_115682.1	Q9BT30	ALKB7_HUMAN	alkB, alkylation repair homolog 7 (E. coli)	215					cellular response to DNA damage stimulus (GO:0006974)|fatty acid metabolic process (GO:0006631)|regulation of lipid storage (GO:0010883)|regulation of mitochondrial membrane permeability involved in programmed necrotic cell death (GO:1902445)	mitochondrial matrix (GO:0005759)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						GGGGAGTCTGGACAGCCGCCC	0.612																																																	0													28.0	32.0	30.0					19																	6374962		2203	4299	6502	SO:0001583	missense	0			AY427650	CCDS12163.1	19p13.3	2008-02-05	2006-02-09	2006-02-09		ENSG00000125652		"""Alkylation repair homologs"""	21306	protein-coding gene	gene with protein product		613305	"""spermatogenesis associated 11"""	SPATA11		12477932	Standard	NM_032306		Approved	MGC10974	uc002meo.2	Q9BT30		ENST00000245812.3:c.644G>C	19.37:g.6374962G>C	ENSP00000245812:p.Gly215Ala		B2R4U9|Q53FF3	Missense_Mutation	SNP	NULL	p.G215A	ENST00000245812.3	37	c.644	CCDS12163.1	19	.	.	.	.	.	.	.	.	.	.	G	6.358	0.434243	0.12045	.	.	ENSG00000125652	ENST00000245812	T	0.40756	1.02	3.12	-0.328	0.12690	.	0.451423	0.18961	N	0.126412	T	0.17323	0.0416	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.19647	-1.0299	10	0.09843	T	0.71	.	3.9634	0.09421	0.2511:0.3933:0.3556:0.0	.	215	Q9BT30	ALKB7_HUMAN	A	215	ENSP00000245812:G215A	ENSP00000245812:G215A	G	+	2	0	ALKBH7	6325962	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-0.238000	0.08977	0.025000	0.15241	-0.519000	0.04390	GGA	ALKBH7	-	NULL	ENSG00000125652		0.612	ALKBH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALKBH7	HGNC	protein_coding	OTTHUMT00000453036.1	-	0.00	76	0	G	NM_032306		6374962	+1	tier1	-	no_errors	ENST00000245812	ensembl	human	known	74_37	missense	16.67	44	9	SNP	0.000	C
AMBRA1	55626	genome.wustl.edu	37	11	46563842	46563842	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:46563842C>T	ENST00000458649.2	-	7	2143	c.1725G>A	c.(1723-1725)ctG>ctA	p.L575L	AMBRA1_ENST00000314845.3_Silent_p.L485L|AMBRA1_ENST00000528950.1_Silent_p.L575L|AMBRA1_ENST00000298834.3_Silent_p.L575L|AMBRA1_ENST00000533727.1_Silent_p.L485L|AMBRA1_ENST00000534300.1_Silent_p.L575L|AMBRA1_ENST00000426438.1_Silent_p.L575L			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	575					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		TGTTGAAGGTCAGGAGATTGT	0.587																																																	0													123.0	100.0	108.0					11																	46563842		2201	4299	6500	SO:0001819	synonymous_variant	0			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.1725G>A	11.37:g.46563842C>T			A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L575	ENST00000458649.2	37	c.1725		11																																																																																			AMBRA1	-	NULL	ENSG00000110497		0.587	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	HGNC	protein_coding	OTTHUMT00000390103.1	-	0.00	54	0	C	NM_017749		46563842	-1	tier1	-	no_errors	ENST00000458649	ensembl	human	known	74_37	silent	32.43	50	24	SNP	1.000	T
ANGPTL6	83854	genome.wustl.edu	37	19	10204497	10204497	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:10204497C>T	ENST00000253109.4	-	4	1061	c.823G>A	c.(823-825)Gaa>Aaa	p.E275K	ANGPTL6_ENST00000589181.1_Missense_Mutation_p.E275K|ANGPTL6_ENST00000592641.1_Missense_Mutation_p.E275K	NM_031917.2	NP_114123.2	Q8NI99	ANGL6_HUMAN	angiopoietin-like 6	275	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)				endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)	12			OV - Ovarian serous cystadenocarcinoma(20;3.58e-08)|Epithelial(33;2.5e-05)|all cancers(31;5.96e-05)			ACTCGCAGTTCATACACTCCA	0.612																																																	0													172.0	155.0	160.0					19																	10204497		2203	4300	6503	SO:0001583	missense	0			AB054064	CCDS12224.1	19p13.2	2013-02-06				ENSG00000130812		"""Fibrinogen C domain containing"""	23140	protein-coding gene	gene with protein product	"""angiopoietin-related protein 5"""	609336				12871997	Standard	NM_031917		Approved	ARP5, AGF	uc002mmy.1	Q8NI99		ENST00000253109.4:c.823G>A	19.37:g.10204497C>T	ENSP00000253109:p.Glu275Lys		A5PKV7|Q9BZZ0	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.E275K	ENST00000253109.4	37	c.823	CCDS12224.1	19	.	.	.	.	.	.	.	.	.	.	C	13.93	2.383483	0.42207	.	.	ENSG00000130812	ENST00000253109	T	0.80653	-1.4	4.57	2.25	0.28309	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.384136	0.24409	N	0.038763	T	0.48259	0.1490	N	0.01809	-0.71	0.25943	N	0.98284	P	0.34864	0.473	B	0.34931	0.192	T	0.45160	-0.9280	10	0.13470	T	0.59	.	3.2429	0.06787	0.1582:0.4014:0.3428:0.0976	.	275	Q8NI99	ANGL6_HUMAN	K	275	ENSP00000253109:E275K	ENSP00000253109:E275K	E	-	1	0	ANGPTL6	10065497	0.963000	0.33076	0.631000	0.29282	0.566000	0.35808	2.048000	0.41278	1.124000	0.41980	0.485000	0.47835	GAA	ANGPTL6	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000130812		0.612	ANGPTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL6	HGNC	protein_coding	OTTHUMT00000451142.1	-	0.00	57	0	C	NM_031917		10204497	-1	tier1	-	no_errors	ENST00000253109	ensembl	human	known	74_37	missense	27.14	51	19	SNP	0.998	T
APOB	338	genome.wustl.edu	37	2	21229677	21229677	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:21229677C>T	ENST00000233242.1	-	26	10190	c.10063G>A	c.(10063-10065)Gaa>Aaa	p.E3355K		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3355					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTAAAAAGTTCAGCATTGGTA	0.378																																																	0													107.0	104.0	105.0					2																	21229677		2203	4300	6503	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.10063G>A	2.37:g.21229677C>T	ENSP00000233242:p.Glu3355Lys		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.E3355K	ENST00000233242.1	37	c.10063	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	19.22	3.784769	0.70222	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.36340	1.26	5.63	5.63	0.86233	.	0.094831	0.46442	D	0.000284	T	0.30759	0.0775	N	0.19112	0.55	0.80722	D	1	B	0.29212	0.237	B	0.30716	0.119	T	0.13124	-1.0521	10	0.72032	D	0.01	.	19.6839	0.95973	0.0:1.0:0.0:0.0	.	3355	P04114	APOB_HUMAN	K	3355	ENSP00000233242:E3355K	ENSP00000233242:E3355K	E	-	1	0	APOB	21083182	0.998000	0.40836	1.000000	0.80357	0.859000	0.49053	3.237000	0.51344	2.632000	0.89209	0.655000	0.94253	GAA	APOB	-	NULL	ENSG00000084674		0.378	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1		0.00	34	0	C			21229677	-1			no_errors	ENST00000233242	ensembl	human	known	74_37	missense	6.52	43	3	SNP	1.000	T
LVRN	206338	genome.wustl.edu	37	5	115298659	115298659	+	Silent	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:115298659G>C	ENST00000357872.4	+	1	469	c.345G>C	c.(343-345)ctG>ctC	p.L115L	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		115						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										GGCCGCAGCTGAGGCCCGACG	0.701																																																	0													40.0	46.0	44.0					5																	115298659		2202	4298	6500	SO:0001819	synonymous_variant	0																														ENST00000357872.4:c.345G>C	5.37:g.115298659G>C			A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Silent	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.L115	ENST00000357872.4	37	c.345	CCDS4124.1	5																																																																																			AQPEP	-	pfam_Peptidase_M1_N	ENSG00000172901		0.701	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQPEP	Uniprot_gn	protein_coding	OTTHUMT00000250852.1		0.00	16	0	G			115298659	+1			no_errors	ENST00000357872	ensembl	human	known	74_37	silent	12.50	21	3	SNP	0.858	C
ARID3B	10620	genome.wustl.edu	37	15	74889137	74889137	+	3'UTR	DEL	T	T	-	rs59860926|rs56663733	byFrequency	TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr15:74889137delT	ENST00000563567.1	+	0	201				ARID3B_ENST00000346246.5_3'UTR			Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)							nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						CTGACTTTTGtttttttttta	0.358													|||unknown(HR)	2188	0.436901	0.5855	0.4654	5008	,	,		15855	0.5744		0.1511	False		,,,				2504	0.3681																0																																										SO:0001624	3_prime_UTR_variant	0				CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000563567.1:c.*198T>-	15.37:g.74889137delT			O95443|Q59HC9|Q6P9C9	RNA	DEL	-	NULL	ENST00000563567.1	37	NULL		15																																																																																			ARID3B	-	-	ENSG00000179361		0.358	ARID3B-006	PUTATIVE	basic|exp_conf	processed_transcript	ARID3B	HGNC	protein_coding	OTTHUMT00000420641.1		0.00	21	0	T	NM_006465		74889137	+1	tier1		no_errors	ENST00000563567	ensembl	human	putative	74_37	rna	7.69	24	2	DEL	0.068	-
ARMC5	79798	genome.wustl.edu	37	16	31470831	31470831	+	5'UTR	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:31470831G>A	ENST00000563544.1	+	0	532				ARMC5_ENST00000408912.3_Missense_Mutation_p.E91K|ARMC5_ENST00000412665.2_5'Flank|ARMC5_ENST00000268314.4_5'UTR|ARMC5_ENST00000538189.1_Missense_Mutation_p.E28K|ARMC5_ENST00000457010.2_5'UTR|RP11-452L6.5_ENST00000564629.1_RNA			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5											central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						GGCGGAGTCTGAGGCCCGAGC	0.697																																																	0													8.0	13.0	11.0					16																	31470831		2061	4220	6281	SO:0001623	5_prime_UTR_variant	0			AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.-15G>A	16.37:g.31470831G>A			Q86WM9|Q9H7P8|Q9H925	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_BTB/POZ_fold,smart_Armadillo,pfscan_Armadillo,pfscan_BTB/POZ-like	p.E91K	ENST00000563544.1	37	c.271	CCDS45472.1	16	.	.	.	.	.	.	.	.	.	.	g	18.15	3.558823	0.65538	.	.	ENSG00000140691	ENST00000408912;ENST00000538189	T;T	0.20463	2.07;2.18	4.93	-6.28	0.02020	.	.	.	.	.	T	0.13841	0.0335	.	.	.	0.29827	N	0.830357	B;B	0.25272	0.073;0.122	B;B	0.19148	0.024;0.024	T	0.15838	-1.0423	8	0.56958	D	0.05	.	11.6305	0.51171	0.0:0.1094:0.7625:0.1282	.	28;91	F5H156;B4DIU9	.;.	K	91;28	ENSP00000386125:E91K;ENSP00000443995:E28K	ENSP00000386125:E91K	E	+	1	0	ARMC5	31378332	0.000000	0.05858	0.208000	0.23602	0.928000	0.56348	-1.488000	0.02308	-1.320000	0.02283	-0.408000	0.06270	GAG	ARMC5	-	NULL	ENSG00000140691		0.697	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC5	HGNC	protein_coding	OTTHUMT00000432847.1	-	0.00	59	0	G	NM_024742		31470831	+1	tier1	-	no_errors	ENST00000408912	ensembl	human	known	74_37	missense	16.46	66	13	SNP	0.073	A
ASPM	259266	genome.wustl.edu	37	1	197059154	197059154	+	Missense_Mutation	SNP	G	G	A	rs201033114		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:197059154G>A	ENST00000367409.4	-	25	10146	c.9890C>T	c.(9889-9891)tCt>tTt	p.S3297F	ASPM_ENST00000294732.7_Missense_Mutation_p.S1712F|ASPM_ENST00000367408.1_Missense_Mutation_p.S962F	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	3297					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						AAATATTTTAGAAATTGCTCC	0.363																																																	0													60.0	63.0	62.0					1																	197059154		2203	4300	6503	SO:0001583	missense	0			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.9890C>T	1.37:g.197059154G>A	ENSP00000356379:p.Ser3297Phe		Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.S3297F	ENST00000367409.4	37	c.9890	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.626252	0.46840	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408;ENST00000367406	T;T;T	0.51817	0.69;0.69;0.69	5.75	3.87	0.44632	.	0.767331	0.12622	N	0.452896	T	0.36991	0.0987	L	0.47716	1.5	0.09310	N	1	B;B;B	0.21381	0.055;0.007;0.046	B;B;B	0.16722	0.012;0.007;0.016	T	0.33523	-0.9865	10	0.45353	T	0.12	.	3.534	0.07788	0.1523:0.1346:0.5742:0.1389	.	1283;1712;3297	E7EQ84;Q4G1H1;Q8IZT6	.;.;ASPM_HUMAN	F	3297;1712;962;1283	ENSP00000356379:S3297F;ENSP00000294732:S1712F;ENSP00000356378:S962F	ENSP00000294732:S1712F	S	-	2	0	ASPM	195325777	0.982000	0.34865	0.582000	0.28627	0.993000	0.82548	1.838000	0.39211	0.762000	0.33152	0.655000	0.94253	TCT	ASPM	-	superfamily_ARM-type_fold	ENSG00000066279		0.363	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1	-	0.00	13	0	G	NM_018136		197059154	-1	tier1	-	no_errors	ENST00000367409	ensembl	human	known	74_37	missense	19.23	21	5	SNP	0.010	A
ATAD2	29028	genome.wustl.edu	37	8	124357292	124357292	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:124357292C>G	ENST00000287394.5	-	19	2657	c.2550G>C	c.(2548-2550)aaG>aaC	p.K850N	RNU6-875P_ENST00000516488.1_RNA|ATAD2_ENST00000521903.1_Missense_Mutation_p.K168N|MIR548AA1_ENST00000384971.2_RNA	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	850					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GTGCTGTTCTCTTAGCTTCAC	0.373																																																	0													193.0	166.0	175.0					8																	124357292		2203	4300	6503	SO:0001583	missense	0			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.2550G>C	8.37:g.124357292C>G	ENSP00000287394:p.Lys850Asn		Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.K850N	ENST00000287394.5	37	c.2550	CCDS6343.1	8	.	.	.	.	.	.	.	.	.	.	C	16.63	3.177603	0.57692	.	.	ENSG00000156802	ENST00000287394;ENST00000521903	D;D	0.83163	-1.69;-1.69	5.58	2.76	0.32466	.	0.100882	0.64402	D	0.000003	D	0.88596	0.6479	M	0.85373	2.75	0.37723	D	0.924999	D	0.58268	0.982	P	0.56088	0.791	D	0.90484	0.4462	10	0.87932	D	0	-19.4604	11.2259	0.48884	0.0:0.7407:0.0:0.2593	.	850	Q6PL18	ATAD2_HUMAN	N	850;168	ENSP00000287394:K850N;ENSP00000429213:K168N	ENSP00000287394:K850N	K	-	3	2	ATAD2	124426473	0.943000	0.32029	1.000000	0.80357	0.453000	0.32348	0.145000	0.16157	0.705000	0.31890	0.655000	0.94253	AAG	ATAD2	-	superfamily_P-loop_NTPase	ENSG00000156802		0.373	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2		0.00	25	0	C	NM_014109		124357292	-1			no_errors	ENST00000287394	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	G
ATAD3B	83858	genome.wustl.edu	37	1	1431023	1431023	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:1431023G>C	ENST00000308647.7	+	16	1889	c.1773G>C	c.(1771-1773)gaG>gaC	p.E591D		NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	591						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TCCAAGGCGAGACCCTCACCT	0.657																																																	0													41.0	43.0	42.0					1																	1431023		2203	4299	6502	SO:0001583	missense	0			AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.1773G>C	1.37:g.1431023G>C	ENSP00000311766:p.Glu591Asp		A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Missense_Mutation	SNP	pfam_DUF3523,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.E591D	ENST00000308647.7	37	c.1773	CCDS30.1	1	.	.	.	.	.	.	.	.	.	.	g	2.411	-0.335308	0.05278	.	.	ENSG00000160072	ENST00000378737;ENST00000308647	D	0.93604	-3.25	1.01	1.01	0.19927	.	3.332670	0.01621	U	0.023033	D	0.83852	0.5344	N	0.08118	0	0.21697	N	0.999582	B;B	0.25904	0.137;0.0	B;B	0.18263	0.021;0.0	T	0.76713	-0.2858	10	0.18710	T	0.47	.	5.3884	0.16229	0.0:0.0:1.0:0.0	.	545;591	Q5T9A4-3;Q5T9A4	.;ATD3B_HUMAN	D	425;591	ENSP00000311766:E591D	ENSP00000311766:E591D	E	+	3	2	ATAD3B	1420886	0.033000	0.19621	0.001000	0.08648	0.004000	0.04260	1.103000	0.31062	0.847000	0.35167	0.194000	0.17425	GAG	ATAD3B	-	NULL	ENSG00000160072		0.657	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD3B	HGNC	protein_coding	OTTHUMT00000001369.2	-	0.00	81	0	G	NM_031921		1431023	+1	tier1	-	no_errors	ENST00000308647	ensembl	human	known	74_37	missense	6.54	100	7	SNP	0.002	C
ATF7IP	55729	genome.wustl.edu	37	12	14589064	14589064	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:14589064C>G	ENST00000540793.1	+	3	1825	c.1670C>G	c.(1669-1671)tCt>tGt	p.S557C	ATF7IP_ENST00000541654.1_3'UTR|ATF7IP_ENST00000543189.1_Missense_Mutation_p.S556C|ATF7IP_ENST00000261168.4_Missense_Mutation_p.S557C|ATF7IP_ENST00000544627.1_Missense_Mutation_p.S565C|ATF7IP_ENST00000536444.1_Missense_Mutation_p.S556C			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	557	Glu-rich.				DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						CGAAAACGTTCTAAATCAGAA	0.363																																																	0													92.0	89.0	90.0					12																	14589064		2203	4300	6503	SO:0001583	missense	0			AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.1670C>G	12.37:g.14589064C>G	ENSP00000444589:p.Ser557Cys		F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.S557C	ENST00000540793.1	37	c.1670	CCDS8663.1	12	.	.	.	.	.	.	.	.	.	.	C	23.3	4.395517	0.83011	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000540793	T;T;T;T;T	0.23348	1.91;1.94;1.91;1.91;1.91	5.48	5.48	0.80851	.	0.000000	0.56097	D	0.000038	T	0.50411	0.1614	L	0.56769	1.78	0.50467	D	0.999875	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;1.0;1.0	D;D;D;D;D;D	0.91635	0.998;0.999;0.994;0.994;0.999;0.999	T	0.48139	-0.9061	10	0.87932	D	0	-16.3455	19.2901	0.94095	0.0:1.0:0.0:0.0	.	565;556;556;557;556;168	B4E2A2;B4DRL6;G3V1U0;Q6VMQ6;Q6VMQ6-2;B3KQF8	.;.;.;MCAF1_HUMAN;.;.	C	557;556;556;565;557	ENSP00000261168:S557C;ENSP00000443179:S556C;ENSP00000445955:S556C;ENSP00000440440:S565C;ENSP00000444589:S557C	ENSP00000261168:S557C	S	+	2	0	ATF7IP	14480331	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.104000	0.64584	2.728000	0.93425	0.585000	0.79938	TCT	ATF7IP	-	NULL	ENSG00000171681		0.363	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATF7IP	HGNC	protein_coding	OTTHUMT00000401400.1	-	0.00	16	0	C	NM_018179		14589064	+1	tier1	-	no_errors	ENST00000261168	ensembl	human	known	74_37	missense	50.00	9	9	SNP	1.000	G
ATP13A4	84239	genome.wustl.edu	37	3	193210921	193210921	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr3:193210921C>T	ENST00000342695.4	-	4	732	c.410G>A	c.(409-411)aGa>aAa	p.R137K	ATP13A4_ENST00000295548.3_Missense_Mutation_p.R137K|ATP13A4_ENST00000392443.3_Missense_Mutation_p.R137K	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	137						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		CCAAACATATCTTATTTTCTG	0.343																																																	0													90.0	86.0	87.0					3																	193210921		2202	4298	6500	SO:0001583	missense	0			AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.410G>A	3.37:g.193210921C>T	ENSP00000339182:p.Arg137Lys		B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.R137K	ENST00000342695.4	37	c.410	CCDS3304.2	3	.	.	.	.	.	.	.	.	.	.	C	19.08	3.757292	0.69648	.	.	ENSG00000127249	ENST00000392443;ENST00000342695;ENST00000295548	T;T;T	0.28666	1.6;1.6;1.6	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000016	T	0.40145	0.1105	L	0.42744	1.35	0.31161	N	0.704321	P;D	0.55172	0.927;0.97	P;P	0.59948	0.668;0.866	T	0.29336	-1.0015	10	0.20519	T	0.43	-1.1749	11.6766	0.51434	0.0:0.9188:0.0:0.0812	.	137;137	Q4VNC1-2;Q4VNC1	.;AT134_HUMAN	K	137	ENSP00000376238:R137K;ENSP00000339182:R137K;ENSP00000295548:R137K	ENSP00000295548:R137K	R	-	2	0	ATP13A4	194693615	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.428000	0.52792	2.662000	0.90505	0.591000	0.81541	AGA	ATP13A4	-	pfam_ATPase_P-typ_Cation_typ_V,tigrfam_ATPase_P-typ_Cation_typ_V	ENSG00000127249		0.343	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A4	HGNC	protein_coding	OTTHUMT00000157244.4	-	0.00	15	0	C	NM_032279		193210921	-1	tier1	-	no_errors	ENST00000342695	ensembl	human	known	74_37	missense	15.38	33	6	SNP	1.000	T
ATP7B	540	genome.wustl.edu	37	13	52542702	52542702	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr13:52542702C>G	ENST00000242839.4	-	4	1741	c.1585G>C	c.(1585-1587)Gag>Cag	p.E529Q	ATP7B_ENST00000344297.5_Missense_Mutation_p.E529Q|ATP7B_ENST00000400366.3_Missense_Mutation_p.E418Q|ATP7B_ENST00000448424.2_Missense_Mutation_p.E529Q|ATP7B_ENST00000542656.1_Intron|ATP7B_ENST00000482841.1_5'UTR|ATP7B_ENST00000400370.3_Intron|ATP7B_ENST00000418097.2_Missense_Mutation_p.E529Q	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	529	HMA 5. {ECO:0000255|PROSITE- ProRule:PRU00280}.				cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TACTTGATCTCTGCCTTTCCT	0.557									Wilson disease																																								0													115.0	116.0	116.0					13																	52542702		2078	4191	6269	SO:0001583	missense	0	Familial Cancer Database		U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.1585G>C	13.37:g.52542702C>G	ENSP00000242839:p.Glu529Gln		Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Missense_Mutation	SNP	pfam_HeavyMe-assoc_HMA,pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,prints_Cation_transp_P_typ_ATPase,tigrfam_Cation_transp_P-typ_ATPase_IB,tigrfam_Cation_transp_P_typ_ATPase,tigrfam_HMA_Cu_ion-bd	p.E529Q	ENST00000242839.4	37	c.1585	CCDS41892.1	13	.	.	.	.	.	.	.	.	.	.	C	18.37	3.609261	0.66558	.	.	ENSG00000123191	ENST00000242839;ENST00000400366;ENST00000344297;ENST00000448424;ENST00000418097	D;D;D;D;D	0.85773	-2.03;-2.03;-2.03;-2.03;-2.03	5.68	4.83	0.62350	Heavy metal-associated domain, HMA (3);Heavy metal-associated domain, copper ion-binding (1);	0.000000	0.85682	D	0.000000	D	0.90174	0.6929	L	0.51422	1.61	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.995;0.955;0.999;0.998;0.991;0.999	D	0.91116	0.4926	10	0.72032	D	0.01	-31.5398	15.9932	0.80223	0.1358:0.8642:0.0:0.0	.	529;529;529;418;529;529	E7ET55;B7ZLR4;F5H748;P35670-3;P35670-2;P35670	.;.;.;.;.;ATP7B_HUMAN	Q	529;418;529;529;529	ENSP00000242839:E529Q;ENSP00000383217:E418Q;ENSP00000342559:E529Q;ENSP00000416738:E529Q;ENSP00000393343:E529Q	ENSP00000242839:E529Q	E	-	1	0	ATP7B	51440703	1.000000	0.71417	0.998000	0.56505	0.282000	0.26991	7.376000	0.79658	1.403000	0.46800	-0.181000	0.13052	GAG	ATP7B	-	pfam_HeavyMe-assoc_HMA,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,tigrfam_HMA_Cu_ion-bd	ENSG00000123191		0.557	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP7B	HGNC	protein_coding	OTTHUMT00000045981.1	-	0.00	25	0	C	NM_000053		52542702	-1	tier1	-	no_errors	ENST00000242839	ensembl	human	known	74_37	missense	12.82	34	5	SNP	1.000	G
BAIAP2-AS1	440465	genome.wustl.edu	37	17	79005303	79005303	+	lincRNA	SNP	T	T	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:79005303T>A	ENST00000577066.1	-	0	2091					NR_026857.1				BAIAP2 antisense RNA 1 (head to head)																		GACAAGTGGCTACTCTCAGGC	0.587																																																	0																																												0			AK027350, AK056555, AK075238, AK096609		17q25.3	2012-10-15	2012-10-15		ENSG00000226137	ENSG00000226137		"""Long non-coding RNAs"""	44342	non-coding RNA	RNA, long non-coding			"""BAIAP2 antisense RNA 1 (non-protein coding)"", ""BAIAP2 antisense RNA 1"""				Standard	NR_026857		Approved		uc002jyy.2		OTTHUMG00000177697		17.37:g.79005303T>A				RNA	SNP	-	NULL	ENST00000577066.1	37	NULL		17																																																																																			BAIAP2-AS1	-	-	ENSG00000226137		0.587	BAIAP2-AS1-001	KNOWN	basic	lincRNA	BAIAP2-AS1	HGNC	lincRNA	OTTHUMT00000438544.1	-	0.00	38	0	T	NR_026857		79005303	-1	tier1	-	no_errors	ENST00000542745	ensembl	human	known	74_37	rna	57.14	15	20	SNP	0.000	A
BBS1	582	genome.wustl.edu	37	11	66299165	66299165	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:66299165G>T	ENST00000318312.7	+	16	1698	c.1647G>T	c.(1645-1647)gaG>gaT	p.E549D	ZDHHC24_ENST00000526986.1_Intron|BBS1_ENST00000455748.2_Missense_Mutation_p.E452D|BBS1_ENST00000393994.2_Missense_Mutation_p.E420D|CTD-3074O7.11_ENST00000419755.3_Missense_Mutation_p.E586D	NM_024649.4	NP_078925.3	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	549					cilium assembly (GO:0042384)|Golgi to plasma membrane protein transport (GO:0043001)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	patched binding (GO:0005113)|RNA polymerase II repressing transcription factor binding (GO:0001103)|smoothened binding (GO:0005119)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	28						ACCCCCTGGAGACCTTTGTGG	0.552									Bardet-Biedl syndrome																												GBM(152;173 2612 9770 10137)												0													179.0	167.0	171.0					11																	66299165		2200	4295	6495	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF503941	CCDS8142.1	11q13	2013-01-08			ENSG00000174483	ENSG00000174483			966	protein-coding gene	gene with protein product		209901				9039982, 12567324	Standard	NM_024649		Approved	FLJ23590	uc001oij.1	Q8NFJ9	OTTHUMG00000167110	ENST00000318312.7:c.1647G>T	11.37:g.66299165G>T	ENSP00000317469:p.Glu549Asp		Q32MM9|Q32MN0|Q96SN4	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like_supfam	p.E586D	ENST00000318312.7	37	c.1758	CCDS8142.1	11	.	.	.	.	.	.	.	.	.	.	G	14.17	2.455200	0.43634	.	.	ENSG00000256349;ENSG00000174483;ENSG00000174483;ENSG00000174483	ENST00000419755;ENST00000318312;ENST00000455748;ENST00000393994	D;D;D;D	0.97089	-4.17;-4.24;-4.03;-4.01	5.79	3.91	0.45181	.	.	.	.	.	D	0.92987	0.7768	L	0.31664	0.95	0.80722	D	1	B;B;B;B;B;B	0.28584	0.153;0.119;0.216;0.153;0.125;0.125	B;B;B;B;B;B	0.32805	0.048;0.111;0.153;0.051;0.021;0.037	D	0.87916	0.2700	9	0.25106	T	0.35	.	8.2404	0.31656	0.2442:0.0:0.7558:0.0	.	224;452;420;437;549;586	B4DH75;E7EQH1;Q32MM9;Q4G0L2;Q8NFJ9;Q8NFJ9-2	.;.;.;.;BBS1_HUMAN;.	D	586;549;452;420	ENSP00000398526:E586D;ENSP00000317469:E549D;ENSP00000405764:E452D;ENSP00000377563:E420D	ENSP00000317469:E549D	E	+	3	2	BBS1;CTD-3074O7.11	66055741	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.913000	0.28611	0.776000	0.33473	0.655000	0.94253	GAG	CTD-3074O7.11	-	NULL	ENSG00000256349		0.552	BBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS1	Clone_based_vega_gene	protein_coding	OTTHUMT00000393235.2	-	0.00	57	0	G			66299165	+1	tier1	-	no_errors	ENST00000419755	ensembl	human	known	74_37	missense	20.43	74	19	SNP	1.000	T
BMP1	649	genome.wustl.edu	37	8	22056861	22056861	+	Intron	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:22056861C>G	ENST00000306385.5	+	15	2777				BMP1_ENST00000354870.5_Intron|BMP1_ENST00000306349.8_Intron|BMP1_ENST00000397816.3_Missense_Mutation_p.L812V	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1						cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		GACCTTCAGTCTGACCCCTGC	0.617																																																	0													44.0	53.0	50.0					8																	22056861		2203	4299	6502	SO:0001627	intron_variant	0				CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761	ENST00000306385.5:c.2107+1928C>G	8.37:g.22056861C>G			A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Missense_Mutation	SNP	pirsf_BMP_1/tolloid-like,pfam_CUB_dom,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,smart_Peptidase_Metallo,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,prints_Peptidase_M12A,pfscan_CUB_dom,pfscan_EG-like_dom	p.L812V	ENST00000306385.5	37	c.2434	CCDS6026.1	8	.	.	.	.	.	.	.	.	.	.	C	12.68	2.010329	0.35511	.	.	ENSG00000168487	ENST00000397816	T	0.65364	-0.15	5.02	1.63	0.23807	.	.	.	.	.	T	0.49558	0.1564	.	.	.	0.80722	D	1	B	0.24426	0.103	B	0.19148	0.024	T	0.48222	-0.9054	8	0.87932	D	0	.	7.3187	0.26515	0.0:0.5152:0.3766:0.1082	.	812	P13497-6	.	V	812	ENSP00000380917:L812V	ENSP00000380917:L812V	L	+	1	2	BMP1	22112806	0.998000	0.40836	1.000000	0.80357	0.990000	0.78478	0.207000	0.17395	0.494000	0.27859	0.462000	0.41574	CTG	BMP1	-	NULL	ENSG00000168487		0.617	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP1	HGNC	protein_coding	OTTHUMT00000214995.2	-	0.00	20	0	C	NM_006132		22056861	+1	tier1	-	no_errors	ENST00000397816	ensembl	human	known	74_37	missense	37.50	5	3	SNP	0.989	G
BRIP1	83990	genome.wustl.edu	37	17	59938866	59938866	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:59938866C>T	ENST00000259008.2	-	2	302	c.35G>A	c.(34-36)gGg>gAg	p.G12E	BRIP1_ENST00000577598.1_Missense_Mutation_p.G12E	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	12	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						AATCTTCACCCCACCAATTGT	0.323			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																															yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	0													128.0	115.0	119.0					17																	59938866		2203	4300	6503	SO:0001583	missense	0			AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.35G>A	17.37:g.59938866C>T	ENSP00000259008:p.Gly12Glu		Q3MJE2|Q8NCI5	Missense_Mutation	SNP	pfam_DEAD_2,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_TIL_dom,smart_Helicase-like_DEXD_c2,smart_Helicase_ATP-bd,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.G12E	ENST00000259008.2	37	c.35	CCDS11631.1	17	.	.	.	.	.	.	.	.	.	.	C	10.09	1.255910	0.22965	.	.	ENSG00000136492	ENST00000259008	T	0.76448	-1.02	5.09	5.09	0.68999	Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.050981	0.85682	D	0.000000	D	0.89220	0.6653	M	0.85099	2.735	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.90198	0.4255	9	.	.	.	-8.7027	17.4723	0.87649	0.0:1.0:0.0:0.0	.	12	Q9BX63	FANCJ_HUMAN	E	12	ENSP00000259008:G12E	.	G	-	2	0	BRIP1	57293648	1.000000	0.71417	1.000000	0.80357	0.169000	0.22640	6.442000	0.73443	2.379000	0.81126	0.655000	0.94253	GGG	BRIP1	-	superfamily_P-loop_NTPase,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3	ENSG00000136492		0.323	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRIP1	HGNC	protein_coding	OTTHUMT00000445362.1	-	0.00	23	0	C	NM_032043		59938866	-1	tier1	-	no_errors	ENST00000259008	ensembl	human	known	74_37	missense	50.00	17	17	SNP	1.000	T
BRWD3	254065	genome.wustl.edu	37	X	80065086	80065087	+	5'UTR	INS	-	-	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chrX:80065086_80065087insA	ENST00000373275.4	-	0	100_101					NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3						cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						GCTTCCGCCGCACTCCTCGTCC	0.639																																																	0																																										SO:0001623	5_prime_UTR_variant	0				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.-117->T	X.37:g.80065087_80065087dupA			C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	RNA	INS	-	NULL	ENST00000373275.4	37	NULL	CCDS14447.1	X																																																																																			BRWD3	-	-	ENSG00000165288		0.639	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	HGNC	protein_coding	OTTHUMT00000057344.1		0.00	9	0	-	NM_153252		80065087	-1	tier1		no_errors	ENST00000478415	ensembl	human	known	74_37	rna	57.89	8	11	INS	0.676:0.668	A
BSX	390259	genome.wustl.edu	37	11	122850084	122850084	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:122850084G>T	ENST00000343035.2	-	2	392	c.344C>A	c.(343-345)aCg>aAg	p.T115K		NM_001098169.1	NP_001091639.1	Q3C1V8	BSH_HUMAN	brain-specific homeobox	115					eating behavior (GO:0042755)|locomotory behavior (GO:0007626)|mammary gland involution (GO:0060056)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	10		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0361)		AGAGAAAACCGTGCGGGCTTT	0.662																																																	0													41.0	51.0	48.0					11																	122850084		2044	4191	6235	SO:0001583	missense	0				CCDS41728.1	11q24.1	2011-07-19			ENSG00000188909	ENSG00000188909		"""Homeoboxes / ANTP class : NKL subclass"""	20450	protein-coding gene	gene with protein product		611074					Standard	NM_001098169		Approved	BSX1	uc010rzs.2	Q3C1V8	OTTHUMG00000150247	ENST00000343035.2:c.344C>A	11.37:g.122850084G>T	ENSP00000344285:p.Thr115Lys			Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.T115K	ENST00000343035.2	37	c.344	CCDS41728.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.497543	0.96355	.	.	ENSG00000188909	ENST00000343035	D	0.97232	-4.3	5.22	5.22	0.72569	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.098835	0.64402	D	0.000002	D	0.98804	0.9597	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99758	1.1020	10	0.87932	D	0	.	18.7806	0.91930	0.0:0.0:1.0:0.0	.	115	Q3C1V8	BSH_HUMAN	K	115	ENSP00000344285:T115K	ENSP00000344285:T115K	T	-	2	0	BSX	122355294	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.642000	0.98461	2.454000	0.82982	0.655000	0.94253	ACG	BSX	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000188909		0.662	BSX-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	BSX	HGNC	protein_coding	OTTHUMT00000317076.1		0.00	32	0	G	NM_001098169		122850084	-1			no_errors	ENST00000343035	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	T
BTBD11	121551	genome.wustl.edu	37	12	108051486	108051486	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:108051486C>T	ENST00000280758.5	+	17	3834	c.3306C>T	c.(3304-3306)tcC>tcT	p.S1102S	BTBD11_ENST00000494235.2_Silent_p.S181S|BTBD11_ENST00000357167.4_Silent_p.S639S|BTBD11_ENST00000420571.2_Silent_p.S983S	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	1102						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						CCAAAGGTTCCGTGGTATGAA	0.517																																																	0													97.0	86.0	89.0					12																	108051486		2203	4300	6503	SO:0001819	synonymous_variant	0			AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.3306C>T	12.37:g.108051486C>T			A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Silent	SNP	pfam_Ankyrin_rpt,pfam_BTB_POZ,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,superfamily_Histone-fold,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.S1102	ENST00000280758.5	37	c.3306	CCDS31893.1	12																																																																																			BTBD11	-	NULL	ENSG00000151136		0.517	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTBD11	HGNC	protein_coding	OTTHUMT00000318003.1	-	0.00	43	0	C	NM_152322		108051486	+1	tier1	-	no_errors	ENST00000280758	ensembl	human	known	74_37	silent	14.29	29	5	SNP	0.340	T
C14orf180	400258	genome.wustl.edu	37	14	105052817	105052817	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:105052817G>C	ENST00000557649.1	+	2	386	c.50G>C	c.(49-51)cGa>cCa	p.R17P	C14orf180_ENST00000410013.1_Missense_Mutation_p.R17P|C14orf180_ENST00000331952.2_Missense_Mutation_p.R17P|RP11-614O9.1_ENST00000556073.1_RNA			Q8N912	NRAC_HUMAN	chromosome 14 open reading frame 180	17						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)							Melanoma(154;0.226)	all cancers(16;0.00405)|OV - Ovarian serous cystadenocarcinoma(23;0.0319)|Epithelial(46;0.0784)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.127)		CCAGAGACACGACGTCAGACC	0.582																																																	0													18.0	18.0	18.0					14																	105052817		2143	4214	6357	SO:0001583	missense	0				CCDS32166.1, CCDS66722.1	14q32.33	2012-11-12	2012-11-12	2012-11-12	ENSG00000184601	ENSG00000184601			33795	protein-coding gene	gene with protein product	"""nutritionally-regulated adipose and cardiac-enriched"""		"""chromosome 14 open reading frame 77"""	C14orf77		23029450	Standard	XM_005267638		Approved	NRAC	uc001yow.1	Q8N912	OTTHUMG00000029806	ENST00000557649.1:c.50G>C	14.37:g.105052817G>C	ENSP00000452502:p.Arg17Pro			Missense_Mutation	SNP	NULL	p.R17P	ENST00000557649.1	37	c.50	CCDS32166.1	14	.	.	.	.	.	.	.	.	.	.	G	2.000	-0.429564	0.04701	.	.	ENSG00000184601	ENST00000557649;ENST00000331952;ENST00000553873;ENST00000410013	.	.	.	2.33	-4.66	0.03329	.	.	.	.	.	T	0.15219	0.0367	N	0.12746	0.255	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.003;0.003;0.003	T	0.06427	-1.0827	8	0.35671	T	0.21	4.4505	2.2886	0.04133	0.2061:0.1272:0.4664:0.2003	.	17;17;17	B4DN93;G3V2Z8;Q8N912	.;.;CN180_HUMAN	P	17	.	ENSP00000333041:R17P	R	+	2	0	C14orf180	104123862	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.235000	0.01202	-3.567000	0.00140	-0.539000	0.04255	CGA	C14orf180	-	NULL	ENSG00000184601		0.582	C14orf180-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C14orf180	HGNC	protein_coding	OTTHUMT00000410580.1	-	0.00	127	0	G	NM_001008404		105052817	+1	tier1	-	no_errors	ENST00000410013	ensembl	human	known	74_37	missense	9.09	120	12	SNP	0.000	C
C19orf71	100128569	genome.wustl.edu	37	19	3543359	3543359	+	Silent	SNP	G	G	A	rs377153853	byFrequency	TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:3543359G>A	ENST00000329493.5	+	2	234	c.210G>A	c.(208-210)tcG>tcA	p.S70S	MFSD12_ENST00000398558.4_Intron|AC005786.7_ENST00000589360.1_RNA|MFSD12_ENST00000389395.3_Intron	NM_001135580.1	NP_001129052.1	A6NCJ1	CS071_HUMAN	chromosome 19 open reading frame 71	70										endometrium(2)	2						TGACCAACTCGGACGCCTGGG	0.682													G|||	5	0.000998403	0.0	0.0	5008	,	,		12069	0.005		0.0	False		,,,				2504	0.0																0													25.0	39.0	35.0					19																	3543359		692	1590	2282	SO:0001819	synonymous_variant	0				CCDS45918.1	19p13.3	2012-10-26			ENSG00000183397	ENSG00000183397			34496	protein-coding gene	gene with protein product							Standard	NM_001135580		Approved	LOC100128569	uc010xhm.2	A6NCJ1		ENST00000329493.5:c.210G>A	19.37:g.3543359G>A				Silent	SNP	NULL	p.S70	ENST00000329493.5	37	c.210	CCDS45918.1	19																																																																																			C19orf71	-	NULL	ENSG00000183397		0.682	C19orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf71	HGNC	protein_coding	OTTHUMT00000452943.1	-	0.00	16	0	G	NM_001135580		3543359	+1	tier1	-	no_errors	ENST00000329493	ensembl	human	known	74_37	silent	31.58	13	6	SNP	0.000	A
C1orf105	92346	genome.wustl.edu	37	1	172437700	172437700	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:172437700G>C	ENST00000367727.4	+	7	716	c.518G>C	c.(517-519)aGa>aCa	p.R173T	C1orf105_ENST00000367725.4_Missense_Mutation_p.R163T|C1orf105_ENST00000367726.1_3'UTR	NM_139240.3	NP_640333.3	O95561	CA105_HUMAN	chromosome 1 open reading frame 105	173										large_intestine(1)|lung(12)|prostate(1)|skin(1)	15						TCCTTGCCCAGAAAGGAACCA	0.512																																																	0													148.0	155.0	153.0					1																	172437700		2203	4300	6503	SO:0001583	missense	0			AL035295	CCDS1301.1, CCDS72983.1	1q24.3	2012-06-26			ENSG00000180999	ENSG00000180999			29591	protein-coding gene	gene with protein product						12477932	Standard	NM_139240		Approved		uc001gik.3	O95561	OTTHUMG00000034750	ENST00000367727.4:c.518G>C	1.37:g.172437700G>C	ENSP00000356700:p.Arg173Thr		Q8IY02	Missense_Mutation	SNP	NULL	p.R173T	ENST00000367727.4	37	c.518	CCDS1301.1	1	.	.	.	.	.	.	.	.	.	.	G	13.95	2.388546	0.42308	.	.	ENSG00000180999	ENST00000367727;ENST00000367725	T;T	0.36878	1.23;1.23	4.0	1.96	0.26148	.	0.441905	0.19314	N	0.117310	T	0.09247	0.0228	N	0.19112	0.55	0.09310	N	1	B	0.32829	0.386	B	0.36766	0.232	T	0.17379	-1.0371	10	0.38643	T	0.18	-1.8776	6.2302	0.20730	0.2517:0.0:0.7483:0.0	.	173	O95561	CA105_HUMAN	T	173;163	ENSP00000356700:R173T;ENSP00000356698:R163T	ENSP00000356698:R163T	R	+	2	0	C1orf105	170704323	0.005000	0.15991	0.015000	0.15790	0.019000	0.09904	0.907000	0.28531	0.546000	0.28920	-0.466000	0.05196	AGA	C1orf105	-	NULL	ENSG00000180999		0.512	C1orf105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf105	HGNC	protein_coding	OTTHUMT00000084062.2	-	0.00	21	0	G	NM_139240		172437700	+1	tier1	-	no_errors	ENST00000367727	ensembl	human	known	74_37	missense	15.00	34	6	SNP	0.023	C
C20orf194	25943	genome.wustl.edu	37	20	3277433	3277433	+	Intron	SNP	T	T	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr20:3277433T>C	ENST00000252032.9	-	23	2086				C20orf194_ENST00000498079.1_5'UTR|C20orf194_ENST00000453730.2_Intron	NM_001009984.2	NP_001009984.1	Q5TEA3	CT194_HUMAN	chromosome 20 open reading frame 194											NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	39						TGTTACATAATGCGAGGCATC	0.493																																																	0																																										SO:0001627	intron_variant	0			AL110249	CCDS42851.1	20p13	2012-10-30			ENSG00000088854	ENSG00000088854			17721	protein-coding gene	gene with protein product		614146					Standard	NM_001009984		Approved	DKFZp434N061	uc002wii.3	Q5TEA3	OTTHUMG00000031742	ENST00000252032.9:c.2018+74A>G	20.37:g.3277433T>C			Q66K86|Q6P2R9|Q9UFX9	RNA	SNP	-	NULL	ENST00000252032.9	37	NULL	CCDS42851.1	20																																																																																			C20orf194	-	-	ENSG00000088854		0.493	C20orf194-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf194	HGNC	protein_coding	OTTHUMT00000077734.1	-	0.00	23	0	T	NM_001009984		3277433	-1	tier1	-	no_errors	ENST00000498079	ensembl	human	known	74_37	rna	46.67	8	7	SNP	0.000	C
CFAP61	26074	genome.wustl.edu	37	20	20269495	20269495	+	Silent	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr20:20269495C>G	ENST00000245957.5	+	23	3115	c.3039C>G	c.(3037-3039)ctC>ctG	p.L1013L	C20orf26_ENST00000377309.2_Intron	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		1013										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		TGCTACATCTCTTTGATCCAA	0.473																																																	0													68.0	59.0	62.0					20																	20269495		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000245957.5:c.3039C>G	20.37:g.20269495C>G			A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Silent	SNP	superfamily_Acyl_CoA_acyltransferase	p.L1013	ENST00000245957.5	37	c.3039	CCDS33447.1	20																																																																																			C20orf26	-	NULL	ENSG00000089101		0.473	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf26	HGNC	protein_coding	OTTHUMT00000078228.3	-	0.00	49	0	C			20269495	+1	tier1	-	no_errors	ENST00000245957	ensembl	human	known	74_37	silent	12.50	49	7	SNP	0.996	G
C5AR2	27202	genome.wustl.edu	37	19	47844098	47844098	+	Silent	SNP	C	C	T	rs138403580	byFrequency	TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:47844098C>T	ENST00000595464.1	+	2	260	c.42C>T	c.(40-42)agC>agT	p.S14S	C5AR2_ENST00000600626.1_Silent_p.S14S|C5AR2_ENST00000257267.2_Silent_p.S14S	NM_001271749.1	NP_001258678.1	Q9P296	C5AR2_HUMAN	complement component 5a receptor 2	14					chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of interleukin-8 secretion (GO:2000482)	apical part of cell (GO:0045177)|basal plasma membrane (GO:0009925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C5a anaphylatoxin receptor activity (GO:0004944)										GGGATTACAGCGACCTCTCGG	0.612																																																	0								C		1,4405		0,1,2202	59.0	61.0	61.0		42	-7.1	0.0	19	dbSNP_134	61	0,8600		0,0,4300	no	coding-synonymous	GPR77	NM_018485.1		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		14/338	47844098	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AB038237	CCDS12699.1	19q13.33	2013-01-28	2013-01-28	2013-01-28		ENSG00000134830		"""GPCR / Class A : Complement component receptors"""	4527	protein-coding gene	gene with protein product		609949	"""G protein-coupled receptor 77"""	GPR77		11165367	Standard	NM_018485		Approved	C5L2	uc010ela.1	Q9P296		ENST00000595464.1:c.42C>T	19.37:g.47844098C>T			B2RA09	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Anaphtx_C5AR1/C5AR2	p.S14	ENST00000595464.1	37	c.42	CCDS12699.1	19																																																																																			C5AR2	-	NULL	ENSG00000134830		0.612	C5AR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5AR2	HGNC	protein_coding	OTTHUMT00000466926.1	-	0.00	32	0	C	NM_018485		47844098	+1	tier1	rs138403580	no_errors	ENST00000257267	ensembl	human	known	74_37	silent	25.71	26	9	SNP	0.000	T
C6orf89	221477	genome.wustl.edu	37	6	36867365	36867365	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:36867365C>G	ENST00000480824.2	+	3	439	c.145C>G	c.(145-147)Cag>Gag	p.Q49E	C6orf89_ENST00000510325.2_5'UTR|C6orf89_ENST00000359359.2_5'UTR|C6orf89_ENST00000373685.1_Missense_Mutation_p.Q49E|C6orf89_ENST00000355190.3_Missense_Mutation_p.Q56E			Q6UWU4	CF089_HUMAN	chromosome 6 open reading frame 89	49					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(2)	15						GAATGAACCTCAGAGACCCCC	0.428																																																	0													65.0	71.0	69.0					6																	36867365		2203	4300	6503	SO:0001583	missense	0			AK058086	CCDS4827.1, CCDS69100.1, CCDS75444.1	6p21.31	2013-03-14			ENSG00000198663	ENSG00000198663			21114	protein-coding gene	gene with protein product	"""bombesin receptor activated protein"""					21857995, 23460338	Standard	NM_152734		Approved	FLJ25357, BRAP	uc003omw.3	Q6UWU4	OTTHUMG00000014613	ENST00000480824.2:c.145C>G	6.37:g.36867365C>G	ENSP00000475947:p.Gln49Glu		B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Missense_Mutation	SNP	NULL	p.Q56E	ENST00000480824.2	37	c.166		6	.	.	.	.	.	.	.	.	.	.	C	21.3	4.132703	0.77662	.	.	ENSG00000198663	ENST00000355190;ENST00000373685;ENST00000416621;ENST00000540072	T;T	0.29142	1.58;1.58	6.08	6.08	0.98989	.	0.067233	0.64402	D	0.000007	T	0.29126	0.0724	L	0.57536	1.79	0.80722	D	1	P;P	0.44429	0.739;0.835	B;B	0.43889	0.291;0.435	T	0.03240	-1.1057	10	0.59425	D	0.04	-8.5836	18.844	0.92196	0.0:1.0:0.0:0.0	.	49;56	Q6UWU4;Q6UWU4-2	CF089_HUMAN;.	E	56;49;56;55	ENSP00000347322:Q56E;ENSP00000362789:Q49E	ENSP00000347322:Q56E	Q	+	1	0	C6orf89	36975343	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	3.541000	0.53618	2.894000	0.99253	0.655000	0.94253	CAG	C6orf89	-	NULL	ENSG00000198663		0.428	C6orf89-004	KNOWN	alternative_5_UTR|basic	protein_coding	C6orf89	HGNC	protein_coding	OTTHUMT00000040387.2	-	0.00	28	0	C	NM_152734		36867365	+1	tier1	-	no_errors	ENST00000355190	ensembl	human	known	74_37	missense	27.78	26	10	SNP	1.000	G
C7	730	genome.wustl.edu	37	5	40947882	40947882	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:40947882C>G	ENST00000313164.9	+	8	1276	c.917C>G	c.(916-918)tCt>tGt	p.S306C		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	306	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				TATCTGCAATCTGGGTCGTTA	0.413																																																	0													88.0	84.0	85.0					5																	40947882		1832	4083	5915	SO:0001583	missense	0			J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.917C>G	5.37:g.40947882C>G	ENSP00000322061:p.Ser306Cys		Q6P3T5|Q92489	Missense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Sushi_SCR_CCP,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.S306C	ENST00000313164.9	37	c.917	CCDS47201.1	5	.	.	.	.	.	.	.	.	.	.	C	19.90	3.912224	0.72983	.	.	ENSG00000112936	ENST00000313164;ENST00000515157	D	0.86562	-2.14	5.9	5.9	0.94986	Membrane attack complex component/perforin (MACPF) domain (3);	0.123853	0.56097	D	0.000024	D	0.94118	0.8114	M	0.83012	2.62	0.42024	D	0.990996	D	0.89917	1.0	D	0.87578	0.998	D	0.94377	0.7601	10	0.72032	D	0.01	-29.0708	18.4666	0.90758	0.0:1.0:0.0:0.0	.	306	P10643	CO7_HUMAN	C	306	ENSP00000322061:S306C	ENSP00000322061:S306C	S	+	2	0	C7	40983639	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	4.454000	0.60068	2.786000	0.95864	0.650000	0.86243	TCT	C7	-	pfam_MACPF,smart_MACPF	ENSG00000112936		0.413	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7	HGNC	protein_coding	OTTHUMT00000317680.1	-	0.00	53	0	C			40947882	+1	tier1	-	no_errors	ENST00000313164	ensembl	human	known	74_37	missense	12.00	87	12	SNP	1.000	G
CA14	23632	genome.wustl.edu	37	1	150236222	150236222	+	Silent	SNP	T	T	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:150236222T>C	ENST00000369111.4	+	10	1862	c.892T>C	c.(892-894)Ttg>Ctg	p.L298L	snoU13_ENST00000458929.1_RNA|APH1A_ENST00000461320.1_5'Flank	NM_012113.1	NP_036245.1	Q9ULX7	CAH14_HUMAN	carbonic anhydrase XIV	298					bicarbonate transport (GO:0015701)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	18	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)		Acetazolamide(DB00819)|Zonisamide(DB00909)	TGTAGGAATCTTGGTTGGCTG	0.463																																																	0													256.0	249.0	251.0					1																	150236222		2203	4300	6503	SO:0001819	synonymous_variant	0			AB025904	CCDS947.1	1q21	2008-02-05			ENSG00000118298	ENSG00000118298		"""Carbonic anhydrases"""	1372	protein-coding gene	gene with protein product		604832				10512682	Standard	XM_005245059		Approved		uc001etx.3	Q9ULX7	OTTHUMG00000012549	ENST00000369111.4:c.892T>C	1.37:g.150236222T>C			Q5TB24|Q8NCF4	Silent	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.L298	ENST00000369111.4	37	c.892	CCDS947.1	1																																																																																			CA14	-	NULL	ENSG00000118298		0.463	CA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA14	HGNC	protein_coding	OTTHUMT00000035064.2	-	0.00	40	0	T	NM_012113		150236222	+1	tier1	-	no_errors	ENST00000369111	ensembl	human	known	74_37	silent	13.46	45	7	SNP	0.734	C
CABS1	85438	genome.wustl.edu	37	4	71201540	71201540	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr4:71201540G>A	ENST00000273936.5	+	1	858	c.784G>A	c.(784-786)Gag>Aag	p.E262K		NM_033122.3	NP_149113.3	Q96KC9	CABS1_HUMAN	calcium-binding protein, spermatid-specific 1	262					spermatogenesis (GO:0007283)	mitochondrial inner membrane (GO:0005743)|motile cilium (GO:0031514)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(4)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TGACTCTGATGAGAAGTTTAT	0.408																																																	0													98.0	96.0	96.0					4																	71201540		2203	4300	6503	SO:0001583	missense	0			AF380838	CCDS3539.1	4q13.3	2013-10-11	2011-01-25	2011-01-25	ENSG00000145309	ENSG00000145309			30710	protein-coding gene	gene with protein product	"""casein-like phosphoprotein"""		"""chromosome 4 open reading frame 35"""	C4orf35		19208547, 19271754	Standard	NM_033122		Approved	NYD-SP26, FLJ32897, CLPH	uc003hff.3	Q96KC9	OTTHUMG00000129405	ENST00000273936.5:c.784G>A	4.37:g.71201540G>A	ENSP00000273936:p.Glu262Lys		B2RCB5|Q86UE0|Q96M17	Missense_Mutation	SNP	NULL	p.E262K	ENST00000273936.5	37	c.784	CCDS3539.1	4	.	.	.	.	.	.	.	.	.	.	G	15.58	2.876375	0.51801	.	.	ENSG00000145309	ENST00000273936	T	0.37058	1.22	4.01	4.01	0.46588	.	0.000000	0.42964	D	0.000628	T	0.46756	0.1409	L	0.34521	1.04	0.27288	N	0.95792	D	0.89917	1.0	D	0.87578	0.998	T	0.27468	-1.0073	10	0.87932	D	0	-48.5134	11.9411	0.52901	0.0:0.0:1.0:0.0	.	262	Q96KC9	CABS1_HUMAN	K	262	ENSP00000273936:E262K	ENSP00000273936:E262K	E	+	1	0	CABS1	71236129	0.999000	0.42202	0.998000	0.56505	0.141000	0.21300	4.113000	0.57851	2.528000	0.85240	0.655000	0.94253	GAG	CABS1	-	NULL	ENSG00000145309		0.408	CABS1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	CABS1	HGNC	protein_coding	OTTHUMT00000251561.3	-	0.00	29	0	G	NM_033122		71201540	+1	tier1	-	no_errors	ENST00000273936	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.999	A
CACNA1E	777	genome.wustl.edu	37	1	181752870	181752870	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:181752870C>G	ENST00000367573.2	+	40	5420	c.5420C>G	c.(5419-5421)tCc>tGc	p.S1807C	CACNA1E_ENST00000360108.3_Missense_Mutation_p.S1788C|CACNA1E_ENST00000367567.4_Missense_Mutation_p.S1414C|CACNA1E_ENST00000357570.5_Missense_Mutation_p.S1758C|CACNA1E_ENST00000367570.1_Missense_Mutation_p.S1807C|CACNA1E_ENST00000526775.1_Missense_Mutation_p.S1788C|CACNA1E_ENST00000358338.5_Missense_Mutation_p.S1739C	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1807					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CACTTCACCTCCACACTTATG	0.448																																																	0													99.0	96.0	97.0					1																	181752870		1995	4163	6158	SO:0001583	missense	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.5420C>G	1.37:g.181752870C>G	ENSP00000356545:p.Ser1807Cys		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.S1807C	ENST00000367573.2	37	c.5420	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.114799	0.77210	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	T;T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23	5.61	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.83027	0.5165	M	0.87456	2.885	0.80722	D	1	D;D	0.76494	0.999;0.996	D;P	0.71414	0.973;0.855	D	0.86350	0.1710	10	0.87932	D	0	.	14.3581	0.66752	0.0:0.928:0.0:0.072	.	1788;1807	Q15878-2;Q15878-3	.;.	C	1807;1788;1758;1739;1414;1788;1807	ENSP00000356542:S1807C;ENSP00000434814:S1788C;ENSP00000350183:S1758C;ENSP00000351101:S1739C;ENSP00000356539:S1414C;ENSP00000353222:S1788C;ENSP00000356545:S1807C	ENSP00000350183:S1758C	S	+	2	0	CACNA1E	180019493	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	7.711000	0.84669	1.372000	0.46190	0.555000	0.69702	TCC	CACNA1E	-	NULL	ENSG00000198216		0.448	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	-	0.00	83	0	C	NM_000721		181752870	+1	tier1	-	no_errors	ENST00000367573	ensembl	human	known	74_37	missense	32.29	65	31	SNP	1.000	G
CALM3	808	genome.wustl.edu	37	19	47111561	47111561	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:47111561G>T	ENST00000291295.9	+	3	341	c.142G>T	c.(142-144)Gag>Tag	p.E48*	CALM3_ENST00000477244.1_3'UTR|CALM3_ENST00000599839.1_Nonsense_Mutation_p.E12*|CTB-12A17.3_ENST00000597609.1_RNA|CALM3_ENST00000596362.1_Nonsense_Mutation_p.E48*|CALM3_ENST00000598871.1_Nonsense_Mutation_p.E12*|CALM3_ENST00000597743.1_Nonsense_Mutation_p.E48*|CALM3_ENST00000594523.1_Nonsense_Mutation_p.E12*|CALM3_ENST00000391918.2_Nonsense_Mutation_p.E12*	NM_005184.2	NP_005175.2	P62158	CALM_HUMAN	calmodulin 3 (phosphorylase kinase, delta)	48	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|detection of calcium ion (GO:0005513)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nitric oxide metabolic process (GO:0046209)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cyclic nucleotide metabolic process (GO:0030801)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cytokinesis (GO:0032465)|regulation of heart rate (GO:0002027)|regulation of high voltage-gated calcium channel activity (GO:1901841)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to corticosterone (GO:0051412)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcomere (GO:0030017)|spindle microtubule (GO:0005876)|spindle pole (GO:0000922)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|N-terminal myristoylation domain binding (GO:0031997)|nitric-oxide synthase regulator activity (GO:0030235)|phospholipase binding (GO:0043274)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|protein phosphatase activator activity (GO:0072542)|protein serine/threonine kinase activator activity (GO:0043539)|thioesterase binding (GO:0031996)|titin binding (GO:0031432)			breast(1)|cervix(2)|endometrium(1)|lung(1)|ovary(1)	6		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000683)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0341)	Aprindine(DB01429)|Bepridil(DB01244)|Chlorpromazine(DB00477)|Cinchocaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Melatonin(DB01065)|Nicardipine(DB00622)|Nifedipine(DB01115)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)|Trifluoperazine(DB00831)	CACTGAAGCAGAGCTGCAGGA	0.587																																																	0													99.0	86.0	90.0					19																	47111561		2203	4300	6503	SO:0001587	stop_gained	0				CCDS33061.1	19q13.2-q13.3	2013-02-25			ENSG00000160014	ENSG00000160014		"""EF-hand domain containing"", ""Endogenous ligands"""	1449	protein-coding gene	gene with protein product	"""prepro-calmodulin 3"""	114183					Standard	NM_005184		Approved	PHKD	uc002pew.3	P62158	OTTHUMG00000133517	ENST00000291295.9:c.142G>T	19.37:g.47111561G>T	ENSP00000291295:p.Glu48*		P02593|P70667|P99014|Q13942|Q53S29|Q61379|Q61380|Q96HK3	Nonsense_Mutation	SNP	pfam_EF_hand_dom,pfam_EF-hand_Ca_insen,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.E48*	ENST00000291295.9	37	c.142	CCDS33061.1	19	.	.	.	.	.	.	.	.	.	.	G	37	6.403021	0.97537	.	.	ENSG00000160014	ENST00000291295;ENST00000391918	.	.	.	5.18	5.18	0.71444	.	0.000000	0.56097	D	0.000035	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-36.8039	16.2303	0.82332	0.0:0.0:1.0:0.0	.	.	.	.	X	48	.	ENSP00000291295:E48X	E	+	1	0	CALM3	51803401	1.000000	0.71417	0.989000	0.46669	0.999000	0.98932	9.657000	0.98554	2.688000	0.91661	0.655000	0.94253	GAG	CALM3	-	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	ENSG00000160014		0.587	CALM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALM3	HGNC	protein_coding	OTTHUMT00000257483.2	-	0.00	32	0	G			47111561	+1	tier1	-	no_errors	ENST00000291295	ensembl	human	known	74_37	nonsense	15.38	33	6	SNP	1.000	T
CAND2	23066	genome.wustl.edu	37	3	12873053	12873053	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr3:12873053G>T	ENST00000456430.2	+	14	3506	c.3465G>T	c.(3463-3465)agG>agT	p.R1155S	RP11-767C1.2_ENST00000606447.1_RNA|CAND2_ENST00000295989.5_Missense_Mutation_p.R1038S	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	1155					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						AGCCACTAAGGGCCACCTGCA	0.622																																					GBM(43;676 868 1633 6395 37496)												0													38.0	40.0	40.0					3																	12873053		2025	4173	6198	SO:0001583	missense	0				CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.3465G>T	3.37:g.12873053G>T	ENSP00000387641:p.Arg1155Ser		B9EGM9|E9KL24	Missense_Mutation	SNP	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.R1155S	ENST00000456430.2	37	c.3465	CCDS54554.1	3	.	.	.	.	.	.	.	.	.	.	G	18.03	3.531608	0.64972	.	.	ENSG00000144712	ENST00000295989;ENST00000456430;ENST00000454887	T;T;T	0.66815	-0.23;-0.23;-0.23	5.14	1.86	0.25419	TATA-binding protein interacting (TIP20) (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.057727	0.64402	D	0.000004	T	0.69620	0.3131	M	0.73319	2.225	0.45962	D	0.998781	P;B	0.45768	0.866;0.161	P;B	0.51974	0.686;0.079	T	0.66440	-0.5923	10	0.44086	T	0.13	-22.9611	7.0606	0.25123	0.3857:0.0:0.6143:0.0	.	1155;1038	O75155;O75155-2	CAND2_HUMAN;.	S	1038;1155;83	ENSP00000295989:R1038S;ENSP00000387641:R1155S;ENSP00000403093:R83S	ENSP00000295989:R1038S	R	+	3	2	CAND2	12848053	0.993000	0.37304	1.000000	0.80357	0.959000	0.62525	0.345000	0.19979	0.540000	0.28808	0.591000	0.81541	AGG	CAND2	-	pfam_TATA-bd_TIP120,superfamily_ARM-type_fold	ENSG00000144712		0.622	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND2	HGNC	protein_coding	OTTHUMT00000339856.4	-	0.00	37	0	G	XM_371617		12873053	+1	tier1	-	no_errors	ENST00000456430	ensembl	human	known	74_37	missense	29.55	31	13	SNP	0.995	T
CAPZB	832	genome.wustl.edu	37	1	19683172	19683172	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:19683172G>C	ENST00000375142.1	-	6	591	c.545C>G	c.(544-546)tCt>tGt	p.S182C	CAPZB_ENST00000433834.1_Missense_Mutation_p.S211C|CAPZB_ENST00000375144.1_Missense_Mutation_p.S170C|CAPZB_ENST00000264202.6_Missense_Mutation_p.S182C|CAPZB_ENST00000401084.2_Missense_Mutation_p.S182C|CAPZB_ENST00000264203.3_Missense_Mutation_p.S208C	NM_001206540.1	NP_001193469.1	P47756	CAPZB_HUMAN	capping protein (actin filament) muscle Z-line, beta	182					actin cytoskeleton organization (GO:0030036)|barbed-end actin filament capping (GO:0051016)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|muscle fiber development (GO:0048747)|negative regulation of microtubule polymerization (GO:0031115)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)|regulation of protein kinase C signaling (GO:0090036)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|membrane (GO:0016020)|WASH complex (GO:0071203)|Z disc (GO:0030018)	actin binding (GO:0003779)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	7		Colorectal(325;3.93e-05)|Renal(390;0.000147)|all_lung(284;0.000169)|Lung NSC(340;0.000202)|Breast(348;0.000496)|Ovarian(437;0.00428)|Myeloproliferative disorder(586;0.0262)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Kidney(64;8.63e-06)|BRCA - Breast invasive adenocarcinoma(304;4.06e-05)|KIRC - Kidney renal clear cell carcinoma(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000525)|STAD - Stomach adenocarcinoma(196;0.00779)|READ - Rectum adenocarcinoma(331;0.103)|Lung(427;0.173)		GCCAGAGCCAGATTTGTTGGT	0.567																																																	0													193.0	206.0	202.0					1																	19683172		2105	4236	6341	SO:0001583	missense	0			U03271	CCDS41277.1, CCDS55579.1, CCDS72717.1, CCDS72718.1	1p36.1	2014-05-09			ENSG00000077549	ENSG00000077549			1491	protein-coding gene	gene with protein product		601572					Standard	NM_004930		Approved		uc021ohr.1	P47756	OTTHUMG00000002556	ENST00000375142.1:c.545C>G	1.37:g.19683172G>C	ENSP00000364284:p.Ser182Cys		Q32Q68|Q5U0L4|Q8TB49|Q9NUC4	Missense_Mutation	SNP	pfam_CapZ_beta,prints_CapZ_beta	p.S211C	ENST00000375142.1	37	c.632	CCDS55579.1	1	.	.	.	.	.	.	.	.	.	.	G	18.28	3.588381	0.66105	.	.	ENSG00000077549	ENST00000401084;ENST00000264203;ENST00000375144;ENST00000375142;ENST00000433834;ENST00000375145;ENST00000264202;ENST00000413711	.	.	.	5.43	5.43	0.79202	.	0.141133	0.64402	N	0.000007	T	0.53142	0.1778	L	0.28115	0.83	0.53688	D	0.999972	B;B;B;B	0.10296	0.001;0.001;0.003;0.001	B;B;B;B	0.12156	0.006;0.003;0.007;0.004	T	0.50701	-0.8797	9	0.66056	D	0.02	-14.2008	17.8626	0.88786	0.0:0.0:1.0:0.0	.	211;208;182;170	B1AK88;B1AK85;P47756-2;B1AK87	.;.;.;.	C	182;208;170;182;211;244;182;170	.	ENSP00000264202:S182C	S	-	2	0	CAPZB	19555759	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.292000	0.78731	2.571000	0.86741	0.558000	0.71614	TCT	CAPZB	-	pfam_CapZ_beta	ENSG00000077549		0.567	CAPZB-003	KNOWN	basic|CCDS	protein_coding	CAPZB	HGNC	protein_coding	OTTHUMT00000007260.1	-	0.00	56	0	G			19683172	-1	tier1	-	no_errors	ENST00000433834	ensembl	human	known	74_37	missense	7.45	87	7	SNP	1.000	C
PPT1	5538	genome.wustl.edu	37	1	40536502	40536502	+	IGR	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:40536502C>G	ENST00000433473.3	-	0	2740				CAP1_ENST00000372802.1_Intron|PPT1_ENST00000372775.2_5'Flank|CAP1_ENST00000372805.3_Intron|CAP1_ENST00000372797.3_Intron|CAP1_ENST00000372792.2_Intron|CAP1_ENST00000372798.1_Intron|CAP1_ENST00000479759.1_Intron|CAP1_ENST00000340450.3_Intron	NM_000310.3	NP_000301.1	P50897	PPT1_HUMAN	palmitoyl-protein thioesterase 1						adult locomotory behavior (GO:0008344)|associative learning (GO:0008306)|brain development (GO:0007420)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cofactor metabolic process (GO:0051186)|cofactor transport (GO:0051181)|grooming behavior (GO:0007625)|lipid catabolic process (GO:0016042)|lysosomal lumen acidification (GO:0007042)|membrane raft organization (GO:0031579)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|neuron development (GO:0048666)|neurotransmitter secretion (GO:0007269)|pinocytosis (GO:0006907)|positive regulation of pinocytosis (GO:0048549)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein catabolic process (GO:0030163)|protein depalmitoylation (GO:0002084)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|regulation of phospholipase A2 activity (GO:0032429)|regulation of synapse structure and activity (GO:0050803)|sphingolipid catabolic process (GO:0030149)|visual perception (GO:0007601)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	palmitoyl-(protein) hydrolase activity (GO:0008474)|palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(5)|large_intestine(1)|lung(3)|ovary(1)|stomach(1)	11	Lung NSC(20;3.43e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1e-18)|Epithelial(16;3.6e-17)|all cancers(16;1.1e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TTTGTTTACTCTGCAGGTAAT	0.453																																																	0													107.0	98.0	101.0					1																	40536502		1909	4142	6051	SO:0001628	intergenic_variant	0			U44772	CCDS447.1, CCDS44119.1	1p32	2014-09-17	2008-07-31		ENSG00000131238	ENSG00000131238	3.1.2.22		9325	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 1, infantile"""	600722		PPT		7637805, 8325646	Standard	NM_000310		Approved	CLN1, INCL	uc001cfb.2	P50897	OTTHUMG00000004495		1.37:g.40536502C>G			B4DY24|Q6FGQ4	RNA	SNP	-	NULL	ENST00000433473.3	37	NULL	CCDS447.1	1																																																																																			CAP1	-	-	ENSG00000131236		0.453	PPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAP1	HGNC	protein_coding	OTTHUMT00000013126.2	-	0.00	59	0	C	NM_000310		40536502	+1	tier1	-	no_errors	ENST00000494114	ensembl	human	known	74_37	rna	32.95	59	29	SNP	0.875	G
CATSPER3	347732	genome.wustl.edu	37	5	134343646	134343646	+	Splice_Site	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:134343646G>A	ENST00000282611.6	+	4	578		c.e4-1			NM_178019.2	NP_821138.1	Q86XQ3	CTSR3_HUMAN	cation channel, sperm associated 3						calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|endoplasmic reticulum (GO:0005783)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)|urinary_tract(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTGCCTTGCAGACGCTGATCA	0.607																																																	0													162.0	118.0	133.0					5																	134343646		2203	4300	6503	SO:0001630	splice_region_variant	0			AF432876	CCDS4181.1	5q31.2	2011-07-05			ENSG00000152705	ENSG00000152705		"""Voltage-gated ion channels / Cation channels, sperm associated"""	20819	protein-coding gene	gene with protein product		609120				12646162, 12932298, 17227845, 16382101	Standard	NM_178019		Approved	CACRC	uc003lag.3	Q86XQ3	OTTHUMG00000129137	ENST00000282611.6:c.493-1G>A	5.37:g.134343646G>A			Q86XS6	Splice_Site	SNP	-	e4-1	ENST00000282611.6	37	c.493-1	CCDS4181.1	5	.	.	.	.	.	.	.	.	.	.	G	10.10	1.258735	0.23051	.	.	ENSG00000152705	ENST00000282611	.	.	.	4.43	4.43	0.53597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8081	0.69974	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CATSPER3	134371545	1.000000	0.71417	0.992000	0.48379	0.037000	0.13140	5.849000	0.69465	2.395000	0.81488	0.462000	0.41574	.	CATSPER3	-	-	ENSG00000152705		0.607	CATSPER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPER3	HGNC	protein_coding	OTTHUMT00000251191.2	-	0.00	49	0	G	NM_178019	Intron	134343646	+1	tier1	-	no_errors	ENST00000282611	ensembl	human	known	74_37	splice_site	25.81	46	16	SNP	0.999	A
CCDC146	57639	genome.wustl.edu	37	7	76891437	76891437	+	Splice_Site	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:76891437G>A	ENST00000285871.4	+	9	1113		c.e9-1		CCDC146_ENST00000415740.2_Splice_Site|CCDC146_ENST00000431197.1_Splice_Site	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146											breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				ACCTGGAACAGAGGGATCTTG	0.378																																																	0													79.0	79.0	79.0					7																	76891437		2203	4300	6503	SO:0001630	splice_region_variant	0			BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.987-1G>A	7.37:g.76891437G>A			A8K8X6|Q9P223	Splice_Site	SNP	-	e8-1	ENST00000285871.4	37	c.987-1	CCDS34671.1	7	.	.	.	.	.	.	.	.	.	.	G	9.028	0.986451	0.18889	.	.	ENSG00000135205	ENST00000285871;ENST00000431197	.	.	.	5.78	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7493	0.62897	0.075:0.0:0.925:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AC007000.1	76729373	1.000000	0.71417	1.000000	0.80357	0.086000	0.17979	4.512000	0.60469	1.466000	0.48025	-0.251000	0.11542	.	CCDC146	-	-	ENSG00000135205		0.378	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC146	HGNC	protein_coding	OTTHUMT00000341449.1	-	0.00	36	0	G	NM_020879	Intron	76891437	+1	tier1	-	no_errors	ENST00000285871	ensembl	human	known	74_37	splice_site	23.91	35	11	SNP	1.000	A
CCDC27	148870	genome.wustl.edu	37	1	3673349	3673349	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:3673349G>A	ENST00000294600.2	+	4	690	c.606G>A	c.(604-606)aaG>aaA	p.K202K		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	202										breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		ACTTGCGGAAGAGGAGAAAAT	0.557																																																	0													80.0	79.0	79.0					1																	3673349		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.606G>A	1.37:g.3673349G>A			Q5TBV3|Q96M50	Missense_Mutation	SNP	NULL	p.R196K	ENST00000294600.2	37	c.587	CCDS50.1	1																																																																																			CCDC27	-	NULL	ENSG00000162592		0.557	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC27	HGNC	protein_coding	OTTHUMT00000009740.1	-	0.00	26	0	G	NM_152492		3673349	+1	tier1	-	no_errors	ENST00000462521	ensembl	human	known	74_37	missense	23.08	40	12	SNP	0.000	A
CCNYL2	414194	genome.wustl.edu	37	10	42907305	42907305	+	RNA	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr10:42907305C>T	ENST00000483242.3	-	0	1126					NR_103829.1		Q5T2Q4	CCYL2_HUMAN	cyclin Y-like 2						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)					breast(2)|endometrium(1)|lung(3)|ovary(1)	7						CTTTCCAACTCATTCCTGGGG	0.368																																																	0																																												0			BC039000		10q11.21	2007-02-09	2007-02-09	2007-02-09	ENSG00000182632	ENSG00000182632			23495	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 21"""	C10orf21			Standard	NR_103829		Approved	bA178A10.2		Q5T2Q4	OTTHUMG00000018009		10.37:g.42907305C>T				RNA	SNP	-	NULL	ENST00000483242.3	37	NULL		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	12.81|12.81	2.049809|2.049809	0.36181|0.36181	.|.	.|.	ENSG00000182632|ENSG00000182632	ENST00000426433|ENST00000431603	.|.	.|.	.|.	1.85|1.85	1.85|1.85	0.25348|0.25348	.|.	0.000000|.	0.85682|.	U|.	0.000000|.	T|T	0.55065|0.55065	0.1897|0.1897	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999999|0.999999	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.51252|0.51252	-0.8729|-0.8729	6|4	0.32370|.	T|.	0.25|.	.|.	7.2613|7.2613	0.26205|0.26205	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	K|I	273|198	.|.	ENSP00000395902:E273K|.	E|M	-|-	1|3	0|0	CCNYL2|CCNYL2	42227311|42227311	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.703000|0.703000	0.40648|0.40648	7.060000|7.060000	0.76692|0.76692	1.351000|1.351000	0.45789|0.45789	0.298000|0.298000	0.19748|0.19748	GAG|ATG	CCNYL2	-	-	ENSG00000182632		0.368	CCNYL2-002	KNOWN	basic	processed_transcript	CCNYL2	HGNC	pseudogene	OTTHUMT00000047670.5	-	0.00	108	0	C	XM_936368		42907305	-1	tier1	-	no_errors	ENST00000483242	ensembl	human	known	74_37	rna	14.29	72	12	SNP	1.000	T
CD151	977	genome.wustl.edu	37	11	836150	836150	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:836150C>A	ENST00000397420.3	+	3	330	c.81C>A	c.(79-81)ttC>ttA	p.F27L	CD151_ENST00000528011.1_Missense_Mutation_p.F27L|CD151_ENST00000322008.4_Missense_Mutation_p.F27L|CD151_ENST00000397421.1_Missense_Mutation_p.F27L			P48509	CD151_HUMAN	CD151 molecule (Raph blood group)	27					cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|T cell proliferation (GO:0042098)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	3		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;1.54e-25)|Epithelial(43;1.22e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.91e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ATTGCTGCTTCTGGGTGAGGA	0.592																																					Esophageal Squamous(14;501 559 15826 37823 38305)												0													107.0	89.0	95.0					11																	836150		2197	4296	6493	SO:0001583	missense	0			AL161965, BC013302, D29963	CCDS7719.1	11p15.5	2014-07-18	2006-03-28		ENSG00000177697	ENSG00000177697		"""CD molecules"", ""Blood group antigens"", ""Tetraspanins"""	1630	protein-coding gene	gene with protein product		602243	"""CD151 antigen"", ""CD151 antigen (Raph blood group)"""			9070943	Standard	NM_004357		Approved	SFA-1, PETA-3, TSPAN24, RAPH	uc001lsb.3	P48509	OTTHUMG00000133311	ENST00000397420.3:c.81C>A	11.37:g.836150C>A	ENSP00000380565:p.Phe27Leu		A8KAK8|E9PI15|Q14826|Q86U54|Q96TE3	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.F27L	ENST00000397420.3	37	c.81	CCDS7719.1	11	.	.	.	.	.	.	.	.	.	.	C	13.33	2.204621	0.38905	.	.	ENSG00000177697	ENST00000397420;ENST00000525718;ENST00000322008;ENST00000397421;ENST00000529810;ENST00000528143;ENST00000526693;ENST00000525333;ENST00000524748;ENST00000527341;ENST00000528867;ENST00000530320;ENST00000526439;ENST00000528011	T;T;T;T;T;T;T;T;T;T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43;-1.43;-1.43;-1.43;-1.43;-1.43;-1.43;-1.43;-1.43;-1.43	4.93	4.02	0.46733	.	0.000000	0.85682	D	0.000000	D	0.85048	0.5608	M	0.80183	2.485	0.80722	D	1	B	0.30889	0.299	B	0.43018	0.405	D	0.84588	0.0665	10	0.45353	T	0.12	.	13.5808	0.61901	0.0:0.9242:0.0:0.0758	.	27	P48509	CD151_HUMAN	L	27	ENSP00000380565:F27L;ENSP00000435854:F27L;ENSP00000324101:F27L;ENSP00000380566:F27L;ENSP00000432258:F27L;ENSP00000435054:F27L;ENSP00000431671:F27L;ENSP00000431403:F27L;ENSP00000436591:F27L;ENSP00000433752:F27L;ENSP00000433787:F27L;ENSP00000434663:F27L;ENSP00000432990:F27L	ENSP00000324101:F27L	F	+	3	2	CD151	826150	1.000000	0.71417	1.000000	0.80357	0.027000	0.11550	2.388000	0.44398	1.313000	0.45069	-0.254000	0.11334	TTC	CD151	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	ENSG00000177697		0.592	CD151-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD151	HGNC	protein_coding	OTTHUMT00000257108.1	-	0.00	43	0	C	NM_004357		836150	+1	tier1	-	no_errors	ENST00000322008	ensembl	human	known	74_37	missense	18.18	27	6	SNP	1.000	A
CDC27	996	genome.wustl.edu	37	17	45234325	45234325	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:45234325G>A	ENST00000066544.3	-	7	889	c.796C>T	c.(796-798)Cga>Tga	p.R266*	CDC27_ENST00000446365.2_Nonsense_Mutation_p.R205*|CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000527547.1_Nonsense_Mutation_p.R266*|CDC27_ENST00000531206.1_Nonsense_Mutation_p.R266*	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	266					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						AATAAACTTCGACCAGTTTTT	0.363																																																	0													60.0	65.0	63.0					17																	45234325		2200	4295	6495	SO:0001587	stop_gained	0			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.796C>T	17.37:g.45234325G>A	ENSP00000066544:p.Arg266*		G3V1C4|Q16349|Q96F35	Nonsense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R266*	ENST00000066544.3	37	c.796	CCDS11509.1	17	.	.	.	.	.	.	.	.	.	.	G	21.2	4.117088	0.77323	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	.	.	.	5.64	4.66	0.58398	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.5002	13.5956	0.61987	0.0:0.0:0.8433:0.1567	.	.	.	.	X	266;266;205;266;266	.	ENSP00000066544:R266X	R	-	1	2	CDC27	42589324	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.123000	0.71614	1.354000	0.45846	0.460000	0.39030	CGA	CDC27	-	NULL	ENSG00000004897		0.363	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	HGNC	protein_coding	OTTHUMT00000389742.2	-	0.00	43	0	G			45234325	-1	tier1	-	no_errors	ENST00000531206	ensembl	human	known	74_37	nonsense	11.11	40	5	SNP	1.000	A
CEACAM6	4680	genome.wustl.edu	37	19	42265341	42265341	+	Silent	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:42265341C>G	ENST00000199764.6	+	3	827	c.609C>G	c.(607-609)ctC>ctG	p.L203L	AC011513.4_ENST00000601409.1_RNA	NM_002483.4	NP_002474.3	P40199	CEAM6_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen)	203	Ig-like C2-type 1.				cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|kidney(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(3;0.00575)|all cancers(3;0.0352)|Epithelial(262;0.0797)		TCACTCTACTCAGCGTCAAAA	0.532																																																	0													229.0	210.0	217.0					19																	42265341		2203	4300	6503	SO:0001819	synonymous_variant	0			M29541	CCDS12585.1	19q13.1-q13.2	2013-01-29			ENSG00000086548	ENSG00000086548		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1818	protein-coding gene	gene with protein product		163980		NCA			Standard	NM_002483		Approved	CD66c	uc002orm.2	P40199	OTTHUMG00000151064	ENST00000199764.6:c.609C>G	19.37:g.42265341C>G			Q13774|Q14920|Q53XP7	Silent	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L203	ENST00000199764.6	37	c.609	CCDS12585.1	19																																																																																			CEACAM6	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000086548		0.532	CEACAM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEACAM6	HGNC	protein_coding	OTTHUMT00000321147.1	-	0.00	161	0	C			42265341	+1	tier1	-	no_errors	ENST00000199764	ensembl	human	known	74_37	silent	26.94	179	66	SNP	0.423	G
CENPC	1060	genome.wustl.edu	37	4	68378268	68378268	+	Silent	SNP	A	A	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr4:68378268A>C	ENST00000273853.6	-	9	1714	c.1464T>G	c.(1462-1464)acT>acG	p.T488T		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	488					chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)										TATCTTTTCTAGTGCTACTTT	0.333																																																	0													79.0	65.0	69.0					4																	68378268		1797	4060	5857	SO:0001819	synonymous_variant	0			M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.1464T>G	4.37:g.68378268A>C			Q8IW27|Q9P0M5	Silent	SNP	pfam_Mif2/CENP-C_cupin,pfam_Cupin_2,superfamily_RmlC_Cupin	p.T488	ENST00000273853.6	37	c.1464	CCDS47063.1	4																																																																																			CENPC	-	NULL	ENSG00000145241		0.333	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPC	HGNC	protein_coding	OTTHUMT00000362001.2	-	0.00	25	0	A			68378268	-1	tier1	-	no_errors	ENST00000273853	ensembl	human	known	74_37	silent	19.35	25	6	SNP	0.000	C
CERS5	91012	genome.wustl.edu	37	12	50524336	50524336	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:50524336C>T	ENST00000317551.6	-	10	1295	c.1171G>A	c.(1171-1173)Gaa>Aaa	p.E391K	CERS5_ENST00000422340.2_Missense_Mutation_p.E333K	NM_147190.2	NP_671723.1	Q8N5B7	CERS5_HUMAN	ceramide synthase 5	391					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										CCTTACTCTTCAGCCCAGTAG	0.517																																																	0													232.0	190.0	204.0					12																	50524336		2203	4300	6503	SO:0001583	missense	0				CCDS8801.1, CCDS61120.1	12q13.12	2014-09-04	2011-07-08	2011-07-08	ENSG00000139624			"""Homeoboxes / CERS class"""	23749	protein-coding gene	gene with protein product		615335	"""LAG1 longevity assurance homolog 5 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 5"""	LASS5			Standard	NM_147190		Approved	Trh4, MGC45411, FLJ25304	uc001rwd.4	Q8N5B7	OTTHUMG00000169819	ENST00000317551.6:c.1171G>A	12.37:g.50524336C>T	ENSP00000325485:p.Glu391Lys		B4DV54	Missense_Mutation	SNP	pfam_TLC-dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_TLC-dom,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_TLC-dom,pfscan_Homeobox_dom	p.E391K	ENST00000317551.6	37	c.1171	CCDS8801.1	12	.	.	.	.	.	.	.	.	.	.	C	24.5	4.541848	0.85917	.	.	ENSG00000139624	ENST00000317551;ENST00000422340	T;T	0.12879	2.83;2.64	5.11	4.16	0.48862	.	0.578885	0.17809	N	0.161269	T	0.23410	0.0566	M	0.75447	2.3	0.47065	D	0.999303	P;P	0.49635	0.926;0.819	P;B	0.44394	0.448;0.334	T	0.08680	-1.0710	10	0.62326	D	0.03	-7.2735	16.5011	0.84256	0.0:0.8691:0.1309:0.0	.	333;391	B4DV54;Q8N5B7	.;CERS5_HUMAN	K	391;333	ENSP00000325485:E391K;ENSP00000389050:E333K	ENSP00000325485:E391K	E	-	1	0	CERS5	48810603	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.601000	0.46249	2.832000	0.97577	0.655000	0.94253	GAA	CERS5	-	NULL	ENSG00000139624		0.517	CERS5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CERS5	HGNC	protein_coding	OTTHUMT00000406069.3	-	0.00	58	0	C	NM_147190		50524336	-1	tier1	-	no_errors	ENST00000317551	ensembl	human	known	74_37	missense	21.54	51	14	SNP	1.000	T
CFTR	1080	genome.wustl.edu	37	7	117227862	117227862	+	Missense_Mutation	SNP	C	C	G	rs397508253|rs76554633		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:117227862C>G	ENST00000003084.6	+	12	1786	c.1654C>G	c.(1654-1656)Caa>Gaa	p.Q552E	CFTR_ENST00000454343.1_Missense_Mutation_p.Q491E	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	552	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	GAGTGGAGGTCAACGAGCAAG	0.348									Cystic Fibrosis																																								0			GRCh37	CM910072|CM962464	CFTR	M	rs76554633						105.0	105.0	105.0					7																	117227862		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	CF	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.1654C>G	7.37:g.117227862C>G	ENSP00000003084:p.Gln552Glu		Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM,tigrfam_cAMP_cl_channel	p.Q552E	ENST00000003084.6	37	c.1654	CCDS5773.1	7	.	.	.	.	.	.	.	.	.	.	C	29.1	4.975277	0.92919	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.91740	-2.9;-2.9;-2.9	5.27	5.27	0.74061	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.95544	0.8552	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95756	0.8796	10	0.87932	D	0	-11.9227	19.2582	0.93955	0.0:1.0:0.0:0.0	.	552	P13569	CFTR_HUMAN	E	552;491;522	ENSP00000003084:Q552E;ENSP00000403677:Q491E;ENSP00000389119:Q522E	ENSP00000003084:Q552E	Q	+	1	0	CFTR	117015098	1.000000	0.71417	0.956000	0.39512	0.986000	0.74619	6.901000	0.75693	2.622000	0.88805	0.655000	0.94253	CAA	CFTR	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_cAMP_cl_channel	ENSG00000001626		0.348	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFTR	HGNC	protein_coding	OTTHUMT00000059397.3		0.00	31	0	C	NM_000492		117227862	+1			no_errors	ENST00000003084	ensembl	human	known	74_37	missense	18.18	18	4	SNP	1.000	G
CHRM4	1132	genome.wustl.edu	37	11	46407355	46407355	+	Silent	SNP	C	C	T	rs201352810		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:46407355C>T	ENST00000433765.2	-	1	752	c.753G>A	c.(751-753)aaG>aaA	p.K251K		NM_000741.2	NP_000732.2	P08173	ACM4_HUMAN	cholinergic receptor, muscarinic 4	251					adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway (GO:0007197)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|regulation of locomotion (GO:0040012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			breast(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	20				GBM - Glioblastoma multiforme(35;0.0254)|Lung(87;0.14)	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Darifenacin(DB00496)|Desipramine(DB01151)|Doxepin(DB01142)|Fesoterodine(DB06702)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paroxetine(DB00715)|Pethidine(DB00454)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Tolterodine(DB01036)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TGACGCTCTGCTTCATTAGTG	0.697																																					Esophageal Squamous(171;1020 1936 4566 30205 42542)												0								C		0,3826		0,0,1913	17.0	18.0	17.0		753	3.4	1.0	11		17	2,8224		0,2,4111	no	coding-synonymous	CHRM4	NM_000741.2		0,2,6024	TT,TC,CC		0.0243,0.0,0.0166		251/480	46407355	2,12050	1913	4113	6026	SO:0001819	synonymous_variant	0			M16405	CCDS44581.1	11p12-p11.2	2012-08-08			ENSG00000180720	ENSG00000180720		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1953	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 4"""	118495				1577490	Standard	NM_000741		Approved		uc001nct.1	P08173	OTTHUMG00000154371	ENST00000433765.2:c.753G>A	11.37:g.46407355C>T			B2RPP4|Q0VD60|Q4VBK7	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_rcpt,prints_GPCR_Rhodpsn,prints_Musac_Ach_M4_rcpt	p.K251	ENST00000433765.2	37	c.753	CCDS44581.1	11																																																																																			CHRM4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000180720		0.697	CHRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM4	HGNC	protein_coding	OTTHUMT00000334985.1	-	0.00	57	0	C	NM_000741		46407355	-1	tier1	rs201352810	no_errors	ENST00000433765	ensembl	human	known	74_37	silent	23.26	66	20	SNP	1.000	T
CHRND	1144	genome.wustl.edu	37	2	233394716	233394716	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:233394716C>A	ENST00000258385.3	+	7	719	c.687C>A	c.(685-687)gaC>gaA	p.D229E	CHRND_ENST00000543200.1_Missense_Mutation_p.D214E|CHRND_ENST00000457943.2_Intron|CHRND_ENST00000536614.1_Missense_Mutation_p.Q193K	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	229					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	CCCCTCTGGACAGCCCCAGCC	0.617																																																	0													129.0	112.0	118.0					2																	233394716		2203	4300	6503	SO:0001583	missense	0			X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.687C>A	2.37:g.233394716C>A	ENSP00000258385:p.Asp229Glu		A8K661|B4DT92|Q52LH4	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.D229E	ENST00000258385.3	37	c.687	CCDS2494.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.422|9.422	1.083323|1.083323	0.20309|0.20309	.|.	.|.	ENSG00000135902|ENSG00000135902	ENST00000543200;ENST00000258385|ENST00000536614	T;T|T	0.78707|0.72167	-1.2;-1.2|-0.63	5.02|5.02	5.02|5.02	0.67125|0.67125	Neurotransmitter-gated ion-channel ligand-binding (3);|.	0.240323|.	0.41294|.	D|.	0.000910|.	T|T	0.59905|0.59905	0.2228|0.2228	N|N	0.12527|0.12527	0.23|0.23	0.80722|0.80722	D|D	1|1	B;B;B|.	0.15719|.	0.014;0.0;0.0|.	B;B;B|.	0.16289|.	0.015;0.002;0.002|.	T|T	0.57991|0.57991	-0.7715|-0.7715	10|7	0.13108|0.22706	T|T	0.6|0.39	.|.	15.1505|15.1505	0.72692|0.72692	0.0:0.7177:0.2823:0.0|0.0:0.7177:0.2823:0.0	.|.	214;229;229|.	B4DT92;A8K661;Q07001|.	.;.;ACHD_HUMAN|.	E|K	214;229|193	ENSP00000438380:D214E;ENSP00000258385:D229E|ENSP00000437740:Q193K	ENSP00000258385:D229E|ENSP00000408819:Q193K	D|Q	+|+	3|1	2|0	CHRND|CHRND	233102960|233102960	0.937000|0.937000	0.31787|0.31787	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	-0.002000|-0.002000	0.12924|0.12924	2.522000|2.522000	0.85027|0.85027	0.655000|0.655000	0.94253|0.94253	GAC|CAG	CHRND	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000135902		0.617	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRND	HGNC	protein_coding	OTTHUMT00000257038.2	-	0.00	64	0	C			233394716	+1	tier1	-	no_errors	ENST00000258385	ensembl	human	known	74_37	missense	18.18	45	10	SNP	1.000	A
CHST6	4166	genome.wustl.edu	37	16	75512762	75512762	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:75512762G>A	ENST00000332272.4	-	3	1144	c.965C>T	c.(964-966)tCg>tTg	p.S322L	CHST6_ENST00000390664.2_Missense_Mutation_p.S322L|RP11-77K12.4_ENST00000530512.3_RNA	NM_021615.4	NP_067628.1	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6	322					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						ATTCCTGGACGAAGTCTTGAA	0.642																																																	0													70.0	62.0	65.0					16																	75512762		2198	4300	6498	SO:0001583	missense	0			AF280086	CCDS10918.1	16q22	2008-02-05			ENSG00000183196	ENSG00000183196		"""Sulfotransferases, membrane-bound"""	6938	protein-coding gene	gene with protein product		605294		MCDC1		8644739, 11017086	Standard	NM_021615		Approved		uc002fef.3	Q9GZX3	OTTHUMG00000137612	ENST00000332272.4:c.965C>T	16.37:g.75512762G>A	ENSP00000328983:p.Ser322Leu		D3DUK3	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	p.S322L	ENST00000332272.4	37	c.965	CCDS10918.1	16	.	.	.	.	.	.	.	.	.	.	G	16.47	3.132558	0.56828	.	.	ENSG00000183196	ENST00000332272;ENST00000390664	D;D	0.99751	-6.63;-6.63	4.73	4.73	0.59995	Sulfotransferase domain (1);	0.177731	0.49305	D	0.000159	D	0.99058	0.9677	L	0.52011	1.625	0.31771	N	0.632165	B	0.24721	0.11	B	0.27887	0.084	D	0.99986	1.3365	10	0.51188	T	0.08	.	15.1951	0.73081	0.0:0.0:1.0:0.0	.	322	Q9GZX3	CHST6_HUMAN	L	322	ENSP00000328983:S322L;ENSP00000375079:S322L	ENSP00000328983:S322L	S	-	2	0	CHST6	74070263	1.000000	0.71417	0.999000	0.59377	0.929000	0.56500	4.468000	0.60162	2.194000	0.70268	0.591000	0.81541	TCG	CHST6	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	ENSG00000183196		0.642	CHST6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CHST6	HGNC	protein_coding	OTTHUMT00000435478.1	-	0.00	58	0	G	NM_021615		75512762	-1	tier1	-	no_errors	ENST00000332272	ensembl	human	known	74_37	missense	14.29	78	13	SNP	1.000	A
CHSY3	337876	genome.wustl.edu	37	5	129520357	129520357	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:129520357G>C	ENST00000305031.4	+	3	1880	c.1522G>C	c.(1522-1524)Gag>Cag	p.E508Q		NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	508					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		GATGATCAATGAGAATGCCAA	0.488																																																	0													67.0	64.0	65.0					5																	129520357		2203	4300	6503	SO:0001583	missense	0			AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.1522G>C	5.37:g.129520357G>C	ENSP00000302629:p.Glu508Gln		B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	pfam_Chond_GalNAc,pfam_Fringe-like	p.E508Q	ENST00000305031.4	37	c.1522	CCDS34223.1	5	.	.	.	.	.	.	.	.	.	.	G	14.38	2.517454	0.44763	.	.	ENSG00000198108	ENST00000305031	T	0.15718	2.4	4.38	4.38	0.52667	.	0.000000	0.64402	D	0.000014	T	0.25827	0.0629	L	0.53249	1.67	0.58432	D	0.999996	P	0.48230	0.907	P	0.48063	0.565	T	0.01301	-1.1391	9	.	.	.	-7.7253	18.2607	0.90034	0.0:0.0:1.0:0.0	.	508	Q70JA7	CHSS3_HUMAN	Q	508	ENSP00000302629:E508Q	.	E	+	1	0	CHSY3	129548256	1.000000	0.71417	0.998000	0.56505	0.958000	0.62258	7.726000	0.84824	2.708000	0.92522	0.650000	0.86243	GAG	CHSY3	-	pfam_Chond_GalNAc	ENSG00000198108		0.488	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHSY3	HGNC	protein_coding	OTTHUMT00000371453.1	-	0.00	25	0	G	NM_175856		129520357	+1	tier1	-	no_errors	ENST00000305031	ensembl	human	known	74_37	missense	11.76	45	6	SNP	1.000	C
CLCNKA	1187	genome.wustl.edu	37	1	16360424	16360424	+	3'UTR	SNP	G	G	C	rs58783141		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:16360424G>C	ENST00000331433.4	+	0	2354				CLCNKA_ENST00000464764.1_3'UTR|CLCNKA_ENST00000420078.1_3'UTR|CLCNKA_ENST00000375692.1_3'UTR			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka						excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	TCAGTGACTGGCCATCACATT	0.522																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.*271G>C	1.37:g.16360424G>C			B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	RNA	SNP	-	NULL	ENST00000331433.4	37	NULL	CCDS167.1	1																																																																																			CLCNKA	-	-	ENSG00000186510		0.522	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLCNKA	HGNC	protein_coding	OTTHUMT00000026326.1	-	0.00	48	0	G			16360424	+1	tier1	rs58783141	no_errors	ENST00000464764	ensembl	human	known	74_37	rna	17.46	52	11	SNP	0.000	C
CLP1	10978	genome.wustl.edu	37	11	57428246	57428246	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:57428246C>T	ENST00000302731.4	+	3	544	c.424C>T	c.(424-426)Cgt>Tgt	p.R142C	CLP1_ENST00000525602.1_Missense_Mutation_p.R206C|CLP1_ENST00000529430.1_Missense_Mutation_p.R217C|CLP1_ENST00000533682.1_Missense_Mutation_p.R206C	NM_001142597.1|NM_006831.2	NP_001136069.1|NP_006822.1	Q5KU26	COL12_HUMAN	cleavage and polyadenylation factor I subunit 1	0					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|stomach(1)	15						GATTACATCTCGTTTAGCAGA	0.438																																																	0													101.0	97.0	99.0					11																	57428246		2201	4296	6497	SO:0001583	missense	0			BC000446	CCDS7964.1, CCDS44600.1	11q12.1	2012-10-02	2012-10-02		ENSG00000172409	ENSG00000172409	2.7.1.78		16999	protein-coding gene	gene with protein product	"""ATP/GTPbinding protein"", ""polyribonucleotide 5'-hydroxyl-kinase"""	608757	"""CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)"""			8896421, 11060040	Standard	NM_006831		Approved	HEAB, hClp1	uc001nkw.3	Q92989	OTTHUMG00000167146	ENST00000302731.4:c.424C>T	11.37:g.57428246C>T	ENSP00000304704:p.Arg142Cys		Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	pfam_Pre-mRNA_cleavage_cplxII_Clp1,superfamily_P-loop_NTPase	p.R206C	ENST00000302731.4	37	c.616	CCDS44600.1	11	.	.	.	.	.	.	.	.	.	.	c	13.52	2.262061	0.39995	.	.	ENSG00000172409	ENST00000529430;ENST00000533682;ENST00000525602;ENST00000302731	T;T;T;T	0.49139	0.79;0.79;0.79;0.97	6.05	5.14	0.70334	.	0.092787	0.85682	D	0.000000	T	0.43809	0.1264	L	0.46157	1.445	0.80722	D	1	B;B	0.13145	0.005;0.007	B;B	0.15484	0.001;0.013	T	0.32268	-0.9913	10	0.51188	T	0.08	-20.5558	14.9414	0.70997	0.0:0.9313:0.0:0.0687	.	142;206	Q92989-2;Q92989	.;CLP1_HUMAN	C	217;206;206;142	ENSP00000433406:R217C;ENSP00000434995:R206C;ENSP00000436066:R206C;ENSP00000304704:R142C	ENSP00000304704:R142C	R	+	1	0	CLP1	57184822	0.996000	0.38824	0.672000	0.29872	0.990000	0.78478	3.095000	0.50235	1.586000	0.49944	0.645000	0.84053	CGT	CLP1	-	superfamily_P-loop_NTPase	ENSG00000172409		0.438	CLP1-003	NOVEL	basic|exp_conf|CCDS	protein_coding	CLP1	HGNC	protein_coding	OTTHUMT00000393465.1	-	0.00	68	0	C	NM_006831		57428246	+1	tier1	-	no_errors	ENST00000525602	ensembl	human	known	74_37	missense	12.28	100	14	SNP	0.960	T
CMAHP	8418	genome.wustl.edu	37	6	25093789	25093789	+	RNA	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:25093789C>G	ENST00000377989.4	-	0	1797							Q9Y471	CMAH_HUMAN	cytidine monophospho-N-acetylneuraminic acid hydroxylase, pseudogene						CMP-N-acetylneuraminate metabolic process (GO:0046381)	cytoplasm (GO:0005737)	2 iron, 2 sulfur cluster binding (GO:0051537)|oxidoreductase activity (GO:0016491)			NS(1)	1						GTGAAGTATTCTTTTATCCAG	0.358																																																	0																																												0					6p23-p22	2011-04-28	2011-04-28	2011-04-28	ENSG00000168405	ENSG00000168405			2098	pseudogene	pseudogene		603209	"""cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMP-N-acetylneuraminate monooxygenase)(pseudogene)"""	CMAH		7608218, 9624188	Standard	NR_002174		Approved		uc003ner.4	Q9Y471	OTTHUMG00000016099		6.37:g.25093789C>G			O95250|Q5TD41|Q5TD42|Q5TD43|Q5TD44|Q68DC3|Q9UEE7	RNA	SNP	-	NULL	ENST00000377989.4	37	NULL		6	.	.	.	.	.	.	.	.	.	.	C	16.19	3.051831	0.55218	.	.	ENSG00000168405	ENST00000377993;ENST00000436589;ENST00000377989	.	.	.	4.85	4.85	0.62838	.	0.224768	0.36893	N	0.002356	T	0.38081	0.1027	.	.	.	0.80722	D	1	B	0.24533	0.105	B	0.22880	0.042	T	0.24083	-1.0170	8	0.27082	T	0.32	-17.2716	16.9064	0.86130	0.0:1.0:0.0:0.0	.	356	C1K3L2	.	Q	356	.	ENSP00000367228:E356Q	E	-	1	0	CMAHP	25201768	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.173000	0.50839	2.505000	0.84491	0.508000	0.49915	GAA	CMAHP	-	-	ENSG00000168405		0.358	CMAHP-002	KNOWN	basic	processed_transcript	CMAHP	HGNC	pseudogene	OTTHUMT00000043292.2	-	0.00	48	0	C	NR_002174		25093789	-1	tier1	-	no_errors	ENST00000377989	ensembl	human	known	74_37	rna	30.61	34	15	SNP	1.000	G
CNGB1	1258	genome.wustl.edu	37	16	58001173	58001173	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:58001173C>G	ENST00000251102.8	-	2	78	c.18G>C	c.(16-18)caG>caC	p.Q6H	CNGB1_ENST00000311183.4_Missense_Mutation_p.Q6H|CNGB1_ENST00000564448.1_Missense_Mutation_p.Q6H	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	6					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						GCAGCACCCTCTGGACCCAGC	0.602																																					Colon(156;1293 1853 16336 28962 38659)												0													61.0	62.0	62.0					16																	58001173		1937	4139	6076	SO:0001583	missense	0			AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.18G>C	16.37:g.58001173C>G	ENSP00000251102:p.Gln6His		H3BN09|O43636|Q13059|Q14029|Q9UMG2	Missense_Mutation	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.Q6H	ENST00000251102.8	37	c.18	CCDS42169.1	16	.	.	.	.	.	.	.	.	.	.	C	16.35	3.099774	0.56183	.	.	ENSG00000070729	ENST00000251102;ENST00000311183	D;T	0.96830	-4.14;0.87	5.06	3.07	0.35406	.	0.000000	0.36778	N	0.002405	D	0.96137	0.8741	L	0.43923	1.385	0.24101	N	0.995871	D;D	0.71674	0.998;0.995	D;P	0.73380	0.98;0.908	D	0.90204	0.4259	10	0.87932	D	0	.	7.3697	0.26794	0.0:0.7922:0.0:0.2078	.	6;6	Q14028-3;Q14028	.;CNGB1_HUMAN	H	6	ENSP00000251102:Q6H;ENSP00000311670:Q6H	ENSP00000251102:Q6H	Q	-	3	2	CNGB1	56558674	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	0.642000	0.24735	0.620000	0.30215	0.448000	0.29417	CAG	CNGB1	-	NULL	ENSG00000070729		0.602	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGB1	HGNC	protein_coding	OTTHUMT00000337167.2	-	0.00	68	0	C	NM_001297		58001173	-1	tier1	-	no_errors	ENST00000251102	ensembl	human	known	74_37	missense	12.00	66	9	SNP	1.000	G
CP	1356	genome.wustl.edu	37	3	148896253	148896253	+	Missense_Mutation	SNP	C	C	T	rs571448440		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr3:148896253C>T	ENST00000264613.6	-	16	3089	c.2827G>A	c.(2827-2829)Gag>Aag	p.E943K		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	943	F5/8 type A 3.|Plastocyanin-like 6.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	TTTACTTTCTCGGGGTGATCA	0.323													C|||	1	0.000199681	0.0	0.0	5008	,	,		19234	0.001		0.0	False		,,,				2504	0.0																0													122.0	115.0	117.0					3																	148896253		2202	4300	6502	SO:0001583	missense	0			M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.2827G>A	3.37:g.148896253C>T	ENSP00000264613:p.Glu943Lys		Q14063|Q2PP18|Q9UKS4	Missense_Mutation	SNP	pfam_Cu-oxidase_2,pfam_Cu-oxidase_3,pfam_Cu-oxidase,superfamily_Cupredoxin	p.E943K	ENST00000264613.6	37	c.2827	CCDS3141.1	3	.	.	.	.	.	.	.	.	.	.	C	9.959	1.222300	0.22457	.	.	ENSG00000047457	ENST00000479771;ENST00000264613;ENST00000494544	D;D;D	0.98602	-5.02;-5.02;-5.02	5.68	3.88	0.44766	Cupredoxin (2);	0.433490	0.27016	N	0.021351	D	0.93442	0.7908	N	0.25245	0.725	0.09310	N	1	B;B;B;B	0.19706	0.038;0.038;0.009;0.001	B;B;B;B	0.15870	0.014;0.014;0.006;0.004	T	0.82697	-0.0329	10	0.07325	T	0.83	-18.8381	9.1893	0.37189	0.0:0.7318:0.1276:0.1405	.	943;943;943;656	A8K5A4;P00450;Q1L857;B3KTA8	.;CERU_HUMAN;.;.	K	78;943;726	ENSP00000420367:E78K;ENSP00000264613:E943K;ENSP00000420545:E726K	ENSP00000264613:E943K	E	-	1	0	CP	150378943	0.794000	0.28838	0.979000	0.43373	0.939000	0.58152	2.187000	0.42602	1.412000	0.46977	0.650000	0.86243	GAG	CP	-	pfam_Cu-oxidase,superfamily_Cupredoxin	ENSG00000047457		0.323	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CP	HGNC	protein_coding	OTTHUMT00000317498.1	-	0.00	38	0	C	NM_000096		148896253	-1	tier1	-	no_errors	ENST00000264613	ensembl	human	known	74_37	missense	17.44	71	15	SNP	0.020	T
CREB3L1	90993	genome.wustl.edu	37	11	46331554	46331554	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:46331554G>C	ENST00000529193.1	+	4	982	c.531G>C	c.(529-531)atG>atC	p.M177I	CREB3L1_ENST00000288400.3_Missense_Mutation_p.M177I			Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like 1	177					regulation of bone mineralization (GO:0030500)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)		FUS/CREB3L1(6)	NS(2)|breast(1)|large_intestine(4)|lung(2)|ovary(3)	12				GBM - Glioblastoma multiforme(35;0.0285)		CGGGAGAGATGACTCAGCTGC	0.592			T	FUS	myxofibrosarcoma																																Pancreas(3;159 194 19597 26278 47995)			Dom	yes		11	11p11.2	90993	cAMP responsive element binding protein 3-like 1		M	0													41.0	47.0	45.0					11																	46331554		1975	4155	6130	SO:0001583	missense	0				CCDS53620.1	11q11	2013-01-10				ENSG00000157613		"""basic leucine zipper proteins"""	18856	protein-coding gene	gene with protein product	"""BBF-2 homolog (drosophila)"""						Standard	NM_052854		Approved	OASIS	uc021qil.1	Q96BA8		ENST00000529193.1:c.531G>C	11.37:g.46331554G>C	ENSP00000434939:p.Met177Ile		Q8N2D5|Q96CP0	Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_CREB	p.M177I	ENST00000529193.1	37	c.531	CCDS53620.1	11	.	.	.	.	.	.	.	.	.	.	G	11.76	1.734956	0.30774	.	.	ENSG00000157613	ENST00000529193;ENST00000288400	T;T	0.63255	-0.03;-0.03	4.45	4.45	0.53987	.	0.282115	0.36101	N	0.002789	T	0.52500	0.1738	L	0.43152	1.355	0.32813	D	0.501659	B	0.12013	0.005	B	0.08055	0.003	T	0.59778	-0.7390	10	0.37606	T	0.19	-20.6822	12.2334	0.54500	0.0:0.0:0.8309:0.1691	.	177	Q96BA8	CR3L1_HUMAN	I	177	ENSP00000434939:M177I;ENSP00000288400:M177I	ENSP00000288400:M177I	M	+	3	0	CREB3L1	46288130	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.103000	0.31062	2.333000	0.79357	0.561000	0.74099	ATG	CREB3L1	-	NULL	ENSG00000157613		0.592	CREB3L1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	CREB3L1	HGNC	protein_coding	OTTHUMT00000389702.1	-	0.00	26	0	G	NM_052854		46331554	+1	tier1	-	no_errors	ENST00000288400	ensembl	human	known	74_37	missense	31.71	28	13	SNP	1.000	C
CREBRF	153222	genome.wustl.edu	37	5	172550174	172550174	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:172550174G>C	ENST00000296953.2	+	8	2092	c.1773G>C	c.(1771-1773)caG>caC	p.Q591H	CREBRF_ENST00000540014.1_Missense_Mutation_p.Q593H	NM_153607.2	NP_705835.2	Q8IUR6	CRERF_HUMAN	CREB3 regulatory factor	591					negative regulation of endoplasmic reticulum unfolded protein response (GO:1900102)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular transport (GO:0032388)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein transport (GO:0051222)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										ACATGGGGCAGAAGCTTGAAA	0.353																																																	0													92.0	106.0	101.0					5																	172550174		2203	4300	6503	SO:0001583	missense	0			AY139008	CCDS34293.1, CCDS54948.1	5q35.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164463	ENSG00000164463			24050	protein-coding gene	gene with protein product	"""luman/CREB3 recruitment factor"""		"""chromosome 5 open reading frame 41"""	C5orf41		18391022	Standard	NM_153607		Approved	LRF	uc003mch.3	Q8IUR6	OTTHUMG00000163322	ENST00000296953.2:c.1773G>C	5.37:g.172550174G>C	ENSP00000296953:p.Gln591His		B3DFH2|B3KW49|D3DQM2|F5GXN3|Q5HYG4|Q5HYK0|Q86YR3|Q8IZG1	Missense_Mutation	SNP	NULL	p.Q593H	ENST00000296953.2	37	c.1779	CCDS34293.1	5	.	.	.	.	.	.	.	.	.	.	G	19.06	3.753908	0.69648	.	.	ENSG00000164463	ENST00000296953;ENST00000540014;ENST00000538538;ENST00000393776	T;T	0.23348	1.91;1.91	5.3	4.43	0.53597	.	0.112837	0.64402	D	0.000009	T	0.24699	0.0599	N	0.19112	0.55	0.52501	D	0.999955	D	0.60160	0.987	P	0.52217	0.693	T	0.02326	-1.1176	10	0.46703	T	0.11	.	11.3201	0.49417	0.1519:0.0:0.8481:0.0	.	591	Q8IUR6	CE041_HUMAN	H	591;593;591;591	ENSP00000296953:Q591H;ENSP00000440075:Q593H	ENSP00000296953:Q591H	Q	+	3	2	C5orf41	172482780	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.818000	0.39012	1.378000	0.46305	0.655000	0.94253	CAG	CREBRF	-	NULL	ENSG00000164463		0.353	CREBRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBRF	HGNC	protein_coding	OTTHUMT00000372667.1	-	0.00	23	0	G	NM_153607		172550174	+1	tier1	-	no_errors	ENST00000540014	ensembl	human	known	74_37	missense	20.00	24	6	SNP	1.000	C
CSMD3	114788	genome.wustl.edu	37	8	113259322	113259322	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:113259322G>T	ENST00000297405.5	-	64	10393	c.10149C>A	c.(10147-10149)caC>caA	p.H3383Q	CSMD3_ENST00000343508.3_Missense_Mutation_p.H3343Q|CSMD3_ENST00000352409.3_Missense_Mutation_p.H3313Q|CSMD3_ENST00000455883.2_Missense_Mutation_p.H3214Q	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3383	Sushi 27. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CTTGGAGAAGGTGTCCTTTTT	0.403										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													137.0	121.0	127.0					8																	113259322		2203	4300	6503	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10149C>A	8.37:g.113259322G>T	ENSP00000297405:p.His3383Gln		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.H3383Q	ENST00000297405.5	37	c.10149	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	16.53	3.150406	0.57151	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83	4.79	-0.294	0.12831	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.36963	0.0986	M	0.73598	2.24	0.31968	N	0.607574	B;P;P	0.44734	0.429;0.842;0.584	P;P;B	0.51266	0.533;0.664;0.303	T	0.51052	-0.8754	10	0.87932	D	0	.	10.3975	0.44209	0.5203:0.0:0.4797:0.0	.	3214;3383;3343	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	Q	3343;3383;2653;3214;3313	ENSP00000345799:H3343Q;ENSP00000297405:H3383Q;ENSP00000341558:H2653Q;ENSP00000412263:H3214Q;ENSP00000343124:H3313Q	ENSP00000297405:H3383Q	H	-	3	2	CSMD3	113328498	0.948000	0.32251	0.984000	0.44739	0.710000	0.40934	0.085000	0.14912	-0.162000	0.10964	-0.384000	0.06662	CAC	CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.403	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	50	0	G	NM_052900		113259322	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	7.35	63	5	SNP	0.992	T
CTAGE6	340307	genome.wustl.edu	37	7	143453407	143453407	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:143453407G>T	ENST00000470691.2	-	1	1382	c.1345C>A	c.(1345-1347)Cat>Aat	p.H449N	RNU6-267P_ENST00000516714.1_RNA	NM_178561.4	NP_848656.2	Q86UF2	CTGE6_HUMAN	CTAGE family, member 6	449						integral component of membrane (GO:0016021)						Melanoma(164;0.0903)					TGATAAAAATGAACAGTTCTC	0.413																																																	0													34.0	32.0	33.0					7																	143453407		1759	3940	5699	SO:0001583	missense	0			BC043153	CCDS64790.1	7q35	2013-05-22	2013-02-25	2013-02-25	ENSG00000271321	ENSG00000271321			28644	protein-coding gene	gene with protein product			"""CTAGE family, member 6, pseudogene"""	CTAGE6P		12477932	Standard	NM_178561		Approved	MGC41943	uc003wdk.4	Q86UF2	OTTHUMG00000157770	ENST00000470691.2:c.1345C>A	7.37:g.143453407G>T	ENSP00000474388:p.His449Asn		A4FU29|Q3ZCM5	Missense_Mutation	SNP	superfamily_tRNA-bd_arm	p.H449N	ENST00000470691.2	37	c.1345		7																																																																																			CTAGE6	-	NULL	ENSG00000271321		0.413	CTAGE6-001	KNOWN	basic|appris_principal	protein_coding	CTAGE6	HGNC	protein_coding	OTTHUMT00000349580.2		0.00	109	0	G	NM_178561		143453407	-1			no_errors	ENST00000470691	ensembl	human	known	74_37	missense	6.90	108	8	SNP	0.039	T
CTNND1	1500	genome.wustl.edu	37	11	57578949	57578949	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:57578949C>G	ENST00000399050.4	+	17	3165	c.2629C>G	c.(2629-2631)Caa>Gaa	p.Q877E	CTNND1_ENST00000532245.1_Missense_Mutation_p.Q770E|CTNND1_ENST00000527467.1_Missense_Mutation_p.Q554E|CTNND1_ENST00000532787.1_Missense_Mutation_p.Q770E|CTNND1_ENST00000361391.6_Missense_Mutation_p.Q871E|CTNND1_ENST00000428599.2_Missense_Mutation_p.Q871E|CTNND1_ENST00000529526.1_Missense_Mutation_p.Q817E|CTNND1_ENST00000526772.1_Missense_Mutation_p.Q548E|CTNND1_ENST00000530094.1_Missense_Mutation_p.Q770E|CTNND1_ENST00000532463.1_Missense_Mutation_p.Q770E|CTNND1_ENST00000399039.4_Missense_Mutation_p.Q877E|CTNND1_ENST00000526357.1_Missense_Mutation_p.Q817E|CTNND1_ENST00000360682.6_Missense_Mutation_p.Q877E|CTNND1_ENST00000533667.1_Missense_Mutation_p.Q548E|CTNND1_ENST00000532649.1_Missense_Mutation_p.Q817E|CTNND1_ENST00000415361.2_Missense_Mutation_p.Q776E|CTNND1_ENST00000524630.1_Missense_Mutation_p.Q871E|CTNND1_ENST00000526938.1_Missense_Mutation_p.Q877E|CTNND1_ENST00000530748.1_Missense_Mutation_p.Q823E|CTNND1_ENST00000529986.1_Missense_Mutation_p.Q770E|CTNND1_ENST00000532844.1_Missense_Mutation_p.Q823E|CTNND1_ENST00000361332.4_Missense_Mutation_p.Q871E|CTNND1_ENST00000426142.2_Missense_Mutation_p.Q770E|CTNND1_ENST00000534579.1_Missense_Mutation_p.Q817E|CTNND1_ENST00000525902.1_Missense_Mutation_p.Q554E|CTNND1_ENST00000529919.1_Missense_Mutation_p.Q877E|CTNND1_ENST00000361796.4_Missense_Mutation_p.Q871E|CTNND1_ENST00000528232.1_Missense_Mutation_p.Q776E|CTNND1_ENST00000358694.6_Missense_Mutation_p.Q871E|CTNND1_ENST00000531014.1_Missense_Mutation_p.Q548E|CTNND1_ENST00000529873.1_Missense_Mutation_p.Q817E|CTNND1_ENST00000528621.1_Missense_Mutation_p.Q817E	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	877					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)			breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				TGACCGGAACCAAAAATCAGG	0.423																																																	0													210.0	193.0	198.0					11																	57578949		1907	4124	6031	SO:0001583	missense	0			AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.2629C>G	11.37:g.57578949C>G	ENSP00000382004:p.Gln877Glu		A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.Q877E	ENST00000399050.4	37	c.2629	CCDS44604.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.83|14.83	2.651714|2.651714	0.47362|0.47362	.|.	.|.	ENSG00000198561|ENSG00000198561	ENST00000531007|ENST00000524630;ENST00000529919;ENST00000399039;ENST00000360682;ENST00000361796;ENST00000529526;ENST00000426142;ENST00000399050;ENST00000361391;ENST00000361332;ENST00000532463;ENST00000529986;ENST00000358694;ENST00000532787;ENST00000533667;ENST00000532649;ENST00000528621;ENST00000530748;ENST00000428599;ENST00000527467;ENST00000528232;ENST00000531014;ENST00000526772;ENST00000529873;ENST00000525902;ENST00000532844;ENST00000526357;ENST00000530094;ENST00000415361;ENST00000532245;ENST00000534579;ENST00000526938	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.74947	.|-0.26;-0.26;-0.26;-0.57;-0.26;-0.26;-0.18;-0.27;-0.57;-0.27;-0.18;-0.18;-0.26;-0.46;-0.89;-0.26;-0.26;-0.26;-0.26;-0.53;-0.17;-0.53;-0.51;-0.56;-0.51;-0.27;-0.28;-0.26;-0.26;-0.18;-0.26;-0.57	5.92|5.92	5.92|5.92	0.95590|0.95590	.|.	.|0.339796	.|0.31323	.|N	.|0.007858	T|T	0.69405|0.69405	0.3107|0.3107	L|L	0.47190|0.47190	1.495|1.495	0.41687|0.41687	D|D	0.989327|0.989327	.|B;B;B;P;B;B;B;B;B	.|0.36874	.|0.027;0.027;0.016;0.572;0.018;0.013;0.002;0.254;0.016	.|B;B;B;B;B;B;B;B;B	.|0.33295	.|0.023;0.023;0.01;0.161;0.004;0.003;0.01;0.068;0.01	T|T	0.67313|0.67313	-0.5702|-0.5702	5|10	.|0.30854	.|T	.|0.27	-7.3501|-7.3501	19.9118|19.9118	0.97027|0.97027	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|877;871;877;770;817;817;871;877;877	.|O60716-3;O60716-2;O60716;O60716-18;O60716-14;O60716-10;O60716-5;F8WA43;C9JZR2	.|.;.;CTND1_HUMAN;.;.;.;.;.;.	R|E	53|871;877;877;877;871;817;770;877;871;871;770;770;871;770;548;817;817;823;871;554;776;548;548;817;554;823;817;770;776;770;817;877	.|ENSP00000436543:Q871E;ENSP00000434808:Q877E;ENSP00000381996:Q877E;ENSP00000353902:Q877E;ENSP00000354907:Q871E;ENSP00000436323:Q817E;ENSP00000409930:Q770E;ENSP00000382004:Q877E;ENSP00000354785:Q871E;ENSP00000354823:Q871E;ENSP00000432075:Q770E;ENSP00000437156:Q770E;ENSP00000351527:Q871E;ENSP00000434949:Q770E;ENSP00000437051:Q548E;ENSP00000435379:Q817E;ENSP00000432243:Q817E;ENSP00000436744:Q823E;ENSP00000413586:Q871E;ENSP00000434900:Q554E;ENSP00000435266:Q776E;ENSP00000432623:Q548E;ENSP00000433158:Q548E;ENSP00000435494:Q817E;ENSP00000434672:Q554E;ENSP00000433276:Q823E;ENSP00000433334:Q817E;ENSP00000437327:Q770E;ENSP00000403518:Q776E;ENSP00000434017:Q770E;ENSP00000435789:Q817E;ENSP00000432041:Q877E	.|ENSP00000351527:Q871E	P|Q	+|+	2|1	0|0	CTNND1|CTNND1	57335525|57335525	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.660000|5.660000	0.68018|0.68018	2.809000|2.809000	0.96659|0.96659	0.557000|0.557000	0.71058|0.71058	CCA|CAA	CTNND1	-	NULL	ENSG00000198561		0.423	CTNND1-006	KNOWN	basic|CCDS	protein_coding	CTNND1	HGNC	protein_coding	OTTHUMT00000393944.1		0.00	35	0	C	NM_001331		57578949	+1			no_errors	ENST00000399050	ensembl	human	known	74_37	missense	10.34	26	3	SNP	1.000	G
CYP39A1	51302	genome.wustl.edu	37	6	46607323	46607323	+	Silent	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:46607323G>C	ENST00000275016.2	-	3	599	c.396C>G	c.(394-396)ctC>ctG	p.L132L		NM_016593.3	NP_057677.2	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A, polypeptide 1	132					bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	24-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033782)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)|steroid 7-alpha-hydroxylase activity (GO:0008387)		EIF3K/CYP39A1(2)	NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)	21						TAAACTGATGGAGATTGACAG	0.368																																																	0													126.0	116.0	119.0					6																	46607323		2203	4300	6503	SO:0001819	synonymous_variant	0			AF237982	CCDS4916.1, CCDS75465.1	6p21.1-p11.2	2008-02-05	2003-01-14		ENSG00000146233	ENSG00000146233		"""Cytochrome P450s"""	17449	protein-coding gene	gene with protein product		605994	"""cytochrome P450, subfamily XXXIX (oxysterol 7 alpha-hydroxylase), polypeptide 1"""			10748047	Standard	NM_016593		Approved		uc003oyf.1	Q9NYL5	OTTHUMG00000014785	ENST00000275016.2:c.396C>G	6.37:g.46607323G>C			Q5VTT0|Q96FW5	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I	p.L132	ENST00000275016.2	37	c.396	CCDS4916.1	6																																																																																			CYP39A1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000146233		0.368	CYP39A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP39A1	HGNC	protein_coding	OTTHUMT00000040787.1	-	0.00	43	0	G			46607323	-1	tier1	-	no_errors	ENST00000275016	ensembl	human	known	74_37	silent	26.19	31	11	SNP	0.000	C
CYP51A1	1595	genome.wustl.edu	37	7	91752604	91752604	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:91752604C>T	ENST00000003100.8	-	7	1081	c.916G>A	c.(916-918)Gaa>Aaa	p.E306K	LRRD1_ENST00000422722.1_5'UTR|CYP51A1_ENST00000450723.1_Missense_Mutation_p.E201K	NM_000786.3	NP_000777.1	Q16850	CP51A_HUMAN	cytochrome P450, family 51, subfamily A, polypeptide 1	300					cholesterol biosynthetic process (GO:0006695)|cholesterol biosynthetic process via 24,25-dihydrolanosterol (GO:0033488)|demethylation (GO:0070988)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|sterol 14-demethylase activity (GO:0008398)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)	10	all_cancers(62;2.16e-09)|all_epithelial(64;3.86e-08)|Breast(17;0.00206)|all_lung(186;0.169)|all_hematologic(106;0.215)|Lung NSC(181;0.227)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		Itraconazole(DB01167)|Ketoconazole(DB01026)|Sertaconazole(DB01153)|Tioconazole(DB01007)	CCTGCTACTTCATCATCAGTC	0.418																																					GBM(70;1100 1190 11592 25836 51397)												0													143.0	141.0	142.0					7																	91752604		2203	4300	6503	SO:0001583	missense	0			U51685	CCDS5623.1, CCDS55123.1	7q21.2	2012-10-10	2003-02-14	2003-02-28	ENSG00000001630	ENSG00000001630		"""Cytochrome P450s"""	2649	protein-coding gene	gene with protein product		601637	"""cytochrome P450, 51 (lanosterol 14-alpha-demethylase)"""	CYP51		8975714	Standard	NM_000786		Approved	CP51, CYPL1, P450L1, LDM, P450-14DM	uc003ulm.4	Q16850	OTTHUMG00000131131	ENST00000003100.8:c.916G>A	7.37:g.91752604C>T	ENSP00000003100:p.Glu306Lys		A4D1F8|B2RAI4|B4DJ55|O00770|O00772|Q16784|Q8N1A8|Q99868	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_B	p.E306K	ENST00000003100.8	37	c.916	CCDS5623.1	7	.	.	.	.	.	.	.	.	.	.	C	36	5.701014	0.96812	.	.	ENSG00000001630	ENST00000003100;ENST00000496998;ENST00000450723	T;T	0.72167	-0.63;-0.63	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.87529	0.6200	M	0.91717	3.235	0.80722	D	1	D;D	0.64830	0.992;0.994	P;D	0.64237	0.887;0.923	D	0.89369	0.3673	10	0.87932	D	0	.	20.1823	0.98208	0.0:1.0:0.0:0.0	.	246;300	B3KRC6;Q16850	.;CP51A_HUMAN	K	306;246;201	ENSP00000003100:E306K;ENSP00000406757:E201K	ENSP00000003100:E306K	E	-	1	0	CYP51A1	91590540	1.000000	0.71417	0.887000	0.34795	0.872000	0.50106	7.751000	0.85126	2.771000	0.95319	0.650000	0.86243	GAA	CYP51A1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I	ENSG00000001630		0.418	CYP51A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP51A1	HGNC	protein_coding	OTTHUMT00000253812.4	-	0.00	47	0	C			91752604	-1	tier1	-	no_errors	ENST00000003100	ensembl	human	known	74_37	missense	15.56	38	7	SNP	1.000	T
WASH4P	374677	genome.wustl.edu	37	16	63247	63247	+	IGR	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:63247G>A	ENST00000326592.9	-	0	2431				DDX11L10_ENST00000513886.1_RNA			A8MWX3	WASH4_HUMAN	WAS protein family homolog 4 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										GGTCTGCAGGGATCCTGCTAC	0.597																																																	0																																										SO:0001628	intergenic_variant	0					16p13.3	2014-08-28	2008-01-16	2008-01-16	ENSG00000234769	ENSG00000234769		"""WAS protein homologs"""	14126	other	unknown			"""family with sequence similarity 39, member C pseudogene"""	FAM39CP		9054936, 11701968, 18159949	Standard	NG_003159		Approved	FLJ31670		A8MWX3	OTTHUMG00000059914		16.37:g.63247G>A				RNA	SNP	-	NULL	ENST00000326592.9	37	NULL		16																																																																																			DDX11L10	-	-	ENSG00000233614		0.597	WASH4P-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal	protein_coding	DDX11L10	HGNC	protein_coding	OTTHUMT00000133175.2		0.00	12	0	G	NG_003159		63247	+1			no_errors	ENST00000513886	ensembl	human	known	74_37	rna	18.18	18	4	SNP	0.013	A
DKK3	27122	genome.wustl.edu	37	11	11985989	11985989	+	3'UTR	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:11985989C>G	ENST00000396505.2	-	0	1313				DKK3_ENST00000527132.1_5'UTR|DKK3_ENST00000525493.1_3'UTR|DKK3_ENST00000326932.4_3'UTR|DKK3_ENST00000450094.2_3'UTR	NM_015881.5	NP_056965.3	Q9UBP4	DKK3_HUMAN	dickkopf WNT signaling pathway inhibitor 3						adrenal gland development (GO:0030325)|anatomical structure morphogenesis (GO:0009653)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of transcription, DNA-templated (GO:0045892)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|pancreas(1)	8				Epithelial(150;0.000502)		TATTGCACATCTACCCACAGC	0.547																																																	0													91.0	112.0	105.0					11																	11985989		2201	4294	6495	SO:0001624	3_prime_UTR_variant	0			AF177396	CCDS7808.1	11p15.3	2013-05-15	2013-05-15		ENSG00000050165	ENSG00000050165			2893	protein-coding gene	gene with protein product	"""regulated in glioma"""	605416	"""dickkopf (Xenopus laevis) homolog 3"", ""dickkopf 3 homolog (Xenopus laevis)"""			10570958	Standard	XM_006718177		Approved	REIC, RIG	uc001mjv.3	Q9UBP4	OTTHUMG00000165709	ENST00000396505.2:c.*22G>C	11.37:g.11985989C>G			A8K1I2|D3DQW1|Q9ULB7	RNA	SNP	-	NULL	ENST00000396505.2	37	NULL	CCDS7808.1	11																																																																																			DKK3	-	-	ENSG00000050165		0.547	DKK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DKK3	HGNC	protein_coding	OTTHUMT00000385863.1	-	0.00	34	0	C	NM_013253		11985989	-1	tier1	-	no_errors	ENST00000527132	ensembl	human	known	74_37	rna	24.53	40	13	SNP	0.042	G
DNAH1	25981	genome.wustl.edu	37	3	52414133	52414133	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr3:52414133C>T	ENST00000420323.2	+	48	7851	c.7590C>T	c.(7588-7590)ctC>ctT	p.L2530L		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2530					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CCTACGAGCTCATCACCAGTG	0.622																																																	0													38.0	39.0	38.0					3																	52414133		1970	4142	6112	SO:0001819	synonymous_variant	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.7590C>T	3.37:g.52414133C>T			B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase	p.L2530	ENST00000420323.2	37	c.7590	CCDS46842.1	3																																																																																			DNAH1	-	NULL	ENSG00000114841		0.622	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	-	0.00	33	0	C	NM_015512		52414133	+1	tier1	-	no_errors	ENST00000420323	ensembl	human	known	74_37	silent	38.71	19	12	SNP	1.000	T
DNAH10	196385	genome.wustl.edu	37	12	124343712	124343712	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:124343712C>T	ENST00000409039.3	+	37	6317	c.6292C>T	c.(6292-6294)Caa>Taa	p.Q2098*		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2098	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TAAAGTGGTTCAAATGTTCGA	0.507																																																	0													40.0	40.0	40.0					12																	124343712		1884	4113	5997	SO:0001587	stop_gained	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.6292C>T	12.37:g.124343712C>T	ENSP00000386770:p.Gln2098*		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.Q2098*	ENST00000409039.3	37	c.6292	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	C	40	8.014800	0.98610	.	.	ENSG00000197653	ENST00000409039	.	.	.	5.4	5.4	0.78164	.	0.000000	0.64402	U	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.2541	0.93938	0.0:1.0:0.0:0.0	.	.	.	.	X	2098	.	ENSP00000386770:Q2098X	Q	+	1	0	DNAH10	122909665	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	7.789000	0.85783	2.541000	0.85698	0.558000	0.71614	CAA	DNAH10	-	superfamily_P-loop_NTPase	ENSG00000197653		0.507	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	-	0.00	55	0	C			124343712	+1	tier1	-	no_errors	ENST00000409039	ensembl	human	known	74_37	nonsense	15.09	44	8	SNP	1.000	T
DNAH17	8632	genome.wustl.edu	37	17	76525741	76525741	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:76525741C>G	ENST00000585328.1	-	22	3435	c.3311G>C	c.(3310-3312)aGa>aCa	p.R1104T	DNAH17_ENST00000389840.5_Missense_Mutation_p.R1107T	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1107	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CAAGCCCATTCTGGCGACTTT	0.592																																																	0													94.0	95.0	95.0					17																	76525741		1952	4150	6102	SO:0001583	missense	0			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.3311G>C	17.37:g.76525741C>G	ENSP00000465516:p.Arg1104Thr		O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_HR1_rho-bd	p.R1107T	ENST00000585328.1	37	c.3320		17	.	.	.	.	.	.	.	.	.	.	C	4.607	0.112861	0.08831	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.22743	1.94	4.96	4.0	0.46444	.	.	.	.	.	T	0.13372	0.0324	N	0.22421	0.69	0.09310	N	1	.	.	.	.	.	.	T	0.27157	-1.0082	7	0.23302	T	0.38	.	4.6735	0.12701	0.0:0.5839:0.1632:0.2529	.	.	.	.	T	1104;1107	ENSP00000374490:R1107T	ENSP00000300671:R1104T	R	-	2	0	DNAH17	74037336	0.000000	0.05858	0.207000	0.23584	0.243000	0.25628	0.423000	0.21313	1.081000	0.41110	0.561000	0.74099	AGA	DNAH17	-	NULL	ENSG00000187775		0.592	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000318962.2	-	0.00	80	0	C	NM_173628		76525741	-1	tier1	-	no_errors	ENST00000389840	ensembl	human	known	74_37	missense	24.11	85	27	SNP	0.001	G
DCDC1	341019	genome.wustl.edu	37	11	31392295	31392295	+	5'Flank	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:31392295G>C	ENST00000452803.1	-	0	0				DNAJC24_ENST00000527601.1_3'UTR|DNAJC24_ENST00000465995.1_5'UTR|DNAJC24_ENST00000536040.1_5'UTR	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1						intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					TGGTTCCATGGATGATGGCGG	0.388																																																	0													55.0	53.0	54.0					11																	31392295		1852	4098	5950	SO:0001631	upstream_gene_variant	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144		11.37:g.31392295G>C	Exception_encountered		A6PVL6|B7WNX6|Q6ZU04	RNA	SNP	-	NULL	ENST00000452803.1	37	NULL	CCDS7872.1	11																																																																																			DNAJC24	-	-	ENSG00000170946		0.388	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC24	HGNC	protein_coding	OTTHUMT00000316531.1	-	0.00	19	0	G	NM_181807		31392295	+1	tier1	-	no_errors	ENST00000532385	ensembl	human	known	74_37	rna	18.18	18	4	SNP	0.033	C
DOCK11	139818	genome.wustl.edu	37	X	117758549	117758549	+	Silent	SNP	A	A	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chrX:117758549A>G	ENST00000276202.7	+	32	3582	c.3519A>G	c.(3517-3519)ctA>ctG	p.L1173L	DOCK11_ENST00000276204.6_Silent_p.L1173L	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1173					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TTGTTGGACTACTTTTGGAAA	0.333																																																	0													184.0	171.0	176.0					X																	117758549		2203	4300	6503	SO:0001819	synonymous_variant	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.3519A>G	X.37:g.117758549A>G			A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Silent	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L1173	ENST00000276202.7	37	c.3519	CCDS35373.1	X																																																																																			DOCK11	-	NULL	ENSG00000147251		0.333	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	-	0.00	29	0	A	NM_144658		117758549	+1	tier1	-	no_errors	ENST00000276202	ensembl	human	known	74_37	silent	51.52	16	17	SNP	1.000	G
DOCK2	1794	genome.wustl.edu	37	5	169097556	169097556	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:169097556C>G	ENST00000256935.8	+	4	259	c.179C>G	c.(178-180)cCt>cGt	p.P60R		NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	60	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGCATTTTTCCTAAGTCATTT	0.353																																																	0													85.0	82.0	83.0					5																	169097556		2203	4300	6503	SO:0001583	missense	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.179C>G	5.37:g.169097556C>G	ENSP00000256935:p.Pro60Arg		Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.P60R	ENST00000256935.8	37	c.179	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	C	23.9	4.473692	0.84640	.	.	ENSG00000134516	ENST00000256935	T	0.27557	1.66	5.59	5.59	0.84812	Src homology-3 domain (3);Variant SH3 (1);	0.106853	0.64402	D	0.000004	T	0.72574	0.3477	H	0.97896	4.1	0.80722	D	1	D	0.89917	1.0	D	0.72625	0.978	D	0.83611	0.0134	10	0.87932	D	0	.	19.5905	0.95508	0.0:1.0:0.0:0.0	.	60	Q92608	DOCK2_HUMAN	R	60	ENSP00000256935:P60R	ENSP00000256935:P60R	P	+	2	0	DOCK2	169030134	1.000000	0.71417	0.652000	0.29579	0.982000	0.71751	4.989000	0.63870	2.627000	0.88993	0.563000	0.77884	CCT	DOCK2	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000134516		0.353	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	-	0.00	53	0	C	NM_004946		169097556	+1	tier1	-	no_errors	ENST00000256935	ensembl	human	known	74_37	missense	23.81	32	10	SNP	1.000	G
DPP10	57628	genome.wustl.edu	37	2	116599859	116599859	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:116599859T>G	ENST00000410059.1	+	26	2809	c.2329T>G	c.(2329-2331)Ttc>Gtc	p.F777V	DPP10_ENST00000393147.2_Missense_Mutation_p.F781V|DPP10_ENST00000409163.1_Missense_Mutation_p.F727V|DPP10_ENST00000310323.8_Missense_Mutation_p.F770V	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	777						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						CCTCAAATTCTTCAGTGATTG	0.378																																																	0													103.0	97.0	99.0					2																	116599859		2203	4300	6503	SO:0001583	missense	0			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.2329T>G	2.37:g.116599859T>G	ENSP00000386565:p.Phe777Val		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.F781V	ENST00000410059.1	37	c.2341	CCDS46400.1	2	.	.	.	.	.	.	.	.	.	.	T	18.21	3.573050	0.65765	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	5.73	5.73	0.89815	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.055231	0.64402	D	0.000001	T	0.65260	0.2674	L	0.58925	1.835	0.50632	D	0.999885	D;D;D;D	0.76494	0.999;0.983;0.999;0.999	D;P;D;D	0.74674	0.973;0.885;0.984;0.984	T	0.67597	-0.5630	10	0.72032	D	0.01	-25.8806	15.4929	0.75624	0.0:0.0:0.0:1.0	.	770;781;773;777	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	V	777;727;781;770	ENSP00000386565:F777V;ENSP00000387038:F727V;ENSP00000376855:F781V;ENSP00000309066:F770V	ENSP00000309066:F770V	F	+	1	0	DPP10	116316329	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.849000	0.75414	2.308000	0.77769	0.533000	0.62120	TTC	DPP10	-	pfam_Peptidase_S9	ENSG00000175497		0.378	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	HGNC	protein_coding	OTTHUMT00000330580.4	-	0.00	33	0	T	NM_020868		116599859	+1	tier1	-	no_errors	ENST00000393147	ensembl	human	known	74_37	missense	41.18	20	14	SNP	1.000	G
DSEL	92126	genome.wustl.edu	37	18	65180716	65180716	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr18:65180716G>A	ENST00000310045.7	-	2	2633	c.1160C>T	c.(1159-1161)tCa>tTa	p.S387L	CTD-2541J13.2_ENST00000581951.1_RNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	377					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				TTGGGCAGTTGAAGGAACCAT	0.438																																																	0													118.0	107.0	111.0					18																	65180716		2203	4300	6503	SO:0001583	missense	0			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.1160C>T	18.37:g.65180716G>A	ENSP00000310565:p.Ser387Leu		Q17RH1|Q6P5Z3	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,superfamily_Chondroitin_lyas	p.S387L	ENST00000310045.7	37	c.1160	CCDS11995.1	18	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474219	0.84640	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.25749	1.78	5.46	5.46	0.80206	.	0.000000	0.85682	U	0.000000	T	0.53286	0.1787	M	0.76002	2.32	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.50250	-0.8850	10	0.42905	T	0.14	-11.8847	19.3189	0.94229	0.0:0.0:1.0:0.0	.	377	Q8IZU8	DSEL_HUMAN	L	387;377	ENSP00000310565:S387L	ENSP00000310565:S387L	S	-	2	0	DSEL	63331696	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.628000	0.98415	2.577000	0.86979	0.563000	0.77884	TCA	DSEL	-	NULL	ENSG00000171451		0.438	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSEL	HGNC	protein_coding	OTTHUMT00000256221.1	-	0.00	82	0	G	NM_032160		65180716	-1	tier1	-	no_errors	ENST00000310045	ensembl	human	known	74_37	missense	16.18	57	11	SNP	1.000	A
DSPP	1834	genome.wustl.edu	37	4	88534007	88534007	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr4:88534007G>A	ENST00000282478.7	+	3	702	c.669G>A	c.(667-669)ggG>ggA	p.G223G	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.G223G			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	223					biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		AGAGAAATGGGACTAAGGAAG	0.443																																																	0													99.0	103.0	102.0					4																	88534007		2002	4174	6176	SO:0001819	synonymous_variant	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.669G>A	4.37:g.88534007G>A			A8MUI0|O95815	Silent	SNP	NULL	p.G223	ENST00000282478.7	37	c.669	CCDS43248.1	4																																																																																			DSPP	-	NULL	ENSG00000152591		0.443	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	-	0.00	46	0	G	NM_014208		88534007	+1	tier1	-	no_errors	ENST00000282478	ensembl	human	known	74_37	silent	13.79	50	8	SNP	0.000	A
UPK3B	80761	genome.wustl.edu	37	7	76634956	76634956	+	Intron	SNP	G	G	C	rs372044986		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:76634956G>C	ENST00000419923.2	+	6	1408				DTX2P1-UPK3BP1-PMS2P11_ENST00000584900.1_RNA|UPK3B_ENST00000443097.2_Intron			Q9BT76	UPK3B_HUMAN	uroplakin 3B						negative regulation of gene expression (GO:0010629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(1)|skin(2)	8		Myeloproliferative disorder(862;0.204)				GACGCTGCCCGTGTCTCCGGA	0.692																																																	0																																										SO:0001627	intron_variant	0			BC004304	CCDS5588.1, CCDS5589.1, CCDS64693.1	7q11.2	2003-07-29			ENSG00000243566	ENSG00000243566			21444	protein-coding gene	gene with protein product	"""uroplakin IIIb"""	611887				12446744	Standard	XM_005250612		Approved	MGC10902, p35, UPIIIb, FLJ32198	uc003ufq.3	Q9BT76	OTTHUMG00000149929	ENST00000419923.2:c.961-13185G>C	7.37:g.76634956G>C			A6NHH5|A8K231|A8MZA8|B3KPU5|Q75MM5|Q86W06	RNA	SNP	-	NULL	ENST00000419923.2	37	NULL	CCDS5588.1	7																																																																																			DTX2P1-UPK3BP1-PMS2P11	-	-	ENSG00000265479		0.692	UPK3B-201	KNOWN	basic|CCDS	protein_coding	DTX2P1-UPK3BP1-PMS2P11	HGNC	protein_coding		-	0.00	70	0	G	NM_030570		76634956	+1	tier1	-	no_errors	ENST00000579700	ensembl	human	known	74_37	rna	10.53	51	6	SNP	0.021	C
DYNC1H1	1778	genome.wustl.edu	37	14	102449796	102449796	+	Silent	SNP	C	C	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:102449796C>A	ENST00000360184.4	+	7	1475	c.1311C>A	c.(1309-1311)atC>atA	p.I437I		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	437	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TGAGAGACATCGTCAAAAGAA	0.418																																																	0													88.0	90.0	89.0					14																	102449796		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.1311C>A	14.37:g.102449796C>A			B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.I437	ENST00000360184.4	37	c.1311	CCDS9966.1	14																																																																																			DYNC1H1	-	pfam_Dynein_heavy_dom-1	ENSG00000197102		0.418	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1		0.00	29	0	C	NM_001376		102449796	+1			no_errors	ENST00000360184	ensembl	human	known	74_37	silent	5.71	33	2	SNP	0.679	A
DYNC2H1	79659	genome.wustl.edu	37	11	103152935	103152935	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:103152935G>A	ENST00000375735.2	+	72	10933	c.10789G>A	c.(10789-10791)Gtt>Att	p.V3597I	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.V3604I	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3597					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AGGTGTGGTTGTTGGAGACAT	0.289																																																	0													90.0	90.0	90.0					11																	103152935		1801	4057	5858	SO:0001583	missense	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.10789G>A	11.37:g.103152935G>A	ENSP00000364887:p.Val3597Ile		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.V3604I	ENST00000375735.2	37	c.10810	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109091	0.37242	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.52295	0.67;0.67	5.83	5.83	0.93111	.	0.217601	0.38663	N	0.001603	T	0.29556	0.0737	N	0.20357	0.565	0.41184	D	0.986253	B;B	0.06786	0.001;0.001	B;B	0.09377	0.003;0.004	T	0.16335	-1.0406	10	0.18276	T	0.48	.	9.0482	0.36360	0.1566:0.0:0.8434:0.0	.	3597;3604	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	I	3597;3604	ENSP00000364887:V3597I;ENSP00000381167:V3604I	ENSP00000364887:V3597I	V	+	1	0	DYNC2H1	102658145	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.940000	0.40223	2.747000	0.94245	0.585000	0.79938	GTT	DYNC2H1	-	NULL	ENSG00000187240		0.289	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	-	0.00	32	0	G	XM_370652		103152935	+1	tier1	-	no_errors	ENST00000398093	ensembl	human	known	74_37	missense	28.21	28	11	SNP	1.000	A
DYRK1B	9149	genome.wustl.edu	37	19	40320544	40320544	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:40320544C>A	ENST00000593685.1	-	5	964	c.496G>T	c.(496-498)Gac>Tac	p.D166Y	DYRK1B_ENST00000323039.5_Missense_Mutation_p.D166Y|DYRK1B_ENST00000348817.3_Missense_Mutation_p.D166Y|DYRK1B_ENST00000597639.1_Missense_Mutation_p.D166Y|DYRK1B_ENST00000430012.2_Missense_Mutation_p.D166Y			Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B	166	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adipose tissue development (GO:0060612)|myoblast fusion (GO:0007520)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(7)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	24	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			ATCTCCGTGTCATGCTGGTTC	0.572																																																	0													73.0	54.0	60.0					19																	40320544		2203	4300	6503	SO:0001583	missense	0			Y17999	CCDS12543.1, CCDS12544.1, CCDS46075.1	19q13.2	2012-10-02			ENSG00000105204	ENSG00000105204	2.7.12.1		3092	protein-coding gene	gene with protein product	"""minibrain-related kinase"""	604556				9918863	Standard	XM_005259395		Approved	MIRK	uc002omj.3	Q9Y463		ENST00000593685.1:c.496G>T	19.37:g.40320544C>A	ENSP00000469863:p.Asp166Tyr		O75258|O75788|O75789	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D166Y	ENST00000593685.1	37	c.496	CCDS12543.1	19	.	.	.	.	.	.	.	.	.	.	C	22.2	4.257169	0.80246	.	.	ENSG00000105204	ENST00000323039;ENST00000348817;ENST00000430012	T;T;T	0.66638	-0.22;-0.22;-0.22	4.3	4.3	0.51218	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.116139	0.56097	D	0.000032	D	0.82848	0.5126	M	0.87547	2.89	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.73708	0.976;0.962;0.981	D	0.86381	0.1729	10	0.87932	D	0	.	14.313	0.66429	0.0:1.0:0.0:0.0	.	166;166;166	Q9Y463-2;Q9Y463;Q9Y463-3	.;DYR1B_HUMAN;.	Y	166	ENSP00000312789:D166Y;ENSP00000221803:D166Y;ENSP00000403182:D166Y	ENSP00000312789:D166Y	D	-	1	0	DYRK1B	45012384	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	7.651000	0.83577	2.236000	0.73375	0.561000	0.74099	GAC	DYRK1B	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000105204		0.572	DYRK1B-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DYRK1B	HGNC	protein_coding	OTTHUMT00000462874.2	-	0.00	63	0	C	NM_004714		40320544	-1	tier1	-	no_errors	ENST00000323039	ensembl	human	known	74_37	missense	16.90	59	12	SNP	1.000	A
ECHDC2	55268	genome.wustl.edu	37	1	53387333	53387333	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:53387333G>C	ENST00000371522.4	-	1	106	c.13C>G	c.(13-15)Ctg>Gtg	p.L5V	ECHDC2_ENST00000358358.5_Missense_Mutation_p.L5V|ECHDC2_ENST00000480312.2_5'Flank|ECHDC2_ENST00000541281.1_5'UTR|ECHDC2_ENST00000536120.1_5'UTR	NM_001198961.1	NP_001185890.1	Q86YB7	ECHD2_HUMAN	enoyl CoA hydratase domain containing 2	5					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	lyase activity (GO:0016829)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	12						AGGAGGCACAGAACGCGCAGC	0.741																																																	0													4.0	6.0	5.0					1																	53387333		2065	4145	6210	SO:0001583	missense	0			AF258590	CCDS571.1, CCDS55600.1, CCDS72794.1	1p32.3	2010-04-30	2010-04-30		ENSG00000121310	ENSG00000121310			23408	protein-coding gene	gene with protein product			"""enoyl Coenzyme A hydratase domain containing 2"""				Standard	NM_018281		Approved	FLJ10948	uc001cup.4	Q86YB7	OTTHUMG00000008927	ENST00000371522.4:c.13C>G	1.37:g.53387333G>C	ENSP00000360577:p.Leu5Val		D3DQ36|Q9NV38	Missense_Mutation	SNP	pfam_Crotonase_core_superfam	p.L5V	ENST00000371522.4	37	c.13	CCDS55600.1	1	.	.	.	.	.	.	.	.	.	.	G	16.11	3.029092	0.54790	.	.	ENSG00000121310	ENST00000371522;ENST00000358358;ENST00000467988	T;T;T	0.62364	0.16;0.11;0.03	4.77	4.77	0.60923	.	0.688914	0.12866	N	0.432711	T	0.43456	0.1248	N	0.08118	0	0.80722	D	1	B;P	0.38167	0.319;0.621	B;B	0.38803	0.146;0.282	T	0.31194	-0.9952	10	0.22706	T	0.39	.	13.165	0.59565	0.0:0.0:1.0:0.0	.	5;5	Q86YB7;Q86YB7-2	ECHD2_HUMAN;.	V	5	ENSP00000360577:L5V;ENSP00000351125:L5V;ENSP00000441962:L5V	ENSP00000351125:L5V	L	-	1	2	ECHDC2	53159921	0.006000	0.16342	0.883000	0.34634	0.113000	0.19764	0.494000	0.22467	2.481000	0.83766	0.555000	0.69702	CTG	ECHDC2	-	NULL	ENSG00000121310		0.741	ECHDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ECHDC2	HGNC	protein_coding	OTTHUMT00000024712.3	-	0.00	17	0	G	NM_018281		53387333	-1	tier1	-	no_errors	ENST00000371522	ensembl	human	known	74_37	missense	25.00	12	4	SNP	0.952	C
EGFLAM	133584	genome.wustl.edu	37	5	38438418	38438418	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:38438418C>T	ENST00000354891.3	+	17	2671	c.2325C>T	c.(2323-2325)ttC>ttT	p.F775F	EGFLAM_ENST00000397202.2_Silent_p.F141F|EGFLAM_ENST00000322350.5_Silent_p.F775F|EGFLAM_ENST00000336740.6_Silent_p.F541F	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	775	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.			F -> L (in Ref. 2; CAH56137). {ECO:0000305}.	extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					AGCATGACTTCACCTCCGGAG	0.502																																					Colon(62;485 1295 3347 17454)												0													69.0	72.0	71.0					5																	38438418		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.2325C>T	5.37:g.38438418C>T			A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Silent	SNP	pfam_Laminin_G,pfam_Fibronectin_type3,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Laminin_G	p.F775	ENST00000354891.3	37	c.2325	CCDS56363.1	5																																																																																			EGFLAM	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G	ENSG00000164318		0.502	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	EGFLAM	HGNC	protein_coding	OTTHUMT00000367323.1	-	0.00	51	0	C	NM_152403		38438418	+1	tier1	-	no_errors	ENST00000354891	ensembl	human	known	74_37	silent	18.42	93	21	SNP	0.243	T
EHMT2	10919	genome.wustl.edu	37	6	31847870	31847870	+	Silent	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:31847870G>C	ENST00000375537.4	-	28	3630	c.3624C>G	c.(3622-3624)gtC>gtG	p.V1208V	EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000375530.4_Silent_p.V1174V|EHMT2_ENST00000375528.4_Silent_p.V1231V|SLC44A4_ENST00000544672.1_5'Flank|SLC44A4_ENST00000465707.1_5'Flank|SLC44A4_ENST00000229729.6_5'Flank|SLC44A4_ENST00000375562.4_5'Flank|EHMT2_ENST00000395728.3_Silent_p.V1265V	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	1208					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						CTCATGTGTTGACAGGGGGCA	0.677																																																	0													40.0	44.0	42.0					6																	31847870		1511	2708	4219	SO:0001819	synonymous_variant	0			AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.3624C>G	6.37:g.31847870G>C			B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Silent	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.V1265	ENST00000375537.4	37	c.3795	CCDS4725.1	6																																																																																			EHMT2	-	NULL	ENSG00000204371		0.677	EHMT2-001	KNOWN	basic|CCDS	protein_coding	EHMT2	HGNC	protein_coding	OTTHUMT00000076355.5	-	0.00	114	0	G	NM_006709		31847870	-1	tier1	-	no_errors	ENST00000395728	ensembl	human	known	74_37	silent	28.72	67	27	SNP	0.459	C
EIF2B1	1967	genome.wustl.edu	37	12	124111668	124111668	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:124111668C>T	ENST00000424014.2	-	5	613	c.405G>A	c.(403-405)ctG>ctA	p.L135L	EIF2B1_ENST00000537073.1_Silent_p.L135L|EIF2B1_ENST00000539951.1_Silent_p.L122L	NM_001414.3	NP_001405.1	Q14232	EI2BA_HUMAN	eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa	135					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme regulator activity (GO:0030234)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|translation initiation factor activity (GO:0003743)			breast(1)|kidney(3)|large_intestine(2)|lung(3)|urinary_tract(1)	10	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.67e-05)|Epithelial(86;0.000353)|all cancers(50;0.00489)		CCAGGACTCTCAGGACCACTC	0.522																																																	0													130.0	111.0	117.0					12																	124111668		2203	4300	6503	SO:0001819	synonymous_variant	0			X95648	CCDS31924.1	12q24.3	1998-10-16	2002-08-29		ENSG00000111361	ENSG00000111361			3257	protein-coding gene	gene with protein product		606686	"""eukaryotic translation initiation factor 2B, subunit 1 (alpha, 26kD)"""	EIF2B			Standard	NM_001414		Approved	EIF-2Balpha, EIF-2B, EIF2BA	uc001ufm.3	Q14232	OTTHUMG00000168696	ENST00000424014.2:c.405G>A	12.37:g.124111668C>T			A6NLY9|B4DGX0|Q3SXP4	Silent	SNP	pfam_IF-2B-related	p.L135	ENST00000424014.2	37	c.405	CCDS31924.1	12																																																																																			EIF2B1	-	pfam_IF-2B-related	ENSG00000111361		0.522	EIF2B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2B1	HGNC	protein_coding	OTTHUMT00000400628.1	-	0.00	46	0	C	NM_001414		124111668	-1	tier1	-	no_errors	ENST00000424014	ensembl	human	known	74_37	silent	9.09	50	5	SNP	0.156	T
EIF2B1	1967	genome.wustl.edu	37	12	124111678	124111678	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:124111678C>T	ENST00000424014.2	-	5	603	c.395G>A	c.(394-396)aGa>aAa	p.R132K	EIF2B1_ENST00000537073.1_Missense_Mutation_p.R132K|EIF2B1_ENST00000539951.1_Missense_Mutation_p.R119K	NM_001414.3	NP_001405.1	Q14232	EI2BA_HUMAN	eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa	132					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme regulator activity (GO:0030234)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|translation initiation factor activity (GO:0003743)			breast(1)|kidney(3)|large_intestine(2)|lung(3)|urinary_tract(1)	10	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.67e-05)|Epithelial(86;0.000353)|all cancers(50;0.00489)		CAGGACCACTCTGGAGTAGGC	0.547																																																	0													126.0	107.0	113.0					12																	124111678		2203	4300	6503	SO:0001583	missense	0			X95648	CCDS31924.1	12q24.3	1998-10-16	2002-08-29		ENSG00000111361	ENSG00000111361			3257	protein-coding gene	gene with protein product		606686	"""eukaryotic translation initiation factor 2B, subunit 1 (alpha, 26kD)"""	EIF2B			Standard	NM_001414		Approved	EIF-2Balpha, EIF-2B, EIF2BA	uc001ufm.3	Q14232	OTTHUMG00000168696	ENST00000424014.2:c.395G>A	12.37:g.124111678C>T	ENSP00000416250:p.Arg132Lys		A6NLY9|B4DGX0|Q3SXP4	Missense_Mutation	SNP	pfam_IF-2B-related	p.R132K	ENST00000424014.2	37	c.395	CCDS31924.1	12	.	.	.	.	.	.	.	.	.	.	C	29.0	4.965797	0.92855	.	.	ENSG00000111361	ENST00000424014;ENST00000228958;ENST00000539951;ENST00000537073	D;D;D;D	0.94457	-3.43;-2.88;-2.88;-2.88	5.72	5.72	0.89469	.	0.043163	0.85682	D	0.000000	D	0.92701	0.7680	M	0.64170	1.965	0.58432	D	0.999996	P;B;B	0.39022	0.655;0.157;0.066	B;B;B	0.41202	0.35;0.052;0.149	D	0.90322	0.4345	10	0.30854	T	0.27	-25.8174	10.3132	0.43721	0.0:0.855:0.0:0.145	.	132;119;132	B4DGX0;F5H0D0;Q14232	.;.;EI2BA_HUMAN	K	132;132;119;132	ENSP00000416250:R132K;ENSP00000228958:R132K;ENSP00000438060:R119K;ENSP00000444183:R132K	ENSP00000228958:R132K	R	-	2	0	EIF2B1	122677631	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.879000	0.63100	2.691000	0.91804	0.655000	0.94253	AGA	EIF2B1	-	pfam_IF-2B-related	ENSG00000111361		0.547	EIF2B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2B1	HGNC	protein_coding	OTTHUMT00000400628.1	-	0.00	45	0	C	NM_001414		124111678	-1	tier1	-	no_errors	ENST00000424014	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
ELF5	2001	genome.wustl.edu	37	11	34515144	34515144	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:34515144G>A	ENST00000312319.2	-	3	496	c.267C>T	c.(265-267)ttC>ttT	p.F89F	ELF5_ENST00000532417.1_Silent_p.F79F|ELF5_ENST00000429939.2_Intron|ELF5_ENST00000257832.2_Silent_p.F79F|ELF5_ENST00000528709.1_Intron	NM_001243081.1|NM_198381.1	NP_001230010.1|NP_938195.1	Q9UKW6	ELF5_HUMAN	E74-like factor 5 (ets domain transcription factor)	89	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|ectoderm development (GO:0007398)|mammary gland epithelial cell differentiation (GO:0060644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			large_intestine(4)|skin(1)	5		Acute lymphoblastic leukemia(5;0.0087)|all_hematologic(20;0.0384)				TGAAGTTGCAGAAGGAGATGC	0.557											OREG0020879	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(61;202 1660 4348 21594)												0													96.0	81.0	86.0					11																	34515144		2202	4298	6500	SO:0001819	synonymous_variant	0			AF049703	CCDS7892.1, CCDS7893.1, CCDS58129.1, CCDS73273.1	11p13-p12	2008-05-14			ENSG00000135374	ENSG00000135374			3320	protein-coding gene	gene with protein product		605169				9840936	Standard	NM_001422		Approved		uc001mvp.2	Q9UKW6	OTTHUMG00000166451	ENST00000312319.2:c.267C>T	11.37:g.34515144G>A		848	A6XAE6|A8K452|O95175|Q8N2K9|Q96QY3|Q9UKW5	Silent	SNP	pfam_Ets_dom,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.F89	ENST00000312319.2	37	c.267	CCDS7892.1	11																																																																																			ELF5	-	pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom	ENSG00000135374		0.557	ELF5-002	KNOWN	basic|CCDS	protein_coding	ELF5	HGNC	protein_coding	OTTHUMT00000389845.1	-	0.00	45	0	G	NM_198381		34515144	-1	tier1	-	no_errors	ENST00000312319	ensembl	human	known	74_37	silent	45.16	17	14	SNP	1.000	A
EMP1	2012	genome.wustl.edu	37	12	13364445	13364446	+	Start_Codon_Ins	INS	-	-	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:13364445_13364446insT	ENST00000256951.5	+	0	200_201				EMP1_ENST00000396301.3_Start_Codon_Ins|EMP1_ENST00000544053.1_Intron|EMP1_ENST00000431267.2_Intron|EMP1_ENST00000537612.1_Start_Codon_Ins|EMP1_ENST00000542289.1_3'UTR	NM_001423.2	NP_001414.1	P54849	EMP1_HUMAN	epithelial membrane protein 1						cell growth (GO:0016049)|cell proliferation (GO:0008283)|epidermis development (GO:0008544)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)							Prostate(47;0.194)		BRCA - Breast invasive adenocarcinoma(232;0.153)		AAGAGCCAACATGTTGGTATTG	0.371																																																	0																																										SO:0001582	initiator_codon_variant	0			U43916	CCDS8660.1	12p12.3	2008-08-04				ENSG00000134531			3333	protein-coding gene	gene with protein product		602333				8996089, 9126480	Standard	NM_001423		Approved	TMP, CL-20	uc001rbr.3	P54849		ENST00000256951.5:c.2dupT	12.37:g.13364446_13364446dupT			B2R5N1|B4DRR1|O00681|Q13481|Q13834	Frame_Shift_Ins	INS	pfam_PMP22/EMP/MP20/Claudin,prints_PMP22_EMP_MP20,prints_EMP_1	p.M1fs	ENST00000256951.5	37	c.1_2	CCDS8660.1	12																																																																																			EMP1	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000134531		0.371	EMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMP1	HGNC	protein_coding	OTTHUMT00000401019.1		0.00	66	0	-	NM_001423		13364446	+1	tier1		no_errors	ENST00000256951	ensembl	human	known	74_37	frame_shift_ins	33.33	26	13	INS	1.000:1.000	T
ZNF540	163255	genome.wustl.edu	37	19	38039934	38039934	+	5'Flank	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:38039934G>A	ENST00000592533.1	+	0	0				ZNF571-AS1_ENST00000591430.1_RNA|ZNF571-AS1_ENST00000590838.1_RNA|ZNF571-AS1_ENST00000587121.1_RNA|ZNF571-AS1_ENST00000592392.1_RNA|ZNF571-AS1_ENST00000588382.1_RNA|ZNF571-AS1_ENST00000589750.1_RNA|ZNF571-AS1_ENST00000589802.1_RNA|ZNF571-AS1_ENST00000586139.1_RNA|ZNF571-AS1_ENST00000585578.1_RNA|ZNF571-AS1_ENST00000586013.1_RNA|CTD-3064H18.4_ENST00000316807.2_RNA|ZNF571-AS1_ENST00000592575.1_RNA	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540						negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCTGCCTGAAGAAACCTCAAG	0.627																																																	0																																										SO:0001631	upstream_gene_variant	0			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6			19.37:g.38039934G>A	Exception_encountered		A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	RNA	SNP	-	NULL	ENST00000592533.1	37	NULL	CCDS12506.1	19	.	.	.	.	.	.	.	.	.	.	G	6.664	0.491145	0.12702	.	.	ENSG00000180458	ENST00000316807	.	.	.	0.364	0.364	0.16124	.	.	.	.	.	T	0.54967	0.1891	.	.	.	.	.	.	.	.	.	.	.	.	T	0.65146	-0.6239	3	0.87932	D	0	.	.	.	.	.	.	.	.	F	23	.	ENSP00000324876:S23F	S	-	2	0	AC022148.1	42731774	0.201000	0.23410	0.022000	0.16811	0.021000	0.10359	0.251000	0.18257	0.406000	0.25560	0.407000	0.27541	TCT	CTD-3064H18.4	-	-	ENSG00000180458		0.627	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000180458	Clone_based_vega_gene	protein_coding	OTTHUMT00000459481.1	-	0.00	58	0	G	NM_152606		38039934	-1	tier1	-	no_errors	ENST00000316807	ensembl	human	known	74_37	rna	22.64	41	12	SNP	0.026	A
SLC35F4	341880	genome.wustl.edu	37	14	58096955	58096955	+	Intron	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:58096955G>A	ENST00000556826.1	-	2	340				SLC35F4_ENST00000557430.1_Intron|CTD-2325K12.1_ENST00000600311.1_RNA	NM_001206920.1	NP_001193849.1	A4IF30	S35F4_HUMAN	solute carrier family 35, member F4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|large_intestine(3)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CTATGATGATGATGACAGATA	0.388																																																	0																																										SO:0001627	intron_variant	0					14q22.3	2013-05-22		2003-11-28	ENSG00000151812	ENSG00000151812		"""Solute carriers"""	19845	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 36"""	C14orf36			Standard	NM_001206920		Approved	FLJ37712	uc021rtp.1	A4IF30	OTTHUMG00000171317	ENST00000556826.1:c.104-36113C>T	14.37:g.58096955G>A			A6NDQ3	RNA	SNP	-	NULL	ENST00000556826.1	37	NULL		14																																																																																			CTD-2325K12.1	-	-	ENSG00000258856		0.388	SLC35F4-004	NOVEL	not_organism_supported|upstream_uORF|basic|appris_principal	protein_coding	ENSG00000258856	Clone_based_vega_gene	protein_coding	OTTHUMT00000412973.1	-	0.00	71	0	G	XM_292260		58096955	+1	tier1	-	no_errors	ENST00000600311	ensembl	human	known	74_37	rna	29.51	43	18	SNP	0.821	A
RP11-652G5.1	0	genome.wustl.edu	37	16	32619544	32619544	+	RNA	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:32619544G>C	ENST00000562976.1	+	0	570																											CACTGGCAAAGAGTAAGTATT	0.443																																																	0																																												0																															16.37:g.32619544G>C				RNA	SNP	-	NULL	ENST00000562976.1	37	NULL		16																																																																																			RP11-652G5.1	-	-	ENSG00000259966		0.443	RP11-652G5.1-002	KNOWN	basic	processed_transcript	ENSG00000259966	Clone_based_vega_gene	pseudogene	OTTHUMT00000432347.1	-	0.00	63	0	G			32619544	+1	tier1	-	no_errors	ENST00000562976	ensembl	human	known	74_37	rna	15.79	80	15	SNP	0.000	C
OBSCN	84033	genome.wustl.edu	37	1	228461367	228461367	+	Intron	SNP	A	A	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:228461367A>T	ENST00000422127.1	+	18	5181				RP5-1139B12.2_ENST00000602517.1_RNA|RP5-1139B12.3_ENST00000602947.1_RNA|OBSCN_ENST00000570156.2_Intron|OBSCN_ENST00000366707.4_Intron|OBSCN_ENST00000366709.4_Intron|OBSCN_ENST00000284548.11_Intron|OBSCN_ENST00000359599.6_Intron|RP5-1139B12.3_ENST00000602529.1_RNA	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TTGAAGAGCAATGGGTATCAG	0.597																																																	0																																										SO:0001627	intron_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.5138-104A>T	1.37:g.228461367A>T			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	RNA	SNP	-	NULL	ENST00000422127.1	37	NULL	CCDS58065.1	1																																																																																			RP5-1139B12.2	-	-	ENSG00000269890		0.597	OBSCN-204	KNOWN	basic|CCDS	protein_coding	ENSG00000269890	Clone_based_vega_gene	protein_coding		-	0.00	42	0	A	NM_052843		228461367	-1	tier1	-	no_errors	ENST00000602517	ensembl	human	known	74_37	rna	26.00	37	13	SNP	0.000	T
TNKS	8658	genome.wustl.edu	37	8	9413446	9413446	+	5'UTR	SNP	G	G	A	rs375949097		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:9413446G>A	ENST00000310430.6	+	0	23				TNKS_ENST00000520408.1_5'UTR|RP11-375N15.2_ENST00000607598.1_RNA|TNKS_ENST00000522110.1_5'UTR	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase						mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)			NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		AGGGGAGTCCGAAGATGGCGG	0.652																																																	0													29.0	31.0	31.0					8																	9413446		2197	4297	6494	SO:0001623	5_prime_UTR_variant	0			AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.-4G>A	8.37:g.9413446G>A			O95272|Q4G0F2	RNA	SNP	-	NULL	ENST00000310430.6	37	NULL	CCDS5974.1	8																																																																																			RP11-375N15.2	-	-	ENSG00000272267		0.652	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000272267	Clone_based_vega_gene	protein_coding	OTTHUMT00000206935.1	-	0.00	70	0	G	NM_003747		9413446	-1	tier1	-	no_errors	ENST00000607598	ensembl	human	known	74_37	rna	17.19	53	11	SNP	1.000	A
EP300	2033	genome.wustl.edu	37	22	41565574	41565574	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr22:41565574T>G	ENST00000263253.7	+	26	5459	c.4240T>G	c.(4240-4242)Tat>Gat	p.Y1414D	RNU6-375P_ENST00000517050.1_RNA|RP1-85F18.6_ENST00000415054.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1414	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)	p.Y1414fs*3(1)		NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						GACTGCAGTCTATCATGAAAT	0.333			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	1	Insertion - Frameshift(1)	urinary_tract(1)											89.0	86.0	87.0					22																	41565574		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.4240T>G	22.37:g.41565574T>G	ENSP00000263253:p.Tyr1414Asp		B1AKC2	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX_dom,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX_dom,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX_dom,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.Y1414D	ENST00000263253.7	37	c.4240	CCDS14010.1	22	.	.	.	.	.	.	.	.	.	.	T	20.3	3.970102	0.74246	.	.	ENSG00000100393	ENST00000263253	D	0.94280	-3.39	5.55	5.55	0.83447	.	0.000000	0.41396	D	0.000891	D	0.97820	0.9284	H	0.96175	3.78	0.58432	D	0.999994	D	0.76494	0.999	D	0.87578	0.998	D	0.99187	1.0869	10	0.87932	D	0	-7.4381	15.6988	0.77521	0.0:0.0:0.0:1.0	.	1414	Q09472	EP300_HUMAN	D	1414	ENSP00000263253:Y1414D	ENSP00000263253:Y1414D	Y	+	1	0	EP300	39895520	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.953000	0.87836	2.115000	0.64714	0.455000	0.32223	TAT	EP300	-	pfam_Histone_H3-K56_AcTrfase_RTT109	ENSG00000100393		0.333	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	-	0.00	21	0	T	NM_001429		41565574	+1	tier1	-	no_errors	ENST00000263253	ensembl	human	known	74_37	missense	41.67	14	10	SNP	1.000	G
EP400	57634	genome.wustl.edu	37	12	132547087	132547087	+	Silent	SNP	G	G	A	rs12366766	byFrequency	TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:132547087G>A	ENST00000333577.4	+	48	8392	c.8283G>A	c.(8281-8283)caG>caA	p.Q2761Q	EP400_ENST00000332482.4_Silent_p.Q2688Q|EP400_ENST00000389561.2_Silent_p.Q2725Q|EP400_ENST00000389562.2_Silent_p.Q2724Q|EP400_ENST00000330386.6_Silent_p.Q2644Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2761	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2724Q(16)|p.Q2725Q(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcagcaacaacagc	0.562													G|||	37	0.00738818	0.0038	0.0072	5008	,	,		15585	0.002		0.0149	False		,,,				2504	0.0102																17	Substitution - coding silent(17)	prostate(4)|kidney(4)|central_nervous_system(3)|lung(3)|endometrium(2)|urinary_tract(1)											28.0	31.0	30.0					12																	132547087		2199	4282	6481	SO:0001819	synonymous_variant	0			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8283G>A	12.37:g.132547087G>A			O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q2761	ENST00000333577.4	37	c.8283		12																																																																																			EP400	-	NULL	ENSG00000183495		0.562	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	HGNC	protein_coding		-	0.00	40	0	G	NM_015409		132547087	+1	tier1	rs12366766	no_errors	ENST00000333577	ensembl	human	known	74_37	silent	8.89	41	4	SNP	1.000	A
EP400	57634	genome.wustl.edu	37	12	132547093	132547093	+	Silent	SNP	A	A	G	rs10902490|rs528214697	byFrequency	TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:132547093A>G	ENST00000333577.4	+	48	8398	c.8289A>G	c.(8287-8289)caA>caG	p.Q2763Q	EP400_ENST00000332482.4_Silent_p.Q2690Q|EP400_ENST00000389561.2_Silent_p.Q2727Q|EP400_ENST00000389562.2_Silent_p.Q2726Q|EP400_ENST00000330386.6_Silent_p.Q2646Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2763	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2726Q(9)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacaacagcagcagc	0.567																																																	9	Substitution - coding silent(9)	lung(3)|kidney(2)|endometrium(2)|central_nervous_system(2)											25.0	29.0	28.0					12																	132547093		2173	4217	6390	SO:0001819	synonymous_variant	0			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8289A>G	12.37:g.132547093A>G			O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q2763	ENST00000333577.4	37	c.8289		12																																																																																			EP400	-	NULL	ENSG00000183495		0.567	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	HGNC	protein_coding		-	0.00	40	0	A	NM_015409		132547093	+1	tier1	rs28513925	no_errors	ENST00000333577	ensembl	human	known	74_37	silent	8.89	41	4	SNP	0.900	G
EPHX1	2052	genome.wustl.edu	37	1	226026976	226026976	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:226026976C>A	ENST00000366837.4	+	5	847	c.651C>A	c.(649-651)ttC>ttA	p.F217L	EPHX1_ENST00000272167.5_Missense_Mutation_p.F217L|RP11-285F7.2_ENST00000424332.1_RNA	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	217					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					GGCTGGGCTTCCAGGAATTCT	0.582																																																	0													70.0	77.0	75.0					1																	226026976		2203	4300	6503	SO:0001583	missense	0			J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.651C>A	1.37:g.226026976C>A	ENSP00000355802:p.Phe217Leu		B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	pfam_Epoxide_hydro_N,pfam_AB_hydrolase_1,pirsf_Epoxide_hydrolase,prints_Epox_hydrolase-like	p.F217L	ENST00000366837.4	37	c.651	CCDS1547.1	1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.706053	0.89018	.	.	ENSG00000143819	ENST00000272167;ENST00000366837	T;T	0.03301	3.98;3.98	4.87	3.94	0.45596	Alpha/beta hydrolase fold-1 (1);	0.000000	0.85682	D	0.000000	T	0.14270	0.0345	M	0.67517	2.055	0.80722	D	1	D	0.60160	0.987	D	0.69307	0.963	T	0.00175	-1.1955	10	0.72032	D	0.01	-10.9668	12.8679	0.57949	0.0:0.9206:0.0:0.0793	.	217	P07099	HYEP_HUMAN	L	217	ENSP00000272167:F217L;ENSP00000355802:F217L	ENSP00000272167:F217L	F	+	3	2	EPHX1	224093599	0.997000	0.39634	1.000000	0.80357	0.994000	0.84299	2.471000	0.45127	2.414000	0.81942	0.591000	0.81541	TTC	EPHX1	-	pfam_AB_hydrolase_1,pirsf_Epoxide_hydrolase	ENSG00000143819		0.582	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHX1	HGNC	protein_coding	OTTHUMT00000092064.1	-	0.00	66	0	C	NM_000120		226026976	+1	tier1	-	no_errors	ENST00000272167	ensembl	human	known	74_37	missense	32.84	45	22	SNP	1.000	A
EPHX1	2052	genome.wustl.edu	37	1	226032974	226032974	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:226032974T>A	ENST00000366837.4	+	9	1490	c.1294T>A	c.(1294-1296)Ttt>Att	p.F432I	EPHX1_ENST00000272167.5_Missense_Mutation_p.F432I|RP11-285F7.2_ENST00000424332.1_RNA	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	432					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					TGGGGGCCACTTTGCGGCCTT	0.597																																																	0													57.0	56.0	56.0					1																	226032974		2203	4300	6503	SO:0001583	missense	0			J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.1294T>A	1.37:g.226032974T>A	ENSP00000355802:p.Phe432Ile		B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	pfam_Epoxide_hydro_N,pfam_AB_hydrolase_1,pirsf_Epoxide_hydrolase,prints_Epox_hydrolase-like	p.F432I	ENST00000366837.4	37	c.1294	CCDS1547.1	1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.405935	0.83230	.	.	ENSG00000143819	ENST00000272167;ENST00000366837	T;T	0.36157	1.27;1.27	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.75339	0.3836	H	0.98769	4.325	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85776	0.1358	10	0.87932	D	0	-13.3	14.3723	0.66849	0.0:0.0:0.0:1.0	.	432	P07099	HYEP_HUMAN	I	432	ENSP00000272167:F432I;ENSP00000355802:F432I	ENSP00000272167:F432I	F	+	1	0	EPHX1	224099597	1.000000	0.71417	1.000000	0.80357	0.404000	0.30871	7.852000	0.86927	2.052000	0.61016	0.379000	0.24179	TTT	EPHX1	-	pirsf_Epoxide_hydrolase,prints_Epox_hydrolase-like	ENSG00000143819		0.597	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHX1	HGNC	protein_coding	OTTHUMT00000092064.1	-	0.00	49	0	T	NM_000120		226032974	+1	tier1	-	no_errors	ENST00000272167	ensembl	human	known	74_37	missense	11.76	60	8	SNP	1.000	A
EPX	8288	genome.wustl.edu	37	17	56271143	56271143	+	Missense_Mutation	SNP	G	G	A	rs369339605		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:56271143G>A	ENST00000225371.5	+	4	525	c.415G>A	c.(415-417)Gag>Aag	p.E139K		NM_000502.4	NP_000493.1	P11678	PERE_HUMAN	eosinophil peroxidase	139					defense response to nematode (GO:0002215)|eosinophil migration (GO:0072677)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-5 production (GO:0032714)|positive regulation of interleukin-4 production (GO:0032753)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.E139K(1)		breast(2)|endometrium(9)|kidney(1)|large_intestine(9)|liver(2)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	48					Melatonin(DB01065)	GGACCAGGCCGAGCGCTGCAG	0.657																																																	1	Substitution - Missense(1)	large_intestine(1)						G	LYS/GLU	2,4404	2.1+/-5.4	0,2,2201	37.0	33.0	34.0		415	4.6	0.8	17		34	0,8600		0,0,4300	no	missense	EPX	NM_000502.4	56	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign	139/716	56271143	2,13004	2203	4300	6503	SO:0001583	missense	0			M26515	CCDS11602.1	17q23.1	2006-09-25				ENSG00000121053	1.11.1.7		3423	protein-coding gene	gene with protein product		131399				2550461, 2541222	Standard	NM_000502		Approved	EPO, EPP, EPX-PEN	uc002ivq.3	P11678		ENST00000225371.5:c.415G>A	17.37:g.56271143G>A	ENSP00000225371:p.Glu139Lys		Q4TVP3	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.E139K	ENST00000225371.5	37	c.415	CCDS11602.1	17	.	.	.	.	.	.	.	.	.	.	G	9.801	1.180569	0.21787	4.54E-4	0.0	ENSG00000121053	ENST00000225371	T	0.70399	-0.48	4.6	4.6	0.57074	.	0.309988	0.34959	N	0.003557	T	0.59197	0.2176	M	0.63428	1.95	0.09310	N	1	P	0.37612	0.602	B	0.27796	0.083	T	0.54043	-0.8352	10	0.24483	T	0.36	-26.4847	9.0188	0.36186	0.1029:0.0:0.8971:0.0	.	139	P11678	PERE_HUMAN	K	139	ENSP00000225371:E139K	ENSP00000225371:E139K	E	+	1	0	EPX	53626142	0.459000	0.25768	0.822000	0.32727	0.017000	0.09413	3.558000	0.53749	2.263000	0.75096	0.442000	0.29010	GAG	EPX	-	superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000121053		0.657	EPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPX	HGNC	protein_coding	OTTHUMT00000443367.1	-	0.00	40	0	G	NM_000502		56271143	+1	tier1	-	no_errors	ENST00000225371	ensembl	human	known	74_37	missense	31.58	39	18	SNP	0.123	A
ERVK13-1	100507321	genome.wustl.edu	37	16	2711935	2711935	+	RNA	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:2711935G>C	ENST00000568395.1	-	0	4792					NR_040023.1		Q9NX77	ENK13_HUMAN	endogenous retrovirus group K13, member 1							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)	structural molecule activity (GO:0005198)										actgcaataagagtaaaaata	0.428																																																	0													9.0	8.0	8.0					16																	2711935		691	1577	2268			0					16p13.3	2011-12-16				ENSG00000260565			27548	other	endogenous retrovirus	"""HERV-K_16p3.3 provirus ancestral Env polyprotein"""						Standard	NR_040023		Approved		uc010bss.2	Q9NX77			16.37:g.2711935G>C			A8K9G3	RNA	SNP	-	NULL	ENST00000568395.1	37	NULL		16																																																																																			ERVK13-1	-	-	ENSG00000260565		0.428	ERVK13-1-001	KNOWN	basic	lincRNA	ERVK13-1	HGNC	processed_transcript	OTTHUMT00000431428.1		0.00	18	0	G	NR_040023		2711935	-1			no_errors	ENST00000568395	ensembl	human	known	74_37	rna	12.12	29	4	SNP	0.308	C
EXOC3L1	283849	genome.wustl.edu	37	16	67223572	67223572	+	Nonsense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:67223572G>C	ENST00000314586.6	-	2	248	c.8C>G	c.(7-9)tCa>tGa	p.S3*	E2F4_ENST00000379378.3_5'Flank|EXOC3L1_ENST00000562887.1_5'UTR	NM_178516.3	NP_848611.2	Q86VI1	EX3L1_HUMAN	exocyst complex component 3-like 1	3	Mediates interaction with EXOC2, EXOC4 and EXOC5. {ECO:0000250}.				exocytosis (GO:0006887)|peptide hormone secretion (GO:0030072)	exocyst (GO:0000145)|secretory granule (GO:0030141)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	21						CTTGGCTGCTGAGTCCATTGT	0.602																																																	0													72.0	51.0	58.0					16																	67223572		2198	4300	6498	SO:0001587	stop_gained	0			AK092858	CCDS10832.1	16q22.1	2011-01-31	2011-01-31	2011-01-31	ENSG00000179044	ENSG00000179044			27540	protein-coding gene	gene with protein product		614117	"""exocyst complex component 3-like"""	EXOC3L		12477932	Standard	NM_178516		Approved	FLJ35539, FLJ35587	uc002erx.1	Q86VI1	OTTHUMG00000137508	ENST00000314586.6:c.8C>G	16.37:g.67223572G>C	ENSP00000325674:p.Ser3*		A8K7I9|Q8NAD2|Q8TEN2	Nonsense_Mutation	SNP	pfam_Sec6	p.S3*	ENST00000314586.6	37	c.8	CCDS10832.1	16	.	.	.	.	.	.	.	.	.	.	G	34	5.322734	0.95708	.	.	ENSG00000179044	ENST00000314586;ENST00000545725;ENST00000314553	.	.	.	3.61	3.61	0.41365	.	1.286100	0.05530	N	0.563858	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-0.077	11.0346	0.47793	0.0:0.0:1.0:0.0	.	.	.	.	X	3	.	ENSP00000325008:S3X	S	-	2	0	EXOC3L1	65781073	0.997000	0.39634	0.692000	0.30179	0.605000	0.37080	3.770000	0.55310	2.322000	0.78497	0.462000	0.41574	TCA	EXOC3L1	-	NULL	ENSG00000179044		0.602	EXOC3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC3L1	HGNC	protein_coding	OTTHUMT00000268827.2		0.00	76	0	G	NM_178516		67223572	-1			no_errors	ENST00000314586	ensembl	human	known	74_37	nonsense	6.49	72	5	SNP	0.720	C
EXOC3L4	91828	genome.wustl.edu	37	14	103569048	103569048	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:103569048G>A	ENST00000380069.3	+	2	1064	c.988G>A	c.(988-990)Gac>Aac	p.D330N		NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	330					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						GCTCGCGCGCGACGCCCGCGG	0.716																																																	0													4.0	5.0	5.0					14																	103569048		1989	3915	5904	SO:0001583	missense	0			AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.988G>A	14.37:g.103569048G>A	ENSP00000369409:p.Asp330Asn		Q14CR2	Missense_Mutation	SNP	pfam_Sec6	p.D330N	ENST00000380069.3	37	c.988	CCDS32163.1	14	.	.	.	.	.	.	.	.	.	.	G	10.58	1.390681	0.25118	.	.	ENSG00000205436	ENST00000380069	T	0.06371	3.31	4.09	2.19	0.27852	.	0.820074	0.10809	N	0.631830	T	0.06096	0.0158	L	0.36672	1.1	0.09310	N	1	B	0.18863	0.031	B	0.17722	0.019	T	0.37619	-0.9698	10	0.46703	T	0.11	-10.7961	6.8603	0.24064	0.1024:0.1792:0.7185:0.0	.	330	Q17RC7	EX3L4_HUMAN	N	330	ENSP00000369409:D330N	ENSP00000369409:D330N	D	+	1	0	EXOC3L4	102638801	0.000000	0.05858	0.159000	0.22649	0.261000	0.26267	0.057000	0.14279	0.361000	0.24292	0.491000	0.48974	GAC	EXOC3L4	-	pfam_Sec6	ENSG00000205436		0.716	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC3L4	HGNC	protein_coding	OTTHUMT00000415663.1		0.00	10	0	G	XM_941093		103569048	+1			no_errors	ENST00000380069	ensembl	human	known	74_37	missense	50.00	2	2	SNP	0.126	A
FAM135A	57579	genome.wustl.edu	37	6	71236164	71236164	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:71236164G>A	ENST00000418814.2	+	15	3991	c.3377G>A	c.(3376-3378)aGa>aAa	p.R1126K	FAM135A_ENST00000505769.1_Missense_Mutation_p.R706K|FAM135A_ENST00000361499.3_Missense_Mutation_p.R930K|FAM135A_ENST00000457062.2_Missense_Mutation_p.R913K|FAM135A_ENST00000505868.1_Missense_Mutation_p.R1126K|FAM135A_ENST00000370479.3_Missense_Mutation_p.R913K	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A	1126										breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						ATGGAAGAAAGACTTACAAAA	0.368																																																	0													121.0	127.0	125.0					6																	71236164		2203	4300	6503	SO:0001583	missense	0			AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.3377G>A	6.37:g.71236164G>A	ENSP00000410768:p.Arg1126Lys		A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Missense_Mutation	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like,pfam_LACT/PDAT_acylTrfase	p.R1126K	ENST00000418814.2	37	c.3377	CCDS55028.1	6	.	.	.	.	.	.	.	.	.	.	G	1.117	-0.656590	0.03480	.	.	ENSG00000082269	ENST00000418814;ENST00000370479;ENST00000505769;ENST00000457062;ENST00000361499;ENST00000505868	T;T;T;T;T;T	0.21191	2.34;2.34;2.02;2.34;2.34;2.33	5.96	5.0	0.66597	.	0.527817	0.22150	N	0.063937	T	0.03263	0.0095	L	0.34521	1.04	0.09310	N	1	B;B;B;B	0.06786	0.001;0.0;0.001;0.001	B;B;B;B	0.12837	0.002;0.001;0.008;0.002	T	0.45145	-0.9281	10	0.02654	T	1	.	4.5261	0.11981	0.2525:0.1993:0.5482:0.0	.	1126;1126;930;913	Q9P2D6-4;Q9P2D6;Q9P2D6-2;Q9P2D6-3	.;F135A_HUMAN;.;.	K	1126;913;706;913;930;1126	ENSP00000410768:R1126K;ENSP00000359510:R913K;ENSP00000423785:R706K;ENSP00000409201:R913K;ENSP00000354913:R930K;ENSP00000423307:R1126K	ENSP00000354913:R930K	R	+	2	0	FAM135A	71292885	0.993000	0.37304	0.080000	0.20451	0.096000	0.18686	2.809000	0.47971	1.399000	0.46721	0.655000	0.94253	AGA	FAM135A	-	NULL	ENSG00000082269		0.368	FAM135A-001	KNOWN	basic|CCDS	protein_coding	FAM135A	HGNC	protein_coding	OTTHUMT00000041137.2	-	0.00	31	0	G	NM_020819		71236164	+1	tier1	-	no_errors	ENST00000418814	ensembl	human	known	74_37	missense	15.79	32	6	SNP	0.218	A
FAM83G	644815	genome.wustl.edu	37	17	18882138	18882138	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:18882138C>T	ENST00000388995.6	-	5	1064	c.841G>A	c.(841-843)Gac>Aac	p.D281N	FAM83G_ENST00000585154.2_Missense_Mutation_p.D281N|FAM83G_ENST00000345041.4_Missense_Mutation_p.D281N|SLC5A10_ENST00000395643.2_Intron|SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000417251.2_Intron|SLC5A10_ENST00000317977.6_Intron|SLC5A10_ENST00000395645.3_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	281					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						ACATTCCGGTCCGTCCGCGCG	0.637																																																	0													46.0	50.0	49.0					17																	18882138		2157	4249	6406	SO:0001583	missense	0			AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.841G>A	17.37:g.18882138C>T	ENSP00000373647:p.Asp281Asn		Q3KQZ4|Q6ZW60	Missense_Mutation	SNP	pfam_DUF1669	p.D281N	ENST00000388995.6	37	c.841	CCDS42276.1	17	.	.	.	.	.	.	.	.	.	.	C	26.3	4.726658	0.89298	.	.	ENSG00000188522	ENST00000388995;ENST00000345041	T;T	0.18174	2.23;2.23	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.29028	0.0721	L	0.35723	1.085	0.50467	D	0.999871	D	0.57571	0.98	D	0.62955	0.909	T	0.02320	-1.1177	10	0.13853	T	0.58	-39.1033	18.558	0.91091	0.0:1.0:0.0:0.0	.	281	A6ND36	FA83G_HUMAN	N	281	ENSP00000373647:D281N;ENSP00000343279:D281N	ENSP00000343279:D281N	D	-	1	0	FAM83G	18822863	1.000000	0.71417	0.998000	0.56505	0.922000	0.55478	6.089000	0.71384	2.377000	0.81083	0.561000	0.74099	GAC	FAM83G	-	pfam_DUF1669	ENSG00000188522		0.637	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM83G	HGNC	protein_coding	OTTHUMT00000253108.4	-	0.00	61	0	C			18882138	-1	tier1	-	no_errors	ENST00000345041	ensembl	human	known	74_37	missense	24.14	22	7	SNP	1.000	T
FAM83G	644815	genome.wustl.edu	37	17	18907093	18907093	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:18907093G>A	ENST00000388995.6	-	2	485	c.262C>T	c.(262-264)Cag>Tag	p.Q88*	FAM83G_ENST00000585154.2_Nonsense_Mutation_p.Q88*|FAM83G_ENST00000345041.4_Nonsense_Mutation_p.Q88*|SLC5A10_ENST00000395643.2_Intron|SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000417251.2_Intron|SLC5A10_ENST00000317977.6_Intron|SLC5A10_ENST00000395645.3_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	88					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						TCGGGCCCCTGAGAGGGGCCC	0.701																																																	0																																										SO:0001587	stop_gained	0			AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.262C>T	17.37:g.18907093G>A	ENSP00000373647:p.Gln88*		Q3KQZ4|Q6ZW60	Nonsense_Mutation	SNP	pfam_DUF1669	p.Q88*	ENST00000388995.6	37	c.262	CCDS42276.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.087375	0.97271	.	.	ENSG00000188522	ENST00000388995;ENST00000345041;ENST00000399096	.	.	.	4.79	1.22	0.21188	.	7.777730	0.00589	U	0.000352	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-3.6454	8.642	0.33983	0.0993:0.2826:0.6181:0.0	.	.	.	.	X	88	.	ENSP00000343279:Q88X	Q	-	1	0	FAM83G	18847818	0.000000	0.05858	0.004000	0.12327	0.305000	0.27757	0.222000	0.17699	0.985000	0.38656	0.491000	0.48974	CAG	FAM83G	-	pfam_DUF1669	ENSG00000188522		0.701	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM83G	HGNC	protein_coding	OTTHUMT00000253108.4	-	0.00	65	0	G			18907093	-1	tier1	-	no_errors	ENST00000345041	ensembl	human	known	74_37	nonsense	42.86	28	21	SNP	0.000	A
FAM83G	644815	genome.wustl.edu	37	17	18907111	18907111	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:18907111G>A	ENST00000388995.6	-	2	467	c.244C>T	c.(244-246)Cgg>Tgg	p.R82W	FAM83G_ENST00000585154.2_Missense_Mutation_p.R82W|FAM83G_ENST00000345041.4_Missense_Mutation_p.R82W|SLC5A10_ENST00000395643.2_Intron|SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000417251.2_Intron|SLC5A10_ENST00000317977.6_Intron|SLC5A10_ENST00000395645.3_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	82					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						CCCGTGCCCCGAGGGTCCTCA	0.697																																																	0													16.0	19.0	18.0					17																	18907111		1847	4084	5931	SO:0001583	missense	0			AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.244C>T	17.37:g.18907111G>A	ENSP00000373647:p.Arg82Trp		Q3KQZ4|Q6ZW60	Missense_Mutation	SNP	pfam_DUF1669	p.R82W	ENST00000388995.6	37	c.244	CCDS42276.1	17	.	.	.	.	.	.	.	.	.	.	G	10.93	1.491068	0.26774	.	.	ENSG00000188522	ENST00000388995;ENST00000345041;ENST00000399096	T;T	0.13901	2.55;2.55	4.79	2.67	0.31697	.	.	.	.	.	T	0.33089	0.0851	M	0.68593	2.085	0.18873	N	0.999987	D	0.89917	1.0	D	0.70935	0.971	T	0.08680	-1.0710	9	0.72032	D	0.01	-21.1307	11.6166	0.51094	0.0:0.0:0.5034:0.4966	.	82	A6ND36	FA83G_HUMAN	W	82	ENSP00000373647:R82W;ENSP00000343279:R82W	ENSP00000343279:R82W	R	-	1	2	FAM83G	18847836	0.043000	0.20138	0.031000	0.17742	0.860000	0.49131	1.430000	0.34914	0.360000	0.24265	0.491000	0.48974	CGG	FAM83G	-	pfam_DUF1669	ENSG00000188522		0.697	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM83G	HGNC	protein_coding	OTTHUMT00000253108.4	-	0.00	85	0	G			18907111	-1	tier1	-	no_errors	ENST00000345041	ensembl	human	known	74_37	missense	43.75	36	28	SNP	0.116	A
FARP1	10160	genome.wustl.edu	37	13	99087937	99087937	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr13:99087937G>T	ENST00000319562.6	+	19	2516	c.2251G>T	c.(2251-2253)Gac>Tac	p.D751Y	FARP1-AS1_ENST00000432229.1_RNA|FARP1_ENST00000595437.1_Missense_Mutation_p.D751Y|FARP1_ENST00000376586.2_Missense_Mutation_p.D751Y	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	751					dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			GATTGGCATTGACAATCTTGT	0.512																																																	0													132.0	119.0	123.0					13																	99087937		2203	4300	6503	SO:0001583	missense	0			AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.2251G>T	13.37:g.99087937G>T	ENSP00000322926:p.Asp751Tyr		Q5JVI9|Q6IQ29	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM-adjacent,pfam_FERM_central,superfamily_DH-domain,superfamily_FERM_central,smart_Band_41_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_FERM_domain,pfscan_Pleckstrin_homology,pfscan_DH-domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.D751Y	ENST00000319562.6	37	c.2251	CCDS9487.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.6|25.6	4.654256|4.654256	0.88056|0.88056	.|.	.|.	ENSG00000152767|ENSG00000152767	ENST00000376586;ENST00000319562|ENST00000423063	T;T|.	0.65178|.	-0.14;-0.14|.	5.8|5.8	5.8|5.8	0.92144|0.92144	Pleckstrin homology-type (1);|.	0.097281|.	0.64402|.	D|.	0.000001|.	T|T	0.74913|0.74913	0.3779|0.3779	M|M	0.64404|0.64404	1.975|1.975	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.85130|.	0.985;0.997|.	T|T	0.71481|0.71481	-0.4580|-0.4580	10|5	0.87932|.	D|.	0|.	.|.	20.063|20.063	0.97692|0.97692	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	751;751|.	Q9Y4F1;C9JME2|.	FARP1_HUMAN;.|.	Y|F	751|53	ENSP00000365771:D751Y;ENSP00000322926:D751Y|.	ENSP00000322926:D751Y|.	D|L	+|+	1|3	0|2	FARP1|FARP1	97885938|97885938	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.788000|0.788000	0.44548|0.44548	9.441000|9.441000	0.97557|0.97557	2.735000|2.735000	0.93741|0.93741	0.655000|0.655000	0.94253|0.94253	GAC|TTG	FARP1	-	NULL	ENSG00000152767		0.512	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARP1	HGNC	protein_coding	OTTHUMT00000045541.3	-	0.00	23	0	G	NM_005766		99087937	+1	tier1	-	no_errors	ENST00000376586	ensembl	human	known	74_37	missense	61.54	10	16	SNP	1.000	T
FAT3	120114	genome.wustl.edu	37	11	92538330	92538330	+	Nonsense_Mutation	SNP	C	C	T	rs563792009		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:92538330C>T	ENST00000298047.6	+	10	8925	c.8908C>T	c.(8908-8910)Cga>Tga	p.R2970*	FAT3_ENST00000525166.1_Nonsense_Mutation_p.R2820*|FAT3_ENST00000409404.2_Nonsense_Mutation_p.R2970*			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2970	Cadherin 27. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGGAAACCCTCGAGGAAGGTT	0.433										TCGA Ovarian(4;0.039)																																							0													65.0	66.0	66.0					11																	92538330		1860	4093	5953	SO:0001587	stop_gained	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8908C>T	11.37:g.92538330C>T	ENSP00000298047:p.Arg2970*		B5MDB0|Q96AU6	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.R2970*	ENST00000298047.6	37	c.8908		11	.	.	.	.	.	.	.	.	.	.	C	50	17.121175	0.99879	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	.	.	.	6.06	4.02	0.46733	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	12.479	0.55831	0.5627:0.4373:0.0:0.0	.	.	.	.	X	2970;2970;2820	.	ENSP00000298047:R2970X	R	+	1	2	FAT3	92177978	0.650000	0.27331	1.000000	0.80357	0.992000	0.81027	1.284000	0.33249	1.530000	0.49136	0.650000	0.86243	CGA	FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.433	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		-	0.00	32	0	C	NM_001008781		92538330	+1	tier1	-	no_errors	ENST00000298047	ensembl	human	known	74_37	nonsense	21.43	33	9	SNP	1.000	T
FGD4	121512	genome.wustl.edu	37	12	32754265	32754265	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:32754265G>C	ENST00000427716.2	+	6	1168	c.744G>C	c.(742-744)gaG>gaC	p.E248D	FGD4_ENST00000531134.1_Missense_Mutation_p.E333D|FGD4_ENST00000546442.1_Missense_Mutation_p.E155D|FGD4_ENST00000266482.3_5'UTR|FGD4_ENST00000381025.3_5'UTR|FGD4_ENST00000525053.1_Missense_Mutation_p.E360D|FGD4_ENST00000534526.2_Missense_Mutation_p.E385D	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	248	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					TTCCAGCAGAGATGGTGAATA	0.353																																																	0													74.0	85.0	81.0					12																	32754265		2203	4300	6503	SO:0001583	missense	0			AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.744G>C	12.37:g.32754265G>C	ENSP00000394487:p.Glu248Asp		Q6ULS2|Q8TCP6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.E248D	ENST00000427716.2	37	c.744	CCDS8727.1	12	.	.	.	.	.	.	.	.	.	.	G	11.30	1.599496	0.28534	.	.	ENSG00000139132	ENST00000534526;ENST00000531134;ENST00000427716;ENST00000546442;ENST00000525053	T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12	4.86	4.86	0.63082	Dbl homology (DH) domain (5);	0.000000	0.50627	D	0.000116	T	0.37652	0.1011	N	0.11106	0.095	0.80722	D	1	B;B;P	0.35307	0.066;0.016;0.494	B;B;B	0.37550	0.169;0.139;0.253	T	0.25328	-1.0135	10	0.15066	T	0.55	-19.6486	5.7718	0.18257	0.2301:0.0:0.7699:0.0	.	360;333;248	E9PJX4;B7Z493;Q96M96	.;.;FGD4_HUMAN	D	385;333;248;155;360	ENSP00000449273:E385D;ENSP00000431323:E333D;ENSP00000394487:E248D;ENSP00000446695:E155D;ENSP00000433666:E360D	ENSP00000394487:E248D	E	+	3	2	FGD4	32645532	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.744000	0.26245	2.517000	0.84864	0.561000	0.74099	GAG	FGD4	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000139132		0.353	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD4	HGNC	protein_coding	OTTHUMT00000268017.1	-	0.00	40	0	G	NM_139241		32754265	+1	tier1	-	no_errors	ENST00000427716	ensembl	human	known	74_37	missense	21.74	18	5	SNP	1.000	C
FHAD1	114827	genome.wustl.edu	37	1	15701080	15701080	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:15701080C>G	ENST00000375998.4	+	25	3464	c.3464C>G	c.(3463-3465)tCt>tGt	p.S1155C	FHAD1_ENST00000375999.3_Missense_Mutation_p.S1155C|FHAD1_ENST00000314740.8_Missense_Mutation_p.S408C|FHAD1_ENST00000417793.1_Missense_Mutation_p.S1119C|FHAD1_ENST00000471347.1_3'UTR|FHAD1_ENST00000358897.4_Missense_Mutation_p.S1155C			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	1155										skin(1)|stomach(1)	2						AAGGCCTTATCTGAACTTCGA	0.562																																																	0													66.0	60.0	62.0					1																	15701080		692	1591	2283	SO:0001583	missense	0			AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.3464C>G	1.37:g.15701080C>G	ENSP00000365166:p.Ser1155Cys		Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.S1155C	ENST00000375998.4	37	c.3464		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.31|18.31	3.596188|3.596188	0.66332|0.66332	.|.	.|.	ENSG00000142621|ENSG00000142621	ENST00000444385|ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998;ENST00000529606;ENST00000314740;ENST00000314668	.|T;T;T;T;T;T;T	.|0.52295	.|0.67;0.69;0.67;0.67;0.71;0.73;0.7	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	.|.	.|.	.|.	.|.	T|T	0.68979|0.68979	0.3060|0.3060	M|M	0.74881|0.74881	2.28|2.28	0.30839|0.30839	N|N	0.735894|0.735894	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.87578	.|0.998;0.973	T|T	0.70146|0.70146	-0.4952|-0.4952	5|9	.|0.62326	.|D	.|0.03	.|.	15.0864|15.0864	0.72158|0.72158	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|408;1155	.|B7WPP2;B1AJZ9	.|.;FHAD1_HUMAN	V|C	474|1155;1119;1155;1155;426;408;390	.|ENSP00000351770:S1155C;ENSP00000407615:S1119C;ENSP00000365167:S1155C;ENSP00000365166:S1155C;ENSP00000434909:S426C;ENSP00000322979:S408C;ENSP00000318812:S390C	.|ENSP00000318812:S390C	L|S	+|+	1|2	2|0	FHAD1|FHAD1	15573667|15573667	0.993000|0.993000	0.37304|0.37304	0.990000|0.990000	0.47175|0.47175	0.943000|0.943000	0.58893|0.58893	3.413000|3.413000	0.52686|0.52686	2.697000|2.697000	0.92050|0.92050	0.650000|0.650000	0.86243|0.86243	CTG|TCT	FHAD1	-	NULL	ENSG00000142621		0.562	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	FHAD1	HGNC	protein_coding	OTTHUMT00000393400.2	-	0.00	31	0	C	NM_052929		15701080	+1	tier1	-	no_errors	ENST00000375999	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.996	G
FHDC1	85462	genome.wustl.edu	37	4	153896730	153896730	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr4:153896730G>A	ENST00000511601.1	+	12	2475	c.2287G>A	c.(2287-2289)Gag>Aag	p.E763K	FHDC1_ENST00000260008.3_Missense_Mutation_p.E763K			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	763									ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					CAGCGACCCTGAGAACAAAGA	0.612																																																	0													58.0	59.0	58.0					4																	153896730		2203	4300	6503	SO:0001583	missense	0			AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.2287G>A	4.37:g.153896730G>A	ENSP00000427567:p.Glu763Lys			Missense_Mutation	SNP	pfam_FH2_Formin,smart_FH2_Formin	p.E763K	ENST00000511601.1	37	c.2287	CCDS34081.1	4	.	.	.	.	.	.	.	.	.	.	G	14.11	2.437102	0.43224	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.33865	1.39;1.39	5.47	5.47	0.80525	.	0.472673	0.21336	N	0.076213	T	0.36936	0.0985	L	0.29908	0.895	0.27999	N	0.935348	D	0.53151	0.958	P	0.49502	0.613	T	0.21381	-1.0247	10	0.15066	T	0.55	.	19.3415	0.94344	0.0:0.0:1.0:0.0	.	763	Q9C0D6	FHDC1_HUMAN	K	763	ENSP00000427567:E763K;ENSP00000260008:E763K	ENSP00000260008:E763K	E	+	1	0	FHDC1	154116180	0.998000	0.40836	0.114000	0.21550	0.216000	0.24613	4.314000	0.59166	2.561000	0.86390	0.563000	0.77884	GAG	FHDC1	-	NULL	ENSG00000137460		0.612	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHDC1	HGNC	protein_coding	OTTHUMT00000364981.2		0.00	42	0	G	NM_033393		153896730	+1			no_errors	ENST00000260008	ensembl	human	known	74_37	missense	6.25	45	3	SNP	0.531	A
FMO2	2327	genome.wustl.edu	37	1	171165874	171165874	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:171165874G>A	ENST00000209929.7	+	4	566	c.408G>A	c.(406-408)caG>caA	p.Q136Q	RP1-127D3.4_ENST00000445909.1_RNA|FMO2_ENST00000529935.1_3'UTR|FMO2_ENST00000441535.1_Silent_p.Q136Q|RP1-127D3.4_ENST00000422841.1_RNA|RP1-127D3.4_ENST00000445290.1_RNA			P31512	FMO4_HUMAN	flavin containing monooxygenase 2 (non-functional)	136					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	22	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GCAAGGAGCAGAGTGCTGTCT	0.493																																																	0													162.0	136.0	145.0					1																	171165874		2203	4300	6503	SO:0001819	synonymous_variant	0			BC005894	CCDS1293.1	1q24.3	2011-08-04	2006-07-17		ENSG00000094963	ENSG00000094963			3770	protein-coding gene	gene with protein product		603955	"""flavin containing monooxygenase 2"""			1417778, 9804831	Standard	XR_426768		Approved		uc001ghk.1	Q99518	OTTHUMG00000035504	ENST00000209929.7:c.408G>A	1.37:g.171165874G>A			Q53XR0	Silent	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_Flavin_mOase,prints_Flavin_mOase_2,prints_Flavin_mOase_1,prints_Flavin_mOase_5	p.Q136	ENST00000209929.7	37	c.408	CCDS1293.1	1																																																																																			FMO2	-	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_Flavin_mOase	ENSG00000094963		0.493	FMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO2	HGNC	protein_coding	OTTHUMT00000086216.2	-	0.00	75	0	G	NM_001460		171165874	+1	tier1	-	no_errors	ENST00000209929	ensembl	human	known	74_37	silent	11.40	101	13	SNP	0.000	A
FRS3	10817	genome.wustl.edu	37	6	41744689	41744689	+	Missense_Mutation	SNP	C	C	T	rs367802861		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:41744689C>T	ENST00000373018.3	-	3	288	c.37G>A	c.(37-39)Gtt>Att	p.V13I	FRS3_ENST00000259748.2_Missense_Mutation_p.V13I|FRS3_ENST00000466420.1_5'UTR	NM_006653.3	NP_006644.1	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3	13	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				fibroblast growth factor receptor signaling pathway (GO:0008543)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TTGTCTGGAACGCTGTCTCTG	0.542																																																	0													186.0	158.0	168.0					6																	41744689		2203	4300	6503	SO:0001583	missense	0			AF036718	CCDS4860.1	6p21.1	2010-08-05			ENSG00000137218	ENSG00000137218			16970	protein-coding gene	gene with protein product		607744				8761293, 9660748	Standard	NM_006653		Approved	SNT-2, FRS2beta, FRS2B	uc003orc.1	O43559	OTTHUMG00000014686	ENST00000373018.3:c.37G>A	6.37:g.41744689C>T	ENSP00000362109:p.Val13Ile		Q5T3D5	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.V13I	ENST00000373018.3	37	c.37	CCDS4860.1	6	.	.	.	.	.	.	.	.	.	.	C	8.392	0.839874	0.16891	.	.	ENSG00000137218	ENST00000373018;ENST00000259748;ENST00000426290;ENST00000422888	D;D;D	0.82433	-1.61;-1.61;-1.61	5.95	-0.354	0.12591	Insulin receptor substrate-1, PTB (1);	0.468795	0.23095	N	0.052000	T	0.35566	0.0936	N	0.05306	-0.075	0.29191	N	0.875856	B	0.02656	0.0	B	0.01281	0.0	T	0.30794	-0.9966	10	0.13470	T	0.59	-19.9252	6.1526	0.20320	0.0:0.3843:0.2227:0.393	.	13	O43559	FRS3_HUMAN	I	13;13;37;13	ENSP00000362109:V13I;ENSP00000259748:V13I;ENSP00000396715:V37I	ENSP00000259748:V13I	V	-	1	0	FRS3	41852667	0.000000	0.05858	0.998000	0.56505	0.585000	0.36419	-1.345000	0.02637	0.067000	0.16545	-0.222000	0.12452	GTT	FRS3	-	pfscan_Insln_rcpt_S1	ENSG00000137218		0.542	FRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRS3	HGNC	protein_coding	OTTHUMT00000040532.2	-	0.00	67	0	C	NM_006653		41744689	-1	tier1	-	no_errors	ENST00000259748	ensembl	human	known	74_37	missense	15.79	64	12	SNP	0.966	T
FTH1	2495	genome.wustl.edu	37	11	61734848	61734848	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:61734848G>A	ENST00000273550.7	-	1	284	c.50C>T	c.(49-51)tCa>tTa	p.S17L	FTH1_ENST00000532601.1_5'Flank|FTH1_ENST00000529631.1_Missense_Mutation_p.S17L|AP003733.1_ENST00000601917.1_5'Flank|FTH1_ENST00000529191.1_Missense_Mutation_p.S17L|FTH1_ENST00000526640.1_Intron	NM_002032.2	NP_002023.2	P02794	FRIH_HUMAN	ferritin, heavy polypeptide 1	17	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|intracellular sequestering of iron ion (GO:0006880)|iron ion transport (GO:0006826)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|post-Golgi vesicle-mediated transport (GO:0006892)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular ferritin complex (GO:0008043)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)|iron ion binding (GO:0005506)			NS(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8					Iron Dextran(DB00893)	GGCGGCCTCTGAGTCCTGGTG	0.701																																																	0													10.0	11.0	11.0					11																	61734848		1916	4028	5944	SO:0001583	missense	0				CCDS41655.1	11q13	2012-10-02			ENSG00000167996	ENSG00000167996			3976	protein-coding gene	gene with protein product	"""apoferritin"", ""placenta immunoregulatory factor"", ""proliferation-inducing protein 15"""	134770		FTHL6		3020541	Standard	NM_002032		Approved	FTH, PLIF, PIG15, FHC	uc001nsu.3	P02794		ENST00000273550.7:c.50C>T	11.37:g.61734848G>A	ENSP00000273550:p.Ser17Leu		B3KNR5|Q3KRA8|Q3SWW1	Missense_Mutation	SNP	pfam_Ferritin_DPS_dom,superfamily_Ferritin-like_SF,pfscan_Ferritin-like_diiron	p.S17L	ENST00000273550.7	37	c.50	CCDS41655.1	11	.	.	.	.	.	.	.	.	.	.	.	18.72	3.684536	0.68157	.	.	ENSG00000167996	ENST00000529191;ENST00000529631;ENST00000530019;ENST00000273550;ENST00000406545	T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17	4.76	3.85	0.44370	Ferritin/ribonucleotide reductase-like (1);Ferritin-related (1);Ferritin-like (1);	0.343345	0.33290	N	0.005071	T	0.53642	0.1809	L	0.50847	1.595	0.80722	D	1	B	0.13594	0.008	B	0.15052	0.012	T	0.54510	-0.8283	10	0.87932	D	0	.	8.4783	0.33027	0.0894:0.2724:0.6383:0.0	.	17	P02794	FRIH_HUMAN	L	17;17;17;17;66	ENSP00000431659:S17L;ENSP00000431575:S17L;ENSP00000433470:S17L;ENSP00000273550:S17L	ENSP00000273550:S17L	S	-	2	0	FTH1	61491424	1.000000	0.71417	0.992000	0.48379	0.973000	0.67179	3.171000	0.50824	1.100000	0.41517	0.484000	0.47621	TCA	FTH1	-	superfamily_Ferritin-like_SF,pfscan_Ferritin-like_diiron	ENSG00000167996		0.701	FTH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTH1	HGNC	protein_coding	OTTHUMT00000388444.1	-	0.00	32	0	G	NM_002032		61734848	-1	tier1	-	no_errors	ENST00000273550	ensembl	human	known	74_37	missense	30.77	18	8	SNP	0.997	A
GABRG2	2566	genome.wustl.edu	37	5	161524723	161524723	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:161524723G>A	ENST00000361925.4	+	4	627	c.407G>A	c.(406-408)cGa>cAa	p.R136Q	GABRG2_ENST00000356592.3_Missense_Mutation_p.R136Q|GABRG2_ENST00000414552.2_Missense_Mutation_p.R136Q|GABRG2_ENST00000393933.4_Missense_Mutation_p.R41Q			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	136					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AAAGTCCTCCGATTGAACAGC	0.383																																																	0													100.0	100.0	100.0					5																	161524723		2203	4300	6503	SO:0001583	missense	0				CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.407G>A	5.37:g.161524723G>A	ENSP00000354651:p.Arg136Gln		F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg_rcpt,prints_GABAA_rcpt,prints_GABBAg2_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.R136Q	ENST00000361925.4	37	c.407	CCDS4358.1	5	.	.	.	.	.	.	.	.	.	.	g	20.7	4.032537	0.75504	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933;ENST00000522053	T;T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38;-1.38	5.81	4.92	0.64577	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.78698	0.4324	N	0.25485	0.75	0.54753	D	0.999989	D;P;P	0.55800	0.973;0.902;0.88	P;B;B	0.51229	0.663;0.441;0.313	T	0.80817	-0.1213	10	0.54805	T	0.06	.	16.5664	0.84599	0.0:0.1306:0.8694:0.0	.	136;136;136	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	Q	136;136;136;41;41	ENSP00000349000:R136Q;ENSP00000410732:R136Q;ENSP00000354651:R136Q;ENSP00000377510:R41Q;ENSP00000430182:R41Q	ENSP00000349000:R136Q	R	+	2	0	GABRG2	161457301	0.964000	0.33143	0.942000	0.38095	0.920000	0.55202	5.438000	0.66550	1.397000	0.46682	0.558000	0.71614	CGA	GABRG2	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,tigrfam_Neur_channel	ENSG00000113327		0.383	GABRG2-002	KNOWN	basic|CCDS	protein_coding	GABRG2	HGNC	protein_coding	OTTHUMT00000252706.1		0.00	38	0	G			161524723	+1			no_errors	ENST00000356592	ensembl	human	known	74_37	missense	6.98	40	3	SNP	0.997	A
LYPLA2	11313	genome.wustl.edu	37	1	24122591	24122591	+	IGR	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:24122591G>C	ENST00000374514.3	+	0	1810				GALE_ENST00000374497.3_Intron|GALE_ENST00000470383.1_5'Flank	NM_007260.2	NP_009191.1	O95372	LYPA2_HUMAN	lysophospholipase II						fatty acid metabolic process (GO:0006631)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	hydrolase activity (GO:0016787)			endometrium(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;1.79e-24)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;4.22e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		GCCCAGATCTGATTTAGCCCC	0.657																																																	0													18.0	20.0	19.0					1																	24122591		2203	4300	6503	SO:0001628	intergenic_variant	0			AF098668	CCDS241.1	1p36.11	2008-08-08			ENSG00000011009	ENSG00000011009	3.1.1.5		6738	protein-coding gene	gene with protein product							Standard	NM_007260		Approved	APT-2	uc001bht.3	O95372	OTTHUMG00000002961		1.37:g.24122591G>C			Q7Z4Z2	RNA	SNP	-	NULL	ENST00000374514.3	37	NULL	CCDS241.1	1																																																																																			GALE	-	-	ENSG00000117308		0.657	LYPLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALE	HGNC	protein_coding	OTTHUMT00000008245.1	-	0.00	35	0	G			24122591	-1	tier1	-	no_errors	ENST00000469556	ensembl	human	known	74_37	rna	9.84	55	6	SNP	0.000	C
GALNS	2588	genome.wustl.edu	37	16	88909193	88909193	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:88909193C>G	ENST00000268695.5	-	2	253	c.165G>C	c.(163-165)gaG>gaC	p.E55D	GALNS_ENST00000542788.1_Intron|GALNS_ENST00000565364.1_5'UTR	NM_000512.4	NP_000503.1	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfatase	55	Catalytic domain.		Missing (in MPS4A). {ECO:0000269|PubMed:16287098}.		carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)|N-acetylgalactosamine-6-sulfatase activity (GO:0043890)|sulfuric ester hydrolase activity (GO:0008484)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(8)	22				BRCA - Breast invasive adenocarcinoma(80;0.0496)		AATTCGGGGTCTCTCTGGAGG	0.607																																					GBM(129;1929 2344 25209 33204)												0			GRCh37	CD041913	GALNS	D							60.0	54.0	56.0					16																	88909193		2197	4298	6495	SO:0001583	missense	0			D17629	CCDS10970.1	16q24.3	2014-07-03	2014-07-03		ENSG00000141012	ENSG00000141012	3.1.6.4	"""Arylsulfatase family"""	4122	protein-coding gene	gene with protein product	"""Morquio syndrome"", ""mucopolysaccharidosis type IVA"""	612222	"""galactosamine (N-acetyl)-6-sulfate sulfatase"""			1755850	Standard	NM_000512		Approved	GAS, GALNAC6S	uc002fly.4	P34059	OTTHUMG00000137862	ENST00000268695.5:c.165G>C	16.37:g.88909193C>G	ENSP00000268695:p.Glu55Asp		Q86VK3	Missense_Mutation	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.E55D	ENST00000268695.5	37	c.165	CCDS10970.1	16	.	.	.	.	.	.	.	.	.	.	C	20.7	4.038651	0.75617	.	.	ENSG00000141012	ENST00000268695	D	0.98633	-5.04	4.8	3.82	0.43975	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.049125	0.85682	D	0.000000	D	0.98466	0.9489	M	0.64080	1.96	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97166	0.9841	10	0.35671	T	0.21	.	9.2154	0.37344	0.0:0.8209:0.0:0.1791	.	55;55	B2R6P1;P34059	.;GALNS_HUMAN	D	55	ENSP00000268695:E55D	ENSP00000268695:E55D	E	-	3	2	GALNS	87436694	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	1.575000	0.36493	2.388000	0.81334	0.561000	0.74099	GAG	GALNS	-	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000141012		0.607	GALNS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNS	HGNC	protein_coding	OTTHUMT00000269543.1	-	0.00	105	0	C			88909193	-1	tier1	-	no_errors	ENST00000268695	ensembl	human	known	74_37	missense	6.99	133	10	SNP	1.000	G
GALNT11	63917	genome.wustl.edu	37	7	151807728	151807728	+	Missense_Mutation	SNP	C	C	T	rs147464952		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:151807728C>T	ENST00000434507.1	+	9	1515	c.1078C>T	c.(1078-1080)Cgg>Tgg	p.R360W	GALNT11_ENST00000320311.2_Missense_Mutation_p.R360W|GALNT11_ENST00000452146.2_Missense_Mutation_p.R279W|GALNT11_ENST00000430044.2_Missense_Mutation_p.R360W			Q8NCW6	GLT11_HUMAN	polypeptide N-acetylgalactosaminyltransferase 11	360	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via threonine (GO:0018243)|regulation of Notch signaling pathway (GO:0008593)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|Notch binding (GO:0005112)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|prostate(5)|skin(2)	27	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		AATATCATTTCGGGTAATTTA	0.328																																																	0								C	TRP/ARG	0,4406		0,0,2203	131.0	139.0	136.0		1078	3.1	1.0	7	dbSNP_134	136	1,8599		0,1,4299	no	missense	GALNT11	NM_022087.2	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	360/609	151807728	1,13005	2203	4300	6503	SO:0001583	missense	0			AC006017	CCDS5930.1	7q36.1	2014-05-09	2014-05-09		ENSG00000178234	ENSG00000178234	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19875	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 11"""	615130	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)"""			11925450	Standard	NM_022087		Approved	GalNAc-T11	uc010lqg.1	Q8NCW6	OTTHUMG00000157251	ENST00000434507.1:c.1078C>T	7.37:g.151807728C>T	ENSP00000416787:p.Arg360Trp		B3KWF4|Q6PCD1|Q9H6C2|Q9H6Z5|Q9UDR8	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.R360W	ENST00000434507.1	37	c.1078	CCDS5930.1	7	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646186	0.67358	0.0	1.16E-4	ENSG00000178234	ENST00000430044;ENST00000452146;ENST00000443352;ENST00000434507;ENST00000320311	D;D;D;D	0.94576	-3.46;-3.46;-3.46;-3.46	5.16	3.07	0.35406	.	0.000000	0.85682	D	0.000000	D	0.98298	0.9436	H	0.98295	4.195	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99278	1.0895	10	0.87932	D	0	.	14.2635	0.66099	0.3979:0.6021:0.0:0.0	.	279;360;360	B7Z5G5;B3KWF4;Q8NCW6	.;.;GLT11_HUMAN	W	360;279;360;360;360	ENSP00000395122:R360W;ENSP00000393399:R279W;ENSP00000416787:R360W;ENSP00000315835:R360W	ENSP00000315835:R360W	R	+	1	2	GALNT11	151438661	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.399000	0.44495	1.108000	0.41662	0.561000	0.74099	CGG	GALNT11	-	NULL	ENSG00000178234		0.328	GALNT11-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GALNT11	HGNC	protein_coding	OTTHUMT00000348184.1	-	0.00	20	0	C	NM_022087		151807728	+1	tier1	rs147464952	no_errors	ENST00000320311	ensembl	human	known	74_37	missense	28.57	14	6	SNP	1.000	T
GATA4	2626	genome.wustl.edu	37	8	11615867	11615867	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:11615867G>A	ENST00000335135.4	+	7	1770	c.1212G>A	c.(1210-1212)aaG>aaA	p.K404K	GATA4_ENST00000532059.1_Silent_p.K405K|GATA4_ENST00000528712.1_Silent_p.K198K	NM_002052.3	NP_002043.2	P43694	GATA4_HUMAN	GATA binding protein 4	404					atrial septum morphogenesis (GO:0060413)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac ventricle morphogenesis (GO:0003208)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to glucose stimulus (GO:0071333)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|endocardial cushion development (GO:0003197)|endoderm development (GO:0007492)|endoderm formation (GO:0001706)|epithelial cell fate commitment (GO:0072148)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|lung lobe formation (GO:0060464)|male gonad development (GO:0008584)|negative regulation of autophagy (GO:0010507)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to mechanical stimulus (GO:0009612)|seminiferous tubule development (GO:0072520)|Sertoli cell differentiation (GO:0060008)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(10)	13	all_epithelial(15;0.0839)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)		CGGCCCTGAAGCTCTCCCCAC	0.602																																																	0													149.0	128.0	135.0					8																	11615867		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097060	CCDS5983.1	8p23.1-p22	2013-01-25	2001-11-28		ENSG00000136574	ENSG00000136574		"""GATA zinc finger domain containing"""	4173	protein-coding gene	gene with protein product		600576	"""GATA-binding protein 4"""			7665171	Standard	NM_002052		Approved		uc003wuc.2	P43694	OTTHUMG00000090800	ENST00000335135.4:c.1212G>A	8.37:g.11615867G>A			B7ZKX0|B7ZKZ4|Q3MJ45|Q5IFM8	Silent	SNP	pfam_GATA_N,pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA_4/5/6,pfscan_Znf_GATA,prints_Znf_GATA	p.K404	ENST00000335135.4	37	c.1212	CCDS5983.1	8																																																																																			GATA4	-	pirsf_TF_GATA_4/5/6	ENSG00000136574		0.602	GATA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA4	HGNC	protein_coding	OTTHUMT00000207587.2	-	0.00	42	0	G	NM_002052		11615867	+1	tier1	-	no_errors	ENST00000335135	ensembl	human	known	74_37	silent	31.11	31	14	SNP	1.000	A
GCC2	9648	genome.wustl.edu	37	2	109089316	109089316	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:109089316G>A	ENST00000309863.6	+	7	3535	c.2821G>A	c.(2821-2823)Gat>Aat	p.D941N		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	941					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)			breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						TGTAAAAAATGATCCTCTGTC	0.308																																																	0													64.0	65.0	65.0					2																	109089316		2201	4297	6498	SO:0001583	missense	0			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.2821G>A	2.37:g.109089316G>A	ENSP00000307939:p.Asp941Asn		A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Missense_Mutation	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,smart_GRIP,pfscan_GRIP	p.D941N	ENST00000309863.6	37	c.2821	CCDS33268.1	2	.	.	.	.	.	.	.	.	.	.	G	14.25	2.480818	0.44044	.	.	ENSG00000135968	ENST00000309863;ENST00000409896	T	0.35236	1.32	4.95	4.06	0.47325	.	0.222293	0.41823	D	0.000816	T	0.51176	0.1659	M	0.65975	2.015	0.39519	D	0.968482	D	0.65815	0.995	P	0.57425	0.82	T	0.54091	-0.8345	10	0.33141	T	0.24	.	14.8516	0.70300	0.0:0.1445:0.8555:0.0	.	941	Q8IWJ2	GCC2_HUMAN	N	941;904	ENSP00000307939:D941N	ENSP00000307939:D941N	D	+	1	0	GCC2	108455748	1.000000	0.71417	0.964000	0.40570	0.012000	0.07955	1.725000	0.38074	1.423000	0.47198	0.557000	0.71058	GAT	GCC2	-	NULL	ENSG00000135968		0.308	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC2	HGNC	protein_coding	OTTHUMT00000358516.3	-	0.00	36	0	G	NM_014635		109089316	+1	tier1	-	no_errors	ENST00000309863	ensembl	human	known	74_37	missense	16.67	40	8	SNP	1.000	A
GCH1	2643	genome.wustl.edu	37	14	55310767	55310767	+	Silent	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:55310767G>T	ENST00000491895.2	-	6	909	c.721C>A	c.(721-723)Cgg>Agg	p.R241R	GCH1_ENST00000543643.2_Intron|GCH1_ENST00000254299.4_5'UTR|GCH1_ENST00000536224.2_Intron|GCH1_ENST00000395514.1_Silent_p.R241R	NM_000161.2	NP_000152.1	P30793	GCH1_HUMAN	GTP cyclohydrolase 1	241			R -> W (in DYT5). {ECO:0000269|PubMed:9778264}.		7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|dopamine biosynthetic process (GO:0042416)|GTP catabolic process (GO:0006184)|metabolic process (GO:0008152)|negative regulation of blood pressure (GO:0045776)|neuromuscular process controlling posture (GO:0050884)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric-oxide synthase activity (GO:0051000)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|pteridine-containing compound biosynthetic process (GO:0042559)|regulation of blood pressure (GO:0008217)|regulation of lung blood pressure (GO:0014916)|regulation of nitric-oxide synthase activity (GO:0050999)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|response to pain (GO:0048265)|response to tumor necrosis factor (GO:0034612)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|tetrahydrofolate biosynthetic process (GO:0046654)|vasodilation (GO:0042311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|coenzyme binding (GO:0050662)|GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(2)|lung(7)|skin(2)	11						AACTCTTCCCGAGTCTTTGGA	0.488																																					Pancreas(198;1245 2204 4807 21567 38372)												0			GRCh37	CM011360	GCH1	M							185.0	146.0	159.0					14																	55310767		2203	4300	6503	SO:0001819	synonymous_variant	0			U19523	CCDS9720.1, CCDS41954.1, CCDS45110.1	14q22.1-q22.2	2014-04-01	2008-08-01		ENSG00000131979	ENSG00000131979	3.5.4.16		4193	protein-coding gene	gene with protein product	"""dopa-responsive dystonia"""	600225	"""dystonia 14"""	GCH, DYT5, DYT14		7874165, 8695054	Standard	XM_005267530		Approved	GTPCH1, DYT5a	uc001xbi.1	P30793	OTTHUMG00000029754	ENST00000491895.2:c.721C>A	14.37:g.55310767G>T			Q6FHY7|Q9Y4I8	Silent	SNP	pfam_GTP_CycHdrlase_I_dom,tigrfam_GTP_CycHdrlase_I	p.R241	ENST00000491895.2	37	c.721	CCDS9720.1	14																																																																																			GCH1	-	tigrfam_GTP_CycHdrlase_I	ENSG00000131979		0.488	GCH1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	GCH1	HGNC	protein_coding	OTTHUMT00000276895.3	-	0.00	38	0	G			55310767	-1	tier1	-	no_errors	ENST00000395514	ensembl	human	known	74_37	silent	9.09	60	6	SNP	0.999	T
GCM2	9247	genome.wustl.edu	37	6	10876178	10876178	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:10876178C>T	ENST00000379491.4	-	4	675	c.528G>A	c.(526-528)aaG>aaA	p.K176K	SYCP2L_ENST00000543878.1_Intron|RP11-637O19.3_ENST00000480294.1_Intron	NM_004752.3	NP_004743.1	O75603	GCM2_HUMAN	glial cells missing homolog 2 (Drosophila)	176					cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to organic substance (GO:0071310)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|parathyroid gland development (GO:0060017)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	30	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				CCATTTGTCTCTTGATGGCGC	0.453																																																	0													216.0	179.0	191.0					6																	10876178		2203	4300	6503	SO:0001819	synonymous_variant	0			AF079550	CCDS4517.1	6p24.2	2008-08-29	2001-11-28	2002-09-27	ENSG00000124827	ENSG00000124827			4198	protein-coding gene	gene with protein product		603716	"""glial cells missing (Drosophila) homolog b"""	GCMB		9928992	Standard	NM_004752		Approved	hGCMb	uc003mzn.4	O75603	OTTHUMG00000014249	ENST00000379491.4:c.528G>A	6.37:g.10876178C>T			D3GDV6|Q5THN5	Silent	SNP	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif	p.K176	ENST00000379491.4	37	c.528	CCDS4517.1	6																																																																																			GCM2	-	superfamily_Tscrpt_reg_GCM_motif	ENSG00000124827		0.453	GCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCM2	HGNC	protein_coding	OTTHUMT00000039844.1	-	0.00	64	0	C			10876178	-1	tier1	-	no_errors	ENST00000379491	ensembl	human	known	74_37	silent	37.50	45	27	SNP	1.000	T
GFPT1	2673	genome.wustl.edu	37	2	69575385	69575385	+	Silent	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:69575385G>T	ENST00000357308.4	-	11	1105	c.927C>A	c.(925-927)atC>atA	p.I309I	GFPT1_ENST00000361060.5_Silent_p.I291I	NM_001244710.1	NP_001231639.1	Q06210	GFPT1_HUMAN	glutamine--fructose-6-phosphate transaminase 1	309					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|circadian regulation of gene expression (GO:0032922)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glucosamine biosynthetic process (GO:0006042)|glutamine metabolic process (GO:0006541)|negative regulation of glycogen biosynthetic process (GO:0045719)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|protein N-linked glycosylation via asparagine (GO:0018279)|response to sucrose (GO:0009744)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			endometrium(1)|large_intestine(3)|lung(5)|skin(3)	12						TAATTCGATGGATAGAAAGAC	0.453																																																	0													161.0	148.0	152.0					2																	69575385		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33216.1, CCDS58713.1	2p13	2014-09-17	2010-05-11		ENSG00000198380	ENSG00000198380	2.6.1.16		4241	protein-coding gene	gene with protein product		138292	"""glutamine-fructose-6-phosphate transaminase 1"""	GFPT		1460020	Standard	NM_002056		Approved	GFAT, GFA, GFAT1	uc002sfi.2	Q06210	OTTHUMG00000152666	ENST00000357308.4:c.927C>A	2.37:g.69575385G>T			Q53QE6|Q9BXF8	Silent	SNP	pfam_SIS,pfam_GATase_dom,tigrfam_GlmS_trans	p.I309	ENST00000357308.4	37	c.927	CCDS58713.1	2																																																																																			GFPT1	-	tigrfam_GlmS_trans	ENSG00000198380		0.453	GFPT1-201	KNOWN	basic|CCDS	protein_coding	GFPT1	HGNC	protein_coding		-	0.00	58	0	G			69575385	-1	tier1	-	no_errors	ENST00000357308	ensembl	human	known	74_37	silent	6.56	57	4	SNP	1.000	T
GHR	2690	genome.wustl.edu	37	5	42718722	42718722	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:42718722G>A	ENST00000230882.4	+	10	1303	c.1113G>A	c.(1111-1113)gaG>gaA	p.E371E	GHR_ENST00000357703.3_Silent_p.E349E|GHR_ENST00000537449.1_Silent_p.E184E|GHR_ENST00000513625.1_3'UTR	NM_000163.4|NM_001242399.2|NM_001242400.2|NM_001242401.3|NM_001242402.2|NM_001242403.2|NM_001242404.2|NM_001242405.2|NM_001242406.2	NP_000154.1|NP_001229328.1|NP_001229329.1|NP_001229330.1|NP_001229331.1|NP_001229332.1|NP_001229333.1|NP_001229334.1|NP_001229335.1	P10912	GHR_HUMAN	growth hormone receptor	371					2-oxoglutarate metabolic process (GO:0006103)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPK activity (GO:0000187)|allantoin metabolic process (GO:0000255)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|endocytosis (GO:0006897)|fatty acid metabolic process (GO:0006631)|growth hormone receptor signaling pathway (GO:0060396)|insulin-like growth factor receptor signaling pathway (GO:0048009)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|multicellular organismal metabolic process (GO:0044236)|oxaloacetate metabolic process (GO:0006107)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|receptor internalization (GO:0031623)|regulation of multicellular organism growth (GO:0040014)|response to cycloheximide (GO:0046898)|response to estradiol (GO:0032355)|succinate metabolic process (GO:0006105)|taurine metabolic process (GO:0019530)|valine metabolic process (GO:0006573)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|growth hormone receptor complex (GO:0070195)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine receptor activity (GO:0004896)|growth factor binding (GO:0019838)|peptide hormone binding (GO:0017046)|proline-rich region binding (GO:0070064)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			NS(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	GTGACCATGAGAAATCACATA	0.438																																																	0													150.0	125.0	134.0					5																	42718722		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3940.1, CCDS56364.1, CCDS75239.1, CCDS75240.1	5p14-p12	2013-03-25			ENSG00000112964	ENSG00000112964		"""Fibronectin type III domain containing"""	4263	protein-coding gene	gene with protein product	"""growth hormone binding protein"""	600946					Standard	NM_001242460		Approved	GHBP	uc003jmt.3	P10912	OTTHUMG00000094791	ENST00000230882.4:c.1113G>A	5.37:g.42718722G>A			Q9HCX2	Silent	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.E371	ENST00000230882.4	37	c.1113	CCDS3940.1	5																																																																																			GHR	-	NULL	ENSG00000112964		0.438	GHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHR	HGNC	protein_coding	OTTHUMT00000211605.2	-	0.00	28	0	G	NM_000163		42718722	+1	tier1	-	no_errors	ENST00000230882	ensembl	human	known	74_37	silent	8.47	54	5	SNP	0.877	A
GLI4	2738	genome.wustl.edu	37	8	144358109	144358109	+	Missense_Mutation	SNP	C	C	G	rs13264624		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:144358109C>G	ENST00000523522.1	+	3	305	c.266C>G	c.(265-267)tCt>tGt	p.S89C	ZFP41_ENST00000522452.1_3'UTR|GLI4_ENST00000340042.1_Missense_Mutation_p.S89C|GLI4_ENST00000523812.1_3'UTR			P10075	GLI4_HUMAN	GLI family zinc finger 4	89					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(1)|lung(5)	9	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			TCTCCTGGCTCTCAGGCCCCT	0.711																																																	0													4.0	3.0	3.0					8																	144358109		1475	2762	4237	SO:0001583	missense	0				CCDS6398.1	8q24.3	2013-01-08	2009-03-05		ENSG00000250571	ENSG00000250571		"""Zinc fingers, C2H2-type"""	4320	protein-coding gene	gene with protein product		165280	"""GLI-Kruppel family member GLI4"", ""glioma-associated oncogene family zinc finger 4"""			2850480	Standard	NM_138465		Approved	HKR4, ZNF928	uc003yxx.3	P10075	OTTHUMG00000164952	ENST00000523522.1:c.266C>G	8.37:g.144358109C>G	ENSP00000430987:p.Ser89Cys		Q96CK9	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S89C	ENST00000523522.1	37	c.266	CCDS6398.1	8	.	.	.	.	.	.	.	.	.	.	C	10.86	1.469965	0.26423	.	.	ENSG00000250571	ENST00000340042;ENST00000523522	T;T	0.07021	3.23;3.23	3.54	-3.94	0.04130	.	.	.	.	.	T	0.03348	0.0097	N	0.14661	0.345	0.09310	N	1	B	0.31519	0.327	B	0.28232	0.087	T	0.38436	-0.9661	9	0.49607	T	0.09	.	0.1352	0.00078	0.3043:0.2332:0.1501:0.3124	rs13264624	89	P10075	GLI4_HUMAN	C	89	ENSP00000345024:S89C;ENSP00000430987:S89C	ENSP00000345024:S89C	S	+	2	0	GLI4	144429484	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.055000	0.03493	-0.647000	0.05444	-0.379000	0.06801	TCT	GLI4	-	NULL	ENSG00000250571		0.711	GLI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI4	HGNC	protein_coding	OTTHUMT00000381128.2	-	0.00	17	0	C			144358109	+1	tier1	rs13264624	no_errors	ENST00000340042	ensembl	human	known	74_37	missense	17.65	28	6	SNP	0.000	G
GLI4	2738	genome.wustl.edu	37	8	144358344	144358344	+	Silent	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:144358344C>G	ENST00000523522.1	+	3	540	c.501C>G	c.(499-501)gtC>gtG	p.V167V	ZFP41_ENST00000522452.1_3'UTR|GLI4_ENST00000340042.1_Silent_p.V167V|GLI4_ENST00000523812.1_3'UTR			P10075	GLI4_HUMAN	GLI family zinc finger 4	167					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(1)|lung(5)	9	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			AGCTGGGAGTCAACTTCGGTC	0.726																																																	0													3.0	4.0	3.0					8																	144358344		1927	3896	5823	SO:0001819	synonymous_variant	0				CCDS6398.1	8q24.3	2013-01-08	2009-03-05		ENSG00000250571	ENSG00000250571		"""Zinc fingers, C2H2-type"""	4320	protein-coding gene	gene with protein product		165280	"""GLI-Kruppel family member GLI4"", ""glioma-associated oncogene family zinc finger 4"""			2850480	Standard	NM_138465		Approved	HKR4, ZNF928	uc003yxx.3	P10075	OTTHUMG00000164952	ENST00000523522.1:c.501C>G	8.37:g.144358344C>G			Q96CK9	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V167	ENST00000523522.1	37	c.501	CCDS6398.1	8																																																																																			GLI4	-	NULL	ENSG00000250571		0.726	GLI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI4	HGNC	protein_coding	OTTHUMT00000381128.2	-	0.00	24	0	C			144358344	+1	tier1	-	no_errors	ENST00000340042	ensembl	human	known	74_37	silent	15.79	32	6	SNP	0.001	G
GMEB1	10691	genome.wustl.edu	37	1	29028959	29028959	+	Missense_Mutation	SNP	C	C	T	rs201750134		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:29028959C>T	ENST00000294409.2	+	7	728	c.638C>T	c.(637-639)aCg>aTg	p.T213M	GMEB1_ENST00000480454.1_3'UTR|GMEB1_ENST00000373816.1_Missense_Mutation_p.T203M|GMEB1_ENST00000361872.4_Missense_Mutation_p.T203M	NM_006582.3	NP_006573.2	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding protein 1	213					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)	11		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		GGTAGCATCACGCAGATTGCC	0.463																																																	0								C	MET/THR,MET/THR	0,4406		0,0,2203	125.0	119.0	121.0		638,608	5.5	1.0	1		121	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	GMEB1	NM_006582.3,NM_024482.2	81,81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	213/574,203/564	29028959	1,13005	2203	4300	6503	SO:0001583	missense	0			AF099013	CCDS327.1, CCDS328.1	1p35	2008-02-05			ENSG00000162419	ENSG00000162419			4370	protein-coding gene	gene with protein product		604409				10386584, 10523663	Standard	NM_006582		Approved	P96PIF, PIF96	uc001bra.3	Q9Y692	OTTHUMG00000003647	ENST00000294409.2:c.638C>T	1.37:g.29028959C>T	ENSP00000294409:p.Thr213Met		B1AT48|Q9NWH1|Q9UKD0	Missense_Mutation	SNP	pfam_SAND_dom,superfamily_SAND_dom-like,smart_SAND_dom,pfscan_SAND_dom	p.T213M	ENST00000294409.2	37	c.638	CCDS327.1	1	.	.	.	.	.	.	.	.	.	.	C	16.73	3.203082	0.58234	0.0	1.16E-4	ENSG00000162419	ENST00000373816;ENST00000456852;ENST00000361872;ENST00000294409	T;T;T	0.56275	0.47;0.47;0.47	5.46	5.46	0.80206	.	0.282614	0.39985	N	0.001210	T	0.45438	0.1342	N	0.03608	-0.345	0.31707	N	0.63995	P;D	0.71674	0.775;0.998	B;P	0.54346	0.064;0.749	T	0.58375	-0.7647	10	0.66056	D	0.02	-9.2314	18.2962	0.90147	0.0:1.0:0.0:0.0	.	213;203	Q9Y692;B1AT47	GMEB1_HUMAN;.	M	203;179;203;213	ENSP00000362922:T203M;ENSP00000355186:T203M;ENSP00000294409:T213M	ENSP00000294409:T213M	T	+	2	0	GMEB1	28901546	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.054000	0.64275	2.861000	0.98227	0.650000	0.86243	ACG	GMEB1	-	NULL	ENSG00000162419		0.463	GMEB1-003	KNOWN	basic|CCDS	protein_coding	GMEB1	HGNC	protein_coding	OTTHUMT00000010333.1	-	0.00	44	0	C	NM_006582		29028959	+1	tier1	rs201750134	no_errors	ENST00000294409	ensembl	human	known	74_37	missense	21.25	63	17	SNP	1.000	T
GREB1	9687	genome.wustl.edu	37	2	11765302	11765302	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:11765302G>C	ENST00000381486.2	+	24	4470	c.4170G>C	c.(4168-4170)tgG>tgC	p.W1390C	GREB1_ENST00000234142.5_Missense_Mutation_p.W1390C|GREB1_ENST00000396123.1_Missense_Mutation_p.W388C	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1390						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		AATCTGACTGGCATTATCTCC	0.448																																					Ovarian(39;850 945 2785 23371 33093)												0													179.0	171.0	173.0					2																	11765302		1899	4121	6020	SO:0001583	missense	0				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.4170G>C	2.37:g.11765302G>C	ENSP00000370896:p.Trp1390Cys		A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.W1390C	ENST00000381486.2	37	c.4170	CCDS42655.1	2	.	.	.	.	.	.	.	.	.	.	G	11.36	1.615307	0.28801	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	T;T;T	0.21734	3.31;3.31;1.99	5.0	3.99	0.46301	.	0.545137	0.20512	N	0.090866	T	0.21801	0.0525	N	0.22421	0.69	0.50467	D	0.999878	P	0.43352	0.804	P	0.52267	0.694	T	0.01114	-1.1447	10	0.38643	T	0.18	-19.314	9.1709	0.37081	0.174:0.0:0.826:0.0	.	1390	Q4ZG55	GREB1_HUMAN	C	1390;1390;388	ENSP00000370896:W1390C;ENSP00000234142:W1390C;ENSP00000379429:W388C	ENSP00000234142:W1390C	W	+	3	0	GREB1	11682753	1.000000	0.71417	0.908000	0.35775	0.369000	0.29798	2.558000	0.45879	2.315000	0.78130	0.655000	0.94253	TGG	GREB1	-	superfamily_P-loop_NTPase	ENSG00000196208		0.448	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREB1	HGNC	protein_coding	OTTHUMT00000280490.1	-	0.00	60	0	G	NM_014668		11765302	+1	tier1	-	no_errors	ENST00000234142	ensembl	human	known	74_37	missense	27.27	40	15	SNP	0.943	C
GPR75	10936	genome.wustl.edu	37	2	54081859	54081859	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:54081859T>C	ENST00000394705.2	-	2	305	c.35A>G	c.(34-36)aAt>aGt	p.N12S	ASB3_ENST00000498475.2_Intron|GPR75-ASB3_ENST00000352846.3_Intron|ASB3_ENST00000406625.2_Intron	NM_006794.3	NP_006785.1	O95800	GPR75_HUMAN	G protein-coupled receptor 75	12					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of neuron death (GO:1901214)	integral component of plasma membrane (GO:0005887)	C-C chemokine receptor activity (GO:0016493)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			CGAGGTGGCATTGGGGGCATC	0.537																																																	0													124.0	119.0	121.0					2																	54081859		2203	4300	6503	SO:0001583	missense	0			AF101472	CCDS1849.1	2p16	2012-08-21			ENSG00000119737	ENSG00000119737		"""GPCR / Class A : Orphans"""	4526	protein-coding gene	gene with protein product		606704				10381362	Standard	NM_006794		Approved	WI-31133	uc002rxo.3	O95800	OTTHUMG00000129280	ENST00000394705.2:c.35A>G	2.37:g.54081859T>C	ENSP00000378195:p.Asn12Ser		B2RC02|Q6NWR2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.N12S	ENST00000394705.2	37	c.35	CCDS1849.1	2	.	.	.	.	.	.	.	.	.	.	T	16.40	3.113609	0.56398	.	.	ENSG00000119737	ENST00000394705	T	0.26957	1.7	5.54	5.54	0.83059	.	0.324362	0.29015	N	0.013417	T	0.22627	0.0546	.	.	.	0.31446	N	0.671322	B	0.24043	0.096	B	0.23150	0.044	T	0.16424	-1.0403	9	0.56958	D	0.05	-12.2179	13.1946	0.59730	0.0:0.0:0.0:1.0	.	12	O95800	GPR75_HUMAN	S	12	ENSP00000378195:N12S	ENSP00000378195:N12S	N	-	2	0	GPR75	53935363	1.000000	0.71417	0.957000	0.39632	0.977000	0.68977	3.221000	0.51215	2.107000	0.64212	0.459000	0.35465	AAT	GPR75	-	NULL	ENSG00000119737		0.537	GPR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR75	HGNC	protein_coding	OTTHUMT00000251403.2	-	0.00	40	0	T			54081859	-1	tier1	-	no_errors	ENST00000394705	ensembl	human	known	74_37	missense	28.26	33	13	SNP	0.991	C
GRIA4	2893	genome.wustl.edu	37	11	105850508	105850508	+	3'UTR	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:105850508G>A	ENST00000530497.1	+	0	2751				GRIA4_ENST00000393127.2_3'UTR|GRIA4_ENST00000533094.1_3'UTR|GRIA4_ENST00000282499.5_3'UTR			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4						glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		AACTGTTGGTGACTGGTGGAA	0.507																																																	0													29.0	27.0	28.0					11																	105850508		2200	4299	6499	SO:0001624	3_prime_UTR_variant	0			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.*42G>A	11.37:g.105850508G>A			Q86XE8	RNA	SNP	-	NULL	ENST00000530497.1	37	NULL	CCDS8333.1	11																																																																																			GRIA4	-	-	ENSG00000152578		0.507	GRIA4-005	KNOWN	basic|CCDS	protein_coding	GRIA4	HGNC	protein_coding	OTTHUMT00000388593.1	-	0.00	30	0	G			105850508	+1	tier1	-	no_errors	ENST00000533094	ensembl	human	putative	74_37	rna	30.00	21	9	SNP	1.000	A
GTF2IRD2P1	401375	genome.wustl.edu	37	7	72664015	72664016	+	RNA	INS	-	-	G	rs202030378|rs372212945	byFrequency	TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:72664015_72664016insG	ENST00000425256.1	-	0	884_885									GTF2I repeat domain containing 2 pseudogene 1																		ATACCACCCCCGGGGCATGCCA	0.505													GGGGG|GGGG|GGGGG|deletion	3786	0.75599	0.7247	0.8242	5008	,	,		6539	0.7212		0.8101	False		,,,				2504	0.7301																0																																												0			AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72664019_72664019dupG				RNA	INS	-	NULL	ENST00000425256.1	37	NULL		7																																																																																			GTF2IRD2P1	-	-	ENSG00000214544		0.505	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	GTF2IRD2P1	HGNC	pseudogene	OTTHUMT00000345921.1		0.00	11	0	-	NR_002164		72664016	-1	tier1		no_errors	ENST00000425256	ensembl	human	known	74_37	rna	20.00	12	3	INS	0.912:0.964	G
GTF3C1	2975	genome.wustl.edu	37	16	27475803	27475803	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:27475803C>T	ENST00000356183.4	-	34	5725	c.5710G>A	c.(5710-5712)Ggg>Agg	p.G1904R	GTF3C1_ENST00000561623.1_Missense_Mutation_p.G1904R	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1904					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GCTTCTGCCCCATCTTCAGCT	0.647																																																	0													66.0	76.0	73.0					16																	27475803		2197	4300	6497	SO:0001583	missense	0			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.5710G>A	16.37:g.27475803C>T	ENSP00000348510:p.Gly1904Arg		B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	pfam_TFIIIC_Bblock-bd	p.G1904R	ENST00000356183.4	37	c.5710	CCDS32414.1	16	.	.	.	.	.	.	.	.	.	.	C	8.935	0.964429	0.18583	.	.	ENSG00000077235	ENST00000356183	T	0.22743	1.94	4.5	-4.56	0.03431	.	1.164370	0.06109	N	0.666806	T	0.13072	0.0317	L	0.44542	1.39	0.09310	N	1	B;B	0.30439	0.116;0.279	B;B	0.28139	0.025;0.086	T	0.26677	-1.0096	10	0.25751	T	0.34	-9.7722	1.7802	0.03030	0.124:0.3648:0.1291:0.382	.	1904;1904	Q12789;Q12789-3	TF3C1_HUMAN;.	R	1904	ENSP00000348510:G1904R	ENSP00000348510:G1904R	G	-	1	0	GTF3C1	27383304	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.168000	0.16622	-0.883000	0.03982	-0.475000	0.04921	GGG	GTF3C1	-	NULL	ENSG00000077235		0.647	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C1	HGNC	protein_coding	OTTHUMT00000433856.1	-	0.00	76	0	C	NM_001520		27475803	-1	tier1	-	no_errors	ENST00000356183	ensembl	human	known	74_37	missense	20.00	88	22	SNP	0.000	T
GUCY2D	3000	genome.wustl.edu	37	17	7910834	7910834	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:7910834C>T	ENST00000254854.4	+	6	1704	c.1554C>T	c.(1552-1554)ggC>ggT	p.G518G		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	518					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				CACATGGGGGCACCTCTCGAA	0.587																																																	0													71.0	70.0	71.0					17																	7910834		2203	4300	6503	SO:0001819	synonymous_variant	0			L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.1554C>T	17.37:g.7910834C>T			Q6LEA7	Silent	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Haem_no_assoc-bd,superfamily_Peripla_BP_I,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G518	ENST00000254854.4	37	c.1554	CCDS11127.1	17																																																																																			GUCY2D	-	smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom	ENSG00000132518		0.587	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2D	HGNC	protein_coding	OTTHUMT00000226973.2	-	0.00	30	0	C			7910834	+1	tier1	-	no_errors	ENST00000254854	ensembl	human	known	74_37	silent	50.00	11	11	SNP	1.000	T
GVINP1	387751	genome.wustl.edu	37	11	6741187	6741187	+	RNA	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:6741187C>G	ENST00000526769.3	-	0	2017					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										TTCTGGGTTTCTTTTAAGATC	0.428																																																	0																																												0			BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6741187C>G			A6NFL2|Q9H8N5	RNA	SNP	-	NULL	ENST00000526769.3	37	NULL		11																																																																																			GVINP1	-	-	ENSG00000254838		0.428	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	GVINP1	HGNC	pseudogene	OTTHUMT00000386960.3		0.00	29	0	C	NR_003945		6741187	-1			no_errors	ENST00000526769	ensembl	human	known	74_37	rna	13.79	25	4	SNP	0.000	G
HAL	3034	genome.wustl.edu	37	12	96389545	96389545	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:96389545C>T	ENST00000261208.3	-	2	512	c.144G>A	c.(142-144)gtG>gtA	p.V48V	HAL_ENST00000541929.1_5'UTR|RP11-256L6.3_ENST00000551849.1_RNA|HAL_ENST00000538703.1_Silent_p.V48V	NM_002108.3	NP_002099.1	P42357	HUTH_HUMAN	histidine ammonia-lyase	48					biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	histidine ammonia-lyase activity (GO:0004397)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	34					L-Histidine(DB00117)	GCGCGTCATCCACGGAGGTGA	0.642																																					NSCLC(169;943 2815 23563 30031)												0													63.0	55.0	58.0					12																	96389545		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9058.1, CCDS58264.1, CCDS58265.1	12q22-q24.1	1991-07-12				ENSG00000084110	4.3.1.3		4806	protein-coding gene	gene with protein product		609457		HIS			Standard	NM_002108		Approved		uc001tem.2	P42357	OTTHUMG00000170354	ENST00000261208.3:c.144G>A	12.37:g.96389545C>T			B4DQC1|B4E0V8|F5GXF2|F5H1U5|Q4VB92|Q4VB93	Silent	SNP	pfam_Aromatic_Lyase,superfamily_L-Aspartase-like,tigrfam_HutH	p.V48	ENST00000261208.3	37	c.144	CCDS9058.1	12																																																																																			HAL	-	NULL	ENSG00000084110		0.642	HAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAL	HGNC	protein_coding	OTTHUMT00000408644.1	-	0.00	30	0	C			96389545	-1	tier1	-	no_errors	ENST00000261208	ensembl	human	known	74_37	silent	14.71	29	5	SNP	1.000	T
HAX1	10456	genome.wustl.edu	37	1	154245820	154245820	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:154245820A>T	ENST00000328703.7	+	2	275	c.62A>T	c.(61-63)gAt>gTt	p.D21V	HAX1_ENST00000457918.2_Intron|HAX1_ENST00000483970.2_Missense_Mutation_p.D21V|HAX1_ENST00000532105.1_Intron	NM_006118.3	NP_006109.2	O00165	HAX1_HUMAN	HCLS1 associated protein X-1	21	Required for localization in mitochondria. {ECO:0000250}.				cellular response to cytokine stimulus (GO:0071345)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin filament polymerization (GO:0030833)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein targeting to mitochondrion (GO:1903214)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|lamellipodium (GO:0030027)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|sarcoplasmic reticulum (GO:0016529)|transcription factor complex (GO:0005667)	interleukin-1 binding (GO:0019966)|protein N-terminus binding (GO:0047485)			cervix(1)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	15	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			AGCCACAGAGATCCCTTTTTT	0.493									Kostmann syndrome																																								0													70.0	71.0	71.0					1																	154245820		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Kostmann Infantile Agranulocytosis, Severe Congenital Neutropenia, Congenital Agranulocytosis	U68566	CCDS1064.1, CCDS44230.1	1q21.3	2014-09-17			ENSG00000143575	ENSG00000143575			16915	protein-coding gene	gene with protein product	"""HCLS1 (and PKD2) associated protein"""	605998				9058808, 10760273	Standard	NM_006118		Approved	HS1BP1, HCLSBP1	uc001fes.3	O00165	OTTHUMG00000035978	ENST00000328703.7:c.62A>T	1.37:g.154245820A>T	ENSP00000329002:p.Asp21Val		A8W4W9|A8W4X0|B4DUJ7|Q5VYD5|Q5VYD7|Q96AU4|Q9BS80	Missense_Mutation	SNP	pirsf_HS1--assoc_X-1	p.D21V	ENST00000328703.7	37	c.62	CCDS1064.1	1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.308553	0.81247	.	.	ENSG00000143575	ENST00000328703;ENST00000483970;ENST00000435087	T;T;T	0.45668	0.89;0.89;0.89	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.58963	0.2159	M	0.80847	2.515	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.66015	-0.6028	10	0.87932	D	0	-18.0087	13.403	0.60893	1.0:0.0:0.0:0.0	.	21;21	O00165-2;O00165	.;HAX1_HUMAN	V	21	ENSP00000329002:D21V;ENSP00000435088:D21V;ENSP00000394920:D21V	ENSP00000329002:D21V	D	+	2	0	HAX1	152512444	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.253000	0.72453	2.240000	0.73641	0.533000	0.62120	GAT	HAX1	-	pirsf_HS1--assoc_X-1	ENSG00000143575		0.493	HAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAX1	HGNC	protein_coding	OTTHUMT00000087650.1	-	0.00	34	0	A	NM_006118		154245820	+1	tier1	-	no_errors	ENST00000483970	ensembl	human	known	74_37	missense	43.33	34	26	SNP	1.000	T
HEPACAM2	253012	genome.wustl.edu	37	7	92844738	92844738	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:92844738C>T	ENST00000394468.2	-	3	768	c.691G>A	c.(691-693)Gat>Aat	p.D231N	HEPACAM2_ENST00000341723.4_Missense_Mutation_p.D219N|HEPACAM2_ENST00000453812.2_Missense_Mutation_p.D254N|HEPACAM2_ENST00000440868.1_Missense_Mutation_p.D219N	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2	231	Ig-like C2-type 1.				centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)				breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						ATAATGATATCACTTTCCATT	0.373																																																	0													113.0	107.0	109.0					7																	92844738		2203	4300	6503	SO:0001583	missense	0			AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.691G>A	7.37:g.92844738C>T	ENSP00000377980:p.Asp231Asn		B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.D231N	ENST00000394468.2	37	c.691	CCDS43616.1	7	.	.	.	.	.	.	.	.	.	.	C	20.4	3.983805	0.74474	.	.	ENSG00000188175	ENST00000394468;ENST00000341723;ENST00000440868;ENST00000453812	T;T;T;T	0.09073	3.02;3.02;3.02;3.02	5.28	4.4	0.53042	Immunoglobulin I-set (1);Immunoglobulin-like (1);	0.422720	0.30093	N	0.010435	T	0.14227	0.0344	L	0.52206	1.635	0.36294	D	0.856607	P;P;P;P	0.52692	0.918;0.955;0.837;0.804	P;P;P;B	0.49140	0.601;0.579;0.516;0.382	T	0.11324	-1.0592	10	0.45353	T	0.12	-15.4192	14.1732	0.65525	0.0:0.9272:0.0:0.0728	.	254;219;231;219	E9PDV5;C9JN07;A8MVW5;A8MVW5-2	.;.;HECA2_HUMAN;.	N	231;219;219;254	ENSP00000377980:D231N;ENSP00000340532:D219N;ENSP00000389592:D219N;ENSP00000390204:D254N	ENSP00000340532:D219N	D	-	1	0	HEPACAM2	92682674	1.000000	0.71417	0.997000	0.53966	0.859000	0.49053	2.758000	0.47565	1.365000	0.46057	0.591000	0.81541	GAT	HEPACAM2	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000188175		0.373	HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEPACAM2	HGNC	protein_coding	OTTHUMT00000254651.1	-	0.00	60	0	C	NM_198151		92844738	-1	tier1	-	no_errors	ENST00000394468	ensembl	human	known	74_37	missense	12.31	57	8	SNP	1.000	T
HIST1H3E	8353	genome.wustl.edu	37	6	26225602	26225602	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:26225602G>C	ENST00000360408.1	+	1	220	c.220G>C	c.(220-222)Gaa>Caa	p.E74Q		NM_003532.2	NP_003523.1	P68431	H31_HUMAN	histone cluster 1, H3e	74					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(5)|skin(1)	8		all_hematologic(11;0.0223)|Acute lymphoblastic leukemia(11;0.0351)				CCTGGTGCGAGAAATAGCTCA	0.617																																																	0													66.0	65.0	65.0					6																	26225602		2203	4300	6503	SO:0001583	missense	0			M60746	CCDS4596.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196966	ENSG00000274750		"""Histones / Replication-dependent"""	4769	protein-coding gene	gene with protein product		602813	"""H3 histone family, member D"", ""histone 1, H3e"""	H3FD		1916825, 12408966	Standard	NM_003532		Approved	H3/d, H3.1	uc003nhc.4	P68431	OTTHUMG00000014434	ENST00000360408.1:c.220G>C	6.37:g.26225602G>C	ENSP00000353581:p.Glu74Gln		A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.E74Q	ENST00000360408.1	37	c.220	CCDS4596.1	6	.	.	.	.	.	.	.	.	.	.	.	15.56	2.869228	0.51588	.	.	ENSG00000196966	ENST00000360408	T	0.52295	0.67	4.45	4.45	0.53987	.	.	.	.	.	T	0.58694	0.2140	.	.	.	0.41685	D	0.989312	.	.	.	.	.	.	T	0.64748	-0.6334	6	0.87932	D	0	.	16.6039	0.84823	0.0:0.0:1.0:0.0	.	.	.	.	Q	74	ENSP00000353581:E74Q	ENSP00000353581:E74Q	E	+	1	0	HIST1H3E	26333581	1.000000	0.71417	1.000000	0.80357	0.409000	0.31022	9.458000	0.97634	2.494000	0.84150	0.491000	0.48974	GAA	HIST1H3E	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000196966		0.617	HIST1H3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3E	HGNC	protein_coding	OTTHUMT00000040097.1	-	0.00	106	0	G	NM_003532		26225602	+1	tier1	-	no_errors	ENST00000360408	ensembl	human	known	74_37	missense	15.00	119	21	SNP	1.000	C
HIST2H2BF	440689	genome.wustl.edu	37	1	149783597	149783597	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:149783597C>G	ENST00000369167.1	-	1	317	c.282G>C	c.(280-282)gaG>gaC	p.E94D	HIST2H2BF_ENST00000427880.2_Missense_Mutation_p.E94D|HIST2H2BF_ENST00000545683.1_Missense_Mutation_p.E94D|HIST2H2BF_ENST00000469483.1_5'UTR|RP11-196G18.21_ENST00000420462.1_RNA	NM_001024599.4	NP_001019770.1	Q5QNW6	H2B2F_HUMAN	histone cluster 2, H2bf	94					chromatin organization (GO:0006325)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Breast(34;0.0124)|all_hematologic(923;0.127)					CCGTCTGGATCTCGCGGGATG	0.642																																																	0													22.0	22.0	22.0					1																	149783597		2203	4275	6478	SO:0001583	missense	0			BC110793	CCDS30846.1, CCDS53359.1	1q21.2	2013-06-03	2006-10-11		ENSG00000203814	ENSG00000203814		"""Histones / Replication-dependent"""	24700	protein-coding gene	gene with protein product			"""histone 2, H2bf"""				Standard	NM_001161334		Approved		uc010pbj.2	Q5QNW6	OTTHUMG00000183159	ENST00000369167.1:c.282G>C	1.37:g.149783597C>G	ENSP00000358164:p.Glu94Asp		A8K0U9|B4DLA9	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.E94D	ENST00000369167.1	37	c.282	CCDS30846.1	1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.035229	0.75617	.	.	ENSG00000203814	ENST00000545683;ENST00000427880;ENST00000369167	T;T;T	0.44881	0.91;0.91;0.91	3.56	3.56	0.40772	Histone-fold (2);Histone core (1);	0.000000	0.64402	D	0.000011	T	0.44891	0.1315	M	0.75884	2.315	0.46011	D	0.998811	P;B;B	0.37636	0.603;0.286;0.057	P;B;B	0.47206	0.541;0.387;0.194	T	0.54351	-0.8307	10	0.66056	D	0.02	.	14.937	0.70964	0.0:1.0:0.0:0.0	.	94;94;94	B4DR52;B4DLA9;Q5QNW6	.;.;H2B2F_HUMAN	D	94	ENSP00000445831:E94D;ENSP00000407461:E94D;ENSP00000358164:E94D	ENSP00000358164:E94D	E	-	3	2	HIST2H2BF	148050221	1.000000	0.71417	1.000000	0.80357	0.227000	0.25037	6.976000	0.76135	2.287000	0.76781	0.195000	0.17529	GAG	HIST2H2BF	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000203814		0.642	HIST2H2BF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H2BF	HGNC	protein_coding	OTTHUMT00000033453.2	-	0.00	110	0	C	NM_001024599		149783597	-1	tier1	-	no_errors	ENST00000427880	ensembl	human	known	74_37	missense	8.78	187	18	SNP	1.000	G
HLA-DQA2	3118	genome.wustl.edu	37	6	32713702	32713702	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:32713702G>A	ENST00000374940.3	+	3	568	c.466G>A	c.(466-468)Gaa>Aaa	p.E156K		NM_020056.4	NP_064440.1	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ alpha 2	156	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)			endometrium(2)|large_intestine(3)|lung(7)|skin(1)	13					"""""""Insulin(DB00071)"""	CTCAGTCACAGAAGGTGTTTC	0.498																																																	0													264.0	238.0	247.0					6																	32713702		1511	2709	4220	SO:0001583	missense	0				CCDS4753.1	6p21.3	2013-01-11			ENSG00000237541	ENSG00000237541		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4943	protein-coding gene	gene with protein product		613503		HLA-DXA			Standard	NM_020056		Approved		uc003obx.3	P01906	OTTHUMG00000031108	ENST00000374940.3:c.466G>A	6.37:g.32713702G>A	ENSP00000364076:p.Glu156Lys		A2BF37|B0V0E7|O19789|Q5SQ94|Q5SR04	Missense_Mutation	SNP	pfam_MHC_II_a_N,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.E156K	ENST00000374940.3	37	c.466	CCDS4753.1	6	.	.	.	.	.	.	.	.	.	.	.	8.495	0.862985	0.17178	.	.	ENSG00000237541	ENST00000374940	T	0.03065	4.06	3.06	1.18	0.20946	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.417696	0.22510	N	0.059118	T	0.01454	0.0047	L	0.54908	1.71	0.29429	N	0.859987	B	0.09022	0.002	B	0.15052	0.012	T	0.39683	-0.9602	10	0.52906	T	0.07	.	6.7156	0.23302	0.2687:0.0:0.7313:0.0	.	156	P01906	DQA2_HUMAN	K	156	ENSP00000364076:E156K	ENSP00000364076:E156K	E	+	1	0	HLA-DQA2	32821680	0.556000	0.26538	0.973000	0.42090	0.210000	0.24377	2.038000	0.41184	0.591000	0.29711	0.174000	0.16983	GAA	HLA-DQA2	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like_dom	ENSG00000237541		0.498	HLA-DQA2-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	HLA-DQA2	HGNC	protein_coding	OTTHUMT00000076179.2	-	0.00	185	0	G	NM_020056		32713702	+1	tier1	-	no_errors	ENST00000374940	ensembl	human	known	74_37	missense	16.79	228	46	SNP	0.823	A
HMCN1	83872	genome.wustl.edu	37	1	186050412	186050412	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:186050412G>A	ENST00000271588.4	+	56	8902	c.8673G>A	c.(8671-8673)ctG>ctA	p.L2891L	HMCN1_ENST00000367492.2_Silent_p.L2891L	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2891	Ig-like C2-type 27.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGAGTGCACTGATAGAGTGTT	0.463																																																	0													161.0	154.0	157.0					1																	186050412		2203	4300	6503	SO:0001819	synonymous_variant	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.8673G>A	1.37:g.186050412G>A			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.L2891	ENST00000271588.4	37	c.8673	CCDS30956.1	1																																																																																			HMCN1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000143341		0.463	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	44	0	G	NM_031935		186050412	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	silent	11.11	48	6	SNP	0.352	A
HSD11B2	3291	genome.wustl.edu	37	16	67470642	67470642	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:67470642C>T	ENST00000326152.5	+	5	1086	c.954C>T	c.(952-954)ctC>ctT	p.L318L	ATP6V0D1_ENST00000567694.1_5'Flank	NM_000196.3	NP_000187.3	P80365	DHI2_HUMAN	hydroxysteroid (11-beta) dehydrogenase 2	318					female pregnancy (GO:0007565)|glucocorticoid biosynthetic process (GO:0006704)|regulation of blood volume by renal aldosterone (GO:0002017)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)	endoplasmic reticulum (GO:0005783)	11-beta-hydroxysteroid dehydrogenase [NAD(P)] activity (GO:0003845)|NAD binding (GO:0051287)|steroid binding (GO:0005496)			breast(1)|endometrium(1)|liver(2)|lung(3)|upper_aerodigestive_tract(1)	8		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0401)|Epithelial(162;0.0891)		TGTCCGACCTCACCCCAGTTG	0.627																																																	0													103.0	91.0	95.0					16																	67470642		2198	4300	6498	SO:0001819	synonymous_variant	0			U14631	CCDS10837.1	16q22	2011-09-14			ENSG00000176387	ENSG00000176387	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5209	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 3"""	614232				7859916, 8611140, 19027726	Standard	NM_000196		Approved	SDR9C3	uc002etd.3	P80365	OTTHUMG00000137507	ENST00000326152.5:c.954C>T	16.37:g.67470642C>T			A7LB28|C5HTY7|Q13194|Q6P2G9|Q8N439|Q96QN8|Q9UC50|Q9UC51|Q9UCW5|Q9UCW6|Q9UCW7|Q9UCW8	Silent	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH	p.L318	ENST00000326152.5	37	c.954	CCDS10837.1	16																																																																																			HSD11B2	-	NULL	ENSG00000176387		0.627	HSD11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD11B2	HGNC	protein_coding	OTTHUMT00000268826.3	-	0.00	42	0	C	NM_000196		67470642	+1	tier1	-	no_errors	ENST00000326152	ensembl	human	known	74_37	silent	12.12	58	8	SNP	0.997	T
HTR1D	3352	genome.wustl.edu	37	1	23520393	23520393	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:23520393C>T	ENST00000374619.1	-	1	829	c.320G>A	c.(319-321)gGc>gAc	p.G107D	HTR1D_ENST00000314113.3_Missense_Mutation_p.G107D	NM_000864.4	NP_000855.1	P28221	5HT1D_HUMAN	5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled	107					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intestine smooth muscle contraction (GO:0014827)|regulation of behavior (GO:0050795)|regulation of locomotion (GO:0040012)|response to toxic substance (GO:0009636)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			NS(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000779)|all_lung(284;0.00135)|Breast(348;0.0385)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0561)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;4.69e-27)|Colorectal(126;4.86e-08)|COAD - Colon adenocarcinoma(152;2.86e-06)|GBM - Glioblastoma multiforme(114;0.00012)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(1967;0.00122)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.083)|LUSC - Lung squamous cell carcinoma(448;0.185)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Naratriptan(DB00952)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Risperidone(DB00734)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	CAAGATTTGGCCAAAGTTCCA	0.532																																																	0													224.0	194.0	204.0					1																	23520393		2203	4300	6503	SO:0001583	missense	0			M89955	CCDS231.1	1p36.3-p34.3	2012-08-08	2012-02-03		ENSG00000179546	ENSG00000179546		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5289	protein-coding gene	gene with protein product		182133	"""5-hydroxytryptamine (serotonin) receptor 1D"""	HTRL		2541503, 1662665	Standard	NM_000864		Approved	RDC4, HT1DA, 5-HT1D	uc001bgn.3	P28221	OTTHUMG00000003235	ENST00000374619.1:c.320G>A	1.37:g.23520393C>T	ENSP00000363748:p.Gly107Asp			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_5HT1D_rcpt,prints_5HT_rcpt	p.G107D	ENST00000374619.1	37	c.320	CCDS231.1	1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.661077	0.88154	.	.	ENSG00000179546	ENST00000314113;ENST00000374619	T;T	0.49720	0.77;0.77	5.6	5.6	0.85130	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.77980	0.4212	M	0.93462	3.42	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83667	0.0164	10	0.87932	D	0	.	18.5989	0.91240	0.0:1.0:0.0:0.0	.	107	P28221	5HT1D_HUMAN	D	107	ENSP00000313661:G107D;ENSP00000363748:G107D	ENSP00000313661:G107D	G	-	2	0	HTR1D	23392980	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.818000	0.86416	2.648000	0.89879	0.655000	0.94253	GGC	HTR1D	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000179546		0.532	HTR1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1D	HGNC	protein_coding	OTTHUMT00000008924.1	-	0.00	54	0	C	NM_000864		23520393	-1	tier1	-	no_errors	ENST00000314113	ensembl	human	known	74_37	missense	20.69	69	18	SNP	1.000	T
HYDIN	54768	genome.wustl.edu	37	16	71022384	71022384	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:71022384C>G	ENST00000393567.2	-	26	4046	c.3896G>C	c.(3895-3897)aGa>aCa	p.R1299T		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1299					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGAGTATATTCTTTCTATTTC	0.378																																																	0													1.0	1.0	1.0					16																	71022384		208	1080	1288	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.3896G>C	16.37:g.71022384C>G	ENSP00000377197:p.Arg1299Thr		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_PapD-like	p.R1299T	ENST00000393567.2	37	c.3896	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	6.396	0.441173	0.12164	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00856	5.61	4.84	1.8	0.24995	.	.	.	.	.	T	0.00998	0.0033	L	0.44542	1.39	0.23232	N	0.998074	B	0.33612	0.419	B	0.33690	0.168	T	0.47548	-0.9109	9	0.14656	T	0.56	.	7.1705	0.25717	0.0:0.7111:0.0:0.2889	.	1298	F8WD23	.	T	1299;1298	ENSP00000377197:R1299T	ENSP00000313052:R1298T	R	-	2	0	HYDIN	69579885	0.000000	0.05858	0.043000	0.18650	0.073000	0.16967	-0.050000	0.11904	0.194000	0.20326	0.511000	0.50034	AGA	HYDIN	-	NULL	ENSG00000157423		0.378	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3		0.00	10	0	C			71022384	-1			no_errors	ENST00000393567	ensembl	human	putative	74_37	missense	33.33	6	3	SNP	0.225	G
ICAM1	3383	genome.wustl.edu	37	19	10395227	10395227	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:10395227G>A	ENST00000264832.3	+	5	1399	c.1074G>A	c.(1072-1074)ctG>ctA	p.L358L	ICAM1_ENST00000423829.2_Silent_p.L136L|CTD-2369P2.5_ENST00000592893.1_RNA|CTD-2369P2.8_ENST00000589379.1_RNA|ICAM4_ENST00000380770.3_5'Flank|ICAM4_ENST00000340992.4_5'Flank|ICAM4_ENST00000393717.2_5'Flank	NM_000201.2	NP_000192.2	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1	358	Ig-like C2-type 4.				adhesion of symbiont to host (GO:0044406)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell aging (GO:0007569)|cellular response to alkaloid (GO:0071312)|cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nutrient levels (GO:0031669)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|establishment of endothelial barrier (GO:0061028)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|ovarian follicle development (GO:0001541)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cellular extravasation (GO:0002693)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of vasoconstriction (GO:0045907)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of leukocyte mediated cytotoxicity (GO:0001910)|regulation of ruffle assembly (GO:1900027)|response to amino acid (GO:0043200)|response to amphetamine (GO:0001975)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gonadotropin (GO:0034698)|response to ionizing radiation (GO:0010212)|response to organic cyclic compound (GO:0014070)|response to sulfur dioxide (GO:0010477)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)|T cell antigen processing and presentation (GO:0002457)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Hyaluronan(DB08818)|Natalizumab(DB00108)	AGCTCCTGCTGAAGGCCACCC	0.647																																																	0													39.0	47.0	44.0					19																	10395227		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12231.1	19p13.3-p13.2	2014-01-30	2008-07-18			ENSG00000090339		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5344	protein-coding gene	gene with protein product	"""human rhinovirus receptor"""	147840				2453850, 3871395	Standard	NM_000201		Approved	BB2, CD54	uc002mnq.2	P05362		ENST00000264832.3:c.1074G>A	19.37:g.10395227G>A			B2R6M3|Q5NKV7|Q96B50	Silent	SNP	pfam_ICAM_N,smart_Ig_sub,prints_ICAM_VCAM_N,prints_ICAM	p.L358	ENST00000264832.3	37	c.1074	CCDS12231.1	19																																																																																			ICAM1	-	smart_Ig_sub	ENSG00000090339		0.647	ICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICAM1	HGNC	protein_coding	OTTHUMT00000451207.1	-	0.00	36	0	G			10395227	+1	tier1	-	no_errors	ENST00000264832	ensembl	human	known	74_37	silent	18.18	18	4	SNP	0.059	A
IER2	9592	genome.wustl.edu	37	19	13264138	13264138	+	Silent	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:13264138C>G	ENST00000588173.1	+	1	1350	c.138C>G	c.(136-138)ctC>ctG	p.L46L	STX10_ENST00000343587.5_5'Flank|IER2_ENST00000587885.1_Silent_p.L46L|CTC-250I14.6_ENST00000586483.1_RNA|IER2_ENST00000292433.3_Silent_p.L46L|CTC-250I14.6_ENST00000592882.1_RNA			Q9BTL4	IER2_HUMAN	immediate early response 2	46						cytoplasm (GO:0005737)				kidney(1)|lung(1)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(19;3.41e-21)			CCCGGGAGCTCTACCTCTCGG	0.697											OREG0025291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													14.0	15.0	15.0					19																	13264138		2198	4296	6494	SO:0001819	synonymous_variant	0			M62831	CCDS12295.1	19p13.13	2008-02-05				ENSG00000160888			28871	protein-coding gene	gene with protein product						2061303	Standard	NM_004907		Approved	ETR101	uc002mwr.3	Q9BTL4		ENST00000588173.1:c.138C>G	19.37:g.13264138C>G		686	Q03827|Q2TAZ2	Silent	SNP	pfam_IER	p.L46	ENST00000588173.1	37	c.138	CCDS12295.1	19																																																																																			IER2	-	pfam_IER	ENSG00000160888		0.697	IER2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IER2	HGNC	protein_coding	OTTHUMT00000453033.1	-	0.00	60	0	C	NM_004907		13264138	+1	tier1	-	no_errors	ENST00000292433	ensembl	human	known	74_37	silent	19.70	53	13	SNP	1.000	G
IFI16	3428	genome.wustl.edu	37	1	159002344	159002344	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:159002344G>A	ENST00000295809.7	+	7	1447	c.1192G>A	c.(1192-1194)Gac>Aac	p.D398N	IFI16_ENST00000430894.2_Missense_Mutation_p.D346N|IFI16_ENST00000368131.4_Missense_Mutation_p.D398N|IFI16_ENST00000340979.6_Missense_Mutation_p.D398N|IFI16_ENST00000359709.3_Missense_Mutation_p.D342N|IFI16_ENST00000368132.3_Missense_Mutation_p.D398N|IFI16_ENST00000448393.2_Missense_Mutation_p.D398N			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	398					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					GAGAAACAATGACCCCAAGAG	0.423																																																	0													93.0	88.0	90.0					1																	159002344		2203	4300	6503	SO:0001583	missense	0			M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.1192G>A	1.37:g.159002344G>A	ENSP00000295809:p.Asp398Asn		B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN,pfscan_HIN200/IF120x	p.D398N	ENST00000295809.7	37	c.1192		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.22|12.22	1.871139|1.871139	0.33069|0.33069	.|.	.|.	ENSG00000163565|ENSG00000163565	ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132;ENST00000430894|ENST00000448393	T;T;T;T;T|.	0.05580|.	3.52;3.42;3.53;3.53;3.48|.	2.15|2.15	0.199|0.199	0.15175|0.15175	.|.	.|.	.|.	.|.	.|.	T|T	0.15522|0.15522	0.0374|0.0374	L|L	0.42245|0.42245	1.32|1.32	0.09310|0.09310	N|N	1|1	B;P|.	0.37955|.	0.024;0.612|.	B;B|.	0.37451|.	0.008;0.25|.	T|T	0.28996|0.28996	-1.0026|-1.0026	9|5	0.48119|.	T|.	0.1|.	.|.	4.2967|4.2967	0.10904|0.10904	0.3658:0.0:0.6342:0.0|0.3658:0.0:0.6342:0.0	.|.	346;398|.	E7EPR3;Q16666-2|.	.;.|.	N|I	398;398;398;398;346|218	ENSP00000295809:D398N;ENSP00000342741:D398N;ENSP00000357113:D398N;ENSP00000357114:D398N;ENSP00000394935:D346N|.	ENSP00000295809:D398N|.	D|M	+|+	1|3	0|0	IFI16|IFI16	157268968|157268968	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-0.182000|-0.182000	0.09726|0.09726	0.039000|0.039000	0.15632|0.15632	0.462000|0.462000	0.41574|0.41574	GAC|ATG	IFI16	-	NULL	ENSG00000163565		0.423	IFI16-013	KNOWN	basic	protein_coding	IFI16	HGNC	protein_coding	OTTHUMT00000421720.1	-	0.00	32	0	G	NM_005531		159002344	+1	tier1	-	no_errors	ENST00000295809	ensembl	human	known	74_37	missense	19.67	49	12	SNP	0.000	A
IL6ST	3572	genome.wustl.edu	37	5	55250687	55250687	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:55250687G>C	ENST00000381298.2	-	11	1713	c.1401C>G	c.(1399-1401)atC>atG	p.I467M	IL6ST_ENST00000381293.2_Intron|IL6ST_ENST00000502326.3_Missense_Mutation_p.I467M|IL6ST_ENST00000381294.3_Intron|IL6ST_ENST00000381287.4_3'UTR|IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000336909.5_Missense_Mutation_p.I467M|IL6ST_ENST00000536319.1_Intron|IL6ST_ENST00000522633.2_3'UTR	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	467	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				GCCAGTCTGTGATACAGGGTG	0.393			O		hepatocellular ca																																			Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	0													210.0	201.0	204.0					5																	55250687		2203	4300	6503	SO:0001583	missense	0			M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.1401C>G	5.37:g.55250687G>C	ENSP00000370698:p.Ile467Met		A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,pfam_IL-6_rcpt_alpha-bd,pfam_Growth/epo_recpt_lig-bind,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.I467M	ENST00000381298.2	37	c.1401	CCDS3971.1	5	.	.	.	.	.	.	.	.	.	.	G	7.456	0.643757	0.14451	.	.	ENSG00000134352	ENST00000381298;ENST00000336909	T;T	0.32023	1.47;1.47	5.79	-0.508	0.11980	Fibronectin, type III (3);Immunoglobulin-like fold (1);	1.028080	0.07635	N	0.929266	T	0.29223	0.0727	L	0.59436	1.845	0.09310	N	1	B;B	0.21381	0.055;0.026	B;B	0.24848	0.054;0.056	T	0.36744	-0.9735	10	0.33141	T	0.24	.	7.8442	0.29417	0.3664:0.1014:0.5322:0.0	.	467;467	Q17RA0;P40189	.;IL6RB_HUMAN	M	467	ENSP00000370698:I467M;ENSP00000338799:I467M	ENSP00000338799:I467M	I	-	3	3	IL6ST	55286444	0.000000	0.05858	0.082000	0.20525	0.250000	0.25880	0.024000	0.13555	0.085000	0.17107	-0.218000	0.12543	ATC	IL6ST	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000134352		0.393	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	IL6ST	HGNC	protein_coding	OTTHUMT00000214146.3	-	0.00	52	0	G	NM_002184		55250687	-1	tier1	-	no_errors	ENST00000336909	ensembl	human	known	74_37	missense	21.15	41	11	SNP	0.000	C
INO80C	125476	genome.wustl.edu	37	18	33048694	33048694	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr18:33048694C>T	ENST00000334598.7	-	5	576	c.460G>A	c.(460-462)Gac>Aac	p.D154N	INO80C_ENST00000586489.1_Missense_Mutation_p.D99N|INO80C_ENST00000441607.2_Missense_Mutation_p.D190N|RP11-322E11.6_ENST00000589258.1_Intron|INO80C_ENST00000590757.1_Missense_Mutation_p.D57N|INO80C_ENST00000592173.1_Intron|RP11-322E11.5_ENST00000591141.1_lincRNA	NM_194281.3	NP_919257.2	Q6PI98	IN80C_HUMAN	INO80 complex subunit C	154					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)				central_nervous_system(1)|endometrium(1)|lung(3)|prostate(2)|skin(1)	8						CTCTGGGGGTCTGTGTAGTTG	0.488																																																	0													84.0	86.0	86.0					18																	33048694		2203	4300	6503	SO:0001583	missense	0				CCDS11914.1, CCDS45853.1	18q12.2	2011-07-06	2008-08-07	2008-08-07	ENSG00000153391	ENSG00000153391		"""INO80 complex subunits"""	26994	protein-coding gene	gene with protein product	"""IES6 homolog (S. cerevisiae)"""		"""chromosome 18 open reading frame 37"""	C18orf37		16230350	Standard	NM_001098817		Approved	FLJ38183, hIes6, IES6	uc010dmt.3	Q6PI98	OTTHUMG00000132564	ENST00000334598.7:c.460G>A	18.37:g.33048694C>T	ENSP00000334473:p.Asp154Asn		B4DUI4|E9PCS7|Q86WR1|Q8N994	Missense_Mutation	SNP	pfam_YL1_C	p.D190N	ENST00000334598.7	37	c.568	CCDS11914.1	18	.	.	.	.	.	.	.	.	.	.	C	32	5.178194	0.94846	.	.	ENSG00000153391	ENST00000441607;ENST00000334598	.	.	.	5.29	5.29	0.74685	YL1 nuclear, C-terminal (1);	.	.	.	.	T	0.78547	0.4300	M	0.74647	2.275	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.73708	0.979;0.981	T	0.79787	-0.1656	8	0.52906	T	0.07	.	16.4478	0.83947	0.0:1.0:0.0:0.0	.	190;154	E9PCS7;Q6PI98	.;IN80C_HUMAN	N	190;154	.	ENSP00000334473:D154N	D	-	1	0	INO80C	31302692	1.000000	0.71417	0.993000	0.49108	0.969000	0.65631	7.511000	0.81718	2.474000	0.83562	0.557000	0.71058	GAC	INO80C	-	pfam_YL1_C	ENSG00000153391		0.488	INO80C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INO80C	HGNC	protein_coding	OTTHUMT00000255768.1	-	0.00	61	0	C	NM_194281		33048694	-1	tier1	-	no_errors	ENST00000441607	ensembl	human	known	74_37	missense	8.77	52	5	SNP	1.000	T
INPP5E	56623	genome.wustl.edu	37	9	139327500	139327500	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr9:139327500C>T	ENST00000371712.3	-	5	1589	c.1187G>A	c.(1186-1188)cGc>cAc	p.R396H		NM_019892.4	NP_063945.2	Q10713	MPPA_HUMAN	inositol polyphosphate-5-phosphatase, 72 kDa	0					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|endometrium(1)|lung(4)|skin(3)	9		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.36e-06)|Epithelial(140;1.4e-05)		AGACACGATGCGTGTGGTCAC	0.612																																																	0													167.0	152.0	157.0					9																	139327500		2202	4300	6502	SO:0001583	missense	0			AF187891	CCDS7000.1	9q34.3	2011-02-11			ENSG00000148384	ENSG00000148384			21474	protein-coding gene	gene with protein product		613037	"""Joubert syndrome 1"""	JBTS1		10764818, 10577920, 19668216	Standard	NM_019892		Approved	PPI5PIV, CORS1	uc004cho.3	Q9NRR6	OTTHUMG00000020927	ENST00000371712.3:c.1187G>A	9.37:g.139327500C>T	ENSP00000360777:p.Arg396His		B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	p.R396H	ENST00000371712.3	37	c.1187	CCDS7000.1	9	.	.	.	.	.	.	.	.	.	.	C	27.3	4.815134	0.90790	.	.	ENSG00000148384	ENST00000371712	D	0.95307	-3.67	4.88	4.88	0.63580	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.97654	0.9231	M	0.90483	3.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.994	D	0.97767	1.0224	10	0.45353	T	0.12	-27.325	17.3863	0.87416	0.0:1.0:0.0:0.0	.	362;396	Q9NRR6-2;Q9NRR6	.;INP5E_HUMAN	H	396	ENSP00000360777:R396H	ENSP00000360777:R396H	R	-	2	0	INPP5E	138447321	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.204000	0.77872	2.423000	0.82170	0.561000	0.74099	CGC	INPP5E	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	ENSG00000148384		0.612	INPP5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP5E	HGNC	protein_coding	OTTHUMT00000055058.1	-	0.00	42	0	C	NM_019892		139327500	-1	tier1	-	no_errors	ENST00000371712	ensembl	human	known	74_37	missense	21.28	37	10	SNP	1.000	T
IQGAP3	128239	genome.wustl.edu	37	1	156524141	156524141	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:156524141G>A	ENST00000361170.2	-	13	1344	c.1334C>T	c.(1333-1335)tCa>tTa	p.S445L		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	445					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GACCACAGCTGAGAGCATCTC	0.617																																																	0													43.0	43.0	43.0					1																	156524141		2203	4300	6503	SO:0001583	missense	0			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.1334C>T	1.37:g.156524141G>A	ENSP00000354451:p.Ser445Leu		Q5T3H8	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_RasGAP	p.S445L	ENST00000361170.2	37	c.1334	CCDS1144.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.244411	0.95272	.	.	ENSG00000183856	ENST00000361170	T	0.14022	2.54	5.03	5.03	0.67393	.	0.000000	0.64402	D	0.000003	T	0.30823	0.0777	M	0.78344	2.41	0.80722	D	1	D	0.63880	0.993	D	0.72338	0.977	T	0.05468	-1.0883	10	0.54805	T	0.06	-5.3578	16.9657	0.86285	0.0:0.0:1.0:0.0	.	445	Q86VI3	IQGA3_HUMAN	L	445	ENSP00000354451:S445L	ENSP00000354451:S445L	S	-	2	0	IQGAP3	154790765	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	9.869000	0.99810	2.336000	0.79503	0.561000	0.74099	TCA	IQGAP3	-	NULL	ENSG00000183856		0.617	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	HGNC	protein_coding	OTTHUMT00000080657.1	-	0.00	70	0	G	NM_178229		156524141	-1	tier1	-	no_errors	ENST00000361170	ensembl	human	known	74_37	missense	21.62	58	16	SNP	1.000	A
IQSEC3	440073	genome.wustl.edu	37	12	176445	176445	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:176445C>T	ENST00000538872.1	+	1	515	c.397C>T	c.(397-399)Cac>Tac	p.H133Y	IQSEC3_ENST00000326261.4_Missense_Mutation_p.H133Y			Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	133					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		CAGCAGGGCTCACACACCCCA	0.721																																																	0													17.0	24.0	21.0					12																	176445		1563	3578	5141	SO:0001583	missense	0			AB029033	CCDS31725.1, CCDS53728.1	12p13.33	2014-03-18			ENSG00000120645	ENSG00000120645			29193	protein-coding gene	gene with protein product		612118				10470851	Standard	NM_001170738		Approved	KIAA1110, MGC30156	uc001qhw.2	Q9UPP2	OTTHUMG00000167975	ENST00000538872.1:c.397C>T	12.37:g.176445C>T	ENSP00000437554:p.His133Tyr		A6NIF2|A6NKV9|Q8TB43	Missense_Mutation	SNP	pfam_Sec7_dom,superfamily_Sec7_dom,smart_Sec7_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7_dom	p.H133Y	ENST00000538872.1	37	c.397	CCDS53728.1	12	.	.	.	.	.	.	.	.	.	.	c	3.655	-0.070735	0.07228	.	.	ENSG00000120645	ENST00000538872;ENST00000326261	T;T	0.36878	1.23;1.23	4.8	1.36	0.22044	.	3.797020	0.01010	U	0.003812	T	0.21145	0.0509	N	0.22421	0.69	0.09310	N	1	.	.	.	.	.	.	T	0.16719	-1.0393	8	0.02654	T	1	.	4.558	0.12145	0.1795:0.5993:0.0:0.2212	.	.	.	.	Y	133	ENSP00000437554:H133Y;ENSP00000315662:H133Y	ENSP00000315662:H133Y	H	+	1	0	IQSEC3	46706	0.887000	0.30362	0.056000	0.19401	0.093000	0.18481	1.763000	0.38461	0.412000	0.25729	0.561000	0.74099	CAC	IQSEC3	-	NULL	ENSG00000120645		0.721	IQSEC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IQSEC3	HGNC	protein_coding	OTTHUMT00000397382.3	-	0.00	131	0	C	XM_495902		176445	+1	tier1	-	no_errors	ENST00000326261	ensembl	human	known	74_37	missense	21.15	123	33	SNP	0.032	T
ISG20	3669	genome.wustl.edu	37	15	89182739	89182739	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr15:89182739G>C	ENST00000306072.5	+	2	500	c.142G>C	c.(142-144)Gag>Cag	p.E48Q	ISG20_ENST00000379224.5_Missense_Mutation_p.E48Q|ISG20_ENST00000560741.1_Missense_Mutation_p.E48Q	NM_002201.4	NP_002192.2	Q96AZ6	ISG20_HUMAN	interferon stimulated exonuclease gene 20kDa	48					cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA catabolic process, exonucleolytic (GO:0000738)|negative regulation of viral genome replication (GO:0045071)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	3'-5'-exoribonuclease activity (GO:0000175)|exonuclease activity (GO:0004527)|exoribonuclease II activity (GO:0008859)|metal ion binding (GO:0046872)|single-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008310)|U1 snRNA binding (GO:0030619)|U2 snRNA binding (GO:0030620)|U3 snoRNA binding (GO:0034511)			large_intestine(1)|lung(3)|prostate(1)	5	Lung NSC(78;0.0554)|all_lung(78;0.103)		BRCA - Breast invasive adenocarcinoma(143;0.12)			GCCTGAGGGAGAGATCACCGA	0.652																																																	0													68.0	68.0	68.0					15																	89182739		2200	4299	6499	SO:0001583	missense	0			X89773	CCDS10345.1	15q26	2006-02-22	2002-08-29		ENSG00000172183	ENSG00000172183			6130	protein-coding gene	gene with protein product		604533	"""interferon stimulated gene (20kD)"""			9235947, 9605874	Standard	NM_002201		Approved	HEM45, CD25	uc002bmv.1	Q96AZ6	OTTHUMG00000148679	ENST00000306072.5:c.142G>C	15.37:g.89182739G>C	ENSP00000306565:p.Glu48Gln		O00441|O00586	Missense_Mutation	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.E48Q	ENST00000306072.5	37	c.142	CCDS10345.1	15	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210298	0.39003	.	.	ENSG00000172183	ENST00000306072;ENST00000379224	T;T	0.22743	1.94;1.94	4.81	0.716	0.18191	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	1.416180	0.04277	N	0.343092	T	0.19046	0.0457	L	0.45744	1.44	0.09310	N	1	B	0.15141	0.012	B	0.15870	0.014	T	0.26643	-1.0097	10	0.34782	T	0.22	-0.1539	4.6482	0.12582	0.2531:0.3173:0.4296:0.0	.	48	Q96AZ6	ISG20_HUMAN	Q	48	ENSP00000306565:E48Q;ENSP00000368526:E48Q	ENSP00000306565:E48Q	E	+	1	0	ISG20	86983743	0.000000	0.05858	0.005000	0.12908	0.945000	0.59286	0.237000	0.17985	0.435000	0.26365	0.561000	0.74099	GAG	ISG20	-	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	ENSG00000172183		0.652	ISG20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISG20	HGNC	protein_coding	OTTHUMT00000309069.2	-	0.00	53	0	G	NM_002201		89182739	+1	tier1	-	no_errors	ENST00000306072	ensembl	human	known	74_37	missense	18.75	65	15	SNP	0.000	C
ITPR3	3710	genome.wustl.edu	37	6	33653581	33653581	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:33653581G>C	ENST00000374316.5	+	42	6704	c.5644G>C	c.(5644-5646)Gag>Cag	p.E1882Q	ITPR3_ENST00000605930.1_Missense_Mutation_p.E1882Q			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	1882					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	GCTGCTGTGTGAGAACCACAA	0.652																																																	0													56.0	53.0	54.0					6																	33653581		2203	4300	6503	SO:0001583	missense	0			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.5644G>C	6.37:g.33653581G>C	ENSP00000363435:p.Glu1882Gln		Q14649|Q5TAQ2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.E1882Q	ENST00000374316.5	37	c.5644	CCDS4783.1	6	.	.	.	.	.	.	.	.	.	.	G	18.56	3.650920	0.67472	.	.	ENSG00000096433	ENST00000374316	D	0.97529	-4.42	4.69	3.75	0.43078	RyR/IP3R Homology associated domain (1);	0.123543	0.56097	D	0.000037	D	0.98516	0.9505	M	0.92784	3.345	0.80722	D	1	D	0.61080	0.989	D	0.69142	0.962	D	0.99264	1.0891	10	0.87932	D	0	-35.8249	14.2036	0.65721	0.0:0.1503:0.8497:0.0	.	1882	Q14573	ITPR3_HUMAN	Q	1882	ENSP00000363435:E1882Q	ENSP00000363435:E1882Q	E	+	1	0	ITPR3	33761559	1.000000	0.71417	0.993000	0.49108	0.415000	0.31203	7.920000	0.87521	2.157000	0.67596	0.313000	0.20887	GAG	ITPR3	-	pfam_RIH_assoc-dom,superfamily_ARM-type_fold	ENSG00000096433		0.652	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR3	HGNC	protein_coding	OTTHUMT00000040204.2	-	0.00	11	0	G	NM_002224		33653581	+1	tier1	-	no_errors	ENST00000374316	ensembl	human	known	74_37	missense	30.77	9	4	SNP	1.000	C
JAKMIP3	282973	genome.wustl.edu	37	10	133930673	133930673	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr10:133930673G>C	ENST00000298622.4	+	2	366	c.228G>C	c.(226-228)aaG>aaC	p.K76N		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	76						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CGGAGCTCAAGACAAAGCTGC	0.577																																																	0													50.0	58.0	55.0					10																	133930673		2195	4296	6491	SO:0001583	missense	0			AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.228G>C	10.37:g.133930673G>C	ENSP00000298622:p.Lys76Asn		A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	NULL	p.K76N	ENST00000298622.4	37	c.228	CCDS44494.1	10	.	.	.	.	.	.	.	.	.	.	G	14.03	2.414714	0.42817	.	.	ENSG00000188385	ENST00000298622	T	0.09445	2.98	4.53	2.49	0.30216	.	0.051702	0.85682	D	0.000000	T	0.25158	0.0611	M	0.64170	1.965	0.25682	N	0.985782	D	0.89917	1.0	D	0.85130	0.997	T	0.01323	-1.1385	10	0.45353	T	0.12	-39.6689	9.0575	0.36414	0.2587:0.0:0.7413:0.0	.	76	Q5VZ66	JKIP3_HUMAN	N	76	ENSP00000298622:K76N	ENSP00000298622:K76N	K	+	3	2	JAKMIP3	133780663	1.000000	0.71417	0.963000	0.40424	0.439000	0.31926	1.369000	0.34227	1.121000	0.41925	0.491000	0.48974	AAG	JAKMIP3	-	NULL	ENSG00000188385		0.577	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	JAKMIP3	HGNC	protein_coding	OTTHUMT00000051049.3	-	0.00	24	0	G	NM_194303		133930673	+1	tier1	-	no_errors	ENST00000298622	ensembl	human	known	74_37	missense	11.36	39	5	SNP	0.990	C
KANK1	23189	genome.wustl.edu	37	9	710812	710812	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr9:710812G>T	ENST00000382303.1	+	7	698	c.46G>T	c.(46-48)Ggt>Tgt	p.G16C	KANK1_ENST00000382293.3_5'UTR|KANK1_ENST00000382297.2_Missense_Mutation_p.G16C|KANK1_ENST00000489369.1_3'UTR	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	16					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		AGGAAAAGCAGGTGATATTCT	0.383																																																	0													86.0	90.0	89.0					9																	710812		2203	4300	6503	SO:0001583	missense	0			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.46G>T	9.37:g.710812G>T	ENSP00000371740:p.Gly16Cys		A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G16C	ENST00000382303.1	37	c.46	CCDS34976.1	9	.	.	.	.	.	.	.	.	.	.	G	7.387	0.629912	0.14257	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297	T;T	0.38887	1.11;1.11	5.95	4.12	0.48240	.	0.413716	0.20992	N	0.082010	T	0.33000	0.0848	L	0.34521	1.04	0.80722	D	1	P;P	0.47106	0.69;0.89	B;B	0.39971	0.215;0.315	T	0.09840	-1.0656	10	0.59425	D	0.04	-0.4094	12.7036	0.57046	0.1333:0.0:0.8667:0.0	.	16;16	Q5W0W1;Q14678	.;KANK1_HUMAN	C	16	ENSP00000371740:G16C;ENSP00000371734:G16C	ENSP00000346479:G16C	G	+	1	0	KANK1	700812	1.000000	0.71417	0.772000	0.31596	0.215000	0.24574	2.919000	0.48836	0.858000	0.35431	0.655000	0.94253	GGT	KANK1	-	NULL	ENSG00000107104		0.383	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	HGNC	protein_coding	OTTHUMT00000051484.2	-	0.00	90	0	G	NM_015158		710812	+1	tier1	-	no_errors	ENST00000382297	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.896	T
KCNV1	27012	genome.wustl.edu	37	8	110986468	110986468	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:110986468G>A	ENST00000524391.1	-	2	1182	c.150C>T	c.(148-150)ttC>ttT	p.F50F	RP11-696P8.2_ENST00000530667.1_RNA|KCNV1_ENST00000297404.1_Silent_p.F50F			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	50					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|ion channel inhibitor activity (GO:0008200)|potassium channel regulator activity (GO:0015459)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			GCGAGAGCACGAAGCGGCTGC	0.706																																																	0													9.0	8.0	9.0					8																	110986468		2152	4209	6361	SO:0001819	synonymous_variant	0			AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164				8670833, 16382104	Standard	NM_014379		Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.150C>T	8.37:g.110986468G>A			Q9UHJ4	Silent	SNP	pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv8,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv4	p.F50	ENST00000524391.1	37	c.150	CCDS6314.1	8																																																																																			KCNV1	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv8,prints_K_chnl_volt-dep_Kv9	ENSG00000164794		0.706	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNV1	HGNC	protein_coding	OTTHUMT00000385525.1		0.00	39	0	G	NM_014379		110986468	-1			no_errors	ENST00000297404	ensembl	human	known	74_37	silent	22.09	67	19	SNP	0.982	A
KDM3B	51780	genome.wustl.edu	37	5	137761139	137761139	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:137761139G>C	ENST00000314358.5	+	17	4479	c.4279G>C	c.(4279-4281)Gag>Cag	p.E1427Q	KDM3B_ENST00000394866.1_Missense_Mutation_p.E1083Q|KDM3B_ENST00000542866.1_Missense_Mutation_p.E459Q	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	1427					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						GCTCAAGTCTGAGCTCTGGAA	0.463																																																	0													83.0	83.0	83.0					5																	137761139		2203	4300	6503	SO:0001583	missense	0			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.4279G>C	5.37:g.137761139G>C	ENSP00000326563:p.Glu1427Gln		A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.E1427Q	ENST00000314358.5	37	c.4279	CCDS34242.1	5	.	.	.	.	.	.	.	.	.	.	G	20.4	3.985908	0.74589	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866;ENST00000542866	T;T;T	0.70631	-0.5;-0.5;-0.5	5.17	5.17	0.71159	.	0.265469	0.42420	D	0.000703	T	0.74527	0.3728	L	0.36672	1.1	0.47949	D	0.999552	D;D	0.54964	0.969;0.958	P;P	0.55824	0.785;0.601	T	0.74487	-0.3649	10	0.41790	T	0.15	-9.655	18.6718	0.91514	0.0:0.0:1.0:0.0	.	1083;1427	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	Q	1427;1217;1083;459	ENSP00000326563:E1427Q;ENSP00000378335:E1083Q;ENSP00000439462:E459Q	ENSP00000326563:E1427Q	E	+	1	0	KDM3B	137789038	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.532000	0.67154	2.403000	0.81681	0.563000	0.77884	GAG	KDM3B	-	NULL	ENSG00000120733		0.463	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3B	HGNC	protein_coding	OTTHUMT00000373597.1	-	0.00	84	0	G	NM_016604		137761139	+1	tier1	-	no_errors	ENST00000314358	ensembl	human	known	74_37	missense	26.80	71	26	SNP	1.000	C
KDM3B	51780	genome.wustl.edu	37	5	137761147	137761147	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:137761147G>A	ENST00000314358.5	+	17	4487	c.4287G>A	c.(4285-4287)tgG>tgA	p.W1429*	KDM3B_ENST00000394866.1_Nonsense_Mutation_p.W1085*|KDM3B_ENST00000542866.1_Nonsense_Mutation_p.W461*	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	1429					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						CTGAGCTCTGGAAGCCAGAAG	0.453																																																	0													89.0	89.0	89.0					5																	137761147		2203	4300	6503	SO:0001587	stop_gained	0			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.4287G>A	5.37:g.137761147G>A	ENSP00000326563:p.Trp1429*		A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Nonsense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.W1429*	ENST00000314358.5	37	c.4287	CCDS34242.1	5	.	.	.	.	.	.	.	.	.	.	G	40	8.055674	0.98632	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866;ENST00000542866	.	.	.	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.2063	18.6718	0.91514	0.0:0.0:1.0:0.0	.	.	.	.	X	1429;1219;1085;461	.	ENSP00000326563:W1429X	W	+	3	0	KDM3B	137789046	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.403000	0.81681	0.563000	0.77884	TGG	KDM3B	-	NULL	ENSG00000120733		0.453	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3B	HGNC	protein_coding	OTTHUMT00000373597.1	-	0.00	88	0	G	NM_016604		137761147	+1	tier1	-	no_errors	ENST00000314358	ensembl	human	known	74_37	nonsense	27.45	74	28	SNP	1.000	A
KCTD16	57528	genome.wustl.edu	37	5	143853449	143853449	+	Silent	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:143853449G>C	ENST00000507359.3	+	3	2150	c.1059G>C	c.(1057-1059)ctG>ctC	p.L353L	KCTD16_ENST00000512467.1_Silent_p.L353L	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	353					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			CTGTCCAGCTGATCCAACAGT	0.552																																																	0													68.0	69.0	69.0					5																	143853449		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.1059G>C	5.37:g.143853449G>C			Q9P2M9	Silent	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.L353	ENST00000507359.3	37	c.1059	CCDS34260.1	5																																																																																			KCTD16	-	NULL	ENSG00000183775		0.552	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCTD16	HGNC	protein_coding	OTTHUMT00000371898.3	-	0.00	19	0	G	XM_098368		143853449	+1	tier1	-	no_errors	ENST00000507359	ensembl	human	known	74_37	silent	17.86	23	5	SNP	1.000	C
KDM5A	5927	genome.wustl.edu	37	12	431719	431719	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:431719G>A	ENST00000399788.2	-	17	2652	c.2290C>T	c.(2290-2292)Cga>Tga	p.R764*	KDM5A_ENST00000382815.4_Nonsense_Mutation_p.R764*	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	764					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						AGCATTACTCGCAATTCAATC	0.373			T	NUP98	AML																																			Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	0													109.0	107.0	107.0					12																	431719		1820	4078	5898	SO:0001587	stop_gained	0				CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.2290C>T	12.37:g.431719G>A	ENSP00000382688:p.Arg764*		A8MV76|Q4LE72|Q86XZ1	Nonsense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.R764*	ENST00000399788.2	37	c.2290	CCDS41736.1	12	.	.	.	.	.	.	.	.	.	.	G	43	10.359199	0.99390	.	.	ENSG00000073614	ENST00000261253;ENST00000399787;ENST00000399788;ENST00000382815;ENST00000544760	.	.	.	5.82	3.78	0.43462	.	0.124212	0.56097	D	0.000030	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.3378	12.2135	0.54394	0.0:0.0:0.3976:0.6024	.	.	.	.	X	383;723;764;764;383	.	ENSP00000261253:R383X	R	-	1	2	KDM5A	301980	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	3.795000	0.55499	1.392000	0.46585	0.655000	0.94253	CGA	KDM5A	-	pfam_Lys_sp_deMease_like_dom	ENSG00000073614		0.373	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5A	HGNC	protein_coding	OTTHUMT00000397812.1	-	0.00	21	0	G	NM_005056		431719	-1	tier1	-	no_errors	ENST00000399788	ensembl	human	known	74_37	nonsense	20.83	19	5	SNP	1.000	A
KIAA0430	9665	genome.wustl.edu	37	16	15715632	15715632	+	Nonsense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:15715632G>C	ENST00000396368.3	-	12	2803	c.2597C>G	c.(2596-2598)tCa>tGa	p.S866*	KIAA0430_ENST00000551742.1_Nonsense_Mutation_p.S866*|KIAA0430_ENST00000540441.2_Nonsense_Mutation_p.S701*|KIAA0430_ENST00000602337.1_Nonsense_Mutation_p.S863*|KIAA0430_ENST00000344181.3_Nonsense_Mutation_p.S535*|KIAA0430_ENST00000548025.1_Nonsense_Mutation_p.S863*	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	866	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						GGTGGCAAGTGAGACCAGGAT	0.428																																																	0													109.0	102.0	104.0					16																	15715632		1874	4119	5993	SO:0001587	stop_gained	0			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.2597C>G	16.37:g.15715632G>C	ENSP00000379654:p.Ser866*		A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Nonsense_Mutation	SNP	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.S866*	ENST00000396368.3	37	c.2597	CCDS10562.2	16	.	.	.	.	.	.	.	.	.	.	G	41	9.035063	0.99044	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000344181;ENST00000548025;ENST00000551742;ENST00000551298	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.8965	0.96963	0.0:0.0:1.0:0.0	.	.	.	.	X	866;701;865;535;863;866;713	.	ENSP00000315718:S865X	S	-	2	0	KIAA0430	15623133	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.017000	0.76399	2.717000	0.92951	0.655000	0.94253	TCA	KIAA0430	-	smart_RRM_dom,pfscan_RRM_dom	ENSG00000166783		0.428	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	HGNC	protein_coding	OTTHUMT00000252131.2	-	0.00	78	0	G	NM_014647		15715632	-1	tier1	-	no_errors	ENST00000396368	ensembl	human	known	74_37	nonsense	18.58	91	21	SNP	1.000	C
ICE1	23379	genome.wustl.edu	37	5	5464326	5464326	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:5464326G>C	ENST00000296564.7	+	13	5101	c.4879G>C	c.(4879-4881)Gag>Cag	p.E1627Q		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1627					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AATACGGCAAGAGGTGGGGCC	0.473																																																	0													85.0	91.0	89.0					5																	5464326		1976	4159	6135	SO:0001583	missense	0																														ENST00000296564.7:c.4879G>C	5.37:g.5464326G>C	ENSP00000296564:p.Glu1627Gln		Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	superfamily_Vitellinogen_superhlx	p.E1627Q	ENST00000296564.7	37	c.4879	CCDS47187.1	5	.	.	.	.	.	.	.	.	.	.	G	26.0	4.694426	0.88830	.	.	ENSG00000164151	ENST00000296564	T	0.19669	2.13	5.27	5.27	0.74061	.	.	.	.	.	T	0.44244	0.1284	L	0.56769	1.78	0.49798	D	0.999824	D	0.89917	1.0	D	0.87578	0.998	T	0.35351	-0.9792	9	0.87932	D	0	-14.0979	16.3759	0.83392	0.0:0.0:1.0:0.0	.	1627	Q9Y2F5	K0947_HUMAN	Q	1627	ENSP00000296564:E1627Q	ENSP00000296564:E1627Q	E	+	1	0	KIAA0947	5517326	1.000000	0.71417	0.998000	0.56505	0.894000	0.52154	7.081000	0.76844	2.453000	0.82957	0.460000	0.39030	GAG	KIAA0947	-	NULL	ENSG00000164151		0.473	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1	-	0.00	23	0	G			5464326	+1	tier1	-	no_errors	ENST00000296564	ensembl	human	known	74_37	missense	33.33	22	11	SNP	1.000	C
ICE1	23379	genome.wustl.edu	37	5	5465301	5465301	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:5465301G>C	ENST00000296564.7	+	13	6076	c.5854G>C	c.(5854-5856)Gag>Cag	p.E1952Q		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1952					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						GAGAGATCAAGAGAAGGAAGT	0.378																																																	0													64.0	56.0	58.0					5																	5465301		1851	4099	5950	SO:0001583	missense	0																														ENST00000296564.7:c.5854G>C	5.37:g.5465301G>C	ENSP00000296564:p.Glu1952Gln		Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	superfamily_Vitellinogen_superhlx	p.E1952Q	ENST00000296564.7	37	c.5854	CCDS47187.1	5	.	.	.	.	.	.	.	.	.	.	G	28.2	4.900988	0.92035	.	.	ENSG00000164151	ENST00000296564	T	0.34859	1.34	5.76	5.76	0.90799	.	.	.	.	.	T	0.58466	0.2124	L	0.59436	1.845	0.54753	D	0.999988	D	0.89917	1.0	D	0.87578	0.998	T	0.58736	-0.7584	9	0.87932	D	0	-14.1794	17.4637	0.87626	0.0:0.0:1.0:0.0	.	1952	Q9Y2F5	K0947_HUMAN	Q	1952	ENSP00000296564:E1952Q	ENSP00000296564:E1952Q	E	+	1	0	KIAA0947	5518301	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	8.932000	0.92897	2.730000	0.93505	0.591000	0.81541	GAG	KIAA0947	-	NULL	ENSG00000164151		0.378	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1	-	0.00	18	0	G			5465301	+1	tier1	-	no_errors	ENST00000296564	ensembl	human	known	74_37	missense	25.00	21	7	SNP	1.000	C
KIAA1211	57482	genome.wustl.edu	37	4	57176886	57176886	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr4:57176886G>C	ENST00000504228.1	+	4	445	c.340G>C	c.(340-342)Gag>Cag	p.E114Q	KIAA1211_ENST00000541073.1_Missense_Mutation_p.E107Q|KIAA1211_ENST00000505410.1_3'UTR|KIAA1211_ENST00000264229.6_Missense_Mutation_p.E114Q			Q6ZU35	K1211_HUMAN	KIAA1211	114										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					AGCTGGAAGTGAGATGGAAGA	0.423																																																	0													140.0	139.0	139.0					4																	57176886		1869	4108	5977	SO:0001583	missense	0			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.340G>C	4.37:g.57176886G>C	ENSP00000423366:p.Glu114Gln		Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	NULL	p.E114Q	ENST00000504228.1	37	c.340	CCDS43230.1	4	.	.	.	.	.	.	.	.	.	.	G	12.63	1.996847	0.35226	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073;ENST00000546221	T;T;T	0.15372	2.54;2.54;2.43	4.74	4.74	0.60224	.	.	.	.	.	T	0.29588	0.0738	L	0.51422	1.61	0.24535	N	0.994097	D;D;D	0.67145	0.996;0.971;0.971	P;P;P	0.62813	0.907;0.776;0.776	T	0.07424	-1.0773	9	0.33940	T	0.23	-19.7354	8.7649	0.34698	0.1005:0.0:0.8995:0.0	.	107;107;114	B7ZVZ4;F5H1N7;Q6ZU35	.;.;K1211_HUMAN	Q	114;114;107;24	ENSP00000264229:E114Q;ENSP00000423366:E114Q;ENSP00000444006:E107Q	ENSP00000264229:E114Q	E	+	1	0	KIAA1211	56871643	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.123000	0.57917	2.463000	0.83235	0.555000	0.69702	GAG	KIAA1211	-	NULL	ENSG00000109265		0.423	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	HGNC	protein_coding	OTTHUMT00000362097.2	-	0.00	85	0	G	NM_020722		57176886	+1	tier1	-	no_errors	ENST00000504228	ensembl	human	known	74_37	missense	12.79	75	11	SNP	0.999	C
KIAA1244	57221	genome.wustl.edu	37	6	138649248	138649248	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:138649248G>C	ENST00000251691.4	+	32	5258	c.5092G>C	c.(5092-5094)Gat>Cat	p.D1698H		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GCTGCCTCCTGATGAAAAACC	0.438																																																	0													76.0	59.0	65.0					6																	138649248		2202	4297	6499	SO:0001583	missense	0			AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.5092G>C	6.37:g.138649248G>C	ENSP00000251691:p.Asp1698His			Missense_Mutation	SNP	pfam_DUF1981_Sec7_assoc,superfamily_ARM-type_fold,superfamily_Sec7_dom,smart_Sec7_dom	p.D1698H	ENST00000251691.4	37	c.5092	CCDS5189.2	6	.	.	.	.	.	.	.	.	.	.	G	17.47	3.397196	0.62177	.	.	ENSG00000112379	ENST00000251691	T	0.19938	2.11	5.49	5.49	0.81192	.	0.117485	0.56097	D	0.000035	T	0.23210	0.0561	L	0.36672	1.1	0.47659	D	0.99948	D	0.54397	0.966	P	0.54401	0.751	T	0.00998	-1.1486	10	0.62326	D	0.03	-30.3502	19.3711	0.94488	0.0:0.0:1.0:0.0	.	1698	Q5TH69	BIG3_HUMAN	H	1698	ENSP00000251691:D1698H	ENSP00000251691:D1698H	D	+	1	0	KIAA1244	138690941	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.570000	0.82390	2.585000	0.87301	0.655000	0.94253	GAT	KIAA1244	-	NULL	ENSG00000112379		0.438	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1244	HGNC	protein_coding	OTTHUMT00000042425.4		0.00	8	0	G	NM_020340		138649248	+1			no_errors	ENST00000251691	ensembl	human	known	74_37	missense	45.45	6	5	SNP	1.000	C
KIF20B	9585	genome.wustl.edu	37	10	91492754	91492754	+	Nonsense_Mutation	SNP	C	C	G	rs144738424		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr10:91492754C>G	ENST00000371728.3	+	19	2551	c.2486C>G	c.(2485-2487)tCa>tGa	p.S829*	KIF20B_ENST00000416354.1_Nonsense_Mutation_p.S829*|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000394289.2_Nonsense_Mutation_p.S829*|KIF20B_ENST00000260753.4_Nonsense_Mutation_p.S789*	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	829					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						AAAATCTGTTCAGAAAGAAAA	0.348																																																	0								C	stop/SER	1,4405	2.1+/-5.4	0,1,2202	61.0	63.0	63.0		2366	0.3	0.8	10	dbSNP_134	63	0,8600		0,0,4300	yes	stop-gained	KIF20B	NM_016195.2		0,1,6502	GG,GC,CC		0.0,0.0227,0.0077		789/1781	91492754	1,13005	2203	4300	6503	SO:0001587	stop_gained	0			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.2486C>G	10.37:g.91492754C>G	ENSP00000360793:p.Ser829*		A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Nonsense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S829*	ENST00000371728.3	37	c.2486		10	.	.	.	.	.	.	.	.	.	.	C	38	7.043871	0.98025	2.27E-4	0.0	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	.	.	.	5.08	0.294	0.15747	.	0.380523	0.19342	N	0.116629	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-0.0626	4.0491	0.09786	0.1589:0.4312:0.0:0.4099	.	.	.	.	X	789;829;829;829	.	ENSP00000260753:S789X	S	+	2	0	KIF20B	91482734	0.032000	0.19561	0.787000	0.31911	0.929000	0.56500	-0.093000	0.11111	0.115000	0.18071	0.655000	0.94253	TCA	KIF20B	-	NULL	ENSG00000138182		0.348	KIF20B-003	KNOWN	basic	protein_coding	KIF20B	HGNC	protein_coding	OTTHUMT00000049330.1	-	0.00	24	0	C	NM_016195		91492754	+1	tier1	rs144738424	no_errors	ENST00000416354	ensembl	human	known	74_37	nonsense	27.27	16	6	SNP	0.131	G
KLHL28	54813	genome.wustl.edu	37	14	45403680	45403680	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:45403680G>T	ENST00000396128.4	-	3	1100	c.981C>A	c.(979-981)tgC>tgA	p.C327*	KLHL28_ENST00000355081.2_Nonsense_Mutation_p.C341*	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	327										breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						GGTCTAAAACGCATATTCCAA	0.388																																																	0													74.0	69.0	71.0					14																	45403680		2203	4300	6503	SO:0001587	stop_gained	0			AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.981C>A	14.37:g.45403680G>T	ENSP00000379434:p.Cys327*		Q0VAL5	Nonsense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.C327*	ENST00000396128.4	37	c.981	CCDS9680.1	14	.	.	.	.	.	.	.	.	.	.	G	34	5.383336	0.95967	.	.	ENSG00000179454	ENST00000396128;ENST00000355081	.	.	.	5.38	-1.31	0.09230	.	0.092525	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	.	12.7631	0.57376	0.3915:0.0:0.6085:0.0	.	.	.	.	X	327;341	.	ENSP00000347193:C341X	C	-	3	2	KLHL28	44473430	0.002000	0.14202	0.997000	0.53966	0.998000	0.95712	-1.031000	0.03578	-0.152000	0.11156	0.557000	0.71058	TGC	KLHL28	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000179454		0.388	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL28	HGNC	protein_coding	OTTHUMT00000276790.3	-	0.00	46	0	G			45403680	-1	tier1	-	no_errors	ENST00000396128	ensembl	human	known	74_37	nonsense	7.84	47	4	SNP	0.980	T
KRT18P55	284085	genome.wustl.edu	37	17	26603264	26603264	+	RNA	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:26603264G>C	ENST00000577198.1	-	0	1697				AC061975.8_ENST00000385109.1_RNA	NR_028334.1				keratin 18 pseudogene 55																		GCTTGACCTTGATGTTCAGCA	0.572																																																	0																																												0					17q11.2	2013-06-25			ENSG00000265480	ENSG00000265480			26874	pseudogene	pseudogene							Standard	NR_028334		Approved		uc002has.3		OTTHUMG00000179422		17.37:g.26603264G>C				RNA	SNP	-	NULL	ENST00000577198.1	37	NULL		17																																																																																			KRT18P55	-	-	ENSG00000265480		0.572	KRT18P55-002	KNOWN	basic	processed_transcript	KRT18P55	HGNC	pseudogene	OTTHUMT00000446194.1	-	0.00	14	0	G	NR_028334		26603264	-1	tier1	-	no_errors	ENST00000577198	ensembl	human	known	74_37	rna	26.09	17	6	SNP	0.998	C
KRTAP5-10	387273	genome.wustl.edu	37	11	71276876	71276876	+	Silent	SNP	A	A	G	rs12788123		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:71276876A>G	ENST00000398531.1	+	1	268	c.243A>G	c.(241-243)aaA>aaG	p.K81K	KRTAP5-10_ENST00000376536.4_Intron	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	81	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.K81K(1)		endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						GGGGCTCCAAAGGGGGCTGTG	0.682																																																	1	Substitution - coding silent(1)	endometrium(1)											51.0	72.0	65.0					11																	71276876		2140	4257	6397	SO:0001819	synonymous_variant	0			AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.243A>G	11.37:g.71276876A>G			B9EHA4	Silent	SNP	NULL	p.K81	ENST00000398531.1	37	c.243	CCDS41684.1	11																																																																																			KRTAP5-10	-	NULL	ENSG00000204572		0.682	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KRTAP5-10	HGNC	protein_coding	OTTHUMT00000127968.2		0.00	61	0	A			71276876	+1			no_errors	ENST00000398531	ensembl	human	known	74_37	silent	10.39	69	8	SNP	0.005	G
LAMA2	3908	genome.wustl.edu	37	6	129724965	129724965	+	Splice_Site	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:129724965G>C	ENST00000421865.2	+	40	5775		c.e40-1			NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CATCCCACCAGAATCCTTGAT	0.403																																																	0													79.0	80.0	80.0					6																	129724965		2203	4300	6503	SO:0001630	splice_region_variant	0			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.5727-1G>C	6.37:g.129724965G>C			Q14736|Q5VUM2|Q93022	Splice_Site	SNP	-	e40-1	ENST00000421865.2	37	c.5727-1	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	G	16.03	3.008129	0.54361	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7297	0.96177	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LAMA2	129766658	1.000000	0.71417	1.000000	0.80357	0.351000	0.29236	8.756000	0.91651	2.658000	0.90341	0.650000	0.86243	.	LAMA2	-	-	ENSG00000196569		0.403	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	-	0.00	34	0	G		Intron	129724965	+1	tier1	-	no_errors	ENST00000421865	ensembl	human	known	74_37	splice_site	13.89	31	5	SNP	1.000	C
LEPRE1	64175	genome.wustl.edu	37	1	43213395	43213395	+	Splice_Site	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:43213395G>A	ENST00000296388.5	-	13	1964	c.1913C>T	c.(1912-1914)aCg>aTg	p.T638M	LEPRE1_ENST00000236040.4_Splice_Site_p.T638M|LEPRE1_ENST00000397054.3_Splice_Site_p.T638M|LEPRE1_ENST00000462474.1_5'UTR			Q32P28	P3H1_HUMAN	leucine proline-enriched proteoglycan (leprecan) 1	638	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				bone development (GO:0060348)|cell growth (GO:0016049)|chaperone-mediated protein folding (GO:0061077)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein hydroxylation (GO:0018126)|protein stabilization (GO:0050821)|regulation of ossification (GO:0030278)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)|protein complex binding (GO:0032403)			large_intestine(2)|lung(15)|ovary(5)|prostate(1)|urinary_tract(3)	26	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	AGCACTCACCGTCACGGTCTT	0.478											OREG0013422	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													190.0	190.0	190.0					1																	43213395		2203	4300	6503	SO:0001630	splice_region_variant	0			AK027648	CCDS472.2, CCDS53307.1, CCDS57986.1	1p34.1	2014-09-17			ENSG00000117385	ENSG00000117385			19316	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 1"", ""growth suppressor 1"""	610339				10951563	Standard	NM_022356		Approved	GROS1, P3H1, LEPRECAN, MGC117314	uc001chx.4	Q32P28	OTTHUMG00000007525	ENST00000296388.5:c.1914+1C>T	1.37:g.43213395G>A		914	Q7KZR4|Q96BR8|Q96SK8|Q96SL5|Q96SN3|Q9H6K3|Q9HC86|Q9HC87	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.T638M	ENST00000296388.5	37	c.1913	CCDS472.2	1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.235588	0.79800	.	.	ENSG00000117385	ENST00000397054;ENST00000236040;ENST00000296388;ENST00000540027	T;T;T	0.46819	0.86;0.86;0.86	5.1	5.1	0.69264	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.054971	0.64402	D	0.000001	T	0.68732	0.3033	M	0.76170	2.325	0.53005	D	0.999964	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.988;0.977;0.987	T	0.73052	-0.4104	10	0.87932	D	0	-18.7453	16.0157	0.80439	0.0:0.0:1.0:0.0	.	638;503;638	Q32P28-3;B4DNM8;Q32P28	.;.;P3H1_HUMAN	M	638;638;638;503	ENSP00000380245:T638M;ENSP00000236040:T638M;ENSP00000296388:T638M	ENSP00000236040:T638M	T	-	2	0	LEPRE1	42985982	1.000000	0.71417	1.000000	0.80357	0.509000	0.34042	9.336000	0.96533	2.372000	0.80975	0.655000	0.94253	ACG	LEPRE1	-	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	ENSG00000117385		0.478	LEPRE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LEPRE1	HGNC	protein_coding	OTTHUMT00000019790.2	-	0.00	62	0	G	NM_022356	Missense_Mutation	43213395	-1	tier1	-	no_errors	ENST00000236040	ensembl	human	known	74_37	missense	28.00	54	21	SNP	1.000	A
LAX1	54900	genome.wustl.edu	37	1	203743776	203743776	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:203743776G>A	ENST00000442561.2	+	5	1554	c.1164G>A	c.(1162-1164)caG>caA	p.Q388Q	LAX1_ENST00000367215.1_3'UTR|LAX1_ENST00000367217.5_Silent_p.Q372Q	NM_017773.3	NP_060243.2	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1	388					antigen receptor-mediated signaling pathway (GO:0050851)|B cell activation (GO:0042113)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)			central_nervous_system(2)|endometrium(3)|large_intestine(2)|lung(13)|prostate(1)|stomach(1)|urinary_tract(2)	24	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ACTCTGAGCAGGGGCCTGGCA	0.483																																																	0													55.0	56.0	56.0					1																	203743776		2203	4300	6503	SO:0001819	synonymous_variant	0			AK000347	CCDS1441.2, CCDS44297.1	1q32.1	2008-02-05			ENSG00000122188	ENSG00000122188			26005	protein-coding gene	gene with protein product	"""LAT-like membrane associated protein"", ""linker for activation of x cells"""					12359715	Standard	NM_017773		Approved	LAX, FLJ20340	uc001haa.3	Q8IWV1	OTTHUMG00000035908	ENST00000442561.2:c.1164G>A	1.37:g.203743776G>A			B7Z744|J3KP69|Q6NSZ6|Q9NXB4	Silent	SNP	NULL	p.Q388	ENST00000442561.2	37	c.1164	CCDS1441.2	1																																																																																			LAX1	-	NULL	ENSG00000122188		0.483	LAX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAX1	HGNC	protein_coding	OTTHUMT00000087468.3	-	0.00	36	0	G	NM_017773		203743776	+1	tier1	-	no_errors	ENST00000442561	ensembl	human	known	74_37	silent	25.00	27	9	SNP	0.046	A
LAMB3	3914	genome.wustl.edu	37	1	209800282	209800282	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:209800282C>T	ENST00000356082.4	-	13	1661	c.1527G>A	c.(1525-1527)ctG>ctA	p.L509L	LAMB3_ENST00000391911.1_Silent_p.L509L|LAMB3_ENST00000367030.3_Silent_p.L509L	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	509	Laminin EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00460}.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		CGCTGCACATCAGGCCACCAA	0.647																																																	0													64.0	51.0	56.0					1																	209800282		2203	4300	6503	SO:0001819	synonymous_variant	0			D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.1527G>A	1.37:g.209800282C>T			D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Silent	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_EGF_laminin,pfscan_Laminin_N	p.L509	ENST00000356082.4	37	c.1527	CCDS1487.1	1																																																																																			LAMB3	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000196878		0.647	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB3	HGNC	protein_coding	OTTHUMT00000088525.2	-	0.00	63	0	C	NM_000228		209800282	-1	tier1	-	no_errors	ENST00000356082	ensembl	human	known	74_37	silent	39.02	50	32	SNP	0.867	T
DSG1	1828	genome.wustl.edu	37	18	28923403	28923403	+	Intron	SNP	C	C	A	rs201728225		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr18:28923403C>A	ENST00000257192.4	+	12	1899				RP11-534N16.1_ENST00000581856.1_RNA|RNU6-167P_ENST00000384292.1_RNA|DSG1_ENST00000462981.2_5'Flank|RP11-534N16.1_ENST00000578119.1_RNA	NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1						apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)			NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			TACTATCCCTCCACCACCAGT	0.413																																																	0													221.0	202.0	208.0					18																	28923403		2203	4300	6503	SO:0001627	intron_variant	0			X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.1688-10C>A	18.37:g.28923403C>A			B7Z845	RNA	SNP	-	NULL	ENST00000257192.4	37	NULL	CCDS11896.1	18																																																																																			RP11-534N16.1	-	-	ENSG00000266729		0.413	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927718	Clone_based_vega_gene	protein_coding	OTTHUMT00000254947.1	-	0.00	120	0	C	NM_001942		28923403	-1	tier1	-	no_errors	ENST00000578119	ensembl	human	known	74_37	rna	9.77	120	13	SNP	0.001	A
DSG1	1828	genome.wustl.edu	37	18	28923561	28923561	+	Intron	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr18:28923561C>T	ENST00000257192.4	+	12	2033				RP11-534N16.1_ENST00000581856.1_RNA|RNU6-167P_ENST00000384292.1_RNA|DSG1_ENST00000462981.2_5'Flank|RP11-534N16.1_ENST00000578119.1_RNA	NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1						apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)			NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			GTGCCACATTCTAAGAAATAG	0.473																																																	0													86.0	76.0	79.0					18																	28923561		2203	4300	6503	SO:0001627	intron_variant	0			X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.1821+15C>T	18.37:g.28923561C>T			B7Z845	RNA	SNP	-	NULL	ENST00000257192.4	37	NULL	CCDS11896.1	18																																																																																			RP11-534N16.1	-	-	ENSG00000266729		0.473	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927718	Clone_based_vega_gene	protein_coding	OTTHUMT00000254947.1	-	0.00	81	0	C	NM_001942		28923561	-1	tier1	-	no_errors	ENST00000578119	ensembl	human	known	74_37	rna	16.67	70	14	SNP	0.000	T
KIF28P	100130097	genome.wustl.edu	37	1	246943704	246943704	+	RNA	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:246943704C>T	ENST00000451123.1	-	0	577				RP11-439E19.3_ENST00000421003.1_RNA|RP11-439E19.3_ENST00000505748.1_RNA|RP11-439E19.3_ENST00000509202.1_RNA																							AGTAGGCCAGCGACTGGAGCC	0.587																																																	0																																												0																															1.37:g.246943704C>T				RNA	SNP	-	NULL	ENST00000451123.1	37	NULL		1																																																																																			RP11-439E19.3	-	-	ENSG00000227953		0.587	RP11-439E19.8-002	KNOWN	basic|exp_conf	processed_transcript	LOC149134	Clone_based_vega_gene	pseudogene	OTTHUMT00000331247.2	-	0.00	38	0	C			246943704	+1	tier1	-	no_errors	ENST00000421003	ensembl	human	known	74_37	rna	25.00	45	15	SNP	0.056	T
LONP2	83752	genome.wustl.edu	37	16	48295447	48295447	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:48295447C>A	ENST00000285737.4	+	5	929	c.836C>A	c.(835-837)aCa>aAa	p.T279K	LONP2_ENST00000535754.1_Missense_Mutation_p.T235K	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						AAAATACGAACATCTAGTATG	0.348																																																	0													125.0	124.0	124.0					16																	48295447		2200	4300	6500	SO:0001583	missense	0			AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.836C>A	16.37:g.48295447C>A	ENSP00000285737:p.Thr279Lys			Missense_Mutation	SNP	pfam_Pept_S16_C,pfam_Pept_S16_N,pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_P-loop_NTPase,superfamily_PUA-like_domain,smart_Pept_S16_N,smart_AAA+_ATPase,tigrfam_Lon_bac/euk-typ	p.T279K	ENST00000285737.4	37	c.836	CCDS10734.1	16	.	.	.	.	.	.	.	.	.	.	C	8.053	0.766495	0.15983	.	.	ENSG00000102910	ENST00000285737;ENST00000544734;ENST00000535754;ENST00000416006	T;T	0.26660	1.72;1.72	5.88	4.93	0.64822	.	0.337453	0.34603	N	0.003828	T	0.09949	0.0244	N	0.01705	-0.755	0.24376	N	0.994814	B;B	0.18610	0.029;0.029	B;B	0.16722	0.016;0.016	T	0.19484	-1.0304	10	0.06625	T	0.88	-5.5299	15.2214	0.73313	0.0:0.9325:0.0:0.0675	.	235;279	B7ZKL7;Q86WA8	.;LONP2_HUMAN	K	279;8;235;235	ENSP00000285737:T279K;ENSP00000445426:T235K	ENSP00000285737:T279K	T	+	2	0	LONP2	46852948	0.995000	0.38212	0.905000	0.35620	0.816000	0.46133	2.814000	0.48010	1.495000	0.48549	0.591000	0.81541	ACA	LONP2	-	tigrfam_Lon_bac/euk-typ	ENSG00000102910		0.348	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONP2	HGNC	protein_coding	OTTHUMT00000256839.2		0.00	17	0	C	NM_031490		48295447	+1			no_errors	ENST00000285737	ensembl	human	known	74_37	missense	12.77	41	6	SNP	0.453	A
LRP10	26020	genome.wustl.edu	37	14	23345309	23345309	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:23345309G>C	ENST00000359591.4	+	5	1843	c.1152G>C	c.(1150-1152)caG>caC	p.Q384H	LRP10_ENST00000546834.1_Missense_Mutation_p.Q384H	NM_014045.3	NP_054764.2	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein 10	384	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(2)	32	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		GCAACTACCAGACTTTCTGTG	0.612																																																	0													66.0	64.0	65.0					14																	23345309		2203	4300	6503	SO:0001583	missense	0			AF131760	CCDS9578.1	14q11.2	2013-05-29			ENSG00000197324	ENSG00000197324		"""Low density lipoprotein receptors"""	14553	protein-coding gene	gene with protein product		609921				11123907	Standard	XM_005267510		Approved	DKFZP564C1940, MGC8675, LRP9, MST087, MSTP087	uc001whd.3	Q7Z4F1	OTTHUMG00000028705	ENST00000359591.4:c.1152G>C	14.37:g.23345309G>C	ENSP00000352601:p.Gln384His		A8K4R5|D3DS31|O95882|Q14CK7|Q86T02|Q8NCZ4|Q9HC42|Q9UG33	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_CUB_dom,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.Q384H	ENST00000359591.4	37	c.1152	CCDS9578.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.68|18.68	3.675649|3.675649	0.67928|0.67928	.|.	.|.	ENSG00000197324|ENSG00000197324	ENST00000551466|ENST00000359591;ENST00000546834	.|D;T	.|0.87650	.|-2.28;0.98	5.97|5.97	5.97|5.97	0.96955|0.96955	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.90916|0.90916	0.7145|0.7145	L|L	0.50333|0.50333	1.59|1.59	0.58432|0.58432	D|D	0.999998|0.999998	.|D	.|0.89917	.|1.0	.|D	.|0.85130	.|0.997	D|D	0.90563|0.90563	0.4517|0.4517	5|10	.|0.59425	.|D	.|0.04	-16.7331|-16.7331	12.5207|12.5207	0.56058|0.56058	0.0769:0.0:0.9231:0.0|0.0769:0.0:0.9231:0.0	.|.	.|384	.|Q7Z4F1	.|LRP10_HUMAN	H|H	286|384	.|ENSP00000352601:Q384H;ENSP00000447559:Q384H	.|ENSP00000352601:Q384H	D|Q	+|+	1|3	0|2	LRP10|LRP10	22415149|22415149	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.511000|2.511000	0.45476|0.45476	2.837000|2.837000	0.97791|0.97791	0.655000|0.655000	0.94253|0.94253	GAC|CAG	LRP10	-	superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	ENSG00000197324		0.612	LRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP10	HGNC	protein_coding	OTTHUMT00000071663.3	-	0.00	36	0	G			23345309	+1	tier1	-	no_errors	ENST00000359591	ensembl	human	known	74_37	missense	16.67	30	6	SNP	1.000	C
LRP10	26020	genome.wustl.edu	37	14	23345331	23345331	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:23345331G>A	ENST00000359591.4	+	5	1865	c.1174G>A	c.(1174-1176)Gat>Aat	p.D392N	LRP10_ENST00000546834.1_Missense_Mutation_p.D392N	NM_014045.3	NP_054764.2	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein 10	392	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(2)	32	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		TGATGGAGCAGATGAGAGACG	0.607																																																	0													96.0	89.0	91.0					14																	23345331		2203	4300	6503	SO:0001583	missense	0			AF131760	CCDS9578.1	14q11.2	2013-05-29			ENSG00000197324	ENSG00000197324		"""Low density lipoprotein receptors"""	14553	protein-coding gene	gene with protein product		609921				11123907	Standard	XM_005267510		Approved	DKFZP564C1940, MGC8675, LRP9, MST087, MSTP087	uc001whd.3	Q7Z4F1	OTTHUMG00000028705	ENST00000359591.4:c.1174G>A	14.37:g.23345331G>A	ENSP00000352601:p.Asp392Asn		A8K4R5|D3DS31|O95882|Q14CK7|Q86T02|Q8NCZ4|Q9HC42|Q9UG33	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_CUB_dom,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.D392N	ENST00000359591.4	37	c.1174	CCDS9578.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.8|26.8	4.772842|4.772842	0.90108|0.90108	.|.	.|.	ENSG00000197324|ENSG00000197324	ENST00000359591;ENST00000546834|ENST00000551466	D;D|.	0.95001|.	-3.58;-3.58|.	5.97|5.97	5.97|5.97	0.96955|0.96955	.|.	0.042338|.	0.85682|.	D|.	0.000000|.	T|T	0.77611|0.77611	0.4156|0.4156	M|M	0.75615|0.75615	2.305|2.305	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.64595|.	0.927|.	T|T	0.75596|0.75596	-0.3263|-0.3263	10|5	0.87932|.	D|.	0|.	-19.8886|-19.8886	19.1994|19.1994	0.93704|0.93704	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	392|.	Q7Z4F1|.	LRP10_HUMAN|.	N|K	392|293	ENSP00000352601:D392N;ENSP00000447559:D392N|.	ENSP00000352601:D392N|.	D|R	+|+	1|2	0|0	LRP10|LRP10	22415171|22415171	1.000000|1.000000	0.71417|0.71417	0.205000|0.205000	0.23548|0.23548	0.904000|0.904000	0.53231|0.53231	7.862000|7.862000	0.87013|0.87013	2.837000|2.837000	0.97791|0.97791	0.655000|0.655000	0.94253|0.94253	GAT|AGA	LRP10	-	superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	ENSG00000197324		0.607	LRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP10	HGNC	protein_coding	OTTHUMT00000071663.3	-	0.00	48	0	G			23345331	+1	tier1	-	no_errors	ENST00000359591	ensembl	human	known	74_37	missense	17.07	34	7	SNP	0.985	A
LRP5	4041	genome.wustl.edu	37	11	68125233	68125233	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:68125233A>T	ENST00000294304.7	+	3	710	c.604A>T	c.(604-606)Atc>Ttc	p.I202F		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	202	Beta-propeller 1.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TGGACTGACCATCGACCTGGA	0.607																																																	0													84.0	66.0	72.0					11																	68125233		2200	4294	6494	SO:0001583	missense	0			AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.604A>T	11.37:g.68125233A>T	ENSP00000294304:p.Ile202Phe		Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.I202F	ENST00000294304.7	37	c.604	CCDS8181.1	11	.	.	.	.	.	.	.	.	.	.	A	16.59	3.164551	0.57476	.	.	ENSG00000162337	ENST00000294304	D	0.96967	-4.19	3.66	3.66	0.41972	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.48767	U	0.000170	D	0.97294	0.9115	M	0.77616	2.38	0.58432	D	0.999992	D	0.57571	0.98	P	0.59703	0.862	D	0.97742	1.0209	10	0.87932	D	0	.	13.3573	0.60635	1.0:0.0:0.0:0.0	.	202	O75197	LRP5_HUMAN	F	202	ENSP00000294304:I202F	ENSP00000294304:I202F	I	+	1	0	LRP5	67881809	0.862000	0.29867	1.000000	0.80357	0.659000	0.38960	1.485000	0.35519	1.903000	0.55091	0.374000	0.22700	ATC	LRP5	-	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000162337		0.607	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP5	HGNC	protein_coding	OTTHUMT00000395088.1	-	0.00	65	0	A	NM_002335		68125233	+1	tier1	-	no_errors	ENST00000294304	ensembl	human	known	74_37	missense	18.67	61	14	SNP	0.999	T
LRRC16A	55604	genome.wustl.edu	37	6	25495435	25495435	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:25495435G>T	ENST00000329474.6	+	16	1685	c.1317G>T	c.(1315-1317)gaG>gaT	p.E439D		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	439					actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						TGTCTCCTGAGCCCTTAAAGT	0.378																																																	0													98.0	91.0	93.0					6																	25495435		1835	4080	5915	SO:0001583	missense	0			AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.1317G>T	6.37:g.25495435G>T	ENSP00000331983:p.Glu439Asp		B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.E439D	ENST00000329474.6	37	c.1317	CCDS54973.1	6	.	.	.	.	.	.	.	.	.	.	G	14.08	2.427380	0.43122	.	.	ENSG00000079691	ENST00000329474;ENST00000399313	T	0.54866	0.55	5.4	4.47	0.54385	.	0.043988	0.85682	D	0.000000	T	0.20536	0.0494	L	0.35593	1.075	0.80722	D	1	B;B;B	0.28933	0.088;0.146;0.228	B;B;B	0.27262	0.036;0.036;0.078	T	0.07158	-1.0787	10	0.19590	T	0.45	.	6.8614	0.24069	0.1482:0.1503:0.7014:0.0	.	439;439;439	Q5VZK9;B2RTQ5;Q5VZK9-2	LR16A_HUMAN;.;.	D	439	ENSP00000331983:E439D	ENSP00000331983:E439D	E	+	3	2	LRRC16A	25603414	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.026000	0.57232	2.695000	0.91970	0.561000	0.74099	GAG	LRRC16A	-	NULL	ENSG00000079691		0.378	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC16A	HGNC	protein_coding	OTTHUMT00000040045.2	-	0.00	31	0	G	NM_017640		25495435	+1	tier1	-	no_errors	ENST00000329474	ensembl	human	novel	74_37	missense	23.68	29	9	SNP	1.000	T
LSM1	27257	genome.wustl.edu	37	8	38033964	38033964	+	5'UTR	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:38033964C>G	ENST00000311351.4	-	0	270				LSM1_ENST00000520755.1_5'UTR|BAG4_ENST00000432471.2_5'Flank|LSM1_ENST00000522515.1_5'UTR|BAG4_ENST00000287322.4_5'Flank	NM_014462.2	NP_055277.1	O15116	LSM1_HUMAN	LSM1, U6 small nuclear RNA associated						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(3)|lung(2)	7	Colorectal(12;0.000442)					ACCAGCACTTCTGCCCCGGCT	0.672																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF000177	CCDS6103.1	8p11.2	2014-02-14	2014-02-14		ENSG00000175324	ENSG00000175324			20472	protein-coding gene	gene with protein product		607281	"""LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)"""			12515382, 11953827	Standard	NM_014462		Approved	CASM, YJL124C	uc003xkw.3	O15116	OTTHUMG00000164051	ENST00000311351.4:c.-126G>C	8.37:g.38033964C>G			B2R5E6	RNA	SNP	-	NULL	ENST00000311351.4	37	NULL	CCDS6103.1	8																																																																																			LSM1	-	-	ENSG00000175324		0.672	LSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM1	HGNC	protein_coding	OTTHUMT00000376965.1	-	0.00	11	0	C	NM_014462		38033964	-1	tier1	-	no_errors	ENST00000522515	ensembl	human	known	74_37	rna	37.50	10	6	SNP	0.000	G
MANEA	79694	genome.wustl.edu	37	6	96054102	96054102	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:96054102G>C	ENST00000358812.4	+	5	1344	c.1210G>C	c.(1210-1212)Gag>Cag	p.E404Q		NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	404	Catalytic. {ECO:0000305}.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		CTCTTTTAATGAGTGGCATGA	0.423																																																	0													59.0	61.0	60.0					6																	96054102		2203	4300	6503	SO:0001583	missense	0			AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.1210G>C	6.37:g.96054102G>C	ENSP00000351669:p.Glu404Gln		A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	Missense_Mutation	SNP	superfamily_Glycoside_hydrolase_SF	p.E404Q	ENST00000358812.4	37	c.1210	CCDS5032.1	6	.	.	.	.	.	.	.	.	.	.	G	28.5	4.925197	0.92319	.	.	ENSG00000172469	ENST00000358812	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.84629	0.5514	M	0.90309	3.105	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86028	0.1511	9	0.87932	D	0	-18.1636	19.8676	0.96824	0.0:0.0:1.0:0.0	.	404	Q5SRI9	MANEA_HUMAN	Q	404	.	ENSP00000351669:E404Q	E	+	1	0	MANEA	96160823	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.357000	0.97099	2.941000	0.99782	0.655000	0.94253	GAG	MANEA	-	NULL	ENSG00000172469		0.423	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MANEA	HGNC	protein_coding	OTTHUMT00000043644.1	-	0.00	26	0	G	NM_024641		96054102	+1	tier1	-	no_errors	ENST00000358812	ensembl	human	known	74_37	missense	32.00	17	8	SNP	1.000	C
MAP1A	4130	genome.wustl.edu	37	15	43817462	43817462	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr15:43817462C>T	ENST00000300231.5	+	4	4241	c.3791C>T	c.(3790-3792)tCa>tTa	p.S1264L	MAP1A_ENST00000382031.1_Missense_Mutation_p.S1502L|MAP1A_ENST00000399453.1_Missense_Mutation_p.S1264L			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1264					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GCCACAGCGTCACCTCCCACA	0.542																																																	0													81.0	94.0	90.0					15																	43817462		2157	4257	6414	SO:0001583	missense	0			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.3791C>T	15.37:g.43817462C>T	ENSP00000300231:p.Ser1264Leu		O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NULL	p.S1264L	ENST00000300231.5	37	c.3791	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	C	0.055	-1.238489	0.01493	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.01527	4.8;4.81;4.81	4.98	0.957	0.19613	.	.	.	.	.	T	0.02083	0.0065	L	0.41710	1.295	0.09310	N	1	B	0.10296	0.003	B	0.11329	0.006	T	0.41197	-0.9522	9	0.56958	D	0.05	-4.8459	8.2678	0.31824	0.0:0.6661:0.0:0.3339	.	1264	P78559	MAP1A_HUMAN	L	1502;1264;1264	ENSP00000371462:S1502L;ENSP00000382380:S1264L;ENSP00000300231:S1264L	ENSP00000300231:S1264L	S	+	2	0	MAP1A	41604754	0.000000	0.05858	0.005000	0.12908	0.027000	0.11550	-0.086000	0.11233	0.315000	0.23110	0.563000	0.77884	TCA	MAP1A	-	NULL	ENSG00000166963		0.542	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	-	0.00	14	0	C	NM_002373		43817462	+1	tier1	-	no_errors	ENST00000399453	ensembl	human	known	74_37	missense	41.67	7	5	SNP	0.001	T
MAP3K14-AS1	100133991	genome.wustl.edu	37	17	43344565	43344565	+	RNA	SNP	T	T	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:43344565T>A	ENST00000585780.1	+	0	1701				MAP3K14-AS1_ENST00000588698.1_RNA|MAP3K14-AS1_ENST00000585346.1_RNA|MAP3K14-AS1_ENST00000592422.1_RNA|MAP3K14-AS1_ENST00000586450.1_RNA|MAP3K14-AS1_ENST00000588160.1_RNA|MAP3K14-AS1_ENST00000585351.1_RNA|MAP3K14-AS1_ENST00000588504.1_RNA|MAP3K14_ENST00000344686.2_RNA|MAP3K14-AS1_ENST00000591263.1_RNA|MAP3K14-AS1_ENST00000590100.1_RNA					MAP3K14 antisense RNA 1																		GAGGAATAATTCTGCAGGGAA	0.542																																																	0													20.0	21.0	21.0					17																	43344565		1923	4138	6061			0			AK311429, BC031942		17q21.31	2014-06-16			ENSG00000267278	ENSG00000267278		"""Long non-coding RNAs"""	44359	non-coding RNA	RNA, long non-coding							Standard	NR_024435		Approved		uc002iit.4		OTTHUMG00000180362		17.37:g.43344565T>A				RNA	SNP	-	NULL	ENST00000585780.1	37	NULL		17	.	.	.	.	.	.	.	.	.	.	T	25.9	4.686303	0.88639	.	.	ENSG00000006062	ENST00000344686	.	.	.	5.93	5.93	0.95920	.	0.092418	0.85682	D	0.000000	T	0.75744	0.3891	L	0.53249	1.67	0.40209	D	0.977605	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.79431	-0.1806	8	0.72032	D	0.01	.	15.5609	0.76244	0.0:0.0:0.0:1.0	.	776;306	Q99558;Q6ZMZ1	M3K14_HUMAN;.	V	775	.	ENSP00000342059:E775V	E	-	2	0	MAP3K14	40700348	1.000000	0.71417	0.885000	0.34714	0.865000	0.49528	5.887000	0.69751	2.271000	0.75665	0.533000	0.62120	GAA	MAP3K14	-	-	ENSG00000006062		0.542	MAP3K14-AS1-008	KNOWN	basic	antisense	MAP3K14	HGNC	antisense	OTTHUMT00000450941.1	-	0.00	83	0	T	NR_024434		43344565	-1	tier1	-	no_errors	ENST00000344686	ensembl	human	known	74_37	rna	63.10	31	53	SNP	0.998	A
MCM3	4172	genome.wustl.edu	37	6	52132674	52132674	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:52132674C>G	ENST00000229854.7	-	14	2137	c.2061G>C	c.(2059-2061)caG>caC	p.Q687H	MCM3_ENST00000419835.2_Missense_Mutation_p.Q641H|MCM3_ENST00000596288.1_Missense_Mutation_p.Q732H			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	687					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					tcttcctcttctgctcctggt	0.478																																																	0													303.0	224.0	251.0					6																	52132674		2198	4300	6498	SO:0001583	missense	0			X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.2061G>C	6.37:g.52132674C>G	ENSP00000229854:p.Gln687His		B4DWW4|Q92660|Q9BTR3|Q9NUE7	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase,prints_Mcm3	p.Q732H	ENST00000229854.7	37	c.2196		6	.	.	.	.	.	.	.	.	.	.	C	13.05	2.121513	0.37436	.	.	ENSG00000112118	ENST00000229854;ENST00000340349;ENST00000419835;ENST00000421471	T;T;T	0.48522	0.81;0.81;0.81	4.59	2.75	0.32379	.	1.449860	0.03590	N	0.231671	T	0.19208	0.0461	N	0.22421	0.69	0.26098	N	0.980852	P;B	0.38148	0.62;0.383	B;B	0.40659	0.336;0.116	T	0.18618	-1.0331	10	0.45353	T	0.12	-2.4724	5.6073	0.17387	0.1943:0.7061:0.0:0.0996	.	641;687	B4DUQ9;P25205	.;MCM3_HUMAN	H	687;184;641;182	ENSP00000229854:Q687H;ENSP00000388647:Q641H;ENSP00000407651:Q182H	ENSP00000229854:Q687H	Q	-	3	2	MCM3	52240633	0.995000	0.38212	0.946000	0.38457	0.905000	0.53344	0.913000	0.28611	0.821000	0.34540	0.655000	0.94253	CAG	MCM3	-	NULL	ENSG00000112118		0.478	MCM3-006	KNOWN	basic|appris_principal	protein_coding	MCM3	HGNC	protein_coding	OTTHUMT00000470784.1	-	0.00	156	0	C			52132674	-1	tier1	-	no_errors	ENST00000596288	ensembl	human	known	74_37	missense	25.40	141	48	SNP	0.963	G
MED7	9443	genome.wustl.edu	37	5	156565835	156565835	+	Missense_Mutation	SNP	T	T	A	rs148324701	byFrequency	TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:156565835T>A	ENST00000286317.5	-	2	989	c.608A>T	c.(607-609)cAt>cTt	p.H203L	MED7_ENST00000420343.1_Missense_Mutation_p.H203L	NM_004270.4	NP_004261.1	O43513	MED7_HUMAN	mediator complex subunit 7	203					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II transcription cofactor activity (GO:0001104)|transcription coactivator activity (GO:0003713)			kidney(1)|large_intestine(1)|lung(3)|urinary_tract(2)	7	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTCTCTTTGATGTTCATTCTG	0.383																																																	0													176.0	164.0	168.0					5																	156565835		2203	4300	6503	SO:0001583	missense	0			AF104251	CCDS4334.1	5q33.3	2008-02-05	2007-07-30	2007-07-30	ENSG00000155868	ENSG00000155868			2378	protein-coding gene	gene with protein product		605045	"""cofactor required for Sp1 transcriptional activation, subunit 9, 33kDa"""	CRSP9		9989412	Standard	NM_004270		Approved	CRSP33	uc003lwm.4	O43513	OTTHUMG00000130243	ENST00000286317.5:c.608A>T	5.37:g.156565835T>A	ENSP00000286317:p.His203Leu			Missense_Mutation	SNP	pfam_Mediatior_Med7	p.H203L	ENST00000286317.5	37	c.608	CCDS4334.1	5	.	.	.	.	.	.	.	.	.	.	T	11.64	1.697935	0.30142	.	.	ENSG00000155868	ENST00000286317;ENST00000420343	.	.	.	5.81	4.65	0.58169	.	0.226336	0.46145	D	0.000303	T	0.23171	0.0560	N	0.08118	0	0.22066	N	0.999383	B	0.02656	0.0	B	0.01281	0.0	T	0.13710	-1.0499	9	0.29301	T	0.29	-1.4156	11.786	0.52043	0.0:0.0683:0.0:0.9317	.	203	O43513	MED7_HUMAN	L	203	.	ENSP00000286317:H203L	H	-	2	0	MED7	156498413	0.998000	0.40836	0.966000	0.40874	0.943000	0.58893	1.808000	0.38912	1.026000	0.39733	0.533000	0.62120	CAT	MED7	-	NULL	ENSG00000155868		0.383	MED7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED7	HGNC	protein_coding	OTTHUMT00000252567.2	-	0.00	75	0	T	NM_004270		156565835	-1	tier1	-	no_errors	ENST00000286317	ensembl	human	known	74_37	missense	32.94	57	28	SNP	0.993	A
MITF	4286	genome.wustl.edu	37	3	69788713	69788713	+	5'UTR	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr3:69788713C>T	ENST00000448226.2	+	0	92				MITF_ENST00000352241.4_5'UTR			O75030	MITF_HUMAN	microphthalmia-associated transcription factor						bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		GCTCTGTTCTCACTTTCCAGC	0.682			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														Melanoma(29;269 969 31479 41502 42961)			Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	0													25.0	28.0	27.0					3																	69788713		1852	4060	5912	SO:0001623	5_prime_UTR_variant	0				CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.-36C>T	3.37:g.69788713C>T			B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	RNA	SNP	-	NULL	ENST00000448226.2	37	NULL		3																																																																																			MITF	-	-	ENSG00000187098		0.682	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	MITF	HGNC	protein_coding	OTTHUMT00000313947.1	-	0.00	55	0	C	NM_198159		69788713	+1	tier1	-	no_errors	ENST00000461511	ensembl	human	known	74_37	rna	24.39	31	10	SNP	0.005	T
MMP16	4325	genome.wustl.edu	37	8	89198796	89198796	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:89198796C>T	ENST00000286614.6	-	3	594	c.313G>A	c.(313-315)Gac>Aac	p.D105N	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	105					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	CTTGTCTGGTCAGGTACACCG	0.378																																																	0													194.0	171.0	179.0					8																	89198796		2203	4300	6503	SO:0001583	missense	0			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.313G>A	8.37:g.89198796C>T	ENSP00000286614:p.Asp105Asn		B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.D105N	ENST00000286614.6	37	c.313	CCDS6246.1	8	.	.	.	.	.	.	.	.	.	.	C	36	5.723578	0.96847	.	.	ENSG00000156103	ENST00000286614;ENST00000522726	T;T	0.61392	0.11;0.11	5.72	5.72	0.89469	Peptidoglycan binding-like (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.84037	0.5384	H	0.95712	3.71	0.80722	D	1	D;D	0.71674	0.998;0.996	D;D	0.72982	0.967;0.979	D	0.88255	0.2919	10	0.87932	D	0	.	19.8778	0.96885	0.0:1.0:0.0:0.0	.	105;105	P51512-2;P51512	.;MMP16_HUMAN	N	105;122	ENSP00000286614:D105N;ENSP00000429147:D122N	ENSP00000286614:D105N	D	-	1	0	MMP16	89267912	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.487000	0.81328	2.710000	0.92621	0.585000	0.79938	GAC	MMP16	-	pirsf_Pept_M10A_Metazoans,superfamily_Peptidoglycan-bd-like,prints_Pept_M10A	ENSG00000156103		0.378	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	HGNC	protein_coding	OTTHUMT00000375304.2	-	0.00	45	0	C	NM_005941		89198796	-1	tier1	-	no_errors	ENST00000286614	ensembl	human	known	74_37	missense	18.00	41	9	SNP	1.000	T
MORC4	79710	genome.wustl.edu	37	X	106228369	106228369	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chrX:106228369G>T	ENST00000355610.4	-	5	905	c.631C>A	c.(631-633)Cca>Aca	p.P211T	MORC4_ENST00000535534.1_Intron|MORC4_ENST00000255495.7_Missense_Mutation_p.P211T	NM_001085354.2|NM_024657.4	NP_001078823.1|NP_078933.3	Q8TE76	MORC4_HUMAN	MORC family CW-type zinc finger 4	211						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	28						TTTTTGCCTGGGATGGCATCA	0.418																																																	0													107.0	100.0	102.0					X																	106228369		2203	4300	6503	SO:0001583	missense	0			AK021627	CCDS14525.2, CCDS48146.1	Xq22.3	2008-02-05	2005-06-15	2005-06-15	ENSG00000133131	ENSG00000133131			23485	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 2"", ""zinc finger, CW type with coiled-coil domain 2"""	ZCWCC2		14607086	Standard	NM_024657		Approved	ZCW4, FLJ11565	uc004emp.4	Q8TE76	OTTHUMG00000022155	ENST00000355610.4:c.631C>A	X.37:g.106228369G>T	ENSP00000347821:p.Pro211Thr		A1YR23|A1YR24|H7BXF1|Q5JUK7|Q96MZ2|Q9HAI7	Missense_Mutation	SNP	pfam_Znf_CW,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Prefoldin,pfscan_Znf_CW	p.P211T	ENST00000355610.4	37	c.631	CCDS14525.2	X	.	.	.	.	.	.	.	.	.	.	G	18.09	3.545384	0.65198	.	.	ENSG00000133131	ENST00000355610;ENST00000255495	T;T	0.73258	-0.73;-0.73	4.78	4.78	0.61160	ATPase-like, ATP-binding domain (2);	0.267510	0.37530	N	0.002054	T	0.70037	0.3178	N	0.22421	0.69	0.80722	D	1	D;D	0.89917	1.0;0.995	D;P	0.83275	0.996;0.887	T	0.63765	-0.6563	10	0.07990	T	0.79	-7.9048	12.7344	0.57214	0.0:0.0:1.0:0.0	.	211;211	A1YR23;Q8TE76	.;MORC4_HUMAN	T	211	ENSP00000347821:P211T;ENSP00000255495:P211T	ENSP00000255495:P211T	P	-	1	0	MORC4	106115025	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.301000	0.51842	2.304000	0.77564	0.529000	0.55759	CCA	MORC4	-	superfamily_HATPase_ATP-bd	ENSG00000133131		0.418	MORC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MORC4	HGNC	protein_coding	OTTHUMT00000057816.3		0.00	44	0	G	NM_024657		106228369	-1			no_errors	ENST00000355610	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
MPP5	64398	genome.wustl.edu	37	14	67746085	67746085	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:67746085G>C	ENST00000261681.4	+	3	859	c.198G>C	c.(196-198)atG>atC	p.M66I	MPP5_ENST00000555925.1_Missense_Mutation_p.M32I|MPP5_ENST00000556345.1_Missense_Mutation_p.M66I	NM_022474.3	NP_071919.2	Q8N3R9	MPP5_HUMAN	membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)	66	Interaction with PARD6B. {ECO:0000250}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|establishment of protein localization to plasma membrane (GO:0090002)|morphogenesis of an epithelial sheet (GO:0002011)|myelin assembly (GO:0032288)|peripheral nervous system myelin maintenance (GO:0032287)|protein localization to myelin sheath abaxonal region (GO:0035750)|tight junction assembly (GO:0070830)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lateral loop (GO:0043219)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein domain specific binding (GO:0019904)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	18				all cancers(60;0.000388)|OV - Ovarian serous cystadenocarcinoma(108;0.00762)|BRCA - Breast invasive adenocarcinoma(234;0.0106)		AGGAGGACATGAGGCGTAGGA	0.483																																																	0													131.0	119.0	123.0					14																	67746085		2203	4300	6503	SO:0001583	missense	0			AK022677	CCDS9779.1, CCDS58325.1	14q23.3	2008-08-11				ENSG00000072415			18669	protein-coding gene	gene with protein product	"""stardust"""	606958				11927608	Standard	NM_022474		Approved	PALS1, FLJ12615	uc001xjc.4	Q8N3R9		ENST00000261681.4:c.198G>C	14.37:g.67746085G>C	ENSP00000261681:p.Met66Ile		A1L380|Q7Z631|Q86T98|Q8N7I5|Q9H9Q0	Missense_Mutation	SNP	pfam_GK/Ca_channel_bsu,pfam_L27_N,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,pfam_L27_C,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.M66I	ENST00000261681.4	37	c.198	CCDS9779.1	14	.	.	.	.	.	.	.	.	.	.	G	12.15	1.852421	0.32699	.	.	ENSG00000072415	ENST00000261681;ENST00000556345;ENST00000555925;ENST00000557783	T;T	0.06849	3.26;3.25	5.53	5.53	0.82687	.	0.095791	0.64402	D	0.000001	T	0.06554	0.0168	N	0.19112	0.55	0.39748	D	0.971843	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37009	-0.9724	10	0.30854	T	0.27	.	13.1842	0.59672	0.0825:0.0:0.9175:0.0	.	66;66	Q8N3R9;G3V2B0	MPP5_HUMAN;.	I	66;66;32;32	ENSP00000261681:M66I;ENSP00000451488:M32I	ENSP00000261681:M66I	M	+	3	0	MPP5	66815838	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.478000	0.45189	2.596000	0.87737	0.462000	0.41574	ATG	MPP5	-	NULL	ENSG00000072415		0.483	MPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP5	HGNC	protein_coding	OTTHUMT00000412498.1		0.00	19	0	G	NM_022474		67746085	+1			no_errors	ENST00000261681	ensembl	human	known	74_37	missense	13.04	20	3	SNP	1.000	C
MROH2B	133558	genome.wustl.edu	37	5	41045946	41045946	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:41045946C>G	ENST00000399564.4	-	18	2188	c.1738G>C	c.(1738-1740)Gaa>Caa	p.E580Q	MROH2B_ENST00000506092.2_Missense_Mutation_p.E135Q	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	580																	CATAAGGATTCTTTGAGCAAC	0.383																																																	0													189.0	180.0	183.0					5																	41045946		1945	4147	6092	SO:0001583	missense	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.1738G>C	5.37:g.41045946C>G	ENSP00000382476:p.Glu580Gln		Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E580Q	ENST00000399564.4	37	c.1738	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	C	16.75	3.210537	0.58343	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.68479	2.96;-0.33	5.51	5.51	0.81932	Armadillo-type fold (1);	0.415062	0.20437	N	0.092360	T	0.77212	0.4097	L	0.51422	1.61	0.39891	D	0.973777	D	0.76494	0.999	D	0.83275	0.996	T	0.75986	-0.3124	10	0.39692	T	0.17	.	14.911	0.70758	0.0:1.0:0.0:0.0	.	580	Q7Z745	HTRB2_HUMAN	Q	135;285;580	ENSP00000441504:E135Q;ENSP00000382476:E580Q	ENSP00000296803:E285Q	E	-	1	0	HEATR7B2	41081703	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	2.273000	0.43381	2.579000	0.87056	0.585000	0.79938	GAA	MROH2B	-	superfamily_ARM-type_fold	ENSG00000171495		0.383	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH2B	HGNC	protein_coding	OTTHUMT00000367558.2	-	0.00	66	0	C	NM_173489		41045946	-1	tier1	-	no_errors	ENST00000399564	ensembl	human	known	74_37	missense	23.62	97	30	SNP	1.000	G
MSLN	10232	genome.wustl.edu	37	16	812752	812752	+	Silent	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:812752G>T	ENST00000382862.3	+	2	167	c.72G>T	c.(70-72)ctG>ctT	p.L24L	MSLN_ENST00000545450.2_Silent_p.L24L|MSLN_ENST00000566549.1_Silent_p.L24L|MSLN_ENST00000563941.1_Silent_p.L24L	NM_013404.4	NP_037536.2	Q13421	MSLN_HUMAN	mesothelin	24					cell adhesion (GO:0007155)|pancreas development (GO:0031016)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|kidney(2)|lung(11)|pancreas(1)|prostate(1)|skin(3)	20		Hepatocellular(780;0.00335)				TCCTGTTCCTGCTCTTCAGCC	0.682																																																	0													75.0	78.0	77.0					16																	812752		2200	4300	6500	SO:0001819	synonymous_variant	0			U40434	CCDS32356.1, CCDS45370.1	16p13.3	2008-04-16			ENSG00000102854	ENSG00000102854			7371	protein-coding gene	gene with protein product		601051				7665620, 8552591	Standard	NM_005823		Approved	CAK1, MPF	uc002cjw.2	Q13421	OTTHUMG00000047992	ENST00000382862.3:c.72G>T	16.37:g.812752G>T			D3DU65|Q14859|Q4VQD5|Q96GR6|Q96KJ5|Q9BR17|Q9BTR2|Q9UCB2|Q9UK57	Silent	SNP	pfam_Mesothelin	p.L24	ENST00000382862.3	37	c.72	CCDS32356.1	16																																																																																			MSLN	-	pfam_Mesothelin	ENSG00000102854		0.682	MSLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MSLN	HGNC	protein_coding	OTTHUMT00000109253.2	-	0.00	108	0	G			812752	+1	tier1	-	no_errors	ENST00000382862	ensembl	human	known	74_37	silent	43.85	73	57	SNP	0.436	T
MSN	4478	genome.wustl.edu	37	X	64956728	64956730	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	AGG	AGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chrX:64956728_64956730delAGG	ENST00000360270.5	+	9	1203_1205	c.1031_1033delAGG	c.(1030-1035)aaggag>aag	p.E346del		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	346					cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)		MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						gaacgggagaaggaggagctgat	0.473			T	ALK	ALCL																																			Dom	yes		X	Xq11.2-q12	4478	moesin		L	0										8,3707		0,4,4,1587,529						4.4	1.0			96	37,6438		0,15,22,2341,1741	no	coding	MSN	NM_002444.2		0,19,26,3928,2270	A1A1,A1R,A1,RR,R		0.5714,0.2153,0.4416				45,10145				SO:0001651	inframe_deletion	0			M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.1031_1033delAGG	X.37:g.64956731_64956733delAGG	ENSP00000353408:p.Glu346del			In_Frame_Del	DEL	pirsf_ERM,pfam_ERM_C_dom,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin_tail,smart_Band_41_domain,prints_Ez/rad/moesin_like,prints_Band_41_fam,pfscan_FERM_domain	p.E346in_frame_del	ENST00000360270.5	37	c.1031_1033	CCDS14382.1	X																																																																																			MSN	-	pirsf_ERM,pfam_ERM_C_dom	ENSG00000147065		0.473	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSN	HGNC	protein_coding	OTTHUMT00000056981.1		0.00	12	0	AGG	NM_002444		64956730	+1			no_errors	ENST00000360270	ensembl	human	known	74_37	in_frame_del	14.00	43	7	DEL	1.000:0.998:1.000	0
MT1H	4496	genome.wustl.edu	37	16	56704480	56704480	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:56704480A>G	ENST00000332374.4	+	2	162	c.91A>G	c.(91-93)Aag>Gag	p.K31E	MT1G_ENST00000569500.1_5'Flank|MT1G_ENST00000568675.1_5'Flank|MT1H_ENST00000569155.1_Missense_Mutation_p.K31E|MT1G_ENST00000444837.2_5'Flank|MT1G_ENST00000379811.3_5'Flank	NM_005951.2	NP_005942.1	P80294	MT1H_HUMAN	metallothionein 1H	31	Alpha.				cellular response to cadmium ion (GO:0071276)|cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			lung(5)	5						CTCCTGCAAGAAGAGTGAGTG	0.582																																																	0													56.0	55.0	55.0					16																	56704480		2198	4298	6496	SO:0001583	missense	0			BC008408	CCDS10767.1	16q13	2008-02-05			ENSG00000205358	ENSG00000205358		"""Metallothioneins"""	7400	protein-coding gene	gene with protein product		156354		MT1		2286373, 8049263	Standard	NM_005951		Approved		uc002ejw.3	P80294	OTTHUMG00000133283	ENST00000332374.4:c.91A>G	16.37:g.56704480A>G	ENSP00000330587:p.Lys31Glu		B2RUY6	Missense_Mutation	SNP	pfam_Metalthion_sfam_euk,superfamily_Metalthion_dom,prints_Metalthion_vert	p.K31E	ENST00000332374.4	37	c.91	CCDS10767.1	16	.	.	.	.	.	.	.	.	.	.	A	12.76	2.035964	0.35893	.	.	ENSG00000205358	ENST00000332374	T	0.24151	1.87	2.12	2.12	0.27331	Metallothionein domain, vertebrate (1);Metallothionein domain (1);	0.000000	0.64402	U	0.000001	T	0.42291	0.1196	.	.	.	0.38598	D	0.950587	D	0.62365	0.991	D	0.66602	0.945	T	0.41342	-0.9514	9	0.59425	D	0.04	-1.4883	7.4215	0.27075	1.0:0.0:0.0:0.0	.	31	P80294	MT1H_HUMAN	E	31	ENSP00000330587:K31E	ENSP00000330587:K31E	K	+	1	0	MT1H	55261981	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	5.014000	0.64029	0.976000	0.38417	0.247000	0.18012	AAG	MT1H	-	pfam_Metalthion_sfam_euk,superfamily_Metalthion_dom,prints_Metalthion_vert	ENSG00000205358		0.582	MT1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MT1H	HGNC	protein_coding	OTTHUMT00000257063.1	-	0.00	94	0	A	NM_005951		56704480	+1	tier1	-	no_errors	ENST00000332374	ensembl	human	known	74_37	missense	8.62	106	10	SNP	1.000	G
MUC16	94025	genome.wustl.edu	37	19	9010665	9010665	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:9010665G>A	ENST00000397910.4	-	38	39199	c.38996C>T	c.(38995-38997)tCc>tTc	p.S12999F		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13001					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S12999F(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GCTGGGGAGGGAGGATGGAGT	0.493																																																	1	Substitution - Missense(1)	skin(1)											84.0	77.0	79.0					19																	9010665		1926	4126	6052	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.38996C>T	19.37:g.9010665G>A	ENSP00000381008:p.Ser12999Phe		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.S12999F	ENST00000397910.4	37	c.38996	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	.	4.090	0.014668	0.07959	.	.	ENSG00000181143	ENST00000397910;ENST00000441155	T	0.02103	4.45	1.16	-2.32	0.06745	.	.	.	.	.	T	0.03178	0.0093	M	0.75447	2.3	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.35450	-0.9788	8	0.87932	D	0	.	2.8744	0.05627	0.2139:0.0:0.4397:0.3464	.	12999	B5ME49	.	F	12999;152	ENSP00000381008:S12999F	ENSP00000381008:S12999F	S	-	2	0	MUC16	8871665	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.531000	0.02219	-1.660000	0.01486	-0.727000	0.03589	TCC	MUC16	-	NULL	ENSG00000181143		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	83	0	G	NM_024690		9010665	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	16.07	47	9	SNP	0.000	A
MUC16	94025	genome.wustl.edu	37	19	9089301	9089301	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:9089301G>A	ENST00000397910.4	-	1	2717	c.2514C>T	c.(2512-2514)ctC>ctT	p.L838L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	838	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.L838L(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTGGGAGGCTGAGAGTGCTAG	0.473																																																	2	Substitution - coding silent(2)	lung(2)											165.0	157.0	160.0					19																	9089301		1990	4172	6162	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.2514C>T	19.37:g.9089301G>A			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.L838	ENST00000397910.4	37	c.2514	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	85	0	G	NM_024690		9089301	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	27.85	57	22	SNP	0.000	A
MUL1	79594	genome.wustl.edu	37	1	20827622	20827622	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:20827622G>C	ENST00000264198.3	-	4	756	c.620C>G	c.(619-621)tCt>tGt	p.S207C		NM_024544.2	NP_078820.2	Q969V5	MUL1_HUMAN	mitochondrial E3 ubiquitin protein ligase 1	207					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|cellular response to exogenous dsRNA (GO:0071360)|mitochondrial fission (GO:0000266)|mitochondrion localization (GO:0051646)|negative regulation of cell growth (GO:0030308)|negative regulation of chemokine (C-C motif) ligand 5 production (GO:0071650)|negative regulation of defense response to virus by host (GO:0050689)|negative regulation of innate immune response (GO:0045824)|negative regulation of mitochondrial fusion (GO:0010637)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein sumoylation (GO:0033235)|protein stabilization (GO:0050821)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901028)	cytoplasm (GO:0005737)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(5)	11		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00748)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000137)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00124)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)		CAGGCGGACAGAGTTGTTGTC	0.612																																																	0													89.0	86.0	87.0					1																	20827622		2203	4300	6503	SO:0001583	missense	0			BC014010	CCDS208.1	1p36.12	2013-01-11	2010-09-17	2008-03-26	ENSG00000090432	ENSG00000090432		"""RING-type (C3HC4) zinc fingers"""	25762	protein-coding gene	gene with protein product	"""ring finger protein 218"", ""mitochondria-anchored protein ligase"", ""growth inhibition and death E3 ligase"", ""mitochondrial ubiquitin ligase activator of NFKB 1"""	612037	"""chromosome 1 open reading frame 166"""	C1orf166		18591963, 12761501, 18213395, 18207745	Standard	NM_024544		Approved	FLJ12875, MULAN, RNF218, MAPL, GIDE	uc001bdi.4	Q969V5	OTTHUMG00000002838	ENST00000264198.3:c.620C>G	1.37:g.20827622G>C	ENSP00000264198:p.Ser207Cys		B5M497|Q7Z431|Q9H9B5	Missense_Mutation	SNP	pfam_MULAN,pfscan_Znf_RING	p.S207C	ENST00000264198.3	37	c.620	CCDS208.1	1	.	.	.	.	.	.	.	.	.	.	G	12.90	2.077563	0.36662	.	.	ENSG00000090432	ENST00000264198	T	0.24723	1.84	6.16	4.25	0.50352	.	0.543212	0.22651	N	0.057340	T	0.23210	0.0561	L	0.38175	1.15	0.26519	N	0.974455	B	0.02656	0.0	B	0.06405	0.002	T	0.14364	-1.0475	10	0.56958	D	0.05	-10.7639	15.0254	0.71667	0.0:0.2703:0.7297:0.0	.	207	Q969V5	MUL1_HUMAN	C	207	ENSP00000264198:S207C	ENSP00000264198:S207C	S	-	2	0	MUL1	20700209	1.000000	0.71417	0.555000	0.28281	0.987000	0.75469	4.033000	0.57282	0.887000	0.36136	0.650000	0.86243	TCT	MUL1	-	pfam_MULAN	ENSG00000090432		0.612	MUL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUL1	HGNC	protein_coding	OTTHUMT00000007951.1	-	0.00	28	0	G	NM_024544		20827622	-1	tier1	-	no_errors	ENST00000264198	ensembl	human	known	74_37	missense	8.77	52	5	SNP	0.980	C
MYLK	4638	genome.wustl.edu	37	3	123419182	123419182	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr3:123419182C>G	ENST00000475616.1	-	15	3132	c.3133G>C	c.(3133-3135)Gag>Cag	p.E1045Q	MYLK_ENST00000346322.5_Missense_Mutation_p.E976Q|MYLK_ENST00000360304.3_Missense_Mutation_p.E1045Q|MYLK_ENST00000360772.3_Missense_Mutation_p.E1045Q|MYLK_ENST00000359169.1_Missense_Mutation_p.E1045Q|MYLK_ENST00000510775.1_5'Flank			Q15746	MYLK_HUMAN	myosin light chain kinase	1045	6 X 12 AA approximate tandem repeats.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TTCAGGGTCTCGGCAGGCTTG	0.547																																																	0													194.0	201.0	199.0					3																	123419182		2203	4300	6503	SO:0001583	missense	0			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.3133G>C	3.37:g.123419182C>G	ENSP00000418335:p.Glu1045Gln		B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E1045Q	ENST00000475616.1	37	c.3133	CCDS46896.1	3	.	.	.	.	.	.	.	.	.	.	C	8.998	0.979390	0.18812	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.69306	-0.39;-0.35;-0.39;-0.33;-0.35	5.5	5.5	0.81552	.	.	.	.	.	T	0.80042	0.4551	M	0.75264	2.295	0.58432	D	0.999996	D;D;D;D;D;D	0.76494	0.998;0.978;0.999;0.979;0.999;0.987	D;P;D;P;D;P	0.70716	0.945;0.676;0.954;0.758;0.97;0.782	T	0.78448	-0.2200	9	0.34782	T	0.22	.	14.8886	0.70590	0.0:1.0:0.0:0.0	.	1045;123;976;1045;976;1045	Q15746-6;Q15746-7;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;.;MYLK_HUMAN	Q	1045;1045;1045;976;1045	ENSP00000354004:E1045Q;ENSP00000353452:E1045Q;ENSP00000352088:E1045Q;ENSP00000320622:E976Q;ENSP00000418335:E1045Q	ENSP00000320622:E976Q	E	-	1	0	MYLK	124901872	0.822000	0.29219	0.952000	0.39060	0.187000	0.23431	1.141000	0.31528	2.575000	0.86900	0.462000	0.41574	GAG	MYLK	-	NULL	ENSG00000065534		0.547	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	HGNC	protein_coding	OTTHUMT00000356464.1	-	0.00	56	0	C	NM_053025		123419182	-1	tier1	-	no_errors	ENST00000360304	ensembl	human	known	74_37	missense	19.28	67	16	SNP	0.340	G
MYLK3	91807	genome.wustl.edu	37	16	46761262	46761262	+	Silent	SNP	C	C	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:46761262C>A	ENST00000394809.4	-	8	1915	c.1800G>T	c.(1798-1800)cgG>cgT	p.R600R	MYLK3_ENST00000536476.1_Silent_p.R259R	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	600	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				CATCTGTGATCCGGTCGAAGA	0.567																																																	0													160.0	104.0	123.0					16																	46761262		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.1800G>T	16.37:g.46761262C>A			B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R600	ENST00000394809.4	37	c.1800	CCDS10723.2	16																																																																																			MYLK3	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000140795		0.567	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYLK3	HGNC	protein_coding	OTTHUMT00000255743.2	-	0.00	42	0	C	NM_182493		46761262	-1	tier1	-	no_errors	ENST00000394809	ensembl	human	known	74_37	silent	20.29	55	14	SNP	1.000	A
MYO18B	84700	genome.wustl.edu	37	22	26242238	26242238	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr22:26242238C>G	ENST00000407587.2	+	19	3712	c.3543C>G	c.(3541-3543)atC>atG	p.I1181M	MYO18B_ENST00000335473.7_Missense_Mutation_p.I1180M|MYO18B_ENST00000536101.1_Missense_Mutation_p.I1180M			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1180	Myosin motor.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.I1181M(2)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GCTCCCAGATCAAGCTGCAGA	0.617																																																	2	Substitution - Missense(2)	lung(2)											75.0	90.0	85.0					22																	26242238		2178	4267	6445	SO:0001583	missense	0			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.3543C>G	22.37:g.26242238C>G	ENSP00000386096:p.Ile1181Met		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.I1180M	ENST00000407587.2	37	c.3540		22	.	.	.	.	.	.	.	.	.	.	C	17.06	3.291905	0.59976	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	T;T;T	0.72282	-0.64;-0.64;-0.64	4.32	4.32	0.51571	Myosin head, motor domain (2);	0.272209	0.35525	N	0.003141	D	0.82490	0.5048	M	0.74258	2.255	0.37920	D	0.93165	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.77004	0.975;0.989;0.983;0.982	D	0.85397	0.1129	10	0.49607	T	0.09	.	14.3612	0.66773	0.0:1.0:0.0:0.0	.	693;1180;1181;1180	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	M	1180;1180;1181	ENSP00000441229:I1180M;ENSP00000334563:I1180M;ENSP00000386096:I1181M	ENSP00000334563:I1180M	I	+	3	3	MYO18B	24572238	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.593000	0.36686	2.255000	0.74692	0.561000	0.74099	ATC	MYO18B	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000133454		0.617	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	-	0.00	39	0	C	NM_032608		26242238	+1	tier1	-	no_errors	ENST00000335473	ensembl	human	known	74_37	missense	44.44	20	16	SNP	1.000	G
NAA11	84779	genome.wustl.edu	37	4	80246828	80246828	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr4:80246828C>T	ENST00000286794.4	-	1	376	c.204G>A	c.(202-204)ccG>ccA	p.P68P	NAA11_ENST00000513733.1_5'Flank	NM_032693.2	NP_116082.1	Q9BSU3	NAA11_HUMAN	N(alpha)-acetyltransferase 11, NatA catalytic subunit	68	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				N-terminal protein amino acid acetylation (GO:0006474)	NatA complex (GO:0031415)|nucleus (GO:0005634)	peptide alpha-N-acetyltransferase activity (GO:0004596)	p.P68P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|skin(2)	23						TATGGCCATGCGGGACATCAT	0.582																																																	1	Substitution - coding silent(1)	lung(1)											111.0	111.0	111.0					4																	80246828		2177	4289	6466	SO:0001819	synonymous_variant	0				CCDS47084.1	4q21.23	2010-05-07	2010-01-14	2010-01-14		ENSG00000156269	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	28125	protein-coding gene	gene with protein product			"""ARD1 homolog B (S. cerevisiae)"""	ARD1B		16638120, 19660095	Standard	NM_032693		Approved	ARD2, hARD2	uc003hlt.4	Q9BSU3		ENST00000286794.4:c.204G>A	4.37:g.80246828C>T			Q66K19|Q6P479	Silent	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.P68	ENST00000286794.4	37	c.204	CCDS47084.1	4																																																																																			NAA11	-	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000156269		0.582	NAA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA11	HGNC	protein_coding	OTTHUMT00000362922.1	-	0.00	22	0	C			80246828	-1	tier1	-	no_errors	ENST00000286794	ensembl	human	known	74_37	silent	40.00	21	14	SNP	0.615	T
NAB2	4665	genome.wustl.edu	37	12	57486239	57486239	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:57486239C>T	ENST00000300131.3	+	3	1344	c.966C>T	c.(964-966)atC>atT	p.I322I	NAB2_ENST00000357680.4_Intron|NAB2_ENST00000342556.6_Silent_p.I322I	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	322	NCD2.				cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						AGCTCACCATCAACGAGGCTG	0.567																																																	0													118.0	100.0	107.0					12																	57486239		2203	4300	6503	SO:0001819	synonymous_variant	0			BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.966C>T	12.37:g.57486239C>T			B2RAK3|O76006|Q14797	Silent	SNP	pfam_NAB_co-repressor_dom,pfam_Nab_N,superfamily_SAM/pointed	p.I322	ENST00000300131.3	37	c.966	CCDS8930.1	12																																																																																			NAB2	-	pfam_NAB_co-repressor_dom	ENSG00000166886		0.567	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAB2	HGNC	protein_coding	OTTHUMT00000412222.1	-	0.00	40	0	C	NM_005967		57486239	+1	tier1	-	no_errors	ENST00000300131	ensembl	human	known	74_37	silent	16.28	36	7	SNP	1.000	T
NANS	54187	genome.wustl.edu	37	9	100840628	100840628	+	Splice_Site	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr9:100840628C>T	ENST00000210444.5	+	4	672	c.602C>T	c.(601-603)tCg>tTg	p.S201L	NANS_ENST00000461452.1_3'UTR|TRIM14_ENST00000478530.1_5'Flank|TRIM14_ENST00000375098.3_Intron	NM_018946.3	NP_061819.2	Q9NR45	SIAS_HUMAN	N-acetylneuraminic acid synthase	201					lipopolysaccharide biosynthetic process (GO:0009103)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	N-acetylneuraminate synthase activity (GO:0050462)|N-acylneuraminate cytidylyltransferase activity (GO:0008781)|N-acylneuraminate-9-phosphate synthase activity (GO:0047444)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	11		Acute lymphoblastic leukemia(62;0.0559)				CGGGTCATCTCGGTGAGCAGG	0.502																																																	0													115.0	102.0	107.0					9																	100840628		2203	4300	6503	SO:0001630	splice_region_variant	0			AF161387	CCDS6733.1	9p24.1-p23	2008-07-31	2008-07-31		ENSG00000095380	ENSG00000095380			19237	protein-coding gene	gene with protein product	"""sialic acid synthase"""	605202				10749855	Standard	NM_018946		Approved	SAS	uc004ayc.3	Q9NR45	OTTHUMG00000020341	ENST00000210444.5:c.603+1C>T	9.37:g.100840628C>T			B2RE98|Q8WUV9|Q9BWS6|Q9NVD4	Missense_Mutation	SNP	pfam_Neu5Ac_N,pfam_SAF,superfamily_AFP_Neu5c_C,smart_SAF,pfscan_AFP_Neu5c_C,prints_Antifreeze_III	p.S201L	ENST00000210444.5	37	c.602	CCDS6733.1	9	.	.	.	.	.	.	.	.	.	.	C	15.26	2.780732	0.49891	.	.	ENSG00000095380	ENST00000210444;ENST00000415280;ENST00000427646	T;T;T	0.43688	0.94;0.94;0.94	5.33	5.33	0.75918	Aldolase-type TIM barrel (1);N-acetylneuraminic acid synthase, N-terminal (1);	0.320649	0.35936	N	0.002898	T	0.29256	0.0728	N	0.25647	0.755	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.003	T	0.06534	-1.0821	10	0.23891	T	0.37	-1.6073	11.996	0.53204	0.1728:0.8272:0.0:0.0	.	37;201	E9PGK0;Q9NR45	.;SIAS_HUMAN	L	201;60;9	ENSP00000210444:S201L;ENSP00000404107:S60L;ENSP00000404642:S9L	ENSP00000210444:S201L	S	+	2	0	NANS	99880449	0.994000	0.37717	1.000000	0.80357	0.973000	0.67179	2.402000	0.44521	2.679000	0.91253	0.650000	0.86243	TCG	NANS	-	pfam_Neu5Ac_N	ENSG00000095380		0.502	NANS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NANS	HGNC	protein_coding	OTTHUMT00000053359.1	-	0.00	49	0	C	NM_018946	Missense_Mutation	100840628	+1	tier1	-	no_errors	ENST00000210444	ensembl	human	known	74_37	missense	58.54	17	24	SNP	1.000	T
NARF	26502	genome.wustl.edu	37	17	80442792	80442792	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:80442792G>A	ENST00000309794.11	+	9	1135	c.937G>A	c.(937-939)Gag>Aag	p.E313K	NARF_ENST00000345415.7_Missense_Mutation_p.E265K|NARF_ENST00000390006.4_Missense_Mutation_p.E254K|NARF-IT1_ENST00000584012.1_RNA|NARF_ENST00000457415.3_Missense_Mutation_p.E359K	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	313						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GCTGTTCAACGAGGATGTGGA	0.572																																																	0													168.0	118.0	135.0					17																	80442792		2203	4300	6503	SO:0001583	missense	0			BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.937G>A	17.37:g.80442792G>A	ENSP00000309899:p.Glu313Lys		A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Missense_Mutation	SNP	pfam_Fe_hydrogenase_lsu_C,pfam_Fe_hydrogenase_ssu-like,superfamily_Fe_hydrogenase,smart_Fe_hydrogenase_ssu-like	p.E313K	ENST00000309794.11	37	c.937	CCDS32777.1	17	.	.	.	.	.	.	.	.	.	.	.	14.11	2.436599	0.43224	.	.	ENSG00000141562	ENST00000390006;ENST00000374611;ENST00000309794;ENST00000345415	T;T;T	0.40476	1.03;1.03;1.03	5.38	2.88	0.33553	Iron hydrogenase, large subunit, C-terminal (1);Iron hydrogenase (1);	0.199306	0.51477	D	0.000090	T	0.15219	0.0367	N	0.05534	-0.03	0.80722	D	1	B;B;B;B	0.29552	0.209;0.085;0.248;0.046	B;B;B;B	0.28465	0.036;0.021;0.09;0.036	T	0.19910	-1.0291	10	0.06099	T	0.92	-22.6592	4.2433	0.10660	0.2281:0.0:0.5796:0.1923	.	359;265;360;313	Q9UHQ1-2;Q9UHQ1-3;E9PH27;Q9UHQ1	.;.;.;NARF_HUMAN	K	254;360;313;265	ENSP00000374656:E254K;ENSP00000309899:E313K;ENSP00000283996:E265K	ENSP00000309899:E313K	E	+	1	0	NARF	78036081	0.443000	0.25641	0.756000	0.31282	0.943000	0.58893	0.900000	0.28431	2.516000	0.84829	0.561000	0.74099	GAG	NARF	-	pfam_Fe_hydrogenase_lsu_C,superfamily_Fe_hydrogenase	ENSG00000141562		0.572	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARF	HGNC	protein_coding	OTTHUMT00000443573.2	-	0.00	148	0	G	NM_031968		80442792	+1	tier1	-	no_errors	ENST00000309794	ensembl	human	known	74_37	missense	8.91	184	18	SNP	0.829	A
NARF	26502	genome.wustl.edu	37	17	80442801	80442801	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:80442801G>A	ENST00000309794.11	+	9	1144	c.946G>A	c.(946-948)Gag>Aag	p.E316K	NARF_ENST00000345415.7_Missense_Mutation_p.E268K|NARF_ENST00000390006.4_Missense_Mutation_p.E257K|NARF-IT1_ENST00000584012.1_RNA|NARF_ENST00000457415.3_Missense_Mutation_p.E362K	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	316						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			CGAGGATGTGGAGGAGGTCAC	0.577																																																	0													166.0	115.0	132.0					17																	80442801		2203	4300	6503	SO:0001583	missense	0			BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.946G>A	17.37:g.80442801G>A	ENSP00000309899:p.Glu316Lys		A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Missense_Mutation	SNP	pfam_Fe_hydrogenase_lsu_C,pfam_Fe_hydrogenase_ssu-like,superfamily_Fe_hydrogenase,smart_Fe_hydrogenase_ssu-like	p.E316K	ENST00000309794.11	37	c.946	CCDS32777.1	17	.	.	.	.	.	.	.	.	.	.	.	15.28	2.786309	0.49997	.	.	ENSG00000141562	ENST00000390006;ENST00000374611;ENST00000309794;ENST00000345415	T;T;T	0.42513	0.97;0.97;0.97	5.38	3.13	0.36017	Iron hydrogenase, large subunit, C-terminal (1);Iron hydrogenase (1);	0.319905	0.38492	N	0.001666	T	0.17492	0.0420	N	0.05330	-0.07	0.80722	D	1	B;B;B;B	0.14012	0.007;0.0;0.009;0.001	B;B;B;B	0.21360	0.013;0.008;0.034;0.01	T	0.13098	-1.0522	10	0.12103	T	0.63	-35.9428	4.9591	0.14057	0.1374:0.4232:0.4394:0.0	.	362;268;363;316	Q9UHQ1-2;Q9UHQ1-3;E9PH27;Q9UHQ1	.;.;.;NARF_HUMAN	K	257;363;316;268	ENSP00000374656:E257K;ENSP00000309899:E316K;ENSP00000283996:E268K	ENSP00000309899:E316K	E	+	1	0	NARF	78036090	0.726000	0.28059	1.000000	0.80357	0.926000	0.56050	0.594000	0.24014	2.516000	0.84829	0.561000	0.74099	GAG	NARF	-	pfam_Fe_hydrogenase_lsu_C,superfamily_Fe_hydrogenase	ENSG00000141562		0.577	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARF	HGNC	protein_coding	OTTHUMT00000443573.2	-	0.00	156	0	G	NM_031968		80442801	+1	tier1	-	no_errors	ENST00000309794	ensembl	human	known	74_37	missense	8.70	189	18	SNP	1.000	A
NARF	26502	genome.wustl.edu	37	17	80443380	80443380	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:80443380G>C	ENST00000309794.11	+	10	1177	c.979G>C	c.(979-981)Gac>Cac	p.D327H	NARF_ENST00000345415.7_Missense_Mutation_p.D279H|NARF_ENST00000390006.4_Missense_Mutation_p.D268H|NARF-IT1_ENST00000584012.1_RNA|NARF_ENST00000457415.3_Missense_Mutation_p.D373H	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	327						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			TAGAAACAAAGACTTCCAAGA	0.413																																																	0													112.0	110.0	110.0					17																	80443380		2203	4300	6503	SO:0001583	missense	0			BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.979G>C	17.37:g.80443380G>C	ENSP00000309899:p.Asp327His		A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Missense_Mutation	SNP	pfam_Fe_hydrogenase_lsu_C,pfam_Fe_hydrogenase_ssu-like,superfamily_Fe_hydrogenase,smart_Fe_hydrogenase_ssu-like	p.D327H	ENST00000309794.11	37	c.979	CCDS32777.1	17	.	.	.	.	.	.	.	.	.	.	.	14.23	2.472634	0.43942	.	.	ENSG00000141562	ENST00000390006;ENST00000374611;ENST00000309794;ENST00000345415	T;T;T	0.50813	0.73;0.73;0.73	5.32	5.32	0.75619	Iron hydrogenase, large subunit, C-terminal (1);Iron hydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.78935	0.4362	H	0.95187	3.635	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.85659	0.1287	10	0.87932	D	0	-9.8846	17.9724	0.89117	0.0:0.0:1.0:0.0	.	373;279;374;327	Q9UHQ1-2;Q9UHQ1-3;E9PH27;Q9UHQ1	.;.;.;NARF_HUMAN	H	268;374;327;279	ENSP00000374656:D268H;ENSP00000309899:D327H;ENSP00000283996:D279H	ENSP00000309899:D327H	D	+	1	0	NARF	78036669	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.426000	0.80270	2.480000	0.83734	0.561000	0.74099	GAC	NARF	-	pfam_Fe_hydrogenase_lsu_C,superfamily_Fe_hydrogenase	ENSG00000141562		0.413	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARF	HGNC	protein_coding	OTTHUMT00000443573.2	-	0.00	50	0	G	NM_031968		80443380	+1	tier1	-	no_errors	ENST00000309794	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	C
NARF	26502	genome.wustl.edu	37	17	80443401	80443401	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:80443401G>C	ENST00000309794.11	+	10	1198	c.1000G>C	c.(1000-1002)Gag>Cag	p.E334Q	NARF_ENST00000345415.7_Missense_Mutation_p.E286Q|NARF_ENST00000390006.4_Missense_Mutation_p.E275Q|NARF-IT1_ENST00000584012.1_RNA|NARF_ENST00000457415.3_Missense_Mutation_p.E380Q	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	334						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GGTCACCCTTGAGAAGAACGG	0.418																																																	0													136.0	128.0	130.0					17																	80443401		2203	4300	6503	SO:0001583	missense	0			BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.1000G>C	17.37:g.80443401G>C	ENSP00000309899:p.Glu334Gln		A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Missense_Mutation	SNP	pfam_Fe_hydrogenase_lsu_C,pfam_Fe_hydrogenase_ssu-like,superfamily_Fe_hydrogenase,smart_Fe_hydrogenase_ssu-like	p.E334Q	ENST00000309794.11	37	c.1000	CCDS32777.1	17	.	.	.	.	.	.	.	.	.	.	.	13.58	2.280124	0.40294	.	.	ENSG00000141562	ENST00000390006;ENST00000374611;ENST00000309794;ENST00000345415	T;T;T	0.45276	0.9;0.9;0.9	5.32	5.32	0.75619	Iron hydrogenase, large subunit, C-terminal (1);Iron hydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.62319	0.2418	M	0.65320	2	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.997;1.0;1.0	T	0.57871	-0.7736	10	0.31617	T	0.26	-13.4437	17.9724	0.89117	0.0:0.0:1.0:0.0	.	380;286;381;334	Q9UHQ1-2;Q9UHQ1-3;E9PH27;Q9UHQ1	.;.;.;NARF_HUMAN	Q	275;381;334;286	ENSP00000374656:E275Q;ENSP00000309899:E334Q;ENSP00000283996:E286Q	ENSP00000309899:E334Q	E	+	1	0	NARF	78036690	1.000000	0.71417	0.161000	0.22692	0.763000	0.43281	7.335000	0.79234	2.480000	0.83734	0.561000	0.74099	GAG	NARF	-	pfam_Fe_hydrogenase_lsu_C,superfamily_Fe_hydrogenase	ENSG00000141562		0.418	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARF	HGNC	protein_coding	OTTHUMT00000443573.2	-	0.00	53	0	G	NM_031968		80443401	+1	tier1	-	no_errors	ENST00000309794	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	C
NBPF9	400818	genome.wustl.edu	37	1	144828816	144828816	+	3'UTR	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:144828816C>T	ENST00000468645.1	+	0	2159				NBPF9_ENST00000281815.8_3'UTR|NBPF9_ENST00000440491.2_3'UTR|NBPF9_ENST00000338347.4_3'UTR			Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9							cytoplasm (GO:0005737)				NS(2)|prostate(1)	3						GATGTCATTCCTGCAGGCAGG	0.468																																																	0													32.0	23.0	26.0					1																	144828816		692	1590	2282	SO:0001624	3_prime_UTR_variant	0				CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000468645.1:c.*2156C>T	1.37:g.144828816C>T				RNA	SNP	-	NULL	ENST00000468645.1	37	NULL		1																																																																																			NBPF9	-	-	ENSG00000168614		0.468	NBPF9-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	NBPF9	HGNC	protein_coding	OTTHUMT00000038846.1	-	0.00	204	0	C	NM_001037675		144828816	+1	tier1	-	no_errors	ENST00000468645	ensembl	human	known	74_37	rna	18.12	260	58	SNP	0.002	T
NCKAP5	344148	genome.wustl.edu	37	2	133541104	133541104	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:133541104C>G	ENST00000409261.1	-	14	3653	c.3280G>C	c.(3280-3282)Gat>Cat	p.D1094H	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.D1094H	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1094	Ser-rich.									NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GAGGCGCTATCATTCAATTGT	0.498																																																	0													256.0	268.0	264.0					2																	133541104		2004	4167	6171	SO:0001583	missense	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.3280G>C	2.37:g.133541104C>G	ENSP00000387128:p.Asp1094His		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	NULL	p.D1094H	ENST00000409261.1	37	c.3280	CCDS46418.1	2	.	.	.	.	.	.	.	.	.	.	C	10.25	1.297322	0.23650	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.11712	2.75;2.75	5.41	4.53	0.55603	.	0.380247	0.18438	U	0.141229	T	0.07052	0.0179	L	0.29908	0.895	0.21878	N	0.999491	B	0.27700	0.186	B	0.25759	0.063	T	0.28618	-1.0038	10	0.49607	T	0.09	.	2.4541	0.04525	0.1557:0.5342:0.15:0.16	.	1094	O14513	NCKP5_HUMAN	H	1094	ENSP00000387128:D1094H;ENSP00000380603:D1094H	ENSP00000380603:D1094H	D	-	1	0	NCKAP5	133257574	0.003000	0.15002	0.038000	0.18304	0.118000	0.20060	0.851000	0.27751	1.521000	0.48983	0.655000	0.94253	GAT	NCKAP5	-	NULL	ENSG00000176771		0.498	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	-	0.00	61	0	C	NM_207481		133541104	-1	tier1	-	no_errors	ENST00000317721	ensembl	human	known	74_37	missense	30.00	63	27	SNP	0.218	G
NELL1	4745	genome.wustl.edu	37	11	21594756	21594756	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:21594756T>G	ENST00000357134.5	+	19	2335	c.2183T>G	c.(2182-2184)cTc>cGc	p.L728R	NELL1_ENST00000532434.1_Missense_Mutation_p.L681R|NELL1_ENST00000298925.5_Missense_Mutation_p.L756R|NELL1_ENST00000529218.1_3'UTR|NELL1_ENST00000325319.5_Missense_Mutation_p.L671R	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	728	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						TGCTGGCCACTCACTTGCCCC	0.443																																																	0													86.0	84.0	85.0					11																	21594756		2203	4300	6503	SO:0001583	missense	0			AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.2183T>G	11.37:g.21594756T>G	ENSP00000349654:p.Leu728Arg		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_VWF_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_VWC_out,smart_VWF_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_VWF_C	p.L728R	ENST00000357134.5	37	c.2183	CCDS7855.1	11	.	.	.	.	.	.	.	.	.	.	T	20.6	4.021133	0.75275	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68	5.48	5.48	0.80851	von Willebrand factor, type C (4);	0.089128	0.45361	D	0.000376	T	0.77942	0.4206	L	0.49513	1.565	0.34872	D	0.743725	P;D;D;D;P	0.62365	0.852;0.97;0.971;0.991;0.878	P;P;P;D;P	0.70716	0.653;0.828;0.88;0.97;0.765	T	0.77991	-0.2379	10	0.13108	T	0.6	-6.0954	15.247	0.73513	0.0:0.0:0.0:1.0	.	671;756;273;681;728	F5H6I3;B3KXR2;Q8N9Z6;Q92832-2;Q92832	.;.;.;.;NELL1_HUMAN	R	756;728;671;681	ENSP00000298925:L756R;ENSP00000349654:L728R;ENSP00000317837:L671R;ENSP00000437170:L681R	ENSP00000298925:L756R	L	+	2	0	NELL1	21551332	0.998000	0.40836	0.430000	0.26722	0.992000	0.81027	7.698000	0.84413	2.078000	0.62432	0.454000	0.30748	CTC	NELL1	-	pfam_VWF_C,smart_VWC_out,smart_VWF_C,pfscan_VWF_C	ENSG00000165973		0.443	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL1	HGNC	protein_coding	OTTHUMT00000387588.1	-	0.00	62	0	T	NM_006157		21594756	+1	tier1	-	no_errors	ENST00000357134	ensembl	human	known	74_37	missense	28.99	49	20	SNP	0.412	G
NF1	4763	genome.wustl.edu	37	17	29527461	29527461	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:29527461C>T	ENST00000358273.4	+	9	1293	c.910C>T	c.(910-912)Cga>Tga	p.R304*	NF1_ENST00000356175.3_Nonsense_Mutation_p.R304*|NF1_ENST00000431387.4_Nonsense_Mutation_p.R304*	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	304					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(6)|p.R304*(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GGACAGTCTACGAAAAGCTCT	0.368			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	18	Whole gene deletion(8)|Unknown(6)|Substitution - Nonsense(4)	soft_tissue(10)|central_nervous_system(4)|autonomic_ganglia(3)|lung(1)	GRCh37	CS983483	NF1	S							80.0	72.0	74.0					17																	29527461		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.910C>T	17.37:g.29527461C>T	ENSP00000351015:p.Arg304*		O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.R304*	ENST00000358273.4	37	c.910	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	C	40	7.928131	0.98565	.	.	ENSG00000196712	ENST00000431387;ENST00000358273;ENST00000356175	.	.	.	5.17	2.99	0.34606	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	.	11.49	0.50375	0.6198:0.3802:0.0:0.0	.	.	.	.	X	304	.	ENSP00000348498:R304X	R	+	1	2	NF1	26551587	0.936000	0.31750	0.786000	0.31890	0.980000	0.70556	1.652000	0.37313	1.151000	0.42436	0.591000	0.81541	CGA	NF1	-	superfamily_ARM-type_fold	ENSG00000196712		0.368	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	-	0.00	64	0	C	NM_000267		29527461	+1	tier1	-	no_errors	ENST00000358273	ensembl	human	known	74_37	nonsense	35.14	48	26	SNP	0.989	T
NIP7	51388	genome.wustl.edu	37	16	69373946	69373946	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:69373946G>C	ENST00000254940.5	+	2	494	c.94G>C	c.(94-96)Gat>Cat	p.D32H	RP11-343C2.9_ENST00000563634.1_Intron|NIP7_ENST00000569637.2_Missense_Mutation_p.D32H|RP11-343C2.7_ENST00000564737.1_Intron|COG8_ENST00000562081.1_5'Flank|COG8_ENST00000306875.4_5'Flank|NIP7_ENST00000254941.6_Missense_Mutation_p.D32H	NM_016101.4	NP_057185.1	Q9Y221	NIP7_HUMAN	NIP7, nucleolar pre-rRNA processing protein	32	N-terminal domain.				ribosome assembly (GO:0042255)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)	6		Ovarian(137;0.101)				GGACCGGCCCGATGGCACCTA	0.657											OREG0023907	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													56.0	56.0	56.0					16																	69373946		2198	4300	6498	SO:0001583	missense	0			AB112439	CCDS10877.1, CCDS56003.1	16q22.1	2013-03-04	2013-03-04		ENSG00000132603	ENSG00000132603			24328	protein-coding gene	gene with protein product			"""nuclear import 7 homolog (S. cerevisiae)"""			14660641, 22195017	Standard	NM_016101		Approved	CGI-37, FLJ10296, HSPC031, KD93	uc002exa.3	Q9Y221	OTTHUMG00000137568	ENST00000254940.5:c.94G>C	16.37:g.69373946G>C	ENSP00000254940:p.Asp32His	1114	B2RD04|Q9NZZ0	Missense_Mutation	SNP	pfam_Rbsml_synth_fac_NIP7-like,superfamily_PUA-like_domain,smart_PUA,pirsf_Ribosomal_synth_fac_NIP7,pfscan_PUA	p.D32H	ENST00000254940.5	37	c.94	CCDS10877.1	16	.	.	.	.	.	.	.	.	.	.	G	16.67	3.187260	0.57909	.	.	ENSG00000132603	ENST00000254940;ENST00000254941	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.86045	0.5839	M	0.91300	3.195	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.71656	0.973;0.974	D	0.88709	0.3221	9	0.87932	D	0	-6.1415	19.634	0.95722	0.0:0.0:1.0:0.0	.	32;32	Q9Y221-2;Q9Y221	.;NIP7_HUMAN	H	32	.	ENSP00000254940:D32H	D	+	1	0	NIP7	67931447	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	9.069000	0.93967	2.642000	0.89623	0.456000	0.33151	GAT	NIP7	-	pfam_Rbsml_synth_fac_NIP7-like,pirsf_Ribosomal_synth_fac_NIP7	ENSG00000132603		0.657	NIP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIP7	HGNC	protein_coding	OTTHUMT00000268947.2	-	0.00	63	0	G	NM_016101		69373946	+1	tier1	-	no_errors	ENST00000254940	ensembl	human	known	74_37	missense	35.71	63	35	SNP	1.000	C
NIPAL3	57185	genome.wustl.edu	37	1	24766717	24766717	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:24766717C>T	ENST00000374399.4	+	3	517	c.149C>T	c.(148-150)gCa>gTa	p.A50V	NIPAL3_ENST00000339255.2_Missense_Mutation_p.A50V|NIPAL3_ENST00000358028.4_Missense_Mutation_p.A50V|NIPAL3_ENST00000003912.3_5'UTR|NIPAL3_ENST00000428131.1_Missense_Mutation_p.A50V	NM_020448.4	NP_065181.1	Q6P499	NPAL3_HUMAN	NIPA-like domain containing 3	50						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(1)	14						GTCAGCATTGCACTTAACCTC	0.532																																																	0													112.0	98.0	102.0					1																	24766717		2203	4300	6503	SO:0001583	missense	0			BX640883	CCDS30631.1	1p36.12-p35.1	2009-03-24		2009-03-24	ENSG00000001461	ENSG00000001461			25233	protein-coding gene	gene with protein product				NPAL3		8619474, 9110174	Standard	NM_020448		Approved	DJ462O23.2	uc001bjh.3	Q6P499	OTTHUMG00000003299	ENST00000374399.4:c.149C>T	1.37:g.24766717C>T	ENSP00000363520:p.Ala50Val		A2A298|Q6MZT9|Q9BVE6	Missense_Mutation	SNP	pfam_Mg_trans_NIPA	p.A50V	ENST00000374399.4	37	c.149	CCDS30631.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.128243	0.94473	.	.	ENSG00000001461	ENST00000374399;ENST00000358028;ENST00000339255;ENST00000428131	D;D;D;D	0.90385	-2.66;-2.66;-2.66;-2.66	5.09	5.09	0.68999	.	0.055193	0.64402	D	0.000001	D	0.95395	0.8505	M	0.81497	2.545	0.80722	D	1	D;D;D	0.71674	0.993;0.996;0.998	D;D;D	0.70487	0.91;0.916;0.969	D	0.95947	0.8951	10	0.87932	D	0	-13.87	18.4912	0.90848	0.0:1.0:0.0:0.0	.	50;50;50	Q6P499-3;Q6P499;A6NN97	.;NPAL3_HUMAN;.	V	50	ENSP00000363520:A50V;ENSP00000350722:A50V;ENSP00000343549:A50V;ENSP00000406509:A50V	ENSP00000343549:A50V	A	+	2	0	NIPAL3	24639304	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	6.387000	0.73191	2.369000	0.80426	0.655000	0.94253	GCA	NIPAL3	-	pfam_Mg_trans_NIPA	ENSG00000001461		0.532	NIPAL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPAL3	HGNC	protein_coding	OTTHUMT00000276996.1	-	0.00	30	0	C	NM_020448		24766717	+1	tier1	-	no_errors	ENST00000374399	ensembl	human	known	74_37	missense	13.46	45	7	SNP	0.999	T
NLRP1	22861	genome.wustl.edu	37	17	5433952	5433952	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:5433952C>T	ENST00000572272.1	-	12	3368	c.3369G>A	c.(3367-3369)gtG>gtA	p.V1123V	NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000354411.3_Silent_p.V1093V|NLRP1_ENST00000262467.5_Silent_p.V1127V|NLRP1_ENST00000345221.3_Silent_p.V1123V|NLRP1_ENST00000269280.4_Silent_p.V1123V|NLRP1_ENST00000577119.1_Silent_p.V1093V			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	1123					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				TCTCAACGGTCACCGCTTCTC	0.567																																																	0													90.0	83.0	85.0					17																	5433952		2203	4300	6503	SO:0001819	synonymous_variant	0			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.3369G>A	17.37:g.5433952C>T			E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Silent	SNP	pfam_CARD,pfam_DAPIN,pfam_Leu-rich_rpt,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD,pfscan_DAPIN,prints_Disease_R	p.V1123	ENST00000572272.1	37	c.3369	CCDS42246.1	17																																																																																			NLRP1	-	NULL	ENSG00000091592		0.567	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP1	HGNC	protein_coding	OTTHUMT00000439517.1		0.00	28	0	C	NM_033004		5433952	-1			no_errors	ENST00000572272	ensembl	human	known	74_37	silent	11.76	30	4	SNP	0.358	T
NLK	51701	genome.wustl.edu	37	17	26512224	26512224	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:26512224A>G	ENST00000407008.3	+	8	1887	c.1169A>G	c.(1168-1170)tAt>tGt	p.Y390C		NM_016231.4	NP_057315.3	Q9UBE8	NLK_HUMAN	nemo-like kinase	390	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Sufficient for interaction with DAPK3.				intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of Wnt signaling pathway (GO:0030178)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|serine phosphorylation of STAT3 protein (GO:0033136)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase activity (GO:0004707)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|SH2 domain binding (GO:0042169)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(1)	14	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		CCTGTACTCTATACCCTGTCT	0.338																																																	0													73.0	61.0	65.0					17																	26512224		2203	4300	6503	SO:0001583	missense	0			AF197898	CCDS11224.2	17q11.2	2005-12-22	2005-12-22		ENSG00000087095	ENSG00000087095			29858	protein-coding gene	gene with protein product		609476	"""nemo like kinase"""			9448268, 10863097	Standard	NM_016231		Approved		uc010crj.3	Q9UBE8	OTTHUMG00000132451	ENST00000407008.3:c.1169A>G	17.37:g.26512224A>G	ENSP00000384625:p.Tyr390Cys		B2RCX1|Q2PNI9|Q6P2A3	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Y390C	ENST00000407008.3	37	c.1169	CCDS11224.2	17	.	.	.	.	.	.	.	.	.	.	A	18.19	3.568044	0.65651	.	.	ENSG00000087095	ENST00000407008	T	0.44881	0.91	5.93	4.86	0.63082	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.58409	0.2120	L	0.58302	1.8	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.58951	-0.7545	10	0.56958	D	0.05	-15.1507	11.2557	0.49052	0.9292:0.0:0.0708:0.0	.	390	Q9UBE8	NLK_HUMAN	C	390	ENSP00000384625:Y390C	ENSP00000384625:Y390C	Y	+	2	0	NLK	23536351	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.730000	0.91510	1.082000	0.41137	-0.256000	0.11100	TAT	NLK	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000087095		0.338	NLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLK	HGNC	protein_coding	OTTHUMT00000255607.3	-	0.00	29	0	A	NM_016231		26512224	+1	tier1	-	no_errors	ENST00000407008	ensembl	human	known	74_37	missense	23.53	13	4	SNP	1.000	G
NLRP5	126206	genome.wustl.edu	37	19	56515193	56515193	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:56515193C>T	ENST00000390649.3	+	2	174	c.174C>T	c.(172-174)ctC>ctT	p.L58L		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	58	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		ACAAATCGCTCACCTTTTCCA	0.423																																																	0													120.0	112.0	115.0					19																	56515193		1866	4110	5976	SO:0001819	synonymous_variant	0			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.174C>T	19.37:g.56515193C>T			A8MTY4|Q86W29	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L58	ENST00000390649.3	37	c.174	CCDS12938.1	19																																																																																			NLRP5	-	superfamily_DEATH-like_dom	ENSG00000171487		0.423	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP5	HGNC	protein_coding	OTTHUMT00000313735.1	-	0.00	45	0	C	NM_153447		56515193	+1	tier1	-	no_errors	ENST00000390649	ensembl	human	known	74_37	silent	17.95	32	7	SNP	0.002	T
NLRX1	79671	genome.wustl.edu	37	11	119050456	119050456	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:119050456C>T	ENST00000409109.1	+	7	2313	c.1726C>T	c.(1726-1728)Cag>Tag	p.Q576*	NLRX1_ENST00000409991.1_Nonsense_Mutation_p.Q576*|NLRX1_ENST00000525863.1_Nonsense_Mutation_p.Q576*|NLRX1_ENST00000292199.2_Nonsense_Mutation_p.Q576*|NLRX1_ENST00000409265.4_Nonsense_Mutation_p.Q576*	NM_001282144.1	NP_001269073.1	Q86UT6	NLRX1_HUMAN	NLR family member X1	576	Required for the repression of MAVS- induced interferon signaling.				innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|viral process (GO:0016032)	mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)			cervix(1)|endometrium(2)|kidney(2)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	22	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		GGCGGTGGCTCAGGCCATGGT	0.602																																																	0													107.0	111.0	110.0					11																	119050456		2200	4295	6495	SO:0001587	stop_gained	0			AB094095	CCDS8416.1	11q23.3	2007-02-07			ENSG00000160703	ENSG00000160703		"""Nucleotide-binding domain and leucine rich repeat containing"""	29890	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat containing X1"", ""NOD-like receptor X1"", ""NLR family, X1"""	611947				12766759	Standard	XM_005271669		Approved	NOD9, CLR11.3	uc001pvw.3	Q86UT6	OTTHUMG00000154476	ENST00000409109.1:c.1726C>T	11.37:g.119050456C>T	ENSP00000387334:p.Gln576*		A8K6Q1|B3KPK2|B3KTA2|Q7RTR3|Q96D51|Q9H724	Nonsense_Mutation	SNP	superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.Q576*	ENST00000409109.1	37	c.1726	CCDS8416.1	11	.	.	.	.	.	.	.	.	.	.	C	41	9.080606	0.99059	.	.	ENSG00000160703	ENST00000409991;ENST00000292199;ENST00000409265;ENST00000409109;ENST00000525863	.	.	.	5.33	5.33	0.75918	.	0.275034	0.32041	N	0.006670	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	14.715	0.69259	0.1454:0.8546:0.0:0.0	.	.	.	.	X	576	.	ENSP00000292199:Q576X	Q	+	1	0	NLRX1	118555666	1.000000	0.71417	1.000000	0.80357	0.658000	0.38924	3.578000	0.53892	2.503000	0.84419	0.561000	0.74099	CAG	NLRX1	-	NULL	ENSG00000160703		0.602	NLRX1-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NLRX1	HGNC	protein_coding	OTTHUMT00000335403.1	-	0.00	94	0	C	NM_170722		119050456	+1	tier1	-	no_errors	ENST00000292199	ensembl	human	known	74_37	nonsense	9.78	83	9	SNP	1.000	T
NOXRED1	122945	genome.wustl.edu	37	14	77872265	77872265	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:77872265G>A	ENST00000380835.2	-	5	1062	c.896C>T	c.(895-897)tCt>tTt	p.S299F		NM_001113475.2	NP_001106946.1	Q6NXP6	NXRD1_HUMAN	NADP-dependent oxidoreductase domain containing 1	299					proline biosynthetic process (GO:0006561)		pyrroline-5-carboxylate reductase activity (GO:0004735)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	9						CCTTTCCTGAGACAAATTCTT	0.408																																																	0													82.0	75.0	77.0					14																	77872265		1568	3582	5150	SO:0001583	missense	0			AK057371	CCDS45142.1	14q24.3	2011-09-30	2011-09-30	2011-09-30	ENSG00000165555	ENSG00000165555			20487	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 148"""	C14orf148			Standard	NM_001113475		Approved	FLJ32809	uc001xtr.3	Q6NXP6	OTTHUMG00000171554	ENST00000380835.2:c.896C>T	14.37:g.77872265G>A	ENSP00000370215:p.Ser299Phe		B3KQ47|O95435	Missense_Mutation	SNP	NULL	p.S299F	ENST00000380835.2	37	c.896	CCDS45142.1	14	.	.	.	.	.	.	.	.	.	.	G	13.11	2.139017	0.37728	.	.	ENSG00000165555	ENST00000380835	T	0.56444	0.46	5.66	1.03	0.20045	.	1.061700	0.07305	N	0.874768	T	0.40719	0.1128	L	0.43152	1.355	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.35475	-0.9787	10	0.46703	T	0.11	0.041	2.7178	0.05192	0.1035:0.1465:0.4516:0.2983	.	299	Q6NXP6	NXRD1_HUMAN	F	299	ENSP00000370215:S299F	ENSP00000370215:S299F	S	-	2	0	C14orf148	76942018	0.000000	0.05858	0.010000	0.14722	0.551000	0.35334	0.326000	0.19646	0.570000	0.29347	0.460000	0.39030	TCT	NOXRED1	-	NULL	ENSG00000165555		0.408	NOXRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOXRED1	HGNC	protein_coding	OTTHUMT00000414103.1	-	0.00	28	0	G	NM_138791		77872265	-1	tier1	-	no_errors	ENST00000380835	ensembl	human	known	74_37	missense	36.11	23	13	SNP	0.000	A
NPEPPS	9520	genome.wustl.edu	37	17	45669307	45669307	+	Intron	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:45669307C>G	ENST00000322157.4	+	11	1497				NPEPPS_ENST00000525037.1_Intron|NPEPPS_ENST00000544660.1_Intron|NPEPPS_ENST00000530173.1_Intron	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive						antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						AACCCTGAATCACACTGTCTG	0.413																																																	0													155.0	97.0	116.0					17																	45669307		2068	4187	6255	SO:0001627	intron_variant	0			Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.1261-15C>G	17.37:g.45669307C>G			B7Z463|Q6P145|Q9NP16|Q9UEM2	Nonsense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.S116*	ENST00000322157.4	37	c.347	CCDS45721.1	17																																																																																			NPEPPS	-	NULL	ENSG00000141279		0.413	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPEPPS	HGNC	protein_coding	OTTHUMT00000384269.1	-	0.00	138	0	C	NM_006310		45669307	+1	tier1	-	no_errors	ENST00000530514	ensembl	human	known	74_37	nonsense	5.77	147	9	SNP	0.979	G
NPHP4	261734	genome.wustl.edu	37	1	5947473	5947473	+	Silent	SNP	G	G	A	rs371647995		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:5947473G>A	ENST00000378156.4	-	18	2623	c.2358C>T	c.(2356-2358)gtC>gtT	p.V786V	NPHP4_ENST00000478423.2_5'UTR	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	786					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		CAGTTGCCACGACCTCAAGCT	0.642																																																	0								G		0,4146		0,0,2073	50.0	59.0	56.0		2358	-10.9	0.0	1		56	2,8424		0,2,4211	no	coding-synonymous	NPHP4	NM_015102.3		0,2,6284	AA,AG,GG		0.0237,0.0,0.0159		786/1427	5947473	2,12570	2073	4213	6286	SO:0001819	synonymous_variant	0			AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.2358C>T	1.37:g.5947473G>A			Q8IWC0	Silent	SNP	NULL	p.V786	ENST00000378156.4	37	c.2358	CCDS44052.1	1																																																																																			NPHP4	-	NULL	ENSG00000131697		0.642	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	NPHP4	HGNC	protein_coding	OTTHUMT00000001715.2	-	0.00	106	0	G			5947473	-1	tier1	-	no_errors	ENST00000378156	ensembl	human	known	74_37	silent	23.23	119	36	SNP	0.010	A
NTN3	4917	genome.wustl.edu	37	16	2522730	2522730	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:2522730C>T	ENST00000293973.1	+	2	1160	c.957C>T	c.(955-957)cgC>cgT	p.R319R	TBC1D24_ENST00000567020.1_5'Flank|TBC1D24_ENST00000293970.5_5'Flank	NM_006181.2	NP_006172.1	O00634	NET3_HUMAN	netrin 3	319	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(2)|lung(3)|prostate(1)	7						ATGCCCGCCGCTGCCGCTTCA	0.682																																																	0													44.0	52.0	50.0					16																	2522730		2151	4230	6381	SO:0001819	synonymous_variant	0			U86759	CCDS10469.1	16p13.3	2013-03-01	2008-10-29	2008-10-29	ENSG00000162068	ENSG00000162068		"""Netrins"""	8030	protein-coding gene	gene with protein product	"""Netrin-3"""	602349	"""netrin 2 (chicken)-like"", ""netrin 2-like (chicken)"""	NTN2L		9143507, 10366627	Standard	NM_006181		Approved		uc002cqj.3	O00634	OTTHUMG00000128867	ENST00000293973.1:c.957C>T	16.37:g.2522730C>T				Silent	SNP	pfam_EGF_laminin,pfam_Laminin_N,pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,smart_Laminin_N,smart_EGF_laminin,smart_Netrin_module_non-TIMP,pfscan_EGF_laminin,pfscan_Laminin_N,pfscan_Netrin_domain	p.R319	ENST00000293973.1	37	c.957	CCDS10469.1	16																																																																																			NTN3	-	pfam_EGF_laminin,smart_EGF_laminin	ENSG00000162068		0.682	NTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTN3	HGNC	protein_coding	OTTHUMT00000250812.1		0.00	14	0	C	NM_006181		2522730	+1			no_errors	ENST00000293973	ensembl	human	known	74_37	silent	17.65	14	3	SNP	1.000	T
NPIPB15	440348	genome.wustl.edu	37	16	74425817	74425817	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:74425817G>C	ENST00000429990.1	+	7	1267	c.1171G>C	c.(1171-1173)Gag>Cag	p.E391Q				A6NHN6	NPB15_HUMAN	nuclear pore complex interacting protein family, member B15	391						extracellular region (GO:0005576)											GAGGCAGAgggaggccgaggc	0.557																																																	0													10.0	12.0	11.0					16																	74425817		1869	4047	5916	SO:0001583	missense	0			BC160029		16q22.3	2013-06-11	2013-06-11	2013-06-11	ENSG00000196436	ENSG00000196436			34409	protein-coding gene	gene with protein product			"""nuclear pore complex interacting protein-like 2"""	NPIPL2			Standard	XM_005256273		Approved	LOC440348	uc010vmt.1	A6NHN6	OTTHUMG00000156916	ENST00000429990.1:c.1171G>C	16.37:g.74425817G>C	ENSP00000411140:p.Glu391Gln		C9J9U8	Missense_Mutation	SNP	NULL	p.E391Q	ENST00000429990.1	37	c.1171		16	.	.	.	.	.	.	.	.	.	.	-	5.599	0.295296	0.10622	.	.	ENSG00000196436	ENST00000504746;ENST00000429990	T	0.47177	0.85	.	.	.	.	.	.	.	.	T	0.18257	0.0438	N	0.08118	0	0.19575	N	0.999968	P	0.37233	0.588	B	0.26202	0.067	T	0.13150	-1.0520	7	0.19590	T	0.45	.	.	.	.	.	330	A6NHN6	NPPL2_HUMAN	Q	255;391	ENSP00000411140:E391Q	ENSP00000411140:E391Q	E	+	1	0	NPIPL2	72983318	.	.	0.000000	0.03702	0.000000	0.00434	.	.	0.000000	0.14550	0.000000	0.15137	GAG	NPIPB15	-	NULL	ENSG00000196436		0.557	NPIPB15-001	KNOWN	basic|appris_principal	protein_coding	NPIPB15	HGNC	protein_coding	OTTHUMT00000346597.2	-	0.00	153	0	G	NM_001018059		74425817	+1	tier1	-	no_errors	ENST00000429990	ensembl	human	known	74_37	missense	5.19	201	11	SNP	0.994	C
NUP188	23511	genome.wustl.edu	37	9	131748958	131748958	+	Splice_Site	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr9:131748958G>T	ENST00000372577.2	+	21	2218		c.e21+1			NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						GAACAGATTGGTAAGGACAGC	0.502																																																	0													150.0	139.0	142.0					9																	131748958		2203	4300	6503	SO:0001630	splice_region_variant	0			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.2197+1G>T	9.37:g.131748958G>T			Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Splice_Site	SNP	-	e21+1	ENST00000372577.2	37	c.2197+1	CCDS35156.1	9	.	.	.	.	.	.	.	.	.	.	G	22.1	4.239860	0.79912	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2117	0.89872	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NUP188	130788779	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.182000	0.94881	2.611000	0.88343	0.491000	0.48974	.	NUP188	-	-	ENSG00000095319		0.502	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP188	HGNC	protein_coding	OTTHUMT00000054529.2		0.00	76	0	G		Intron	131748958	+1			no_errors	ENST00000372577	ensembl	human	known	74_37	splice_site	5.80	64	4	SNP	1.000	T
NTNG2	84628	genome.wustl.edu	37	9	135073473	135073473	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr9:135073473T>C	ENST00000393229.3	+	3	1110	c.334T>C	c.(334-336)Tgg>Cgg	p.W112R	NTNG2_ENST00000360670.3_Missense_Mutation_p.W112R|NTNG2_ENST00000372179.3_Missense_Mutation_p.W112R|NTNG2_ENST00000393228.4_Missense_Mutation_p.W112R	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	112	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)				central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		GAGCATCACCTGGAGCCGCTA	0.642																																																	0													73.0	66.0	68.0					9																	135073473		2203	4300	6503	SO:0001583	missense	0			AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.334T>C	9.37:g.135073473T>C	ENSP00000376921:p.Trp112Arg		Q5JUJ2|Q6UXY0|Q96JH0	Missense_Mutation	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_EGF_extracell,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_N	p.W112R	ENST00000393229.3	37	c.334	CCDS6946.1	9	.	.	.	.	.	.	.	.	.	.	T	20.6	4.016695	0.75161	.	.	ENSG00000196358	ENST00000393229;ENST00000393228;ENST00000360670;ENST00000372179	T;D;D;T	0.86769	-0.12;-2.17;-2.17;-0.12	5.13	5.13	0.70059	Laminin, N-terminal (3);	0.000000	0.85682	D	0.000000	D	0.92512	0.7622	M	0.72118	2.19	0.53688	D	0.999974	D	0.89917	1.0	D	0.97110	1.0	D	0.93267	0.6648	10	0.72032	D	0.01	.	14.1188	0.65172	0.0:0.0:0.0:1.0	.	112	Q96CW9	NTNG2_HUMAN	R	112	ENSP00000376921:W112R;ENSP00000376920:W112R;ENSP00000353888:W112R;ENSP00000361252:W112R	ENSP00000353888:W112R	W	+	1	0	NTNG2	134063294	1.000000	0.71417	0.997000	0.53966	0.940000	0.58332	7.998000	0.88491	1.929000	0.55896	0.459000	0.35465	TGG	NTNG2	-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N	ENSG00000196358		0.642	NTNG2-001	KNOWN	basic|CCDS	protein_coding	NTNG2	HGNC	protein_coding	OTTHUMT00000054779.1	-	0.00	54	0	T	NM_032536		135073473	+1	tier1	-	no_errors	ENST00000360670	ensembl	human	known	74_37	missense	44.93	38	31	SNP	0.999	C
OLFM2	93145	genome.wustl.edu	37	19	9971454	9971454	+	Missense_Mutation	SNP	G	G	A	rs375695569		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:9971454G>A	ENST00000264833.4	-	2	265	c.80C>T	c.(79-81)cCa>cTa	p.P27L	OLFM2_ENST00000590841.1_5'Flank	NM_058164.2	NP_477512.1	O95897	NOE2_HUMAN	olfactomedin 2	27					protein secretion (GO:0009306)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular region (GO:0005576)|synapse (GO:0045202)				breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	31						GCCCTCTTCTGGGTTCTGGAA	0.627																																																	0													23.0	23.0	23.0					19																	9971454		2203	4300	6503	SO:0001583	missense	0			AF131839	CCDS12221.1	19p13.2	2008-07-03				ENSG00000105088			17189	protein-coding gene	gene with protein product	"""noelin 2"""						Standard	NM_058164		Approved	OlfC, NOE2	uc002mmp.3	O95897		ENST00000264833.4:c.80C>T	19.37:g.9971454G>A	ENSP00000264833:p.Pro27Leu		Q6IMJ3|Q96FC2	Missense_Mutation	SNP	pfam_Olfac-like,pfam_Noelin-1,superfamily_Quinonprotein_ADH-like_supfam,smart_Olfac-like,pfscan_Olfac-like	p.P27L	ENST00000264833.4	37	c.80	CCDS12221.1	19	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716477	0.89205	.	.	ENSG00000105088	ENST00000264833	T	0.48201	0.82	4.86	4.86	0.63082	.	0.077797	0.51477	N	0.000087	T	0.65471	0.2694	M	0.65975	2.015	0.80722	D	1	D	0.67145	0.996	D	0.70016	0.967	T	0.65228	-0.6219	9	.	.	.	.	15.5385	0.76021	0.0:0.0:1.0:0.0	.	27	O95897	NOE2_HUMAN	L	27	ENSP00000264833:P27L	.	P	-	2	0	OLFM2	9832454	1.000000	0.71417	0.979000	0.43373	0.910000	0.53928	7.475000	0.81041	2.528000	0.85240	0.655000	0.94253	CCA	OLFM2	-	pfam_Noelin-1	ENSG00000105088		0.627	OLFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFM2	HGNC	protein_coding	OTTHUMT00000451119.1		0.00	37	0	G			9971454	-1			no_errors	ENST00000264833	ensembl	human	known	74_37	missense	17.65	28	6	SNP	1.000	A
OLIG1	116448	genome.wustl.edu	37	21	34444476	34444476	+	3'UTR	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr21:34444476G>A	ENST00000382348.1	+	0	2027				AP000282.2_ENST00000420356.1_RNA|AP000282.2_ENST00000454622.1_RNA|OLIG1_ENST00000498799.1_3'UTR|OLIG1_ENST00000333063.5_3'UTR	NM_138983.2	NP_620450.2	Q8TAK6	OLIG1_HUMAN	oligodendrocyte transcription factor 1						neuron fate commitment (GO:0048663)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)	1						GCGGCCCGCAGGTCTTCCTTC	0.592																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AP000109	CCDS42920.1, CCDS42920.2	21q22.11	2013-05-21			ENSG00000184221	ENSG00000184221		"""Basic helix-loop-helix proteins"""	16983	protein-coding gene	gene with protein product	"""oligodendrocyte-specific bHLH transcription factor 1"", ""oligodendrocyte lineage transcription factor 1"", ""basic domain, helix-loop-helix protein, class B, 6"""	606385				11526205	Standard	NM_138983		Approved	BHLHB6, bHLHe21	uc002yqz.3	Q8TAK6	OTTHUMG00000065064	ENST00000382348.1:c.*1108G>A	21.37:g.34444476G>A			Q7RTS0	RNA	SNP	-	NULL	ENST00000382348.1	37	NULL	CCDS42920.2	21																																																																																			OLIG1	-	-	ENSG00000184221		0.592	OLIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLIG1	HGNC	protein_coding	OTTHUMT00000139730.1	-	0.00	75	0	G	NM_138983		34444476	+1	tier1	-	no_errors	ENST00000498799	ensembl	human	known	74_37	rna	33.90	39	20	SNP	0.000	A
OPTN	10133	genome.wustl.edu	37	10	13174166	13174166	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr10:13174166A>G	ENST00000378748.3	+	14	1863	c.1501A>G	c.(1501-1503)Aaa>Gaa	p.K501E	OPTN_ENST00000378747.3_Missense_Mutation_p.K501E|OPTN_ENST00000378752.3_Missense_Mutation_p.K495E|OPTN_ENST00000378764.2_Missense_Mutation_p.K495E|OPTN_ENST00000263036.5_Missense_Mutation_p.K501E|OPTN_ENST00000378757.2_Missense_Mutation_p.K501E	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	501	Interaction with HD.|Interaction with MYO6.				cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						AGTTCTGCTGAAAGAGAATGA	0.483																																																	0													113.0	109.0	110.0					10																	13174166		2203	4300	6503	SO:0001583	missense	0			AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.1501A>G	10.37:g.13174166A>G	ENSP00000368022:p.Lys501Glu		B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Missense_Mutation	SNP	pfam_NEMO_N	p.K501E	ENST00000378748.3	37	c.1501	CCDS7094.1	10	.	.	.	.	.	.	.	.	.	.	A	17.99	3.524051	0.64747	.	.	ENSG00000123240	ENST00000263036;ENST00000378764;ENST00000378757;ENST00000378752;ENST00000378748;ENST00000378747	D;D;D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28;-2.28;-2.28	6.17	6.17	0.99709	.	0.039861	0.85682	D	0.000000	D	0.87446	0.6179	M	0.64997	1.995	0.50632	D	0.999888	P;P	0.48589	0.912;0.857	P;B	0.47430	0.547;0.345	D	0.86963	0.2093	10	0.42905	T	0.14	-37.4418	11.7532	0.51859	0.853:0.147:0.0:0.0	.	495;501	Q96CV9-2;Q96CV9	.;OPTN_HUMAN	E	501;495;501;495;501;501	ENSP00000263036:K501E;ENSP00000368040:K495E;ENSP00000368032:K501E;ENSP00000368027:K495E;ENSP00000368022:K501E;ENSP00000368021:K501E	ENSP00000263036:K501E	K	+	1	0	OPTN	13214172	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	4.618000	0.61211	2.371000	0.80710	0.533000	0.62120	AAA	OPTN	-	NULL	ENSG00000123240		0.483	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OPTN	HGNC	protein_coding	OTTHUMT00000046834.1	-	0.00	39	0	A	NM_021980		13174166	+1	tier1	-	no_errors	ENST00000263036	ensembl	human	known	74_37	missense	13.21	46	7	SNP	1.000	G
OR10D3	26497	genome.wustl.edu	37	11	124056092	124056092	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:124056092T>C	ENST00000318666.6	+	1	170	c.116T>C	c.(115-117)cTa>cCa	p.L39P				Q8NH80	O10D3_HUMAN	olfactory receptor, family 10, subfamily D, member 3 (non-functional)	39						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										GCCTGCACTCTACTGGGAAAT	0.463																																																	0																																										SO:0001583	missense	0			X64983		11q24.2	2014-04-01	2010-06-25	2010-06-25	ENSG00000197309	ENSG00000197309		"""GPCR / Class A : Olfactory receptors"""	8168	other	unknown			"""olfactory receptor, family 10, subfamily D, member 3 pseudogene"""	OR10D3P		1370859	Standard	NG_004125		Approved	HTPCRX09	uc001pzv.2	Q8NH80	OTTHUMG00000165166	ENST00000318666.6:c.116T>C	11.37:g.124056092T>C	ENSP00000323895:p.Leu39Pro			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L39P	ENST00000318666.6	37	c.116		11	.	.	.	.	.	.	.	.	.	.	T	16.20	3.055639	0.55325	.	.	ENSG00000197309	ENST00000318666	T	0.00563	6.58	5.27	5.27	0.74061	.	0.207213	0.24132	N	0.041256	T	0.01092	0.0036	.	.	.	0.22581	N	0.998961	.	.	.	.	.	.	T	0.47971	-0.9075	7	0.87932	D	0	-6.9183	14.8431	0.70240	0.0:0.0:0.0:1.0	.	.	.	.	P	39	ENSP00000323895:L39P	ENSP00000323895:L39P	L	+	2	0	OR10D3	123561302	0.464000	0.25807	0.045000	0.18777	0.825000	0.46686	4.238000	0.58688	1.991000	0.58162	0.533000	0.62120	CTA	OR10D3	-	pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn	ENSG00000197309		0.463	OR10D3-001	KNOWN	basic|appris_principal	protein_coding	OR10D3	HGNC	protein_coding	OTTHUMT00000382394.2	-	0.00	120	0	T			124056092	+1	tier1	-	no_errors	ENST00000318666	ensembl	human	known	74_37	missense	25.42	88	30	SNP	0.022	C
OR11A1	26531	genome.wustl.edu	37	6	29394838	29394838	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:29394838C>T	ENST00000377149.1	-	5	1053	c.581G>A	c.(580-582)aGa>aAa	p.R194K	OR11A1_ENST00000377147.2_Missense_Mutation_p.R194K|OR11A1_ENST00000377148.1_Missense_Mutation_p.R194K|OR5V1_ENST00000377154.1_Intron			Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A, member 1	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|large_intestine(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	19						CTGAGCCACTCTGGGATCCGA	0.522																																																	0													50.0	49.0	50.0					6																	29394838		1509	2707	4216	SO:0001583	missense	0				CCDS34363.1	6p22.2-p21.31	2014-02-19	2002-02-28		ENSG00000204694	ENSG00000204694		"""GPCR / Class A : Olfactory receptors"""	8176	protein-coding gene	gene with protein product			"""olfactory receptor, family 11, subfamily A, member 2"""	OR11A2			Standard	XM_005249001		Approved	hs6M1-18	uc003nmg.3	Q9GZK7	OTTHUMG00000031225	ENST00000377149.1:c.581G>A	6.37:g.29394838C>T	ENSP00000366354:p.Arg194Lys		A2BF33|A6NFQ3|B0S7T2|Q5ST16|Q9GZK8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.R194K	ENST00000377149.1	37	c.581	CCDS34363.1	6	.	.	.	.	.	.	.	.	.	.	C	7.243	0.601574	0.13939	.	.	ENSG00000204694	ENST00000377148;ENST00000377149;ENST00000377147	T;T;T	0.00044	8.83;8.83;8.83	3.81	0.496	0.16896	GPCR, rhodopsin-like superfamily (1);	6.755040	0.00166	N	0.000004	T	0.00039	0.0001	N	0.05510	-0.035	0.09310	N	1	B	0.26708	0.157	B	0.29524	0.103	T	0.23547	-1.0185	10	0.54805	T	0.06	4.7122	2.2613	0.04068	0.2289:0.3695:0.0:0.4015	.	194	Q9GZK7	O11A1_HUMAN	K	194	ENSP00000366353:R194K;ENSP00000366354:R194K;ENSP00000366352:R194K	ENSP00000366352:R194K	R	-	2	0	OR11A1	29502817	0.000000	0.05858	0.494000	0.27515	0.273000	0.26683	-2.121000	0.01322	0.221000	0.20879	0.411000	0.27672	AGA	OR11A1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000204694		0.522	OR11A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OR11A1	HGNC	protein_coding	OTTHUMT00000193778.1	-	0.00	27	0	C			29394838	-1	tier1	-	no_errors	ENST00000377147	ensembl	human	known	74_37	missense	20.51	31	8	SNP	0.002	T
OR13C9	286362	genome.wustl.edu	37	9	107379583	107379583	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr9:107379583C>T	ENST00000259362.1	-	1	902	c.903G>A	c.(901-903)aaG>aaA	p.K301K		NM_001001956.1	NP_001001956.1	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C, member 9	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(9)|prostate(1)|skin(4)	22						CTTTCACATCCTTGTTTCTAA	0.378																																																	0													178.0	172.0	174.0					9																	107379583		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS35093.1	9q31.1	2013-09-24			ENSG00000136839	ENSG00000136839		"""GPCR / Class A : Olfactory receptors"""	15104	protein-coding gene	gene with protein product							Standard	NM_001001956		Approved		uc011lvr.2	Q8NGT0	OTTHUMG00000020416	ENST00000259362.1:c.903G>A	9.37:g.107379583C>T			Q6IFL2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K301	ENST00000259362.1	37	c.903	CCDS35093.1	9																																																																																			OR13C9	-	prints_GPCR_Rhodpsn	ENSG00000136839		0.378	OR13C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C9	HGNC	protein_coding	OTTHUMT00000053490.1	-	0.00	110	0	C			107379583	-1	tier1	-	no_errors	ENST00000259362	ensembl	human	known	74_37	silent	36.29	79	45	SNP	1.000	T
OR1S1	219959	genome.wustl.edu	37	11	57982698	57982698	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:57982698C>T	ENST00000309433.6	+	1	482	c.482C>T	c.(481-483)tCa>tTa	p.S161L		NM_001004458.1	NP_001004458.1	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S, member 1	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(24)|kidney(1)|large_intestine(1)|liver(1)|lung(10)|prostate(1)|skin(2)|stomach(3)|urinary_tract(3)	48		Breast(21;0.0589)				ACAGTCATCTCATGGTTCCTC	0.473																																																	0													219.0	204.0	209.0					11																	57982698		2201	4296	6497	SO:0001583	missense	0			BK004299	CCDS31546.1	11q12.1	2012-08-09			ENSG00000172774	ENSG00000172774		"""GPCR / Class A : Olfactory receptors"""	8227	protein-coding gene	gene with protein product							Standard	NM_001004458		Approved	OST034	uc010rkc.2	Q8NH92	OTTHUMG00000167463	ENST00000309433.6:c.482C>T	11.37:g.57982698C>T	ENSP00000311688:p.Ser161Leu		Q6IFG3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S161L	ENST00000309433.6	37	c.482	CCDS31546.1	11	.	.	.	.	.	.	.	.	.	.	C	6.511	0.462405	0.12342	.	.	ENSG00000172774	ENST00000309433	T	0.37752	1.18	3.45	1.25	0.21368	GPCR, rhodopsin-like superfamily (1);	0.483471	0.17547	N	0.170329	T	0.37758	0.1015	M	0.67517	2.055	0.09310	N	1	B	0.33841	0.428	B	0.39876	0.312	T	0.35151	-0.9800	10	0.72032	D	0.01	.	7.5727	0.27918	0.1742:0.4856:0.3401:0.0	.	161	Q8NH92	OR1S1_HUMAN	L	161	ENSP00000311688:S161L	ENSP00000311688:S161L	S	+	2	0	OR1S1	57739274	0.000000	0.05858	0.013000	0.15412	0.023000	0.10783	1.059000	0.30517	0.597000	0.29811	0.479000	0.44913	TCA	OR1S1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000172774		0.473	OR1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1S1	HGNC	protein_coding	OTTHUMT00000394705.1	-	0.00	66	0	C	NM_001004458		57982698	+1	tier1	-	no_errors	ENST00000309433	ensembl	human	known	74_37	missense	25.00	56	19	SNP	0.002	T
OR2T11	127077	genome.wustl.edu	37	1	248790179	248790179	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:248790179G>C	ENST00000330803.2	-	1	312	c.251C>G	c.(250-252)tCt>tGt	p.S84C		NM_001001964.1	NP_001001964.1	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T, member 11 (gene/pseudogene)	84						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(5)|lung(20)|skin(2)	28	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTTCTCTTTAGAAACCATGTC	0.502																																																	0													67.0	65.0	66.0					1																	248790179		2052	4233	6285	SO:0001583	missense	0			BK004476	CCDS31122.1	1q44	2013-10-10	2013-10-10		ENSG00000183130	ENSG00000183130		"""GPCR / Class A : Olfactory receptors"""	19574	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 11"""				Standard	NM_001001964		Approved	OR2T11Q	uc001ier.1	Q8NH01	OTTHUMG00000040384	ENST00000330803.2:c.251C>G	1.37:g.248790179G>C	ENSP00000328934:p.Ser84Cys		Q6IEY6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S84C	ENST00000330803.2	37	c.251	CCDS31122.1	1	.	.	.	.	.	.	.	.	.	.	.	6.644	0.487248	0.12641	.	.	ENSG00000183130	ENST00000330803	T	0.03035	4.07	4.62	2.64	0.31445	GPCR, rhodopsin-like superfamily (1);	0.165435	0.28977	N	0.013536	T	0.08088	0.0202	M	0.83223	2.63	0.09310	N	1	P	0.49783	0.928	P	0.48089	0.566	T	0.15122	-1.0448	10	0.39692	T	0.17	.	4.091	0.09970	0.1793:0.0:0.5106:0.3101	.	84	Q8NH01	O2T11_HUMAN	C	84	ENSP00000328934:S84C	ENSP00000328934:S84C	S	-	2	0	OR2T11	246856802	0.000000	0.05858	0.024000	0.17045	0.062000	0.15995	-0.662000	0.05305	1.134000	0.42165	0.655000	0.94253	TCT	OR2T11	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000183130		0.502	OR2T11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T11	HGNC	protein_coding	OTTHUMT00000097134.1	-	0.00	58	0	G	NM_001001964		248790179	-1	tier1	-	no_errors	ENST00000330803	ensembl	human	known	74_37	missense	22.58	70	21	SNP	0.088	C
OR56A1	120796	genome.wustl.edu	37	11	6048626	6048626	+	Silent	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:6048626G>T	ENST00000316650.5	-	1	345	c.309C>A	c.(307-309)gcC>gcA	p.A103A		NM_001001917.2	NP_001001917.2	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A, member 1	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(22)|ovary(2)	33		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGAGGAAGCAGGCAGGGAAGC	0.552																																																	0													111.0	97.0	102.0					11																	6048626		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065821	CCDS31405.1	11p15.4	2012-08-09			ENSG00000180934	ENSG00000180934		"""GPCR / Class A : Olfactory receptors"""	14781	protein-coding gene	gene with protein product							Standard	NM_001001917		Approved		uc010qzw.2	Q8NGH5	OTTHUMG00000165377	ENST00000316650.5:c.309C>A	11.37:g.6048626G>T			B2RNI2|Q6IFL0	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A103	ENST00000316650.5	37	c.309	CCDS31405.1	11																																																																																			OR56A1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000180934		0.552	OR56A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR56A1	HGNC	protein_coding	OTTHUMT00000383757.1	-	0.00	70	0	G	NM_001001917		6048626	-1	tier1	-	no_errors	ENST00000316650	ensembl	human	known	74_37	silent	22.62	65	19	SNP	0.498	T
OR4C13	283092	genome.wustl.edu	37	11	49974835	49974835	+	Missense_Mutation	SNP	G	G	C	rs182918611		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:49974835G>C	ENST00000555099.1	+	1	893	c.861G>C	c.(859-861)ttG>ttC	p.L287F		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	287						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						TCTACACCTTGAGGAATGCTC	0.373																																																	0													65.0	64.0	64.0					11																	49974835		2200	4296	6496	SO:0001583	missense	0			AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.861G>C	11.37:g.49974835G>C	ENSP00000452277:p.Leu287Phe		A6NJJ3|B9EH30|Q6IF48|Q96R68	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L287F	ENST00000555099.1	37	c.861	CCDS31495.1	11	.	.	.	.	.	.	.	.	.	.	.	0.035	-1.313875	0.01331	.	.	ENSG00000258817	ENST00000555099	T	0.39787	1.06	2.77	-4.2	0.03823	.	0.197919	0.24820	N	0.035326	T	0.26846	0.0657	L	0.53671	1.685	0.09310	N	1	B	0.28082	0.2	B	0.30782	0.12	T	0.13656	-1.0501	9	.	.	.	.	1.557	0.02586	0.2148:0.2862:0.3546:0.1444	.	287	Q8NGP0	OR4CD_HUMAN	F	287	ENSP00000452277:L287F	.	L	+	3	2	OR4C13	49931411	0.046000	0.20272	0.696000	0.30242	0.073000	0.16967	-0.922000	0.04004	-0.654000	0.05394	-1.238000	0.01547	TTG	OR4C13	-	prints_Olfact_rcpt,prints_GPCR_Rhodpsn	ENSG00000258817		0.373	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C13	HGNC	protein_coding	OTTHUMT00000391103.1	-	0.00	42	0	G	NM_001001955		49974835	+1	tier1	-	no_errors	ENST00000555099	ensembl	human	known	74_37	missense	30.51	41	18	SNP	0.041	C
OR6P1	128366	genome.wustl.edu	37	1	158533238	158533238	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:158533238G>A	ENST00000334632.1	-	1	156	c.157C>T	c.(157-159)Cca>Tca	p.P53S		NM_001160325.1	NP_001153797.1	Q8NGX9	OR6P1_HUMAN	olfactory receptor, family 6, subfamily P, member 1	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|lung(1)	6						TGAAGGCTTGGAGCAAGCCAT	0.468																																																	0													49.0	55.0	53.0					1																	158533238		692	1591	2283	SO:0001583	missense	0			BK004193	CCDS53391.1	1q23.1	2012-08-09			ENSG00000186440	ENSG00000186440		"""GPCR / Class A : Olfactory receptors"""	15036	protein-coding gene	gene with protein product							Standard	NM_001160325		Approved		uc010pim.2	Q8NGX9	OTTHUMG00000019633	ENST00000334632.1:c.157C>T	1.37:g.158533238G>A	ENSP00000334721:p.Pro53Ser		Q6IFR9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P53S	ENST00000334632.1	37	c.157	CCDS53391.1	1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.366070	0.00212	.	.	ENSG00000186440	ENST00000334632	T	0.03951	3.75	5.0	0.863	0.19062	GPCR, rhodopsin-like superfamily (1);	0.319633	0.22608	N	0.057871	T	0.00552	0.0018	N	0.05306	-0.075	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43180	-0.9407	10	0.08599	T	0.76	.	6.0909	0.19993	0.2409:0.1344:0.6247:0.0	.	53	Q8NGX9	OR6P1_HUMAN	S	53	ENSP00000334721:P53S	ENSP00000334721:P53S	P	-	1	0	OR6P1	156799862	0.000000	0.05858	0.078000	0.20375	0.002000	0.02628	-1.352000	0.02619	0.004000	0.14682	-0.282000	0.10007	CCA	OR6P1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000186440		0.468	OR6P1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6P1	HGNC	protein_coding	OTTHUMT00000051848.1	-	0.00	21	0	G			158533238	-1	tier1	-	no_errors	ENST00000334632	ensembl	human	known	74_37	missense	30.23	30	13	SNP	0.000	A
OR8H2	390151	genome.wustl.edu	37	11	55872714	55872714	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:55872714C>T	ENST00000313503.1	+	1	196	c.196C>T	c.(196-198)Cac>Tac	p.H66Y		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H66Y(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					TTTCCTTACTCACCTGTCATT	0.428										HNSCC(53;0.14)																																							1	Substitution - Missense(1)	lung(1)											232.0	218.0	223.0					11																	55872714		2201	4292	6493	SO:0001583	missense	0			AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.196C>T	11.37:g.55872714C>T	ENSP00000323982:p.His66Tyr		Q6IFC1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.H66Y	ENST00000313503.1	37	c.196	CCDS31518.1	11	.	.	.	.	.	.	.	.	.	.	c	12.47	1.946469	0.34377	.	.	ENSG00000181767	ENST00000313503	T	0.02974	4.09	3.58	2.54	0.30619	GPCR, rhodopsin-like superfamily (1);	0.228496	0.31519	N	0.007516	T	0.08626	0.0214	M	0.63428	1.95	0.09310	N	1	D	0.67145	0.996	D	0.65323	0.934	T	0.03112	-1.1071	10	0.87932	D	0	.	6.119	0.20142	0.2702:0.6231:0.0:0.1067	.	66	Q8N162	OR8H2_HUMAN	Y	66	ENSP00000323982:H66Y	ENSP00000323982:H66Y	H	+	1	0	OR8H2	55629290	0.000000	0.05858	0.894000	0.35097	0.612000	0.37316	-0.085000	0.11250	1.952000	0.56665	0.440000	0.28878	CAC	OR8H2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181767		0.428	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H2	HGNC	protein_coding	OTTHUMT00000391540.1	-	0.00	81	0	C	NM_001005200		55872714	+1	tier1	-	no_errors	ENST00000313503	ensembl	human	known	74_37	missense	15.73	75	14	SNP	0.000	T
OR8K5	219453	genome.wustl.edu	37	11	55927085	55927085	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:55927085C>A	ENST00000313447.1	-	1	708	c.709G>T	c.(709-711)Gct>Tct	p.A237S		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A237T(1)		large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				GTGGAGAAAGCCTTTTTCCTG	0.408																																																	1	Substitution - Missense(1)	lung(1)											85.0	80.0	82.0					11																	55927085		2201	4296	6497	SO:0001583	missense	0			BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.709G>T	11.37:g.55927085C>A	ENSP00000323853:p.Ala237Ser		Q6IFB5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A237S	ENST00000313447.1	37	c.709	CCDS31521.1	11	.	.	.	.	.	.	.	.	.	.	c	11.86	1.765018	0.31228	.	.	ENSG00000181752	ENST00000313447	T	0.00359	7.87	3.98	3.06	0.35304	GPCR, rhodopsin-like superfamily (1);	0.351885	0.24431	N	0.038600	T	0.00496	0.0016	M	0.93939	3.475	0.28586	N	0.909891	P	0.36768	0.569	B	0.35770	0.21	T	0.03587	-1.1022	10	0.87932	D	0	.	11.6173	0.51096	0.1805:0.8195:0.0:0.0	.	237	Q8NH50	OR8K5_HUMAN	S	237	ENSP00000323853:A237S	ENSP00000323853:A237S	A	-	1	0	OR8K5	55683661	0.994000	0.37717	0.954000	0.39281	0.155000	0.21991	3.064000	0.49986	1.019000	0.39547	-0.377000	0.06932	GCT	OR8K5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000181752		0.408	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K5	HGNC	protein_coding	OTTHUMT00000391543.1		0.00	29	0	C	NM_001004058		55927085	-1			no_errors	ENST00000313447	ensembl	human	known	74_37	missense	8.82	31	3	SNP	1.000	A
OS9	10956	genome.wustl.edu	37	12	58112103	58112103	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:58112103G>C	ENST00000315970.7	+	11	1350	c.1309G>C	c.(1309-1311)Gag>Cag	p.E437Q	OS9_ENST00000552285.1_Missense_Mutation_p.E437Q|OS9_ENST00000413095.2_Missense_Mutation_p.E231Q|OS9_ENST00000551035.1_Missense_Mutation_p.E405Q|RP11-571M6.7_ENST00000549477.1_RNA|OS9_ENST00000257966.8_Missense_Mutation_p.E438Q|OS9_ENST00000389146.6_Missense_Mutation_p.E437Q|OS9_ENST00000435406.2_Missense_Mutation_p.E385Q|OS9_ENST00000389142.5_Missense_Mutation_p.E437Q|OS9_ENST00000439210.2_Missense_Mutation_p.E378Q	NM_001017958.2|NM_006812.3	NP_001017958.1|NP_006803.1	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum lectin	437					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein retention in ER lumen (GO:0006621)|protein targeting (GO:0006605)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum lumen (GO:0005788)|Hrd1p ubiquitin ligase complex (GO:0000836)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	21	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			GGGAGAATTTGAGAAGGAACT	0.537																																																	0													218.0	191.0	200.0					12																	58112103		2203	4300	6503	SO:0001583	missense	0			AB002806	CCDS31843.1, CCDS31844.1, CCDS31845.1, CCDS31846.1, CCDS58246.1, CCDS58247.1, CCDS58248.1, CCDS58249.1	12q13	2009-08-26	2009-08-26						16994	protein-coding gene	gene with protein product	"""endoplasmic reticulum lectin 2"", ""erlectin 2"""	609677				8634085, 9498564, 19346256, 18264092	Standard	NM_006812		Approved	OS-9, ERLEC2	uc001spj.3	Q13438	OTTHUMG00000170284	ENST00000315970.7:c.1309G>C	12.37:g.58112103G>C	ENSP00000318165:p.Glu437Gln		A6NDD1|A6NFR7|A6NLB2|A8K5Q9|B4DE28|B4DPX1|B4E1I6|E7ENT8|E7EW91|F8VUH2|G3XA88|O00579|Q6IBL2|Q8IZ58|Q9BW99	Missense_Mutation	SNP	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom	p.E437Q	ENST00000315970.7	37	c.1309	CCDS31843.1	12	.	.	.	.	.	.	.	.	.	.	G	29.6	5.017802	0.93404	.	.	ENSG00000135506	ENST00000552285;ENST00000315970;ENST00000439210;ENST00000389146;ENST00000413095;ENST00000551035;ENST00000257966;ENST00000435406;ENST00000389142	T;T;T;T;T;T;T;T;T	0.54279	0.98;1.37;1.8;1.82;0.95;0.64;0.97;0.58;1.81	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.63295	0.2499	L	0.32530	0.975	0.53688	D	0.999977	D;D;D;D;D;D;D;D	0.89917	0.993;1.0;0.997;1.0;0.993;1.0;1.0;0.999	D;D;D;D;D;D;D;D	0.91635	0.968;0.997;0.994;0.999;0.968;0.998;0.998;0.993	T	0.56463	-0.7975	10	0.29301	T	0.29	.	18.4191	0.90582	0.0:0.0:1.0:0.0	.	378;405;231;438;437;437;437;437	E7EW91;F8VUH2;B4E321;G3XA88;E9PEY5;Q9BW99;A6NLB2;Q13438	.;.;.;.;.;.;.;OS9_HUMAN	Q	437;437;378;437;231;405;438;385;437	ENSP00000450010:E437Q;ENSP00000318165:E437Q;ENSP00000407360:E378Q;ENSP00000373798:E437Q;ENSP00000413112:E231Q;ENSP00000447866:E405Q;ENSP00000257966:E438Q;ENSP00000389632:E385Q;ENSP00000373794:E437Q	ENSP00000257966:E438Q	E	+	1	0	OS9	56398370	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.510000	0.73729	2.884000	0.98904	0.655000	0.94253	GAG	OS9	-	NULL	ENSG00000135506		0.537	OS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OS9	HGNC	protein_coding	OTTHUMT00000408344.1	-	0.00	32	0	G	NM_006812		58112103	+1	tier1	-	no_errors	ENST00000315970	ensembl	human	known	74_37	missense	25.81	23	8	SNP	1.000	C
OSR2	116039	genome.wustl.edu	37	8	99963845	99963845	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:99963845C>T	ENST00000297565.4	+	4	1351	c.855C>T	c.(853-855)agC>agT	p.S285S	OSR2_ENST00000435298.2_Missense_Mutation_p.A258V|OSR2_ENST00000522510.1_Silent_p.S285S|OSR2_ENST00000457907.2_Silent_p.S406S	NM_001142462.1	NP_001135934.1	Q8N2R0	OSR2_HUMAN	odd-skipped related transciption factor 2	285					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|chondrocyte differentiation (GO:0002062)|embryo development (GO:0009790)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|head development (GO:0060322)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|osteoblast proliferation (GO:0033687)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Breast(36;4.14e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.0136)			AGCCCTACAGCTGCGAGCAGT	0.522																																																	0													51.0	54.0	53.0					8																	99963845		2040	4192	6232	SO:0001819	synonymous_variant	0			AY038072	CCDS47901.1, CCDS47902.1, CCDS69520.1	8q22.2	2013-10-17	2013-10-17			ENSG00000164920		"""Zinc fingers, C2H2-type"""	15830	protein-coding gene	gene with protein product		611297	"""odd-skipped related 2 (Drosophila)"""				Standard	XM_005250779		Approved	FLJ90037	uc003yir.3	Q8N2R0		ENST00000297565.4:c.855C>T	8.37:g.99963845C>T			A8K626|B4E3B7|Q96AM6|Q96LB6|Q96LB7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A258V	ENST00000297565.4	37	c.773	CCDS47901.1	8	.	.	.	.	.	.	.	.	.	.	C	9.032	0.987624	0.18966	.	.	ENSG00000164920	ENST00000435298	T	0.05786	3.39	5.65	4.76	0.60689	.	.	.	.	.	T	0.04679	0.0127	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42766	-0.9432	7	.	.	.	-12.266	9.492	0.38965	0.144:0.7858:0.0:0.0702	.	258	Q8N2R0-2	.	V	258	ENSP00000402862:A258V	.	A	+	2	0	OSR2	100033021	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.691000	0.61738	1.595000	0.50050	0.655000	0.94253	GCT	OSR2	-	NULL	ENSG00000164920		0.522	OSR2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OSR2	HGNC	protein_coding	OTTHUMT00000379505.1	-	0.00	56	0	C	NM_053001		99963845	+1	tier1	-	no_errors	ENST00000435298	ensembl	human	known	74_37	missense	34.55	35	19	SNP	1.000	T
PARD3	56288	genome.wustl.edu	37	10	34626223	34626223	+	Nonsense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr10:34626223G>C	ENST00000374789.3	-	17	2874	c.2549C>G	c.(2548-2550)tCa>tGa	p.S850*	PARD3_ENST00000374773.1_Intron|PARD3_ENST00000466092.1_5'Flank|PARD3_ENST00000544292.1_Nonsense_Mutation_p.S564*|PARD3_ENST00000346874.4_Nonsense_Mutation_p.S850*|PARD3_ENST00000350537.4_Intron|PARD3_ENST00000340077.5_Nonsense_Mutation_p.S847*|PARD3_ENST00000374790.3_Nonsense_Mutation_p.S790*|PARD3_ENST00000545260.1_Intron|PARD3_ENST00000545693.1_Nonsense_Mutation_p.S834*|PARD3_ENST00000374776.1_Intron|PARD3_ENST00000374794.3_Nonsense_Mutation_p.S790*|PARD3_ENST00000374788.3_Nonsense_Mutation_p.S847*	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	850	Interacts with PRKCI and PRKCZ. {ECO:0000250}.				apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				CATGCTTTTTGATTTTCGTGT	0.353																																																	0													108.0	98.0	101.0					10																	34626223		2203	4300	6503	SO:0001587	stop_gained	0			AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.2549C>G	10.37:g.34626223G>C	ENSP00000363921:p.Ser850*		F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Nonsense_Mutation	SNP	pfam_DUF3534,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S850*	ENST00000374789.3	37	c.2549	CCDS7178.1	10	.	.	.	.	.	.	.	.	.	.	G	44	10.930267	0.99490	.	.	ENSG00000148498	ENST00000545693;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000374790;ENST00000340077;ENST00000544292	.	.	.	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	20.1237	0.97972	0.0:0.0:1.0:0.0	.	.	.	.	X	834;850;847;850;790;790;847;564	.	ENSP00000341844:S847X	S	-	2	0	PARD3	34666229	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.759000	0.94783	0.561000	0.74099	TCA	PARD3	-	NULL	ENSG00000148498		0.353	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARD3	HGNC	protein_coding	OTTHUMT00000047527.1	-	0.00	24	0	G	NM_019619		34626223	-1	tier1	-	no_errors	ENST00000374789	ensembl	human	known	74_37	nonsense	37.50	25	15	SNP	1.000	C
PARP8	79668	genome.wustl.edu	37	5	49963923	49963923	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:49963923C>G	ENST00000281631.5	+	2	268	c.110C>G	c.(109-111)tCc>tGc	p.S37C	PARP8_ENST00000514342.2_5'UTR|PARP8_ENST00000514067.2_Missense_Mutation_p.S37C|PARP8_ENST00000513738.1_Missense_Mutation_p.S37C|PARP8_ENST00000503750.2_Missense_Mutation_p.S37C|PARP8_ENST00000505697.2_Missense_Mutation_p.S37C|PARP8_ENST00000503665.1_Missense_Mutation_p.S37C|PARP8_ENST00000505554.1_Missense_Mutation_p.S16C|PARP8_ENST00000511363.2_3'UTR	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	37						intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				TACTCTGACTCCACCTTTACT	0.448																																																	0													155.0	148.0	150.0					5																	49963923		2203	4300	6503	SO:0001583	missense	0			AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.110C>G	5.37:g.49963923C>G	ENSP00000281631:p.Ser37Cys		Q3KRB7|Q6DHZ1|Q9H754	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.S37C	ENST00000281631.5	37	c.110	CCDS3954.1	5	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639589	0.67244	.	.	ENSG00000151883	ENST00000505697;ENST00000503750;ENST00000502524;ENST00000515175;ENST00000281631;ENST00000513738;ENST00000503665;ENST00000514067;ENST00000503046;ENST00000505554	.	.	.	5.51	4.62	0.57501	.	0.142264	0.47455	D	0.000238	T	0.43277	0.1240	N	0.08118	0	0.80722	D	1	D;D	0.58268	0.982;0.97	P;P	0.52909	0.713;0.52	T	0.38265	-0.9669	8	.	.	.	-7.9776	14.6267	0.68626	0.1466:0.8534:0.0:0.0	.	37;37	Q8N3A8-2;Q8N3A8	.;PARP8_HUMAN	C	37;37;37;37;37;37;37;37;37;16	.	.	S	+	2	0	PARP8	49999680	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.301000	0.72782	1.279000	0.44446	0.655000	0.94253	TCC	PARP8	-	NULL	ENSG00000151883		0.448	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP8	HGNC	protein_coding	OTTHUMT00000214035.3	-	0.00	229	0	C	NM_024615		49963923	+1	tier1	-	no_errors	ENST00000281631	ensembl	human	known	74_37	missense	32.53	253	122	SNP	1.000	G
PAX1	5075	genome.wustl.edu	37	20	21687102	21687102	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr20:21687102C>A	ENST00000398485.2	+	2	367	c.313C>A	c.(313-315)Ctg>Atg	p.L105M	PAX1_ENST00000460221.1_Intron|PAX1_ENST00000444366.2_Missense_Mutation_p.L81M	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	P15863	PAX1_HUMAN	paired box 1	105	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				bone morphogenesis (GO:0060349)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|parathyroid gland development (GO:0060017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sclerotome development (GO:0061056)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(21)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	38						GGTGAACCAGCTGGGCGGTGT	0.662																																																	0													35.0	40.0	38.0					20																	21687102		2203	4299	6502	SO:0001583	missense	0				CCDS13146.2, CCDS74709.1	20p11.22	2007-07-12	2007-07-12		ENSG00000125813	ENSG00000125813		"""Paired boxes"""	8615	protein-coding gene	gene with protein product		167411	"""paired box gene 1"""			1358810	Standard	NM_006192		Approved		uc002wsj.3	P15863	OTTHUMG00000032034	ENST00000398485.2:c.313C>A	20.37:g.21687102C>A	ENSP00000381499:p.Leu105Met		B4E0D6|Q642X9|Q6NTC0|Q9Y558	Missense_Mutation	SNP	pfam_Paired_dom,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom,prints_Paired_dom	p.L105M	ENST00000398485.2	37	c.313	CCDS13146.2	20	.	.	.	.	.	.	.	.	.	.	C	16.08	3.020506	0.54576	.	.	ENSG00000125813	ENST00000398485;ENST00000444366	D;D	0.99695	-6.43;-6.43	5.14	4.2	0.49525	Paired box protein, N-terminal (4);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.000000	0.64402	D	0.000004	D	0.99725	0.9893	M	0.93678	3.445	0.53005	D	0.999961	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.91635	0.988;0.999;0.998	D	0.97873	1.0287	10	0.87932	D	0	.	10.5391	0.45022	0.0:0.842:0.0:0.158	.	81;11;105	P15863-2;C9J775;P15863	.;.;PAX1_HUMAN	M	105;81	ENSP00000381499:L105M;ENSP00000410355:L81M	ENSP00000381499:L105M	L	+	1	2	PAX1	21635102	1.000000	0.71417	1.000000	0.80357	0.620000	0.37586	0.952000	0.29149	1.161000	0.42604	0.655000	0.94253	CTG	PAX1	-	pfam_Paired_dom,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom,prints_Paired_dom	ENSG00000125813		0.662	PAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAX1	HGNC	protein_coding	OTTHUMT00000078282.3	-	0.00	47	0	C			21687102	+1	tier1	-	no_errors	ENST00000398485	ensembl	human	known	74_37	missense	46.43	30	26	SNP	1.000	A
PBDC1	51260	genome.wustl.edu	37	X	75397537	75397537	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chrX:75397537G>A	ENST00000373358.3	+	6	699	c.496G>A	c.(496-498)Gaa>Aaa	p.E166K	PBDC1_ENST00000373357.3_Silent_p.K128K	NM_016500.3	NP_057584.2	Q9BVG4	PBDC1_HUMAN	polysaccharide biosynthesis domain containing 1	166																	TCAGGACAaagaaggagagaa	0.438																																																	0													94.0	85.0	88.0					X																	75397537		2203	4300	6503	SO:0001583	missense	0			BC001220	CCDS14432.1, CCDS75995.1	Xq13.2	2012-11-28	2012-11-28	2012-11-28	ENSG00000102390	ENSG00000102390			28790	protein-coding gene	gene with protein product			"""chromosome X open reading frame 26"""	CXorf26		11042152	Standard	NM_016500		Approved	MGC874	uc004ecl.1	Q9BVG4	OTTHUMG00000021876	ENST00000373358.3:c.496G>A	X.37:g.75397537G>A	ENSP00000362456:p.Glu166Lys			Missense_Mutation	SNP	pfam_Put_polysacc_synth	p.E166K	ENST00000373358.3	37	c.496	CCDS14432.1	X	.	.	.	.	.	.	.	.	.	.	G	8.030	0.761482	0.15914	.	.	ENSG00000102390	ENST00000373358	.	.	.	5.21	1.46	0.22682	.	0.485483	0.24645	N	0.036769	T	0.24275	0.0588	L	0.27053	0.805	0.24104	N	0.995865	B	0.06786	0.001	B	0.06405	0.002	T	0.15838	-1.0423	8	.	.	.	-19.5685	6.6733	0.23080	0.4088:0.0:0.5912:0.0	.	166	Q9BVG4	CX026_HUMAN	K	166	.	.	E	+	1	0	CXorf26	75313940	0.961000	0.32948	0.334000	0.25495	0.485000	0.33311	0.712000	0.25779	0.173000	0.19788	-0.213000	0.12676	GAA	PBDC1	-	NULL	ENSG00000102390		0.438	PBDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PBDC1	HGNC	protein_coding	OTTHUMT00000057294.1	-	0.00	9	0	G	NM_016500		75397537	+1	tier1	-	no_errors	ENST00000373358	ensembl	human	known	74_37	missense	48.15	14	13	SNP	0.000	A
PCDHAC1	56135	genome.wustl.edu	37	5	140307392	140307392	+	Silent	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:140307392C>G	ENST00000253807.2	+	1	915	c.915C>G	c.(913-915)ctC>ctG	p.L305L	PCDHA13_ENST00000289272.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHAC1_ENST00000409700.3_Silent_p.L305L|PCDHA13_ENST00000409494.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	305	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGAAACGCTCTTGGAGGCAT	0.557																																																	0													144.0	128.0	134.0					5																	140307392		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.915C>G	5.37:g.140307392C>G			Q9Y5F5|Q9Y5I5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L305	ENST00000253807.2	37	c.915	CCDS4241.1	5																																																																																			PCDHAC1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000248383		0.557	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHAC1	HGNC	protein_coding	OTTHUMT00000251798.1	-	0.00	31	0	C	NM_018898		140307392	+1	tier1	-	no_errors	ENST00000253807	ensembl	human	known	74_37	silent	35.48	20	11	SNP	0.001	G
PCDHB1	29930	genome.wustl.edu	37	5	140431922	140431922	+	Silent	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:140431922C>G	ENST00000306549.3	+	1	944	c.867C>G	c.(865-867)ctC>ctG	p.L289L		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	289	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAGCAATTCTCAAGACGTTTC	0.468																																																	0													68.0	69.0	68.0					5																	140431922		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.867C>G	5.37:g.140431922C>G			Q2M257	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L289	ENST00000306549.3	37	c.867	CCDS4243.1	5																																																																																			PCDHB1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000171815		0.468	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB1	HGNC	protein_coding	OTTHUMT00000251822.2	-	0.00	35	0	C	NM_013340		140431922	+1	tier1	-	no_errors	ENST00000306549	ensembl	human	known	74_37	silent	28.57	30	12	SNP	0.000	G
PDE4C	5143	genome.wustl.edu	37	19	18324249	18324249	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:18324249T>C	ENST00000355502.3	-	17	2408	c.1537A>G	c.(1537-1539)Acc>Gcc	p.T513A	PDE4C_ENST00000594465.3_Missense_Mutation_p.T513A|PDE4C_ENST00000597297.1_Missense_Mutation_p.T283A|PDE4C_ENST00000447275.3_Missense_Mutation_p.T407A|PDE4C_ENST00000598111.2_Missense_Mutation_p.T228A|PDE4C_ENST00000262805.12_Missense_Mutation_p.T481A|PDE4C_ENST00000539010.1_Missense_Mutation_p.T282A|AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000594617.3_Missense_Mutation_p.T513A			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	513					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	TCCACCATGGTCTTGAGGTCG	0.612																																																	0													151.0	119.0	130.0					19																	18324249		2203	4300	6503	SO:0001583	missense	0				CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.1537A>G	19.37:g.18324249T>C	ENSP00000347689:p.Thr513Ala		B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.T513A	ENST00000355502.3	37	c.1537	CCDS12373.1	19	.	.	.	.	.	.	.	.	.	.	T	18.16	3.561592	0.65538	.	.	ENSG00000105650	ENST00000536045;ENST00000355502;ENST00000536507;ENST00000262805;ENST00000447275;ENST00000545961;ENST00000336173;ENST00000539010;ENST00000543547	D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55	4.63	4.63	0.57726	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.87736	0.6252	L	0.49640	1.575	0.43230	D	0.995122	D;D;B;D	0.76494	0.992;0.997;0.106;0.999	D;D;B;D	0.91635	0.989;0.938;0.209;0.999	D	0.88637	0.3173	10	0.87932	D	0	.	12.0009	0.53230	0.0:0.0:0.0:1.0	.	513;481;319;228	Q08493;Q08493-3;O43850;O76104	PDE4C_HUMAN;.;.;.	A	592;513;501;481;407;319;227;282;622	ENSP00000347689:T513A;ENSP00000262805:T481A;ENSP00000402091:T407A;ENSP00000439470:T282A	ENSP00000262805:T481A	T	-	1	0	PDE4C	18185249	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.745000	0.85046	1.732000	0.51606	0.454000	0.30748	ACC	PDE4C	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	ENSG00000105650		0.612	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE4C	HGNC	protein_coding	OTTHUMT00000466295.1	-	0.00	110	0	T			18324249	-1	tier1	-	no_errors	ENST00000355502	ensembl	human	known	74_37	missense	5.15	92	5	SNP	1.000	C
PDIA4	9601	genome.wustl.edu	37	7	148701243	148701243	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:148701243G>A	ENST00000286091.4	-	10	1813	c.1581C>T	c.(1579-1581)gtC>gtT	p.V527V		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	527	Thioredoxin 3. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			CCACGACCTTGACGGGTCCCT	0.572																																																	0													166.0	151.0	157.0					7																	148701243		2203	4300	6503	SO:0001819	synonymous_variant	0			BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.1581C>T	7.37:g.148701243G>A			A8K4K6|Q549T6	Silent	SNP	pirsf_Protein_diS-isomerase_A4,pfam_Thioredoxin_domain,pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Thioredoxin,prints_Calsequestrin,tigrfam_Prot_disulphide_isomerase,tigrfam_Disulphide_isomerase	p.V527	ENST00000286091.4	37	c.1581	CCDS5893.1	7																																																																																			PDIA4	-	pirsf_Protein_diS-isomerase_A4,pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold,tigrfam_Prot_disulphide_isomerase	ENSG00000155660		0.572	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIA4	HGNC	protein_coding	OTTHUMT00000317077.1	-	0.00	94	0	G	NM_004911		148701243	-1	tier1	-	no_errors	ENST00000286091	ensembl	human	known	74_37	silent	15.32	94	17	SNP	0.960	A
PER1	5187	genome.wustl.edu	37	17	8045267	8045267	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:8045267C>T	ENST00000317276.4	-	22	3693	c.3456G>A	c.(3454-3456)atG>atA	p.M1152I	PER1_ENST00000578089.1_5'Flank|PER1_ENST00000581082.1_Missense_Mutation_p.M1129I	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	1152	CRY binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GCACAGAGGTCATGTCCCTGC	0.617			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																																Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	0													43.0	45.0	45.0					17																	8045267		2203	4300	6503	SO:0001583	missense	0			AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.3456G>A	17.37:g.8045267C>T	ENSP00000314420:p.Met1152Ile		B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,superfamily_PAS,smart_PAS,pfscan_PAS	p.M1152I	ENST00000317276.4	37	c.3456	CCDS11131.1	17	.	.	.	.	.	.	.	.	.	.	C	9.410	1.080249	0.20309	.	.	ENSG00000179094	ENST00000317276	T	0.12465	2.68	5.67	2.61	0.31194	Period circadian-like, C-terminal (1);	0.326011	0.35378	N	0.003260	T	0.04452	0.0122	N	0.03253	-0.375	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.12837	0.008;0.001	T	0.36138	-0.9760	10	0.10902	T	0.67	-3.2775	4.9866	0.14192	0.0:0.5915:0.1527:0.2558	.	1143;1152	A2I2P6;O15534	.;PER1_HUMAN	I	1152	ENSP00000314420:M1152I	ENSP00000314420:M1152I	M	-	3	0	PER1	7985992	0.551000	0.26497	0.989000	0.46669	0.948000	0.59901	0.632000	0.24583	0.342000	0.23796	0.655000	0.94253	ATG	PER1	-	pfam_Period_circadian-like_C	ENSG00000179094		0.617	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER1	HGNC	protein_coding	OTTHUMT00000441481.2	-	0.00	126	0	C			8045267	-1	tier1	-	no_errors	ENST00000317276	ensembl	human	known	74_37	missense	32.00	68	32	SNP	1.000	T
PGBD2	267002	genome.wustl.edu	37	1	249211564	249211564	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:249211564C>T	ENST00000329291.5	+	3	928	c.781C>T	c.(781-783)Ccc>Tcc	p.P261S	PGBD2_ENST00000462488.1_3'UTR|PGBD2_ENST00000539153.1_Missense_Mutation_p.P258S|PGBD2_ENST00000355360.4_Missense_Mutation_p.P10S	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	261										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GAAGCATGCACCCTTGGAAGA	0.502																																																	0													102.0	106.0	105.0					1																	249211564		2203	4300	6503	SO:0001583	missense	0			AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.781C>T	1.37:g.249211564C>T	ENSP00000331643:p.Pro261Ser		B3KVR8|Q6MZF8	Missense_Mutation	SNP	NULL	p.P261S	ENST00000329291.5	37	c.781	CCDS31128.1	1	.	.	.	.	.	.	.	.	.	.	C	16.82	3.227634	0.58668	.	.	ENSG00000185220	ENST00000355360;ENST00000329291;ENST00000539153	T;T;T	0.15487	2.42;2.42;2.42	3.76	2.84	0.33178	.	0.000000	0.36444	N	0.002594	T	0.27697	0.0681	L	0.60455	1.87	0.29330	N	0.866774	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.10428	-1.0630	10	0.07482	T	0.82	-31.2522	6.9707	0.24646	0.0:0.8729:0.0:0.1271	.	258;261	F5H4U7;Q6P3X8	.;PGBD2_HUMAN	S	10;261;258	ENSP00000355424:P10S;ENSP00000331643:P261S;ENSP00000439950:P258S	ENSP00000331643:P261S	P	+	1	0	PGBD2	247178187	0.020000	0.18652	0.990000	0.47175	0.986000	0.74619	1.479000	0.35453	0.920000	0.36970	0.563000	0.77884	CCC	PGBD2	-	NULL	ENSG00000185220		0.502	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PGBD2	HGNC	protein_coding	OTTHUMT00000097318.1	-	0.00	28	0	C			249211564	+1	tier1	-	no_errors	ENST00000329291	ensembl	human	known	74_37	missense	16.67	45	9	SNP	0.994	T
PGC	5225	genome.wustl.edu	37	6	41710116	41710116	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:41710116G>C	ENST00000373025.3	-	5	621	c.559C>G	c.(559-561)Ctg>Gtg	p.L187V	PGC_ENST00000425343.2_Missense_Mutation_p.L187V	NM_002630.3	NP_002621.1	P20142	PEPC_HUMAN	progastricsin (pepsinogen C)	187					digestion (GO:0007586)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|skin(1)	16	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			TCCACGGACAGAGCAGGGTAG	0.602																																																	0													132.0	95.0	107.0					6																	41710116		2203	4300	6503	SO:0001583	missense	0				CCDS4859.1, CCDS55000.1	6p21.1	2012-10-02			ENSG00000096088	ENSG00000096088	3.4.23.3		8890	protein-coding gene	gene with protein product		169740					Standard	NM_002630		Approved		uc003ora.2	P20142	OTTHUMG00000014683	ENST00000373025.3:c.559C>G	6.37:g.41710116G>C	ENSP00000362116:p.Leu187Val		B4DVZ3|Q5T3D7|Q5T3D8	Missense_Mutation	SNP	pfam_Aspartic_peptidase,pfam_Aspartic_peptidase_N,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase	p.L187V	ENST00000373025.3	37	c.559	CCDS4859.1	6	.	.	.	.	.	.	.	.	.	.	G	4.323	0.059301	0.08339	.	.	ENSG00000096088	ENST00000373025;ENST00000424183;ENST00000356667;ENST00000425343	T;T;T	0.60548	1.32;0.36;0.18	4.42	3.5	0.40072	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.339105	0.23834	N	0.044115	T	0.46308	0.1386	M	0.88842	2.985	0.09310	N	1	P	0.36144	0.539	B	0.30105	0.111	T	0.52741	-0.8535	10	0.72032	D	0.01	.	12.1793	0.54204	0.0:0.0:0.67:0.33	.	187	P20142	PEPC_HUMAN	V	187;108;108;187	ENSP00000362116:L187V;ENSP00000349094:L108V;ENSP00000405094:L187V	ENSP00000349094:L108V	L	-	1	2	PGC	41818094	0.091000	0.21658	0.227000	0.23927	0.004000	0.04260	0.304000	0.19228	2.287000	0.76781	0.561000	0.74099	CTG	PGC	-	pfam_Aspartic_peptidase,superfamily_Peptidase_aspartic_dom	ENSG00000096088		0.602	PGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGC	HGNC	protein_coding	OTTHUMT00000040521.2	-	0.00	35	0	G			41710116	-1	tier1	-	no_errors	ENST00000373025	ensembl	human	known	74_37	missense	41.30	27	19	SNP	0.037	C
PHLPP1	23239	genome.wustl.edu	37	18	60646373	60646373	+	Silent	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr18:60646373G>T	ENST00000262719.5	+	17	5097	c.4863G>T	c.(4861-4863)cgG>cgT	p.R1621R	PHLPP1_ENST00000400316.4_Silent_p.R1109R			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	1621					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						TTGGGCGCCGGAGGGCCAATG	0.597																																																	0													30.0	33.0	32.0					18																	60646373		1968	4149	6117	SO:0001819	synonymous_variant	0			AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.4863G>T	18.37:g.60646373G>T			A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Silent	SNP	pfam_PP2C-like_dom,pfam_Leu-rich_rpt,superfamily_PP2C-like_dom,smart_Leu-rich_rpt_typical-subtyp,smart_PP2C-like_dom,pfscan_Pleckstrin_homology	p.R1621	ENST00000262719.5	37	c.4863	CCDS45881.2	18																																																																																			PHLPP1	-	NULL	ENSG00000081913		0.597	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PHLPP1	HGNC	protein_coding	OTTHUMT00000319249.2	-	0.00	32	0	G	NM_194449		60646373	+1	tier1	-	no_errors	ENST00000262719	ensembl	human	known	74_37	silent	47.83	12	11	SNP	0.997	T
PJA2	9867	genome.wustl.edu	37	5	108714941	108714941	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:108714941C>T	ENST00000361189.2	-	4	486	c.247G>A	c.(247-249)Gat>Aat	p.D83N	PJA2_ENST00000361557.3_Missense_Mutation_p.D83N|PJA2_ENST00000511624.1_5'UTR	NM_014819.4	NP_055634.3	O43164	PJA2_HUMAN	praja ring finger 2, E3 ubiquitin protein ligase	83					long-term memory (GO:0007616)|protein ubiquitination (GO:0016567)|regulation of protein kinase A signaling (GO:0010738)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		TCAACTTGATCCAAAGGACTG	0.308																																																	0													35.0	37.0	36.0					5																	108714941		2202	4300	6502	SO:0001583	missense	0			AB007898	CCDS4099.1	5q22.1	2013-01-09	2012-02-23	2003-06-05	ENSG00000198961	ENSG00000198961		"""RING-type (C3HC4) zinc fingers"""	17481	protein-coding gene	gene with protein product			"""ring finger protein 131"", ""praja ring finger 2"""	RNF131			Standard	NM_014819		Approved	KIAA0438, Neurodap1	uc003kos.4	O43164	OTTHUMG00000128750	ENST00000361189.2:c.247G>A	5.37:g.108714941C>T	ENSP00000354775:p.Asp83Asn		A8K6U4|D3DSZ5|Q68D49|Q8N1G5	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.D83N	ENST00000361189.2	37	c.247	CCDS4099.1	5	.	.	.	.	.	.	.	.	.	.	C	18.00	3.526506	0.64860	.	.	ENSG00000198961	ENST00000361189;ENST00000361557	T;T	0.11821	2.74;2.74	6.16	6.16	0.99307	.	0.320106	0.30879	N	0.008697	T	0.11965	0.0291	L	0.43152	1.355	0.41541	D	0.988514	B	0.30824	0.296	B	0.19946	0.027	T	0.06844	-1.0804	10	0.05833	T	0.94	-30.9137	19.0404	0.92997	0.0:1.0:0.0:0.0	.	83	O43164	PJA2_HUMAN	N	83	ENSP00000354775:D83N;ENSP00000355284:D83N	ENSP00000354775:D83N	D	-	1	0	PJA2	108742840	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.433000	0.44793	2.937000	0.99478	0.650000	0.86243	GAT	PJA2	-	NULL	ENSG00000198961		0.308	PJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PJA2	HGNC	protein_coding	OTTHUMT00000250663.1	-	0.00	30	0	C	NM_014819		108714941	-1	tier1	-	no_errors	ENST00000361189	ensembl	human	known	74_37	missense	40.00	18	12	SNP	1.000	T
PKHD1L1	93035	genome.wustl.edu	37	8	110374853	110374853	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:110374853T>A	ENST00000378402.5	+	1	148	c.44T>A	c.(43-45)cTg>cAg	p.L15Q		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	15					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CTCTGTGGGCTGCTCCTGTGT	0.642										HNSCC(38;0.096)																																							0													40.0	46.0	44.0					8																	110374853		1930	4151	6081	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.44T>A	8.37:g.110374853T>A	ENSP00000367655:p.Leu15Gln		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.L15Q	ENST00000378402.5	37	c.44	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	T	14.14	2.446747	0.43429	.	.	ENSG00000205038	ENST00000378402	D	0.87966	-2.32	3.93	3.93	0.45458	.	0.161726	0.26193	N	0.025781	D	0.87111	0.6096	N	0.24115	0.695	0.33424	D	0.580255	D	0.71674	0.998	D	0.79784	0.993	D	0.89399	0.3694	10	0.87932	D	0	.	9.3337	0.38038	0.0:0.0:0.0:1.0	.	15	Q86WI1	PKHL1_HUMAN	Q	15	ENSP00000367655:L15Q	ENSP00000367655:L15Q	L	+	2	0	PKHD1L1	110444029	1.000000	0.71417	0.949000	0.38748	0.047000	0.14425	3.203000	0.51075	1.792000	0.52537	0.254000	0.18369	CTG	PKHD1L1	-	NULL	ENSG00000205038		0.642	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	81	0	T	NM_177531		110374853	+1	tier1	-	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	27.18	75	28	SNP	0.976	A
PKHD1L1	93035	genome.wustl.edu	37	8	110408258	110408258	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:110408258G>C	ENST00000378402.5	+	11	918	c.814G>C	c.(814-816)Gtc>Ctc	p.V272L		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	272	IPT/TIG 3.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TCCCCCAGAGGTCACCATGAT	0.393										HNSCC(38;0.096)																																							0													56.0	48.0	51.0					8																	110408258		1967	4167	6134	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.814G>C	8.37:g.110408258G>C	ENSP00000367655:p.Val272Leu		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.V272L	ENST00000378402.5	37	c.814	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	9.648	1.140823	0.21205	.	.	ENSG00000205038	ENST00000378402	T	0.75704	-0.96	5.8	0.864	0.19068	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.321129	0.28151	N	0.016419	T	0.63850	0.2546	L	0.46885	1.475	0.35057	D	0.76117	B	0.14805	0.011	B	0.17979	0.02	T	0.59241	-0.7491	10	0.44086	T	0.13	.	8.8155	0.34993	0.4934:0.0:0.5066:0.0	.	272	Q86WI1	PKHL1_HUMAN	L	272	ENSP00000367655:V272L	ENSP00000367655:V272L	V	+	1	0	PKHD1L1	110477434	1.000000	0.71417	0.758000	0.31321	0.032000	0.12392	0.929000	0.28844	-0.117000	0.11872	-0.792000	0.03331	GTC	PKHD1L1	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT	ENSG00000205038		0.393	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	53	0	G	NM_177531		110408258	+1	tier1	-	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	30.43	32	14	SNP	1.000	C
PKP2	5318	genome.wustl.edu	37	12	32975511	32975511	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:32975511C>G	ENST00000070846.6	-	9	1885	c.1861G>C	c.(1861-1863)Gag>Cag	p.E621Q	PKP2_ENST00000340811.4_Missense_Mutation_p.E577Q	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	621					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)	p.E621K(1)		NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					TCTGGGAGCTCTGCCTCCAGC	0.413																																																	1	Substitution - Missense(1)	kidney(1)											96.0	94.0	95.0					12																	32975511		2203	4300	6503	SO:0001583	missense	0			X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.1861G>C	12.37:g.32975511C>G	ENSP00000070846:p.Glu621Gln		A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.E621Q	ENST00000070846.6	37	c.1861	CCDS8731.1	12	.	.	.	.	.	.	.	.	.	.	C	15.53	2.861864	0.51482	.	.	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	D;D	0.84070	-1.8;-1.8	5.05	5.05	0.67936	Armadillo-like helical (1);Armadillo-type fold (1);	0.057793	0.64402	D	0.000002	D	0.83008	0.5161	M	0.77103	2.36	0.46131	D	0.998888	B;B;P	0.34955	0.288;0.19;0.477	B;B;B	0.31390	0.129;0.061;0.091	D	0.85073	0.0941	10	0.62326	D	0.03	0.2032	16.6153	0.84909	0.0:1.0:0.0:0.0	.	577;577;621	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	Q	577;621;621	ENSP00000342800:E577Q;ENSP00000070846:E621Q	ENSP00000070846:E621Q	E	-	1	0	PKP2	32866778	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.669000	0.61575	2.328000	0.79073	0.563000	0.77884	GAG	PKP2	-	superfamily_ARM-type_fold	ENSG00000057294		0.413	PKP2-002	KNOWN	basic|CCDS	protein_coding	PKP2	HGNC	protein_coding	OTTHUMT00000404449.1		0.00	45	0	C	NM_004572		32975511	-1			no_errors	ENST00000070846	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	G
PLAC9	219348	genome.wustl.edu	37	10	81904016	81904016	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr10:81904016T>C	ENST00000372263.3	+	3	242	c.200T>C	c.(199-201)gTg>gCg	p.V67A	PLAC9_ENST00000372267.2_Intron|PLAC9_ENST00000372270.2_Missense_Mutation_p.V25A	NM_001012973.1	NP_001012991.1	Q5JTB6	PLAC9_HUMAN	placenta-specific 9	67						extracellular region (GO:0005576)				kidney(1)|ovary(1)	2	Prostate(51;0.0095)|all_epithelial(25;0.175)		Colorectal(32;0.109)			GGGACAGAGGTGAAAGGCCTG	0.617											OREG0020321	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													82.0	72.0	75.0					10																	81904016		2203	4300	6503	SO:0001583	missense	0				CCDS31232.1	10q23.2	2008-02-04			ENSG00000189129	ENSG00000189129			19255	protein-coding gene	gene with protein product		612857					Standard	NM_001012973		Approved		uc001kbp.1	Q5JTB6	OTTHUMG00000018596	ENST00000372263.3:c.200T>C	10.37:g.81904016T>C	ENSP00000361337:p.Val67Ala	1209		Missense_Mutation	SNP	NULL	p.V67A	ENST00000372263.3	37	c.200	CCDS31232.1	10	.	.	.	.	.	.	.	.	.	.	T	13.30	2.194787	0.38806	.	.	ENSG00000189129	ENST00000372270;ENST00000372263	.	.	.	3.78	3.78	0.43462	.	0.197615	0.25222	N	0.032225	T	0.46112	0.1376	.	.	.	0.20196	N	0.99993	D	0.64830	0.994	P	0.51833	0.681	T	0.37842	-0.9688	8	0.72032	D	0.01	.	9.1287	0.36833	0.0:0.0:0.0:1.0	.	67	Q5JTB6	PLAC9_HUMAN	A	25;67	.	ENSP00000361337:V67A	V	+	2	0	PLAC9	81893996	1.000000	0.71417	0.267000	0.24556	0.064000	0.16182	3.150000	0.50662	1.727000	0.51537	0.381000	0.24937	GTG	PLAC9	-	NULL	ENSG00000189129		0.617	PLAC9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLAC9	HGNC	protein_coding	OTTHUMT00000049019.1	-	0.00	64	0	T	NM_001012973		81904016	+1	tier1	-	no_errors	ENST00000372263	ensembl	human	known	74_37	missense	9.52	75	8	SNP	0.477	C
PLEC	5339	genome.wustl.edu	37	8	144995124	144995124	+	Silent	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:144995124G>T	ENST00000322810.4	-	32	9445	c.9276C>A	c.(9274-9276)atC>atA	p.I3092I	PLEC_ENST00000398774.2_Silent_p.I2923I|PLEC_ENST00000354589.3_Silent_p.I2955I|PLEC_ENST00000356346.3_Silent_p.I2941I|PLEC_ENST00000527096.1_Silent_p.I2978I|PLEC_ENST00000345136.3_Silent_p.I2955I|PLEC_ENST00000354958.2_Silent_p.I2933I|PLEC_ENST00000357649.2_Silent_p.I2959I|PLEC_ENST00000436759.2_Silent_p.I2982I	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3092	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TGATCTTGATGATCTTCTCCA	0.612																																																	0													33.0	38.0	36.0					8																	144995124		2095	4210	6305	SO:0001819	synonymous_variant	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.9276C>A	8.37:g.144995124G>T			Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.I3092	ENST00000322810.4	37	c.9276	CCDS43772.1	8																																																																																			PLEC	-	NULL	ENSG00000178209		0.612	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1		0.00	24	0	G	NM_000445		144995124	-1			no_errors	ENST00000322810	ensembl	human	known	74_37	silent	11.11	40	5	SNP	1.000	T
PLEC	5339	genome.wustl.edu	37	8	144997022	144997022	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:144997022C>T	ENST00000322810.4	-	31	7655	c.7486G>A	c.(7486-7488)Gag>Aag	p.E2496K	PLEC_ENST00000398774.2_Missense_Mutation_p.E2327K|PLEC_ENST00000354589.3_Missense_Mutation_p.E2359K|PLEC_ENST00000356346.3_Missense_Mutation_p.E2345K|PLEC_ENST00000527096.1_Missense_Mutation_p.E2382K|PLEC_ENST00000345136.3_Missense_Mutation_p.E2359K|PLEC_ENST00000354958.2_Missense_Mutation_p.E2337K|PLEC_ENST00000357649.2_Missense_Mutation_p.E2363K|PLEC_ENST00000436759.2_Missense_Mutation_p.E2386K	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2496	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TGCGTCTCCTCCGCCAGCTGC	0.687																																																	0													6.0	7.0	7.0					8																	144997022		2163	4250	6413	SO:0001583	missense	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.7486G>A	8.37:g.144997022C>T	ENSP00000323856:p.Glu2496Lys		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.E2496K	ENST00000322810.4	37	c.7486	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	C	9.239	1.037684	0.19669	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.76578	-1.0;-1.0;-1.03;-1.03;-1.01;-1.0;-0.99;-1.0;-1.0	5.15	0.896	0.19253	.	0.413845	0.20668	U	0.087898	T	0.74061	0.3667	L	0.55990	1.75	0.28866	N	0.89526	B;B;B;B;B;B;B;B	0.06786	0.001;0.001;0.001;0.001;0.001;0.001;0.001;0.001	B;B;B;B;B;B;B;B	0.09377	0.004;0.004;0.004;0.002;0.004;0.004;0.004;0.004	T	0.67063	-0.5765	10	0.52906	T	0.07	.	18.6109	0.91285	0.0:0.7465:0.2535:0.0	.	2386;2345;2337;2496;2327;2359;2363;2359	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	K	2359;2363;2359;2327;2496;2337;2345;2386;2382	ENSP00000344848:E2359K;ENSP00000350277:E2363K;ENSP00000346602:E2359K;ENSP00000381756:E2327K;ENSP00000323856:E2496K;ENSP00000347044:E2337K;ENSP00000348702:E2345K;ENSP00000388180:E2386K;ENSP00000434583:E2382K	ENSP00000323856:E2496K	E	-	1	0	PLEC	145069010	0.486000	0.25980	0.260000	0.24451	0.894000	0.52154	0.891000	0.28309	0.170000	0.19704	-0.290000	0.09829	GAG	PLEC	-	NULL	ENSG00000178209		0.687	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	-	0.00	39	0	C	NM_000445		144997022	-1	tier1	-	no_errors	ENST00000322810	ensembl	human	known	74_37	missense	13.85	56	9	SNP	0.079	T
POU4F2	5458	genome.wustl.edu	37	4	147561864	147561864	+	Silent	SNP	C	C	T	rs572053159		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr4:147561864C>T	ENST00000281321.3	+	2	1382	c.1134C>T	c.(1132-1134)atC>atT	p.I378I	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	378					axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					TCGCCGCCATCGCGGAGAAGC	0.552																																																	0													50.0	56.0	54.0					4																	147561864		2203	4300	6503	SO:0001819	synonymous_variant	0			U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.1134C>T	4.37:g.147561864C>T			B1PJR6|B2RC84|Q13883|Q14987	Silent	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.I378	ENST00000281321.3	37	c.1134	CCDS34074.1	4																																																																																			POU4F2	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000151615		0.552	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F2	HGNC	protein_coding	OTTHUMT00000367020.1	-	0.00	27	0	C	NM_004575		147561864	+1	tier1	-	no_errors	ENST00000281321	ensembl	human	known	74_37	silent	15.79	32	6	SNP	1.000	T
PPFIA4	8497	genome.wustl.edu	37	1	203013536	203013536	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:203013536G>A	ENST00000447715.2	+	9	972	c.531G>A	c.(529-531)gaG>gaA	p.E177E	PPFIA4_ENST00000367240.2_Silent_p.E177E|PPFIA4_ENST00000295706.4_5'UTR|PPFIA4_ENST00000414050.2_5'Flank			O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4	177					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(20)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	50						CAGCGCTGGAGCGAGTCACCA	0.632																																																	0													4.0	3.0	4.0					1																	203013536		806	1832	2638	SO:0001819	synonymous_variant	0			AF034801	CCDS44296.1	1q32.1	2013-01-10			ENSG00000143847	ENSG00000143847		"""Sterile alpha motif (SAM) domain containing"""	9248	protein-coding gene	gene with protein product	"""Liprin-alpha4"""	603145				9624153	Standard	XM_005245553		Approved		uc009xaj.3	O75335	OTTHUMG00000042123	ENST00000447715.2:c.531G>A	1.37:g.203013536G>A			A2RUJ5|B1APN8|B1N949|B7ZM43|O94971	Silent	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_Prefoldin,smart_SAM,pfscan_SAM	p.E177	ENST00000447715.2	37	c.531		1																																																																																			PPFIA4	-	superfamily_Prefoldin	ENSG00000143847		0.632	PPFIA4-005	NOVEL	basic|appris_candidate	protein_coding	PPFIA4	HGNC	protein_coding	OTTHUMT00000462949.1	-	0.00	43	0	G	NM_015053		203013536	+1	tier1	-	no_errors	ENST00000367240	ensembl	human	novel	74_37	silent	30.43	32	14	SNP	1.000	A
PPFIBP2	8495	genome.wustl.edu	37	11	7661053	7661053	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:7661053C>A	ENST00000299492.4	+	15	1715	c.1327C>A	c.(1327-1329)Ccc>Acc	p.P443T	PPFIBP2_ENST00000528883.1_Missense_Mutation_p.P331T|PPFIBP2_ENST00000530582.1_3'UTR|PPFIBP2_ENST00000533792.1_Missense_Mutation_p.P285T|PPFIBP2_ENST00000530181.1_Missense_Mutation_p.P300T	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	443					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		CAAATCTCCTCCCACCATCTG	0.592																																																	0													90.0	90.0	90.0					11																	7661053		2201	4296	6497	SO:0001583	missense	0			AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.1327C>A	11.37:g.7661053C>A	ENSP00000299492:p.Pro443Thr		B7Z433|E9PK77|O75337|Q8WW26	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_Integrase_Tn916-type_DNA-bd_N,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.P443T	ENST00000299492.4	37	c.1327	CCDS31419.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.456|4.456	0.084506|0.084506	0.08583|0.08583	.|.	.|.	ENSG00000166387|ENSG00000166387	ENST00000299492;ENST00000533792;ENST00000537467;ENST00000541115;ENST00000528883;ENST00000530181;ENST00000530081|ENST00000534409	T;T;T;T|.	0.30182|.	1.97;1.55;1.96;1.54|.	5.16|5.16	2.23|2.23	0.28157|0.28157	.|.	0.506682|.	0.20593|.	N|.	0.089302|.	T|T	0.38161|0.38161	0.1030|0.1030	L|L	0.50333|0.50333	1.59|1.59	0.09310|0.09310	N|N	1|1	B;B;B;B;B;B|.	0.33940|.	0.148;0.124;0.433;0.124;0.001;0.001|.	B;B;B;B;B;B|.	0.36244|.	0.093;0.03;0.22;0.03;0.001;0.002|.	T|T	0.25916|0.25916	-1.0118|-1.0118	10|5	0.36615|.	T|.	0.2|.	-8.3442|-8.3442	5.3336|5.3336	0.15945|0.15945	0.1605:0.6657:0.0:0.1737|0.1605:0.6657:0.0:0.1737	.|.	331;331;366;285;300;443|.	E9PK77;B7Z433;F5GWB0;E9PP16;E9PMU1;Q8ND30|.	.;.;.;.;.;LIPB2_HUMAN|.	T|Y	443;285;285;366;331;300;87|122	ENSP00000299492:P443T;ENSP00000436498:P285T;ENSP00000435469:P331T;ENSP00000437321:P300T|.	ENSP00000299492:P443T|.	P|S	+|+	1|2	0|0	PPFIBP2|PPFIBP2	7617629|7617629	0.000000|0.000000	0.05858|0.05858	0.017000|0.017000	0.16124|0.16124	0.030000|0.030000	0.12068|0.12068	-0.291000|-0.291000	0.08343|0.08343	0.270000|0.270000	0.21984|0.21984	-0.270000|-0.270000	0.10280|0.10280	CCC|TCC	PPFIBP2	-	NULL	ENSG00000166387		0.592	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIBP2	HGNC	protein_coding	OTTHUMT00000385345.2		0.00	38	0	C	NM_003621		7661053	+1			no_errors	ENST00000299492	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.009	A
PRKD1	5587	genome.wustl.edu	37	14	30068914	30068914	+	Nonsense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:30068914G>C	ENST00000331968.5	-	14	2244	c.2015C>G	c.(2014-2016)tCa>tGa	p.S672*	PRKD1_ENST00000415220.2_Nonsense_Mutation_p.S680*	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	672	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		CTTTTCACTTGACAAGATCAT	0.363																																																	0													116.0	115.0	115.0					14																	30068914		2203	4300	6503	SO:0001587	stop_gained	0				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.2015C>G	14.37:g.30068914G>C	ENSP00000333568:p.Ser672*		A6NL64|B2RAF6	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.S672*	ENST00000331968.5	37	c.2015	CCDS9637.1	14	.	.	.	.	.	.	.	.	.	.	G	40	8.297355	0.98747	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	.	.	.	5.95	5.95	0.96441	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-10.9172	20.3931	0.98965	0.0:0.0:1.0:0.0	.	.	.	.	X	672;680	.	ENSP00000333568:S672X	S	-	2	0	PRKD1	29138665	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.824000	0.97209	0.655000	0.94253	TCA	PRKD1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000184304		0.363	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKD1	HGNC	protein_coding	OTTHUMT00000276611.2	-	0.00	48	0	G	NM_002742		30068914	-1	tier1	-	no_errors	ENST00000331968	ensembl	human	known	74_37	nonsense	25.81	23	8	SNP	1.000	C
PPP4R4	57718	genome.wustl.edu	37	14	94722887	94722887	+	Silent	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:94722887G>C	ENST00000304338.3	+	17	2110	c.1956G>C	c.(1954-1956)gtG>gtC	p.V652V		NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	652					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						AAATGTGTGTGAGGAAACTCC	0.363																																																	0													111.0	114.0	113.0					14																	94722887		2203	4300	6503	SO:0001819	synonymous_variant	0			AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.1956G>C	14.37:g.94722887G>C			Q9BUF8|Q9HCF0	Silent	SNP	superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.V652	ENST00000304338.3	37	c.1956	CCDS9921.1	14																																																																																			PPP4R4	-	superfamily_ARM-type_fold	ENSG00000119698		0.363	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP4R4	HGNC	protein_coding	OTTHUMT00000413056.1	-	0.00	31	0	G	NM_058237		94722887	+1	tier1	-	no_errors	ENST00000304338	ensembl	human	known	74_37	silent	24.32	28	9	SNP	0.997	C
PRLR	5618	genome.wustl.edu	37	5	35068920	35068920	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:35068920C>G	ENST00000382002.5	-	8	1172	c.746G>C	c.(745-747)tGt>tCt	p.C249S	PRLR_ENST00000310101.5_Missense_Mutation_p.C249S|PRLR_ENST00000542609.1_Missense_Mutation_p.C249S|PRLR_ENST00000509934.1_Intron|PRLR_ENST00000397391.3_Intron|PRLR_ENST00000511486.1_Missense_Mutation_p.C148S|PRLR_ENST00000342362.5_Missense_Mutation_p.C148S|PRLR_ENST00000231423.3_Missense_Mutation_p.C249S|PRLR_ENST00000513753.1_Missense_Mutation_p.C249S|PRLR_ENST00000348262.3_Intron	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	249					activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	AATAATCAAACAGATGACAGC	0.418																																																	0													132.0	119.0	123.0					5																	35068920		2203	4300	6503	SO:0001583	missense	0				CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.746G>C	5.37:g.35068920C>G	ENSP00000371432:p.Cys249Ser		B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Missense_Mutation	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.C249S	ENST00000382002.5	37	c.746	CCDS3909.1	5	.	.	.	.	.	.	.	.	.	.	C	16.31	3.087988	0.55968	.	.	ENSG00000113494	ENST00000231423;ENST00000513753;ENST00000542609;ENST00000342362;ENST00000382002;ENST00000511486;ENST00000310101	T;T;T;D;D;D;T	0.89050	-1.11;-1.05;-1.08;-2.46;-1.54;-2.46;-1.08	5.76	4.88	0.63580	.	0.132933	0.64402	D	0.000001	D	0.95389	0.8503	M	0.90145	3.09	0.43771	D	0.996291	D;D;D;D	0.89917	1.0;1.0;0.998;0.998	D;D;D;D	0.85130	0.997;0.997;0.964;0.964	D	0.95912	0.8924	10	0.54805	T	0.06	-10.2226	16.4476	0.83942	0.1324:0.8676:0.0:0.0	.	249;148;249;249	P16471;P16471-2;P16471-6;P16471-4	PRLR_HUMAN;.;.;.	S	249;249;249;148;249;148;249	ENSP00000231423:C249S;ENSP00000424841:C249S;ENSP00000441813:C249S;ENSP00000339213:C148S;ENSP00000371432:C249S;ENSP00000422556:C148S;ENSP00000309008:C249S	ENSP00000231423:C249S	C	-	2	0	PRLR	35104677	1.000000	0.71417	1.000000	0.80357	0.491000	0.33493	2.730000	0.47335	1.551000	0.49450	0.655000	0.94253	TGT	PRLR	-	NULL	ENSG00000113494		0.418	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLR	HGNC	protein_coding	OTTHUMT00000207575.2	-	0.00	26	0	C			35068920	-1	tier1	-	no_errors	ENST00000382002	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	G
PRMT1	3276	genome.wustl.edu	37	19	50185264	50185264	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:50185264C>T	ENST00000391851.4	+	3	365	c.236C>T	c.(235-237)tCg>tTg	p.S79L	MIR5088_ENST00000581740.1_RNA|PRMT1_ENST00000532489.1_Missense_Mutation_p.S51L|PRMT1_ENST00000454376.2_Missense_Mutation_p.S97L	NM_198318.4	NP_938074.2	Q99873	ANM1_HUMAN	protein arginine methyltransferase 1	87	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cell surface receptor signaling pathway (GO:0007166)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|negative regulation of megakaryocyte differentiation (GO:0045653)|neuron projection development (GO:0031175)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|protein methylation (GO:0006479)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|identical protein binding (GO:0042802)|methyltransferase activity (GO:0008168)|N-methyltransferase activity (GO:0008170)|poly(A) RNA binding (GO:0044822)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(2)	12		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00103)|GBM - Glioblastoma multiforme(134;0.012)		GACGTCGGCTCGGGCACCGGC	0.637																																																	0													54.0	48.0	50.0					19																	50185264		2203	4300	6503	SO:0001583	missense	0			D66904	CCDS42592.1, CCDS46145.1, CCDS74425.1	19q13	2014-06-12	2006-02-16	2006-02-16	ENSG00000126457	ENSG00000126457	2.1.1.125	"""Protein arginine methyltransferases"""	5187	protein-coding gene	gene with protein product		602950	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 2"", ""HMT1 hnRNP methyltransferase-like 2 (S. cerevisiae)"""	HRMT1L2		9545638	Standard	NM_001207042		Approved	HCP1, ANM1	uc010enf.2	Q99873	OTTHUMG00000167568	ENST00000391851.4:c.236C>T	19.37:g.50185264C>T	ENSP00000375724:p.Ser79Leu		B4E3C3|G5E9B6|Q15529|Q2VP93|Q6LEU5|Q8WUW5|Q99872|Q99874|Q9NZ04|Q9NZ05|Q9NZ06	Missense_Mutation	SNP	pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Arg_MeTrfase,pfam_Methyltransf_11,pfam_Small_mtfrase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	p.S97L	ENST00000391851.4	37	c.290	CCDS42592.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.03|17.03	3.284174|3.284174	0.59867|0.59867	.|.	.|.	ENSG00000126457|ENSG00000126457	ENST00000524771|ENST00000529284;ENST00000532489;ENST00000527382;ENST00000534465;ENST00000391851;ENST00000449059;ENST00000454376;ENST00000529836;ENST00000526224;ENST00000527412	.|T;T;T;T;T;T;T;T;T	.|0.25749	.|1.78;1.78;1.78;1.78;1.78;1.78;1.8;1.78;1.8	5.04|5.04	4.01|4.01	0.46588|0.46588	.|.	.|0.126699	.|0.49916	.|D	.|0.000135	T|T	0.47135|0.47135	0.1429|0.1429	M|M	0.86864|0.86864	2.845|2.845	0.51767|0.51767	D|D	0.999938|0.999938	.|D;D;D;D	.|0.65815	.|0.995;0.995;0.994;0.994	.|P;P;P;P	.|0.59643	.|0.861;0.663;0.628;0.628	T|T	0.51694|0.51694	-0.8673|-0.8673	5|10	.|0.87932	.|D	.|0	-0.0644|-0.0644	7.0038|7.0038	0.24826|0.24826	0.0:0.7334:0.1747:0.0919|0.0:0.7334:0.1747:0.0919	.|.	.|87;51;79;73	.|Q99873;E9PKG1;G5E9B6;Q99873-2	.|ANM1_HUMAN;.;.;.	W|L	107|51;51;51;51;79;73;97;73;51;76	.|ENSP00000432349:S51L;ENSP00000433556:S51L;ENSP00000432538:S51L;ENSP00000431957:S51L;ENSP00000375724:S79L;ENSP00000406162:S97L;ENSP00000437273:S73L;ENSP00000432788:S51L;ENSP00000436732:S76L	.|ENSP00000375724:S79L	R|S	+|+	1|2	2|0	PRMT1|PRMT1	54877076|54877076	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.156000|0.156000	0.22039|0.22039	5.432000|5.432000	0.66514|0.66514	1.368000|1.368000	0.46115|0.46115	-0.148000|-0.148000	0.13756|0.13756	CGG|TCG	PRMT1	-	pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Arg_MeTrfase,pfam_Methyltransf_11,pfam_Small_mtfrase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	ENSG00000126457		0.637	PRMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT1	HGNC	protein_coding	OTTHUMT00000395065.1	-	0.00	71	0	C	NM_001536		50185264	+1	tier1	-	no_errors	ENST00000454376	ensembl	human	known	74_37	missense	15.79	64	12	SNP	0.996	T
PRRC1	133619	genome.wustl.edu	37	5	126866085	126866085	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:126866085A>G	ENST00000296666.8	+	5	942	c.754A>G	c.(754-756)Atc>Gtc	p.I252V	PRRC1_ENST00000512635.2_Missense_Mutation_p.I252V|PRRC1_ENST00000442138.2_Missense_Mutation_p.I252V	NM_130809.3	NP_570721.1	Q96M27	PRRC1_HUMAN	proline-rich coiled-coil 1	252						Golgi apparatus (GO:0005794)				endometrium(1)|large_intestine(1)|lung(4)	6		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0851)|Epithelial(69;0.113)		GGCTCCCTATATCAGTATGTA	0.423																																																	0													81.0	78.0	79.0					5																	126866085		2203	4300	6503	SO:0001583	missense	0			AJ515429	CCDS4143.1, CCDS68943.1	5q23.2	2008-02-05			ENSG00000164244	ENSG00000164244			28164	protein-coding gene	gene with protein product						15541471	Standard	NM_130809		Approved	FLJ32875	uc003kuk.3	Q96M27	OTTHUMG00000128982	ENST00000296666.8:c.754A>G	5.37:g.126866085A>G	ENSP00000296666:p.Ile252Val		Q69YM8|Q7L2U7|Q86Y42|Q8IVJ4|Q8IVL4|Q8NEZ7|Q96AJ3	Missense_Mutation	SNP	pfam_NTPase/PRRC1	p.I252V	ENST00000296666.8	37	c.754	CCDS4143.1	5	.	.	.	.	.	.	.	.	.	.	A	22.3	4.268886	0.80469	.	.	ENSG00000164244	ENST00000296666;ENST00000442138;ENST00000330542;ENST00000414018;ENST00000512635;ENST00000512535	.	.	.	5.16	3.99	0.46301	.	0.000000	0.85682	D	0.000000	T	0.67373	0.2886	M	0.69823	2.125	0.80722	D	1	D;D	0.60575	0.972;0.988	P;P	0.56163	0.755;0.793	T	0.70077	-0.4971	9	0.72032	D	0.01	-19.2963	10.7584	0.46251	0.8578:0.0:0.0:0.1422	.	252;252	Q96M27;Q96M27-5	PRRC1_HUMAN;.	V	252	.	ENSP00000296666:I252V	I	+	1	0	PRRC1	126893984	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	9.072000	0.93986	0.967000	0.38186	0.533000	0.62120	ATC	PRRC1	-	NULL	ENSG00000164244		0.423	PRRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC1	HGNC	protein_coding	OTTHUMT00000250971.3	-	0.00	33	0	A	NM_130809		126866085	+1	tier1	-	no_errors	ENST00000512635	ensembl	human	known	74_37	missense	21.74	36	10	SNP	1.000	G
PTPRF	5792	genome.wustl.edu	37	1	44079217	44079217	+	Intron	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:44079217C>T	ENST00000359947.4	+	23	4313				PTPRF_ENST00000372414.3_Intron|PTPRF_ENST00000438120.1_Intron|PTPRF_ENST00000372413.3_Intron|PTPRF_ENST00000422171.2_Intron|PTPRF_ENST00000496447.1_Intron	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F						cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CACATACATGCGTTGGGGCTT	0.577																																																	0																																										SO:0001627	intron_variant	0			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.3974-72C>T	1.37:g.44079217C>T			D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	RNA	SNP	-	NULL	ENST00000359947.4	37	NULL	CCDS489.2	1																																																																																			PTPRF	-	-	ENSG00000142949		0.577	PTPRF-001	KNOWN	basic|CCDS	protein_coding	PTPRF	HGNC	protein_coding	OTTHUMT00000019710.1	-	0.00	63	0	C			44079217	+1	tier1	-	no_errors	ENST00000477970	ensembl	human	known	74_37	rna	35.29	55	30	SNP	0.011	T
PTPRN2	5799	genome.wustl.edu	37	7	157333462	157333462	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:157333462C>T	ENST00000389418.4	-	23	3003	c.2994G>A	c.(2992-2994)gcG>gcA	p.A998A	PTPRN2_ENST00000409483.1_Silent_p.A960A|PTPRN2_ENST00000389416.4_Silent_p.A981A|PTPRN2_ENST00000404321.2_Silent_p.A1021A|PTPRN2_ENST00000389413.3_Silent_p.A969A	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	998	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CGGCTGTCAGCGCGAACTCAA	0.652																																																	0													25.0	25.0	25.0					7																	157333462		2194	4288	6482	SO:0001819	synonymous_variant	0			AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.2994G>A	7.37:g.157333462C>T			E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.A1021	ENST00000389418.4	37	c.3063	CCDS5947.1	7																																																																																			PTPRN2	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	ENSG00000155093		0.652	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTPRN2	HGNC	protein_coding	OTTHUMT00000353214.1	-	0.00	73	0	C			157333462	-1	tier1	-	no_errors	ENST00000404321	ensembl	human	known	74_37	silent	30.14	51	22	SNP	0.309	T
R3HDML	140902	genome.wustl.edu	37	20	42965973	42965973	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr20:42965973C>T	ENST00000217043.2	+	1	348	c.176C>T	c.(175-177)tCt>tTt	p.S59F		NM_178491.2	NP_848586.1	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like	59						extracellular region (GO:0005576)	peptidase inhibitor activity (GO:0030414)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)	21		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			CGCCACATCTCTGTGAGAGAC	0.607																																																	0													68.0	62.0	64.0					20																	42965973		2203	4300	6503	SO:0001583	missense	0			BC107048	CCDS13329.1	20q13.12	2007-04-26	2005-09-02		ENSG00000101074	ENSG00000101074			16249	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing-like"""				Standard	NM_178491		Approved	dJ881L22.3	uc002xls.2	Q9H3Y0	OTTHUMG00000032524	ENST00000217043.2:c.176C>T	20.37:g.42965973C>T	ENSP00000217043:p.Ser59Phe			Missense_Mutation	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	p.S59F	ENST00000217043.2	37	c.176	CCDS13329.1	20	.	.	.	.	.	.	.	.	.	.	C	15.50	2.853134	0.51270	.	.	ENSG00000101074	ENST00000217043	T	0.11712	2.75	5.18	5.18	0.71444	CAP domain (2);	0.000000	0.85682	D	0.000000	T	0.33904	0.0879	M	0.66939	2.045	0.58432	D	0.99999	D	0.89917	1.0	D	0.87578	0.998	T	0.04678	-1.0934	10	0.72032	D	0.01	.	18.686	0.91563	0.0:1.0:0.0:0.0	.	59	Q9H3Y0	CRSPL_HUMAN	F	59	ENSP00000217043:S59F	ENSP00000217043:S59F	S	+	2	0	R3HDML	42399387	1.000000	0.71417	1.000000	0.80357	0.077000	0.17291	4.305000	0.59110	2.419000	0.82065	0.385000	0.25706	TCT	R3HDML	-	superfamily_CAP_domain	ENSG00000101074		0.607	R3HDML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	R3HDML	HGNC	protein_coding	OTTHUMT00000079344.1	-	0.00	72	0	C	NM_178491		42965973	+1	tier1	-	no_errors	ENST00000217043	ensembl	human	known	74_37	missense	9.64	75	8	SNP	1.000	T
RAG1	5896	genome.wustl.edu	37	11	36596806	36596806	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:36596806C>G	ENST00000299440.5	+	2	2064	c.1952C>G	c.(1951-1953)tCt>tGt	p.S651C		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	651					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				AAACCTAACTCTGAACTGTGT	0.468									Familial Hemophagocytic Lymphohistiocytosis																												Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)												0													74.0	68.0	70.0					11																	36596806		2202	4298	6500	SO:0001583	missense	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.1952C>G	11.37:g.36596806C>G	ENSP00000299440:p.Ser651Cys		E9PPC4|Q8IY72|Q8NER2	Missense_Mutation	SNP	pfam_Znf_VDJ_recomb-activ_1,smart_Znf_RING,pfscan_Znf_RING	p.S651C	ENST00000299440.5	37	c.1952	CCDS7902.1	11	.	.	.	.	.	.	.	.	.	.	C	18.99	3.740662	0.69304	.	.	ENSG00000166349	ENST00000534663;ENST00000299440	D;D	0.91011	-2.77;-2.77	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.97303	0.9118	H	0.96604	3.85	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98111	1.0420	10	0.87932	D	0	.	19.9367	0.97143	0.0:1.0:0.0:0.0	.	651	P15918	RAG1_HUMAN	C	651	ENSP00000434610:S651C;ENSP00000299440:S651C	ENSP00000299440:S651C	S	+	2	0	RAG1	36553382	1.000000	0.71417	0.969000	0.41365	0.986000	0.74619	7.487000	0.81328	2.704000	0.92352	0.644000	0.83932	TCT	RAG1	-	NULL	ENSG00000166349		0.468	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAG1	HGNC	protein_coding	OTTHUMT00000389535.1	-	0.00	43	0	C	NM_000448		36596806	+1	tier1	-	no_errors	ENST00000299440	ensembl	human	known	74_37	missense	20.83	38	10	SNP	1.000	G
RASGRF1	5923	genome.wustl.edu	37	15	79298644	79298644	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr15:79298644C>T	ENST00000419573.3	-	15	2272	c.1998G>A	c.(1996-1998)ctG>ctA	p.L666L	RASGRF1_ENST00000394745.3_5'Flank|RASGRF1_ENST00000558480.2_Silent_p.L653L|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	666	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						AGTCGATGCTCAGGAAGCGCA	0.557																																																	0													155.0	124.0	134.0					15																	79298644		2196	4293	6489	SO:0001819	synonymous_variant	0			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.1998G>A	15.37:g.79298644C>T			F8VPA5|H0YKF2|J3KQP9|Q16027	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.L666	ENST00000419573.3	37	c.1998	CCDS10309.1	15																																																																																			RASGRF1	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,pfscan_Ras-like_Gua-exchang_fac_N	ENSG00000058335		0.557	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	RASGRF1	HGNC	protein_coding	OTTHUMT00000291371.3		0.00	38	0	C	NM_002891		79298644	-1			no_errors	ENST00000419573	ensembl	human	known	74_37	silent	5.88	64	4	SNP	1.000	T
RBM4	5936	genome.wustl.edu	37	11	66384399	66384399	+	De_novo_Start_OutOfFrame	SNP	A	A	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:66384399A>T	ENST00000503028.2	+	0	298				RBM14-RBM4_ENST00000511114.1_3'UTR|RBM14_ENST00000409738.4_Missense_Mutation_p.M70L|RBM14_ENST00000393979.3_Missense_Mutation_p.M70L|RBM4_ENST00000514361.3_Missense_Mutation_p.M70L|RBM14_ENST00000443702.1_Missense_Mutation_p.M70L|RNU4-39P_ENST00000362455.1_RNA|RBM14-RBM4_ENST00000412278.2_Missense_Mutation_p.M70L|RBM14_ENST00000310137.4_Missense_Mutation_p.M70L|RBM14_ENST00000409372.1_Missense_Mutation_p.M70L|RBM14-RBM4_ENST00000500635.2_Missense_Mutation_p.M70L			Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4						cap-independent translational initiation (GO:0002190)|cell differentiation (GO:0030154)|circadian regulation of translation (GO:0097167)|entrainment of circadian clock by photoperiod (GO:0043153)|IRES-dependent translational initiation (GO:0002192)|mRNA processing (GO:0006397)|negative regulation of translation (GO:0017148)|negative regulation of translation in response to stress (GO:0032055)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of nucleocytoplasmic transport (GO:0046822)|response to arsenic-containing substance (GO:0046685)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|stress-activated MAPK cascade (GO:0051403)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	miRNA binding (GO:0035198)|mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|pre-mRNA intronic pyrimidine-rich binding (GO:0097158)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)		CGTGGTGGAGATGTCGCGCCC	0.672																																																	0													38.0	48.0	44.0					11																	66384399		2189	4266	6455			0			U89505	CCDS41676.1, CCDS55776.1, CCDS55777.1	11q13	2013-02-12			ENSG00000173933	ENSG00000173933		"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	9901	protein-coding gene	gene with protein product		602571				9169144, 16260624	Standard	NM_002896		Approved	LARK, RBM4A, ZCRB3A, ZCCHC21		Q9BWF3	OTTHUMG00000154171	ENST00000503028.2:c.-142A>T	11.37:g.66384399A>T			B3KUN0|B4E1U0|E7EQS3|O02916|Q4VC48|Q6P1P2|Q8WU85	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.M70L	ENST00000503028.2	37	c.208	CCDS41676.1	11	.	.	.	.	.	.	.	.	.	.	A	11.45	1.642782	0.29246	.	.	ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000248643;ENSG00000248643	ENST00000310137;ENST00000393979;ENST00000409372;ENST00000443702;ENST00000409738;ENST00000412278;ENST00000500635	T;T;T;T;T;T;T	0.38240	1.15;1.15;3.51;3.51;3.51;3.51;3.51	5.06	5.06	0.68205	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.53938	D	0.000056	T	0.12902	0.0313	N	0.02420	-0.555	0.80722	D	1	B;B;B;B	0.16802	0.019;0.003;0.0;0.006	B;B;B;B	0.14578	0.011;0.004;0.001;0.004	T	0.13899	-1.0492	10	0.07030	T	0.85	-4.1641	9.0729	0.36504	0.8146:0.1854:0.0:0.0	.	70;70;70;70	B0LM41;Q96PK6-2;Q2PYN1;Q96PK6	.;.;.;RBM14_HUMAN	L	70	ENSP00000311747:M70L;ENSP00000377548:M70L;ENSP00000386518:M70L;ENSP00000414650:M70L;ENSP00000386995:M70L;ENSP00000388552:M70L;ENSP00000421279:M70L	ENSP00000311747:M70L	M	+	1	0	RBM14;RBM14-RBM4	66140975	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.200000	0.32247	1.916000	0.55485	0.379000	0.24179	ATG	RBM14	-	pfscan_RRM_dom	ENSG00000239306		0.672	RBM4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM14	HGNC	protein_coding	OTTHUMT00000334212.1	-	0.00	57	0	A	NM_002896		66384399	+1	tier1	-	no_errors	ENST00000310137	ensembl	human	known	74_37	missense	25.00	36	12	SNP	1.000	T
RCL1	10171	genome.wustl.edu	37	9	4827077	4827077	+	Intron	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr9:4827077C>G	ENST00000381750.4	+	3	607				RCL1_ENST00000381732.3_Missense_Mutation_p.S143C	NM_005772.3	NP_005763.3	Q9Y2P8	RCL1_HUMAN	RNA terminal phosphate cyclase-like 1						ribosome biogenesis (GO:0042254)|RNA processing (GO:0006396)	nucleolus (GO:0005730)	catalytic activity (GO:0003824)			breast(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	9	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)		TGTTTTGTCTCTTGTCACAAC	0.358																																																	0													57.0	54.0	55.0					9																	4827077		2203	4300	6503	SO:0001627	intron_variant	0			AJ276894	CCDS6456.1, CCDS69565.1, CCDS75810.1	9p24.1-p23	2008-02-05			ENSG00000120158	ENSG00000120158			17687	protein-coding gene	gene with protein product		611405					Standard	NM_001286701		Approved	RPCL1, RNAC	uc003zis.2	Q9Y2P8	OTTHUMG00000019474	ENST00000381750.4:c.384+44C>G	9.37:g.4827077C>G			D3DRI2|Q5VYW9|Q5VZU1|Q9H9D0|Q9NY00|Q9P044	Missense_Mutation	SNP	pfam_RNA3'_phos_cyclase_dom,superfamily_RNA3'P_cycl/enolpyr_Trfase_a/b	p.S143C	ENST00000381750.4	37	c.428	CCDS6456.1	9	.	.	.	.	.	.	.	.	.	.	C	11.70	1.717638	0.30413	.	.	ENSG00000120158	ENST00000381732	.	.	.	5.1	2.09	0.27110	.	.	.	.	.	T	0.27241	0.0668	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.19910	-1.0291	4	.	.	.	.	5.7713	0.18255	0.0:0.407:0.4122:0.1808	.	.	.	.	C	143	.	.	S	+	2	0	RCL1	4817077	0.001000	0.12720	0.049000	0.19019	0.207000	0.24258	-0.212000	0.09319	0.745000	0.32763	0.650000	0.86243	TCT	RCL1	-	NULL	ENSG00000120158		0.358	RCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCL1	HGNC	protein_coding	OTTHUMT00000051587.1	-	0.00	101	0	C	NM_005772		4827077	+1	tier1	-	no_errors	ENST00000381732	ensembl	human	known	74_37	missense	11.11	104	13	SNP	0.019	G
RELN	5649	genome.wustl.edu	37	7	103175830	103175830	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:103175830G>C	ENST00000428762.1	-	46	7441	c.7282C>G	c.(7282-7284)Cgg>Ggg	p.R2428G	RELN_ENST00000343529.5_Missense_Mutation_p.R2428G|RELN_ENST00000424685.2_Missense_Mutation_p.R2428G	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2428					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.R2428W(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACCAGGATCCGTTGCAGATGA	0.458																																					NSCLC(146;835 1944 15585 22231 52158)												1	Substitution - Missense(1)	kidney(1)											175.0	134.0	147.0					7																	103175830		2203	4300	6503	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.7282C>G	7.37:g.103175830G>C	ENSP00000392423:p.Arg2428Gly		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.R2428G	ENST00000428762.1	37	c.7282	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	G	17.78	3.473662	0.63737	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.21932	1.98;1.98;1.98	5.57	2.32	0.28847	Neuraminidase (1);	0.000000	0.85682	D	0.000000	T	0.38904	0.1058	L	0.54323	1.7	0.47621	D	0.999473	D;P	0.76494	0.999;0.936	D;P	0.69479	0.964;0.569	T	0.29731	-1.0002	10	0.72032	D	0.01	.	14.2227	0.65839	0.0:0.0:0.3047:0.6953	.	2428;2428	P78509-2;P78509	.;RELN_HUMAN	G	2428	ENSP00000392423:R2428G;ENSP00000345694:R2428G;ENSP00000388446:R2428G	ENSP00000345694:R2428G	R	-	1	2	RELN	102963066	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.032000	0.41127	0.662000	0.31006	0.655000	0.94253	CGG	RELN	-	superfamily_Sialidases	ENSG00000189056		0.458	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	-	0.00	66	0	G	NM_005045		103175830	-1	tier1	-	no_errors	ENST00000424685	ensembl	human	known	74_37	missense	16.39	51	10	SNP	1.000	C
RETSAT	54884	genome.wustl.edu	37	2	85573265	85573265	+	Intron	SNP	G	G	C	rs141261861		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:85573265G>C	ENST00000295802.4	-	6	1110				RETSAT_ENST00000263854.6_Intron|RETSAT_ENST00000457495.2_Intron|RETSAT_ENST00000475624.2_5'UTR	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)						oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	CTGGGATGAAGAGAAAGGCCC	0.582																																																	0								G		1,4405	2.1+/-5.4	0,1,2202	90.0	90.0	90.0			-4.2	0.0	2	dbSNP_134	90	0,8600		0,0,4300	no	intron	RETSAT	NM_017750.3		0,1,6502	CC,CG,GG		0.0,0.0227,0.0077			85573265	1,13005	2203	4300	6503	SO:0001627	intron_variant	0			AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.998-48C>G	2.37:g.85573265G>C			A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	RNA	SNP	-	NULL	ENST00000295802.4	37	NULL	CCDS1972.1	2																																																																																			RETSAT	-	-	ENSG00000042445		0.582	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RETSAT	HGNC	protein_coding	OTTHUMT00000252489.1	-	0.00	27	0	G	NM_017750		85573265	-1	tier1	-	no_errors	ENST00000475624	ensembl	human	known	74_37	rna	27.03	27	10	SNP	0.000	C
REV1	51455	genome.wustl.edu	37	2	100017707	100017707	+	Silent	SNP	T	T	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:100017707T>C	ENST00000258428.3	-	23	3981	c.3753A>G	c.(3751-3753)acA>acG	p.T1251T	REV1_ENST00000465835.1_5'Flank|EIF5B_ENST00000289371.6_3'UTR|REV1_ENST00000393445.3_Silent_p.T1250T	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	1251					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GTAATATTTATGTAACTTTTA	0.378								Direct reversal of damage																																									0													65.0	65.0	65.0					2																	100017707		2203	4300	6503	SO:0001819	synonymous_variant	0			AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.3753A>G	2.37:g.100017707T>C			O95941|Q53SI7|Q9C0J4|Q9NUP2	Silent	SNP	pfam_DNA_repair_prot_UmuC-like,pfam_DNA_pol_Y-fam_little_finger,pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_DNA_pol_Y-fam_little_finger,smart_BRCT_dom,pirsf_REV1,pfscan_BRCT_dom,pfscan_DNA_repair_prot_UmuC-like_N	p.T1251	ENST00000258428.3	37	c.3753	CCDS2045.1	2																																																																																			REV1	-	pirsf_REV1	ENSG00000135945		0.378	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REV1	HGNC	protein_coding	OTTHUMT00000253123.2	-	0.00	52	0	T	NM_016316		100017707	-1	tier1	-	no_errors	ENST00000258428	ensembl	human	known	74_37	silent	26.67	33	12	SNP	0.070	C
REV1	51455	genome.wustl.edu	37	2	100019123	100019123	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:100019123C>A	ENST00000258428.3	-	21	3753	c.3525G>T	c.(3523-3525)tgG>tgT	p.W1175C	REV1_ENST00000465835.1_5'Flank|RP11-527J8.1_ENST00000608144.1_RNA|REV1_ENST00000393445.3_Missense_Mutation_p.W1174C	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	1175	Protein interaction domain; mediates interaction with DNA polymerase zeta.				DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TTGTAGTTATCCATTCTCTGA	0.463								Direct reversal of damage																																									0													86.0	80.0	82.0					2																	100019123		2203	4300	6503	SO:0001583	missense	0			AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.3525G>T	2.37:g.100019123C>A	ENSP00000258428:p.Trp1175Cys		O95941|Q53SI7|Q9C0J4|Q9NUP2	Missense_Mutation	SNP	pfam_DNA_repair_prot_UmuC-like,pfam_DNA_pol_Y-fam_little_finger,pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_DNA_pol_Y-fam_little_finger,smart_BRCT_dom,pirsf_REV1,pfscan_BRCT_dom,pfscan_DNA_repair_prot_UmuC-like_N	p.W1175C	ENST00000258428.3	37	c.3525	CCDS2045.1	2	.	.	.	.	.	.	.	.	.	.	C	23.4	4.408071	0.83340	.	.	ENSG00000135945	ENST00000393445;ENST00000258428	D;D	0.83591	-1.73;-1.74	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.91362	0.7275	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.90021	0.4128	10	0.46703	T	0.11	.	20.3854	0.98941	0.0:1.0:0.0:0.0	.	1175;1174	Q9UBZ9;Q9UBZ9-2	REV1_HUMAN;.	C	1174;1175	ENSP00000377091:W1174C;ENSP00000258428:W1175C	ENSP00000258428:W1175C	W	-	3	0	REV1	99385555	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.844000	0.75390	2.825000	0.97269	0.655000	0.94253	TGG	REV1	-	pirsf_REV1	ENSG00000135945		0.463	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REV1	HGNC	protein_coding	OTTHUMT00000253123.2	-	0.00	28	0	C	NM_016316		100019123	-1	tier1	-	no_errors	ENST00000258428	ensembl	human	known	74_37	missense	11.90	37	5	SNP	1.000	A
RHBG	57127	genome.wustl.edu	37	1	156347784	156347784	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:156347784G>T	ENST00000368249.1	+	3	416	c.378G>T	c.(376-378)atG>atT	p.M126I	RHBG_ENST00000537040.1_Intron|RHBG_ENST00000400992.2_Missense_Mutation_p.M57I|RHBG_ENST00000368246.2_Missense_Mutation_p.M126I|RHBG_ENST00000255013.3_Missense_Mutation_p.M57I|RHBG_ENST00000451864.2_Missense_Mutation_p.M57I	NM_001256396.1|NM_020407.4	NP_001243325.1|NP_065140.3	Q9H310	RHBG_HUMAN	Rh family, B glycoprotein (gene/pseudogene)	126					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	anchored component of plasma membrane (GO:0046658)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|spectrin-associated cytoskeleton (GO:0014731)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					TCCCCAGCATGATCAATGCTG	0.632																																																	0													56.0	58.0	57.0					1																	156347784		2015	4184	6199	SO:0001583	missense	0			AF193807		1q22	2013-05-22	2009-01-22		ENSG00000132677	ENSG00000132677		"""Solute carriers"""	14572	protein-coding gene	gene with protein product		607079	"""Rhesus blood group, B glycoprotein"""			10852913	Standard	NM_020407		Approved	SLC42A2	uc010pho.3	Q9H310	OTTHUMG00000024057	ENST00000368249.1:c.378G>T	1.37:g.156347784G>T	ENSP00000357232:p.Met126Ile		A8K475|Q5SZW4|Q5SZW6|Q5SZW7|Q6P193|Q6YJI2|Q6YJI3	Missense_Mutation	SNP	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom,prints_RhesusRHD	p.M126I	ENST00000368249.1	37	c.378		1	.	.	.	.	.	.	.	.	.	.	G	17.53	3.412206	0.62511	.	.	ENSG00000132677	ENST00000368249;ENST00000368246;ENST00000400992;ENST00000255013;ENST00000451864	T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98	5.16	5.16	0.70880	Ammonium transporter AmtB-like (3);	0.078488	0.85682	D	0.000000	T	0.14270	0.0345	L	0.42632	1.34	0.80722	D	1	B;P;B	0.35575	0.201;0.51;0.099	B;B;B	0.39840	0.126;0.311;0.088	T	0.02070	-1.1219	10	0.42905	T	0.14	-20.9614	16.1884	0.81971	0.0:0.0:1.0:0.0	.	126;57;163	Q9H310;Q9H310-3;Q5SZW5	RHBG_HUMAN;.;.	I	126;126;57;57;57	ENSP00000357232:M126I;ENSP00000357229:M126I;ENSP00000383777:M57I;ENSP00000255013:M57I;ENSP00000389836:M57I	ENSP00000255013:M57I	M	+	3	0	RHBG	154614408	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	9.102000	0.94226	2.688000	0.91661	0.561000	0.74099	ATG	RHBG	-	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom	ENSG00000132677		0.632	RHBG-001	NOVEL	basic	protein_coding	RHBG	HGNC	protein_coding	OTTHUMT00000060589.2	-	0.00	50	0	G	NM_001256395		156347784	+1	tier1	-	no_errors	ENST00000368246	ensembl	human	known	74_37	missense	17.19	53	11	SNP	1.000	T
RHOBTB1	9886	genome.wustl.edu	37	10	62631842	62631842	+	Intron	SNP	G	G	A	rs556377938	byFrequency	TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr10:62631842G>A	ENST00000337910.5	-	10	2259				RHOBTB1_ENST00000490827.1_5'UTR|RHOBTB1_ENST00000357917.4_Intron	NM_001242359.1|NM_014836.4	NP_001229288.1|NP_055651.1	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	Prostate(12;0.0112)					AATCATCCATGAGCTGCCTGC	0.478																																																	0																																										SO:0001627	intron_variant	0			AB018283	CCDS7261.1	10q22.1	2013-01-08			ENSG00000072422	ENSG00000072422		"""BTB/POZ domain containing"""	18738	protein-coding gene	gene with protein product		607351				11222756	Standard	NM_014836		Approved	KIAA0740	uc001jlh.3	O94844	OTTHUMG00000018292	ENST00000337910.5:c.1921+100C>T	10.37:g.62631842G>A				RNA	SNP	-	NULL	ENST00000337910.5	37	NULL	CCDS7261.1	10																																																																																			RHOBTB1	-	-	ENSG00000072422		0.478	RHOBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOBTB1	HGNC	protein_coding	OTTHUMT00000048220.1	-	0.00	20	0	G			62631842	-1	tier1	-	no_errors	ENST00000490827	ensembl	human	known	74_37	rna	28.12	22	9	SNP	0.000	A
RILPL2	196383	genome.wustl.edu	37	12	123907666	123907666	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:123907666C>A	ENST00000280571.8	-	3	826	c.530G>T	c.(529-531)aGa>aTa	p.R177I		NM_145058.1	NP_659495.1	Q969X0	RIPL2_HUMAN	Rab interacting lysosomal protein-like 2	177					epithelial cell morphogenesis (GO:0003382)|intracellular protein transport (GO:0006886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|primary cilium (GO:0072372)	identical protein binding (GO:0042802)			endometrium(1)|large_intestine(2)|lung(2)|skin(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000546)|Epithelial(86;0.00179)|all cancers(50;0.0168)		ATCTTTTTCTCTTCTTCCTCC	0.413																																																	0													168.0	155.0	160.0					12																	123907666		2203	4300	6503	SO:0001583	missense	0			AB085763	CCDS9248.1	12q24.31	2007-11-27				ENSG00000150977			28787	protein-coding gene	gene with protein product		614093				14668488	Standard	NM_145058		Approved	MGC7036, FLJ30380, FLJ32372	uc001uey.1	Q969X0		ENST00000280571.8:c.530G>T	12.37:g.123907666C>A	ENSP00000280571:p.Arg177Ile			Missense_Mutation	SNP	pfam_RILP	p.R177I	ENST00000280571.8	37	c.530	CCDS9248.1	12	.	.	.	.	.	.	.	.	.	.	C	13.33	2.204037	0.38905	.	.	ENSG00000150977	ENST00000280571	T	0.44482	0.92	5.06	2.24	0.28232	.	0.687691	0.14704	N	0.303400	T	0.33731	0.0873	L	0.51422	1.61	0.09310	N	1	P	0.40515	0.719	B	0.39217	0.294	T	0.13202	-1.0518	10	0.42905	T	0.14	.	5.8952	0.18935	0.0:0.5358:0.2968:0.1674	.	177	Q969X0	RIPL2_HUMAN	I	177	ENSP00000280571:R177I	ENSP00000280571:R177I	R	-	2	0	RILPL2	122473619	0.526000	0.26298	0.000000	0.03702	0.122000	0.20287	0.546000	0.23284	0.256000	0.21614	-0.872000	0.02987	AGA	RILPL2	-	pfam_RILP	ENSG00000150977		0.413	RILPL2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RILPL2	HGNC	protein_coding		-	0.00	52	0	C	NM_145058		123907666	-1	tier1	-	no_errors	ENST00000280571	ensembl	human	known	74_37	missense	11.36	39	5	SNP	0.003	A
RIN2	54453	genome.wustl.edu	37	20	19981592	19981592	+	3'UTR	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr20:19981592G>A	ENST00000255006.6	+	0	2996				RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_3'UTR	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2						endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						AGACAGGCGGGACTTCCCAGT	0.527																																																	0													35.0	36.0	36.0					20																	19981592		1964	4152	6116	SO:0001624	3_prime_UTR_variant	0			AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.*12G>A	20.37:g.19981592G>A			Q00425|Q5TFT8|Q9BQL3|Q9H071	RNA	SNP	-	NULL	ENST00000255006.6	37	NULL	CCDS56182.1	20																																																																																			RIN2	-	-	ENSG00000132669		0.527	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	HGNC	protein_coding	OTTHUMT00000078212.1	-	0.00	27	0	G			19981592	+1	tier1	-	no_errors	ENST00000484638	ensembl	human	known	74_37	rna	23.53	13	4	SNP	0.001	A
RNFT2	84900	genome.wustl.edu	37	12	117204678	117204678	+	Silent	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:117204678C>G	ENST00000257575.4	+	6	920	c.687C>G	c.(685-687)ctC>ctG	p.L229L	RNFT2_ENST00000392549.2_Silent_p.L229L|RNFT2_ENST00000407967.3_Silent_p.L229L|RNFT2_ENST00000319176.7_Silent_p.L229L			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	229						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		GGAACACCCTCTATGTGCTTT	0.537																																																	0													129.0	91.0	104.0					12																	117204678		2203	4300	6503	SO:0001819	synonymous_variant	0			AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.687C>G	12.37:g.117204678C>G			E9PAM7|Q96SU5	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.L229	ENST00000257575.4	37	c.687	CCDS44987.1	12																																																																																			RNFT2	-	NULL	ENSG00000135119		0.537	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNFT2	HGNC	protein_coding	OTTHUMT00000320417.1	-	0.00	63	0	C	NM_032814		117204678	+1	tier1	-	no_errors	ENST00000257575	ensembl	human	known	74_37	silent	18.57	57	13	SNP	0.580	G
RP1	6101	genome.wustl.edu	37	8	55538983	55538983	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:55538983G>C	ENST00000220676.1	+	4	2689	c.2541G>C	c.(2539-2541)ttG>ttC	p.L847F		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	847					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.L847F(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CTGGGTATTTGAGAGGAATGG	0.343																																					Colon(91;1014 1389 7634 14542 40420)												1	Substitution - Missense(1)	cervix(1)											43.0	46.0	45.0					8																	55538983		2203	4298	6501	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.2541G>C	8.37:g.55538983G>C	ENSP00000220676:p.Leu847Phe			Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.L847F	ENST00000220676.1	37	c.2541	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	G	14.80	2.643723	0.47258	.	.	ENSG00000104237	ENST00000220676	T	0.57107	0.42	5.63	4.74	0.60224	.	0.386417	0.19167	N	0.121046	T	0.49830	0.1580	L	0.60455	1.87	0.31176	N	0.702584	P	0.51933	0.949	P	0.44696	0.458	T	0.61681	-0.7013	10	0.87932	D	0	.	7.26	0.26197	0.1085:0.0:0.7256:0.1659	.	847	P56715	RP1_HUMAN	F	847	ENSP00000220676:L847F	ENSP00000220676:L847F	L	+	3	2	RP1	55701536	0.755000	0.28372	0.973000	0.42090	0.852000	0.48524	1.622000	0.36997	1.306000	0.44926	0.655000	0.94253	TTG	RP1	-	NULL	ENSG00000104237		0.343	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	-	0.00	19	0	G	NM_006269		55538983	+1	tier1	-	no_errors	ENST00000220676	ensembl	human	known	74_37	missense	36.36	21	12	SNP	0.895	C
RPAP1	26015	genome.wustl.edu	37	15	41816047	41816047	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr15:41816047C>T	ENST00000304330.4	-	17	2474	c.2358G>A	c.(2356-2358)gaG>gaA	p.E786E	RPAP1_ENST00000561603.1_Silent_p.E786E	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	786						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CTCTCCACATCTCAGGTCTGG	0.612																																																	0													38.0	36.0	37.0					15																	41816047		2203	4300	6503	SO:0001819	synonymous_variant	0			BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.2358G>A	15.37:g.41816047C>T			Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Silent	SNP	pfam_RNA_pol_II_AP1_C,pfam_RNA_pol_II_AP1_N,superfamily_ARM-type_fold	p.E786	ENST00000304330.4	37	c.2358	CCDS10079.1	15																																																																																			RPAP1	-	NULL	ENSG00000103932		0.612	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAP1	HGNC	protein_coding	OTTHUMT00000252694.2	-	0.00	35	0	C	NM_015540		41816047	-1	tier1	-	no_errors	ENST00000304330	ensembl	human	known	74_37	silent	36.67	38	22	SNP	0.003	T
RPRD1A	55197	genome.wustl.edu	37	18	33606966	33606966	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr18:33606966C>T	ENST00000399022.4	-	6	857	c.686G>A	c.(685-687)aGa>aAa	p.R229K	RPRD1A_ENST00000357384.4_Missense_Mutation_p.R229K|RPRD1A_ENST00000588737.1_Missense_Mutation_p.R193K|RPRD1A_ENST00000337059.5_Missense_Mutation_p.R193K|RPRD1A_ENST00000319040.6_Missense_Mutation_p.R229K|RPRD1A_ENST00000590898.1_Missense_Mutation_p.R193K	NM_018170.3	NP_060640.2	Q96P16	RPR1A_HUMAN	regulation of nuclear pre-mRNA domain containing 1A	229					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(2)	12						TGCCGCCAATCTGCCATTGTA	0.393																																																	0													85.0	80.0	82.0					18																	33606966		2203	4298	6501	SO:0001583	missense	0			AF419845	CCDS11917.1	18q12.2	2012-02-09	2008-08-15		ENSG00000141425	ENSG00000141425			25560	protein-coding gene	gene with protein product	"""cyclin-dependent kinase 2B-inhibitor-related protein"", ""Cyclin-dependent kinase inhibitor 2B-related protein (p15INK4B-related protein)"""	610347				12470661, 22231121	Standard	NM_018170		Approved	P15RS, FLJ10656, HsT3101	uc002kzg.3	Q96P16	OTTHUMG00000132591	ENST00000399022.4:c.686G>A	18.37:g.33606966C>T	ENSP00000381984:p.Arg229Lys		A8KA42|B2RBA3|Q7Z5G8|Q96FY9|Q9NVL4	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_CID_dom	p.R229K	ENST00000399022.4	37	c.686	CCDS11917.1	18	.	.	.	.	.	.	.	.	.	.	C	32	5.159666	0.94686	.	.	ENSG00000141425	ENST00000399022;ENST00000357384;ENST00000337059;ENST00000319040	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.75547	0.3864	M	0.69463	2.115	0.80722	D	1	D;P;D	0.69078	0.997;0.723;0.985	D;P;P	0.63877	0.919;0.465;0.868	T	0.74970	-0.3482	9	0.41790	T	0.15	-11.5558	16.6337	0.85040	0.0:1.0:0.0:0.0	.	229;229;193	Q96P16-2;Q96P16;Q96P16-3	.;RPR1A_HUMAN;.	K	229;229;193;229	.	ENSP00000314602:R229K	R	-	2	0	RPRD1A	31860964	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.734000	0.84928	2.583000	0.87209	0.650000	0.86243	AGA	RPRD1A	-	NULL	ENSG00000141425		0.393	RPRD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPRD1A	HGNC	protein_coding	OTTHUMT00000255802.1	-	0.00	35	0	C	NM_018170		33606966	-1	tier1	-	no_errors	ENST00000357384	ensembl	human	known	74_37	missense	15.22	39	7	SNP	1.000	T
RUNDC3B	154661	genome.wustl.edu	37	7	87258250	87258250	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:87258250C>T	ENST00000338056.3	+	1	522	c.111C>T	c.(109-111)atC>atT	p.I37I	RUNDC3B_ENST00000493037.1_Silent_p.I37I|ABCB1_ENST00000265724.3_Intron|RUNDC3B_ENST00000394654.3_Silent_p.I37I	NM_001134405.1|NM_138290.2	NP_001127877.1|NP_612147.1	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B	37										breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(2)	26	Esophageal squamous(14;0.00164)					GGAACCTGATCACCGTGTGCA	0.726																																																	0													22.0	24.0	23.0					7																	87258250		2195	4295	6490	SO:0001819	synonymous_variant	0				CCDS5609.1, CCDS47635.1, CCDS47636.1	7q21.12	2009-01-14			ENSG00000105784	ENSG00000105784			30286	protein-coding gene	gene with protein product						12645870	Standard	NM_138290		Approved	RPIP9, RPIB9	uc003ujb.3	Q96NL0	OTTHUMG00000131035	ENST00000338056.3:c.111C>T	7.37:g.87258250C>T			B4DFD0|E9PBR4|Q8IWW5|Q8NB55|Q8TBG7	Silent	SNP	pfam_Run,smart_Run,pfscan_Run	p.I37	ENST00000338056.3	37	c.111	CCDS5609.1	7																																																																																			RUNDC3B	-	NULL	ENSG00000105784		0.726	RUNDC3B-001	KNOWN	basic|CCDS	protein_coding	RUNDC3B	HGNC	protein_coding	OTTHUMT00000253679.1	-	0.00	23	0	C	NM_138290		87258250	+1	tier1	-	no_errors	ENST00000338056	ensembl	human	known	74_37	silent	33.33	10	5	SNP	1.000	T
RXRG	6258	genome.wustl.edu	37	1	165377516	165377516	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:165377516C>T	ENST00000359842.5	-	8	1388	c.1086G>A	c.(1084-1086)caG>caA	p.Q362Q	RXRG_ENST00000470566.1_5'Flank	NM_001256570.1|NM_006917.4	NP_001243499.1|NP_008848.1	P48443	RXRG_HUMAN	retinoid X receptor, gamma	362	Ligand-binding. {ECO:0000250}.				gene expression (GO:0010467)|heart development (GO:0007507)|neuron differentiation (GO:0030182)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|skeletal muscle tissue development (GO:0007519)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	9-cis retinoic acid receptor activity (GO:0004886)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(6)|lung(22)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	38	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tretinoin(DB00755)	ACTTGTCCATCTGCATGTCTT	0.483																																																	0													165.0	146.0	152.0					1																	165377516		2203	4300	6503	SO:0001819	synonymous_variant	0			U38480	CCDS1248.1, CCDS72970.1	1q22-q23	2013-01-16			ENSG00000143171	ENSG00000143171		"""Nuclear hormone receptors"""	10479	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 3"""	180247				8034312	Standard	NR_033824		Approved	NR2B3	uc001gda.3	P48443	OTTHUMG00000034626	ENST00000359842.5:c.1086G>A	1.37:g.165377516C>T			A6NIP1|Q6IBU7	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Nuc_recep-AF1,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoid-X_rcpt/HNF4,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_COUP_TF	p.Q362	ENST00000359842.5	37	c.1086	CCDS1248.1	1																																																																																			RXRG	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Retinoid-X_rcpt/HNF4,prints_Str_hrmn_rcpt	ENSG00000143171		0.483	RXRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RXRG	HGNC	protein_coding	OTTHUMT00000083794.2	-	0.00	61	0	C	NM_006917		165377516	-1	tier1	-	no_errors	ENST00000359842	ensembl	human	known	74_37	silent	25.66	84	29	SNP	1.000	T
RYR2	6262	genome.wustl.edu	37	1	237954760	237954760	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:237954760G>A	ENST00000366574.2	+	93	13825	c.13508G>A	c.(13507-13509)aGa>aAa	p.R4503K	RYR2_ENST00000542537.1_Missense_Mutation_p.R4487K|RYR2_ENST00000360064.6_Missense_Mutation_p.R4509K	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4503					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TACAACATGAGAATGTTAGCC	0.333																																																	0													204.0	178.0	186.0					1																	237954760		1850	4093	5943	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.13508G>A	1.37:g.237954760G>A	ENSP00000355533:p.Arg4503Lys		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.R4509K	ENST00000366574.2	37	c.13526	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	18.89	3.719392	0.68844	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.94457	-3.43;-3.43;-3.43	4.66	3.74	0.42951	Ryanodine Receptor TM 4-6 (1);	0.000000	0.64402	U	0.000014	D	0.92974	0.7764	N	0.21508	0.67	0.80722	D	1	D	0.57257	0.979	D	0.71414	0.973	D	0.88966	0.3397	10	0.06099	T	0.92	.	13.2861	0.60243	0.0777:0.0:0.9223:0.0	.	4503	Q92736	RYR2_HUMAN	K	4503;4509;4487	ENSP00000355533:R4503K;ENSP00000353174:R4509K;ENSP00000443798:R4487K	ENSP00000353174:R4509K	R	+	2	0	RYR2	236021383	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	1.097000	0.41459	0.555000	0.69702	AGA	RYR2	-	pfam_Ryanrecept_TM4-6	ENSG00000198626		0.333	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	82	0	G	NM_001035		237954760	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	20.00	72	18	SNP	1.000	A
RYR2	6262	genome.wustl.edu	37	1	237955559	237955559	+	Missense_Mutation	SNP	G	G	A	rs371157286		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:237955559G>A	ENST00000366574.2	+	94	14035	c.13718G>A	c.(13717-13719)cGt>cAt	p.R4573H	RYR2_ENST00000542537.1_Missense_Mutation_p.R4557H|RYR2_ENST00000360064.6_Missense_Mutation_p.R4579H	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4573					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CCCACGTTGCGTATCTTAGCT	0.468																																																	0								G	HIS/ARG	0,4168		0,0,2084	71.0	77.0	75.0		13718	5.5	0.9	1		75	1,8419		0,1,4209	no	missense	RYR2	NM_001035.2	29	0,1,6293	AA,AG,GG		0.0119,0.0,0.0079	benign	4573/4968	237955559	1,12587	2084	4210	6294	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.13718G>A	1.37:g.237955559G>A	ENSP00000355533:p.Arg4573His		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.R4579H	ENST00000366574.2	37	c.13736	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.487955	0.84854	0.0	1.19E-4	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000536033	D;D;D	0.94497	-3.44;-3.44;-3.44	5.49	5.49	0.81192	Ryanodine Receptor TM 4-6 (1);	0.000000	0.53938	U	0.000049	D	0.90926	0.7148	L	0.41236	1.265	0.43279	D	0.995249	B;B	0.18310	0.001;0.027	B;B	0.15484	0.003;0.013	D	0.86913	0.2062	10	0.46703	T	0.11	-13.5457	13.0177	0.58768	0.0738:0.0:0.9262:0.0	.	6;4573	F5H3C7;Q92736	.;RYR2_HUMAN	H	4573;4579;4557;6	ENSP00000355533:R4573H;ENSP00000353174:R4579H;ENSP00000443798:R4557H	ENSP00000353174:R4579H	R	+	2	0	RYR2	236022182	1.000000	0.71417	0.939000	0.37840	0.985000	0.73830	4.812000	0.62613	2.731000	0.93534	0.650000	0.86243	CGT	RYR2	-	pfam_Ryanrecept_TM4-6	ENSG00000198626		0.468	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	35	0	G	NM_001035		237955559	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	14.29	29	5	SNP	0.987	A
SATB2	23314	genome.wustl.edu	37	2	200298187	200298187	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:200298187C>G	ENST00000417098.1	-	3	1036	c.220G>C	c.(220-222)Gaa>Caa	p.E74Q	SATB2_ENST00000457245.1_Missense_Mutation_p.E74Q|SATB2_ENST00000428695.1_Missense_Mutation_p.E74Q|SATB2_ENST00000443023.1_Intron|SATB2_ENST00000260926.5_Missense_Mutation_p.E74Q	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	74					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TTGTCATATTCAAGAGAGCCG	0.468																																					Colon(30;262 767 11040 24421 36230)												0													113.0	112.0	113.0					2																	200298187		2203	4300	6503	SO:0001583	missense	0			AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.220G>C	2.37:g.200298187C>G	ENSP00000401112:p.Glu74Gln		A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.E74Q	ENST00000417098.1	37	c.220	CCDS2327.1	2	.	.	.	.	.	.	.	.	.	.	C	15.89	2.966656	0.53507	.	.	ENSG00000119042	ENST00000417098;ENST00000260926;ENST00000428695;ENST00000457245	T;T;T;T	0.53857	0.6;0.6;0.6;0.6	5.86	5.86	0.93980	.	0.234965	0.39020	N	0.001496	T	0.59555	0.2202	L	0.29908	0.895	0.35902	D	0.830477	B;D	0.63046	0.004;0.992	B;P	0.61003	0.004;0.882	T	0.61758	-0.6997	10	0.33940	T	0.23	-12.825	18.3607	0.90374	0.0:1.0:0.0:0.0	.	74;74	Q3ZB87;Q9UPW6	.;SATB2_HUMAN	Q	74	ENSP00000401112:E74Q;ENSP00000260926:E74Q;ENSP00000388581:E74Q;ENSP00000405420:E74Q	ENSP00000260926:E74Q	E	-	1	0	SATB2	200006432	1.000000	0.71417	0.990000	0.47175	0.963000	0.63663	7.506000	0.81665	2.777000	0.95525	0.655000	0.94253	GAA	SATB2	-	NULL	ENSG00000119042		0.468	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SATB2	HGNC	protein_coding	OTTHUMT00000256140.1	-	0.00	21	0	C	NM_015265		200298187	-1	tier1	-	no_errors	ENST00000260926	ensembl	human	known	74_37	missense	21.21	26	7	SNP	0.997	G
SEC24D	9871	genome.wustl.edu	37	4	119649764	119649764	+	Silent	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr4:119649764G>C	ENST00000280551.6	-	22	3148	c.2910C>G	c.(2908-2910)ctC>ctG	p.L970L	SEC24D_ENST00000429811.2_3'UTR|SEC24D_ENST00000505134.1_5'UTR|SEC24D_ENST00000511481.1_Silent_p.L601L|SEC24D_ENST00000379735.5_Silent_p.L971L			O94855	SC24D_HUMAN	SEC24 family member D	970					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						TTATCATTCTGAGTTGTTGAG	0.299																																																	0													145.0	140.0	141.0					4																	119649764		2203	4298	6501	SO:0001819	synonymous_variant	0			AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.2910C>G	4.37:g.119649764G>C			Q8IYI7	Silent	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom	p.L971	ENST00000280551.6	37	c.2913	CCDS3710.1	4																																																																																			SEC24D	-	pfam_Gelsolin_dom	ENSG00000150961		0.299	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24D	HGNC	protein_coding	OTTHUMT00000256514.4	-	0.00	32	0	G			119649764	-1	tier1	-	no_errors	ENST00000379735	ensembl	human	known	74_37	silent	20.93	34	9	SNP	1.000	C
SEMA3E	9723	genome.wustl.edu	37	7	82997166	82997166	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:82997166C>A	ENST00000307792.3	-	17	2531	c.2064G>T	c.(2062-2064)gaG>gaT	p.E688D	SEMA3E_ENST00000427262.1_Missense_Mutation_p.E628D	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	688					axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				GATGCCTGTCCTCCTCATCGT	0.478																																																	0													146.0	123.0	131.0					7																	82997166		2203	4300	6503	SO:0001583	missense	0			AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.2064G>T	7.37:g.82997166C>A	ENSP00000303212:p.Glu688Asp		B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom,pfscan_Ig-like_dom	p.E688D	ENST00000307792.3	37	c.2064	CCDS34674.1	7	.	.	.	.	.	.	.	.	.	.	C	6.294	0.422422	0.11928	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514	T;T	0.31769	1.53;1.48	5.68	1.37	0.22104	.	0.729939	0.13611	N	0.375114	T	0.18718	0.0449	N	0.22421	0.69	0.44309	D	0.997187	B	0.02656	0.0	B	0.04013	0.001	T	0.08229	-1.0732	10	0.15066	T	0.55	.	11.2836	0.49210	0.0:0.5939:0.0:0.4061	.	688	O15041	SEM3E_HUMAN	D	688;628;688	ENSP00000303212:E688D;ENSP00000405052:E628D	ENSP00000303212:E688D	E	-	3	2	SEMA3E	82835102	0.764000	0.28473	0.430000	0.26722	0.074000	0.17049	-0.076000	0.11412	0.355000	0.24131	-0.335000	0.08231	GAG	SEMA3E	-	NULL	ENSG00000170381		0.478	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3E	HGNC	protein_coding	OTTHUMT00000336606.1	-	0.00	87	0	C	NM_012431		82997166	-1	tier1	-	no_errors	ENST00000307792	ensembl	human	known	74_37	missense	28.00	53	21	SNP	0.995	A
SEMA4C	54910	genome.wustl.edu	37	2	97530058	97530058	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:97530058C>G	ENST00000305476.5	-	10	1156	c.1024G>C	c.(1024-1026)Gag>Cag	p.E342Q		NM_017789.4	NP_060259.4	Q9C0C4	SEM4C_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C	342	Dominant negative effect on myogenic differentiation. {ECO:0000250}.|Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell migration in hindbrain (GO:0021535)|cerebellum development (GO:0021549)|muscle cell differentiation (GO:0042692)|neural tube closure (GO:0001843)|positive regulation of stress-activated MAPK cascade (GO:0032874)|semaphorin-plexin signaling pathway (GO:0071526)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle membrane (GO:0030672)	receptor activity (GO:0004872)			NS(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	17						TAGGGGCCCTCAAACACCCGC	0.612																																																	0													105.0	106.0	106.0					2																	97530058		2203	4300	6503	SO:0001583	missense	0			AB051526	CCDS2029.1	2q11.2	2013-01-11			ENSG00000168758	ENSG00000168758		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10731	protein-coding gene	gene with protein product	"""M-Sema F"""	604462		SEMAI		7656991	Standard	NM_017789		Approved	Semacl1, Semaf	uc002sxh.4	Q9C0C4	OTTHUMG00000130535	ENST00000305476.5:c.1024G>C	2.37:g.97530058C>G	ENSP00000306844:p.Glu342Gln		Q32MJ3|Q7Z5X0	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,pfscan_Semap_dom,pfscan_Ig-like_dom	p.E342Q	ENST00000305476.5	37	c.1024	CCDS2029.1	2	.	.	.	.	.	.	.	.	.	.	C	17.94	3.512269	0.64522	.	.	ENSG00000168758	ENST00000305476	T	0.12039	2.72	5.34	5.34	0.76211	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.051380	0.85682	D	0.000000	T	0.24005	0.0581	M	0.69185	2.1	0.49483	D	0.999797	P;P	0.38250	0.624;0.624	B;B	0.43445	0.42;0.42	T	0.01021	-1.1478	10	0.33141	T	0.24	.	17.8022	0.88591	0.0:1.0:0.0:0.0	.	342;52	Q9C0C4;Q6P5A5	SEM4C_HUMAN;.	Q	342	ENSP00000306844:E342Q	ENSP00000306844:E342Q	E	-	1	0	SEMA4C	96893785	0.998000	0.40836	0.994000	0.49952	0.949000	0.60115	4.059000	0.57470	2.501000	0.84356	0.561000	0.74099	GAG	SEMA4C	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000168758		0.612	SEMA4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4C	HGNC	protein_coding	OTTHUMT00000252957.1	-	0.00	58	0	C	NM_017789		97530058	-1	tier1	-	no_errors	ENST00000305476	ensembl	human	known	74_37	missense	6.17	76	5	SNP	1.000	G
SEMA6B	10501	genome.wustl.edu	37	19	4548164	4548164	+	Silent	SNP	G	G	T	rs543932524		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:4548164G>T	ENST00000586582.1	-	14	1786	c.1476C>A	c.(1474-1476)ggC>ggA	p.G492G	SEMA6B_ENST00000301293.3_Silent_p.G492G|SEMA6B_ENST00000586965.1_Silent_p.G492G|RN7SL121P_ENST00000584223.1_RNA	NM_032108.3	NP_115484.2	Q9H3T3	SEM6B_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B	492	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCTGTCTCGCCACCGCCGG	0.697																																																	0													14.0	15.0	15.0					19																	4548164		2184	4281	6465	SO:0001819	synonymous_variant	0			AB022433	CCDS12131.1	19p13.3	2008-07-22				ENSG00000167680		"""Semaphorins"""	10739	protein-coding gene	gene with protein product	"""Sema VIb"", ""semaphorin Z"", ""semaphorin VIB"""	608873		SEMAN		9361278	Standard	NM_032108		Approved	semaZ, SEMA-VIB, SEM-SEMA-Y	uc010dud.2	Q9H3T3		ENST00000586582.1:c.1476C>A	19.37:g.4548164G>T			A5PKU4|F6IB19|Q9NRK9	Silent	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,pfscan_Semap_dom	p.G492	ENST00000586582.1	37	c.1476	CCDS12131.1	19																																																																																			SEMA6B	-	superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000167680		0.697	SEMA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA6B	HGNC	protein_coding	OTTHUMT00000458656.2		0.00	45	0	G	NM_032108		4548164	-1			no_errors	ENST00000301293	ensembl	human	known	74_37	silent	7.69	36	3	SNP	0.783	T
SERPINB10	5273	genome.wustl.edu	37	18	61584739	61584739	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr18:61584739delA	ENST00000238508.3	+	3	277	c.218delA	c.(217-219)gaafs	p.E73fs		NM_005024.1	NP_005015.1	P48595	SPB10_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 10	73					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R76fs*7(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(3)|stomach(2)	24		Esophageal squamous(42;0.131)				CCTGAAAGTGAAAAAAAAAGG	0.284																																																	1	Deletion - Frameshift(1)	large_intestine(1)								39,129,4010		1,0,37,2,125,1924	26.0	26.0	26.0			5.3	1.0	18		27	67,232,7845		0,0,67,0,232,3773	no	codingComplex	SERPINB10	NM_005024.1		1,0,104,2,357,5697	A1A1,A1A2,A1R,A2A2,A2R,RR		3.6714,4.0211,3.79			61584739	106,361,11855	2173	4255	6428	SO:0001589	frameshift_variant	0			U35459	CCDS11990.1	18q21.3	2014-02-18	2005-08-18		ENSG00000242550	ENSG00000242550		"""Serine (or cysteine) peptidase inhibitors"""	8942	protein-coding gene	gene with protein product	"""protease inhibitor 10 (ovalbumin type, bomapin)"""	602058	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10"""	PI10		9268635, 10871600, 24172014	Standard	NM_005024		Approved	bomapin		P48595	OTTHUMG00000060594	ENST00000238508.3:c.218delA	18.37:g.61584739delA	ENSP00000238508:p.Glu73fs		Q4VAX4|Q4VAX7	Frame_Shift_Del	DEL	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.R76fs	ENST00000238508.3	37	c.218	CCDS11990.1	18																																																																																			SERPINB10	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000242550		0.284	SERPINB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB10	HGNC	protein_coding	OTTHUMT00000134012.3		0.00	31	0	A	NM_005024		61584739	+1	tier1		no_errors	ENST00000238508	ensembl	human	known	74_37	frame_shift_del	10.00	27	3	DEL	0.998	-
SH2B1	25970	genome.wustl.edu	37	16	28877776	28877776	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:28877776G>T	ENST00000322610.8	+	4	800	c.361G>T	c.(361-363)Ggc>Tgc	p.G121C	SH2B1_ENST00000359285.5_Missense_Mutation_p.G121C|SH2B1_ENST00000538342.1_Intron|SH2B1_ENST00000337120.5_Missense_Mutation_p.G121C|SH2B1_ENST00000545570.1_Intron|SH2B1_ENST00000563674.1_Intron|SH2B1_ENST00000395532.4_Missense_Mutation_p.G121C			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1	121	Interaction with JAK2 (low-affinity binding; independent of JAK2 phosphorylation). {ECO:0000250}.|Interaction with RAC1. {ECO:0000250}.|Required for NGF signaling. {ECO:0000250}.				blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.G121C(2)		endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						GGCTGTGCTGGGCCCTTCTCG	0.632																																																	2	Substitution - Missense(2)	lung(2)											43.0	41.0	42.0					16																	28877776		2197	4300	6497	SO:0001583	missense	0			AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2		ENST00000322610.8:c.361G>T	16.37:g.28877776G>T	ENSP00000321221:p.Gly121Cys		A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Missense_Mutation	SNP	pfam_Phe_ZIP,pfam_Pleckstrin_homology,pfam_SH2,superfamily_Phe_ZIP,smart_Pleckstrin_homology,smart_SH2,pfscan_SH2,prints_SH2	p.G121C	ENST00000322610.8	37	c.361	CCDS53996.1	16	.	.	.	.	.	.	.	.	.	.	g	17.72	3.459297	0.63401	.	.	ENSG00000178188	ENST00000322610;ENST00000359285;ENST00000395532;ENST00000337120	T;T;T;T	0.50548	0.74;0.75;0.76;0.76	4.77	4.77	0.60923	.	0.000000	0.64402	D	0.000003	T	0.56156	0.1966	N	0.24115	0.695	0.36958	D	0.893201	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.957;0.998;0.956	T	0.66532	-0.5900	10	0.66056	D	0.02	-31.6327	16.6033	0.84821	0.0:0.0:1.0:0.0	.	121;121;121	Q9NRF2-2;Q9NRF2-3;Q9NRF2	.;.;SH2B1_HUMAN	C	121	ENSP00000321221:G121C;ENSP00000352232:G121C;ENSP00000378903:G121C;ENSP00000337163:G121C	ENSP00000321221:G121C	G	+	1	0	SH2B1	28785277	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.159000	0.71856	2.208000	0.71279	0.436000	0.28706	GGC	SH2B1	-	NULL	ENSG00000178188		0.632	SH2B1-001	KNOWN	basic|CCDS	protein_coding	SH2B1	HGNC	protein_coding	OTTHUMT00000432666.1		0.00	12	0	G	NM_015503		28877776	+1			no_errors	ENST00000322610	ensembl	human	known	74_37	missense	8.00	23	2	SNP	1.000	T
SHANK2	22941	genome.wustl.edu	37	11	70332425	70332425	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:70332425C>G	ENST00000423696.2	-	15	2872	c.2836G>C	c.(2836-2838)Gac>Cac	p.D946H	SHANK2_ENST00000409161.1_Missense_Mutation_p.D729H|SHANK2_ENST00000449833.2_Missense_Mutation_p.D730H|SHANK2_ENST00000338508.4_Missense_Mutation_p.D1326H			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	946					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			AGGGCGTTGTCCAGCTTAGTG	0.587																																																	0													116.0	103.0	107.0					11																	70332425		2200	4294	6494	SO:0001583	missense	0			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.2836G>C	11.37:g.70332425C>G	ENSP00000394536:p.Asp946His		C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.D1326H	ENST00000423696.2	37	c.3976		11	.	.	.	.	.	.	.	.	.	.	C	7.156	0.584825	0.13749	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	T;T;T;T;T;T	0.19938	2.11;2.11;2.11;2.11;2.11;2.11	5.24	4.32	0.51571	.	612.597000	0.00166	N	0.000000	T	0.32285	0.0824	L	0.34521	1.04	0.35531	D	0.802279	P;P;P	0.46706	0.523;0.883;0.654	P;P;P	0.52424	0.503;0.506;0.698	T	0.01834	-1.1264	10	0.48119	T	0.1	.	10.1033	0.42517	0.0:0.7751:0.1498:0.0751	.	946;1325;730	Q9UPX8;Q9UPX8-3;Q9UPX8-4	SHAN2_HUMAN;.;.	H	730;729;604;1326;946;964;949	ENSP00000399423:D730H;ENSP00000386491:D729H;ENSP00000402944:D604H;ENSP00000345193:D1326H;ENSP00000394536:D946H;ENSP00000294018:D949H	ENSP00000294018:D949H	D	-	1	0	SHANK2	70010073	0.012000	0.17670	0.001000	0.08648	0.080000	0.17528	2.573000	0.46007	1.169000	0.42739	-0.311000	0.09066	GAC	SHANK2	-	NULL	ENSG00000162105		0.587	SHANK2-203	KNOWN	basic	protein_coding	SHANK2	HGNC	protein_coding		-	0.00	33	0	C	NM_012309		70332425	-1	tier1	-	no_errors	ENST00000338508	ensembl	human	known	74_37	missense	27.27	32	12	SNP	0.023	G
SHPRH	257218	genome.wustl.edu	37	6	146268631	146268631	+	Missense_Mutation	SNP	C	C	T	rs577017273		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:146268631C>T	ENST00000367505.2	-	6	1474	c.1210G>A	c.(1210-1212)Gag>Aag	p.E404K	SHPRH_ENST00000275233.7_Missense_Mutation_p.E404K|SHPRH_ENST00000438092.2_Missense_Mutation_p.E404K|SHPRH_ENST00000367503.3_Missense_Mutation_p.E404K			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	404					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		CCTCCTACCTCGGGAAGAGTG	0.448																																																	0													133.0	130.0	131.0					6																	146268631		1952	4143	6095	SO:0001583	missense	0			AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.1210G>A	6.37:g.146268631C>T	ENSP00000356475:p.Glu404Lys		Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Histone_H1/H5_H15,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,superfamily_WW_dom,smart_Helicase_ATP-bd,smart_Histone_H1/H5_H15,smart_Znf_PHD,smart_Znf_RING,smart_Helicase_C,pfscan_Znf_RING,pfscan_Helicase_C	p.E404K	ENST00000367505.2	37	c.1210	CCDS43513.2	6	.	.	.	.	.	.	.	.	.	.	C	23.8	4.460174	0.84317	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233;ENST00000444767	T;T;T;T	0.74106	-0.81;-0.81;-0.8;-0.81	5.4	5.4	0.78164	DEAD-like helicase (1);	0.082034	0.49916	D	0.000131	T	0.78710	0.4326	L	0.54323	1.7	0.54753	D	0.999986	D;D;D;D	0.89917	0.996;0.998;0.998;1.0	P;D;P;D	0.66716	0.734;0.916;0.863;0.946	T	0.72453	-0.4289	10	0.21540	T	0.41	-24.1199	19.547	0.95302	0.0:1.0:0.0:0.0	.	293;404;404;293	Q149N8-2;Q149N8;Q149N8-4;F8WEL0	.;SHPRH_HUMAN;.;.	K	404;404;404;404;293	ENSP00000356475:E404K;ENSP00000356473:E404K;ENSP00000412797:E404K;ENSP00000275233:E404K	ENSP00000275233:E404K	E	-	1	0	SHPRH	146310324	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.677000	0.68142	2.693000	0.91896	0.585000	0.79938	GAG	SHPRH	-	superfamily_P-loop_NTPase,smart_Helicase_ATP-bd	ENSG00000146414		0.448	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHPRH	HGNC	protein_coding	OTTHUMT00000042571.2	-	0.00	33	0	C	NM_173082		146268631	-1	tier1	-	no_errors	ENST00000367503	ensembl	human	known	74_37	missense	26.32	28	10	SNP	1.000	T
SIRPB1	10326	genome.wustl.edu	37	20	1592043	1592044	+	Intron	DEL	CA	CA	-	rs369003673|rs373671792		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr20:1592043_1592044delCA	ENST00000381605.4	-	1	141				SIRPB1_ENST00000381603.3_Intron|RP4-576H24.4_ENST00000564763.1_Intron|SIRPB1_ENST00000381596.1_5'UTR|SIRPB1_ENST00000279477.7_Frame_Shift_Del_p.V131fs|SIRPB1_ENST00000568365.1_Frame_Shift_Del_p.V131fs	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1						cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						ACTTAAACTCCACGTGGTCGGG	0.515																																																	0									,,	231,1407		113,5,701					,,	2.7	0.0			85	326,4880		161,4,2438	no	intron,frameshift,intron	SIRPB1	NM_006065.3,NM_001135844.2,NM_001083910.2	,,	274,9,3139	A1A1,A1R,RR		6.262,14.1026,8.1385	,,	,,		557,6287				SO:0001627	intron_variant	0			Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.76+8470TG>-	20.37:g.1592043_1592044delCA			A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Frame_Shift_Del	DEL	pfam_Ig_C1-set,pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_C1-set,pfscan_Ig-like_dom	p.V131fs	ENST00000381605.4	37	c.393_392	CCDS13019.1	20																																																																																			SIRPB1	-	pfam_Ig_V-set,smart_Ig_sub	ENSG00000101307		0.515	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIRPB1	HGNC	protein_coding	OTTHUMT00000077555.2		0.00	60	0	CA	NM_006065		1592044	-1			no_errors	ENST00000279477	ensembl	human	known	74_37	frame_shift_del	12.73	48	7	DEL	0.021:0.003	0
SIRPB1	10326	genome.wustl.edu	37	20	1592048	1592048	+	Intron	DEL	G	G	-	rs372728073|rs45545343	byFrequency	TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr20:1592048delG	ENST00000381605.4	-	1	141				SIRPB1_ENST00000381603.3_Intron|RP4-576H24.4_ENST00000564763.1_Intron|SIRPB1_ENST00000381596.1_5'UTR|SIRPB1_ENST00000279477.7_Frame_Shift_Del_p.H130fs|SIRPB1_ENST00000568365.1_Frame_Shift_Del_p.H130fs	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1						cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						AACTCCACGTGGTCGGGGCTC	0.517																																																	0									,,	293,1373		143,7,683	110.0	108.0	108.0		,,	1.4	0.0	20		91	398,4888		193,12,2438	no	intron,frameshift,intron	SIRPB1	NM_006065.3,NM_001135844.2,NM_001083910.2	,,	336,19,3121	A1A1,A1R,RR		7.5293,17.587,9.9396	,,	,,	1592048	691,6261	242	939	1181	SO:0001627	intron_variant	0			Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.76+8466C>-	20.37:g.1592048delG			A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Frame_Shift_Del	DEL	pfam_Ig_C1-set,pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_C1-set,pfscan_Ig-like_dom	p.H130fs	ENST00000381605.4	37	c.388	CCDS13019.1	20																																																																																			SIRPB1	-	pfam_Ig_V-set,smart_Ig_sub	ENSG00000101307		0.517	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIRPB1	HGNC	protein_coding	OTTHUMT00000077555.2		0.00	59	0	G	NM_006065		1592048	-1			no_errors	ENST00000279477	ensembl	human	known	74_37	frame_shift_del	12.07	51	7	DEL	0.000	0
SIGLEC1	6614	genome.wustl.edu	37	20	3674093	3674093	+	Splice_Site	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr20:3674093C>T	ENST00000344754.4	-	13	3508		c.e13+1		SIGLEC1_ENST00000202578.4_Splice_Site	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin						cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.?(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						GCCAGACTCACAGAGGACGTC	0.647																																																	1	Unknown(1)	ovary(1)											27.0	32.0	30.0					20																	3674093		2202	4300	6502	SO:0001630	splice_region_variant	0			AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3508+1G>A	20.37:g.3674093C>T			Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Splice_Site	SNP	-	e13+1	ENST00000344754.4	37	c.3508+1	CCDS13060.1	20	.	.	.	.	.	.	.	.	.	.	C	12.79	2.044315	0.36085	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9452	0.71026	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SIGLEC1	3622093	1.000000	0.71417	1.000000	0.80357	0.244000	0.25665	4.214000	0.58527	2.612000	0.88384	0.655000	0.94253	.	SIGLEC1	-	-	ENSG00000088827		0.647	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC1	HGNC	protein_coding	OTTHUMT00000077761.2	-	0.00	70	0	C	NM_023068	Intron	3674093	-1	tier1	-	no_errors	ENST00000344754	ensembl	human	known	74_37	splice_site	13.56	51	8	SNP	1.000	T
SLC22A4	6583	genome.wustl.edu	37	5	131657980	131657980	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:131657980C>T	ENST00000200652.3	+	4	930	c.756C>T	c.(754-756)ttC>ttT	p.F252F	AC034220.3_ENST00000417795.1_RNA	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	252					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	TTGCTTACTTCATCAGAGACT	0.522																																																	0													150.0	136.0	141.0					5																	131657980		2203	4300	6503	SO:0001819	synonymous_variant	0			AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.756C>T	5.37:g.131657980C>T			O14546	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.F252	ENST00000200652.3	37	c.756	CCDS4153.1	5																																																																																			SLC22A4	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000197208		0.522	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A4	HGNC	protein_coding	OTTHUMT00000132661.1	-	0.00	132	0	C	NM_003059		131657980	+1	tier1	-	no_errors	ENST00000200652	ensembl	human	known	74_37	silent	23.03	126	38	SNP	1.000	T
SLC26A4	5172	genome.wustl.edu	37	7	107334901	107334901	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:107334901G>A	ENST00000265715.3	+	11	1541	c.1317G>A	c.(1315-1317)ggG>ggA	p.G439G	SLC26A4_ENST00000480841.1_3'UTR|SLC26A4_ENST00000543100.1_Silent_p.G8G|SLC26A4_ENST00000544569.1_Silent_p.G26G|SLC26A4_ENST00000541474.1_Intron	NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	439					chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						TTGCCCTGGGGAAGCTTCTGG	0.478									Pendred syndrome																																								0													186.0	166.0	173.0					7																	107334901		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Goiter-Deafness syndrome	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.1317G>A	7.37:g.107334901G>A			B7Z266|O43170	Silent	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.G439	ENST00000265715.3	37	c.1317	CCDS5746.1	7																																																																																			SLC26A4	-	pfam_Sulph_transpt,tigrfam_SulP_transpt	ENSG00000091137		0.478	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A4	HGNC	protein_coding	OTTHUMT00000337148.1	-	0.00	46	0	G	NM_000441		107334901	+1	tier1	-	no_errors	ENST00000265715	ensembl	human	known	74_37	silent	20.00	44	11	SNP	0.998	A
SLC30A10	55532	genome.wustl.edu	37	1	220088979	220088979	+	Missense_Mutation	SNP	G	G	A	rs375331656		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:220088979G>A	ENST00000366926.3	-	4	1431	c.1270C>T	c.(1270-1272)Cac>Tac	p.H424Y	SLC30A10_ENST00000536446.1_Missense_Mutation_p.H179Y|SLC30A10_ENST00000484079.1_5'UTR	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	424					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		CCATTGACGTGAGCCAGAGGC	0.557																																					Colon(76;360 1614 43677 51136)												0								G	TYR/HIS	1,4405	2.1+/-5.4	0,1,2202	96.0	93.0	94.0		1270	6.0	0.8	1		94	0,8600		0,0,4300	no	missense	SLC30A10	NM_018713.2	83	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	424/486	220088979	1,13005	2203	4300	6503	SO:0001583	missense	0			AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.1270C>T	1.37:g.220088979G>A	ENSP00000355893:p.His424Tyr		Q49AL9|Q9NPW0	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.H424Y	ENST00000366926.3	37	c.1270	CCDS31026.1	1	.	.	.	.	.	.	.	.	.	.	G	8.378	0.836933	0.16891	2.27E-4	0.0	ENSG00000196660	ENST00000366926;ENST00000536446	T;T	0.64085	-0.08;0.5	6.02	6.02	0.97574	.	0.200424	0.35466	N	0.003192	T	0.46092	0.1375	L	0.27053	0.805	0.24168	N	0.995635	P	0.38335	0.627	B	0.34489	0.184	T	0.45145	-0.9281	9	.	.	.	-24.2878	11.7403	0.51788	0.0:0.2332:0.6423:0.1245	.	424	Q6XR72	ZNT10_HUMAN	Y	424;179	ENSP00000355893:H424Y;ENSP00000439489:H179Y	.	H	-	1	0	SLC30A10	218155602	0.976000	0.34144	0.835000	0.33067	0.176000	0.22953	1.465000	0.35299	2.857000	0.98124	0.650000	0.86243	CAC	SLC30A10	-	NULL	ENSG00000196660		0.557	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A10	HGNC	protein_coding	OTTHUMT00000357709.1	-	0.00	31	0	G	NM_018713		220088979	-1	tier1	-	no_errors	ENST00000366926	ensembl	human	known	74_37	missense	25.71	52	18	SNP	0.217	A
SLC38A6	145389	genome.wustl.edu	37	14	61519096	61519096	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:61519096G>T	ENST00000267488.4	+	16	1436	c.1320G>T	c.(1318-1320)ttG>ttT	p.L440F	SLC38A6_ENST00000456840.2_Intron|SLC38A6_ENST00000354886.2_Intron	NM_153811.2	NP_722518.2	Q8IZM9	S38A6_HUMAN	solute carrier family 38, member 6	440					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)		p.L440F(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.0981)		TTGGAATTTTGGTTGGGAATT	0.259																																																	1	Substitution - Missense(1)	lung(1)											87.0	83.0	84.0					14																	61519096		2197	4290	6487	SO:0001583	missense	0			AF070578	CCDS9751.1, CCDS53900.1	14q23.1	2013-05-22			ENSG00000139974	ENSG00000139974		"""Solute carriers"""	19863	protein-coding gene	gene with protein product							Standard	NM_153811		Approved	NAT-1	uc001xfh.2	Q8IZM9	OTTHUMG00000140335	ENST00000267488.4:c.1320G>T	14.37:g.61519096G>T	ENSP00000267488:p.Leu440Phe		C9JWA6|Q86SY5	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.L440F	ENST00000267488.4	37	c.1320	CCDS9751.1	14	.	.	.	.	.	.	.	.	.	.	G	13.50	2.257051	0.39896	.	.	ENSG00000139974	ENST00000267488;ENST00000529212	T;T	0.02974	4.09;4.09	5.17	3.2	0.36748	.	.	.	.	.	T	0.04003	0.0112	L	0.33339	1.005	0.80722	D	1	P	0.40211	0.707	P	0.46758	0.526	T	0.53201	-0.8472	9	0.49607	T	0.09	.	6.7388	0.23424	0.1659:0.0:0.653:0.1811	.	440	Q8IZM9	S38A6_HUMAN	F	440;213	ENSP00000267488:L440F;ENSP00000437190:L213F	ENSP00000267488:L440F	L	+	3	2	SLC38A6	60588849	1.000000	0.71417	0.999000	0.59377	0.943000	0.58893	1.080000	0.30779	1.398000	0.46701	0.650000	0.86243	TTG	SLC38A6	-	pfam_AA_transpt_TM	ENSG00000139974		0.259	SLC38A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A6	HGNC	protein_coding	OTTHUMT00000276957.1		0.00	12	0	G			61519096	+1			no_errors	ENST00000267488	ensembl	human	known	74_37	missense	15.38	11	2	SNP	0.986	T
SLC39A4	55630	genome.wustl.edu	37	8	145637923	145637923	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:145637923C>T	ENST00000301305.3	-	12	2048	c.1943G>A	c.(1942-1944)tGa>tAa	p.*648*	SLC39A4_ENST00000276833.5_Silent_p.*623*|SLC39A4_ENST00000531013.1_5'UTR|GS1-393G12.14_ENST00000607491.1_RNA	NM_130849.2	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter), member 4	0					cellular response to zinc ion starvation (GO:0034224)|cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	14	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			GGCAGGGTATCAGAAGGTGAT	0.607																																																	0													160.0	167.0	165.0					8																	145637923		2203	4300	6503	SO:0001819	synonymous_variant	0			AK025537	CCDS6424.1, CCDS43782.1	8q24.3	2013-05-22			ENSG00000147804	ENSG00000147804		"""Solute carriers"""	17129	protein-coding gene	gene with protein product		607059	"""acrodermatitis enteropathica, zinc-deficiency type"""	AEZ		12801924, 12659941, 14709598	Standard	NM_017767		Approved	ZIP4, AWMS2	uc003zcq.3	Q6P5W5		ENST00000301305.3:c.1943G>A	8.37:g.145637923C>T			Q7L5S5|Q9H6T8|Q9NXC4	Silent	SNP	pfam_ZIP	p.*648	ENST00000301305.3	37	c.1943	CCDS6424.1	8																																																																																			SLC39A4	-	NULL	ENSG00000147804		0.607	SLC39A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC39A4	HGNC	protein_coding	OTTHUMT00000382688.1	-	0.00	108	0	C			145637923	-1	tier1	-	no_errors	ENST00000301305	ensembl	human	known	74_37	silent	7.00	186	14	SNP	0.998	T
SLC4A2	6522	genome.wustl.edu	37	7	150768592	150768592	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:150768592G>A	ENST00000485713.1	+	14	3131	c.2091G>A	c.(2089-2091)ctG>ctA	p.L697L	SLC4A2_ENST00000413384.2_Silent_p.L697L|SLC4A2_ENST00000310317.5_Silent_p.L615L|SLC4A2_ENST00000392826.2_Silent_p.L688L|SLC4A2_ENST00000461735.1_Silent_p.L683L	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	697					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCCACTACCTGAGTGACTTCC	0.637																																																	0													53.0	54.0	54.0					7																	150768592		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.2091G>A	7.37:g.150768592G>A			B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Silent	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange,prints_Anion_exchange_2,tigrfam_HCO3_transpt_euk	p.L697	ENST00000485713.1	37	c.2091	CCDS5917.1	7																																																																																			SLC4A2	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk	ENSG00000164889		0.637	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC4A2	HGNC	protein_coding	OTTHUMT00000351039.1	-	0.00	43	0	G	NM_003040		150768592	+1	tier1	-	no_errors	ENST00000413384	ensembl	human	known	74_37	silent	13.33	39	6	SNP	1.000	A
SLC50A1	55974	genome.wustl.edu	37	1	155110171	155110171	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:155110171C>A	ENST00000368404.4	+	4	479	c.417C>A	c.(415-417)agC>agA	p.S139R	SLC50A1_ENST00000484157.1_Missense_Mutation_p.S74R|SLC50A1_ENST00000368401.5_Missense_Mutation_p.S84R|SLC50A1_ENST00000368405.3_Intron|SLC50A1_ENST00000303343.8_Intron	NM_018845.3	NP_061333.2	Q9BRV3	SWET1_HUMAN	solute carrier family 50 (sugar efflux transporter), member 1	139	MtN3/slv 2.				carbohydrate transport (GO:0008643)|DNA recombination (GO:0006310)|glucoside transport (GO:0042946)|positive regulation of gene expression, epigenetic (GO:0045815)	endomembrane system (GO:0012505)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucoside transmembrane transporter activity (GO:0042947)			endometrium(1)|lung(1)|ovary(1)|skin(1)	4						TCACCATCAGCATGTACCTCT	0.542																																																	0													82.0	81.0	82.0					1																	155110171		2203	4300	6503	SO:0001583	missense	0			AF126023, AF126024	CCDS1093.1, CCDS44238.1, CCDS44239.1, CCDS72929.1, CCDS72930.1	1q22	2013-07-17	2013-07-17	2010-11-30	ENSG00000169241	ENSG00000169241		"""Solute carriers"""	30657	protein-coding gene	gene with protein product	"""stromal cell protein"""	613683	"""recombination activating gene 1 activating protein 1"""	RAG1AP1		21107422	Standard	NM_018845		Approved	SCP, RP11-540D14.5, slv, RZPDo834D038D, HsSWEET1, SWEET1	uc001fhj.4	Q9BRV3	OTTHUMG00000035333	ENST00000368404.4:c.417C>A	1.37:g.155110171C>A	ENSP00000357389:p.Ser139Arg		Q5SR64|Q6IAK6|Q96DC5|Q9UHQ2|Q9UHQ3	Missense_Mutation	SNP	pfam_SWEET_sugar_transpr	p.S139R	ENST00000368404.4	37	c.417	CCDS1093.1	1	.	.	.	.	.	.	.	.	.	.	C	19.17	3.776664	0.70107	.	.	ENSG00000169241	ENST00000484157;ENST00000368404;ENST00000368401	.	.	.	4.98	2.94	0.34122	.	0.208111	0.56097	D	0.000022	T	0.66066	0.2752	M	0.87682	2.9	0.52099	D	0.999945	D;P	0.53745	0.962;0.645	P;P	0.57204	0.815;0.532	T	0.67417	-0.5676	9	0.25106	T	0.35	-10.9482	11.8607	0.52465	0.0:0.8919:0.0:0.1081	.	84;139	Q9BRV3-2;Q9BRV3	.;SWET1_HUMAN	R	74;139;84	.	ENSP00000357386:S84R	S	+	3	2	SLC50A1	153376795	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.805000	0.38883	0.641000	0.30601	0.655000	0.94253	AGC	SLC50A1	-	pfam_SWEET_sugar_transpr	ENSG00000169241		0.542	SLC50A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC50A1	HGNC	protein_coding	OTTHUMT00000085505.1	-	0.00	57	0	C	NM_018845		155110171	+1	tier1	-	no_errors	ENST00000368404	ensembl	human	known	74_37	missense	26.47	75	27	SNP	1.000	A
SLC5A12	159963	genome.wustl.edu	37	11	26719966	26719966	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr11:26719966G>A	ENST00000396005.3	-	7	1247	c.938C>T	c.(937-939)tCa>tTa	p.S313L	SLC5A12_ENST00000280467.6_Missense_Mutation_p.S313L	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	313					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						GTCTGGTGCTGAGATGATGCC	0.473																																																	0													99.0	93.0	95.0					11																	26719966		2203	4299	6502	SO:0001583	missense	0			BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.938C>T	11.37:g.26719966G>A	ENSP00000379326:p.Ser313Leu		Q86UC7	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.S313L	ENST00000396005.3	37	c.938	CCDS7860.2	11	.	.	.	.	.	.	.	.	.	.	G	17.22	3.333514	0.60853	.	.	ENSG00000148942	ENST00000396005;ENST00000280467;ENST00000533617	D;D;D	0.88046	-2.33;-2.33;-2.33	5.98	4.03	0.46877	.	0.075956	0.53938	D	0.000042	D	0.90075	0.6900	M	0.88241	2.94	0.36582	D	0.873584	B;B	0.27700	0.039;0.186	B;B	0.37387	0.067;0.248	D	0.92021	0.5626	10	0.66056	D	0.02	.	11.7433	0.51804	0.0648:0.0:0.8119:0.1234	.	313;313	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	L	313;313;125	ENSP00000379326:S313L;ENSP00000280467:S313L;ENSP00000435053:S125L	ENSP00000280467:S313L	S	-	2	0	SLC5A12	26676542	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	4.756000	0.62205	1.514000	0.48869	0.585000	0.79938	TCA	SLC5A12	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000148942		0.473	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A12	HGNC	protein_coding	OTTHUMT00000319681.1	-	0.00	31	0	G	NM_178498		26719966	-1	tier1	-	no_errors	ENST00000396005	ensembl	human	known	74_37	missense	26.83	30	11	SNP	0.986	A
SLC9A4	389015	genome.wustl.edu	37	2	103120146	103120146	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:103120146C>T	ENST00000295269.4	+	3	1417	c.960C>T	c.(958-960)ctC>ctT	p.L320L		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	320					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						CTGAAACCCTCTATCTCTCCG	0.428																																																	0													147.0	139.0	141.0					2																	103120146		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.960C>T	2.37:g.103120146C>T			Q69YK0	Silent	SNP	pfam_Cation/H_exchanger,prints_NaH_exchanger,prints_Na/H_exchanger_2,tigrfam_NaH_exchanger	p.L320	ENST00000295269.4	37	c.960	CCDS33264.1	2																																																																																			SLC9A4	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000180251		0.428	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A4	HGNC	protein_coding	OTTHUMT00000329498.1		0.00	31	0	C	NM_001011552.3		103120146	+1			no_errors	ENST00000295269	ensembl	human	known	74_37	silent	5.88	64	4	SNP	0.999	T
SLC9C1	285335	genome.wustl.edu	37	3	111997672	111997672	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr3:111997672C>T	ENST00000305815.5	-	4	474	c.222G>A	c.(220-222)atG>atA	p.M74I	SLC9C1_ENST00000487372.1_Missense_Mutation_p.M74I|SLC9C1_ENST00000467397.1_5'UTR	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	74				M -> I (in Ref. 1; BAC87265). {ECO:0000305}.	cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										AGTCTGGACTCATCCATTGTA	0.323																																																	0													116.0	125.0	122.0					3																	111997672		2202	4300	6502	SO:0001583	missense	0			AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.222G>A	3.37:g.111997672C>T	ENSP00000306627:p.Met74Ile		Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	pfam_Cation/H_exchanger,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.M74I	ENST00000305815.5	37	c.222	CCDS33817.1	3	.	.	.	.	.	.	.	.	.	.	C	4.647	0.120356	0.08881	.	.	ENSG00000172139	ENST00000305815;ENST00000487372;ENST00000486574	T;T;T	0.10668	2.85;2.85;2.85	5.14	2.4	0.29515	Cation/H+ exchanger (1);	0.180731	0.39687	N	0.001281	T	0.08268	0.0206	L	0.53249	1.67	0.24245	N	0.995342	B;B	0.17465	0.022;0.022	B;B	0.12837	0.007;0.008	T	0.45396	-0.9264	10	0.02654	T	1	-12.3627	7.4059	0.26991	0.0:0.7248:0.0:0.2752	.	74;74	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	I	74;74;1	ENSP00000306627:M74I;ENSP00000420688:M74I;ENSP00000417274:M1I	ENSP00000306627:M74I	M	-	3	0	SLC9A10	113480362	0.060000	0.20803	0.409000	0.26459	0.058000	0.15608	0.060000	0.14342	0.285000	0.22329	-0.140000	0.14226	ATG	SLC9C1	-	pfam_Cation/H_exchanger	ENSG00000172139		0.323	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9C1	HGNC	protein_coding	OTTHUMT00000354066.1		0.00	27	0	C	NM_183061		111997672	-1			no_errors	ENST00000305815	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.560	T
SMAD9	4093	genome.wustl.edu	37	13	37422854	37422854	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr13:37422854G>A	ENST00000399275.2	-	6	1502	c.1363C>T	c.(1363-1365)Cag>Tag	p.Q455*	SMAD9-AS1_ENST00000437983.2_RNA|SMAD9_ENST00000379826.4_Nonsense_Mutation_p.Q455*|SMAD9_ENST00000350148.5_Nonsense_Mutation_p.Q418*			O15198	SMAD9_HUMAN	SMAD family member 9	455	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cartilage development (GO:0051216)|cellular response to organic cyclic compound (GO:0071407)|hindbrain development (GO:0030902)|intracellular signal transduction (GO:0035556)|midbrain development (GO:0030901)|Mullerian duct regression (GO:0001880)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)	18		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)		GAGCCCATCTGAGTCAGAACT	0.498																																																	0													179.0	174.0	176.0					13																	37422854		2203	4300	6503	SO:0001587	stop_gained	0				CCDS9360.1, CCDS45032.1	13q12-q14	2014-09-17	2006-11-06	2004-05-26	ENSG00000120693	ENSG00000120693		"""SMADs"""	6774	protein-coding gene	gene with protein product		603295	"""MAD, mothers against decapentaplegic homolog 9 (Drosophila)"", ""SMAD, mothers against DPP homolog 9 (Drosophila)"""	MADH6, MADH9		9205116	Standard	NM_001127217		Approved		uc001uvw.3	O15198	OTTHUMG00000016740	ENST00000399275.2:c.1363C>T	13.37:g.37422854G>A	ENSP00000382216:p.Gln455*		A2A2Y6|O14989|Q5TBA1	Nonsense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.Q455*	ENST00000399275.2	37	c.1363	CCDS45032.1	13	.	.	.	.	.	.	.	.	.	.	G	41	8.658060	0.98903	.	.	ENSG00000120693	ENST00000399275;ENST00000350148;ENST00000379826	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.6096	0.91279	0.0:0.0:1.0:0.0	.	.	.	.	X	455;418;455	.	ENSP00000239885:Q418X	Q	-	1	0	SMAD9	36320854	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	9.740000	0.98839	2.711000	0.92665	0.561000	0.74099	CAG	SMAD9	-	superfamily_SMAD_FHA_domain,pfscan_SMAD_dom_Dwarfin-type	ENSG00000120693		0.498	SMAD9-002	KNOWN	basic|CCDS	protein_coding	SMAD9	HGNC	protein_coding	OTTHUMT00000044525.2	-	0.00	29	0	G	NM_005905		37422854	-1	tier1	-	no_errors	ENST00000379826	ensembl	human	known	74_37	nonsense	33.33	20	10	SNP	1.000	A
SNAP91	9892	genome.wustl.edu	37	6	84371233	84371233	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:84371233C>G	ENST00000439399.2	-	5	756	c.440G>C	c.(439-441)aGg>aCg	p.R147T	SNAP91_ENST00000521485.1_Missense_Mutation_p.R147T|SNAP91_ENST00000520302.1_Missense_Mutation_p.R147T|SNAP91_ENST00000369694.2_Missense_Mutation_p.R147T|SNAP91_ENST00000520213.1_Missense_Mutation_p.R147T|SNAP91_ENST00000521743.1_Missense_Mutation_p.R147T|SNAP91_ENST00000428679.2_Missense_Mutation_p.R147T|SNAP91_ENST00000437520.1_Missense_Mutation_p.R147T|SNAP91_ENST00000195649.6_Missense_Mutation_p.R147T	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	147					clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)	p.R147K(2)		breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		TTTCTTCACCCTGGCAAAATC	0.348																																																	2	Substitution - Missense(2)	lung(2)											53.0	50.0	51.0					6																	84371233		1807	4068	5875	SO:0001583	missense	0			AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.440G>C	6.37:g.84371233C>G	ENSP00000400459:p.Arg147Thr		A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	pfam_ANTH_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.R147T	ENST00000439399.2	37	c.440	CCDS47455.1	6	.	.	.	.	.	.	.	.	.	.	C	24.2	4.504772	0.85176	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000521931;ENST00000519779;ENST00000518309;ENST00000369690	T;T;T;T;T;T;T;T;T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4;1.4;1.4;1.4;1.4;1.4;1.4;1.4;1.4	5.13	5.13	0.70059	ENTH/VHS (1);ANTH (1);	0.048531	0.85682	D	0.000000	T	0.48429	0.1499	M	0.86651	2.83	0.51233	D	0.999915	B;P;D;P	0.53885	0.403;0.77;0.963;0.77	B;P;P;P	0.54401	0.172;0.583;0.751;0.583	T	0.58205	-0.7677	10	0.87932	D	0	-13.2673	12.3201	0.54979	0.0:0.9221:0.0:0.0779	.	147;147;147;147	O60641-3;E5RI02;O60641;E1P549	.;.;AP180_HUMAN;.	T	147	ENSP00000429776:R147T;ENSP00000358708:R147T;ENSP00000400459:R147T;ENSP00000195649:R147T;ENSP00000412492:R147T;ENSP00000413277:R147T;ENSP00000428511:R147T;ENSP00000428215:R147T;ENSP00000428026:R147T;ENSP00000430071:R147T;ENSP00000429429:R147T;ENSP00000430441:R147T;ENSP00000358704:R147T	ENSP00000195649:R147T	R	-	2	0	SNAP91	84427952	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.874000	0.63064	2.542000	0.85734	0.563000	0.77884	AGG	SNAP91	-	pfam_ANTH_dom,superfamily_ENTH_VHS	ENSG00000065609		0.348	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SNAP91	HGNC	protein_coding	OTTHUMT00000375296.1	-	0.00	36	0	C			84371233	-1	tier1	-	no_errors	ENST00000369694	ensembl	human	known	74_37	missense	24.14	22	7	SNP	1.000	G
RPL30	6156	genome.wustl.edu	37	8	99054836	99054837	+	Intron	INS	-	-	AAAA	rs3073528|rs143116921|rs56899568		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:99054836_99054837insAAAA	ENST00000521291.1	-	3	445				KB-1208A12.3_ENST00000501016.2_RNA|RPL30_ENST00000523172.1_Intron|RPL30_ENST00000518164.1_Intron|SNORA72_ENST00000384339.1_RNA|RPL30_ENST00000287038.3_Intron|RPL30_ENST00000396070.2_Intron			P62888	RL30_HUMAN	ribosomal protein L30						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(2)|lung(4)|skin(1)	7	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.192)			ATTAGAAAGGCAAAAAAAAAAA	0.361																																																	0																																										SO:0001627	intron_variant	0				CCDS34928.1	8q22	2013-05-09			ENSG00000156482	ENSG00000156482		"""L ribosomal proteins"""	10333	protein-coding gene	gene with protein product		180467				1577483	Standard	NM_000989		Approved	L30	uc003yif.3	P62888	OTTHUMG00000164796	ENST00000521291.1:c.298+35->TTTT	8.37:g.99054841_99054844dupAAAA			B2R591|P04645|Q502Z6	RNA	INS	-	NULL	ENST00000521291.1	37	NULL	CCDS34928.1	8																																																																																			KB-1208A12.3	-	-	ENSG00000245970		0.361	RPL30-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNORA72	Clone_based_vega_gene	protein_coding	OTTHUMT00000380450.1		0.00	23	0	-			99054837	+1	tier1		no_errors	ENST00000501016	ensembl	human	known	74_37	rna	24.24	25	8	INS	0.001:0.049	AAAA
SNRPD2	6633	genome.wustl.edu	37	19	46190949	46190949	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:46190949C>T	ENST00000342669.3	-	3	663	c.219G>A	c.(217-219)atG>atA	p.M73I	SNRPD2_ENST00000585392.1_Missense_Mutation_p.M9I|SNRPD2_ENST00000588301.1_Missense_Mutation_p.M73I|SNRPD2_ENST00000391932.3_Missense_Mutation_p.M63I|SNRPD2_ENST00000587367.1_Missense_Mutation_p.M63I|SNRPD2_ENST00000588599.1_Missense_Mutation_p.M63I|SNRPD2_ENST00000590212.1_3'UTR	NM_004597.5	NP_004588.1	P62316	SMD2_HUMAN	small nuclear ribonucleoprotein D2 polypeptide 16.5kDa	73					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(1)|lung(2)	4		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00546)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.194)		CCTCAGTCCACATCTCCTTCA	0.592																																																	0													141.0	108.0	119.0					19																	46190949		2203	4300	6503	SO:0001583	missense	0				CCDS33053.1, CCDS54281.1	19q13.2-q13.3	2011-10-11	2002-08-29		ENSG00000125743	ENSG00000125743			11159	protein-coding gene	gene with protein product	"""snRNP core protein D2"""	601061	"""small nuclear ribonucleoprotein D2 polypeptide (16.5kD)"""	SNRPD1		7527560, 1701240	Standard	NM_004597		Approved	Sm-D2	uc002pcw.3	P62316		ENST00000342669.3:c.219G>A	19.37:g.46190949C>T	ENSP00000342374:p.Met73Ile		A8K797|J3KPM5|P43330	Missense_Mutation	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	p.M73I	ENST00000342669.3	37	c.219	CCDS33053.1	19	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297939	0.60086	.	.	ENSG00000125743	ENST00000342669;ENST00000391932	T;T	0.39787	1.06;1.06	5.82	5.82	0.92795	Like-Sm ribonucleoprotein (LSM) domain, eukaryotic/archaea-type (1);Like-Sm ribonucleoprotein (LSM) domain (1);Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.000000	0.85682	D	0.000000	T	0.34164	0.0888	L	0.31664	0.95	0.80722	D	1	B	0.24768	0.111	B	0.19391	0.025	T	0.05146	-1.0903	10	0.31617	T	0.26	.	17.587	0.87984	0.0:1.0:0.0:0.0	.	73	P62316	SMD2_HUMAN	I	73;63	ENSP00000342374:M73I;ENSP00000375798:M63I	ENSP00000342374:M73I	M	-	3	0	SNRPD2	50882789	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.146000	0.77373	2.745000	0.94114	0.655000	0.94253	ATG	SNRPD2	-	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	ENSG00000125743		0.592	SNRPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRPD2	HGNC	protein_coding	OTTHUMT00000459648.1	-	0.00	96	0	C	NM_004597		46190949	-1	tier1	-	no_errors	ENST00000342669	ensembl	human	known	74_37	missense	22.55	79	23	SNP	1.000	T
SOS2	6655	genome.wustl.edu	37	14	50649280	50649280	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:50649280C>T	ENST00000216373.5	-	6	1033	c.759G>A	c.(757-759)ttG>ttA	p.L253L	SOS2_ENST00000543680.1_Silent_p.L253L|SOS2_ENST00000555794.1_5'Flank	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	253	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					GTTTCACAGTCAATTCATGTA	0.343																																																	0													72.0	70.0	71.0					14																	50649280		2203	4300	6503	SO:0001819	synonymous_variant	0			L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.759G>A	14.37:g.50649280C>T			B7ZKT6|D3DSB4|Q15503|Q17RN1	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Histone_core_D,superfamily_Ras_GEF_dom,superfamily_Histone-fold,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.L253	ENST00000216373.5	37	c.759	CCDS9697.1	14																																																																																			SOS2	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000100485		0.343	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOS2	HGNC	protein_coding	OTTHUMT00000276878.2		0.00	12	0	C			50649280	-1			no_errors	ENST00000216373	ensembl	human	known	74_37	silent	14.81	23	4	SNP	1.000	T
SOX13	9580	genome.wustl.edu	37	1	204086794	204086794	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:204086794C>T	ENST00000367204.1	+	7	843	c.734C>T	c.(733-735)tCc>tTc	p.S245F	SOX13_ENST00000367203.4_3'UTR	NM_005686.2	NP_005677.2	Q9UN79	SOX13_HUMAN	SRY (sex determining region Y)-box 13	245	Pro-rich.				anatomical structure morphogenesis (GO:0009653)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	13	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			ACCCCTGACTCCCAGCTGGCC	0.572																																																	0													49.0	57.0	54.0					1																	204086794		2081	4218	6299	SO:0001583	missense	0				CCDS44299.1	1q32	2008-07-18			ENSG00000143842	ENSG00000143842		"""SRY (sex determining region Y)-boxes"""	11192	protein-coding gene	gene with protein product	"""islet cell antibody 12"", ""SRY-related HMG-box gene 13"", ""type 1 diabetes autoantigen"", ""SRY-box 13"""	604748				10198172	Standard	NM_005686		Approved	Sox-13, ICA12, MGC117216	uc001ham.3	Q9UN79	OTTHUMG00000036050	ENST00000367204.1:c.734C>T	1.37:g.204086794C>T	ENSP00000356172:p.Ser245Phe		B4E2B0|O95275|O95826|Q3KQV7|Q5SXX1|Q9UHW7	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.S245F	ENST00000367204.1	37	c.734	CCDS44299.1	1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.231317	0.79688	.	.	ENSG00000143842	ENST00000367204	D	0.97850	-4.57	5.05	5.05	0.67936	.	0.167961	0.52532	D	0.000073	D	0.97420	0.9156	L	0.54323	1.7	0.34572	D	0.713564	P;P;P;D	0.59767	0.761;0.877;0.93;0.986	B;B;P;P	0.54100	0.293;0.216;0.483;0.742	D	0.99969	1.1941	10	0.72032	D	0.01	.	15.3165	0.74085	0.0:1.0:0.0:0.0	.	112;112;245;227	B4DX26;B4E3N9;Q9UN79;Q5SXX2	.;.;SOX13_HUMAN;.	F	245	ENSP00000356172:S245F	ENSP00000356172:S245F	S	+	2	0	SOX13	202353417	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.144000	0.64832	2.324000	0.78689	0.460000	0.39030	TCC	SOX13	-	NULL	ENSG00000143842		0.572	SOX13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX13	HGNC	protein_coding	OTTHUMT00000087881.2	-	0.00	33	0	C	NM_005686		204086794	+1	tier1	-	no_errors	ENST00000367204	ensembl	human	known	74_37	missense	22.03	46	13	SNP	1.000	T
SOX14	8403	genome.wustl.edu	37	3	137484324	137484324	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr3:137484324C>T	ENST00000306087.1	+	1	746	c.698C>T	c.(697-699)tCg>tTg	p.S233L		NM_004189.3	NP_004180.1	O95416	SOX14_HUMAN	SRY (sex determining region Y)-box 14	233					entrainment of circadian clock (GO:0009649)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|regulation of neuron migration (GO:2001222)|visual perception (GO:0007601)	nuclear transcription factor complex (GO:0044798)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.S233L(1)		large_intestine(2)|lung(12)	14						GACCCTTATTCGTCAGCCCAC	0.652																																																	1	Substitution - Missense(1)	large_intestine(1)											49.0	40.0	43.0					3																	137484324		2186	4263	6449	SO:0001583	missense	0			AJ006230	CCDS3094.1	3q22-q23	2008-07-18			ENSG00000168875	ENSG00000168875		"""SRY (sex determining region Y)-boxes"""	11193	protein-coding gene	gene with protein product	"""HMG box transcription factor SOX-14"", ""SRY-box 14"""	604747				9925951	Standard	NM_004189		Approved	SOX28	uc003erm.2	O95416	OTTHUMG00000159757	ENST00000306087.1:c.698C>T	3.37:g.137484324C>T	ENSP00000305343:p.Ser233Leu		B2RAC0|Q3KPH7	Missense_Mutation	SNP	pfam_HMG_box_dom,pfam_TF_SOX,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.S233L	ENST00000306087.1	37	c.698	CCDS3094.1	3	.	.	.	.	.	.	.	.	.	.	C	14.04	2.417999	0.42918	.	.	ENSG00000168875	ENST00000306087	D	0.96200	-3.94	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	D	0.88250	0.6386	N	0.03608	-0.345	0.80722	D	1	B	0.06786	0.001	B	0.01281	0.0	D	0.83622	0.0140	10	0.31617	T	0.26	.	17.388	0.87422	0.0:1.0:0.0:0.0	.	233	O95416	SOX14_HUMAN	L	233	ENSP00000305343:S233L	ENSP00000305343:S233L	S	+	2	0	SOX14	138967014	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.602000	0.82796	2.333000	0.79357	0.561000	0.74099	TCG	SOX14	-	NULL	ENSG00000168875		0.652	SOX14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX14	HGNC	protein_coding	OTTHUMT00000357182.1		0.00	49	0	C	NM_004189		137484324	+1			no_errors	ENST00000306087	ensembl	human	known	74_37	missense	8.77	52	5	SNP	1.000	T
SPAG6	9576	genome.wustl.edu	37	10	22690153	22690153	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr10:22690153C>G	ENST00000376624.3	+	9	1403	c.1261C>G	c.(1261-1263)Cta>Gta	p.L421V	SPAG6_ENST00000376603.2_Missense_Mutation_p.L497V|RP11-301N24.3_ENST00000422675.1_RNA|SPAG6_ENST00000313311.6_Missense_Mutation_p.L421V|SPAG6_ENST00000538630.1_Missense_Mutation_p.L396V|SPAG6_ENST00000490361.1_3'UTR|SPAG6_ENST00000376601.1_Missense_Mutation_p.L182V	NM_001253855.1|NM_012443.3	NP_001240784.1|NP_036575.1	O75602	SPAG6_HUMAN	sperm associated antigen 6	421					cell projection organization (GO:0030030)|spermatid development (GO:0007286)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|prostate(1)|skin(2)	27						TGAACCATTTCTATATGATGC	0.353																																																	0													107.0	101.0	103.0					10																	22690153		2203	4300	6503	SO:0001583	missense	0			AF079363	CCDS7139.1, CCDS7140.1, CCDS58071.1, CCDS73072.1	10p12.31	2014-01-21			ENSG00000077327	ENSG00000077327		"""Armadillo repeat containing"""	11215	protein-coding gene	gene with protein product	"""axoneme central apparatus protein"""	605730				10493827	Standard	NM_012443		Approved	Repro-SA-1, pf16, CT141	uc001iri.3	O75602	OTTHUMG00000017808	ENST00000376624.3:c.1261C>G	10.37:g.22690153C>G	ENSP00000365811:p.Leu421Val		A8K1I8|B4DXZ4|Q5VUX5|Q5VUX6|Q5VUX7|Q6FI74|Q8NHQ6	Missense_Mutation	SNP	pfam_Armadillo,pfam_HEAT,pfam_26S_Psome_nonATP_su5,superfamily_ARM-type_fold,smart_Armadillo	p.L497V	ENST00000376624.3	37	c.1489	CCDS7139.1	10	.	.	.	.	.	.	.	.	.	.	C	19.40	3.821293	0.71028	.	.	ENSG00000077327	ENST00000376624;ENST00000376603;ENST00000376601;ENST00000538630;ENST00000456231;ENST00000313311	T;T;T;T;T;T	0.67523	-0.27;-0.27;-0.04;-0.27;-0.04;-0.27	5.11	3.23	0.37069	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69869	0.3159	M	0.75264	2.295	0.54753	D	0.999988	P;P;P;P	0.43477	0.546;0.808;0.675;0.736	B;P;B;B	0.46452	0.2;0.517;0.365;0.2	T	0.74680	-0.3584	10	0.59425	D	0.04	-14.2001	11.6826	0.51466	0.0:0.8679:0.0:0.1321	.	396;497;421;421	B4DXZ4;O75602-3;O75602-2;O75602	.;.;.;SPAG6_HUMAN	V	421;497;182;396;182;421	ENSP00000365811:L421V;ENSP00000365788:L497V;ENSP00000365786:L182V;ENSP00000441325:L396V;ENSP00000411111:L182V;ENSP00000323599:L421V	ENSP00000323599:L421V	L	+	1	2	SPAG6	22730159	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.055000	0.49916	2.385000	0.81259	0.650000	0.86243	CTA	SPAG6	-	superfamily_ARM-type_fold	ENSG00000077327		0.353	SPAG6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG6	HGNC	protein_coding	OTTHUMT00000047187.1		0.00	35	0	C			22690153	+1			no_errors	ENST00000376603	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	G
SPOCK3	50859	genome.wustl.edu	37	4	167656000	167656000	+	3'UTR	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr4:167656000G>C	ENST00000357154.3	-	0	1520				SPOCK3_ENST00000511531.1_3'UTR|SPOCK3_ENST00000512681.1_3'UTR|SPOCK3_ENST00000504953.1_3'UTR|SPOCK3_ENST00000502330.1_3'UTR|SPOCK3_ENST00000421836.2_3'UTR|SPOCK3_ENST00000357545.4_3'UTR|SPOCK3_ENST00000535728.1_3'UTR|SPOCK3_ENST00000511269.1_3'UTR|SPOCK3_ENST00000541354.1_3'UTR|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000510741.1_3'UTR|SPOCK3_ENST00000506886.1_3'UTR	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3						negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		TGGGGAAGAAGATAATTTTAA	0.244																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.*72C>G	4.37:g.167656000G>C			B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	RNA	SNP	-	NULL	ENST00000357154.3	37	NULL	CCDS54817.1	4																																																																																			SPOCK3	-	-	ENSG00000196104		0.244	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCK3	HGNC	protein_coding	OTTHUMT00000364091.1	-	0.00	45	0	G			167656000	-1	tier1	-	no_errors	ENST00000507137	ensembl	human	known	74_37	rna	13.04	40	6	SNP	0.892	C
SPPL3	121665	genome.wustl.edu	37	12	121202843	121202843	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr12:121202843A>G	ENST00000353487.2	-	11	1617	c.1114T>C	c.(1114-1116)Ttc>Ctc	p.F372L		NM_139015.4	NP_620584.2	Q8TCT6	SPPL3_HUMAN	signal peptide peptidase like 3	373						Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)					all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TTGGAGTGGAAAGGCTCAGAC	0.488																																																	0													71.0	64.0	67.0					12																	121202843		2203	4300	6503	SO:0001583	missense	0				CCDS9208.1	12q24.31	2012-02-21			ENSG00000157837	ENSG00000157837			30424	protein-coding gene	gene with protein product	"""intramembrane protease 2"", ""presenilin-like protein 4"""	608240				12139484	Standard	NM_139015		Approved	IMP2, PSL4, MGC90402, MGC126674, MGC126676, DKFZP586C1324	uc001tzd.3	Q8TCT6	OTTHUMG00000169232	ENST00000353487.2:c.1114T>C	12.37:g.121202843A>G	ENSP00000288680:p.Phe372Leu		Q3MJ04|Q8TAU4|Q96DD9	Missense_Mutation	SNP	pfam_Peptidase_A22B_SPP,smart_Preselin/SPP	p.F372L	ENST00000353487.2	37	c.1114	CCDS9208.1	12	.	.	.	.	.	.	.	.	.	.	A	14.25	2.478302	0.44044	.	.	ENSG00000157837	ENST00000353487;ENST00000405631	T	0.17691	2.26	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.31888	0.0811	M	0.65498	2.005	0.80722	D	1	D;B	0.64830	0.994;0.149	P;B	0.54401	0.751;0.048	T	0.03166	-1.1065	10	0.28530	T	0.3	-35.1902	15.477	0.75489	1.0:0.0:0.0:0.0	.	373;372	Q8TCT6;Q3MJ04	PSL4_HUMAN;.	L	372;371	ENSP00000288680:F372L	ENSP00000288680:F372L	F	-	1	0	AC069214.1	119687226	1.000000	0.71417	0.991000	0.47740	0.996000	0.88848	8.730000	0.91510	2.108000	0.64289	0.533000	0.62120	TTC	SPPL3	-	NULL	ENSG00000157837		0.488	SPPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPPL3	HGNC	protein_coding	OTTHUMT00000402980.2		0.00	14	0	A	NM_139015		121202843	-1			no_errors	ENST00000353487	ensembl	human	known	74_37	missense	22.22	14	4	SNP	0.998	G
STC1	6781	genome.wustl.edu	37	8	23702448	23702448	+	Silent	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:23702448G>C	ENST00000290271.2	-	4	862	c.579C>G	c.(577-579)ctC>ctG	p.L193L	STC1_ENST00000524323.1_Silent_p.L124L	NM_003155.2	NP_003146.1	P52823	STC1_HUMAN	stanniocalcin 1	193					bone development (GO:0060348)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cAMP (GO:0071320)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hypoxia (GO:0071456)|chondrocyte proliferation (GO:0035988)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endothelial cell morphogenesis (GO:0001886)|growth plate cartilage axis specification (GO:0003421)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of renal phosphate excretion (GO:1903403)|ossification (GO:0001503)|positive regulation of calcium ion import (GO:0090280)|regulation of anion transport (GO:0044070)|regulation of cardiac muscle cell contraction (GO:0086004)|response to vitamin D (GO:0033280)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		GGATGTGGAAGAGGCTGGCCA	0.522																																																	0													184.0	160.0	168.0					8																	23702448		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6043.1	8p22-p12	2008-06-23			ENSG00000159167	ENSG00000159167			11373	protein-coding gene	gene with protein product		601185		STC		9480753	Standard	NM_003155		Approved		uc003xdw.1	P52823	OTTHUMG00000097853	ENST00000290271.2:c.579C>G	8.37:g.23702448G>C			B4DN22|Q71UE5	Silent	SNP	pfam_Stanniocalcin	p.L193	ENST00000290271.2	37	c.579	CCDS6043.1	8																																																																																			STC1	-	pfam_Stanniocalcin	ENSG00000159167		0.522	STC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STC1	HGNC	protein_coding	OTTHUMT00000215143.1	-	0.00	46	0	G			23702448	-1	tier1	-	no_errors	ENST00000290271	ensembl	human	known	74_37	silent	37.50	35	21	SNP	1.000	C
SYNE2	23224	genome.wustl.edu	37	14	64612848	64612848	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:64612848G>C	ENST00000344113.4	+	84	15758	c.15546G>C	c.(15544-15546)ttG>ttC	p.L5182F	ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Missense_Mutation_p.L1816F|SYNE2_ENST00000358025.3_Missense_Mutation_p.L5182F|SYNE2_ENST00000357395.3_Missense_Mutation_p.L1567F|SYNE2_ENST00000554584.1_Missense_Mutation_p.L5099F|SYNE2_ENST00000394768.2_Missense_Mutation_p.L1567F	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5182					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TACAGATCTTGAACAACTGGC	0.358																																																	0													60.0	66.0	64.0					14																	64612848		2203	4300	6503	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.15546G>C	14.37:g.64612848G>C	ENSP00000341781:p.Leu5182Phe		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L5182F	ENST00000344113.4	37	c.15546	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	15.84	2.952213	0.53293	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;3.62;0.98	5.63	5.63	0.86233	.	0.000000	0.42964	D	0.000623	T	0.65460	0.2693	M	0.82323	2.585	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.995;0.997	T	0.69379	-0.5161	10	0.72032	D	0.01	.	11.1489	0.48447	0.143:0.0:0.857:0.0	.	1567;5099;5182;5182	Q8WXH0-7;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;SYNE2_HUMAN;.	F	5182;1567;5182;5099;5105;1816;1567	ENSP00000350719:L5182F;ENSP00000349969:L1567F;ENSP00000341781:L5182F;ENSP00000452570:L5099F;ENSP00000450831:L1816F;ENSP00000378249:L1567F	ENSP00000261678:L5105F	L	+	3	2	SYNE2	63682601	0.999000	0.42202	1.000000	0.80357	0.476000	0.33039	1.375000	0.34295	2.646000	0.89796	0.655000	0.94253	TTG	SYNE2	-	smart_Spectrin/alpha-actinin	ENSG00000054654		0.358	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	-	0.00	35	0	G	NM_182914		64612848	+1	tier1	-	no_errors	ENST00000358025	ensembl	human	known	74_37	missense	26.32	28	10	SNP	1.000	C
SYNGAP1	8831	genome.wustl.edu	37	6	33408515	33408515	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:33408515G>A	ENST00000418600.2	+	11	1787	c.1686G>A	c.(1684-1686)ccG>ccA	p.P562P	SYNGAP1_ENST00000293748.5_Silent_p.P562P|SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000428982.2_Silent_p.P503P|MIR5004_ENST00000579078.1_RNA	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	562	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.		P -> L (in MRD5; the disease phenotype consists of intellectual disability and autism; the mutant protein is less efficient in inhibiting ERK phosphorylation induced by neuronal activity). {ECO:0000269|PubMed:23161826}.		dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						GCGTGTTCCCGAGGGAGCTGA	0.627																																																	0													21.0	21.0	21.0					6																	33408515		2202	4299	6501	SO:0001819	synonymous_variant	0			AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.1686G>A	6.37:g.33408515G>A			A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Silent	SNP	pfam_DUF3498,pfam_RasGAP,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.P562	ENST00000418600.2	37	c.1686	CCDS34434.2	6																																																																																			SYNGAP1	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,smart_RasGAP,pfscan_RasGAP	ENSG00000197283		0.627	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGAP1	HGNC	protein_coding	OTTHUMT00000076151.4	-	0.00	44	0	G	XM_166407		33408515	+1	tier1	-	no_errors	ENST00000418600	ensembl	human	known	74_37	silent	18.97	47	11	SNP	1.000	A
TAF1B	9014	genome.wustl.edu	37	2	10008430	10008430	+	Nonsense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:10008430C>G	ENST00000263663.5	+	6	613	c.425C>G	c.(424-426)tCa>tGa	p.S142*	TAF1B_ENST00000402170.1_3'UTR|TAF1B_ENST00000396242.3_5'UTR	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	142	N-terminal cyclin fold.				gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CTAAGTCATTCAGACTGGGCT	0.373																																																	0													93.0	81.0	85.0					2																	10008430		2203	4300	6503	SO:0001587	stop_gained	0			L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.425C>G	2.37:g.10008430C>G	ENSP00000263663:p.Ser142*		B4DI42|F8WD72|Q15574|Q8WVC3	Nonsense_Mutation	SNP	pfam_TF_Rrn7	p.S142*	ENST00000263663.5	37	c.425	CCDS33143.1	2	.	.	.	.	.	.	.	.	.	.	C	13.58	2.278773	0.40294	.	.	ENSG00000115750	ENST00000263663;ENST00000402170	.	.	.	5.55	4.67	0.58626	.	0.411149	0.26654	N	0.023193	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.5191	10.3648	0.44017	0.0:0.9121:0.0:0.0879	.	.	.	.	X	142	.	.	S	+	2	0	TAF1B	9925881	0.790000	0.28787	0.180000	0.23079	0.446000	0.32137	3.549000	0.53681	1.580000	0.49851	-0.150000	0.13652	TCA	TAF1B	-	NULL	ENSG00000115750		0.373	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1B	HGNC	protein_coding	OTTHUMT00000323426.2	-	0.00	27	0	C	NM_005680		10008430	+1	tier1	-	no_errors	ENST00000263663	ensembl	human	known	74_37	nonsense	14.29	24	4	SNP	0.457	G
TACR1	6869	genome.wustl.edu	37	2	75425863	75425863	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:75425863C>T	ENST00000305249.5	-	1	963	c.198G>A	c.(196-198)gtG>gtA	p.V66V	TACR1_ENST00000409848.3_Silent_p.V66V	NM_001058.3	NP_001049.1	P25103	NK1R_HUMAN	tachykinin receptor 1	66					acute inflammatory response (GO:0002526)|aggressive behavior (GO:0002118)|angiotensin-mediated drinking behavior (GO:0003051)|associative learning (GO:0008306)|behavioral response to pain (GO:0048266)|detection of abiotic stimulus (GO:0009582)|eating behavior (GO:0042755)|inflammatory response (GO:0006954)|long-term memory (GO:0007616)|operant conditioning (GO:0035106)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of action potential (GO:0045760)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of ossification (GO:0045778)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of saliva secretion (GO:0046878)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|positive regulation of vasoconstriction (GO:0045907)|regulation of smooth muscle cell migration (GO:0014910)|regulation of smooth muscle cell proliferation (GO:0048660)|response to auditory stimulus (GO:0010996)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to heat (GO:0009408)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to progesterone (GO:0032570)|smooth muscle contraction involved in micturition (GO:0060083)|sperm ejaculation (GO:0042713)|tachykinin receptor signaling pathway (GO:0007217)	cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance P receptor activity (GO:0016496)|tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(8)|ovary(1)|skin(1)	24					Aprepitant(DB00673)|Ketamine(DB01221)|Vapreotide(DB04894)	AATAGTTCGTCACTGTCCTCA	0.512																																					Pancreas(64;62 1268 3653 14826 43765)												0													170.0	142.0	151.0					2																	75425863		2203	4300	6503	SO:0001819	synonymous_variant	0			M76675	CCDS1958.1, CCDS46345.1	2p13.1-p12	2012-08-08			ENSG00000115353	ENSG00000115353		"""GPCR / Class A : Tachykinin receptors"""	11526	protein-coding gene	gene with protein product		162323		TAC1R		1657150	Standard	NM_001058		Approved	SPR, NK1R, NKIR	uc002sng.2	P25103	OTTHUMG00000129973	ENST00000305249.5:c.198G>A	2.37:g.75425863C>T			A8K150	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_NK1_rcpt,prints_Neurokn_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NK3_rcpt	p.V66	ENST00000305249.5	37	c.198	CCDS1958.1	2																																																																																			TACR1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_NPY_rcpt	ENSG00000115353		0.512	TACR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACR1	HGNC	protein_coding	OTTHUMT00000252239.3	-	0.00	50	0	C	NM_001058		75425863	-1	tier1	-	no_errors	ENST00000305249	ensembl	human	known	74_37	silent	30.00	56	24	SNP	0.994	T
TBCD	6904	genome.wustl.edu	37	17	80879433	80879433	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:80879433C>T	ENST00000355528.4	+	25	2288	c.2158C>T	c.(2158-2160)Cac>Tac	p.H720Y	TBCD_ENST00000539345.2_Missense_Mutation_p.H720Y|RP11-497H17.1_ENST00000571113.1_lincRNA	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	720					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			CATCTCAAGTCACTCCCGCCA	0.507																																																	0													93.0	98.0	96.0					17																	80879433		2157	4262	6419	SO:0001583	missense	0			BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.2158C>T	17.37:g.80879433C>T	ENSP00000347719:p.His720Tyr		O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	pfam_Tubulin_specific_chaperoneD_C,superfamily_ARM-type_fold	p.H720Y	ENST00000355528.4	37	c.2158	CCDS45818.1	17	.	.	.	.	.	.	.	.	.	.	C	3.258	-0.151758	0.06585	.	.	ENSG00000141556	ENST00000355528;ENST00000334614	T	0.69040	-0.37	4.61	2.26	0.28386	Armadillo-like helical (1);Armadillo-type fold (1);	1.058890	0.07290	N	0.872306	T	0.59032	0.2164	L	0.59436	1.845	0.09310	N	0.999995	P;P;B;B	0.50443	0.935;0.893;0.011;0.072	B;B;B;B	0.40506	0.331;0.127;0.004;0.094	T	0.53085	-0.8488	9	.	.	.	.	4.334	0.11078	0.2848:0.597:0.0:0.1182	.	720;720;720;720	B4DE53;Q9BTW9;Q9BTW9-4;F5H8C7	.;TBCD_HUMAN;.;.	Y	720;471	ENSP00000347719:H720Y	.	H	+	1	0	TBCD	78472722	0.004000	0.15560	0.068000	0.19968	0.087000	0.18053	0.656000	0.24948	1.057000	0.40506	0.585000	0.79938	CAC	TBCD	-	superfamily_ARM-type_fold	ENSG00000141556		0.507	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCD	HGNC	protein_coding	OTTHUMT00000439415.1	-	0.00	57	0	C	NM_005993		80879433	+1	tier1	-	no_errors	ENST00000355528	ensembl	human	known	74_37	missense	13.48	77	12	SNP	0.141	T
TECR	9524	genome.wustl.edu	37	19	14675792	14675792	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:14675792C>T	ENST00000215567.5	+	9	731	c.594C>T	c.(592-594)ctC>ctT	p.L198L	TECR_ENST00000600083.1_Silent_p.L43L|TECR_ENST00000596073.1_Silent_p.L43L|TECR_ENST00000436007.2_Silent_p.L213L	NM_138501.5	NP_612510.1	Q9NZ01	TECR_HUMAN	trans-2,3-enoyl-CoA reductase	198					cellular lipid metabolic process (GO:0044255)|fatty acid elongation (GO:0030497)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|nucleus (GO:0005634)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(1)|large_intestine(1)|ovary(1)	3						AACTGGCGCTCGCCATCTTTG	0.662																																																	0													49.0	55.0	53.0					19																	14675792		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001416	CCDS12313.1	19p13.12	2014-05-27	2009-07-21	2009-07-21	ENSG00000099797	ENSG00000099797			4551	protein-coding gene	gene with protein product		610057	"""glycoprotein, synaptic 2"""	SC2, GPSN2		9653160, 12482854	Standard	NM_138501		Approved	TER, MRT14	uc002mza.3	Q9NZ01		ENST00000215567.5:c.594C>T	19.37:g.14675792C>T			B2RD55|O75350|Q6IBB2|Q9BWK3|Q9Y6P0	Silent	SNP	pfam_3-oxo-5_a-steroid_4-DH_C,pfscan_3-oxo-5_a-steroid_4-DH_C	p.L213	ENST00000215567.5	37	c.639	CCDS12313.1	19																																																																																			TECR	-	pfam_3-oxo-5_a-steroid_4-DH_C,pfscan_3-oxo-5_a-steroid_4-DH_C	ENSG00000099797		0.662	TECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECR	HGNC	protein_coding	OTTHUMT00000466000.1	-	0.00	66	0	C	NM_138501		14675792	+1	tier1	-	no_errors	ENST00000436007	ensembl	human	known	74_37	silent	22.92	37	11	SNP	0.357	T
TINF2	26277	genome.wustl.edu	37	14	24709275	24709276	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:24709275_24709276insTT	ENST00000267415.7	-	8	1556_1557	c.1215_1216insAA	c.(1213-1218)gaaggafs	p.G406fs	TINF2_ENST00000399423.4_3'UTR|TINF2_ENST00000540705.1_Frame_Shift_Ins_p.G371fs|TINF2_ENST00000538777.1_3'UTR|TINF2_ENST00000558566.1_3'UTR|TINF2_ENST00000558510.1_5'Flank	NM_001099274.1	NP_001092744.1	Q9BSI4	TINF2_HUMAN	TERF1 (TRF1)-interacting nuclear factor 2	406					negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of protein ADP-ribosylation (GO:0010836)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of telomere maintenance (GO:0032206)|protein localization to chromosome (GO:0034502)|protein localization to chromosome, telomeric region (GO:0070198)|telomere assembly (GO:0032202)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	chromosome, telomeric region (GO:0000781)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinucleolar chromocenter (GO:0010370)	telomeric DNA binding (GO:0042162)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|prostate(1)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(265;0.0185)		CTCACCTTTCCTTCCCCCTGGC	0.505									Congenital Dyskeratosis;Ataxia Pancytopenia syndrome																																								0																																										SO:0001589	frameshift_variant	0	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita;Myelocerebellar disorder	AF195512	CCDS41936.1, CCDS41937.1	14q12	2008-07-29				ENSG00000092330			11824	protein-coding gene	gene with protein product		604319				10581025, 18252230	Standard	NM_012461		Approved	TIN2	uc001woa.4	Q9BSI4		ENST00000267415.7:c.1214_1215dupAA	14.37:g.24709276_24709277dupTT	ENSP00000267415:p.Gly406fs		B3W5Q7|Q9H904|Q9UHC2	Frame_Shift_Ins	INS	NULL	p.G405fs	ENST00000267415.7	37	c.1216_1215	CCDS41936.1	14																																																																																			TINF2	-	NULL	ENSG00000092330		0.505	TINF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TINF2	HGNC	protein_coding	OTTHUMT00000415406.2		0.00	55	0	-			24709276	-1	tier1		no_errors	ENST00000267415	ensembl	human	known	74_37	frame_shift_ins	22.06	53	15	INS	0.902:0.846	TT
TLN1	7094	genome.wustl.edu	37	9	35706804	35706804	+	Silent	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr9:35706804G>C	ENST00000314888.9	-	38	5402	c.5049C>G	c.(5047-5049)gtC>gtG	p.V1683V	TLN1_ENST00000464379.1_Intron|TLN1_ENST00000540444.1_Silent_p.V1683V	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1683	Interaction with SYNM.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GCTGCTGGCTGACTGCAGCGA	0.537																																																	0													89.0	95.0	93.0					9																	35706804		2203	4300	6503	SO:0001819	synonymous_variant	0			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.5049C>G	9.37:g.35706804G>C			A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Silent	SNP	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.V1683	ENST00000314888.9	37	c.5049	CCDS35009.1	9																																																																																			TLN1	-	superfamily_Vinculin/catenin	ENSG00000137076		0.537	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	HGNC	protein_coding	OTTHUMT00000052353.2		0.00	23	0	G	NM_006289		35706804	-1			no_errors	ENST00000314888	ensembl	human	known	74_37	silent	20.00	16	4	SNP	1.000	C
TMEM61	199964	genome.wustl.edu	37	1	55457722	55457722	+	Silent	SNP	G	G	A	rs149361095	byFrequency	TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:55457722G>A	ENST00000371268.3	+	3	853	c.579G>A	c.(577-579)ccG>ccA	p.P193P	RP11-12C17.2_ENST00000436960.1_RNA	NM_182532.1	NP_872338.1	Q8N0U2	TMM61_HUMAN	transmembrane protein 61	193						integral component of membrane (GO:0016021)				endometrium(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	4						AGACGACACCGAGTGCCACAC	0.597																																																	0								G		0,4406		0,0,2203	110.0	110.0	110.0		579	-5.7	0.0	1	dbSNP_134	110	6,8594	5.0+/-18.6	0,6,4294	no	coding-synonymous	TMEM61	NM_182532.1		0,6,6497	AA,AG,GG		0.0698,0.0,0.0461		193/211	55457722	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	0			BC029775	CCDS601.1	1p32.3	2008-02-05			ENSG00000143001	ENSG00000143001			27296	protein-coding gene	gene with protein product						12477932	Standard	NM_182532		Approved		uc001cyd.3	Q8N0U2	OTTHUMG00000009991	ENST00000371268.3:c.579G>A	1.37:g.55457722G>A				Silent	SNP	NULL	p.P193	ENST00000371268.3	37	c.579	CCDS601.1	1																																																																																			TMEM61	-	NULL	ENSG00000143001		0.597	TMEM61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM61	HGNC	protein_coding	OTTHUMT00000027683.1	-	0.00	22	0	G	NM_182532		55457722	+1	tier1	rs149361095	no_errors	ENST00000371268	ensembl	human	known	74_37	silent	37.50	20	12	SNP	0.000	A
TMCO1	54499	genome.wustl.edu	37	1	165737460	165737460	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:165737460C>T	ENST00000392129.6	-	2	267	c.117G>A	c.(115-117)ctG>ctA	p.L39L	TMCO1_ENST00000367881.5_Silent_p.L90L|RP11-466F5.8_ENST00000423121.1_RNA|TMCO1_ENST00000464650.1_5'UTR|TMCO1_ENST00000580248.1_5'UTR	NM_001256165.1|NM_019026.4	NP_001243094.1|NP_061899.2	Q9UM00	TMCO1_HUMAN	transmembrane and coiled-coil domains 1	39						endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)	9	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)					CTTCTGCCTTCAGTCTCTTGT	0.358																																																	0													182.0	162.0	168.0					1																	165737460		2203	4300	6503	SO:0001819	synonymous_variant	0			AB020980	CCDS1251.1, CCDS1251.2	1q22-q25	2008-02-05	2005-07-13	2005-07-13	ENSG00000143183	ENSG00000143183			18188	protein-coding gene	gene with protein product		614123	"""transmembrane and coiled-coil domains 4"""	TMCC4		8619474, 9110174	Standard	NM_019026		Approved	HP10122	uc001gdj.5	Q9UM00	OTTHUMG00000034672	ENST00000392129.6:c.117G>A	1.37:g.165737460C>T			B2REA0|O75545|Q9BZS3|Q9BZU8	Silent	SNP	pfam_DUF106_TM	p.L90	ENST00000392129.6	37	c.270		1																																																																																			TMCO1	-	pfam_DUF106_TM	ENSG00000143183		0.358	TMCO1-008	KNOWN	basic|appris_principal	protein_coding	TMCO1	HGNC	protein_coding	OTTHUMT00000467850.1	-	0.00	81	0	C	NM_019026		165737460	-1	tier1	-	no_errors	ENST00000367881	ensembl	human	known	74_37	silent	21.55	91	25	SNP	1.000	T
TMX3	54495	genome.wustl.edu	37	18	66381131	66381133	+	In_Frame_Del	DEL	ACA	ACA	-			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	ACA	ACA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr18:66381131_66381133delACA	ENST00000299608.2	-	2	367_369	c.51_53delTGT	c.(49-54)gttgta>gta	p.17_18VV>V	TMX3_ENST00000443099.2_In_Frame_Del_p.17_18VV>V|TMX3_ENST00000562706.1_In_Frame_Del_p.17_18VV>V	NM_019022.3	NP_061895.3	Q96JJ7	TMX3_HUMAN	thioredoxin-related transmembrane protein 3	17					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	17						CATATCAAGTACAACAACTGAAA	0.296																																																	0																																										SO:0001651	inframe_deletion	0			BX647846	CCDS32840.1	18q22	2011-10-19	2009-02-23	2009-02-23		ENSG00000166479		"""Protein disulfide isomerases"""	24718	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 13"""		"""thioredoxin domain containing 10"""	TXNDC10		15623505	Standard	NM_019022		Approved	FLJ20793, KIAA1830, PDIA13	uc002lkf.3	Q96JJ7		ENST00000299608.2:c.51_53delTGT	18.37:g.66381134_66381136delACA	ENSP00000299608:p.Val18del		B3KV75|Q52LT7|Q8N5J0|Q9NWJ9	In_Frame_Del	DEL	pfam_Thioredoxin_domain,pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Thioredoxin	p.V18in_frame_del	ENST00000299608.2	37	c.53_51	CCDS32840.1	18																																																																																			TMX3	-	superfamily_Thioredoxin-like_fold	ENSG00000166479		0.296	TMX3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	TMX3	HGNC	protein_coding	OTTHUMT00000420155.1		0.00	44	0	ACA	NM_019022		66381133	-1	tier1		no_errors	ENST00000299608	ensembl	human	known	74_37	in_frame_del	57.14	12	16	DEL	0.860:0.725:0.720	-
TNPO1	3842	genome.wustl.edu	37	5	72161504	72161504	+	Missense_Mutation	SNP	A	A	G	rs113424229		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:72161504A>G	ENST00000337273.5	+	6	970	c.544A>G	c.(544-546)Atc>Gtc	p.I182V	TNPO1_ENST00000506351.2_Missense_Mutation_p.I174V|TNPO1_ENST00000523768.1_Missense_Mutation_p.I132V|TNPO1_ENST00000454282.1_Missense_Mutation_p.I132V|TNPO1_ENST00000447967.2_Intron	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	182					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		TCCTCTCAACATCATGATTCC	0.353																																																	0													118.0	116.0	117.0					5																	72161504		2202	4300	6502	SO:0001583	missense	0			U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.544A>G	5.37:g.72161504A>G	ENSP00000336712:p.Ile182Val		B4DVC6|Q92957|Q92975	Missense_Mutation	SNP	pfam_HEAT,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.I182V	ENST00000337273.5	37	c.544	CCDS43329.1	5	.	.	.	.	.	.	.	.	.	.	A	9.524	1.109079	0.20714	.	.	ENSG00000083312	ENST00000337273;ENST00000454282;ENST00000523768;ENST00000506351	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	4.89	4.89	0.63831	Armadillo-like helical (1);Armadillo-type fold (1);	0.213279	0.49916	D	0.000133	T	0.40040	0.1101	N	0.16066	0.365	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.26849	-1.0091	10	0.21014	T	0.42	-10.457	7.657	0.28381	0.8387:0.0:0.1613:0.0	.	132;182	Q92973-3;Q92973	.;TNPO1_HUMAN	V	182;132;132;174	ENSP00000336712:I182V;ENSP00000398524:I132V;ENSP00000428899:I132V;ENSP00000425118:I174V	ENSP00000336712:I182V	I	+	1	0	TNPO1	72197260	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.451000	0.44952	1.958000	0.56883	0.528000	0.53228	ATC	TNPO1	-	superfamily_ARM-type_fold	ENSG00000083312		0.353	TNPO1-001	KNOWN	basic|CCDS	protein_coding	TNPO1	HGNC	protein_coding	OTTHUMT00000218577.3	-	0.00	32	0	A	NM_002270		72161504	+1	tier1	rs113424229	no_errors	ENST00000337273	ensembl	human	known	74_37	missense	24.44	34	11	SNP	1.000	G
TNXB	7148	genome.wustl.edu	37	6	32023938	32023938	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:32023938C>G	ENST00000375244.3	-	24	8358	c.8157G>C	c.(8155-8157)gaG>gaC	p.E2719D	TNXB_ENST00000375247.2_Missense_Mutation_p.E2719D			P22105	TENX_HUMAN	tenascin XB	2777	Fibronectin type-III 19. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GGCTGGGGGTCTCTTCCTCTG	0.617																																																	0													32.0	38.0	36.0					6																	32023938		1230	2528	3758	SO:0001583	missense	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.8157G>C	6.37:g.32023938C>G	ENSP00000364393:p.Glu2719Asp		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.E2719D	ENST00000375244.3	37	c.8157		6	.	.	.	.	.	.	.	.	.	.	C	16.06	3.016052	0.54468	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.58210	0.56;0.35	3.97	3.09	0.35607	.	.	.	.	.	T	0.28499	0.0705	M	0.74258	2.255	0.24271	N	0.995242	B	0.31705	0.336	B	0.35550	0.205	T	0.30031	-0.9992	9	0.13108	T	0.6	.	6.6291	0.22847	0.1804:0.7216:0.0:0.0981	.	2719	P22105-3	.	D	2719	ENSP00000364393:E2719D;ENSP00000364396:E2719D	ENSP00000364393:E2719D	E	-	3	2	TNXB	32131916	0.339000	0.24784	0.998000	0.56505	0.800000	0.45204	-0.165000	0.09968	0.857000	0.35407	0.456000	0.33151	GAG	TNXB	-	NULL	ENSG00000168477		0.617	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	-	0.00	42	0	C	NM_019105		32023938	-1	tier1	-	no_errors	ENST00000375247	ensembl	human	known	74_37	missense	28.95	26	11	SNP	1.000	G
TP53	7157	genome.wustl.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	T	C	rs121912666		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr17:7578190T>C	ENST00000269305.4	-	6	848	c.659A>G	c.(658-660)tAt>tGt	p.Y220C	TP53_ENST00000359597.4_Missense_Mutation_p.Y220C|TP53_ENST00000455263.2_Missense_Mutation_p.Y220C|TP53_ENST00000445888.2_Missense_Mutation_p.Y220C|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.Y220C|TP53_ENST00000413465.2_Missense_Mutation_p.Y220C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	220	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:9450901}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y220C(278)|p.Y127C(24)|p.Y220S(12)|p.?(11)|p.0?(8)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y127S(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*2(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGCGGCTCATAGGGCACCAC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	343	Substitution - Missense(315)|Unknown(11)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	ovary(55)|breast(54)|lung(37)|upper_aerodigestive_tract(35)|urinary_tract(19)|oesophagus(19)|large_intestine(17)|liver(17)|central_nervous_system(16)|stomach(15)|haematopoietic_and_lymphoid_tissue(15)|endometrium(14)|soft_tissue(8)|biliary_tract(6)|bone(5)|pancreas(4)|prostate(4)|peritoneum(2)|small_intestine(1)	GRCh37	CM015378|CM951227	TP53	M	rs121912666						102.0	94.0	97.0					17																	7578190		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.659A>G	17.37:g.7578190T>C	ENSP00000269305:p.Tyr220Cys		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Y220C	ENST00000269305.4	37	c.659	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	22.1	4.248510	0.80024	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99840	-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.89287	3.02	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.996;1.0;0.999;0.998;1.0	D	0.96735	0.9542	10	0.87932	D	0	-1.87	13.4753	0.61306	0.0:0.0:0.0:1.0	.	181;220;220;127;220;220;220	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	220;220;220;220;220;220;209;127;88;127	ENSP00000410739:Y220C;ENSP00000352610:Y220C;ENSP00000269305:Y220C;ENSP00000398846:Y220C;ENSP00000391127:Y220C;ENSP00000391478:Y220C;ENSP00000425104:Y88C;ENSP00000423862:Y127C	ENSP00000269305:Y220C	Y	-	2	0	TP53	7518915	1.000000	0.71417	0.585000	0.28666	0.993000	0.82548	6.232000	0.72313	2.128000	0.65567	0.460000	0.39030	TAT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	62	0	T	NM_000546		7578190	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	48.00	26	24	SNP	0.998	C
TPM4	7171	genome.wustl.edu	37	19	16178531	16178531	+	Missense_Mutation	SNP	G	G	A	rs368923322		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:16178531G>A	ENST00000344824.6	+	1	215	c.97G>A	c.(97-99)Gag>Aag	p.E33K	TPM4_ENST00000538887.1_Missense_Mutation_p.E33K|CTD-2231E14.4_ENST00000585520.1_lincRNA	NM_001145160.1	NP_001138632.1	P67936	TPM4_HUMAN	tropomyosin 4	151					cellular component movement (GO:0006928)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|osteoblast differentiation (GO:0001649)	cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|membrane (GO:0016020)|muscle thin filament tropomyosin (GO:0005862)|podosome (GO:0002102)|stress fiber (GO:0001725)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)		TPM4/ALK(12)	breast(1)|large_intestine(3)	4						GAAAGCCGCTGAGGACAAGTG	0.632			T	ALK	ALCL																																			Dom	yes		19	19p13.1	7171	tropomyosin 4		L	0									LYS/GLU	1,3135		0,1,1567	78.0	76.0	76.0		97	2.4	0.8	19		76	0,7164		0,0,3582	no	missense	TPM4	NM_001145160.1	56	0,1,5149	AA,AG,GG		0.0,0.0319,0.0097	benign	33/285	16178531	1,10299	1568	3582	5150	SO:0001583	missense	0				CCDS12338.1, CCDS46007.1	19p13.1	2013-03-11			ENSG00000167460	ENSG00000167460		"""Tropomyosins"""	12013	protein-coding gene	gene with protein product		600317				8641132	Standard	NM_003290		Approved		uc002ndi.2	P67936	OTTHUMG00000182134	ENST00000344824.6:c.97G>A	19.37:g.16178531G>A	ENSP00000345230:p.Glu33Lys		P07226|Q15659|Q5U0D9|Q9BU85|Q9H8Q3|Q9UCS1|Q9UCS2|Q9UCS3|Q9UCS4	Missense_Mutation	SNP	pfam_Tropomyosin,prints_Tropomyosin	p.E33K	ENST00000344824.6	37	c.97	CCDS46007.1	19	.	.	.	.	.	.	.	.	.	.	g	21.1	4.100491	0.76983	3.19E-4	0.0	ENSG00000167460	ENST00000344824;ENST00000538887	D;D	0.90844	-2.74;-2.74	3.45	2.36	0.29203	.	0.000000	0.31554	U	0.007448	D	0.90331	0.6975	.	.	.	0.44694	D	0.997683	P	0.44690	0.841	P	0.47573	0.55	D	0.89512	0.3772	9	0.72032	D	0.01	-13.574	10.5227	0.44929	0.0988:0.0:0.9012:0.0	.	33	P67936-2	.	K	33	ENSP00000345230:E33K;ENSP00000439135:E33K	ENSP00000345230:E33K	E	+	1	0	TPM4	16039531	1.000000	0.71417	0.777000	0.31699	0.729000	0.41735	7.290000	0.78711	0.766000	0.33244	0.450000	0.29827	GAG	TPM4	-	NULL	ENSG00000167460		0.632	TPM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPM4	HGNC	protein_coding	OTTHUMT00000459672.2	-	0.00	41	0	G	NM_003290		16178531	+1	tier1	-	no_errors	ENST00000344824	ensembl	human	known	74_37	missense	11.67	53	7	SNP	0.996	A
TMSB10	9168	genome.wustl.edu	37	2	85133906	85133906	+	IGR	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:85133906G>C	ENST00000233143.4	+	0	492					NM_021103.3	NP_066926.1	P63313	TYB10_HUMAN	thymosin beta 10						actin cytoskeleton organization (GO:0030036)|sequestering of actin monomers (GO:0042989)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)	1						GTGGGTCGCAGAATGGGCTGA	0.502																																																	0																																										SO:0001628	intergenic_variant	0				CCDS1970.1	2p11.2	2008-02-25	2008-02-25		ENSG00000034510	ENSG00000034510			11879	protein-coding gene	gene with protein product		188399				3365256, 10487837	Standard	NM_021103		Approved	TB10	uc002sow.1	P63313	OTTHUMG00000130027		2.37:g.85133906G>C			P13472|Q596K9	RNA	SNP	-	NULL	ENST00000233143.4	37	NULL	CCDS1970.1	2																																																																																			TRABD2A	-	-	ENSG00000186854		0.502	TMSB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRABD2A	HGNC	protein_coding	OTTHUMT00000252302.2	-	0.00	34	0	G	NM_021103		85133906	-1	tier1	-	no_errors	ENST00000474298	ensembl	human	putative	74_37	rna	19.35	25	6	SNP	0.001	C
TRIM10	10107	genome.wustl.edu	37	6	30128405	30128405	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:30128405G>A	ENST00000449742.2	-	1	306	c.231C>T	c.(229-231)aaC>aaT	p.N77N	TRIM10_ENST00000376704.3_Silent_p.N77N|TRIM15_ENST00000376694.4_5'Flank	NM_006778.3	NP_006769.2	Q9UDY6	TRI10_HUMAN	tripartite motif containing 10	77					erythrocyte differentiation (GO:0030218)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)	p.N77K(1)		ovary(1)	1						TCTCCACCACGTTAGCCAGCT	0.582																																																	1	Substitution - Missense(1)	lung(1)											149.0	152.0	151.0					6																	30128405		2203	4300	6503	SO:0001819	synonymous_variant	0			Y07829	CCDS4676.1, CCDS34375.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000204613	ENSG00000204613		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10072	protein-coding gene	gene with protein product		605701	"""tripartite motif-containing 10"""	RNF9		9271628, 10207104	Standard	NM_052828		Approved	RFB30, HERF1	uc003npo.3	Q9UDY6	OTTHUMG00000031295	ENST00000449742.2:c.231C>T	6.37:g.30128405G>A			A6NF84|Q5SRJ5|Q5SRK8|Q86Z08|Q96QB6|Q9C023|Q9C024	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.N77	ENST00000449742.2	37	c.231	CCDS34375.1	6																																																																																			TRIM10	-	NULL	ENSG00000204613		0.582	TRIM10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM10	HGNC	protein_coding	OTTHUMT00000076634.1	-	0.00	69	0	G			30128405	-1	tier1	-	no_errors	ENST00000449742	ensembl	human	known	74_37	silent	9.18	89	9	SNP	0.077	A
TRRAP	8295	genome.wustl.edu	37	7	98601877	98601877	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:98601877G>C	ENST00000359863.4	+	67	10541	c.10332G>C	c.(10330-10332)tgG>tgC	p.W3444C	TRRAP_ENST00000355540.3_Missense_Mutation_p.W3415C|TRRAP_ENST00000446306.3_Missense_Mutation_p.W3433C	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3444					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TGAAAAAGTGGATCAAAATCT	0.383																																																	0													87.0	99.0	95.0					7																	98601877		2203	4300	6503	SO:0001583	missense	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.10332G>C	7.37:g.98601877G>C	ENSP00000352925:p.Trp3444Cys		A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.W3444C	ENST00000359863.4	37	c.10332	CCDS59066.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.9|22.9	4.351003|4.351003	0.82132|0.82132	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000456197|ENST00000359863;ENST00000355540;ENST00000446306	.|D;D	.|0.81579	.|-1.51;-1.51	5.46|5.46	5.46|5.46	0.80206|0.80206	.|Protein kinase-like domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.92237|0.92237	0.7538|0.7538	M|M	0.91972|0.91972	3.26|3.26	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.999;0.991;0.991	D|D	0.93582|0.93582	0.6913|0.6913	5|10	.|0.87932	.|D	.|0	.|.	19.3185|19.3185	0.94226|0.94226	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|3415;3172;3444	.|Q9Y4A5-2;Q59FH1;Q9Y4A5	.|.;.;TRRAP_HUMAN	A|C	3173|3444;3415;3432	.|ENSP00000352925:W3444C;ENSP00000347733:W3415C	.|ENSP00000347733:W3415C	G|W	+|+	2|3	0|0	TRRAP|TRRAP	98439813|98439813	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	9.869000|9.869000	0.99810|0.99810	2.574000|2.574000	0.86865|0.86865	0.650000|0.650000	0.86243|0.86243	GGA|TGG	TRRAP	-	superfamily_Kinase-like_dom	ENSG00000196367		0.383	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	-	0.00	31	0	G	NM_003496		98601877	+1	tier1	-	no_errors	ENST00000359863	ensembl	human	known	74_37	missense	25.53	35	12	SNP	1.000	C
TRRAP	8295	genome.wustl.edu	37	7	98601974	98601974	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:98601974G>A	ENST00000359863.4	+	67	10638	c.10429G>A	c.(10429-10431)Gaa>Aaa	p.E3477K	TRRAP_ENST00000355540.3_Missense_Mutation_p.E3448K|TRRAP_ENST00000446306.3_Missense_Mutation_p.E3466K	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3477					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			ACAGACAGCTGAAGTGGAAAT	0.498																																																	0													89.0	96.0	93.0					7																	98601974		2203	4300	6503	SO:0001583	missense	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.10429G>A	7.37:g.98601974G>A	ENSP00000352925:p.Glu3477Lys		A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E3477K	ENST00000359863.4	37	c.10429	CCDS59066.1	7	.	.	.	.	.	.	.	.	.	.	G	36	5.658754	0.96734	.	.	ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306	T;T	0.80994	-1.44;-1.44	5.61	5.61	0.85477	Protein kinase-like domain (1);	0.052717	0.64402	D	0.000001	D	0.91324	0.7264	M	0.87900	2.915	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.991	D;P;P	0.73708	0.981;0.871;0.828	D	0.92148	0.5726	10	0.72032	D	0.01	.	19.6414	0.95758	0.0:0.0:1.0:0.0	.	3448;3205;3477	Q9Y4A5-2;Q59FH1;Q9Y4A5	.;.;TRRAP_HUMAN	K	3477;3448;3465	ENSP00000352925:E3477K;ENSP00000347733:E3448K	ENSP00000347733:E3448K	E	+	1	0	TRRAP	98439910	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	9.869000	0.99810	2.655000	0.90218	0.650000	0.86243	GAA	TRRAP	-	superfamily_Kinase-like_dom	ENSG00000196367		0.498	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	-	0.00	38	0	G	NM_003496		98601974	+1	tier1	-	no_errors	ENST00000359863	ensembl	human	known	74_37	missense	30.77	27	12	SNP	1.000	A
TSC1	7248	genome.wustl.edu	37	9	135787825	135787825	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr9:135787825G>T	ENST00000298552.3	-	9	978	c.757C>A	c.(757-759)Cat>Aat	p.H253N	TSC1_ENST00000440111.2_Missense_Mutation_p.H253N|TSC1_ENST00000545250.1_Missense_Mutation_p.H202N|TSC1_ENST00000403810.1_Missense_Mutation_p.H253N	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	253					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		ACAACATCATGAGTTTCTAAT	0.418			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																														yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	1	Unknown(1)	bone(1)											123.0	105.0	111.0					9																	135787825		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.757C>A	9.37:g.135787825G>T	ENSP00000298552:p.His253Asn		B7Z897|Q5VVN5	Missense_Mutation	SNP	pfam_Hamartin,superfamily_ARM-type_fold	p.H253N	ENST00000298552.3	37	c.757	CCDS6956.1	9	.	.	.	.	.	.	.	.	.	.	G	27.7	4.859483	0.91433	.	.	ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250;ENST00000537172;ENST00000424271;ENST00000403810	D;D;D;D;D	0.88896	-2.44;-2.44;-2.44;-2.44;-2.44	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.95046	0.8396	M	0.83603	2.65	0.80722	D	1	D;D;P;D;P;D	0.76494	0.999;0.989;0.852;0.981;0.956;0.976	D;D;P;P;D;D	0.87578	0.998;0.944;0.539;0.852;0.955;0.924	D	0.95026	0.8165	10	0.66056	D	0.02	-14.9842	18.9865	0.92773	0.0:0.0:1.0:0.0	.	132;202;253;253;253;253	B7Z604;B7Z897;Q86WV8;Q59IT9;Q32NF0;Q92574	.;.;.;.;.;TSC1_HUMAN	N	253;253;202;132;132;253	ENSP00000298552:H253N;ENSP00000394524:H253N;ENSP00000444017:H202N;ENSP00000438099:H132N;ENSP00000386093:H253N	ENSP00000298552:H253N	H	-	1	0	TSC1	134777646	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.724000	0.93272	0.561000	0.74099	CAT	TSC1	-	pfam_Hamartin	ENSG00000165699		0.418	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSC1	HGNC	protein_coding	OTTHUMT00000054799.1	-	0.00	62	0	G			135787825	-1	tier1	-	no_errors	ENST00000298552	ensembl	human	known	74_37	missense	55.81	19	24	SNP	1.000	T
TSHZ2	128553	genome.wustl.edu	37	20	51872037	51872037	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr20:51872037C>A	ENST00000371497.5	+	2	2927	c.2040C>A	c.(2038-2040)tgC>tgA	p.C680*	TSHZ2_ENST00000603338.2_Nonsense_Mutation_p.C677*|TSHZ2_ENST00000329613.6_Nonsense_Mutation_p.C677*|RP4-678D15.1_ENST00000606932.1_RNA	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	680					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			GCAATGGGTGCGCCCTCGCCA	0.632																																																	0													50.0	47.0	48.0					20																	51872037		2203	4300	6503	SO:0001587	stop_gained	0			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2040C>A	20.37:g.51872037C>A	ENSP00000360552:p.Cys680*		B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Nonsense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.C680*	ENST00000371497.5	37	c.2040	CCDS33490.1	20	.	.	.	.	.	.	.	.	.	.	C	41	8.701216	0.98920	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	.	.	.	5.53	-6.81	0.01704	.	0.049571	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.0834	15.8151	0.78595	0.0:0.5909:0.0:0.4091	.	.	.	.	X	680;677;206	.	ENSP00000333114:C677X	C	+	3	2	TSHZ2	51305444	0.045000	0.20229	0.000000	0.03702	0.008000	0.06430	0.012000	0.13287	-1.850000	0.01169	-0.796000	0.03273	TGC	TSHZ2	-	NULL	ENSG00000182463		0.632	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	HGNC	protein_coding	OTTHUMT00000080398.6		0.00	26	0	C	NM_173485		51872037	+1			no_errors	ENST00000371497	ensembl	human	known	74_37	nonsense	5.26	36	2	SNP	0.018	A
TTC21A	199223	genome.wustl.edu	37	3	39159627	39159627	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr3:39159627G>A	ENST00000431162.2	+	7	918	c.784G>A	c.(784-786)Gaa>Aaa	p.E262K	TTC21A_ENST00000301819.6_Missense_Mutation_p.E262K|TTC21A_ENST00000440121.1_Missense_Mutation_p.E221K			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	262										NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		GCTTGCAAGAGAAGGAAACAT	0.438																																																	0													158.0	156.0	156.0					3																	39159627		1993	4179	6172	SO:0001583	missense	0			AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.784G>A	3.37:g.39159627G>A	ENSP00000398211:p.Glu262Lys		A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Missense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E262K	ENST00000431162.2	37	c.784	CCDS46800.1	3	.	.	.	.	.	.	.	.	.	.	G	27.1	4.801381	0.90538	.	.	ENSG00000168026	ENST00000301819;ENST00000424305;ENST00000431162;ENST00000440121	T;T;T	0.36699	1.24;1.24;2.31	5.43	5.43	0.79202	.	0.070445	0.56097	D	0.000035	T	0.49474	0.1559	L	0.60455	1.87	0.45056	D	0.998075	D;D;D;D;D	0.61697	0.962;0.972;0.99;0.982;0.972	P;P;P;P;P	0.56398	0.68;0.737;0.797;0.631;0.737	T	0.31081	-0.9956	10	0.22109	T	0.4	-14.79	16.7468	0.85474	0.0:0.0:1.0:0.0	.	221;262;262;262;262	Q8NDW8-6;Q8NDW8-5;Q8NDW8-7;Q8NDW8;F5H6V8	.;.;.;TT21A_HUMAN;.	K	262;262;262;221	ENSP00000301819:E262K;ENSP00000398211:E262K;ENSP00000410882:E221K	ENSP00000301819:E262K	E	+	1	0	TTC21A	39134631	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	4.427000	0.59888	2.551000	0.86045	0.563000	0.77884	GAA	TTC21A	-	NULL	ENSG00000168026		0.438	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC21A	HGNC	protein_coding	OTTHUMT00000377829.1		0.00	34	0	G	NM_145755		39159627	+1			no_errors	ENST00000301819	ensembl	human	known	74_37	missense	11.54	23	3	SNP	1.000	A
TUBA3E	112714	genome.wustl.edu	37	2	130949566	130949566	+	Silent	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:130949566G>C	ENST00000312988.7	-	5	1291	c.1191C>G	c.(1189-1191)ctC>ctG	p.L397L		NM_207312.2	NP_997195	Q6PEY2	TBA3E_HUMAN	tubulin, alpha 3e	397					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|kidney(7)|large_intestine(6)|lung(9)|skin(2)	28	Colorectal(110;0.1)					TGGCATACATGAGATCGAACT	0.632																																																	0													117.0	116.0	116.0					2																	130949566		2203	4300	6503	SO:0001819	synonymous_variant	0			BC057811	CCDS2158.1	2q21.1	2007-03-16			ENSG00000152086	ENSG00000152086		"""Tubulins"""	20765	protein-coding gene	gene with protein product							Standard	NM_207312		Approved		uc002tqv.3	Q6PEY2	OTTHUMG00000131626	ENST00000312988.7:c.1191C>G	2.37:g.130949566G>C				Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin	p.L397	ENST00000312988.7	37	c.1191	CCDS2158.1	2																																																																																			TUBA3E	-	superfamily_Tub_FtsZ_C,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin	ENSG00000152086		0.632	TUBA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA3E	HGNC	protein_coding	OTTHUMT00000254519.1	-	0.00	47	0	G	NM_207312		130949566	-1	tier1	-	no_errors	ENST00000312988	ensembl	human	known	74_37	silent	24.59	46	15	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179559307	179559307	+	Intron	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:179559307G>C	ENST00000591111.1	-	115	30700				TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTTGTAGCTGAAACACAAAG	0.333																																																	0													22.0	20.0	21.0					2																	179559307		1793	4011	5804	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.30475+18C>G	2.37:g.179559307G>C			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	RNA	SNP	-	NULL	ENST00000591111.1	37	NULL		2																																																																																			TTN-AS1	-	-	ENSG00000237298		0.333	TTN-019	PUTATIVE	basic	protein_coding	TTN-AS1	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	44	0	G	NM_133378		179559307	+1	tier1	-	no_errors	ENST00000589487	ensembl	human	known	74_37	rna	30.30	23	10	SNP	0.905	C
TMPRSS11F	389208	genome.wustl.edu	37	4	68928855	68928855	+	Intron	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr4:68928855G>C	ENST00000356291.2	-	8	1075				RP11-35D5.1_ENST00000600441.1_RNA|UBA6-AS1_ENST00000511571.1_RNA|UBA6-AS1_ENST00000499180.2_RNA|UBA6-AS1_ENST00000500538.2_RNA	NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F							extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						TATTAATATAGAGAAAAAGAA	0.368																																																	0													76.0	77.0	77.0					4																	68928855		2200	4298	6498	SO:0001627	intron_variant	0			AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.1015+1547C>G	4.37:g.68928855G>C			A8MXX2	RNA	SNP	-	NULL	ENST00000356291.2	37	NULL	CCDS3520.1	4																																																																																			UBA6-AS1	-	-	ENSG00000248049		0.368	TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA6-AS1	HGNC	protein_coding	OTTHUMT00000251439.1	-	0.00	35	0	G	NM_207407		68928855	+1	tier1	-	no_errors	ENST00000499180	ensembl	human	known	74_37	rna	34.00	33	17	SNP	0.897	C
UBE2D2	7322	genome.wustl.edu	37	5	138979986	138979986	+	Silent	SNP	A	A	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr5:138979986A>T	ENST00000398733.3	+	2	680	c.54A>T	c.(52-54)ccA>ccT	p.P18P	UBE2D2_ENST00000511725.1_5'UTR|UBE2D2_ENST00000505548.1_5'UTR|UBE2D2_ENST00000253815.2_5'UTR	NM_003339.2	NP_003330.1	P62837	UB2D2_HUMAN	ubiquitin-conjugating enzyme E2D 2	18					cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GGGACCCTCCAGCACAGTGTT	0.328																																																	0													84.0	82.0	83.0					5																	138979986		1879	4133	6012	SO:0001819	synonymous_variant	0			L40146	CCDS43369.1, CCDS47275.1	5q31.2	2013-10-18	2011-05-19		ENSG00000131508	ENSG00000131508		"""Ubiquitin-conjugating enzymes E2"""	12475	protein-coding gene	gene with protein product		602962	"""ubiquitin-conjugating enzyme E2D 2 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181838		Approved	UbcH5B, UBC4	uc003ler.3	P62837	OTTHUMG00000163282	ENST00000398733.3:c.54A>T	5.37:g.138979986A>T			D3DQC9|P51669|Q3MN78|Q96RP6	Silent	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.P18	ENST00000398733.3	37	c.54	CCDS43369.1	5																																																																																			UBE2D2	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000131508		0.328	UBE2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2D2	HGNC	protein_coding	OTTHUMT00000372454.3	-	0.00	38	0	A	NM_181838		138979986	+1	tier1	-	no_errors	ENST00000398733	ensembl	human	known	74_37	silent	24.24	25	8	SNP	1.000	T
UBE2F	140739	genome.wustl.edu	37	2	238949975	238949975	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:238949975G>C	ENST00000272930.4	+	10	748	c.554G>C	c.(553-555)aGa>aCa	p.R185T	UBE2F_ENST00000414443.1_Missense_Mutation_p.R153T|UBE2F_ENST00000409332.1_Missense_Mutation_p.R163T|UBE2F-SCLY_ENST00000449191.1_Missense_Mutation_p.R131T|UBE2F_ENST00000409633.1_Missense_Mutation_p.R164T|UBE2F_ENST00000409953.1_Missense_Mutation_p.R161T	NM_001278305.1|NM_080678.2	NP_001265234.1|NP_542409.1	Q969M7	UBE2F_HUMAN	ubiquitin-conjugating enzyme E2F (putative)	185					protein neddylation (GO:0045116)		ATP binding (GO:0005524)|NEDD8 ligase activity (GO:0019788)			endometrium(1)|large_intestine(1)	2		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;6.7e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|Kidney(56;3.53e-09)|KIRC - Kidney renal clear cell carcinoma(57;9.79e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000136)|Lung(119;0.0126)|LUSC - Lung squamous cell carcinoma(224;0.0301)		CGTTATGCCAGATGATAAAAG	0.493																																																	0													109.0	105.0	107.0					2																	238949975		2203	4300	6503	SO:0001583	missense	0			BC010549	CCDS2523.1, CCDS63175.1, CCDS63176.1, CCDS63177.1	2q37.3	2008-02-05	2005-12-15		ENSG00000184182	ENSG00000184182		"""Ubiquitin-conjugating enzymes E2"""	12480	protein-coding gene	gene with protein product	"""NEDD8 conjugating enzyme"""					12477932	Standard	NM_080678		Approved	NCE2	uc031rrz.1	Q969M7	OTTHUMG00000133341	ENST00000272930.4:c.554G>C	2.37:g.238949975G>C	ENSP00000272930:p.Arg185Thr		A8K1Z8|B4DDT9|B4DFI1|B4DMK3|B4DZU2|B8ZZG2|C9J212|H9KVB9	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.R185T	ENST00000272930.4	37	c.554	CCDS2523.1	2	.	.	.	.	.	.	.	.	.	.	G	19.48	3.836206	0.71373	.	.	ENSG00000184182	ENST00000272930;ENST00000409633;ENST00000414443;ENST00000409953;ENST00000409332	T;D;T;T;T	0.84944	-0.19;-1.92;1.4;1.42;1.45	5.95	5.95	0.96441	Ubiquitin-conjugating enzyme/RWD-like (1);	0.000000	0.85682	D	0.000000	D	0.86948	0.6056	N	0.20401	0.57	0.47476	D	0.999435	D;P	0.53462	0.96;0.951	P;D	0.70935	0.678;0.971	D	0.88296	0.2946	10	0.87932	D	0	-18.1438	15.8855	0.79244	0.0:0.0:1.0:0.0	.	153;185	Q969M7-3;Q969M7	.;UBE2F_HUMAN	T	185;164;153;161;163	ENSP00000272930:R185T;ENSP00000387299:R164T;ENSP00000399183:R153T;ENSP00000386680:R161T;ENSP00000387060:R163T	ENSP00000272930:R185T	R	+	2	0	UBE2F	238614714	1.000000	0.71417	1.000000	0.80357	0.525000	0.34531	6.903000	0.75703	2.825000	0.97269	0.655000	0.94253	AGA	UBE2F	-	superfamily_UBQ-conjugating_enzyme/RWD	ENSG00000184182		0.493	UBE2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2F	HGNC	protein_coding	OTTHUMT00000257171.2	-	0.00	81	0	G	NM_080678		238949975	+1	tier1	-	no_errors	ENST00000272930	ensembl	human	known	74_37	missense	13.33	65	10	SNP	1.000	C
UBR4	23352	genome.wustl.edu	37	1	19510631	19510631	+	Silent	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:19510631G>T	ENST00000375254.3	-	16	2004	c.1977C>A	c.(1975-1977)acC>acA	p.T659T	UBR4_ENST00000375226.2_Silent_p.T659T|UBR4_ENST00000375267.2_Silent_p.T659T|UBR4_ENST00000375217.2_Silent_p.T659T	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	659					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GCATGGAAGAGGTGATGAAGT	0.428																																																	0													99.0	96.0	97.0					1																	19510631		2203	4300	6503	SO:0001819	synonymous_variant	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.1977C>A	1.37:g.19510631G>T			A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.T659	ENST00000375254.3	37	c.1977	CCDS189.1	1																																																																																			UBR4	-	NULL	ENSG00000127481		0.428	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	-	0.00	22	0	G	NM_020765		19510631	-1	tier1	-	no_errors	ENST00000375267	ensembl	human	known	74_37	silent	18.75	26	6	SNP	1.000	T
UNKL	64718	genome.wustl.edu	37	16	1463960	1463960	+	Silent	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:1463960G>C	ENST00000389221.4	-	2	173	c.174C>G	c.(172-174)ctC>ctG	p.L58L	UNKL_ENST00000397462.1_Silent_p.L58L|UNKL_ENST00000503648.1_5'UTR|UNKL_ENST00000508903.2_Silent_p.L58L|UNKL_ENST00000301712.5_Silent_p.L58L|LA16c-312E8.2_ENST00000568554.1_RNA	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like	58					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				GCCGCTGGTTGAGGAAGTGCC	0.642											OREG0023546	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													17.0	16.0	16.0					16																	1463960		2108	4150	6258	SO:0001819	synonymous_variant	0			BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.174C>G	16.37:g.1463960G>C		596	B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Nonsense_Mutation	SNP	NULL	p.S43*	ENST00000389221.4	37	c.128	CCDS53981.1	16																																																																																			UNKL	-	NULL	ENSG00000059145		0.642	UNKL-201	KNOWN	basic|CCDS	protein_coding	UNKL	HGNC	protein_coding		-	0.00	39	0	G	NM_001037125		1463960	-1	tier1	-	no_errors	ENST00000382757	ensembl	human	known	74_37	nonsense	41.82	32	23	SNP	0.998	C
UMOD	7369	genome.wustl.edu	37	16	20362149	20362149	+	De_novo_Start_OutOfFrame	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr16:20362149G>C	ENST00000396142.2	-	0	15				UMOD_ENST00000396134.2_De_novo_Start_OutOfFrame|UMOD_ENST00000396138.4_Missense_Mutation_p.Q20E|UMOD_ENST00000424589.1_Intron|UMOD_ENST00000570689.1_Intron|UMOD_ENST00000302509.4_Intron			P07911	UROM_HUMAN	uromodulin						cellular defense response (GO:0006968)|chemical homeostasis (GO:0048878)|excretion (GO:0007588)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte cell-cell adhesion (GO:0007159)|metanephric ascending thin limb development (GO:0072218)|metanephric distal convoluted tubule development (GO:0072221)|metanephric thick ascending limb development (GO:0072233)|negative regulation of cell proliferation (GO:0008285)|neutrophil migration (GO:1990266)|regulation of ion homeostasis (GO:2000021)|response to organic substance (GO:0010033)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|primary cilium (GO:0072372)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|IgG binding (GO:0019864)			endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						CTCTGTCTCTGATGTCTGGTG	0.488																																																	0																																												0			M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344			12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""			8382593	Standard	NM_003361		Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000396142.2:c.-90C>G	16.37:g.20362149G>C			B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	Missense_Mutation	SNP	pfam_ZP_dom,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_ZP_dom,pfscan_EG-like_dom,pfscan_ZP_dom,prints_ZP_dom	p.Q20E	ENST00000396142.2	37	c.58	CCDS10583.1	16																																																																																			UMOD	-	NULL	ENSG00000169344		0.488	UMOD-202	KNOWN	basic|appris_principal|CCDS	protein_coding	UMOD	HGNC	protein_coding			0.00	21	0	G			20362149	-1			no_errors	ENST00000396138	ensembl	human	putative	74_37	missense	8.11	34	3	SNP	0.001	C
USH2A	7399	genome.wustl.edu	37	1	215848443	215848443	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:215848443C>T	ENST00000307340.3	-	63	13196	c.12810G>A	c.(12808-12810)gtG>gtA	p.V4270V	USH2A_ENST00000366943.2_Silent_p.V4270V	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4270	Fibronectin type-III 28. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		cataggatatcacaggtggag	0.433										HNSCC(13;0.011)																																							0													84.0	80.0	81.0					1																	215848443		2203	4300	6503	SO:0001819	synonymous_variant	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12810G>A	1.37:g.215848443C>T			Q5VVM9|Q6S362|Q9NS27	Silent	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.V4270	ENST00000307340.3	37	c.12810	CCDS31025.1	1																																																																																			USH2A	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.433	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	-	0.00	37	0	C	NM_007123		215848443	-1	tier1	-	no_errors	ENST00000366943	ensembl	human	known	74_37	silent	28.07	41	16	SNP	0.000	T
USH2A	7399	genome.wustl.edu	37	1	216420404	216420404	+	Missense_Mutation	SNP	C	C	T	rs142898216		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:216420404C>T	ENST00000307340.3	-	13	2718	c.2332G>A	c.(2332-2334)Gac>Aac	p.D778N	USH2A_ENST00000366942.3_Missense_Mutation_p.D778N|USH2A_ENST00000366943.2_Missense_Mutation_p.D778N	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	778	Laminin EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTGCAGGTGTCACACTGAAGT	0.483										HNSCC(13;0.011)																																							0													143.0	137.0	139.0					1																	216420404		2203	4300	6503	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.2332G>A	1.37:g.216420404C>T	ENSP00000305941:p.Asp778Asn		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.D778N	ENST00000307340.3	37	c.2332	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.893126	0.91889	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.64991	-0.13;-0.13;-0.13	6.06	6.06	0.98353	EGF-like, laminin (4);	0.000000	0.47093	D	0.000241	T	0.65606	0.2707	L	0.53780	1.695	0.54753	D	0.999989	P;P	0.48089	0.905;0.884	P;P	0.49853	0.624;0.571	T	0.63143	-0.6703	10	0.37606	T	0.19	.	13.778	0.63066	0.0:0.9304:0.0:0.0696	.	778;778	O75445-2;O75445	.;USH2A_HUMAN	N	778	ENSP00000305941:D778N;ENSP00000355910:D778N;ENSP00000355909:D778N	ENSP00000305941:D778N	D	-	1	0	USH2A	214487027	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	4.524000	0.60552	2.871000	0.98454	0.655000	0.94253	GAC	USH2A	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000042781		0.483	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1		0.00	17	0	C	NM_007123		216420404	-1			no_errors	ENST00000366943	ensembl	human	known	74_37	missense	13.04	40	6	SNP	1.000	T
UTP14C	9724	genome.wustl.edu	37	13	52604065	52604065	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr13:52604065C>T	ENST00000521776.2	+	2	1858	c.1125C>T	c.(1123-1125)ttC>ttT	p.F375F		NM_021645.5	NP_067677.4	Q5TAP6	UT14C_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast)	375					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|rRNA processing (GO:0006364)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)				breast(4)|cervix(1)|endometrium(1)|large_intestine(10)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	32		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.3e-08)		CCTGGATGTTCAGGAGCTGCA	0.542																																																	0													101.0	87.0	92.0					13																	52604065		2203	4300	6503	SO:0001819	synonymous_variant	0			D87455	CCDS31978.1	13q12.2-q13.3	2010-11-23	2004-06-15	2004-06-16	ENSG00000253797	ENSG00000253797			20321	protein-coding gene	gene with protein product		608969	"""KIAA0266"""	KIAA0266		9039502, 16354793	Standard	NM_021645		Approved	2700066J21Rik	uc021rjw.1	Q5TAP6	OTTHUMG00000164353	ENST00000521776.2:c.1125C>T	13.37:g.52604065C>T			Q5FWG3|Q92555	Silent	SNP	pfam_SSU_processome_Utp14	p.F375	ENST00000521776.2	37	c.1125	CCDS31978.1	13																																																																																			UTP14C	-	pfam_SSU_processome_Utp14	ENSG00000253797		0.542	UTP14C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP14C	HGNC	protein_coding	OTTHUMT00000045049.2	-	0.00	22	0	C	NM_021645		52604065	+1	tier1	-	no_errors	ENST00000521776	ensembl	human	known	74_37	silent	30.77	18	8	SNP	0.806	T
VENTX	27287	genome.wustl.edu	37	10	135053603	135053603	+	Silent	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr10:135053603C>T	ENST00000325980.9	+	3	1081	c.570C>T	c.(568-570)tcC>tcT	p.S190S		NM_014468.3	NP_055283.1	O95231	VENTX_HUMAN	VENT homeobox	190					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(1)	14		all_cancers(35;4.15e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)|all cancers(32;1.19e-05)		CACCCCTGTCCGGGCCCCAGG	0.667																																																	0													27.0	30.0	29.0					10																	135053603		2203	4298	6501	SO:0001819	synonymous_variant	0			AF068006	CCDS7675.1	10q26.3	2011-06-20	2011-06-01	2005-09-27	ENSG00000151650	ENSG00000151650		"""Homeoboxes / ANTP class : NKL subclass"""	13639	protein-coding gene	gene with protein product		607158	"""VENT-like homeobox 2"", ""VENT homeobox homolog (Xenopus laevis)"""	VENTX2		10790436	Standard	NM_014468		Approved	HPX42B	uc010quy.1	O95231	OTTHUMG00000019307	ENST00000325980.9:c.570C>T	10.37:g.135053603C>T			Q32MZ3	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.S190	ENST00000325980.9	37	c.570	CCDS7675.1	10																																																																																			VENTX	-	NULL	ENSG00000151650		0.667	VENTX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VENTX	HGNC	protein_coding	OTTHUMT00000051116.4	-	0.00	80	0	C	NM_014468		135053603	+1	tier1	-	no_errors	ENST00000325980	ensembl	human	known	74_37	silent	41.77	46	33	SNP	0.000	T
ATG7	10533	genome.wustl.edu	37	3	11600101	11600101	+	IGR	SNP	G	G	A	rs377034464	byFrequency	TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr3:11600101G>A	ENST00000354449.3	+	0	4959				VGLL4_ENST00000413604.1_Missense_Mutation_p.R209C|VGLL4_ENST00000404339.1_Missense_Mutation_p.R273C|VGLL4_ENST00000430365.2_Missense_Mutation_p.R274C|VGLL4_ENST00000273038.3_Missense_Mutation_p.R268C|VGLL4_ENST00000451674.2_Missense_Mutation_p.R188C|VGLL4_ENST00000424529.2_Missense_Mutation_p.R184C	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7						adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						TGGCCCCTGCGAGAGGCGGAC	0.652																																																	0													50.0	57.0	55.0					3																	11600101		2203	4300	6503	SO:0001628	intergenic_variant	0			AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740		3.37:g.11600101G>A			B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Missense_Mutation	SNP	smart_TDU_repeat	p.R274C	ENST00000354449.3	37	c.820	CCDS2605.1	3	.	.	.	.	.	.	.	.	.	.	G	16.99	3.273674	0.59649	.	.	ENSG00000144560	ENST00000273038;ENST00000413604;ENST00000451674;ENST00000424529;ENST00000430365;ENST00000404339	T;T;T	0.49432	0.79;0.79;0.78	5.01	4.04	0.47022	.	0.000000	0.64402	D	0.000003	T	0.61464	0.2349	L	0.47716	1.5	0.46774	D	0.999193	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.998;0.998;0.998;0.998	T	0.65504	-0.6152	10	0.87932	D	0	-47.2405	14.7559	0.69564	0.0:0.0:0.793:0.207	.	274;188;184;273;268	G5E9M7;Q14135-6;Q14135-5;G5E9F4;Q14135	.;.;.;.;VGLL4_HUMAN	C	268;209;188;184;274;273	ENSP00000273038:R268C;ENSP00000404251:R274C;ENSP00000384705:R273C	ENSP00000273038:R268C	R	-	1	0	VGLL4	11575101	0.910000	0.30920	0.833000	0.33012	0.862000	0.49288	1.515000	0.35845	2.321000	0.78463	0.563000	0.77884	CGC	VGLL4	-	NULL	ENSG00000144560		0.652	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VGLL4	HGNC	protein_coding	OTTHUMT00000251951.3	-	0.00	99	0	G	NM_006395		11600101	-1	tier1	-	no_errors	ENST00000430365	ensembl	human	known	74_37	missense	14.29	89	15	SNP	0.494	A
VN1R1	57191	genome.wustl.edu	37	19	57967238	57967238	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:57967238C>A	ENST00000321039.3	-	1	616	c.617G>T	c.(616-618)gGa>gTa	p.G206V	AC004076.9_ENST00000415705.3_Intron|AC004076.9_ENST00000596831.1_Intron	NM_020633.3	NP_065684.1	Q9GZP7	VN1R1_HUMAN	vomeronasal 1 receptor 1	206					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)|Breast(46;0.222)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)|Lung(386;0.171)		AGAACAGTATCCATAATTGTT	0.408																																																	0													101.0	96.0	98.0					19																	57967238		2203	4300	6503	SO:0001583	missense	0			AF255342	CCDS12951.1	19q13.4	2012-08-22	2003-01-15		ENSG00000178201	ENSG00000178201		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	13548	protein-coding gene	gene with protein product		605234	"""vomeronasal olfactory receptor, (chromosome 19) subtype I, member 1"""	VNR19I1		10973240	Standard	NM_020633		Approved	V1RL1, ZVNR1, ZVNH1	uc002qos.2	Q9GZP7		ENST00000321039.3:c.617G>T	19.37:g.57967238C>A	ENSP00000322339:p.Gly206Val		B3KSV5|Q7Z5H8|Q7Z5H9	Missense_Mutation	SNP	pfam_Vmron_rcpt_1,pfam_TAS2_rcpt,pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Vmron_rcpt_1	p.G206V	ENST00000321039.3	37	c.617	CCDS12951.1	19	.	.	.	.	.	.	.	.	.	.	C	13.56	2.273090	0.40194	.	.	ENSG00000178201	ENST00000321039	T	0.09255	3.0	3.96	-7.08	0.01558	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.12987	0.0315	M	0.66439	2.03	0.09310	N	1	P	0.48589	0.912	P	0.51806	0.68	T	0.09818	-1.0657	9	0.34782	T	0.22	.	0.9102	0.01293	0.2313:0.1773:0.3425:0.2489	.	206	Q9GZP7	VN1R1_HUMAN	V	206	ENSP00000322339:G206V	ENSP00000322339:G206V	G	-	2	0	VN1R1	62659050	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.383000	0.07398	-0.803000	0.04415	0.590000	0.80494	GGA	VN1R1	-	pfam_Vmron_rcpt_1,pfam_TAS2_rcpt,pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000178201		0.408	VN1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VN1R1	HGNC	protein_coding	OTTHUMT00000466464.1	-	0.00	43	0	C	NM_020633		57967238	-1	tier1	-	no_errors	ENST00000321039	ensembl	human	known	74_37	missense	33.33	36	18	SNP	0.000	A
VPS13B	157680	genome.wustl.edu	37	8	100791077	100791077	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr8:100791077G>C	ENST00000358544.2	+	42	7783	c.7672G>C	c.(7672-7674)Gag>Cag	p.E2558Q	VPS13B_ENST00000357162.2_Missense_Mutation_p.E2533Q|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2558					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TAAACTTCTAGAGTGCAGAAA	0.458																																					Colon(161;2205 2542 7338 31318)												0													125.0	116.0	119.0					8																	100791077		2203	4300	6503	SO:0001583	missense	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.7672G>C	8.37:g.100791077G>C	ENSP00000351346:p.Glu2558Gln		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.E2558Q	ENST00000358544.2	37	c.7672	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	G	28.9	4.957080	0.92726	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.72505	-0.66;-0.66	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.81851	0.4910	L	0.50333	1.59	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.994	T	0.82356	-0.0498	10	0.62326	D	0.03	.	19.5118	0.95144	0.0:0.0:1.0:0.0	.	2533;2558	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	Q	2533;2558	ENSP00000349685:E2533Q;ENSP00000351346:E2558Q	ENSP00000349685:E2533Q	E	+	1	0	VPS13B	100860253	1.000000	0.71417	0.964000	0.40570	0.991000	0.79684	9.165000	0.94761	2.612000	0.88384	0.655000	0.94253	GAG	VPS13B	-	NULL	ENSG00000132549		0.458	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	-	0.00	55	0	G	NM_184042		100791077	+1	tier1	-	no_errors	ENST00000358544	ensembl	human	known	74_37	missense	19.12	55	13	SNP	1.000	C
VPS13C	54832	genome.wustl.edu	37	15	62209602	62209602	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr15:62209602G>A	ENST00000261517.5	-	60	8066	c.7993C>T	c.(7993-7995)Cat>Tat	p.H2665Y	VPS13C_ENST00000249837.3_Missense_Mutation_p.H2622Y|VPS13C_ENST00000395896.4_Missense_Mutation_p.H2665Y|RN7SL613P_ENST00000584412.1_RNA|VPS13C_ENST00000395898.3_Missense_Mutation_p.H2622Y	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						GGATAAAGATGAATAATGTAA	0.383																																																	0													126.0	115.0	118.0					15																	62209602		2203	4300	6503	SO:0001583	missense	0			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.7993C>T	15.37:g.62209602G>A	ENSP00000261517:p.His2665Tyr			Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.H2665Y	ENST00000261517.5	37	c.7993	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	G	22.8	4.338631	0.81911	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.50001	0.76;0.76;0.94	5.76	4.84	0.62591	.	0.045746	0.85682	N	0.000000	T	0.71651	0.3365	M	0.85373	2.75	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.997;1.0;1.0;1.0;0.999	T	0.77496	-0.2566	10	0.87932	D	0	.	14.6633	0.68888	0.0699:0.0:0.9301:0.0	.	2665;2622;2665;2622;2665	F5GZG8;Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;.;VP13C_HUMAN	Y	2622;2665;2665;2665	ENSP00000249837:H2622Y;ENSP00000261517:H2665Y;ENSP00000379233:H2665Y	ENSP00000249837:H2622Y	H	-	1	0	VPS13C	59996894	1.000000	0.71417	0.796000	0.32109	0.953000	0.61014	7.420000	0.80191	1.430000	0.47334	0.650000	0.86243	CAT	VPS13C	-	NULL	ENSG00000129003		0.383	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	-	0.00	29	0	G	NM_017684		62209602	-1	tier1	-	no_errors	ENST00000261517	ensembl	human	known	74_37	missense	34.78	30	16	SNP	1.000	A
WBSCR17	64409	genome.wustl.edu	37	7	71177154	71177154	+	3'UTR	SNP	A	A	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr7:71177154A>G	ENST00000333538.5	+	0	2454				WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17						protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				GGGGCACTGGAGCCTGGCCCC	0.667																																																	0													41.0	40.0	40.0					7																	71177154		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.*23A>G	7.37:g.71177154A>G			Q8NFV9|Q9NTA8	RNA	SNP	-	NULL	ENST00000333538.5	37	NULL	CCDS5540.1	7																																																																																			WBSCR17	-	-	ENSG00000185274		0.667	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR17	HGNC	protein_coding	OTTHUMT00000252006.1	-	0.00	21	0	A	NM_022479		71177154	+1	tier1	-	no_errors	ENST00000467723	ensembl	human	known	74_37	rna	31.03	20	9	SNP	0.014	G
WDR63	126820	genome.wustl.edu	37	1	85555813	85555813	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:85555813A>G	ENST00000294664.6	+	8	935	c.755A>G	c.(754-756)aAt>aGt	p.N252S	WDR63_ENST00000326813.8_Intron|WDR63_ENST00000370596.1_Intron	NM_145172.3	NP_660155.2	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	252										NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)	36				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		TATCCTAAAAATGCTACTACG	0.333																																																	0													42.0	44.0	43.0					1																	85555813		2201	4283	6484	SO:0001583	missense	0				CCDS702.1, CCDS72818.1	1p22.3	2014-02-21	2013-02-19	2013-02-19	ENSG00000162643	ENSG00000162643		"""WD repeat domain containing"""	30711	protein-coding gene	gene with protein product						21953912	Standard	XM_005270438		Approved	DIC3, FLJ30067, NYD-SP29	uc001dkt.3	Q8IWG1	OTTHUMG00000009953	ENST00000294664.6:c.755A>G	1.37:g.85555813A>G	ENSP00000294664:p.Asn252Ser		A8K988|Q96L72|Q96NU4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.N252S	ENST00000294664.6	37	c.755	CCDS702.1	1	.	.	.	.	.	.	.	.	.	.	A	19.79	3.892612	0.72524	.	.	ENSG00000162643	ENST00000294664	T	0.44482	0.92	5.63	5.63	0.86233	.	0.046654	0.85682	D	0.000000	T	0.54319	0.1851	M	0.88310	2.945	0.52501	D	0.999957	D	0.60160	0.987	P	0.53549	0.729	T	0.64765	-0.6330	10	0.54805	T	0.06	-0.6444	15.0202	0.71624	1.0:0.0:0.0:0.0	.	252	Q8IWG1	WDR63_HUMAN	S	252	ENSP00000294664:N252S	ENSP00000294664:N252S	N	+	2	0	WDR63	85328401	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	6.897000	0.75671	2.134000	0.65973	0.482000	0.46254	AAT	WDR63	-	NULL	ENSG00000162643		0.333	WDR63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR63	HGNC	protein_coding	OTTHUMT00000027565.2	-	0.00	27	0	A	NM_145172		85555813	+1	tier1	-	no_errors	ENST00000294664	ensembl	human	known	74_37	missense	15.00	17	3	SNP	1.000	G
WDR7	23335	genome.wustl.edu	37	18	54363617	54363617	+	Missense_Mutation	SNP	C	C	G	rs150975555		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr18:54363617C>G	ENST00000254442.3	+	12	1713	c.1502C>G	c.(1501-1503)tCt>tGt	p.S501C	WDR7_ENST00000357574.3_Missense_Mutation_p.S501C|WDR7_ENST00000589935.1_Intron	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	501					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		GACATATTTTCTGGAGAAATG	0.358																																																	0													139.0	132.0	135.0					18																	54363617		2203	4300	6503	SO:0001583	missense	0			AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.1502C>G	18.37:g.54363617C>G	ENSP00000254442:p.Ser501Cys		A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S501C	ENST00000254442.3	37	c.1502	CCDS11962.1	18	.	.	.	.	.	.	.	.	.	.	C	26.6	4.752084	0.89753	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000398311	T;T	0.06068	3.35;3.35	6.03	6.03	0.97812	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.053050	0.85682	D	0.000000	T	0.22244	0.0536	L	0.53249	1.67	0.80722	D	1	D;D	0.69078	0.996;0.997	D;P	0.64877	0.93;0.707	T	0.00005	-1.2540	10	0.87932	D	0	.	20.1519	0.98089	0.0:1.0:0.0:0.0	.	501;501	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	C	501	ENSP00000254442:S501C;ENSP00000350187:S501C	ENSP00000254442:S501C	S	+	2	0	WDR7	52514615	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.854000	0.69503	2.861000	0.98227	0.655000	0.94253	TCT	WDR7	-	superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000091157		0.358	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR7	HGNC	protein_coding	OTTHUMT00000256062.1	-	0.00	65	0	C			54363617	+1	tier1	-	no_errors	ENST00000254442	ensembl	human	known	74_37	missense	50.60	41	42	SNP	1.000	G
WDR87	83889	genome.wustl.edu	37	19	38380747	38380747	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:38380747G>A	ENST00000303868.5	-	6	3671	c.3447C>T	c.(3445-3447)ctC>ctT	p.L1149L	WDR87_ENST00000447313.2_Silent_p.L1188L	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1149										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						CATCTTTTGAGAGCTTTATTA	0.443																																																	0													129.0	92.0	103.0					19																	38380747		692	1591	2283	SO:0001819	synonymous_variant	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.3447C>T	19.37:g.38380747G>A			Q9BWV9	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L1188	ENST00000303868.5	37	c.3564	CCDS46063.1	19																																																																																			WDR87	-	superfamily_ARM-type_fold	ENSG00000171804		0.443	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	-	0.00	83	0	G	XM_940478		38380747	-1	tier1	-	no_errors	ENST00000447313	ensembl	human	known	74_37	silent	18.95	77	18	SNP	0.000	A
XKR3	150165	genome.wustl.edu	37	22	17288835	17288835	+	Silent	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr22:17288835G>T	ENST00000331428.5	-	2	231	c.129C>A	c.(127-129)ctC>ctA	p.L43L		NM_175878.3	NP_787074.2	Q5GH77	XKR3_HUMAN	XK, Kell blood group complex subunit-related family, member 3	43						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CACCACAGTAGAGAACAGTTG	0.378																																																	0													112.0	106.0	107.0					22																	17288835		1875	4104	5979	SO:0001819	synonymous_variant	0			AY989815	CCDS42975.1	22q11.1	2007-01-16	2006-01-12		ENSG00000172967	ENSG00000172967			28778	protein-coding gene	gene with protein product		611674	"""X Kell blood group precursor-related family, member 3"""			16431037	Standard	NM_175878		Approved	MGC57211, XTES	uc002zlv.3	Q5GH77	OTTHUMG00000143726	ENST00000331428.5:c.129C>A	22.37:g.17288835G>T			B2RPN1|Q52PG8|Q8N7E1	Silent	SNP	pfam_Transport_prot_XK	p.L43	ENST00000331428.5	37	c.129	CCDS42975.1	22																																																																																			XKR3	-	pfam_Transport_prot_XK	ENSG00000172967		0.378	XKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR3	HGNC	protein_coding	OTTHUMT00000289789.1	-	0.00	34	0	G	NM_175878		17288835	-1	tier1	-	no_errors	ENST00000331428	ensembl	human	known	74_37	silent	31.58	13	6	SNP	0.682	T
XRCC6	2547	genome.wustl.edu	37	22	42033762	42033762	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr22:42033762G>A	ENST00000359308.4	+	5	1395	c.740G>A	c.(739-741)cGc>cAc	p.R247H	XRCC6_ENST00000405878.1_Missense_Mutation_p.R247H|XRCC6_ENST00000405506.1_Missense_Mutation_p.R197H|XRCC6_ENST00000402580.3_Missense_Mutation_p.R206H|XRCC6_ENST00000428575.2_Missense_Mutation_p.R114H|XRCC6_ENST00000360079.3_Missense_Mutation_p.R247H			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	247					brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						CGGAAGGTTCGCGCCAAGGAG	0.562								Non-homologous end-joining																																									0													50.0	43.0	45.0					22																	42033762		2203	4300	6503	SO:0001583	missense	0			J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.740G>A	22.37:g.42033762G>A	ENSP00000352257:p.Arg247His		B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Missense_Mutation	SNP	pirsf_Ku70,pfam_Ku_N,pfam_Ku70/Ku80_beta-barrel_dom,pfam_Ku_C,pfam_SAP_dom,superfamily_SPOC_like_C_dom,smart_Ku70/Ku80_beta-barrel_dom,smart_SAP_dom,pfscan_SAP_dom,tigrfam_Ku70	p.R247H	ENST00000359308.4	37	c.740	CCDS14021.1	22	.	.	.	.	.	.	.	.	.	.	G	21.0	4.084576	0.76642	.	.	ENSG00000196419	ENST00000360079;ENST00000402580;ENST00000428575;ENST00000359308;ENST00000405878;ENST00000402409;ENST00000405506	.	.	.	5.6	4.57	0.56435	Ku70/Ku80, N-terminal alpha/beta (1);	0.000000	0.85682	D	0.000000	T	0.67618	0.2912	M	0.87758	2.905	0.80722	D	1	B;P;B;B	0.35363	0.256;0.497;0.424;0.194	B;B;B;B	0.35607	0.169;0.14;0.136;0.206	T	0.68845	-0.5301	9	0.29301	T	0.29	-4.3483	15.8157	0.78597	0.0:0.0:0.8628:0.1372	.	197;247;206;247	B1AHC9;B1AHC7;B1AHC8;P12956	.;.;.;XRCC6_HUMAN	H	247;206;114;247;247;247;197	.	ENSP00000352257:R247H	R	+	2	0	XRCC6	40363708	1.000000	0.71417	0.881000	0.34555	0.961000	0.63080	6.154000	0.71826	1.328000	0.45358	0.655000	0.94253	CGC	XRCC6	-	pirsf_Ku70,pfam_Ku_N,tigrfam_Ku70	ENSG00000196419		0.562	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	XRCC6	HGNC	protein_coding	OTTHUMT00000321688.1	-	0.00	18	0	G	NM_001469		42033762	+1	tier1	-	no_errors	ENST00000359308	ensembl	human	known	74_37	missense	41.18	10	7	SNP	0.999	A
YME1L1	10730	genome.wustl.edu	37	10	27434388	27434388	+	Silent	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr10:27434388G>C	ENST00000326799.3	-	4	619	c.471C>G	c.(469-471)gtC>gtG	p.V157V	YME1L1_ENST00000376016.3_Silent_p.V100V|YME1L1_ENST00000477432.1_3'UTR|YME1L1_ENST00000375972.3_Silent_p.V100V	NM_139312.2	NP_647473.1	Q96TA2	YMEL1_HUMAN	YME1-like 1 ATPase	157					cell proliferation (GO:0008283)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrion organization (GO:0007005)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23						ATTGTGCAGAGACATGGGATG	0.303																																																	0													80.0	83.0	82.0					10																	27434388		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ132637	CCDS7151.1, CCDS7152.1, CCDS58072.1	10p14	2013-06-10	2013-06-10		ENSG00000136758	ENSG00000136758		"""ATPases / AAA-type"""	12843	protein-coding gene	gene with protein product		607472	"""YME1 (S.cerevisiae)-like 1"", ""YME1-like 1 (S. cerevisiae)"""			22262461	Standard	NM_139312		Approved		uc001itj.3	Q96TA2	OTTHUMG00000017853	ENST00000326799.3:c.471C>G	10.37:g.27434388G>C			B4DNM1|D3DRV8|D3DRV9|Q5T8D9|Q9H1Q0|Q9UMR9	Silent	SNP	pfam_Peptidase_M41,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_FtsH	p.V157	ENST00000326799.3	37	c.471	CCDS7152.1	10																																																																																			YME1L1	-	NULL	ENSG00000136758		0.303	YME1L1-005	KNOWN	basic|CCDS	protein_coding	YME1L1	HGNC	protein_coding	OTTHUMT00000047306.1	-	0.00	26	0	G	NM_139312		27434388	-1	tier1	-	no_errors	ENST00000326799	ensembl	human	known	74_37	silent	16.00	21	4	SNP	0.795	C
ZBTB14	7541	genome.wustl.edu	37	18	5291265	5291265	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr18:5291265G>A	ENST00000357006.4	-	4	1280	c.942C>T	c.(940-942)ttC>ttT	p.F314F	ZBTB14_ENST00000400143.3_Silent_p.F314F	NM_001143823.2|NM_001243704.1	NP_001137295.1|NP_001230633.1	O43829	ZBT14_HUMAN	zinc finger and BTB domain containing 14	314					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)										CCTGTGTGGTGAAACCTTTTG	0.473																																																	0													132.0	126.0	128.0					18																	5291265		2203	4300	6503	SO:0001819	synonymous_variant	0			D89859	CCDS11837.1	18p11.31	2013-09-19	2013-01-08	2013-01-08	ENSG00000198081	ENSG00000198081		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12860	protein-coding gene	gene with protein product		602126	"""zinc finger protein 161 homolog (mouse)"", ""zinc finger protein 161"", ""ZFP161 zinc finger protein"""	ZFP161		9244432	Standard	NM_001243702		Approved	ZNF478	uc010dkp.3	O43829	OTTHUMG00000131563	ENST00000357006.4:c.942C>T	18.37:g.5291265G>A			O00403|Q2TB80	Silent	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.F314	ENST00000357006.4	37	c.942	CCDS11837.1	18																																																																																			ZBTB14	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198081		0.473	ZBTB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB14	HGNC	protein_coding	OTTHUMT00000254425.1	-	0.00	102	0	G	NM_003409		5291265	-1	tier1	-	no_errors	ENST00000357006	ensembl	human	known	74_37	silent	13.21	92	14	SNP	0.995	A
ZBTB38	253461	genome.wustl.edu	37	3	141162094	141162094	+	Silent	SNP	C	C	G	rs147594598	byFrequency	TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr3:141162094C>G	ENST00000514251.1	+	4	1143	c.864C>G	c.(862-864)tcC>tcG	p.S288S	ZBTB38_ENST00000321464.5_Silent_p.S289S|ZBTB38_ENST00000441582.2_Silent_p.S288S					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						CTCCAGTATCCAACTTAGAGG	0.458																																																	0													80.0	77.0	78.0					3																	141162094		1884	4104	5988	SO:0001819	synonymous_variant	0			BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.864C>G	3.37:g.141162094C>G				Silent	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S289	ENST00000514251.1	37	c.867	CCDS43157.1	3																																																																																			ZBTB38	-	NULL	ENSG00000177311		0.458	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB38	HGNC	protein_coding	OTTHUMT00000359329.2	-	0.00	27	0	C			141162094	+1	tier1	-	no_errors	ENST00000321464	ensembl	human	known	74_37	silent	32.56	29	14	SNP	0.018	G
ZBTB48	3104	genome.wustl.edu	37	1	6642271	6642271	+	Missense_Mutation	SNP	G	G	A	rs549375724		TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:6642271G>A	ENST00000377674.4	+	3	1002	c.844G>A	c.(844-846)Gag>Aag	p.E282K		NM_001278647.1|NM_001278648.1|NM_005341.2	NP_001265576.1|NP_001265577.1|NP_005332.1	P10074	ZBT48_HUMAN	zinc finger and BTB domain containing 48	282					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.35e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00109)|STAD - Stomach adenocarcinoma(132;0.017)|READ - Rectum adenocarcinoma(331;0.0642)		TGAGCCTGCTGAGAACAGAAA	0.527													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19485	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(125;1449 1657 4031 29866 49542)												0													70.0	71.0	71.0					1																	6642271		2203	4300	6503	SO:0001583	missense	0			BC013573	CCDS84.1	1p36.3	2013-01-08	2006-09-20	2006-09-20	ENSG00000204859	ENSG00000204859		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4930	protein-coding gene	gene with protein product		165270	"""GLI-Kruppel family member HKR3"""	HKR3		2850480, 8661141	Standard	NM_001278647		Approved	ZNF855	uc001anx.3	P10074	OTTHUMG00000001438	ENST00000377674.4:c.844G>A	1.37:g.6642271G>A	ENSP00000366902:p.Glu282Lys		Q5SY19	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E282K	ENST00000377674.4	37	c.844	CCDS84.1	1	.	.	.	.	.	.	.	.	.	.	G	18.64	3.668030	0.67814	.	.	ENSG00000204859	ENST00000319084;ENST00000435905;ENST00000377674	T;T;T	0.23754	1.96;1.89;3.0	5.67	4.75	0.60458	.	0.319885	0.35436	N	0.003206	T	0.12732	0.0309	N	0.08118	0	0.29377	N	0.863608	B	0.27559	0.181	B	0.23275	0.045	T	0.09292	-1.0681	10	0.18276	T	0.48	-18.6233	13.7024	0.62618	0.076:0.0:0.924:0.0	.	282	P10074	ZBT48_HUMAN	K	282	ENSP00000313416:E282K;ENSP00000416054:E282K;ENSP00000366902:E282K	ENSP00000313416:E282K	E	+	1	0	ZBTB48	6564858	1.000000	0.71417	0.983000	0.44433	0.965000	0.64279	2.982000	0.49337	2.677000	0.91161	0.561000	0.74099	GAG	ZBTB48	-	NULL	ENSG00000204859		0.527	ZBTB48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB48	HGNC	protein_coding	OTTHUMT00000004193.1	-	0.00	45	0	G	NM_005341		6642271	+1	tier1	-	no_errors	ENST00000377674	ensembl	human	known	74_37	missense	22.54	55	16	SNP	0.991	A
ZEB1	6935	genome.wustl.edu	37	10	31809970	31809970	+	Silent	SNP	T	T	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr10:31809970T>C	ENST00000320985.10	+	7	1817	c.1707T>C	c.(1705-1707)ccT>ccC	p.P569P	ZEB1_ENST00000446923.2_Silent_p.P553P|ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000542815.3_Silent_p.P502P|ZEB1_ENST00000361642.5_Silent_p.P570P|ZEB1_ENST00000560721.2_Silent_p.P549P			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	569					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				CTGAGAAGCCTGAGTCCTCTG	0.448																																					Ovarian(40;423 959 14296 36701 49589)												0													74.0	73.0	74.0					10																	31809970		2203	4300	6503	SO:0001819	synonymous_variant	0			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.1707T>C	10.37:g.31809970T>C			B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.P570	ENST00000320985.10	37	c.1710	CCDS7169.1	10																																																																																			ZEB1	-	NULL	ENSG00000148516		0.448	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZEB1	HGNC	protein_coding	OTTHUMT00000419083.2	-	0.00	33	0	T	NM_030751		31809970	+1	tier1	-	no_errors	ENST00000361642	ensembl	human	known	74_37	silent	13.89	31	5	SNP	0.789	C
ZFYVE1	53349	genome.wustl.edu	37	14	73460063	73460063	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr14:73460063G>A	ENST00000556143.1	-	4	1711	c.991C>T	c.(991-993)Cat>Tat	p.H331Y	ZFYVE1_ENST00000553891.1_Missense_Mutation_p.H331Y|ZFYVE1_ENST00000318876.5_Missense_Mutation_p.H331Y	NM_001281735.1|NM_021260.2	NP_001268664.1|NP_067083.1	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1	331					negative regulation of phosphatase activity (GO:0010923)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|ER-mitochondrion membrane contact site (GO:0044233)|Golgi stack (GO:0005795)|perinuclear region of cytoplasm (GO:0048471)|pre-autophagosomal structure (GO:0000407)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(17)|ovary(1)|prostate(2)|skin(1)	35		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)		TCTGAGGGATGATCTATACAA	0.502																																																	0													60.0	57.0	58.0					14																	73460063		2203	4300	6503	SO:0001583	missense	0			AF251025	CCDS9811.1, CCDS41969.1, CCDS61498.1	14q24.2	2014-06-13	2003-02-28	2003-03-07		ENSG00000165861		"""Zinc fingers, FYVE domain containing"""	13180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 172"""	605471	"""zinc finger protein, subfamily 2A (FYVE domain containing), 1"""	ZNFN2A1		11024279, 11256955	Standard	NM_021260		Approved	DFCP1, KIAA1589, TAFF1, PPP1R172	uc001xnm.3	Q9HBF4		ENST00000556143.1:c.991C>T	14.37:g.73460063G>A	ENSP00000450742:p.His331Tyr		J3KNL9|Q8WYX7|Q96K57|Q9BXP9|Q9HCI3	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,superfamily_P-loop_NTPase,superfamily_Growth_fac_rcpt_N_dom,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.H331Y	ENST00000556143.1	37	c.991	CCDS9811.1	14	.	.	.	.	.	.	.	.	.	.	G	16.71	3.198134	0.58126	.	.	ENSG00000165861	ENST00000553891;ENST00000318876;ENST00000556143	T;T;T	0.63744	-0.06;-0.06;-0.06	5.47	5.47	0.80525	.	0.190512	0.48286	D	0.000186	T	0.42877	0.1222	N	0.08118	0	0.80722	D	1	B;B	0.26445	0.002;0.149	B;B	0.19666	0.001;0.026	T	0.44345	-0.9334	10	0.62326	D	0.03	-21.2265	14.2064	0.65737	0.0:0.0:0.8506:0.1494	.	331;331	G3V5N8;Q9HBF4	.;ZFYV1_HUMAN	Y	331	ENSP00000452442:H331Y;ENSP00000326921:H331Y;ENSP00000450742:H331Y	ENSP00000326921:H331Y	H	-	1	0	ZFYVE1	72529816	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.519000	0.67074	2.588000	0.87417	0.555000	0.69702	CAT	ZFYVE1	-	superfamily_Growth_fac_rcpt_N_dom	ENSG00000165861		0.502	ZFYVE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE1	HGNC	protein_coding	OTTHUMT00000413172.1	-	0.00	25	0	G	NM_021260		73460063	-1	tier1	-	no_errors	ENST00000553891	ensembl	human	known	74_37	missense	11.63	38	5	SNP	1.000	A
ZMYM6	9204	genome.wustl.edu	37	1	35452974	35452974	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:35452974C>G	ENST00000357182.4	-	16	3936	c.3709G>C	c.(3709-3711)Gag>Cag	p.E1237Q	ZMYM6_ENST00000373340.2_Intron|ZMYM6_ENST00000487874.1_Intron|RP11-244H3.1_ENST00000417456.1_RNA|ZMYM6_ENST00000493328.1_5'UTR|ZMYM6NB_ENST00000373337.3_5'Flank	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	1237					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				GAAGATAGCTCTGTTAGCTTT	0.358																																																	0													86.0	83.0	84.0					1																	35452974		1826	4084	5910	SO:0001583	missense	0			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.3709G>C	1.37:g.35452974C>G	ENSP00000349708:p.Glu1237Gln		B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	pfam_Znf_MYM,superfamily_RNaseH-like_dom,smart_TRASH_dom	p.E1237Q	ENST00000357182.4	37	c.3709	CCDS387.2	1	.	.	.	.	.	.	.	.	.	.	G	0.095	-1.161749	0.01673	.	.	ENSG00000163867	ENST00000357182	T	0.20598	2.06	5.09	3.17	0.36434	Ribonuclease H-like (1);	0.463359	0.23692	N	0.045512	T	0.10294	0.0252	N	0.12637	0.245	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33854	-0.9852	10	0.19147	T	0.46	2.2933	8.4794	0.33034	0.0:0.3319:0.5077:0.1604	.	1237	O95789	ZMYM6_HUMAN	Q	1237	ENSP00000349708:E1237Q	ENSP00000349708:E1237Q	E	-	1	0	ZMYM6	35225561	0.020000	0.18652	0.002000	0.10522	0.963000	0.63663	1.211000	0.32382	0.397000	0.25310	-0.127000	0.14921	GAG	ZMYM6	-	superfamily_RNaseH-like_dom	ENSG00000163867		0.358	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM6	HGNC	protein_coding	OTTHUMT00000011999.1		0.00	28	0	C	NM_007167		35452974	-1			no_errors	ENST00000357182	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.001	G
ZNF101	94039	genome.wustl.edu	37	19	19790859	19790859	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:19790859G>A	ENST00000592502.1	+	4	1171	c.1061G>A	c.(1060-1062)cGa>cAa	p.R354Q	ZNF101_ENST00000415784.2_Missense_Mutation_p.R234Q			Q8IZC7	ZN101_HUMAN	zinc finger protein 101	354					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)	17						AGTTGTTTTCGAAGACATAAA	0.408																																																	0													64.0	65.0	64.0					19																	19790859		2203	4300	6503	SO:0001583	missense	0			AK097169	CCDS32971.1	19p13.11	2013-01-08	2004-02-10		ENSG00000181896	ENSG00000181896		"""Zinc fingers, C2H2-type"", ""-"""	12881	protein-coding gene	gene with protein product		603983	"""zinc finger protein 101 (Y2)"""			11441184	Standard	XM_005260165		Approved	HZF12, DKFZp570I0164	uc002nni.2	Q8IZC7	OTTHUMG00000167736	ENST00000592502.1:c.1061G>A	19.37:g.19790859G>A	ENSP00000468049:p.Arg354Gln		C9JU83|Q0VDG9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R354Q	ENST00000592502.1	37	c.1061	CCDS32971.1	19	.	.	.	.	.	.	.	.	.	.	G	9.495	1.101820	0.20632	.	.	ENSG00000181896	ENST00000318110;ENST00000415440;ENST00000415784	T;T	0.20598	2.06;2.06	0.235	0.235	0.15431	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09598	0.0236	N	0.26042	0.785	0.09310	N	1	P	0.43519	0.809	B	0.29353	0.101	T	0.23583	-1.0184	7	.	.	.	.	.	.	.	.	354	Q8IZC7	ZN101_HUMAN	Q	354;354;234	ENSP00000319716:R354Q;ENSP00000400952:R234Q	.	R	+	2	0	ZNF101	19651859	0.000000	0.05858	0.803000	0.32268	0.802000	0.45316	0.053000	0.14184	0.308000	0.22923	0.313000	0.20887	CGA	ZNF101	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181896		0.408	ZNF101-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF101	HGNC	protein_coding	OTTHUMT00000460559.1	-	0.00	33	0	G	NM_033204		19790859	+1	tier1	-	no_errors	ENST00000318110	ensembl	human	known	74_37	missense	16.67	35	7	SNP	0.003	A
ZNF274	10782	genome.wustl.edu	37	19	58698339	58698339	+	Silent	SNP	G	G	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:58698339G>T	ENST00000326804.4	+	4	645	c.186G>T	c.(184-186)gtG>gtT	p.V62V	ZNF274_ENST00000597818.1_3'UTR|ZNF274_ENST00000345813.3_Intron|ZNF274_ENST00000424679.2_Intron	NM_001278734.1|NM_133502.1	NP_001265663.1|NP_598009.1	Q96GC6	ZN274_HUMAN	zinc finger protein 274	62	KRAB 1. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)|skin(1)	21		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		AACCAGATGTGGTATCTCAGT	0.502																																																	0													50.0	48.0	49.0					19																	58698339		1931	4151	6082	SO:0001819	synonymous_variant	0			AB029149	CCDS74473.1, CCDS74474.1, CCDS74475.1, CCDS74476.1	19q13.43	2013-01-09				ENSG00000171606		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13068	protein-coding gene	gene with protein product		605467				10777669	Standard	NM_133502		Approved	ZKSCAN19, ZSCAN51	uc002qrs.1	Q96GC6		ENST00000326804.4:c.186G>T	19.37:g.58698339G>T			Q53XU4|Q6MZG1|Q8WY37|Q8WY38|Q92969|Q9UII0|Q9UII1	Silent	SNP	pfam_Krueppel-associated_box,pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.V62	ENST00000326804.4	37	c.186		19																																																																																			ZNF274	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000171606		0.502	ZNF274-201	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF274	HGNC	protein_coding		-	0.00	27	0	G	NM_133502		58698339	+1	tier1	-	no_errors	ENST00000326804	ensembl	human	known	74_37	silent	13.04	20	3	SNP	0.998	T
ZNF292	23036	genome.wustl.edu	37	6	87966128	87966128	+	Silent	SNP	T	T	A	rs575913628	byFrequency	TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:87966128T>A	ENST00000369577.3	+	8	2824	c.2781T>A	c.(2779-2781)acT>acA	p.T927T	ZNF292_ENST00000339907.4_Silent_p.T922T	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	927						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		CTGCTACTACTCCTCTACTTC	0.443																																																	0													77.0	73.0	74.0					6																	87966128		1891	4117	6008	SO:0001819	synonymous_variant	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.2781T>A	6.37:g.87966128T>A			Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T927	ENST00000369577.3	37	c.2781	CCDS47457.1	6																																																																																			ZNF292	-	NULL	ENSG00000188994		0.443	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	-	0.00	16	0	T	NM_015021		87966128	+1	tier1	-	no_errors	ENST00000369577	ensembl	human	known	74_37	silent	24.00	19	6	SNP	0.000	A
ZNF292	23036	genome.wustl.edu	37	6	87971218	87971218	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr6:87971218A>G	ENST00000369577.3	+	8	7914	c.7871A>G	c.(7870-7872)cAt>cGt	p.H2624R	ZNF292_ENST00000339907.4_Missense_Mutation_p.H2619R	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	2624						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		AAAGGATCCCATTCAAATTCA	0.358																																																	0													39.0	36.0	37.0					6																	87971218		1842	4106	5948	SO:0001583	missense	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.7871A>G	6.37:g.87971218A>G	ENSP00000358590:p.His2624Arg		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H2624R	ENST00000369577.3	37	c.7871	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	A	12.22	1.871897	0.33069	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.06608	3.28;3.29	6.06	4.9	0.64082	.	0.247095	0.47852	N	0.000217	T	0.03915	0.0110	M	0.68317	2.08	0.32677	N	0.516013	B	0.16166	0.016	B	0.10450	0.005	T	0.12451	-1.0547	10	0.59425	D	0.04	.	12.0252	0.53367	0.9329:0.0:0.0671:0.0	.	2624	O60281	ZN292_HUMAN	R	2624;2619	ENSP00000358590:H2624R;ENSP00000342847:H2619R	ENSP00000342847:H2619R	H	+	2	0	ZNF292	88027937	1.000000	0.71417	0.998000	0.56505	0.882000	0.50991	4.889000	0.63171	1.102000	0.41551	0.533000	0.62120	CAT	ZNF292	-	NULL	ENSG00000188994		0.358	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	-	0.00	16	0	A	NM_015021		87971218	+1	tier1	-	no_errors	ENST00000369577	ensembl	human	known	74_37	missense	32.14	19	9	SNP	0.996	G
ZNF540	163255	genome.wustl.edu	37	19	38104049	38104049	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:38104049C>G	ENST00000592533.1	+	5	2200	c.1868C>G	c.(1867-1869)aCt>aGt	p.T623S	ZNF540_ENST00000589117.1_Missense_Mutation_p.T591S|ZNF540_ENST00000343599.5_Missense_Mutation_p.T623S|ZNF540_ENST00000316433.4_Missense_Mutation_p.T623S	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	623					negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCACACCTTACTGAACATCAG	0.373																																																	0													43.0	44.0	44.0					19																	38104049		2202	4300	6502	SO:0001583	missense	0			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.1868C>G	19.37:g.38104049C>G	ENSP00000466274:p.Thr623Ser		A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T623S	ENST00000592533.1	37	c.1868	CCDS12506.1	19	.	.	.	.	.	.	.	.	.	.	C	12.16	1.855075	0.32791	.	.	ENSG00000171817	ENST00000316433;ENST00000343599	T	0.35973	1.28	2.8	-1.25	0.09405	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15998	0.0385	N	0.10809	0.05	0.09310	N	1	B;B	0.11235	0.003;0.004	B;B	0.16289	0.009;0.015	T	0.19844	-1.0293	9	0.46703	T	0.11	.	2.4346	0.04479	0.3794:0.2684:0.0:0.3522	.	591;623	Q8NDQ6-2;Q8NDQ6	.;ZN540_HUMAN	S	623;591	ENSP00000324598:T623S	ENSP00000324598:T623S	T	+	2	0	ZNF540	42795889	0.000000	0.05858	0.002000	0.10522	0.881000	0.50899	-5.563000	0.00113	-0.152000	0.11156	0.305000	0.20034	ACT	ZNF540	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171817		0.373	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF540	HGNC	protein_coding	OTTHUMT00000459481.1	-	0.00	39	0	C	NM_152606		38104049	+1	tier1	-	no_errors	ENST00000316433	ensembl	human	known	74_37	missense	28.89	32	13	SNP	0.000	G
ZNF415	55786	genome.wustl.edu	37	19	53625823	53625823	+	5'UTR	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:53625823C>T	ENST00000500065.4	-	0	182				ZNF415_ENST00000597748.1_Intron|ZNF415_ENST00000595193.1_Intron|ZNF415_ENST00000599261.1_5'UTR|ZNF415_ENST00000596683.1_Intron|ZNF415_ENST00000440291.1_Intron|ZNF415_ENST00000601493.1_Intron|ZNF415_ENST00000455735.2_Intron|ZNF415_ENST00000243643.4_Intron|ZNF415_ENST00000600574.1_Intron|ZNF415_ENST00000448501.1_Intron|ZNF415_ENST00000421033.1_Intron|ZNF415_ENST00000595813.1_5'UTR|ZNF415_ENST00000601215.1_Intron|ZNF415_ENST00000597503.1_Intron|ZNF415_ENST00000594011.1_Intron	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		CAGGATGCTTCAGACTCAGAG	0.488																																																	0													90.0	94.0	93.0					19																	53625823		692	1591	2283	SO:0001623	5_prime_UTR_variant	0			AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.-152G>A	19.37:g.53625823C>T			F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	RNA	SNP	-	NULL	ENST00000500065.4	37	NULL	CCDS54313.1	19																																																																																			ZNF415	-	-	ENSG00000170954		0.488	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF415	HGNC	protein_coding	OTTHUMT00000464043.1	-	0.00	34	0	C	NM_018355		53625823	-1	tier1	-	no_errors	ENST00000594286	ensembl	human	known	74_37	rna	15.00	34	6	SNP	0.004	T
ZNF672	79894	genome.wustl.edu	37	1	249141564	249141564	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr1:249141564C>T	ENST00000306562.3	+	4	837	c.91C>T	c.(91-93)Cga>Tga	p.R31*		NM_024836.1	NP_079112.1	Q499Z4	ZN672_HUMAN	zinc finger protein 672	31					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(1)	5	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			AGTGCTGCTGCGACATGAACG	0.632																																																	0													49.0	41.0	44.0					1																	249141564		2203	4300	6503	SO:0001587	stop_gained	0			AK027476	CCDS1638.1	1q44	2013-01-08			ENSG00000171161	ENSG00000171161		"""Zinc fingers, C2H2-type"""	26179	protein-coding gene	gene with protein product	"""hypothetical protein FLJ22301"""					12477932	Standard	NM_024836		Approved	FLJ22301	uc001iex.3	Q499Z4	OTTHUMG00000040377	ENST00000306562.3:c.91C>T	1.37:g.249141564C>T	ENSP00000421915:p.Arg31*		Q96H65|Q96IM3|Q9H6G5	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R31*	ENST00000306562.3	37	c.91	CCDS1638.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.261464	0.95368	.	.	ENSG00000171161	ENST00000306562;ENST00000428515;ENST00000423362;ENST00000306576	.	.	.	3.43	-1.31	0.09230	.	0.342605	0.16199	U	0.225007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	6.3214	0.21219	0.4785:0.4259:0.0:0.0956	.	.	.	.	X	31	.	ENSP00000421915:R31X	R	+	1	2	ZNF672	247108187	0.000000	0.05858	0.024000	0.17045	0.186000	0.23388	-2.305000	0.01133	-0.227000	0.09884	0.655000	0.94253	CGA	ZNF672	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171161		0.632	ZNF672-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF672	HGNC	protein_coding	OTTHUMT00000097125.2	-	0.00	50	0	C	NM_024836		249141564	+1	tier1	-	no_errors	ENST00000306562	ensembl	human	known	74_37	nonsense	11.43	62	8	SNP	0.001	T
ZNF804A	91752	genome.wustl.edu	37	2	185800688	185800688	+	Missense_Mutation	SNP	A	A	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr2:185800688A>C	ENST00000302277.6	+	4	1159	c.565A>C	c.(565-567)Agt>Cgt	p.S189R		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	189							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AGATCCAGAAAGTGCAAATAA	0.363																																																	0													65.0	68.0	67.0					2																	185800688		2203	4300	6503	SO:0001583	missense	0			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.565A>C	2.37:g.185800688A>C	ENSP00000303252:p.Ser189Arg		A7E253|Q6ZN26	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.S189R	ENST00000302277.6	37	c.565	CCDS2291.1	2	.	.	.	.	.	.	.	.	.	.	A	15.29	2.790446	0.50102	.	.	ENSG00000170396	ENST00000302277	T	0.06371	3.31	5.52	5.52	0.82312	.	0.391778	0.24659	N	0.036657	T	0.05044	0.0135	L	0.27053	0.805	0.31088	N	0.711113	P	0.45902	0.868	B	0.36666	0.23	T	0.09465	-1.0673	10	0.66056	D	0.02	-4.9259	10.8153	0.46571	0.9237:0.0:0.0763:0.0	.	189	Q7Z570	Z804A_HUMAN	R	189	ENSP00000303252:S189R	ENSP00000303252:S189R	S	+	1	0	ZNF804A	185508933	1.000000	0.71417	0.613000	0.29037	0.749000	0.42624	4.294000	0.59043	2.098000	0.63641	0.383000	0.25322	AGT	ZNF804A	-	NULL	ENSG00000170396		0.363	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	HGNC	protein_coding	OTTHUMT00000255871.1	-	0.00	25	0	A	NM_194250		185800688	+1	tier1	-	no_errors	ENST00000302277	ensembl	human	known	74_37	missense	20.83	19	5	SNP	0.950	C
ZNF850	342892	genome.wustl.edu	37	19	37241489	37241489	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:37241489G>C	ENST00000591344.1	-	5	611	c.453C>G	c.(451-453)ttC>ttG	p.F151L	ZNF850_ENST00000589390.1_Intron	NM_001193552.1|NM_001267779.1	NP_001180481.1|NP_001254708.1	A8MQ14	ZN850_HUMAN	zinc finger protein 850	151					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TCTGTAGGCAGAAAGTTGGTG	0.398																																																	0																																										SO:0001583	missense	0			BC052603	CCDS59379.1, CCDS74350.1	19q13.12	2013-01-08	2010-08-02	2010-08-02		ENSG00000267041		"""Zinc fingers, C2H2-type"", ""-"""	27994	protein-coding gene	gene with protein product			"""zinc finger protein 850 pseudogene"", ""zinc finger protein 850 (pseudogene)"""	ZNF850P		12477932	Standard	NM_001193552		Approved		uc010efc.3	A8MQ14		ENST00000591344.1:c.453C>G	19.37:g.37241489G>C	ENSP00000464976:p.Phe151Leu			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F151L	ENST00000591344.1	37	c.453	CCDS59379.1	19																																																																																			ZNF850	-	NULL	ENSG00000267041		0.398	ZNF850-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF850	HGNC	protein_coding	OTTHUMT00000453557.1	-	0.00	161	0	G	XM_001720258		37241489	-1	tier1	-	no_errors	ENST00000591344	ensembl	human	known	74_37	missense	22.94	131	39	SNP	0.001	C
ZNF841	284371	genome.wustl.edu	37	19	52568449	52568449	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:52568449G>C	ENST00000426391.2	-	5	2889	c.2338C>G	c.(2338-2340)Cag>Gag	p.Q780E	CTC-471J1.2_ENST00000569091.1_RNA|ZNF841_ENST00000594295.1_Missense_Mutation_p.Q896E|ZNF841_ENST00000389534.4_Missense_Mutation_p.Q896E|ZNF841_ENST00000359973.2_Missense_Mutation_p.Q472E|ZNF432_ENST00000598446.1_Intron			Q6ZN19	ZN841_HUMAN	zinc finger protein 841	780					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(3)|lung(3)	11						TGTTTTATCTGATGTTTAGTG	0.383																																																	0													246.0	205.0	217.0					19																	52568449		692	1591	2283	SO:0001583	missense	0			AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.2338C>G	19.37:g.52568449G>C	ENSP00000415453:p.Gln780Glu		B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q896E	ENST00000426391.2	37	c.2686		19	.	.	.	.	.	.	.	.	.	.	G	11.57	1.677457	0.29783	.	.	ENSG00000197608	ENST00000389534;ENST00000426391;ENST00000359973	T;T;T	0.08546	3.51;3.33;3.08	1.69	0.519	0.17035	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	N	0.08118	0	0.09310	N	1	B;B;B	0.27882	0.192;0.143;0.121	B;B;B	0.20955	0.032;0.019;0.014	T	0.40365	-0.9567	9	0.62326	D	0.03	.	3.2155	0.06697	0.1609:0.0:0.5775:0.2615	.	896;472;780	Q6ZN19-3;Q6ZN19-2;Q6ZN19	.;.;ZN841_HUMAN	E	896;780;472	ENSP00000374185:Q896E;ENSP00000415453:Q780E;ENSP00000353060:Q472E	ENSP00000353060:Q472E	Q	-	1	0	ZNF841	57260261	0.000000	0.05858	0.004000	0.12327	0.741000	0.42261	0.050000	0.14120	0.033000	0.15463	0.313000	0.20887	CAG	ZNF841	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197608		0.383	ZNF841-001	PUTATIVE	basic	protein_coding	ZNF841	HGNC	protein_coding	OTTHUMT00000462435.1	-	0.00	76	0	G	XM_209155		52568449	-1	tier1	-	no_errors	ENST00000389534	ensembl	human	known	74_37	missense	24.10	63	20	SNP	0.223	C
ZNF880	400713	genome.wustl.edu	37	19	52877592	52877592	+	Silent	SNP	G	G	A			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:52877592G>A	ENST00000422689.2	+	3	195	c.180G>A	c.(178-180)gaG>gaA	p.E60E	ZNF880_ENST00000600321.1_Silent_p.E60E|ZNF880_ENST00000424032.2_Silent_p.E60E|ZNF880_ENST00000597976.1_Silent_p.E60E|ZNF880_ENST00000344085.5_Silent_p.E60E	NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	60	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						CCATGTTGGAGCAAAGGAGAG	0.453																																																	0													93.0	78.0	82.0					19																	52877592		692	1591	2283	SO:0001819	synonymous_variant	0			BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.180G>A	19.37:g.52877592G>A			B4DNA6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E60	ENST00000422689.2	37	c.180	CCDS46164.1	19																																																																																			ZNF880	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000221923		0.453	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF880	HGNC	protein_coding	OTTHUMT00000397374.1	-	0.00	47	0	G	NM_001145434		52877592	+1	tier1	-	no_errors	ENST00000422689	ensembl	human	known	74_37	silent	21.28	37	10	SNP	0.026	A
ZSCAN5B	342933	genome.wustl.edu	37	19	56703331	56703331	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A5B8-01A-11D-A28B-09	TCGA-IG-A5B8-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d2635231-8fb7-4495-bbf6-a63d2189c046	0561ebf7-7dbb-470c-a60f-58993a9b8db8	g.chr19:56703331C>G	ENST00000586855.2	-	3	789	c.476G>C	c.(475-477)aGa>aCa	p.R159T	ZSCAN5B_ENST00000358992.3_Missense_Mutation_p.R159T			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	159					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						GGACACGTCTCTCGGATCATC	0.577																																																	0													32.0	34.0	34.0					19																	56703331		2203	4300	6503	SO:0001583	missense	0				CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.476G>C	19.37:g.56703331C>G	ENSP00000466072:p.Arg159Thr			Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R159T	ENST00000586855.2	37	c.476	CCDS46203.1	19	.	.	.	.	.	.	.	.	.	.	C	0.569	-0.842079	0.02671	.	.	ENSG00000197213	ENST00000358992	T	0.05717	3.4	1.9	-2.38	0.06622	.	.	.	.	.	T	0.04679	0.0127	L	0.58101	1.795	0.09310	N	1	P	0.38922	0.651	B	0.30646	0.118	T	0.37979	-0.9682	9	0.19147	T	0.46	.	3.9056	0.09180	0.3542:0.4771:0.1687:0.0	.	159	A6NJL1	ZSA5B_HUMAN	T	159	ENSP00000351883:R159T	ENSP00000351883:R159T	R	-	2	0	ZSCAN5B	61395143	0.000000	0.05858	0.000000	0.03702	0.133000	0.20885	-1.163000	0.03138	-0.658000	0.05366	0.306000	0.20318	AGA	ZSCAN5B	-	NULL	ENSG00000197213		0.577	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN5B	HGNC	protein_coding	OTTHUMT00000457834.2	-	0.00	67	0	C	NM_001080456		56703331	-1	tier1	-	no_errors	ENST00000358992	ensembl	human	known	74_37	missense	19.28	67	16	SNP	0.000	G
